Sample records for affects intracellular signaling


    EPA Science Inventory

    A book chapter in ?Molecular Toxicology: Transcriptional Targets? reviewed the role of intracellular signaling in the developmental neurotoxicity of environmental chemicals. This chapter covered a number of aspects including the development of the nervous system, role of intrace...

  2. Revisiting intracellular calcium signaling semantics.


    Haiech, Jacques; Audran, Emilie; Fève, Marie; Ranjeva, Raoul; Kilhoffer, Marie-Claude


    Cells use intracellular free calcium concentration changes for signaling. Signal encoding occurs through both spatial and temporal modulation of the free calcium concentration. The encoded message is detected by an ensemble of intracellular sensors forming the family of calcium-binding proteins (CaBPs) which must faithfully translate the message using a new syntax that is recognized by the cell. The cell is home to a significant although limited number of genes coding for proteins involved in the signal encoding and decoding processes. In a cell, only a subset of this ensemble of genes is expressed, leading to a genetic regulation of the calcium signal pathways. Calmodulin (CaM), the most ubiquitous expressed intracellular calcium-binding protein, plays a major role in calcium signal translation. Similar to a hub, it is central to a large and finely tuned network, receiving information, integrating it and dispatching the cognate response. In this review, we examine the different steps starting with an external stimulus up to a cellular response, with special emphasis on CaM and the mechanism by which it decodes calcium signals and translates it into exquisitely coordinated cellular events. By this means, we will revisit the calcium signaling semantics, hoping that we will ease communication between scientists dealing with calcium signals in different biological systems and different domains.

  3. Intracellular Signalling in Retinal Ischemia

    DTIC Science & Technology


    36) However, vascularization of the RPE is not known to occur in human diseases of photoreceptor degeneration, such as retinitis pigmentosa ...A.C. (1986) Retinitis pigmentosa and retinal neovascularization. Ophthalmology 91, 1599- 1603. Figure la: Control rat retina, 8 weeks of age, central...TITLE (Include Security Classification) Intracellular Signalling in Retinal Ischemia 12. PERSONAL AUTHOR(S) Burns, Margaret Sue; Bellhorn, Roy William

  4. Pharmacology of intracellular signalling pathways

    PubMed Central

    Nahorski, Stefan R


    This article provides a brief and somewhat personalized review of the dramatic developments that have occurred over the last 45 years in our understanding of intracellular signalling pathways associated with G-protein-coupled receptor activation. Signalling via cyclic AMP, the phosphoinositides and Ca2+ is emphasized and these systems have already been revealed as new pharmacological targets. The therapeutic benefits of most of such targets are, however, yet to be realized, but it is certain that the discipline of pharmacology needs to widen its boundaries to meet these challenges in the future. PMID:16402119

  5. Intracellular Signal Modulation by Nanomaterials

    PubMed Central

    Hussain, Salik; Garantziotis, Stavros; Rodrigues-Lima, Fernando; Dupret, Jean-Marie; Baeza-Squiban, Armelle; Boland, Sonja


    A thorough understanding of the interactions of nanomaterials with biological systems and the resulting activation of signal transduction pathways is essential for the development of safe and consumer friendly nanotechnology. Here we present an overview of signaling pathways induced by nanomaterial exposures and describe the possible correlation of their physicochemical characteristics with biological outcomes. In addition to the hierarchical oxidative stress model and a review of the intrinsic and cell-mediated mechanisms of reactive Oxygen species (ROS) generating capacities of nanomaterials, we also discuss other oxidative stress dependent and independent cellular signaling pathways. Induction of the inflammasome, calcium signaling, and endoplasmic reticulum stress are reviewed. Furthermore, the uptake mechanisms can crucially affect the cytotoxicity of nanomaterials and membrane-dependent signaling pathways can be responsible for cellular effects of nanomaterials. Epigenetic regulation by nanomaterials effects of nanoparticle-protein interactions on cell signaling pathways, and the induction of various cell death modalities by nanomaterials are described. We describe the common trigger mechanisms shared by various nanomaterials to induce cell death pathways and describe the interplay of different modalities in orchestrating the final outcome after nanomaterial exposures. A better understanding of signal modulations induced by nanomaterials is not only essential for the synthesis and design of safer nanomaterials but will also help to discover potential nanomedical applications of these materials. Several biomedical applications based on the different signaling pathways induced by nanomaterials are already proposed and will certainly gain a great deal of attraction in the near future. PMID:24683030

  6. Intracellular signal modulation by nanomaterials.


    Hussain, Salik; Garantziotis, Stavros; Rodrigues-Lima, Fernando; Dupret, Jean-Marie; Baeza-Squiban, Armelle; Boland, Sonja


    A thorough understanding of the interactions of nanomaterials with biological systems and the resulting activation of signal transduction pathways is essential for the development of safe and consumer friendly nanotechnology. Here we present an overview of signaling pathways induced by nanomaterial exposures and describe the possible correlation of their physicochemical characteristics with biological outcomes. In addition to the hierarchical oxidative stress model and a review of the intrinsic and cell-mediated mechanisms of reactive oxygen species (ROS) generating capacities of nanomaterials, we also discuss other oxidative stress dependent and independent cellular signaling pathways. Induction of the inflammasome, calcium signaling, and endoplasmic reticulum stress are reviewed. Furthermore, the uptake mechanisms can be of crucial importance for the cytotoxicity of nanomaterials and membrane-dependent signaling pathways have also been shown to be responsible for cellular effects of nanomaterials. Epigenetic regulation by nanomaterials, effects of nanoparticle-protein interactions on cell signaling pathways, and the induction of various cell death modalities by nanomaterials are described. We describe the common trigger mechanisms shared by various nanomaterials to induce cell death pathways and describe the interplay of different modalities in orchestrating the final outcome after nanomaterial exposures. A better understanding of signal modulations induced by nanomaterials is not only essential for the synthesis and design of safer nanomaterials but will also help to discover potential nanomedical applications of these materials. Several biomedical applications based on the different signaling pathways induced by nanomaterials are already proposed and will certainly gain a great deal of attraction in the near future.

  7. Modeling of spatially-restricted intracellular signaling.


    Neves, Susana R


    Understanding the signaling capabilities of a cell presents a major challenge, not only due to the number of molecules involved, but also because of the complex network connectivity of intracellular signaling. Recently, the proliferation of quantitative imaging techniques has led to the discovery of the vast spatial organization of intracellular signaling. Computational modeling has emerged as a powerful tool for understanding how inhomogeneous signaling originates and is maintained. This article covers the current imaging techniques used to obtain quantitative spatial data and the mathematical approaches used to model spatial cell biology. Modeling-derived hypotheses have been experimentally tested and the integration of modeling and imaging approaches has led to non-intuitive mechanistic insights.

  8. Uncoupling Caveolae from Intracellular Signaling In Vivo

    PubMed Central

    Kraehling, Jan R.; Hao, Zhengrong; Lee, Monica Y.; Vinyard, David J.; Velazquez, Heino; Liu, X.; Stan, Radu V.; Brudvig, Gary W.; Sessa, William C.


    Rationale Caveolin-1 negatively regulates eNOS derived NO production and this has been mapped to several residues on Cav-1 including F92. Herein, we reasoned that endothelial expression of an F92ACav-1 transgene would let us decipher the mechanisms and relationships between caveolae structure and intracellular signaling. Objective This study was designed to separate caveolae formation from its downstream signaling effects. Methods and Results An endothelial-specific doxycycline-regulated mouse model for the expression of Cav-1-F92A was developed. Blood pressure by telemetry and nitric oxide bioavailability by electron paramagnetic resonance and phosphorylation of VASP were determined. Caveolae integrity in the presence of Cav-1-F92A was measured by stabilization of Cav-2, sucrose gradient and electron microscopy. Histological analysis of heart and lung, echocardiography and signaling were performed. Conclusions This study shows that mutant Cav-1-F92A forms caveolae structures similar to WT but leads to increases in NO bioavailability in vivo thereby demonstrating that caveolae formation and downstream signaling events occur through independent mechanisms. PMID:26602865

  9. Tumour suppressors hamartin and tuberin: intracellular signalling.


    Krymskaya, Vera P


    Tumour suppressors hamartin and tuberin, encoded by tuberous sclerosis complex 1(TSC1) and TSC2 genes, respectively, are critical regulators of cell growth and proliferation. Mutations in TSC1 and TSC2 genes are the cause of an autosomal dominant disorder known as tuberous sclerosis complex (TSC). Another genetic disorder, lymphangioleiomyomatosis (LAM), is also associated with mutations in the TSC2 gene. Hamartin and tuberin control cell growth by negatively regulating S6 kinase 1 (S6K1) and eukaryotic initiation factor 4E binding protein 1 (4E-BP1), potentially through their upstream modulator mammalian target of rapamycin (mTOR). Growth factors and insulin promote Akt/PKB-dependent phosphorylation of tuberin, which in turn, releases S6K1 from negative regulation by tuberin and results in the activation of S6K1. Although much has been written regarding the molecular genetics of TSC and LAM, which is associated with either the loss of or mutation in the TSC1 and TSC2 genes, few reviews have addressed the intracellular signalling pathways regulated by hamartin and tuberin. The current review will fill the gap in our understanding of their role in cellular signalling networks, and by improving this understanding, an integrated picture regarding the normal function of tuberin and hamartin is beginning to emerge.

  10. Intracellular signaling by phospholipase D as a therapeutic target.


    Steed, P M; Chow, A H


    The pharmaceutical industry has recently focused on intracellular signaling as a means to integrate the multiple facets of complex disease states, such as inflammation, because these pathways respond to numerous extracellular signals and coordinate a collection of cell responses contributing to pathology. One critical aspect of intracellular signaling is regulation of key cell functions by lipid mediators, in particular the generation of a key mediator, phosphatidic acid (PA) via the hydrolysis of phosphatidylcholine by phospholipase D (PLD). Research in this field has intensified, due in part to the recent cloning and partial characterization of the two PLD isoforms in mammalian cells, and this work has contributed significantly to our understanding of events downstream of PA generation. It is these effector functions of PLD activity that make this pathway attractive as a therapeutic target while the biochemical properties of the PLD isozymes make them amenable to small molecule intervention. Recent studies indicate that PA, and its immediate metabolites diacylglycerol and lyso-PA, affect numerous cellular pathways including ligand-mediated secretion, cytoskeletal reorganisations, respiratory burst, prostaglandin release, cell migration, cytokine release, and mitogenesis. This review summarises the data implicating signaling via PLD in these cell functions, obtained from: (i) molecular analyses of PLD/effector interactions, (ii) correlation between PA production and cell responses, (iii) experimental manipulation of PA levels, (iv) inhibition of PLD regulators, and (v) direct inhibition of PA production. The utility of targeting PLD signaling for the treatment of acute/chronic inflammation and other indications is discussed in light of these data.

  11. Inhibitor of apoptosis proteins as intracellular signaling intermediates.


    Kocab, Andrew J; Duckett, Colin S


    Inhibitor of apoptosis (IAP) proteins have often been considered inhibitors of cell death due to early reports that described their ability to directly bind and inhibit caspases, the primary factors that implement apoptosis. However, a greater understanding is evolving regarding the vital roles played by IAPs as transduction intermediates in a diverse set of signaling cascades associated with functions ranging from the innate immune response to cell migration to cell-cycle regulation. In this review, we discuss the functions of IAPs in signaling, focusing primarily on the cellular IAP (c-IAP) proteins. The c-IAPs are important components in tumor necrosis factor receptor superfamily signaling cascades, which include activation of the NF-κB transcription factor family. As these receptors modulate cell proliferation and cell death, the involvement of the c-IAPs in these pathways provides an additional means of controlling cellular fate beyond simply inhibiting caspase activity. Additionally, IAP-binding proteins, such as Smac and caspases, which have been described as having cell death-independent roles, may affect c-IAP activity in intracellular signaling. Collectively, the multi-faceted functions and complex regulation of the c-IAPs illustrate their importance as intracellular signaling intermediates.

  12. Control of Intracellular Calcium Signaling as a Neuroprotective Strategy

    PubMed Central

    Duncan, R. Scott; Goad, Daryl L.; Grillo, Michael A.; Kaja, Simon; Payne, Andrew J.; Koulen, Peter


    Both acute and chronic degenerative diseases of the nervous system reduce the viability and function of neurons through changes in intracellular calcium signaling. In particular, pathological increases in the intracellular calcium concentration promote such pathogenesis. Disease involvement of numerous regulators of intracellular calcium signaling located on the plasma membrane and intracellular organelles has been documented. Diverse groups of chemical compounds targeting ion channels, G-protein coupled receptors, pumps and enzymes have been identified as potential neuroprotectants. The present review summarizes the discovery, mechanisms and biological activity of neuroprotective molecules targeting proteins that control intracellular calcium signaling to preserve or restore structure and function of the nervous system. Disease relevance, clinical applications and new technologies for the identification of such molecules are being discussed. PMID:20335972

  13. Systematic Characterization of Dynamic Parameters of Intracellular Calcium Signals

    PubMed Central

    Mackay, Laurent; Mikolajewicz, Nicholas; Komarova, Svetlana V.; Khadra, Anmar


    Dynamic processes, such as intracellular calcium signaling, are hallmark of cellular biology. As real-time imaging modalities become widespread, a need for analytical tools to reliably characterize time-series data without prior knowledge of the nature of the recordings becomes more pressing. The goal of this study is to develop a signal-processing algorithm for MATLAB that autonomously computes the parameters characterizing prominent single transient responses (TR) and/or multi-peaks responses (MPR). The algorithm corrects for signal contamination and decomposes experimental recordings into contributions from drift, TRs, and MPRs. It subsequently provides numerical estimates for the following parameters: time of onset after stimulus application, activation time (time for signal to increase from 10 to 90% of peak), and amplitude of response. It also provides characterization of the (i) TRs by quantifying their area under the curve (AUC), response duration (time between 1/2 amplitude on ascent and descent of the transient), and decay constant of the exponential decay region of the deactivation phase of the response, and (ii) MPRs by quantifying the number of peaks, mean peak magnitude, mean periodicity, standard deviation of periodicity, oscillatory persistence (time between first and last discernable peak), and duty cycle (fraction of period during which system is active) for all the peaks in the signal, as well as coherent oscillations (i.e., deterministic spikes). We demonstrate that the signal detection performance of this algorithm is in agreement with user-mediated detection and that parameter estimates obtained manually and algorithmically are correlated. We then apply this algorithm to study how metabolic acidosis affects purinergic (P2) receptor-mediated calcium signaling in osteoclast precursor cells. Our results reveal that acidosis significantly attenuates the amplitude and AUC calcium responses at high ATP concentrations. Collectively, our data

  14. Intracellular Zn(2+) signaling in the dentate gyrus is required for object recognition memory.


    Takeda, Atsushi; Tamano, Haruna; Ogawa, Taisuke; Takada, Shunsuke; Nakamura, Masatoshi; Fujii, Hiroaki; Ando, Masaki


    The role of perforant pathway-dentate granule cell synapses in cognitive behavior was examined focusing on synaptic Zn(2+) signaling in the dentate gyrus. Object recognition memory was transiently impaired when extracellular Zn(2+) levels were decreased by injection of clioquinol and N,N,N',N'-tetrakis-(2-pyridylmethyl) ethylendediamine. To pursue the effect of the loss and/or blockade of Zn(2+) signaling in dentate granule cells, ZnAF-2DA (100 pmol, 0.1 mM/1 µl), an intracellular Zn(2+) chelator, was locally injected into the dentate molecular layer of rats. ZnAF-2DA injection, which was estimated to chelate intracellular Zn(2+) signaling only in the dentate gyrus, affected object recognition memory 1 h after training without affecting intracellular Ca(2+) signaling in the dentate molecular layer. In vivo dentate gyrus long-term potentiation (LTP) was affected under the local perfusion of the recording region (the dentate granule cell layer) with 0.1 mM ZnAF-2DA, but not with 1-10 mM CaEDTA, an extracellular Zn(2+) chelator, suggesting that the blockade of intracellular Zn(2+) signaling in dentate granule cells affects dentate gyrus LTP. The present study demonstrates that intracellular Zn(2+) signaling in the dentate gyrus is required for object recognition memory, probably via dentate gyrus LTP expression.

  15. Danger signals, inflammasomes, and the intricate intracellular lives of chlamydiae.


    Pettengill, Matthew A; Abdul-Sater, Ali; Coutinho-Silva, Robson; Ojcius, David M


    Chlamydiae are obligate intracellular bacterial pathogens, and as such are sensitive to alterations in the cellular physiology of their hosts. Chlamydial infections often cause pathologic consequences due to prolonged localized inflammation. Considerable advances have been made in the last few years regarding our understanding of how two key inflammation-associated signaling pathways influence the biology of Chlamydia infections: inflammation regulating purinergic signaling pathways significantly impact intracellular chlamydial development, and inflammasome activation modulates both chlamydial growth and infection mediated pro-inflammatory cytokine production. We review here elements of both pathways, presenting the latest developments contributing to our understanding of how chlamydial infections are influenced by inflammasomes and purinergic signaling.

  16. Calcium, channels, intracellular signaling and autoimmunity.


    Izquierdo, Jorge-Hernán; Bonilla-Abadía, Fabio; Cañas, Carlos A; Tobón, Gabriel J


    Calcium (Ca²⁺) is an important cation able to function as a second messenger in different cells of the immune system, particularly in B and T lymphocytes, macrophages and mastocytes, among others. Recent discoveries related to the entry of Ca²⁺ through the store-operated calcium entry (SOCE) has opened a new investigation area about the cell destiny regulated by Ca²⁺ especially in B and T lymphocytes. SOCE acts through calcium-release-activated calcium (CRAC) channels. The function of CRAC depends of two recently discovered regulators: the Ca²⁺ sensor in the endoplasmic reticulum or stromal interaction molecule (STIM-1) and one subunit of CRAC channels called Orai1. This review focuses on the role of Ca²⁺ signals in B and T lymphocytes functions, the signalling pathways leading to Ca²⁺ influx, and the relationship between Ca²⁺ signals and autoimmune diseases.

  17. The Notch intracellular domain integrates signals from Wnt, Hedgehog, TGFβ/BMP and hypoxia pathways.


    Borggrefe, Tilman; Lauth, Matthias; Zwijsen, An; Huylebroeck, Danny; Oswald, Franz; Giaimo, Benedetto Daniele


    Notch signaling is a highly conserved signal transduction pathway that regulates stem cell maintenance and differentiation in several organ systems. Upon activation, the Notch receptor is proteolytically processed, its intracellular domain (NICD) translocates into the nucleus and activates expression of target genes. Output, strength and duration of the signal are tightly regulated by post-translational modifications. Here we review the intracellular post-translational regulation of Notch that fine-tunes the outcome of the Notch response. We also describe how crosstalk with other conserved signaling pathways like the Wnt, Hedgehog, hypoxia and TGFβ/BMP pathways can affect Notch signaling output. This regulation can happen by regulation of ligand, receptor or transcription factor expression, regulation of protein stability of intracellular key components, usage of the same cofactors or coregulation of the same key target genes. Since carcinogenesis is often dependent on at least two of these pathways, a better understanding of their molecular crosstalk is pivotal.

  18. Cell adhesion and intracellular calcium signaling in neurons

    PubMed Central


    Cell adhesion molecules (CAMs) play indispensable roles in the developing and mature brain by regulating neuronal migration and differentiation, neurite outgrowth, axonal fasciculation, synapse formation and synaptic plasticity. CAM-mediated changes in neuronal behavior depend on a number of intracellular signaling cascades including changes in various second messengers, among which CAM-dependent changes in intracellular Ca2+ levels play a prominent role. Ca2+ is an essential secondary intracellular signaling molecule that regulates fundamental cellular functions in various cell types, including neurons. We present a systematic review of the studies reporting changes in intracellular Ca2+ levels in response to activation of the immunoglobulin superfamily CAMs, cadherins and integrins in neurons. We also analyze current experimental evidence on the Ca2+ sources and channels involved in intracellular Ca2+ increases mediated by CAMs of these families, and systematically review the role of the voltage-dependent Ca2+ channels (VDCCs) in neurite outgrowth induced by activation of these CAMs. Molecular mechanisms linking CAMs to VDCCs and intracellular Ca2+ stores in neurons are discussed. PMID:24330678

  19. Intracellular signalling involved in volume regulatory decrease.


    Hoffmann, E K


    The following volume-sensitive channels are characterized in Ehrlich ascites tumor cells (EATC), (i) a tamoxifen- and AA acid sensitive, outwardly rectifying small anion channel (I(Cl,vol)) with low field anion selectivity (I(-)>Cl(-)) and moderate depolarisation-induced inactivation, (ii) a separate DIDS- and niflumic acid-sensitive organic osmolyte/anion channel (OOC) transporting predominantly taurine, and (iii) a clofilium- and Ba(2+)-sensitive, voltage- and Ca(2+)-insensitive 5 pS K(+) channel (I(K,vol)), resistant to a range of K(+) channel inhibitors including ChTX, clotrimazole, apamin, kaliotoxin, margatoxin, and TEA, and with a pH(o) dependence reminiscent of the two-pore domain background K(+) channels TASK. Cell swelling leads to an immediate and transient 3.3 fold increase in the rate of AA release resulting from activation of cPLA(2)alpha, which is found to be translocated to the nucleus upon cell swelling (probably to the inner nuclear membrane), where it is phosphorylated and activated by a G-protein coupled process. AA is a precursor for LTC(4), which is transported out of the cell, where it is converted to LTD(4), which activates I(K,vol), and OOC, whereas I(Cl,vol) is activated via a different pathway. In the absence of an increase in [Ca(2+)](i), the unitary conductance, kinetics, and pharmacological profile are similar for I(K,vol) and the K(+)-channels activated by LTD(4). Tyrosine phosphorylations are involved in the volume regulatory pathways and in defining the volume set-point. Tyrosin kinases appear to be involved in the signalling sequence leading to opening of the channels, and tyrosin phosphatases seem to be involved in closing of the channels. Finally a significant de-polymerization of F-actin is observed after cell swelling, the potential role of which in the volume regulatory mechanisms is under investigation.

  20. Adaptation of fast marching methods to intracellular signaling

    NASA Astrophysics Data System (ADS)

    Chikando, Aristide C.; Kinser, Jason M.


    Imaging of signaling phenomena within the intracellular domain is a well studied field. Signaling is the process by which all living cells communicate with their environment and with each other. In the case of signaling calcium waves, numerous computational models based on solving homogeneous reaction diffusion equations have been developed. Typically, the reaction diffusion approach consists of solving systems of partial differential equations at each update step. The traditional methods used to solve these reaction diffusion equations are very computationally expensive since they must employ small time steps in order to reduce the computational error. The presented research suggests the application of fast marching methods to imaging signaling calcium waves, more specifically fertilization calcium waves, in Xenopus laevis eggs. The fast marching approach provides fast and efficient means of tracking the evolution of monotonically advancing fronts. A model that employs biophysical properties of intracellular calcium signaling, and adapts fast marching methods to tracking the propagation of signaling calcium waves is presented. The developed model is used to reproduce simulation results obtained with reaction diffusion based model. Results obtained with our model agree with both the results obtained with reaction diffusion based models, and confocal microscopy observations during in vivo experiments. The adaptation of fast marching methods to intracellular protein or macromolecule trafficking is also briefly explored.

  1. Evaluation of Intracellular Signaling Downstream Chimeric Antigen Receptors

    PubMed Central

    Karlsson, Hannah; Svensson, Emma; Gigg, Camilla; Jarvius, Malin; Olsson-Strömberg, Ulla; Savoldo, Barbara; Dotti, Gianpietro; Loskog, Angelica


    CD19-targeting CAR T cells have shown potency in clinical trials targeting B cell leukemia. Although mainly second generation (2G) CARs carrying CD28 or 4-1BB have been investigated in patients, preclinical studies suggest that third generation (3G) CARs with both CD28 and 4-1BB have enhanced capacity. However, little is known about the intracellular signaling pathways downstream of CARs. In the present work, we have analyzed the signaling capacity post antigen stimulation in both 2G and 3G CARs. 3G CAR T cells expanded better than 2G CAR T cells upon repeated stimulation with IL-2 and autologous B cells. An antigen-driven accumulation of CAR+ cells was evident post antigen stimulation. The cytotoxicity of both 2G and 3G CAR T cells was maintained by repeated stimulation. The phosphorylation status of intracellular signaling proteins post antigen stimulation showed that 3G CAR T cells had a higher activation status than 2G. Several proteins involved in signaling downstream the TCR were activated, as were proteins involved in the cell cycle, cell adhesion and exocytosis. In conclusion, 3G CAR T cells had a higher degree of intracellular signaling activity than 2G CARs which may explain the increased proliferative capacity seen in 3G CAR T cells. The study also indicates that there may be other signaling pathways to consider when designing or evaluating new generations of CARs. PMID:26700307

  2. Evolution of the Calcium-Based Intracellular Signaling System

    PubMed Central

    Marchadier, Elodie; Oates, Matt E.; Fang, Hai; Donoghue, Philip C.J.; Hetherington, Alistair M.; Gough, Julian


    To progress our understanding of molecular evolution from a collection of well-studied genes toward the level of the cell, we must consider whole systems. Here, we reveal the evolution of an important intracellular signaling system. The calcium-signaling toolkit is made up of different multidomain proteins that have undergone duplication, recombination, sequence divergence, and selection. The picture of evolution, considering the repertoire of proteins in the toolkit of both extant organisms and ancestors, is radically different from that of other systems. In eukaryotes, the repertoire increased in both abundance and diversity at a far greater rate than general genomic expansion. We describe how calcium-based intracellular signaling evolution differs not only in rate but in nature, and how this correlates with the disparity of plants and animals. PMID:27358427

  3. Intracellular Ca(2+) signaling is required for neurotrophin-induced potentiation in the adult rat hippocampus.


    Kang, H; Schuman, E M


    Recent studies have demonstrated the importance of neurotrophin function in adult synaptic plasticity. In an effort to characterize the intracellular signaling pathways that couple Trk receptor activation to the final physiological effects of neurotrophins, we have examined the role of intracellular calcium rises in neurotrophin-induced synaptic enhancement in hippocampal slices. Using pharmacological blockers to two different calcium ion (Ca(2+)) sources, voltage-gated Ca(2+) channels and intracellular Ca(2+) stores, we show that the potentiating effects of neurotrophins in hippocampal slices are mediated by intracellular Ca(2+) signaling. Although basal synaptic transmission between hippocampal CA3 and CA1 neurons was not affected by nifedipine or thapsigargin, both drugs significantly attenuated brain-derived neurotrophic factor or neurotrophin-3-induced synaptic enhancement. The pharmacological blockade of Ca(2+) signaling is effective only during the initial period of neurotrophin-induced potentiation. These data suggest that the minimal requirements for inducing potentiation by neurotrophins involve a transient increase in intracellular Ca(2+) concentration, via voltage-gated Ca(2+) channels and/or intracellular Ca(2+) stores.

  4. Practical aspects of measuring intracellular calcium signals with fluorescent indicators.


    Kao, Joseph P Y; Li, Gong; Auston, Darryl A


    The use of fluorescent indicators for monitoring calcium (Ca(2+)) signals and for measuring Ca(2+) concentration ([Ca(2+)]) in living cells is described. The following topics are covered in detail: (1) ratiometric and nonratiometric fluorescent indicators and the principles underlying their use, (2) techniques for loading Ca(2+) indicators and Ca(2+) buffers into living cells, (3) calibration of indicator fluorescence intensity measurements to yield values of intracellular [Ca(2+)], (4) analysis of nonratiometric fluorescence intensity data and caveats relating to their interpretation, (5) techniques for manipulating intracellular and extracellular [Ca(2+)], and (6) the use of fluorescent indicators to monitor Ca(2+) signals in mitochondria. The chapter aims to present these fundamental topics in a manner that is practically useful and intuitively accessible. The origins of key mathematical equations used in the article are outlined in two appendices.

  5. Human β-Cell Proliferation and Intracellular Signaling: Part 3

    PubMed Central

    Hussain, Mehboob A.; García-Ocaña, Adolfo; Vasavada, Rupangi C.; Bhushan, Anil; Bernal-Mizrachi, Ernesto


    This is the third in a series of Perspectives on intracellular signaling pathways coupled to proliferation in pancreatic β-cells. We contrast the large knowledge base in rodent β-cells with the more limited human database. With the increasing incidence of type 1 diabetes and the recognition that type 2 diabetes is also due in part to a deficiency of functioning β-cells, there is great urgency to identify therapeutic approaches to expand human β-cell numbers. Therapeutic approaches might include stem cell differentiation, transdifferentiation, or expansion of cadaver islets or residual endogenous β-cells. In these Perspectives, we focus on β-cell proliferation. Past Perspectives reviewed fundamental cell cycle regulation and its upstream regulation by insulin/IGF signaling via phosphatidylinositol-3 kinase/mammalian target of rapamycin signaling, glucose, glycogen synthase kinase-3 and liver kinase B1, protein kinase Cζ, calcium-calcineurin–nuclear factor of activated T cells, epidermal growth factor/platelet-derived growth factor family members, Wnt/β-catenin, leptin, and estrogen and progesterone. Here, we emphasize Janus kinase/signal transducers and activators of transcription, Ras/Raf/extracellular signal–related kinase, cadherins and integrins, G-protein–coupled receptors, and transforming growth factor β signaling. We hope these three Perspectives will serve to introduce these pathways to new researchers and will encourage additional investigators to focus on understanding how to harness key intracellular signaling pathways for therapeutic human β-cell regeneration for diabetes. PMID:25999530

  6. Ca2+ signaling and intracellular Ca2+ binding proteins.


    Niki, I; Yokokura, H; Sudo, T; Kato, M; Hidaka, H


    Changes in cytosolic Ca2+ concentrations evoke a wide range of cellular responses and intracellular Ca(2+)-binding proteins are the key molecules to transduce Ca2+ signaling via enzymatic reactions or modulation of protein/protein interations (Fig.1). The EF hand proteins, like calmodulin and S100 proteins, are considered to exert Ca(2+)-dependent actions in the nucleus or the cytoplasm. The Ca2+/phospholipid binding proteins are classified into two groups, the annexins and the C2 region proteins. These proteins, distributed mainly in the cytoplasm, translocate to the plasma membrane in response to an increase in cytosolic Ca2+ and function in the vicinity of the membrane. Ca2+ storage proteins in the endoplasmic or sarcoplasmic reticulum provide the high Ca2+ capacity of the Ca2+ store sites, which regulate intracellular Ca2+ distribution. The variety and complexity of Ca2+ signaling result from the cooperative actions of specific Ca(2+)-binding proteins. This review describes biochemical properties of intracellular Ca(2+)-binding proteins and their proposed roles in mediating Ca2+ signaling.


    PubMed Central

    Kocab, Andrew J.; Duckett, Colin S.


    The inhibitor of apoptosis (IAP) proteins have often been considered inhibitors of cell death due to early studies describing their ability to directly bind and inhibit caspases, the primary factors that implement apoptosis. However, a greater understanding is evolving for the vital roles played by the IAPs as transduction intermediates in a diverse set of signaling cascades that have been associated with functions ranging from the innate immune response to cell migration to cell cycle regulation. In this review, we discuss the functions of the IAPs in signaling, focusing primarily on the cellular IAP (c-IAP) proteins. The c-IAPs are important components in the TNF receptor superfamily signaling cascades, which include the activation of the NF-κB transcription factor family. Since these receptors can modulate cell proliferation and cell death, the roles of the c-IAPs in these pathways provide additional means of controlling cellular fate beyond simply inhibiting caspase activity. Additionally, IAP binding proteins, such as Smac and caspases, which have been described as having cell death-independent roles, may impact c-IAP activity in intracellular signaling. Collectively, the multifaceted functions and complex regulation of the c-IAPs illustrate the importance of the c-IAPs as intracellular signaling intermediates. PMID:26462035

  8. The Growth Hormone Secretagogue Receptor: Its Intracellular Signaling and Regulation

    PubMed Central

    Yin, Yue; Li, Yin; Zhang, Weizhen


    The growth hormone secretagogue receptor (GHSR), also known as the ghrelin receptor, is involved in mediating a wide variety of biological effects of ghrelin, including: stimulation of growth hormone release, increase of food intake and body weight, modulation of glucose and lipid metabolism, regulation of gastrointestinal motility and secretion, protection of neuronal and cardiovascular cells, and regulation of immune function. Dependent on the tissues and cells, activation of GHSR may trigger a diversity of signaling mechanisms and subsequent distinct physiological responses. Distinct regulation of GHSR occurs at levels of transcription, receptor interaction and internalization. Here we review the current understanding on the intracellular signaling pathways of GHSR and its modulation. An overview of the molecular structure of GHSR is presented first, followed by the discussion on its signaling mechanisms. Finally, potential mechanisms regulating GHSR are reviewed. PMID:24651458

  9. Modeling intracellular signaling underlying striatal function in health and disease

    PubMed Central

    Nair, Anu G; Gutierrez-Arenas, Omar; Eriksson, Olivia; Jauhiainen, Alexandra; Blackwell, Kim T; Kotaleski, Jeanette Hellgren


    Striatum, which is the input nucleus of the basal ganglia, integrates cortical and thalamic glutamatergic inputs with dopaminergic afferents from the substantia nigra pars compacta. The combination of dopamine and glutamate strongly modulates molecular and cellular properties of striatal neurons and the strength of corticostriatal synapses. These actions are performed via intracellular signaling networks, containing several intertwined feedback loops. Understanding the role of dopamine and other neuromodulators requires the development of quantitative dynamical models for describing the intracellular signaling, in order to provide precise unambiguous descriptions and quantitative predictions. Building such models requires integration of data from multiple data sources containing information regarding the molecular interactions, the strength of these interactions, and the subcellular localization of the molecules. Due to the uncertainty, variability, and sparseness of these data, parameter estimation techniques are critical for inferring or constraining the unknown parameters, and sensitivity analysis evaluates which parameters are most critical for a given observed macroscopic behavior. Here, we briefly review the modeling approaches and tools that have been used to investigate biochemical signaling in the striatum, along with some of the models built around striatum. We also suggest a future direction for the development of such models from the, now becoming abundant, high-throughput data. PMID:24560149

  10. Intracellular Mono-ADP-Ribosylation in Signaling and Disease

    PubMed Central

    Bütepage, Mareike; Eckei, Laura; Verheugd, Patricia; Lüscher, Bernhard


    A key process in the regulation of protein activities and thus cellular signaling pathways is the modification of proteins by post-translational mechanisms. Knowledge about the enzymes (writers and erasers) that attach and remove post-translational modifications, the targets that are modified and the functional consequences elicited by specific modifications, is crucial for understanding cell biological processes. Moreover detailed knowledge about these mechanisms and pathways helps to elucidate the molecular causes of various diseases and in defining potential targets for therapeutic approaches. Intracellular adenosine diphosphate (ADP)-ribosylation refers to the nicotinamide adenine dinucleotide (NAD+)-dependent modification of proteins with ADP-ribose and is catalyzed by enzymes of the ARTD (ADP-ribosyltransferase diphtheria toxin like, also known as PARP) family as well as some members of the Sirtuin family. Poly-ADP-ribosylation is relatively well understood with inhibitors being used as anti-cancer agents. However, the majority of ARTD enzymes and the ADP-ribosylating Sirtuins are restricted to catalyzing mono-ADP-ribosylation. Although writers, readers and erasers of intracellular mono-ADP-ribosylation have been identified only recently, it is becoming more and more evident that this reversible post-translational modification is capable of modulating key intracellular processes and signaling pathways. These include signal transduction mechanisms, stress pathways associated with the endoplasmic reticulum and stress granules, and chromatin-associated processes such as transcription and DNA repair. We hypothesize that mono-ADP-ribosylation controls, through these different pathways, the development of cancer and infectious diseases. PMID:26426055

  11. The role of Noise for Intracellular Calcium Signaling

    NASA Astrophysics Data System (ADS)

    Jung, Peter


    Calcium signaling is one of the most important and common cellular signaling mechanisms. Calcium signals turn on the wound response in epithelia cells (e.g. the cornea) and brain tissue, play an important role for metabolic processes in liver and pancreas, signal the heart muscle to contract, and are important players in learning and memory. Binding of agonist to receptors in the cell membrane can trigger the release of Ca^2+ from internal stores through small patches of release channels and the formation of intracellular, spatiotemporal calcium patterns that can be observed by using fluorescent markers. What makes these patterns so interesting from the biologic as well as the nonlinear dynamics perspective is that active elements (the release channels) are distributed discretely in small patches (about 100nm in size) that are typically 2mm apart. Processes on this scale are subject to large fluctuations that can dominate the overall calcium signal on a cellular and tissue scale depending on physiologic parameters. Pattern formation in such systems, with discretely distributed active sites and fluctuations poses new challenges that researchers have started to address only in the last years. Recent results in computational modeling of these processes from the elementary release process to the cellular level, are put into context with experimental findings. We focus on the effects of receptor clustering in the context of the cellular Ca^2+ signaling capability.

  12. Intracellular signals of lung cancer cells as possible therapeutic targets

    PubMed Central

    Tanaka, Kiyomichi; Kumano, Keiki; Ueno, Hiroo


    In recent years, several molecularly targeted therapies have been developed as part of lung cancer treatment; they have produced dramatically good results. However, among the many oncogenes that have been identified to be involved in the development of lung cancers, a number of oncogenes are not covered by these advanced therapies. For the treatment of lung cancers, which is a group of heterogeneous diseases, persistent effort in developing individual therapies based on the respective causal genes is important. In addition, for the development of a novel therapy, identification of the lung epithelial stem cells and the origin cells of lung cancer, and understanding about candidate cancer stem cells in lung cancer tissues, their intracellular signaling pathways, and the mechanism of dysregulation of the pathways in cancer cells are extremely important. However, the development of drug resistance by cancer cells, despite the use of molecularly targeted drugs for the causal genes, thus obstructing treatment, is a well-known phenomenon. In this article, we discuss major causal genes of lung cancers and intracellular signaling pathways involving those genes, and review studies on origin and stem cells of lung cancers, as well as the possibility of developing molecularly targeted therapies based on these studies. PMID:25707772

  13. Neutrophil cell surface receptors and their intracellular signal transduction pathways☆

    PubMed Central

    Futosi, Krisztina; Fodor, Szabina; Mócsai, Attila


    Neutrophils play a critical role in the host defense against bacterial and fungal infections, but their inappropriate activation also contributes to tissue damage during autoimmune and inflammatory diseases. Neutrophils express a large number of cell surface receptors for the recognition of pathogen invasion and the inflammatory environment. Those include G-protein-coupled chemokine and chemoattractant receptors, Fc-receptors, adhesion receptors such as selectins/selectin ligands and integrins, various cytokine receptors, as well as innate immune receptors such as Toll-like receptors and C-type lectins. The various cell surface receptors trigger very diverse signal transduction pathways including activation of heterotrimeric and monomeric G-proteins, receptor-induced and store-operated Ca2 + signals, protein and lipid kinases, adapter proteins and cytoskeletal rearrangement. Here we provide an overview of the receptors involved in neutrophil activation and the intracellular signal transduction processes they trigger. This knowledge is crucial for understanding how neutrophils participate in antimicrobial host defense and inflammatory tissue damage and may also point to possible future targets of the pharmacological therapy of neutrophil-mediated autoimmune or inflammatory diseases. PMID:23994464

  14. Lipid raft-dependent uptake, signaling, and intracellular fate of Porphyromonas gingivalis in mouse macrophages

    PubMed Central

    Wang, Min; Hajishengallis, George


    Summary Lipid rafts are cholesterol-enriched microdomains involved in cellular trafficking and implicated as portals for certain pathogens. We sought to determine whether the oral pathogen Porphyromonas gingivalis enters macrophages via lipid rafts, and if so, to examine the impact of raft entry on its intracellular fate. Using J774A.1 mouse macrophages, we found that P. gingivalis colocalizes with lipid rafts in a cholesterol-dependent way. Depletion of cellular cholesterol using methyl-β-cyclodextrin resulted in about 50% inhibition of P. gingivalis uptake, although this effect was reversed by cholesterol reconstitution. The intracellular survival of P. gingivalis was dramatically inhibited in cholesterol-depleted cells relative to untreated or cholesterol-reconstituted cells, even when infections were adjusted to allow equilibration of the initial intracellular bacterial load. P. gingivalis thus appeared to exploit raft-mediated uptake for promoting its survival. Consistent with this, lipid raft disruption enhanced the colocalization of internalized P. gingivalis with lysosomes. In contrast, raft disruption did not affect the expression of host receptors interacting with P. gingivalis, although it significantly inhibited signal transduction. In summary, P. gingivalis uses macrophage lipid rafts as signaling and entry platforms, which determine its intracellular fate to the pathogen’s own advantage. PMID:18547335

  15. MC1R signaling. Intracellular partners and pathophysiological implications.


    Herraiz, Cecilia; Garcia-Borron, Jose C; Jiménez-Cervantes, Celia; Olivares, Conchi


    The melanocortin-1 receptor (MC1R) preferentially expressed in melanocytes is best known as a key regulator of the synthesis of epidermal melanin pigments. Its paracrine stimulation by keratinocyte-derived melanocortins also activates DNA repair pathways and antioxidant defenses to build a complex, multifaceted photoprotective response. Many MC1R actions rely on cAMP-dependent activation of two transcription factors, MITF and PGC1α, but pleiotropic MC1R signaling also involves activation of mitogen-activated kinases and AKT. MC1R partners such as β-arrestins, PTEN and the E3 ubiquitin ligase MGRN1 differentially regulate these pathways. The MC1R gene is complex and polymorphic, with frequent variants associated with skin phenotypes and increased cancer risk. We review current knowledge of signaling from canonical MC1R, its splice isoforms and natural polymorphic variants. Recently discovered intracellular targets and partners are also discussed, to highlight the diversity of mechanisms that may contribute to normal and pathological variation of pigmentation and sensitivity to solar radiation-induced damage. This article is part of a Special Issue entitled: Melanocortin Receptors - edited by Ya-Xiong Tao.

  16. Connexin 43 hemichannels and intracellular signaling in bone cells

    PubMed Central

    Plotkin, Lilian I.


    Cell function and survival are controlled by intracellular signals, and modulated by surrounding cells and the extracellular environment. Connexin channels participate in these processes by mediating cell-to-cell communication. In bone cells, gap junction channels were detected in the early 1970s, and are present among bone resorbing osteoclasts, bone forming osteoblasts, and osteocytes - mature osteoblasts embedded in the mineralized matrix. These channels are composed mainly by Cx43, although the expression of other connexins (45, 46, and 37) has also been reported. It is now believed that undocked Cx43 hemichannels (connexons) formed in unopposed cell membranes facing the extracellular environment participate in the interaction of bone cells with the extracellular environment, and in their communication with neighboring cells. Thus, we and others demonstrated the presence of active hemichannels in osteoblastic and osteocytic cells. These hemichannels open in response to pharmacological and mechanical stimulation. In particular, preservation of the viability of osteoblasts and osteocytes by the anti-osteoporotic drugs bisphosphonates depends on Cx43 expression in vitro and in vivo, and is mediated by undocked hemichannels. Cx43 hemichannels are also required for the release of prostaglandins and ATP by osteocytes, and for cell survival induced by mechanical stimulation in vitro. Moreover, they are required for the anti-apoptotic effect of parathyroid hormone in osteoblastic cells. This review summarizes the current knowledge on the presence and function of undocked connexons, and the role of hemichannel regulation for the maintenance of bone cell viability and, potentially, bone health. PMID:24772090

  17. Activator of G-Protein Signaling 3-Induced Lysosomal Biogenesis Limits Macrophage Intracellular Bacterial Infection.


    Vural, Ali; Al-Khodor, Souhaila; Cheung, Gordon Y C; Shi, Chong-Shan; Srinivasan, Lalitha; McQuiston, Travis J; Hwang, Il-Young; Yeh, Anthony J; Blumer, Joe B; Briken, Volker; Williamson, Peter R; Otto, Michael; Fraser, Iain D C; Kehrl, John H


    Many intracellular pathogens cause disease by subverting macrophage innate immune defense mechanisms. Intracellular pathogens actively avoid delivery to or directly target lysosomes, the major intracellular degradative organelle. In this article, we demonstrate that activator of G-protein signaling 3 (AGS3), an LPS-inducible protein in macrophages, affects both lysosomal biogenesis and activity. AGS3 binds the Gi family of G proteins via its G-protein regulatory (GoLoco) motif, stabilizing the Gα subunit in its GDP-bound conformation. Elevated AGS3 levels in macrophages limited the activity of the mammalian target of rapamycin pathway, a sensor of cellular nutritional status. This triggered the nuclear translocation of transcription factor EB, a known activator of lysosomal gene transcription. In contrast, AGS3-deficient macrophages had increased mammalian target of rapamycin activity, reduced transcription factor EB activity, and a lower lysosomal mass. High levels of AGS3 in macrophages enhanced their resistance to infection by Burkholderia cenocepacia J2315, Mycobacterium tuberculosis, and methicillin-resistant Staphylococcus aureus, whereas AGS3-deficient macrophages were more susceptible. We conclude that LPS priming increases AGS3 levels, which enhances lysosomal function and increases the capacity of macrophages to eliminate intracellular pathogens.

  18. Host Intracellular Signaling Events and Pro-inflammatory Cytokine Production in African Trypanosomiasis

    PubMed Central

    Kuriakose, Shiby M.; Singh, Rani; Uzonna, Jude E.


    Pathogens, such as bacteria, viruses, and parasites, possess specific molecules or proteins that are recognized by several host innate immune receptors, leading to the activation of several intracellular signaling molecules and pathways. The magnitude and quality of these events significantly affect the outcome of infection. African trypanosomes, including Trypanosoma congolense, are capable of manipulating the host immune response, including the activity of macrophages, which are the key immune cells that contribute to the immunopathogenesis of African trypanosomiasis. Although it is known that immune hyperactivation and excessive pro-inflammatory cytokine production are the hallmarks of African trypanosomiasis, the mechanisms through which these events are triggered are poorly defined. However, it is known that macrophages may play a significant role in these processes, because phagocytosis of trypanosomes by macrophages initiates intracellular signal transduction cascades that lead to the release of pro-inflammatory cytokines and alteration in cell function. This review highlights recent progress in our understanding of the innate immune receptors, signaling pathways, and transcription factors involved in T. congolense-induced pro-inflammatory cytokine production in macrophages. It will reveal the existence of complex signaling events through which the parasite modulates the host immune response, thus identifying novel targets that could aid in designing strategies to effectively control the disease. PMID:27242788

  19. Signaling pathways affecting skeletal health.


    Marie, Pierre J


    Skeletal health is dependent on the balance between bone resorption and formation during bone remodeling. Multiple signaling pathways play essential roles in the maintenance of skeletal integrity by positively or negatively regulating bone cells. During the last years, significant advances have been made in our understanding of the essential signaling pathways that regulate bone cell commitment, differentiation and survival. New signaling anabolic pathways triggered by parathyroid hormone, local growth factors, Wnt signaling, and calcium sensing receptor have been identified. Novel signals induced by interactions between bone cells-matrix (integrins), osteoblasts/osteocytes (cadherins, connexins), and osteoblasts/osteoclast (ephrins, Wnt-RhoA, semaphorins) have been discovered. Recent studies revealed the key pathways (MAPK, PI3K/Akt) that critically control bone cells and skeletal mass. This review summarizes the most recent knowledge on the major signaling pathways that control bone cells, and their potential impact on the development of therapeutic strategies to improve human bone health.

  20. Study of neurotoxic intracellular calcium signalling triggered by amyloids.


    Villalobos, Carlos; Caballero, Erica; Sanz-Blasco, Sara; Núñez, Lucía


    Neurotoxicity in Alzheimer's disease (AD) is associated to dishomeostasis of intracellular Ca(2+) induced by amyloid β peptide (Aβ) species. Understanding of the effects of Aβ on intracellular Ca(2+) homeostasis requires preparation of the different Aβ assemblies including oligomers and fibrils and the testing of their effects on cytosolic and mitochondrial Ca(2+) in neurons. Procedures for cerebellar granule cell culture, preparation of Aβ species as well as fluorescence and bioluminescence imaging of cytosolic and mitochondrial Ca(2+) in neurons are described.

  1. Mechanisms of Borrelia burgdorferi internalization and intracellular innate immune signaling.


    Petnicki-Ocwieja, Tanja; Kern, Aurelie


    Lyme disease is a long-term infection whose most severe pathology is characterized by inflammatory arthritis of the lower bearing joints, carditis, and neuropathy. The inflammatory cascades are initiated through the early recognition of invading Borrelia burgdorferi spirochetes by cells of the innate immune response, such as neutrophils and macrophage. B. burgdorferi does not have an intracellular niche and thus much research has focused on immune pathways activated by pathogen recognition molecules at the cell surface, such as the Toll-like receptors (TLRs). However, in recent years, studies have shown that internalization of the bacterium by host cells is an important component of the defense machinery in response to B. burgdorferi. Upon internalization, B. burgdorferi is trafficked through an endo/lysosomal pathway resulting in the activation of a number of intracellular pathogen recognition receptors including TLRs and Nod-like receptors (NLRs). Here we will review the innate immune molecules that participate in both cell surface and intracellular immune activation by B. burgdorferi.

  2. Modulation of Macrophage Inflammatory Nuclear Factor κB (NF-κB) Signaling by Intracellular Cryptococcus neoformans.


    Hayes, James B; Sircy, Linda M; Heusinkveld, Lauren E; Ding, Wandi; Leander, Rachel N; McClelland, Erin E; Nelson, David E


    Cryptococcus neoformans (Cn) is a common facultative intracellular pathogen that can cause life-threatening fungal meningitis in immunocompromised individuals. Shortly after infection, Cn is detectable as both extra- and intracellular yeast particles, with Cn being capable of establishing long-lasting latent infections within host macrophages. Although recent studies have shown that shed capsular polysaccharides and intact extracellular Cn can compromise macrophage function through modulation of NF-κB signaling, it is currently unclear whether intracellular Cn also affects NF-κB signaling. Utilizing live cell imaging and computational modeling, we find that extra- and intracellular Cn support distinct modes of NF-κB signaling in cultured murine macrophages. Specifically, in RAW 264.7 murine macrophages treated with extracellular glucuronoxylomannan (GXM), the major Cn capsular polysaccharide, LPS-induced nuclear translocation of p65 is inhibited, whereas in cells with intracellular Cn, LPS-induced nuclear translocation of p65 is both amplified and sustained. Mathematical simulations and quantification of nascent protein expression indicate that this is a possible consequence of Cn-induced "translational interference," impeding IκBα resynthesis. We also show that long term Cn infection induces stable nuclear localization of p65 and IκBα proteins in the absence of additional pro-inflammatory stimuli. In this case, nuclear localization of p65 is not accompanied by TNFα or inducible NOS (iNOS) expression. These results demonstrate that capsular polysaccharides and intact intracellular yeast manipulate NF-κB via multiple distinct mechanisms and provide new insights into how Cn might modulate cellular signaling at different stages of an infection.

  3. Criticality in intracellular calcium signaling in cardiac myocytes.


    Nivala, Michael; Ko, Christopher Y; Nivala, Melissa; Weiss, James N; Qu, Zhilin


    Calcium (Ca) is a ubiquitous second messenger that regulates many biological functions. The elementary events of local Ca signaling are Ca sparks, which occur randomly in time and space, and integrate to produce global signaling events such as intra- and intercellular Ca waves and whole-cell Ca oscillations. Despite extensive experimental characterization in many systems, the transition from local random to global synchronous events is still poorly understood. Here we show that criticality, a ubiquitous dynamical phenomenon in nature, is responsible for the transition from local to global Ca signaling. We demonstrate this first in a computational model of Ca signaling in a cardiac myocyte and then experimentally in mouse ventricular myocytes, complemented by a theoretical agent-based model to delineate the underlying dynamics. We show that the interaction between the Ca release units via Ca-induced Ca release causes self-organization of Ca spark clusters. When the coupling between Ca release units is weak, the cluster-size distribution is exponential. As the interactions become strong, the cluster-size distribution changes to a power-law distribution, which is characteristic of criticality in thermodynamic and complex nonlinear systems, and facilitates the formation and propagation of Ca waves and whole-cell Ca oscillations. Our findings illustrate how criticality is harnessed by a biological cell to regulate Ca signaling via self-organization of random subcellular events into cellular-scale oscillations, and provide a general theoretical framework for the transition from local Ca signaling to global Ca signaling in biological cells.

  4. Noise decomposition of intracellular biochemical signaling networks using nonequivalent reporters

    PubMed Central

    Rhee, Alex; Cheong, Raymond; Levchenko, Andre


    Experimental measurements of biochemical noise have primarily focused on sources of noise at the gene expression level due to limitations of existing noise decomposition techniques. Here, we introduce a mathematical framework that extends classical extrinsic–intrinsic noise analysis and enables mapping of noise within upstream signaling networks free of such restrictions. The framework applies to systems for which the responses of interest are linearly correlated on average, although the framework can be easily generalized to the nonlinear case. Interestingly, despite the high degree of complexity and nonlinearity of most mammalian signaling networks, three distinct tumor necrosis factor (TNF) signaling network branches displayed linearly correlated responses, in both wild-type and perturbed versions of the network, across multiple orders of magnitude of ligand concentration. Using the noise mapping analysis, we find that the c-Jun N-terminal kinase (JNK) pathway generates higher noise than the NF-κB pathway, whereas the activation of c-Jun adds a greater amount of noise than the activation of ATF-2. In addition, we find that the A20 protein can suppress noise in the activation of ATF-2 by separately inhibiting the TNF receptor complex and JNK pathway through a negative feedback mechanism. These results, easily scalable to larger and more complex networks, pave the way toward assessing how noise propagates through cellular signaling pathways and create a foundation on which we can further investigate the relationship between signaling system architecture and biological noise. PMID:25404303

  5. Intracellular sensing of microbes and danger signals by the inflammasomes.


    Horvath, Gabor L; Schrum, Jacob E; De Nardo, Christine M; Latz, Eicke


    The cells of the innate immune system mobilize a coordinated immune response towards invading microbes and after disturbances in tissue homeostasis. These immune responses typically lead to infection control and tissue repair. Exaggerated or uncontrolled immune responses, however, can also induce acute of chronic inflammatory pathologies that are characteristic for many common diseases such as sepsis, arthritis, atherosclerosis, or Alzheimer's disease. In recent years, the concerted efforts of many scientists have uncovered numerous mechanisms by which immune cells detect foreign or changed self-substances that appear in infections or during tissue damage. These substances stimulate signaling receptors, which leads to cellular activation and the induction of effector mechanisms. Here, we review the role of inflammasomes, a family of signaling molecules that form multi-molecular signaling platforms and activate inflammatory caspases and interleukin-1β cytokines.

  6. SLC30A9 mutation affecting intracellular zinc homeostasis causes a novel cerebro-renal syndrome.


    Perez, Yonatan; Shorer, Zamir; Liani-Leibson, Keren; Chabosseau, Pauline; Kadir, Rotem; Volodarsky, Michael; Halperin, Daniel; Barber-Zucker, Shiran; Shalev, Hanna; Schreiber, Ruth; Gradstein, Libe; Gurevich, Evgenia; Zarivach, Raz; Rutter, Guy A; Landau, Daniel; Birk, Ohad S


    A novel autosomal recessive cerebro-renal syndrome was identified in consanguineous Bedouin kindred: neurological deterioration was evident as of early age, progressing into severe intellectual disability, profound ataxia, camptocormia and oculomotor apraxia. Brain MRI was normal. Four of the six affected individuals also had early-onset nephropathy with features of tubulo-interstitial nephritis, hypertension and tendency for hyperkalemia, though none had rapid deterioration of renal function. Genome wide linkage analysis identified an ∼18 Mb disease-associated locus on chromosome 4 (maximal logarithm of odds score 4.4 at D4S2971; θ = 0). Whole exome sequencing identified a single mutation in SLC30A9 within this locus, segregating as expected within the kindred and not found in a homozygous state in 300 Bedouin controls. We showed that SLC30A9 (solute carrier family 30 member 9; also known as ZnT-9) is ubiquitously expressed with high levels in cerebellum, skeletal muscle, thymus and kidney. Confocal analysis of SH-SY5Y cells overexpressing SLC30A9 fused to enhanced green fluorescent protein demonstrated vesicular cytosolic localization associated with the endoplasmic reticulum, not co-localizing with endosomal or Golgi markers. SLC30A9 encodes a putative zinc transporter (by similarity) previously associated with Wnt signalling. However, using dual-luciferase reporter assay in SH-SY5Y cells we showed that Wnt signalling was not affected by the mutation. Based on protein modelling, the identified mutation is expected to affect SLC30A9's highly conserved cation efflux domain, putatively disrupting its transmembrane helix structure. Cytosolic Zn2+ measurements in HEK293 cells overexpressing wild-type and mutant SLC30A9 showed lower zinc concentration within mutant rather than wild-type SLC30A9 cells. This suggests that SLC30A9 has zinc transport properties affecting intracellular zinc homeostasis, and that the molecular mechanism of the disease is through

  7. Intracellular LINGO-1 negatively regulates Trk neurotrophin receptor signaling.


    Meabon, James S; de Laat, Rian; Ieguchi, Katsuaki; Serbzhinsky, Dmitry; Hudson, Mark P; Huber, B Russel; Wiley, Jesse C; Bothwell, Mark


    Neurotrophins, essential regulators of many aspects of neuronal differentiation and function, signal via four receptors, p75, TrkA, TrkB and TrkC. The three Trk paralogs are members of the LIG superfamily of membrane proteins, which share extracellular domains consisting of leucine-rich repeat and C2 Ig domains. Another LIG protein, LINGO-1 has been reported to bind and influence signaling of p75 as well as TrkA, TrkB and TrkC. Here we examine the manner in which LINGO-1 influences the function of TrkA, TrkB and TrkC. We report that Trk activation promotes Trk association with LINGO-1, and that this association promotes Trk degradation by a lysosomal mechanism. This mechanism resembles the mechanism by which another LIG protein, LRIG1, promotes lysosomal degradation of receptor tyrosine kinases such as the EGF receptor. We present evidence indicating that the Trk/LINGO-1 interaction occurs, in part, within recycling endosomes. We show that a mutant form of LINGO-1, with much of the extracellular domain deleted, has the capacity to enhance TrkA signaling in PC12 cells, possibly by acting as an inhibitor of Trk down-regulation by full length LINGO-1. We propose that LINGO-1 functions as a negative feedback regulator of signaling by cognate receptor tyrosine kinases including TrkA, TrkB and TrkC.

  8. Intracellular cAMP signaling by soluble adenylyl cyclase

    PubMed Central

    Tresguerres, Martin; Levin, Lonny R.; Buck, Jochen


    Soluble adenylyl cyclase (sAC) is a recently identified source of the ubiquitous second messenger cAMP. sAC is distinct from the more widely studied source of cAMP, the transmembrane adenylyl cyclases (tmACs); its activity is uniquely regulated by bicarbonate anions, and it is distributed throughout the cytoplasm and in cellular organelles. Due to its unique localization and regulation, sAC has various functions in a variety of physiological systems which are distinct from tmACs. In this review, we detail the known functions of sAC, and we reassess commonly held views of cAMP signaling inside cells. PMID:21490586

  9. Intracellular cAMP signaling by soluble adenylyl cyclase.


    Tresguerres, Martin; Levin, Lonny R; Buck, Jochen


    Soluble adenylyl cyclase (sAC) is a recently identified source of the ubiquitous second messenger cyclic adenosine 3',5' monophosphate (cAMP). sAC is distinct from the more widely studied source of cAMP, the transmembrane adenylyl cyclases (tmACs); its activity is uniquely regulated by bicarbonate anions, and it is distributed throughout the cytoplasm and in cellular organelles. Due to its unique localization and regulation, sAC has various functions in a variety of physiological systems that are distinct from tmACs. In this review, we detail the known functions of sAC, and we reassess commonly held views of cAMP signaling inside cells.

  10. Irisin Controls Growth, Intracellular Ca2+ Signals, and Mitochondrial Thermogenesis in Cardiomyoblasts.


    Xie, Chao; Zhang, Yuan; Tran, Tran D N; Wang, Hai; Li, Shiwu; George, Eva Vertes; Zhuang, Haoyang; Zhang, Peilan; Kandel, Avi; Lai, Yimu; Tang, Dongqi; Reeves, Westley H; Cheng, Henrique; Ding, Yousong; Yang, Li-Jun


    Exercise offers short-term and long-term health benefits, including an increased metabolic rate and energy expenditure in myocardium. The newly-discovered exercise-induced myokine, irisin, stimulates conversion of white into brown adipocytes as well as increased mitochondrial biogenesis and energy expenditure. Remarkably, irisin is highly expressed in myocardium, but its physiological effects in the heart are unknown. The objective of this work is to investigate irisin's potential multifaceted effects on cardiomyoblasts and myocardium. For this purpose, H9C2 cells were treated with recombinant irisin produced in yeast cells (r-irisin) and in HEK293 cells (hr-irisin) for examining its effects on cell proliferation by MTT [3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay and on gene transcription profiles by qRT-PCR. R-irisin and hr-irisin both inhibited cell proliferation and activated genes related to cardiomyocyte metabolic function and differentiation, including myocardin, follistatin, smooth muscle actin, and nuclear respiratory factor-1. Signal transduction pathways affected by r-irisin in H9C2 cells and C57BL/6 mice were examined by detecting phosphorylation of PI3K-AKT, p38, ERK or STAT3. We also measured intracellular Ca2+ signaling and mitochondrial thermogenesis and energy expenditure in r-irisin-treated H9C2 cells. The results showed that r-irisin, in a certain concentration rage, could activate PI3K-AKT and intracellular Ca2+ signaling and increase cellular oxygen consumption in H9C2 cells. Our study also suggests the existence of irisin-specific receptor on the membrane of H9C2 cells. In conclusion, irisin in a certain concentration rage increased myocardial cell metabolism, inhibited cell proliferation and promoted cell differentiation. These effects might be mediated through PI3K-AKT and Ca2+ signaling, which are known to activate expression of exercise-related genes such as follistatin and myocardin. This work supports the value

  11. Irisin Controls Growth, Intracellular Ca2+ Signals, and Mitochondrial Thermogenesis in Cardiomyoblasts

    PubMed Central

    Xie, Chao; Zhang, Yuan; Tran, Tran D. N.; Wang, Hai; Li, Shiwu; George, Eva Vertes; Zhuang, Haoyang; Zhang, Peilan; Kandel, Avi; Lai, Yimu; Tang, Dongqi; Reeves, Westley H.; Cheng, Henrique; Ding, Yousong; Yang, Li-Jun


    Exercise offers short-term and long-term health benefits, including an increased metabolic rate and energy expenditure in myocardium. The newly-discovered exercise-induced myokine, irisin, stimulates conversion of white into brown adipocytes as well as increased mitochondrial biogenesis and energy expenditure. Remarkably, irisin is highly expressed in myocardium, but its physiological effects in the heart are unknown. The objective of this work is to investigate irisin’s potential multifaceted effects on cardiomyoblasts and myocardium. For this purpose, H9C2 cells were treated with recombinant irisin produced in yeast cells (r-irisin) and in HEK293 cells (hr-irisin) for examining its effects on cell proliferation by MTT [3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay and on gene transcription profiles by qRT-PCR. R-irisin and hr-irisin both inhibited cell proliferation and activated genes related to cardiomyocyte metabolic function and differentiation, including myocardin, follistatin, smooth muscle actin, and nuclear respiratory factor-1. Signal transduction pathways affected by r-irisin in H9C2 cells and C57BL/6 mice were examined by detecting phosphorylation of PI3K-AKT, p38, ERK or STAT3. We also measured intracellular Ca2+ signaling and mitochondrial thermogenesis and energy expenditure in r-irisin-treated H9C2 cells. The results showed that r-irisin, in a certain concentration rage, could activate PI3K-AKT and intracellular Ca2+ signaling and increase cellular oxygen consumption in H9C2 cells. Our study also suggests the existence of irisin-specific receptor on the membrane of H9C2 cells. In conclusion, irisin in a certain concentration rage increased myocardial cell metabolism, inhibited cell proliferation and promoted cell differentiation. These effects might be mediated through PI3K-AKT and Ca2+ signaling, which are known to activate expression of exercise-related genes such as follistatin and myocardin. This work supports the value

  12. Role of α7 nicotinic receptor in the immune system and intracellular signaling pathways

    PubMed Central

    Zdanowski, Robert; Ujazdowska, Dominika; Lewicka, Aneta; Lewicki, Sławomir


    Acetylcholine has been well known as one of the most exemplary neurotransmitters. In humans, this versatile molecule and its synthesizing enzyme, choline acetyltransferase, have been found in various non-neural tissues such as the epithelium, endothelium, mesothelium muscle, blood cells and immune cells. The non-neuronal acetylcholine is accompanied by the expression of acetylcholinesterase and nicotinic/muscarinic acetylcholine receptors. Increasing evidence of the non-neuronal acetylcholine system found throughout the last few years has indicated this neurotransmitter as one of the major cellular signaling molecules (associated e.g. with kinases and transcription factors activity). This system is responsible for maintenance and optimization of the cellular function, such as proliferation, differentiation, adhesion, migration, intercellular contact and apoptosis. Additionally, it controls proper activity of immune cells and affects differentiation, antigen presentation or cytokine production (both pro- and anti-inflammatory). The present article reviews recent findings about the non-neuronal cholinergic system in the field of immune system and intracellular signaling pathways. PMID:26648784

  13. Kinetic insulation as an effective mechanism for achieving pathway specificity in intracellular signaling networks

    PubMed Central

    Behar, Marcelo; Dohlman, Henrik G.; Elston, Timothy C.


    Intracellular signaling pathways that share common components often elicit distinct physiological responses. In most cases, the biochemical mechanisms responsible for this signal specificity remain poorly understood. Protein scaffolds and cross-inhibition have been proposed as strategies to prevent unwanted cross-talk. Here, we report a mechanism for signal specificity termed “kinetic insulation.” In this approach signals are selectively transmitted through the appropriate pathway based on their temporal profile. In particular, we demonstrate how pathway architectures downstream of a common component can be designed to efficiently separate transient signals from signals that increase slowly over time. Furthermore, we demonstrate that upstream signaling proteins can generate the appropriate input to the common pathway component regardless of the temporal profile of the external stimulus. Our results suggest that multilevel signaling cascades may have evolved to modulate the temporal profile of pathway activity so that stimulus information can be efficiently encoded and transmitted while ensuring signal specificity. PMID:17913886

  14. N-myristoylated proteins, key components in intracellular signal transduction systems enabling rapid and flexible cell responses

    PubMed Central

    HAYASHI, Nobuhiro; TITANI, Koiti


    N-myristoylation, one of the co- or post-translational modifications of proteins, has so far been regarded as necessary for anchoring of proteins to membranes. Recently, we have revealed that Nα-myristoylation of several brain proteins unambiguously regulates certain protein–protein interactions that may affect signaling pathways in brain. Comparison of the amino acid sequences of myristoylated proteins including those in other organs suggests that this regulation is involved in signaling pathways not only in brain but also in other organs. Thus, it has been shown that myristoylated proteins in cells regulate the signal transduction between membranes and cytoplasmic fractions. An algorithm we have developed to identify myristoylated proteins in cells predicts the presence of hundreds of myristoylated proteins. Interestingly, a large portion of the myristoylated proteins thought to take part in signal transduction between membranes and cytoplasmic fractions are included in the predicted myristoylated proteins. If the proteins functionally regulated by myristoylation, a posttranslational protein modification, were understood as cross-talk points within the intracellular signal transduction system, known signaling pathways could thus be linked to each other, and a novel map of this intracellular network could be constructed. On the basis of our recent results, this review will highlight the multifunctional aspects of protein N-myristoylation in brain. PMID:20467215

  15. Acoustic tweezers for studying intracellular calcium signaling in SKBR-3 human breast cancer cells.


    Hwang, Jae Youn; Yoon, Chi Woo; Lim, Hae Gyun; Park, Jin Man; Yoon, Sangpil; Lee, Jungwoo; Shung, K Kirk


    Extracellular matrix proteins such as fibronectin (FNT) play crucial roles in cell proliferation, adhesion, and migration. For better understanding of these associated cellular activities, various microscopic manipulation tools have been used to study their intracellular signaling pathways. Recently, it has appeared that acoustic tweezers may possess similar capabilities in the study. Therefore, we here demonstrate that our newly developed acoustic tweezers with a high-frequency lithium niobate ultrasonic transducer have potentials to study intracellular calcium signaling by FNT-binding to human breast cancer cells (SKBR-3). It is found that intracellular calcium elevations in SKBR-3 cells, initially occurring on the microbead-contacted spot and then eventually spreading over the entire cell, are elicited by attaching an acoustically trapped FNT-coated microbead. Interestingly, they are suppressed by either extracellular calcium elimination or phospholipase C (PLC) inhibition. Hence, this suggests that our acoustic tweezers may serve as an alternative tool in the study of intracellular signaling by FNT-binding activities.

  16. Light generation of intracellular Ca2+ signals by a genetically encoded protein BACCS

    PubMed Central

    Ishii, Tomohiro; Sato, Koji; Kakumoto, Toshiyuki; Miura, Shigenori; Touhara, Kazushige; Takeuchi, Shoji; Nakata, Takao


    Ca2+ signals are highly regulated in a spatiotemporal manner in numerous cellular physiological events. Here we report a genetically engineered blue light-activated Ca2+ channel switch (BACCS), as an optogenetic tool for generating Ca2+ signals. BACCS opens Ca2+-selective ORAI ion channels in response to light. A BACCS variant, dmBACCS2, combined with Drosophila Orai, elevates the Ca2+ concentration more rapidly, such that Ca2+ elevation in mammalian cells is observed within 1 s on light exposure. Using BACCSs, we successfully control cellular events including NFAT-mediated gene expression. In the mouse olfactory system, BACCS mediates light-dependent electrophysiological responses. Furthermore, we generate BACCS mutants, which exhibit fast and slow recovery of intracellular Ca2+. Thus, BACCSs are a useful optogenetic tool for generating temporally various intracellular Ca2+ signals with a large dynamic range, and will be applicable to both in vitro and in vivo studies. PMID:26282514

  17. Redox Regulation of Intracellular Zinc: Molecular Signaling in the Life and Death of Neurons

    PubMed Central

    Aizenman, Elias


    Abstract Zn2+ has emerged as a major regulator of neuronal physiology, as well as an important signaling agent in neural injury. The intracellular concentration of this metal is tightly regulated through the actions of Zn2+ transporters and the thiol-rich metal binding protein metallothionein, closely linking the redox status of the cell to cellular availability of Zn2+. Accordingly, oxidative and nitrosative stress during ischemic injury leads to an accumulation of neuronal free Zn2+ and the activation of several downstream cell death processes. While this Zn2+ rise is an established signaling event in neuronal cell death, recent evidence suggests that a transient, sublethal accumulation of free Zn2+ can also play a critical role in neuroprotective pathways activated during ischemic preconditioning. Thus, redox-sensitive proteins, like metallothioneins, may play a critical role in determining neuronal cell fate by regulating the localization and concentration of intracellular free Zn2+. Antioxid. Redox Signal. 15, 2249–2263. PMID:20849376

  18. Aquaporin-3 mediates hydrogen peroxide uptake to regulate downstream intracellular signaling

    PubMed Central

    Miller, Evan W.; Dickinson, Bryan C.; Chang, Christopher J.


    Hydrogen peroxide (H2O2) produced by cell-surface NADPH Oxidase (Nox) enzymes is emerging as an important signaling molecule for growth, differentiation, and migration processes. However, how cells spatially regulate H2O2 to achieve physiological redox signaling over nonspecific oxidative stress pathways is insufficiently understood. Here we report that the water channel Aquaporin-3 (AQP3) can facilitate the uptake of H2O2 into mammalian cells and mediate downstream intracellular signaling. Molecular imaging with Peroxy Yellow 1 Methyl-Ester (PY1-ME), a new chemoselective fluorescent indicator for H2O2, directly demonstrates that aquaporin isoforms AQP3 and AQP8, but not AQP1, can promote uptake of H2O2 specifically through membranes in mammalian cells. Moreover, we show that intracellular H2O2 accumulation can be modulated up or down based on endogenous AQP3 expression, which in turn can influence downstream cell signaling cascades. Finally, we establish that AQP3 is required for Nox-derived H2O2 signaling upon growth factor stimulation. Taken together, our findings demonstrate that the downstream intracellular effects of H2O2 can be regulated across biological barriers, a discovery that has broad implications for the controlled use of this potentially toxic small molecule for beneficial physiological functions. PMID:20724658

  19. Intracellular calcium signals regulate growth of hepatic stellate cells via specific effects on cell cycle progression.


    Soliman, Elwy M; Rodrigues, Michele Angela; Gomes, Dawidson Assis; Sheung, Nina; Yu, Jin; Amaya, Maria Jimina; Nathanson, Michael H; Dranoff, Jonathan A


    Hepatic stellate cells (HSC) are important mediators of liver fibrosis. Hormones linked to downstream intracellular Ca(2+) signals upregulate HSC proliferation, but the mechanisms by which this occurs are unknown. Nuclear and cytosolic Ca(2+) signals may have distinct effects on cell proliferation, so we expressed plasmid and adenoviral constructs containing the Ca(2+) chelator parvalbumin (PV) linked to either a nuclear localization sequence (NLS) or a nuclear export sequence (NES) to block Ca(2+) signals in distinct compartments within LX-2 immortalized human HSC and primary rat HSC. PV-NLS and PV-NES constructs each targeted to the appropriate intracellular compartment and blocked Ca(2+) signals only within that compartment. PV-NLS and PV-NES constructs inhibited HSC growth. Furthermore, blockade of nuclear or cytosolic Ca(2+) signals arrested growth at the G2/mitosis (G2/M) cell-cycle interface and prevented the onset of mitosis. Blockade of nuclear or cytosolic Ca(2+) signals downregulated phosphorylation of the G2/M checkpoint phosphatase Cdc25C. Inhibition of calmodulin kinase II (CaMK II) had identical effects on LX-2 growth and Cdc25C phosphorylation. We propose that nuclear and cytosolic Ca(2+) are critical signals that regulate HSC growth at the G2/M checkpoint via CaMK II-mediated regulation of Cdc25C phosphorylation. These data provide a new logical target for pharmacological therapy directed against progression of liver fibrosis.

  20. Intracellular light-induced release of signaling molecules from gold-coated liposomes

    NASA Astrophysics Data System (ADS)

    Orsinger, Gabriel V.; Williams, Joshua D.; Romanowski, Marek


    The combination of laser light and composite nanovesicles enables unique opportunities for precise delivery to, and ondemand release of molecular compounds within, single cells at high spatiotemporal resolution. Here, we demonstrate precise delivery and intracellular release of molecules from gold-coated liposomes via near infrared (NIR) light. The plasmon resonant gold shell provides a light-sensitive trigger for on-demand content release from thermosensitive liposomes. Two demonstrations of intracellular delivery and release from gold-coated liposomes are presented here. The first example uses microinjection to preload gold-coated liposomes into a single cell, followed by exposure to onresonant NIR laser light to trigger release of a fluorescent nuclear dye intracellularly. In the second delivery and release demonstration, gold-coated liposomes encapsulating inositol trisphosphate (IP3), a ubiquitous secondary messenger in cell signaling cascades, passively accumulate within cells via endocytosis. Exposure to on-resonant NIR laser wavelength of light induces rapid release of IP3 from the intracellular liposomes and subsequent activation of Ca2+ signaling at a single cell, monitored by changes in fluorescence intensity of a Ca 2+-sensitive dye.

  1. Simplest relationship between local field potential and intracellular signals in layered neural tissue.


    Chizhov, Anton V; Sanchez-Aguilera, Alberto; Rodrigues, Serafim; de la Prida, Liset Menendez


    The relationship between the extracellularly measured electric field potential resulting from synaptic activity in an ensemble of neurons and intracellular signals in these neurons is an important but still open question. Based on a model neuron with a cylindrical dendrite and lumped soma, we derive a formula that substantiates a proportionality between the local field potential and the total somatic transmembrane current that emerges from the difference between the somatic and dendritic membrane potentials. The formula is tested by intra- and extracellular recordings of evoked synaptic responses in hippocampal slices. Additionally, the contribution of different membrane currents to the field potential is demonstrated in a two-population mean-field model. Our formalism, which allows for a simple estimation of unknown dendritic currents directly from somatic measurements, provides an interpretation of the local field potential in terms of intracellularly measurable synaptic signals. It is also applicable to the study of cortical activity using two-compartment neuronal population models.

  2. Simplest relationship between local field potential and intracellular signals in layered neural tissue

    NASA Astrophysics Data System (ADS)

    Chizhov, Anton V.; Sanchez-Aguilera, Alberto; Rodrigues, Serafim; de la Prida, Liset Menendez


    The relationship between the extracellularly measured electric field potential resulting from synaptic activity in an ensemble of neurons and intracellular signals in these neurons is an important but still open question. Based on a model neuron with a cylindrical dendrite and lumped soma, we derive a formula that substantiates a proportionality between the local field potential and the total somatic transmembrane current that emerges from the difference between the somatic and dendritic membrane potentials. The formula is tested by intra- and extracellular recordings of evoked synaptic responses in hippocampal slices. Additionally, the contribution of different membrane currents to the field potential is demonstrated in a two-population mean-field model. Our formalism, which allows for a simple estimation of unknown dendritic currents directly from somatic measurements, provides an interpretation of the local field potential in terms of intracellularly measurable synaptic signals. It is also applicable to the study of cortical activity using two-compartment neuronal population models.

  3. A physiologic signaling role for the γ-secretase-derived intracellular fragment of APP

    PubMed Central

    Leissring, Malcolm A.; Murphy, M. Paul; Mead, Tonya R.; Akbari, Yama; Sugarman, Michael C.; Jannatipour, Mehrdad; Anliker, Brigitte; Müller, Ulrike; Saftig, Paul; De Strooper, Bart; Wolfe, Michael S.; Golde, Todd E.; LaFerla, Frank M.


    Presenilins mediate an unusual intramembranous proteolytic activity known as γ-secretase, two substrates of which are the Notch receptor (Notch) and the β-amyloid precursor protein (APP). γ-Secretase-mediated cleavage of APP, like that of Notch, yields an intracellular fragment [APP intracellular domain (AICD)] that forms a transcriptively active complex. We now demonstrate a functional role for AICD in regulating phosphoinositide-mediated calcium signaling. Genetic ablation of the presenilins or pharmacological inhibition of γ-secretase activity (and thereby AICD production) attenuated calcium signaling in a dose-dependent and reversible manner through a mechanism involving the modulation of endoplasmic reticulum calcium stores. Cells lacking APP (and hence AICD) exhibited similar calcium signaling deficits, and—notably—these disturbances could be reversed by transfection with APP constructs containing an intact AICD, but not by constructs lacking this domain. Our findings indicate that the AICD regulates phosphoinositide-mediated calcium signaling through a γ-secretase-dependent signaling pathway, suggesting that the intramembranous proteolysis of APP may play a signaling role analogous to that of Notch. PMID:11917117

  4. The selective Bcl-2 inhibitor venetoclax, a BH3 mimetic, does not dysregulate intracellular Ca(2+) signaling.


    Vervloessem, Tamara; Ivanova, Hristina; Luyten, Tomas; Parys, Jan B; Bultynck, Geert


    Anti-apoptotic B cell-lymphoma-2 (Bcl-2) proteins are emerging as therapeutic targets in a variety of cancers for precision medicines, like the BH3-mimetic drug venetoclax (ABT-199), which antagonizes the hydrophobic cleft of Bcl-2. However, the impact of venetoclax on intracellular Ca(2+) homeostasis and dynamics in cell systems has not been characterized in detail. Here, we show that venetoclax did not affect Ca(2+)-transport systems from the endoplasmic reticulum (ER) in permeabilized cell systems. Venetoclax (1μM) did neither trigger Ca(2+) release by itself nor affect agonist-induced Ca(2+) release in a variety of intact cell models. Among the different cell types, we also studied two Bcl-2-dependent cancer cell models with a varying sensitivity towards venetoclax, namely SU-DHL-4 and OCI-LY-1, both diffuse large B-cell lymphoma cell lines. Acute application of venetoclax did also not dysregulate Ca(2+) signaling in these Bcl-2-dependent cancer cells. Moreover, venetoclax-induced cell death was independent of intracellular Ca(2+) overload, since Ca(2+) buffering using BAPTA-AM did not suppress venetoclax-induced cell death. This study therefore shows that venetoclax does not dysregulate the intracellular Ca(2+) homeostasis in a variety of cell types, which may underlie its limited toxicity in human patients. Furthermore, venetoclax-induced cell death in Bcl-2-dependent cancer cells is not mediated by intracellular Ca(2+) overload. This article is part of a Special Issue entitled: ECS Meeting edited by Claus Heizmann, Joachim Krebs and Jacques Haiech.

  5. The emerging role of phosphoinositide clustering in intracellular trafficking and signal transduction

    PubMed Central

    Picas, Laura; Gaits-Iacovoni, Frederique; Goud, Bruno


    Phosphoinositides are master regulators of multiple cellular processes: from vesicular trafficking to signaling, cytoskeleton dynamics, and cell growth. They are synthesized by the spatiotemporal regulated activity of phosphoinositide-metabolizing enzymes. The recent observation that some protein modules are able to cluster phosphoinositides suggests that alternative or complementary mechanisms might operate to stabilize the different phosphoinositide pools within cellular compartments. Herein, we discuss the different known and potential molecular players that are prone to engage phosphoinositide clustering and elaborate on how such a mechanism might take part in the regulation of intracellular trafficking and signal transduction. PMID:27092250

  6. An Intracellular Antioxidant Determines the Expression of a Melanin-Based Signal in a Bird

    PubMed Central

    Galván, Ismael; Alonso-Alvarez, Carlos


    To understand how traits used in animal communication evolved and are maintained as honest signals, we need to understand the mechanisms that prevent cheating. It has been proposed that honest signaling is guaranteed by the costs associated with the signal expression. However, the nature of these costs is still under debate. Melanin-based signals are intriguing because their expression seems to be tightly controlled by genes and the resource involved (i.e. melanin) seems to be not limited. However, in vertebrates, low levels of a key intracellular antioxidant (i.e. glutathione) are needed to promote melanogenesis. We propose that melanin-based ornaments can signal the ability to cope with oxidative stress because those individuals with low enough levels of glutathione, such as those required for melanin production, should manage well the whole of the antioxidant machinery in order to maintain a certain oxidative status. We analysed the expression of a melanin-based signal: the well-known black stripe of the great tit (Parus major). Great tit nestlings were injected with a specific inhibitor of glutathione production (DL-buthionine-S,R-sulfoximine; BSO) throughout their development. BSO effectively decreased intracellular glutathione levels without apparent side effects on growth or body condition. Instead, treated nestlings developed black breast stripes 70–100% larger than controls. Moreover, treated nestlings also compensated the decrease in glutathione levels by increasing the levels of circulating antioxidants. Results indicate that melanin-based signals can be at least partially permeable to environmental influences such as those associated to oxidative stress. They also reveal a potential handicap associated to the expression of this kind of signals. Finally, although other contributing factors could have been present, our findings emphasize the role of oxidative stress in shaping the evolution of animal signals in general and, in particular, those produced

  7. G beta gamma signaling reduces intracellular cAMP to promote meiotic progression in mouse oocytes.


    Gill, Arvind; Hammes, Stephen R


    In nearly every vertebrate species, elevated intracellular cAMP maintains oocytes in prophase I of meiosis. Prior to ovulation, gonadotropins trigger various intra-ovarian processes, including the breakdown of gap junctions, the activation of EGF receptors, and the secretion of steroids. These events in turn decrease intracellular cAMP levels in select oocytes to allow meiotic progression, or maturation, to resume. Studies suggest that cAMP levels are kept elevated in resting oocytes by constitutive G protein signaling, and that the drop in intracellular cAMP that accompanies maturation may be due in part to attenuation of this inhibitory G protein-mediated signaling. Interestingly, one of these G protein regulators of meiotic arrest is the Galpha(s) protein, which stimulates adenylyl cyclase to raise intracellular cAMP in two important animal models of oocyte development: Xenopus leavis frogs and mice. In addition to G(alpha)(s), constitutive Gbetagamma activity similarly stimulates adenylyl cyclase to raise cAMP and prevent maturation in Xenopus oocytes; however, the role of Gbetagamma in regulating meiosis in mouse oocytes has not been examined. Here we show that Gbetagamma does not contribute to the maintenance of murine oocyte meiotic arrest. In fact, contrary to observations in frog oocytes, Gbetagamma signaling in mouse oocytes reduces cAMP and promotes oocyte maturation, suggesting that Gbetagamma might in fact play a positive role in promoting oocyte maturation. These observations emphasize that, while many general concepts and components of meiotic regulation are conserved from frogs to mice, specific differences exist that may lead to important insights regarding ovarian development in vertebrates.

  8. Model-based control of the temporal patterns of intracellular signaling in silico

    PubMed Central

    Murakami, Yohei; Koyama, Masanori; Oba, Shigeyuki; Kuroda, Shinya; Ishii, Shin


    The functions of intracellular signal transduction systems are determined by the temporal behavior of intracellular molecules and their interactions. Of the many dynamical properties of the system, the relationship between the dynamics of upstream molecules and downstream molecules is particularly important. A useful tool in understanding this relationship is a methodology to control the dynamics of intracellular molecules with an extracellular stimulus. However, this is a difficult task because the relationship between the levels of upstream molecules and those of downstream molecules is often not only stochastic, but also time-inhomogeneous, nonlinear, and not one-to-one. In this paper, we present an easy-to-implement model-based control method that makes the target downstream molecule to trace a desired time course by changing the concentration of a controllable upstream molecule. Our method uses predictions from Monte Carlo simulations of the model to decide the strength of the stimulus, while using a particle-based approach to make inferences regarding unobservable states. We applied our method to in silico control problems of insulin-dependent AKT pathway model and EGF-dependent Akt pathway model with system noise. We show that our method can robustly control the dynamics of the intracellular molecules against unknown system noise of various strengths, even in the absence of complete knowledge of the true model of the target system. PMID:28275530

  9. Microglial Intracellular Ca2+ Signaling in Synaptic Development and its Alterations in Neurodevelopmental Disorders

    PubMed Central

    Mizoguchi, Yoshito; Monji, Akira


    Autism spectrum disorders (ASDs) are neurodevelopmental disorders characterized by deficits in social interaction, difficulties with language and repetitive/restricted behaviors. Microglia are resident innate immune cells which release many factors including proinflammatory cytokines, nitric oxide (NO) and brain-derived neurotrophic factor (BDNF) when they are activated in response to immunological stimuli. Recent in vivo imaging has shown that microglia sculpt and refine the synaptic circuitry by removing excess and unwanted synapses and be involved in the development of neural circuits or synaptic plasticity thereby maintaining the brain homeostasis. BDNF, one of the neurotrophins, has various important roles in cell survival, neurite outgrowth, neuronal differentiation, synaptic plasticity and the maintenance of neural circuits in the CNS. Intracellular Ca2+ signaling is important for microglial functions including ramification, de-ramification, migration, phagocytosis and release of cytokines, NO and BDNF. BDNF induces a sustained intracellular Ca2+ elevation through the upregulation of the surface expression of canonical transient receptor potential 3 (TRPC3) channels in rodent microglia. BDNF might have an anti-inflammatory effect through the inhibition of microglial activation and TRPC3 could play important roles in not only inflammatory processes but also formation of synapse through the modulation of microglial phagocytic activity in the brain. This review article summarizes recent findings on emerging dual, inflammatory and non-inflammatory, roles of microglia in the brain and reinforces the importance of intracellular Ca2+ signaling for microglial functions in both normal neurodevelopment and their potential contributing to neurodevelopmental disorders such as ASDs. PMID:28367116

  10. The effect of feeding during recovery from aerobic exercise on skeletal muscle intracellular signaling.


    Reidy, Paul T; Konopka, Adam R; Hinkley, J Matthew; Undem, Miranda K; Harber, Matthew P


    We previously reported an increase in skeletal muscle protein synthesis during fasted and fed recovery from nonexhaustive aerobic exercise (Harber et al., 2010). The current study examined skeletal muscle intracellular signaling in the same subjects to further investigate mechanisms of skeletal muscle protein metabolism with and without feeding following aerobic exercise. Eight males (VO₂peak: 52 ± 2 ml⁻¹·kg⁻¹·min⁻¹) performed 60-min of cycle ergometry at 72 ± 1% VO₂peak on two occasions in a counter-balanced design. Exercise trials differed only in the postexercise nutritional intervention: EX-FED (5 kcal, 0.83 g carbohydrate, 0.37 g protein, 0.03 g fat per kg body weight) and EX-FAST (noncaloric, isovolumic placebo) ingested immediately and one hour after exercise. Muscle biopsies were obtained from the vastus lateralis at rest (on a separate day) and two hours postexercise to assess intracellular signaling via western blotting of p70S6K1, eEF2, 4EBP1, AMPKα and p38 MAPK. p70S6K1 phosphorylation was elevated (p < .05) in EX-FED relative to REST and EX-FAST. eEF2, 4EBP1, AMPKα and p38 MAPK signaling were unaltered at 2 h after exercise independent of feeding status when expressed as the ratio of phosphorylated to total protein normalized to actin. These data demonstrate that feeding after a nonexhaustive bout of aerobic exercise stimulates skeletal muscle p70S6K1 intracellular signaling favorable for promoting protein synthesis which may, as recent literature has suggested, better prepare the muscle for subsequent exercise bouts. These data provide further support into the role of feeding on mechanisms regulating muscle protein metabolism during recovery from aerobic exercise.

  11. Increase of Intracellular Cyclic AMP by PDE4 Inhibitors Affects HepG2 Cell Cycle Progression and Survival.


    Massimi, Mara; Cardarelli, Silvia; Galli, Francesca; Giardi, Maria Federica; Ragusa, Federica; Panera, Nadia; Cinque, Benedetta; Cifone, Maria Grazia; Biagioni, Stefano; Giorgi, Mauro


    Type 4 cyclic nucleotide phosphodiesterases (PDE4) are major members of a superfamily of enzymes (PDE) involved in modulation of intracellular signaling mediated by cAMP. Broadly expressed in most human tissues and present in large amounts in the liver, PDEs have in the last decade been key therapeutic targets for several inflammatory diseases. Recently, a significant body of work has underscored their involvement in different kinds of cancer, but with no attention paid to liver cancer. The present study investigated the effects of two PDE4 inhibitors, rolipram and DC-TA-46, on the growth of human hepatoma HepG2 cells. Treatment with these inhibitors caused a marked increase of intracellular cAMP level and a dose- and time-dependent effect on cell growth. The concentrations of inhibitors that halved cell proliferation to about 50% were used for cell cycle experiments. Rolipram (10 μM) and DC-TA-46 (0.5 μM) produced a decrease of cyclin expression, in particular of cyclin A, as well as an increase in p21, p27 and p53, as evaluated by Western blot analysis. Changes in the intracellular localization of cyclin D1 were also observed after treatments. In addition, both inhibitors caused apoptosis, as demonstrated by an Annexin-V cytofluorimetric assay and analysis of caspase-3/7 activity. Results demonstrated that treatment with PDE4 inhibitors affected HepG2 cell cycle and survival, suggesting that they might be useful as potential adjuvant, chemotherapeutic or chemopreventive agents in hepatocellular carcinoma. J. Cell. Biochem. 118: 1401-1411, 2017. © 2016 Wiley Periodicals, Inc.

  12. The deiodinases and the control of intracellular thyroid hormone signaling during cellular differentiation☆

    PubMed Central

    Dentice, Monica; Marsili, Alessandro; Zavacki, AnnMarie; Larsen, P. Reed; Salvatore, Domenico


    Background Thyroid hormone influences gene expression in virtually all vertebrates. Its action is initiated by the activation of T4 to T3, an outer ring deiodination reaction that is catalyzed by the type 1 or the type 2 iodothyronine selenodeiodinases (D1 or D2). Inactivation of T4 and T3 occurs via inner ring deiodination catalyzed by the type 3 iodothyronine selenodeiodinases (D3). The T4 concentration is generally quite stable in human plasma, with T3 levels also remaining constant. Deiodinase actions are tightly regulated in both pre- and post-natal life when they are required to make local adjustments of intracellular T3 concentrations in a precise spatio- and temporal manner. Although all the signals governing the dynamic expression of deiodinases in specific cell types are not known, many important regulatory factors have been deciphered. Scope of review This review provides striking examples from the recent literature illustrating how the expression of D2 and D3 is finely tuned during maturation of different organs, and how their action play a critical role in different settings to control intracellular T3 availability. Major conclusions Emerging evidence indicates that in various cell contexts, D2 and D3 are expressed in a dynamic balance, in which the expression of one enzyme is coordinately regulated with that of the other to tightly control intracellular T3 levels commensurate with cell requirements at that time. General significance Deiodinases control TH action in a precise spatio-temporal fashion thereby providing a novel mechanism for the local paracrine and autocrine regulation of TH action. This remarkable tissue-specific regulation of intracellular thyroid status remains hidden due to the maintenance of constant circulating TH concentrations by the hypothalamic–pituitary–thyroid axis. This article is part of a Special Issue entitled Thyroid hormone signalling. PMID:22634734

  13. Tuning cell migration: contractility as an integrator of intracellular signals from multiple cues.


    Bordeleau, Francois; Reinhart-King, Cynthia A


    There has been immense progress in our understanding of the factors driving cell migration in both two-dimensional and three-dimensional microenvironments over the years. However, it is becoming increasingly evident that even though most cells share many of the same signaling molecules, they rarely respond in the same way to migration cues. To add to the complexity, cells are generally exposed to multiple cues simultaneously, in the form of growth factors and/or physical cues from the matrix. Understanding the mechanisms that modulate the intracellular signals triggered by multiple cues remains a challenge. Here, we will focus on the molecular mechanism involved in modulating cell migration, with a specific focus on how cell contractility can mediate the crosstalk between signaling initiated at cell-matrix adhesions and growth factor receptors.

  14. Tuning cell migration: contractility as an integrator of intracellular signals from multiple cues

    PubMed Central

    Bordeleau, Francois; Reinhart-King, Cynthia A.


    There has been immense progress in our understanding of the factors driving cell migration in both two-dimensional and three-dimensional microenvironments over the years. However, it is becoming increasingly evident that even though most cells share many of the same signaling molecules, they rarely respond in the same way to migration cues. To add to the complexity, cells are generally exposed to multiple cues simultaneously, in the form of growth factors and/or physical cues from the matrix. Understanding the mechanisms that modulate the intracellular signals triggered by multiple cues remains a challenge. Here, we will focus on the molecular mechanism involved in modulating cell migration, with a specific focus on how cell contractility can mediate the crosstalk between signaling initiated at cell-matrix adhesions and growth factor receptors. PMID:27508074

  15. Structural Basis of Intracellular TGF-β Signaling: Receptors and Smads.


    Chaikuad, Apirat; Bullock, Alex N


    Stimulation of the transforming growth factor β (TGF-β) family receptors activates an intracellular phosphorylation-dependent signaling cascade that culminates in Smad transcriptional activation and turnover. Structural studies have identified a number of allosteric mechanisms that control the localization, conformation, and oligomeric state of the receptors and Smads. Such mechanisms dictate the ordered binding of substrate and adaptor proteins that determine the directionality of the signaling process. Activation of the pathway has been illustrated by the various structures of the receptor-activated Smads (R-Smads) with SARA, Smad4, and YAP, respectively, whereas mechanisms of down-regulation have been elucidated by the structural complexes of FKBP12, Ski, and Smurf1. Interesting parallels have emerged between the R-Smads and the Forkhead-associated (FHA) and interferon regulatory factor (IRF)-associated domains, as well as the Hippo pathway. However, important questions remain as to the mechanism of Smad-independent signaling.

  16. Key mediators of intracellular amino acids signaling to mTORC1 activation.


    Duan, Yehui; Li, Fengna; Tan, Kunrong; Liu, Hongnan; Li, Yinghui; Liu, Yingying; Kong, Xiangfeng; Tang, Yulong; Wu, Guoyao; Yin, Yulong


    Mammalian target of rapamycin complex 1 (mTORC1) is activated by amino acids to promote cell growth via protein synthesis. Specifically, Ras-related guanosine triphosphatases (Rag GTPases) are activated by amino acids, and then translocate mTORC1 to the surface of late endosomes and lysosomes. Ras homolog enriched in brain (Rheb) resides on this surface and directly activates mTORC1. Apart from the presence of intracellular amino acids, Rag GTPases and Rheb, other mediators involved in intracellular amino acid signaling to mTORC1 activation include human vacuolar sorting protein-34 (hVps34) and mitogen-activating protein kinase kinase kinase kinase-3 (MAP4K3). Those molecular links between mTORC1 and its mediators form a complicate signaling network that controls cellular growth, proliferation, and metabolism. Moreover, it is speculated that amino acid signaling to mTORC1 may start from the lysosomal lumen. In this review, we discussed the function of these mediators in mTORC1 pathway and how these mediators are regulated by amino acids in details.

  17. Acidic calcium stores open for business: expanding the potential for intracellular Ca2+ signaling

    PubMed Central

    Patel, Sandip; Docampo, Roberto


    Changes in cytosolic calcium concentration are crucial for a variety of cellular processes in all cells. It has long been appreciated that calcium is stored and released from intracellular calcium stores such as the endoplasmic reticulum. However, emerging evidence indicates that calcium is also dynamically regulated by a seemingly disparate collection of acidic organelles. Here, we review the defining features of these acidic calcium stores and highlight recent progress in understanding the mechanisms of uptake and release of calcium from these stores. We also examine the nature of calcium buffering within the stores and summarize the physiological and patho-physiological significance of these ubiquitous organelles in calcium signaling. PMID:20303271

  18. Metabotropic glutamate receptor 5 couples cellular prion protein to intracellular signalling in Alzheimer’s disease

    PubMed Central

    Haas, Laura T.; Salazar, Santiago V.; Kostylev, Mikhail A.; Um, Ji Won; Kaufman, Adam C.


    Alzheimer’s disease-related phenotypes in mice can be rescued by blockade of either cellular prion protein or metabotropic glutamate receptor 5. We sought genetic and biochemical evidence that these proteins function cooperatively as an obligate complex in the brain. We show that cellular prion protein associates via transmembrane metabotropic glutamate receptor 5 with the intracellular protein mediators Homer1b/c, calcium/calmodulin-dependent protein kinase II, and the Alzheimer’s disease risk gene product protein tyrosine kinase 2 beta. Coupling of cellular prion protein to these intracellular proteins is modified by soluble amyloid-β oligomers, by mouse brain Alzheimer’s disease transgenes or by human Alzheimer’s disease pathology. Amyloid-β oligomer-triggered phosphorylation of intracellular protein mediators and impairment of synaptic plasticity in vitro requires Prnp–Grm5 genetic interaction, being absent in transheterozygous loss-of-function, but present in either single heterozygote. Importantly, genetic coupling between Prnp and Grm5 is also responsible for signalling, for survival and for synapse loss in Alzheimer’s disease transgenic model mice. Thus, the interaction between metabotropic glutamate receptor 5 and cellular prion protein has a central role in Alzheimer’s disease pathogenesis, and the complex is a potential target for disease-modifying intervention. PMID:26667279

  19. Metabotropic glutamate receptor 5 couples cellular prion protein to intracellular signalling in Alzheimer's disease.


    Haas, Laura T; Salazar, Santiago V; Kostylev, Mikhail A; Um, Ji Won; Kaufman, Adam C; Strittmatter, Stephen M


    Alzheimer's disease-related phenotypes in mice can be rescued by blockade of either cellular prion protein or metabotropic glutamate receptor 5. We sought genetic and biochemical evidence that these proteins function cooperatively as an obligate complex in the brain. We show that cellular prion protein associates via transmembrane metabotropic glutamate receptor 5 with the intracellular protein mediators Homer1b/c, calcium/calmodulin-dependent protein kinase II, and the Alzheimer's disease risk gene product protein tyrosine kinase 2 beta. Coupling of cellular prion protein to these intracellular proteins is modified by soluble amyloid-β oligomers, by mouse brain Alzheimer's disease transgenes or by human Alzheimer's disease pathology. Amyloid-β oligomer-triggered phosphorylation of intracellular protein mediators and impairment of synaptic plasticity in vitro requires Prnp-Grm5 genetic interaction, being absent in transheterozygous loss-of-function, but present in either single heterozygote. Importantly, genetic coupling between Prnp and Grm5 is also responsible for signalling, for survival and for synapse loss in Alzheimer's disease transgenic model mice. Thus, the interaction between metabotropic glutamate receptor 5 and cellular prion protein has a central role in Alzheimer's disease pathogenesis, and the complex is a potential target for disease-modifying intervention.

  20. Emerin suppresses Notch signaling by restricting the Notch intracellular domain to the nuclear membrane.


    Lee, Byongsun; Lee, Tae-Hee; Shim, Jaekyung


    Emerin is an inner nuclear membrane protein that is involved in maintaining the mechanical integrity of the nuclear membrane. Increasing evidence supports the involvement of emerin in the regulation of gene expression; however, its precise function remains to be elucidated. Here, we show that emerin downregulated genes downstream of Notch signaling, which are activated exclusively by the Notch intracellular domain (NICD). Deletion mutant experiments revealed that the transmembrane domain of emerin is important for the inhibition of Notch signaling. Emerin interacted directly and colocalized with the NICD at the nuclear membrane. Emerin knockdown induced the phosphorylation of ERK and AKT, increased endogenous Notch signaling, and inhibited hydrogen peroxide-induced apoptosis in HeLa cells. Notably, the downregulation of barrier-to-autointegration factor (BAF) or lamin A/C increased Notch signaling by inducing the release of emerin into the cytosol, implying that nuclear membrane-bound emerin acts as an endogenous inhibitor of Notch signaling. Taken together, our results indicate that emerin negatively regulates Notch signaling by promoting the retention of the NICD at the nuclear membrane. This mechanism could constitute a new therapeutic target for the treatment of emerin-related diseases.

  1. Intracellular Redox Compartmentation and ROS-Related Communication in Regulation and Signaling1[OPEN

    PubMed Central


    Recent years have witnessed enormous progress in understanding redox signaling related to reactive oxygen species (ROS) in plants. The consensus view is that such signaling is intrinsic to many developmental processes and responses to the environment. ROS-related redox signaling is tightly wedded to compartmentation. Because membranes function as barriers, highly redox-active powerhouses such as chloroplasts, peroxisomes, and mitochondria may elicit specific signaling responses. However, transporter functions allow membranes also to act as bridges between compartments, and so regulated capacity to transmit redox changes across membranes influences the outcome of triggers produced at different locations. As well as ROS and other oxidizing species, antioxidants are key players that determine the extent of ROS accumulation at different sites and that may themselves act as signal transmitters. Like ROS, antioxidants can be transported across membranes. In addition, the intracellular distribution of antioxidative enzymes may be modulated to regulate or facilitate redox signaling appropriate to the conditions. Finally, there is substantial plasticity in organellar shape, with extensions such as stromules, peroxules, and matrixules playing potentially crucial roles in organelle-organelle communication. We provide an overview of the advances in subcellular compartmentation, identifying the gaps in our knowledge and discussing future developments in the area. PMID:27208308

  2. Intracellular calcium signals display an avalanche-like behavior over multiple lengthscales

    PubMed Central

    Lopez, Lucía; Piegari, Estefanía; Sigaut, Lorena; Ponce Dawson, Silvina


    Many natural phenomena display “self-organized criticality” (SOC), (Bak et al., 1987). This refers to spatially extended systems for which patterns of activity characterized by different lengthscales can occur with a probability density that follows a power law with pattern size. Differently from power laws at phase transitions, systems displaying SOC do not need the tuning of an external parameter. Here we analyze intracellular calcium (Ca2+) signals, a key component of the signaling toolkit of almost any cell type. Ca2+ signals can either be spatially restricted (local) or propagate throughout the cell (global). Different models have suggested that the transition from local to global signals is similar to that of directed percolation. Directed percolation has been associated, in turn, to the appearance of SOC. In this paper we discuss these issues within the framework of simple models of Ca2+ signal propagation. We also analyze the size distribution of local signals (“puffs”) observed in immature Xenopus Laevis oocytes. The puff amplitude distribution obtained from observed local signals is not Gaussian with a noticeable fraction of large size events. The experimental distribution of puff areas in the spatio-temporal record of the image has a long tail that is approximately log-normal. The distribution can also be fitted with a power law relationship albeit with a smaller goodness of fit. The power law behavior is encountered within a simple model that includes some coupling among individual signals for a wide range of parameter values. An analysis of the model shows that a global elevation of the Ca2+ concentration plays a major role in determining whether the puff size distribution is long-tailed or not. This suggests that Ca2+-clearing from the cytosol is key to determine whether IP3-mediated Ca2+ signals can display a SOC-like behavior or not. PMID:22969730

  3. Spatiotemporal Properties of Intracellular Calcium Signaling in Osteocytic and Osteoblastic Cell Networks under Fluid Flow

    PubMed Central

    Jing, Da; Lu, X. Lucas; Luo, Erping; Sajda, Paul; Leong, Pui L; Guo, X. Edward


    Mechanical stimuli can trigger intracellular calcium (Ca2+) responses in osteocytes and osteoblasts. Successful construction of bone cell networks necessitates more elaborate and systematic analysis for the spatiotemporal properties of Ca2+ signaling in the networks. In the present study, an unsupervised algorithm based on independent component analysis (ICA) was employed to extract the Ca2+ signals of bone cells in the network. We demonstrated that the ICA-based technology could yield higher signal fidelity than the manual region of interest (ROI) method. Second, the spatiotemporal properties of Ca2+ signaling in osteocyte-like MLO-Y4 and osteoblast-like MC3T3-E1 cell networks under laminar and steady fluid flow stimulation were systematically analyzed and compared. MLO-Y4 cells exhibited much more active Ca2+ transients than MC3T3-E1 cells, evidenced by more Ca2+ peaks, less time to the 1st peak and less time between the 1st and 2nd peaks. With respect to temporal properties, MLO-Y4 cells demonstrated higher spike rate and Ca2+ oscillating frequency. The spatial intercellular synchronous activities of Ca2+ signaling in MLO-Y4 cell networks were higher than those in MC3T3-E1 cell networks and also negatively correlated with the intercellular distance, revealing faster Ca2+ wave propagation in MLO-Y4 cell networks. Our findings show that the unsupervised ICA-based technique results in more sensitive and quantitative signal extraction than traditional ROI analysis, with the potential to be widely employed in Ca2+ signaling extraction in the cell networks. The present study also revealed a dramatic spatiotemporal difference in Ca2+ signaling for osteocytic and osteoblastic cell networks in processing the mechanical stimulus. The higher intracellular Ca2+ oscillatory behaviors and intercellular coordination of MLO-Y4 cells provided further evidences that osteocytes may behave as the major mechanical sensor in bone modeling and remodeling processes. PMID:23328496

  4. Multiple Model-Informed Open-Loop Control of Uncertain Intracellular Signaling Dynamics

    PubMed Central

    Perley, Jeffrey P.; Mikolajczak, Judith; Harrison, Marietta L.; Buzzard, Gregery T.; Rundell, Ann E.


    Computational approaches to tune the activation of intracellular signal transduction pathways both predictably and selectively will enable researchers to explore and interrogate cell biology with unprecedented precision. Techniques to control complex nonlinear systems typically involve the application of control theory to a descriptive mathematical model. For cellular processes, however, measurement assays tend to be too time consuming for real-time feedback control and models offer rough approximations of the biological reality, thus limiting their utility when considered in isolation. We overcome these problems by combining nonlinear model predictive control with a novel adaptive weighting algorithm that blends predictions from multiple models to derive a compromise open-loop control sequence. The proposed strategy uses weight maps to inform the controller of the tendency for models to differ in their ability to accurately reproduce the system dynamics under different experimental perturbations (i.e. control inputs). These maps, which characterize the changing model likelihoods over the admissible control input space, are constructed using preexisting experimental data and used to produce a model-based open-loop control framework. In effect, the proposed method designs a sequence of control inputs that force the signaling dynamics along a predefined temporal response without measurement feedback while mitigating the effects of model uncertainty. We demonstrate this technique on the well-known Erk/MAPK signaling pathway in T cells. In silico assessment demonstrates that this approach successfully reduces target tracking error by 52% or better when compared with single model-based controllers and non-adaptive multiple model-based controllers. In vitro implementation of the proposed approach in Jurkat cells confirms a 63% reduction in tracking error when compared with the best of the single-model controllers. This study provides an experimentally

  5. Multiple model-informed open-loop control of uncertain intracellular signaling dynamics.


    Perley, Jeffrey P; Mikolajczak, Judith; Harrison, Marietta L; Buzzard, Gregery T; Rundell, Ann E


    Computational approaches to tune the activation of intracellular signal transduction pathways both predictably and selectively will enable researchers to explore and interrogate cell biology with unprecedented precision. Techniques to control complex nonlinear systems typically involve the application of control theory to a descriptive mathematical model. For cellular processes, however, measurement assays tend to be too time consuming for real-time feedback control and models offer rough approximations of the biological reality, thus limiting their utility when considered in isolation. We overcome these problems by combining nonlinear model predictive control with a novel adaptive weighting algorithm that blends predictions from multiple models to derive a compromise open-loop control sequence. The proposed strategy uses weight maps to inform the controller of the tendency for models to differ in their ability to accurately reproduce the system dynamics under different experimental perturbations (i.e. control inputs). These maps, which characterize the changing model likelihoods over the admissible control input space, are constructed using preexisting experimental data and used to produce a model-based open-loop control framework. In effect, the proposed method designs a sequence of control inputs that force the signaling dynamics along a predefined temporal response without measurement feedback while mitigating the effects of model uncertainty. We demonstrate this technique on the well-known Erk/MAPK signaling pathway in T cells. In silico assessment demonstrates that this approach successfully reduces target tracking error by 52% or better when compared with single model-based controllers and non-adaptive multiple model-based controllers. In vitro implementation of the proposed approach in Jurkat cells confirms a 63% reduction in tracking error when compared with the best of the single-model controllers. This study provides an experimentally

  6. Are Molecular Vibration Patterns of Cell Structural Elements Used for Intracellular Signalling?

    PubMed Central

    Jaross, Werner


    Background: To date the manner in which information reaches the nucleus on that part within the three-dimensional structure where specific restorative processes of structural components of the cell are required is unknown. The soluble signalling molecules generated in the course of destructive and restorative processes communicate only as needed. Hypothesis: All molecules show temperature-dependent molecular vibration creating a radiation in the infrared region. Each molecule species has in its turn a specific frequency pattern under given specific conditions. Changes in their structural composition result in modified frequency patterns of the molecules in question. The main structural elements of the cell membrane, of the endoplasmic reticulum, of the Golgi apparatus, and of the different microsomes representing the great variety of polar lipids show characteristic frequency patterns with peaks in the region characterised by low water absorption. These structural elements are very dynamic, mainly caused by the creation of signal molecules and transport containers. By means of the characteristic radiation, the area where repair or substitution services are needed could be identified; this spatial information complements the signalling of the soluble signal molecules. Based on their resonance properties receptors located on the outer leaflet of the nuclear envelope should be able to read typical frequencies and pass them into the nucleus. Clearly this physical signalling must be blocked by the cell membrane to obviate the flow of information into adjacent cells. Conclusion: If the hypothesis can be proved experimentally, it should be possible to identify and verify characteristic infrared frequency patterns. The application of these signal frequencies onto cells would open entirely new possibilities in medicine and all biological disciplines specifically to influence cell growth and metabolism. Similar to this intracellular system, an extracellular signalling system

  7. Regulation of Epidermal Growth Factor Receptor Signaling by Endocytosis and Intracellular Trafficking

    SciTech Connect

    Burke, Patrick; Schooler, Kevin; Wiley, H S.


    Ligand activation of the epidermal growth factor receptor (EGFR) leads to its rapid internalization and eventual delivery to lysosomes. This process is thought to be a mechanism to attenuate signaling, but signals could potentially be generated following endocytosis. To directly evaluate EGFR signaling during receptor trafficking, we developed a technique to rapidly and selectively isolate internalized EGFR and associated molecules using reversibly-biotinylated anti-EGFR antibodies. In addition, we developed antibodies specific to tyrosine-phosphorylated EGFR. Using a combination of fluorescence imaging and affinity precipitation approaches, we evaluated the state of EGFR activation and substrate association during trafficking in epithelial cells. We found that following internalization, EGFR remained active in the early endosomes. However, receptors were inactivated prior to degradation, apparently due to ligand removal from endosomes. Adapter molecules, such as Shc, were associated with EGFR both at the cell surface and within endosomes. Some molecules, such as Grb2, were primarily found associated with surface EGFR, while others, such as Eps8, were only found with intracellular receptors. During the inactivation phase, c-Cbl became EGFR-associated, consistent with its postulated role in receptor attenuation. We conclude that the association of the EGFR with different proteins is compartment-specific . In addition, ligand loss is the proximal cause of EGFR inactivation. Thus, regulated trafficking could potentially influence the pattern as well as the duration of signal transduction.

  8. From intracellular signaling to population oscillations: bridging size- and time-scales in collective behavior

    PubMed Central

    Sgro, Allyson E; Schwab, David J; Noorbakhsh, Javad; Mestler, Troy; Mehta, Pankaj; Gregor, Thomas


    Collective behavior in cellular populations is coordinated by biochemical signaling networks within individual cells. Connecting the dynamics of these intracellular networks to the population phenomena they control poses a considerable challenge because of network complexity and our limited knowledge of kinetic parameters. However, from physical systems, we know that behavioral changes in the individual constituents of a collectively behaving system occur in a limited number of well-defined classes, and these can be described using simple models. Here, we apply such an approach to the emergence of collective oscillations in cellular populations of the social amoeba Dictyostelium discoideum. Through direct tests of our model with quantitative in vivo measurements of single-cell and population signaling dynamics, we show how a simple model can effectively describe a complex molecular signaling network at multiple size and temporal scales. The model predicts novel noise-driven single-cell and population-level signaling phenomena that we then experimentally observe. Our results suggest that like physical systems, collective behavior in biology may be universal and described using simple mathematical models. PMID:25617347

  9. Fluoxetine suppresses calcium signaling in human T lymphocytes through depletion of intracellular calcium stores.


    Gobin, V; De Bock, M; Broeckx, B J G; Kiselinova, M; De Spiegelaere, W; Vandekerckhove, L; Van Steendam, K; Leybaert, L; Deforce, D


    Selective serotonin reuptake inhibitors, such as fluoxetine, have recently been shown to exert anti-inflammatory and immunosuppressive effects. Although the effects on cytokine secretion, proliferation and viability of T lymphocytes have been extensively characterized, little is known about the mechanism behind these effects. It is well known that Ca(2+) signaling is an important step in the signaling transduction pathway following T cell receptor activation. Therefore, we investigated if fluoxetine interferes with Ca(2+) signaling in Jurkat T lymphocytes. Fluoxetine was found to suppress Ca(2+) signaling in response to T cell receptor activation. Moreover, fluoxetine was found to deplete intracellular Ca(2+) stores, thereby leaving less Ca(2+) available for release upon IP3- and ryanodine-receptor activation. The Ca(2+)-modifying effects of fluoxetine are not related to its capability to block the serotonin transporter, as even a large excess of 5HT did not abolish the effects. In conclusion, these data show that fluoxetine decreases IP3- and ryanodine-receptor mediated Ca(2+) release in Jurkat T lymphocytes, an effect likely to be at the basis of the observed immunosuppression.

  10. Intracellular localization of human cytidine deaminase. Identification of a functional nuclear localization signal.


    Somasekaram, A; Jarmuz, A; How, A; Scott, J; Navaratnam, N


    The cytidine deaminases belong to the family of multisubunit enzymes that catalyze the hydrolytic deamination of their substrate to a corresponding uracil product. They play a major role in pyrimidine nucleoside and nucleotide salvage. The intracellular distribution of cytidine deaminase and related enzymes has previously been considered to be cytosolic. Here we show that human cytidine deaminase (HCDA) is present in the nucleus. A highly specific, affinity purified polyclonal antibody against HCDA was used to analyze the intracellular localization of native HCDA in a variety of mammalian cells by in situ immunochemistry. Native HCDA was found to be present in the nucleus as well as the cytoplasm in several cell types. Indirect immunofluorescence microscopy indicated a predominantly nuclear localization of FLAG-tagged HCDA overexpressed in these cells. We have identified an amino-terminal bipartite nuclear localization signal that is both necessary and sufficient to direct HCDA and a non-nuclear reporter protein to the nucleus. We also show HCDA binding to the nuclear import receptor, importin alpha. Similar putative bipartite nuclear localization sequences are found in other cytidine/deoxycytidylate deaminases. The results presented here suggest that the pyrimidine nucleotide salvage pathway may operate in the nucleus. This localization may have implications in the regulation of nucleoside and nucleotide metabolism and nucleic acid biosynthesis.

  11. Coupling mechanical forces to electrical signaling: molecular motors and the intracellular transport of ion channels.


    Barry, Joshua; Gu, Chen


    Proper localization of various ion channels is fundamental to neuronal functions, including postsynaptic potential plasticity, dendritic integration, action potential initiation and propagation, and neurotransmitter release. Microtubule-based forward transport mediated by kinesin motors plays a key role in placing ion channel proteins to correct subcellular compartments. PDZ- and coiled-coil-domain proteins function as adaptor proteins linking ionotropic glutamate and GABA receptors to various kinesin motors, respectively. Recent studies show that several voltage-gated ion channel/transporter proteins directly bind to kinesins during forward transport. Three major regulatory mechanisms underlying intracellular transport of ion channels are also revealed. These studies contribute to understanding how mechanical forces are coupled to electrical signaling and illuminating pathogenic mechanisms in neurodegenerative diseases.

  12. The Yeast Retrograde Response as a Model of Intracellular Signaling of Mitochondrial Dysfunction

    PubMed Central

    Jazwinski, S. Michal; Kriete, Andres


    Mitochondrial dysfunction activates intracellular signaling pathways that impact yeast longevity, and the best known of these pathways is the retrograde response. More recently, similar responses have been discerned in other systems, from invertebrates to human cells. However, the identity of the signal transducers is either unknown or apparently diverse, contrasting with the well-established signaling module of the yeast retrograde response. On the other hand, it has become equally clear that several other pathways and processes interact with the retrograde response, embedding it in a network responsive to a variety of cellular states. An examination of this network supports the notion that the master regulator NFκB aggregated a variety of mitochondria-related cellular responses at some point in evolution and has become the retrograde transcription factor. This has significant consequences for how we view some of the deficits associated with aging, such as inflammation. The support for NFκB as the retrograde response transcription factor is not only based on functional analyses. It is bolstered by the fact that NFκB can regulate Myc–Max, which is activated in human cells with dysfunctional mitochondria and impacts cellular metabolism. Myc–Max is homologous to the yeast retrograde response transcription factor Rtg1–Rtg3. Further research will be needed to disentangle the pro-aging from the anti-aging effects of NFκB. Interestingly, this is also a challenge for the complete understanding of the yeast retrograde response. PMID:22629248

  13. Some Factors Affecting Time Reversal Signal Reconstruction

    NASA Astrophysics Data System (ADS)

    Prevorovsky, Z.; Kober, J.

    Time reversal (TR) ultrasonic signal processing is now broadly used in a variety of applications, and also in NDE/NDT field. TR processing is used e.g. for S/N ratio enhancement, reciprocal transducer calibration, location, identification, and reconstruction of unknown sources, etc. TR procedure in con-junction with nonlinear elastic wave spectroscopy NEWS is also useful for sensitive detection of defects (nonlinearity presence). To enlarge possibilities of acoustic emission (AE) method, we proposed the use of TR signal reconstruction ability for detected AE signals transfer from a structure with AE source onto a similar remote model of the structure (real or numerical), which allows easier source analysis under laboratory conditions. Though the TR signal reconstruction is robust regarding the system variations, some small differences and changes influence space-time TR focus and reconstruction quality. Experiments were performed on metallic parts of both simple and complicated geometry to examine effects of small changes of temperature or configuration (body shape, dimensions, transducers placement, etc.) on TR reconstruction quality. Results of experiments are discussed in this paper. Considering mathematical similarity between TR and Coda Wave Interferometry (CWI), prediction of signal reconstruction quality was possible using only the direct propagation. The results show how some factors like temperature or stress changes may deteriorate the TR reconstruction quality. It is also shown that sometimes the reconstruction quality is not enhanced using longer TR signal (S/N ratio may decrease).

  14. Aroclor 1254, a developmental neurotoxicant, alters energy metabolism- and intracellular signaling-associated protein networks in rat cerebellum and hippocampus

    SciTech Connect

    Kodavanti, Prasada Rao S.; Osorio, Cristina; Royland, Joyce E.; Ramabhadran, Ram; Alzate, Oscar


    The vast literature on the mode of action of polychlorinated biphenyls (PCBs) indicates that PCBs are a unique model for understanding the mechanisms of toxicity of environmental mixtures of persistent chemicals. PCBs have been shown to adversely affect psychomotor function and learning and memory in humans. Although the molecular mechanisms for PCB effects are unclear, several studies indicate that the disruption of Ca{sup 2+}-mediated signal transduction plays significant roles in PCB-induced developmental neurotoxicity. Culminating events in signal transduction pathways include the regulation of gene and protein expression, which affects the growth and function of the nervous system. Our previous studies showed changes in gene expression related to signal transduction and neuronal growth. In this study, protein expression following developmental exposure to PCB is examined. Pregnant rats (Long Evans) were dosed with 0.0 or 6.0 mg/kg/day of Aroclor-1254 from gestation day 6 through postnatal day (PND) 21, and the cerebellum and hippocampus from PND14 animals were analyzed to determine Aroclor 1254-induced differential protein expression. Two proteins were found to be differentially expressed in the cerebellum following PCB exposure while 18 proteins were differentially expressed in the hippocampus. These proteins are related to energy metabolism in mitochondria (ATP synthase, sub unit {beta} (ATP5B), creatine kinase, and malate dehydrogenase), calcium signaling (voltage-dependent anion-selective channel protein 1 (VDAC1) and ryanodine receptor type II (RyR2)), and growth of the nervous system (dihydropyrimidinase-related protein 4 (DPYSL4), valosin-containing protein (VCP)). Results suggest that Aroclor 1254-like persistent chemicals may alter energy metabolism and intracellular signaling, which might result in developmental neurotoxicity. -- Highlights: Black-Right-Pointing-Pointer We performed brain proteomic analysis of rats exposed to the neurotoxicant

  15. Functional receptors and intracellular signal pathways of midkine (MK) and pleiotrophin (PTN).


    Xu, Chuanying; Zhu, Shunying; Wu, Mingyuan; Han, Wei; Yu, Yan


    Midkine (MK) and pleiotrophin (PTN) belong to the subfamily of heparin binding growth factors. They have ca. 50% structural homology, with similar C- and N-domains as well as comparable binding affinity to heparin, glycoproteins and proteoglycans. Both MK and PTN have diverse functions, such as mitogenicity, inflammation, angiogenesis, oncogenesis and stem cell self-renewal. The high expression of MK and PTN in many kinds of cancers makes them excellent as cancer biomarkers and targets for anticancer drug development. In addition, the important roles of MK and PTN in the regeneration of tissues, such as myocardium, cartilage, neuron, muscle, and bone, make them attractive candidates for the treatment of degenerative diseases such as myocardiac and cerebral infarction, Alzheimer's disease, Parkinson's disease and skeletal muscle injury. As a result, there has been a growing interest in the mechanisms of MK and PTN function, including the diverse receptors on the cell membrane and complex signal pathways in the cytoplasm. This work reviews the structures of MK and PTN, as well as the receptors and the intracellular signal pathways involving MK and PTN which will pave the way for future development of MK and PTN therapeutics.

  16. Anabolic androgenic steroids and intracellular calcium signaling: a mini review on mechanisms and physiological implications.


    Vicencio, J M; Estrada, M; Galvis, D; Bravo, R; Contreras, A E; Rotter, D; Szabadkai, G; Hill, J A; Rothermel, B A; Jaimovich, E; Lavandero, S


    Increasing evidence suggests that nongenomic effects of testosterone and anabolic androgenic steroids (AAS) operate concertedly with genomic effects. Classically, these responses have been viewed as separate and independent processes, primarily because nongenomic responses are faster and appear to be mediated by membrane androgen receptors, whereas long-term genomic effects are mediated through cytosolic androgen receptors regulating transcriptional activity. Numerous studies have demonstrated increases in intracellular Ca2+ in response to AAS. These Ca2+ mediated responses have been seen in a diversity of cell types, including osteoblasts, platelets, skeletal muscle cells, cardiac myocytes and neurons. The versatility of Ca2+ as a second messenger provides these responses with a vast number of pathophysiological implications. In cardiac cells, testosterone elicits voltage-dependent Ca2+ oscillations and IP3R-mediated Ca2+ release from internal stores, leading to activation of MAPK and mTOR signaling that promotes cardiac hypertrophy. In neurons, depending upon concentration, testosterone can provoke either physiological Ca2+ oscillations, essential for synaptic plasticity, or sustained, pathological Ca2+ transients that lead to neuronal apoptosis. We propose therefore, that Ca2+ acts as an important point of crosstalk between nongenomic and genomic AAS signaling, representing a central regulator that bridges these previously thought to be divergent responses.

  17. Hypoxia Affects Neprilysin Expression Through Caspase Activation and an APP Intracellular Domain-dependent Mechanism

    PubMed Central

    Kerridge, Caroline; Kozlova, Daria I.; Nalivaeva, Natalia N.; Turner, Anthony J.


    While gene mutations in the amyloid precursor protein (APP) and the presenilins lead to an accumulation of the amyloid β-peptide (Aβ) in the brain causing neurodegeneration and familial Alzheimer's disease (AD), over 95% of all AD cases are sporadic. Despite the pathologies being indistinguishable, relatively little is known about the mechanisms affecting generation of Aβ in the sporadic cases. Vascular disorders such as ischaemia and stroke are well established risk factors for the development of neurodegenerative diseases and systemic hypoxic episodes have been shown to increase Aβ production and accumulation. We have previously shown that hypoxia causes a significant decrease in the expression of the major Aβ-degrading enzyme neprilysin (NEP) which might deregulate Aβ clearance. Aβ itself is derived from the transmembrane APP along with several other biologically active metabolites including the C-terminal fragment (CTF) termed the APP intracellular domain (AICD), which regulates the expression of NEP and some other genes in neuronal cells. Here we show that in hypoxia there is a significantly increased expression of caspase-3, 8, and 9 in human neuroblastoma NB7 cells, which can degrade AICD. Using chromatin immunoprecipitation we have revealed that there was also a reduction of AICD bound to the NEP promoter region which underlies the decreased expression and activity of the enzyme under hypoxic conditions. Incubation of the cells with a caspase-3 inhibitor Z-DEVD-FMK could rescue the effect of hypoxia on NEP activity protecting the levels of AICD capable of binding the NEP promoter. These data suggest that activation of caspases might play an important role in regulation of NEP levels in the brain under pathological conditions such as hypoxia and ischaemia leading to a deficit of Aβ clearance and increasing the risk of development of AD. PMID:26617481

  18. Antagonistic and cooperative actions of Kif7 and Sufu define graded intracellular Gli activities in Hedgehog signaling.


    Law, Kelvin King Lo; Makino, Shigeru; Mo, Rong; Zhang, Xiaoyun; Puviindran, Vijitha; Hui, Chi-Chung


    Graded Hedgehog (Hh) signaling governs the balance of Gli transcriptional activators and repressors to specify diverse ventral cell fates in the spinal cord. It remains unclear how distinct intracellular Gli activity is generated. Here, we demonstrate that Sufu acts universally as a negative regulator of Hh signaling, whereas Kif7 inhibits Gli activity in cooperation with, and independent of, Sufu. Together, they deter naïve precursors from acquiring increasingly ventral identity. We show that Kif7 is also required to establish high intracellular Gli activity by antagonizing the Sufu-inhibition of Gli2. Strikingly, by abolishing the negative regulatory action of Sufu, diverse ventral cell fates can be specified in the absence of extracellular Hh signaling. These data suggest that Sufu is the primary regulator of graded Hh signaling and establish that the antagonistic and cooperative actions of Kif7 and Sufu are responsible for setting up distinct Gli activity in ventral cell fate specification.

  19. Regulation of Notch1 signaling by the APP intracellular domain facilitates degradation of the Notch1 intracellular domain and RBP-Jk.


    Kim, Mi-Yeon; Mo, Jung-Soon; Ann, Eun-Jung; Yoon, Ji-Hye; Jung, Jane; Choi, Yun-Hee; Kim, Su-Man; Kim, Hwa-Young; Ahn, Ji-Seon; Kim, Hangun; Kim, Kwonseop; Hoe, Hyang-Sook; Park, Hee-Sae


    The Notch1 receptor is a crucial controller of cell fate decisions, and is also a key regulator of cell growth and differentiation in a variety of contexts. In this study, we have demonstrated that the APP intracellular domain (AICD) attenuates Notch1 signaling by accelerated degradation of the Notch1 intracellular domain (Notch1-IC) and RBP-Jk, through different degradation pathways. AICD suppresses Notch1 transcriptional activity by the dissociation of the Notch1-IC-RBP-Jk complex after processing by γ-secretase. Notch1-IC is capable of forming a trimeric complex with Fbw7 and AICD, and AICD enhances the protein degradation of Notch1-IC through an Fbw7-dependent proteasomal pathway. AICD downregulates the levels of RBP-Jk protein through the lysosomal pathway. AICD-mediated degradation is involved in the preferential degradation of non-phosphorylated RBP-Jk. Collectively, our results demonstrate that AICD functions as a negative regulator in Notch1 signaling through the promotion of Notch1-IC and RBP-Jk protein degradation.

  20. Calcium inhibition as an intracellular signal for actin–myosin interaction

    PubMed Central

    KOHAMA, Kazuhiro


    Intracellular signaling pathways include both the activation and the inhibition of biological processes. The activation of Ca2+ regulation of actin-myosin interactions was examined first, whereas it took 20 years for the author to clarify the inhibitory mode by using Physarum polycephalum, a lower eukaryote. This review describes the investigation of the inhibitory mode since 1980. The inhibitory effect of Ca2+ on myosin was detected chemically by ATPase assays and mechanically by in vitro motility assays. The Ca2+-binding ability of Physarum myosin is as high as that of scallop myosin. Ca2+ inhibits Physarum myosin, whereas it activates scallop myosin. We cloned cDNA of the myosin heavy chain and light chains to express a hybrid of Physarum and scallop myosin, and found that the Ca-binding light chain (CaLc), which belongs to an alkali light chain class, plays a major role in Ca inhibition. The role of CaLc was confirmed by mutating its EF-hand, Ca-binding structure and expressing Physarum myosin as a recombinant protein. Thus, the data obtained by classical protein purification were confirmed by the results obtained with the modern recombinant techniques. However, there are some discrepancies that remain to be solved as described in Section XII. PMID:27941307

  1. Enhanced intracellular signaling pathway in osteoblasts on ultraviolet lighttreated hydrophilic titanium.


    Iwasa, Fuminori; Baba, Kazuyoshi; Ogawa, Takahiro


    Ultraviolet (UV) light treatment of titanium immediately prior to use, or photofunctionalization, reactivates the time-dependent degradation of bioactivity of titanium (biological aging of titanium) and increases its osseointegration capacity beyond the inherent maximal level. Although the initial osteoblast attachment is reportedly enhanced on UV-treated titanium surfaces, the detailed mechanism behind the increase in osseointegration is unknown. This study examined the potential modulation of intracellular signaling pathway in osteoblasts on UV-treated titanium surfaces. Rat bone marrow-derived osteoblasts were cultured on 4-week-old, new, and UV-treated titanium surfaces. The new and UV-treated surfaces were superhydrophilic, whereas the 4-week-old surface was hydrophobic. Although the rate of protein adsorption was similarly increased on the new and UV-treated surfaces compared with the 4-week-old surface, the number of attached cells and their spreading behavior were further enhanced on the UV-treated surface. This additional enhancement was associated with the remarkably upregulated expression of paxillin and phospho-paxillin and exclusive upregulation of Rho GTPase family genes. This study provides with the first molecular evidence of the enhanced initial behavior of osteoblasts on UV-treated titanium surfaces. The enhancement was accentuated and distinct from the new titanium surface with similar hydrophilicity, suggesting that surface properties other than the level of hydrophilicity are responsible.

  2. Stress Induces a Switch of Intracellular Signaling in Sensory Neurons in a Model of Generalized Pain

    PubMed Central

    Khasar, Sachia G.; Burkham, Jennifer; Dina, Olayinka A.; Brown, Adrienne S.; Bogen, Oliver; Alessandri-Haber, Nicole; Green, Paul G.; Reichling, David B.; Levine, Jon D.


    Stress dramatically exacerbates pain in diseases such as fibromyalgia and rheumatoid arthritis, but the underlying mechanisms are unknown. We tested the hypothesis that stress causes generalized hyperalgesia by enhancing pro-nociceptive effects of immune mediators. Rats exposed to non-habituating sound stress exhibited no change in mechanical nociceptive threshold, but showed a marked increase in hyperalgesia evoked by local injections of prostaglandin E2 or epinephrine. This enhancement, which developed more than a week after exposure to stress, required concerted action of glucocorticoids and catecholamines at receptors located in the periphery on sensory afferents. The altered response to pronociceptive mediators involved a switch in coupling of their receptors from predominantly stimulatory to inhibitory G-proteins (Gs to Gi), and for prostaglandin E2, emergence of novel dependence on protein kinase C epsilon. Thus, an important mechanism in generalized pain syndromes may be stress-induced co-activation of the hypothalmo-pituitary-adrenal and sympatho-adrenal axes, causing a long-lasting alteration in intracellular signaling pathways, enabling normally innocuous levels of immune mediators to produce chronic hyperalgesia. PMID:18509033

  3. Intracellular TCR-signaling pathway: novel markers for lymphoma diagnosis and potential therapeutic targets.


    Agostinelli, Claudio; Rizvi, Hasan; Paterson, Jennifer; Shende, Vishvesh; Akarca, Ayse U; Agostini, Elena; Fuligni, Fabio; Righi, Simona; Spagnolo, Sebastiano; Piccaluga, Pier Paolo; Clark, Edward A; Pileri, Stefano A; Marafioti, Teresa


    Despite the immunologic functions of T-cell receptor signaling molecules being extensively investigated, their potential as immunohistochemical markers has been poorly explored. With this background, we evaluated the expression of 5 intracellular proteins-GADS, DOK2, SKAP55, ITK, and PKCα-involved in T-cell receptor signaling in normal and neoplastic hematologic tissue samples, using antibodies raised against fixation-resistant epitopes of the 5 molecules. All 5 antibodies were associated with normal T-cell differentiation. GADS, DOK2, SKAP55, and ITK turned out to be T-cell lineage-specific markers in the setting of lymphoid and myeloid precursor neoplasms but showed differential expression in peripheral T-cell lymphoma (PTCL) subtypes, being detected in PTCL/not otherwise specified (NOS) and angioimmunoblastic T-cell lymphoma but negative in anaplastic large cell lymphoma (ALCL). Peripheral B-cell lymphomas were consistently negative for ITK, with occasional cases showing expression of DOK2 and SKAP55, and a proportion (47%) of hairy cell leukemias were GADS. Notably, PKCα highlighted a defective antigen in both PTCL/NOS (6%) and angioimmunoblastic T-cell lymphoma (10%), mostly negative in ALCL, and was aberrantly expressed in classical Hodgkin lymphoma (65%), Burkitt lymphoma (48%), and plasma cell myeloma (48%). In conclusion, all five molecules evaluated play a role in T-cell differentiation in normal and neoplastic tissues. They can be applied confidently to routine sections contributing primarily to assignment of T-lineage differentiation in the setting of hematopoietic precursor neoplasms (GADS/DOK2/SKAP55/ITK) and for the differential diagnosis between ALCL and PTCL/NOS (GADS/DOK2/SKAP55/ITK) or classical Hodgkin lymphoma (PKCα). Finally, association with specific tumor subtypes may have therapeutic potential.

  4. Methoxychlor and Vinclozolin Induce Rapid Changes in Intercellular and Intracellular Signaling in Liver Progenitor Cells.


    Babica, Pavel; Zurabian, Rimma; Kumar, Esha R; Chopra, Rajus; Mianecki, Maxwell J; Park, Joon-Suk; Jaša, Libor; Trosko, James E; Upham, Brad L


    Methoxychlor (MXC) and vinclozolin (VIN) are well-recognized endocrine disrupting chemicals known to alter epigenetic regulations and transgenerational inheritance; however, non-endocrine disruption endpoints are also important. Thus, we determined the effects of MXC and VIN on the dysregulation of gap junctional intercellular communication (GJIC) and activation of mitogen-activated protein kinases (MAPKs) in WB-F344 rat liver epithelial cells. Both chemicals induced a rapid dysregulation of GJIC at non-cytotoxic doses, with 30 min EC50 values for GJIC inhibition being 10 µM for MXC and 126 µM for VIN. MXC inhibited GJIC for at least 24 h, while VIN effects were transient and GJIC recovered after 4 h. VIN induced rapid hyperphosphorylation and internalization of gap junction protein connexin43, and both chemicals also activated MAPK ERK1/2 and p38. Effects on GJIC were not prevented by MEK1/2 inhibitor, but by an inhibitor of phosphatidylcholine-specific phospholipase C (PC-PLC), resveratrol, and in the case of VIN, also, by a p38 inhibitor. Estrogen (ER) and androgen receptor (AR) modulators (estradiol, ICI 182,780, HPTE, testosterone, flutamide, VIN M2) did not attenuate MXC or VIN effects on GJIC. Our data also indicate that the effects were elicited by the parental compounds of MXC and VIN. Our study provides new evidence that MXC and VIN dysregulate GJIC via mechanisms involving rapid activation of PC-PLC occurring independently of ER- or AR-dependent genomic signaling. Such alterations of rapid intercellular and intracellular signaling events involved in regulations of gene expression, tissue development, function and homeostasis, could also contribute to transgenerational epigenetic effects of endocrine disruptors.

  5. Intracellular Ca2+ signals in human-derived pancreatic somatostatin-secreting cells (QGP-1N).


    Squires, P E; Amiranoff, B; Dunne, M J


    Single-cell microfluorimetry techniques have been used to examine the effects of acetylcholine (0.1-100 microM) on the intracellular free calcium ion concentration ([Ca2+]i) in a human-derived pancreatic somatostatin-secreting cell line, QGP-1N. When applied to the bath solution, acetylcholine was found to evoke a marked and rapid increase in [Ca2+]i at all concentrations tested. These responses were either sustained, or associated with the generation of complex patterns of [Ca2+]i transients. Overall, the pattern of response was concentration related. In general, 0.1-10 microM acetylcholine initiated a series of repetitive oscillations in cytoplasmic Ca2+, whilst at higher concentrations the responses consisted of a rapid rise in [Ca2+]i followed by a smaller more sustained increase. Without external Ca2+, 100 microM acetylcholine caused only a transient rise in [Ca2+]i, whereas lower concentrations of the agonist were able to initiate, but not maintain, [Ca2+]i oscillations. Acetylcholine-evoked Ca2+ signals were abolished by atropine (1-10 microM), verapamil (100 microM) and caffeine (20 mM). Nifedipine failed to have any significant effect upon agonist-evoked increases in [Ca2+]i, whilst 50 mM KCl, used to depolarise the cell membrane, only elicited a transient increase in [Ca2+]i. Ryanodine (50-500 nM) and caffeine (1-20 mM) did not increase basal Ca2+ levels, but the Ca(2+)-ATPase inhibitors 2,5-di(tert-butyl)-hydroquinone (TBQ) and thapsigargin both elevated [Ca2+]i levels. These data demonstrate for the first time cytosolic Ca2+ signals in single isolated somatostatin-secreting cells of the pancreas. We have demonstrated that acetylcholine will evoke both Ca2+ influx and Ca2+ mobilisation, and we have partially addressed the subcellular mechanism responsible for these events.

  6. Intracellular sodium affects ouabain interaction with the Na/K pump in cultured chick cardiac myocytes

    PubMed Central


    Whether a given dose of ouabain will produce inotropic or toxic effects depends on factors that affect the apparent affinity (K0.5) of the Na/K pump for ouabain. To accurately resolve these factors, especially the effect of intracellular Na concentration (Nai), we have applied three complementary techniques for measuring the K0.5 for ouabain in cultured embryonic chick cardiac myocytes. Under control conditions with 5.4 mM Ko, the value of the K0.5 for ouabain was 20.6 +/- 1.2, 12.3 +/- 1.7, and 6.6 +/- 0.4 microM, measured by voltage-clamp, Na-selective microelectrode, and equilibrium [3H]ouabain-binding techniques, respectively. A significant difference in the three techniques was the time of exposure to ouabain (30 s-30 min). Since increased duration of exposure to ouabain would increase Nai, monensin was used to raise Nai to investigate what effect Nai might have on the apparent affinity of block by ouabain. Monensin enhanced the rise in Na content induced by 1 microM ouabain. In the presence of 1 microM [3H]ouabain, total binding was found to be a saturating function of Na content. Using the voltage- clamp method, we found that the value of the K0.5 for ouabain was lowered by nearly an order of magnitude in the presence of 3 microM monensin to 2.4 +/- 0.2 microM and the magnitude of the Na/K pump current was increased about threefold. Modeling the Na/K pump as a cyclic sequence of states with a single state having high affinity for ouabain shows that changes in Nai alone are sufficient to cause a 10- fold change in K0.5. These results suggest that Nai reduces the value of the apparent affinity of the Na/K pump for ouabain in 5.4 mM Ko by increasing its turnover rate, thus increasing the availability of the conformation of the Na/K pump that binds ouabain with high affinity. PMID:2299333

  7. [A role of some intracellular signaling cascades in planarian regeneration activated under irradiation with low-temperature argon plasma].


    Ermakov, A M; Ermakova, O N; Maevskiĭ, E I


    Using inhibitory analysis the role of some intracellular signaling pathways in activation of planarian regeneration under the influence of low-temperature argon plasma (LTAP) has been investigated. Inactivation of specific inhibitors of intracellular signaling enzymes such as the receptor tyrosine kinase (EGFR), TGF β receptor, calmodulin, adenylate cyclase, phospholipase A2, phospholipase C, cyclin-dependent protein kinase, JAK2-protein kinase, JNK-protein kinase MEK-protein kinase led to inhibition of the head growth during its regeneration in planarians. Pretreatment with LTAP irradiation provided no inhibitory action of some cascades regulating proliferation. However, the inhibitors of the key regulators of regeneration: TGF β receptor, calmodulin and MEK-protein kinase completely suppressed the activating effect of plasma. Thus, by the example of regenerating planarians it is shown, that biological activity of low-temperature argon plasma LTAP is caused by modulation of a plurality of cellular signaling systems.

  8. Recombinant differential anchorage probes that tower over the spatial dimension of intracellular signals for high content screening and analysis.


    Schembri, Laura; Zanese, Marion; Depierre-Plinet, Gaelle; Petit, Muriel; Elkaoukabi-Chaibi, Assia; Tauzin, Loic; Florean, Cristina; Lartigue, Lydia; Medina, Chantal; Rey, Christophe; Belloc, Francis; Reiffers, Josy; Ichas, François; De Giorgi, Francesca


    Recombinant fluorescent probes allow the detection of molecular events inside living cells. Many of them exploit the intracellular space to provide positional signals and, thus, require detection by single cell imaging. We describe here a novel strategy based on probes capable of encoding the spatial dimension of intracellular signals into "all-or-none" fluorescence intensity changes (differential anchorage probes, DAPs). The resulting signals can be acquired in single cells at high throughput by automated flow cytometry, (i) bypassing image acquisition and analysis, (ii) providing a direct quantitative readout, and (iii) allowing the exploration of large experimental series. We illustrate our purpose with DAPs for Bax and the effector caspases 3 and 7, which are keys players in apoptotic cell death, and show applications in basic research, high content multiplexed library screening, compound characterization, and drug profiling.

  9. Curcumin improves intestinal barrier function: modulation of intracellular signaling, and organization of tight junctions.


    Wang, Jing; Ghosh, Siddhartha S; Ghosh, Shobha


    Association between circulating lipopolysaccharide (LPS) and metabolic diseases (such as type 2 diabetes and atherosclerosis) has shifted the focus from high-fat high-cholesterol containing Western-type diet (WD)-induced changes in gut microbiota per se to release of gut bacteria-derived products (e.g., LPS) into circulation due to intestinal barrier dysfunction as the possible mechanism for the chronic inflammatory state underlying the development of these diseases. We demonstrated earlier that oral supplementation with curcumin attenuates WD-induced development of type 2 diabetes and atherosclerosis. Poor bioavailability of curcumin has precluded the establishment of a causal relationship between oral supplementation and it is in vivo effects. We hypothesized that curcumin attenuates WD-induced chronic inflammation and associated metabolic diseases by modulating the function of intestinal epithelial cells (IECs) and the intestinal barrier function. The objective of the present study was to delineate the underlying mechanisms. The human IEC lines Caco-2 and HT-29 were used for these studies and modulation of direct as well as indirect effects of LPS on intracellular signaling as well as tight junctions were examined. Pretreatment with curcumin significantly attenuated LPS-induced secretion of master cytokine IL-1β from IECs and macrophages. Furthermore, curcumin also reduced IL-1β-induced activation of p38 MAPK in IECs and subsequent increase in expression of myosin light chain kinase involved in the phosphorylation of tight junction proteins and ensuing disruption of their normal arrangement. The major site of action of curcumin is, therefore, likely the IECs and the intestinal barrier, and by reducing intestinal barrier dysfunction, curcumin modulates chronic inflammatory diseases despite poor bioavailability.

  10. The role of cAMP-mediated intracellular signaling in regulating Na+ uptake in zebrafish larvae

    PubMed Central

    Kumai, Yusuke; Kwong, Raymond W. M.


    In the current study, the role of cAMP in stimulating Na+ uptake in larval zebrafish was investigated. Treating larvae at 4 days postfertilization (dpf) with 10 μM forskolin or 1 μM 8-bromo cAMP significantly increased Na+ uptake by three-fold and twofold, respectively. The cAMP-dependent stimulation of Na+ uptake was probably unrelated to protein trafficking via microtubules because pretreatment with 200 μM colchicine or 30 μM nocodazole did not attenuate the magnitude of the response. Na+ uptake was stimulated markedly following acute (2 h) exposure to acidic water. The acid-induced increase in Na+ uptake was accompanied by a twofold elevation in whole body cAMP levels and attenuated by inhibiting PKA with 10 μM H-89. Knockdown of Na+-H+ exchanger 3b (NHE3b) attenuated, but did not abolish, the stimulation of Na+ uptake during forskolin treatment. In glial cell missing 2 morphants, in which the role of NHE3b in Na+ uptake is diminished and the Na+-Cl− cotransporter (NCC) becomes the predominant route of Na+ entry, forskolin treatment continued to increase Na+ uptake. These data suggest that at least NHE3b and NCC are targeted by cAMP in zebrafish larvae. Staining of larvae with fluorescent forskolin and propranolol revealed the presence of transmembrane adenylyl cyclase within multiple subtypes of ionocytes expressing β-adrenergic receptors. Taken together, results of the present study demonstrate that cAMP-mediated intracellular signaling may regulate multiple Na+ transporters and plays an important role in regulating Na+ uptake in zebrafish larvae during acute exposure to an acidic environment. PMID:24259461

  11. Moderate increases in intracellular calcium activate neuroprotective signals in hippocampal neurons.


    Bickler, P E; Fahlman, C S


    Although large increases in neuronal intracellular calcium concentrations ([Ca(2+)](i)) are lethal, moderate increases in [Ca(2+)](i) of 50-200 nM may induce immediate or long-term tolerance of ischemia or other stresses. In neurons in rat hippocampal slice cultures, we determined the relationship between [Ca(2+)](i), cell death, and Ca(2+)-dependent neuroprotective signals before and after a 45 min period of oxygen and glucose deprivation (OGD). Thirty minutes before OGD, [Ca(2+)](i) was increased in CA1 neurons by 40-200 nM with 1 nM-1 microM of a Ca(2+)-selective ionophore (calcimycin or ionomycin-"Ca(2+) preconditioning"). Ca(2+) preconditioning greatly reduced cell death in CA1, CA3 and dentate during the following 7 days, even though [Ca(2+)](i) was similar (approximately 2 microM) in preconditioned and control neurons 1 h after the OGD. When pre-OGD [Ca(2+)](i) was lowered to 25 nM (10 nM ionophore in Ca(2+)-free medium) or increased to 8 microM (10 microM ionophore), more than 90% of neurons died. Increased levels of the anti-apoptotic protein protein kinase B (Akt) and the MAP kinase ERK (p42/44) were present in preconditioned slices after OGD. Reducing Ca(2+) influx, inhibiting calmodulin, and preventing Akt or MAP kinase p42/44 upregulation prevented Ca(2+) preconditioning, supporting a specific role for Ca(2+) in the neuroprotective process. Further, in continuously oxygenated cultured hippocampal/cortical neurons, preconditioning for 30 min with 10 nM ionomycin reduced cell death following a 4 microM increase in [Ca(2+)](i) elicited by 1 microM ionomycin. Thus, a zone of moderately increased [Ca(2+)](i) before a potentially lethal insult promotes cell survival, uncoupling subsequent large increases in [Ca(2+)](i) from initiating cell death processes.

  12. Altered intracellular signaling cascades in peripheral blood mononuclear cells from BD patients.


    Barbosa, Izabela Guimarães; Nogueira, Camila R C; Rocha, Natália Pessoa; Queiroz, Ana Luiza Lemos; Vago, Juliana Priscila; Tavares, Luciana Pádua; Assis, Frankcinéia; Fagundes, Caio Tavares; Huguet, Rodrigo Barreto; Bauer, Moisés Evandro; Teixeira, Antônio Lúcio; de Sousa, Lirlândia Pires


    Bipolar disorder (BD) is a severe psychiatric disorder of complex physiopathology that has been associated with a pro-inflammatory state. The aim of the present study was to investigate intracellular pathways associated with inflammatory signaling, assessing the phosphorylation levels of transcription factor nuclear factor kappa B (NF-κB) and mitogen-activated protein kinase (MAPKs) in peripheral blood mononuclear cells of euthymic BD patients and healthy controls. Fifteen BD euthymic type I patients, and 12 healthy controls matched by age and gender were enrolled in this study. All subjects were assessed by the Mini-International Neuropsychiatry Interview and the patients also by the Young Mania Rating Scale and the Hamilton Depression Rating Scale. Phosphorylation levels of p65 NF-κB subunit, and MAPK ERK1/2, and p38 were assessed by Western blot and flow cytometry. Plasma cytokines (IL-2, IL-4, IL6, IL-10, IFN-γ, TNF-α, and IL-17A) were measured using cytometric bead arrays. Western blot and flow cytometry analyses showed increased phosphorylation levels of p65 NF-κB subunit, and MAPKs ERK1/2, and p38 in BD patients in euthymia in comparison with controls. BD patients presented increased pro-inflammatory cytokines levels in comparison with controls, and TNF-α correlated with the levels of phosphorylated p65 NF-κB. The present study found increased activation of MAPK and NF-κB pathways in BD patients, which is in line with a pro-inflammatory status.

  13. New Verapamil Analogs Inhibit Intracellular Mycobacteria without Affecting the Functions of Mycobacterium-Specific T Cells.


    Abate, Getahun; Ruminiski, Peter G; Kumar, Malkeet; Singh, Kawaljit; Hamzabegovic, Fahreta; Hoft, Daniel F; Eickhoff, Christopher S; Selimovic, Asmir; Campbell, Mary; Chibale, Kelly


    There is a growing interest in repurposing mycobacterial efflux pump inhibitors, such as verapamil, for tuberculosis (TB) treatment. To aid in the design of better analogs, we studied the effects of verapamil on macrophages and Mycobacterium tuberculosis-specific T cells. Macrophage activation was evaluated by measuring levels of nitric oxide, tumor necrosis factor alpha (TNF-α), interleukin-1 beta (IL-1β), and gamma interferon (IFN-γ). Since verapamil is a known autophagy inducer, the roles of autophagy induction in the antimycobacterial activities of verapamil and norverapamil were studied using bone marrow-derived macrophages from ATG5(flox/flox) (control) and ATG5(flox/flox) Lyz-Cre mice. Our results showed that despite the well-recognized effects of verapamil on calcium channels and autophagy, its action on intracellular M. tuberculosis does not involve macrophage activation or autophagy induction. Next, the effects of verapamil and norverapamil on M. tuberculosis-specific T cells were assessed using flow cytometry following the stimulation of peripheral blood mononuclear cells from TB-skin-test-positive donors with M. tuberculosis whole-cell lysate for 7 days in the presence or absence of drugs. We found that verapamil and norverapamil inhibit the expansion of M. tuberculosis-specific T cells. Additionally, three new verapamil analogs were found to inhibit intracellular Mycobacterium bovis BCG, and one of the three analogs (KSV21) inhibited intracellular M. tuberculosis replication at concentrations that did not inhibit M. tuberculosis-specific T cell expansion. KSV21 also inhibited mycobacterial efflux pumps to the same degree as verapamil. More interestingly, the new analog enhances the inhibitory activities of isoniazid and rifampin on intracellular M. tuberculosis. In conclusion, KSV21 is a promising verapamil analog on which to base structure-activity relationship studies aimed at identifying more effective analogs.

  14. New Verapamil Analogs Inhibit Intracellular Mycobacteria without Affecting the Functions of Mycobacterium-Specific T Cells

    PubMed Central

    Ruminiski, Peter G.; Kumar, Malkeet; Singh, Kawaljit; Hamzabegovic, Fahreta; Hoft, Daniel F.; Eickhoff, Christopher S.; Selimovic, Asmir; Campbell, Mary; Chibale, Kelly


    There is a growing interest in repurposing mycobacterial efflux pump inhibitors, such as verapamil, for tuberculosis (TB) treatment. To aid in the design of better analogs, we studied the effects of verapamil on macrophages and Mycobacterium tuberculosis-specific T cells. Macrophage activation was evaluated by measuring levels of nitric oxide, tumor necrosis factor alpha (TNF-α), interleukin-1 beta (IL-1β), and gamma interferon (IFN-γ). Since verapamil is a known autophagy inducer, the roles of autophagy induction in the antimycobacterial activities of verapamil and norverapamil were studied using bone marrow-derived macrophages from ATG5flox/flox (control) and ATG5flox/flox Lyz-Cre mice. Our results showed that despite the well-recognized effects of verapamil on calcium channels and autophagy, its action on intracellular M. tuberculosis does not involve macrophage activation or autophagy induction. Next, the effects of verapamil and norverapamil on M. tuberculosis-specific T cells were assessed using flow cytometry following the stimulation of peripheral blood mononuclear cells from TB-skin-test-positive donors with M. tuberculosis whole-cell lysate for 7 days in the presence or absence of drugs. We found that verapamil and norverapamil inhibit the expansion of M. tuberculosis-specific T cells. Additionally, three new verapamil analogs were found to inhibit intracellular Mycobacterium bovis BCG, and one of the three analogs (KSV21) inhibited intracellular M. tuberculosis replication at concentrations that did not inhibit M. tuberculosis-specific T cell expansion. KSV21 also inhibited mycobacterial efflux pumps to the same degree as verapamil. More interestingly, the new analog enhances the inhibitory activities of isoniazid and rifampin on intracellular M. tuberculosis. In conclusion, KSV21 is a promising verapamil analog on which to base structure-activity relationship studies aimed at identifying more effective analogs. PMID:26643325

  15. The Molecular Basis of Toxins’ Interactions with Intracellular Signaling via Discrete Portals

    PubMed Central

    Lahiani, Adi; Yavin, Ephraim; Lazarovici, Philip


    An understanding of the molecular mechanisms by which microbial, plant or animal-secreted toxins exert their action provides the most important element for assessment of human health risks and opens new insights into therapies addressing a plethora of pathologies, ranging from neurological disorders to cancer, using toxinomimetic agents. Recently, molecular and cellular biology dissecting tools have provided a wealth of information on the action of these diverse toxins, yet, an integrated framework to explain their selective toxicity is still lacking. In this review, specific examples of different toxins are emphasized to illustrate the fundamental mechanisms of toxicity at different biochemical, molecular and cellular- levels with particular consideration for the nervous system. The target of primary action has been highlighted and operationally classified into 13 sub-categories. Selected examples of toxins were assigned to each target category, denominated as portal, and the modulation of the different portal’s signaling was featured. The first portal encompasses the plasma membrane lipid domains, which give rise to pores when challenged for example with pardaxin, a fish toxin, or is subject to degradation when enzymes of lipid metabolism such as phospholipases A2 (PLA2) or phospholipase C (PLC) act upon it. Several major portals consist of ion channels, pumps, transporters and ligand gated ionotropic receptors which many toxins act on, disturbing the intracellular ion homeostasis. Another group of portals consists of G-protein-coupled and tyrosine kinase receptors that, upon interaction with discrete toxins, alter second messengers towards pathological levels. Lastly, subcellular organelles such as mitochondria, nucleus, protein- and RNA-synthesis machineries, cytoskeletal networks and exocytic vesicles are also portals targeted and deregulated by other diverse group of toxins. A fundamental concept can be drawn from these seemingly different toxins with

  16. The Molecular Basis of Toxins' Interactions with Intracellular Signaling via Discrete Portals.


    Lahiani, Adi; Yavin, Ephraim; Lazarovici, Philip


    An understanding of the molecular mechanisms by which microbial, plant or animal-secreted toxins exert their action provides the most important element for assessment of human health risks and opens new insights into therapies addressing a plethora of pathologies, ranging from neurological disorders to cancer, using toxinomimetic agents. Recently, molecular and cellular biology dissecting tools have provided a wealth of information on the action of these diverse toxins, yet, an integrated framework to explain their selective toxicity is still lacking. In this review, specific examples of different toxins are emphasized to illustrate the fundamental mechanisms of toxicity at different biochemical, molecular and cellular- levels with particular consideration for the nervous system. The target of primary action has been highlighted and operationally classified into 13 sub-categories. Selected examples of toxins were assigned to each target category, denominated as portal, and the modulation of the different portal's signaling was featured. The first portal encompasses the plasma membrane lipid domains, which give rise to pores when challenged for example with pardaxin, a fish toxin, or is subject to degradation when enzymes of lipid metabolism such as phospholipases A₂ (PLA₂) or phospholipase C (PLC) act upon it. Several major portals consist of ion channels, pumps, transporters and ligand gated ionotropic receptors which many toxins act on, disturbing the intracellular ion homeostasis. Another group of portals consists of G-protein-coupled and tyrosine kinase receptors that, upon interaction with discrete toxins, alter second messengers towards pathological levels. Lastly, subcellular organelles such as mitochondria, nucleus, protein- and RNA-synthesis machineries, cytoskeletal networks and exocytic vesicles are also portals targeted and deregulated by other diverse group of toxins. A fundamental concept can be drawn from these seemingly different toxins with

  17. Intracellular calcium promotes radioresistance of non-small cell lung cancer A549 cells through activating Akt signaling.


    Wang, Yiling; He, Jiantao; Zhang, Shenghui; Yang, Qingbo


    Radiotherapy is a major therapeutic approach in non-small cell lung cancer but is restricted by radioresistance. Although Akt signaling promotes radioresistance in non-small cell lung cancer, it is not well understood how Akt signaling is activated. Since intracellular calcium (Ca(2+)) could activate Akt in A549 cells, we investigated the relationship between intracellular calcium (Ca(2+)) and Akt signaling in radioresistant A549 cells by establishing radioresistant non-small cell lung cancer A549 cells. The radioresistant cell line A549 was generated by dose-gradient irradiation of the parental A549 cells. The cell viability, proliferation, and apoptosis were, respectively, assessed using the cell counting kit-8, EdU labeling, and flow cytometry analysis. The phosphorylation of Akt was evaluated by Western blotting, and the intracellular Ca(2+) concentration was assessed by Fluo 4-AM. The radioresistant A549 cells displayed mesenchymal morphology. After additional irradiation, the radioresistant A549 cells showed decreased cell viability and proliferation but increased apoptosis. Moreover, the intracellular Ca(2+) concentration and the phosphorylation level on the Akt473 site in radioresistant A549 cells were higher than those in original cells, whereas the percentage of apoptosis in radioresistant A549 cells was less. All these results could be reversed by verapamil. In conclusion, our study found that intracellular Ca(2+) could promote radioresistance of non-small cell lung cancer cells through phosphorylating of Akt on the 473 site, which contributes to a better understanding on the non-small cell lung cancer radioresistance, and may provide a new target for radioresistance management.

  18. Structurally similar estradiol analogs uniquely alter the regulation of intracellular signaling pathways.


    Yarger, James G; Babine, Robert E; Bittner, Michael; Shanle, Erin; Xu, Wei; Hershberger, Pamela; Nye, Steven H


    Ligand structure can affect the activation of nuclear receptors, such as estrogen receptors (ERs), and their control of signaling pathways for cellular responses including death and differentiation. We hypothesized that distinct biological functions of similar estradiol (E(2)) analogs could be identified by integrating gene expression patterns obtained from human tumor cell lines with receptor binding and functional data for the purpose of developing compounds for treatment of a variety of diseases. We compared the estrogen receptor subtype selectivity and impact on signaling pathways for three distinct, but structurally similar, analogs of E(2). Modifications in the core structure of E(2) led to pronounced changes in subtype selectivity for estrogen receptors, ER-α or ER-β, along with varying degrees of ER dimerization and activation. While all three E(2) analogs are predominantly ER-β agonists, the cell growth inhibitory activity commonly associated with this class of compounds was detected for only two of the analogs and might be explained by a ligand-specific pattern of gene transcription. Microarray studies using three different human tumor cell lines demonstrated that the analogs distinctly affect the transcription of genes in signaling pathways for chromosome replication, cell death, and oligodendrocyte progenitor cell differentiation. That the E(2) analogs could lower tumor cell viability and stimulate neuronal differentiation confirmed that gene expression data could accurately distinguish biological activity of the E(2) analogs. The findings reported here confirm that cellular responses can be regulated by making key structural alterations to the core structure of endogenous ER ligands.

  19. Tollip, an intracellular trafficking protein, is a novel modulator of the transforming growth factor-β signaling pathway.


    Zhu, Lu; Wang, Lingdi; Luo, Xiaolin; Zhang, Yongxian; Ding, Qiurong; Jiang, Xiaomeng; Wang, Xiao; Pan, Yi; Chen, Yan


    Upon activation, TGF-β type I receptor (TβRI) undergoes active ubiquitination via recruitment of E3 ligases to the receptor complex by Smad7. However, how ubiquitination of TβRI is coupled to intracellular trafficking, and protein degradation remains unclear. We report here that Tollip, an adaptor protein that contains both ubiquitin-associated domains and endosome-targeting domain, plays an important role in modulating trafficking and degradation of TβRI. Tollip was previously demonstrated to possess a functional role in modulating the signaling of interleukin-1 and Toll-like receptors. We identify here that Tollip interacts with Smad7, a major modulatory protein involved in the negative regulation of TGF-β signaling. Overexpression of Tollip antagonizes TGF-β-stimulated transcriptional response, Smad2 phosphorylation, and epithelial-mesenchymal transition. Tollip also interacts with ubiquitinated TβRI, and such interaction requires ubiquitin-associated domains of Tollip. The interaction and intracellular colocalization of Tollip with TβRI is enhanced by Smad7. Overexpression of Tollip accelerates protein degradation of activated TβRI. In addition, Tollip alters subcellular compartmentalization and endosomal trafficking of activated TβRI. Collectively, our studies reveal that Tollip cooperates with Smad7 to modulate intracellular trafficking and degradation of ubiquitinated TβRI, whereby negatively regulates TGF-β signaling pathway.

  20. EpCAM Intracellular Domain Promotes Porcine Cell Reprogramming by Upregulation of Pluripotent Gene Expression via Beta-catenin Signaling

    PubMed Central

    Yu, Tong; Ma, Yangyang; Wang, Huayan


    Previous study showed that expression of epithelial cell adhesion molecule (EpCAM) was significantly upregulated in porcine induced pluripotent stem cells (piPSCs). However, the regulatory mechanism and the downstream target genes of EpCAM were not well investigated. In this study, we found that EpCAM was undetectable in fibroblasts, but highly expressed in piPSCs. Promoter of EpCAM was upregulated by zygotic activated factors LIN28, and ESRRB, but repressed by maternal factors OCT4 and SOX2. Knocking down EpCAM by shRNA significantly reduced the pluripotent gene expression. Conversely, overexpression of EpCAM significantly increased the number of alkaline phosphatase positive colonies and elevated the expression of endogenous pluripotent genes. As a key surface-to-nucleus factor, EpCAM releases its intercellular domain (EpICD) by a two-step proteolytic processing sequentially. Blocking the proteolytic processing by inhibitors TAPI-1 and DAPT could reduce the intracellular level of EpICD and lower expressions of OCT4, SOX2, LIN28, and ESRRB. We noticed that increasing intracellular EpICD only was unable to improve activity of EpCAM targeted genes, but by blocking GSK-3 signaling and stabilizing beta-catenin signaling, EpICD could then significantly stimulate the promoter activity. These results showed that EpCAM intracellular domain required beta-catenin signaling to enhance porcine cell reprogramming. PMID:28393933

  1. Does amiodarone affect heart rate by inhibiting the intracellular generation of triiodothyronine from thyroxine?

    PubMed Central

    Lindenmeyer, M.; Spörri, S.; Stäubli, M.; Studer, A.; Studer, H.


    The hypothesis that the antiarrhythmic drug amiodarone slows down the heart rate by its inhibitory action on the intracellular conversion of thyroxine (T4) to 3,5,3' triiodothyronine (T3) was investigated. For this purpose we compared the effect of amiodarone with that of another potent inhibitor of the T4----T3 conversion, i.e. the radiographic contrast medium iopanoic acid, on the heart rate of unanaesthetized guinea-pigs. Both amiodarone and, to an even greater extent, iopanoic acid induced an increase in serum 3.5',3' triiodothyronine (reverse T3), indicating effective inhibition of T4----T3 conversion. Both amiodarone and iopanoic acid were accumulated in the liver and in the heart (measured as iodine). While amiodarone induced bradycardia, iopanoic acid did not change the heart rate. Supraphysiological amounts of exogenous T3 reverted the amiodarone induced bradycardia to near normal values. A comparable effect was observed with isoprenaline. The intracellular inhibition of the T4----T3 conversion is not the ultimate mode of the action of the amiodarone effect on heart rate. It is thought that amiodarone interacts with T3 at its receptor or somewhere later along the pathway from the T3-receptor interaction to the final effect of T3 on heart rate. PMID:6733357

  2. The Potential of Vitamin D-Regulated Intracellular Signaling Pathways as Targets for Myeloid Leukemia Therapy

    PubMed Central

    Gocek, Elzbieta; Studzinski, George P.


    The current standard regimens for the treatment of acute myeloid leukemia (AML) are curative in less than half of patients; therefore, there is a great need for innovative new approaches to this problem. One approach is to target new treatments to the pathways that are instrumental to cell growth and survival with drugs that are less harmful to normal cells than to neoplastic cells. In this review, we focus on the MAPK family of signaling pathways and those that are known to, or potentially can, interact with MAPKs, such as PI3K/AKT/FOXO and JAK/STAT. We exemplify the recent studies in this field with specific relevance to vitamin D and its derivatives, since they have featured prominently in recent scientific literature as having anti-cancer properties. Since microRNAs also are known to be regulated by activated vitamin D, this is also briefly discussed here, as are the implications of the emerging acquisition of transcriptosome data and potentiation of the biological effects of vitamin D by other compounds. While there are ongoing clinical trials of various compounds that affect signaling pathways, more studies are needed to establish the clinical utility of vitamin D in the treatment of cancer. PMID:26239344

  3. Characteristics of receptor- and transducer-coupled activation of the intracellular signalling in sensory neuron revealed by atomic force microscopy

    NASA Astrophysics Data System (ADS)

    Khalisov, M. M.; Penniyaynen, V. A.; Esikova, N. A.; Ankudinov, A. V.; Krylov, B. V.


    The mechanical properties of sensory neurons upon activation of intracellular cascade processes by comenic acid binding to a membrane opioid-like receptor (receptor-coupled), as well as a very low (endogenous) concentration of ouabain (transducer-coupled), have been investigated. Using atomic force microscopy, it is established that exposure to ouabain, in contrast to the impact of comenic acid, leads to a hardening of the neuron soma. This suggests that the receptor-coupled signal transmission to the cell genome is carried out through mechanisms that are different from the transducer-coupled signal pathways.

  4. [Intracellular signal systems in the epithelium- and endothelium-dependent relaxation of smooth muscles].


    Kapilevich, L V; Kovalev, I V; Baskakov, M B; Medvedev, M A


    The research of mechanisms of a regulation electrical and contractile of properties of unstriated muscles of an internals remains by an actual problem of modern physiology and medicine. Already now it is possible to state that the efficacy of means of correction of distresses of an internals depends on a degree of a level of scrutiny of these mechanisms. Among physiologically active substances effecting on smooth muscle cells (SM), the special relaxing factor synthesized by endotheliocytes, epithelial cells and SM. Identified by the majority of the explorers as oxide of nitrogen (NO), relaxing factor responds for exhibiting of many myogenic responses of pots and pneumatic routes. The mechanisms of synthesis and implementation of effects of this factor in SM cells up to the extremity are not clarified. The considerable advance in learning mechanisms of operation relaxing factor on SM is connected to discovering of ability of some nitro compounds to replicate NO-dependent relaxing effects in these cells. The main systems of intracellular regulation are involved in mechanisms of implementation endothelial and epithelial local regulatory effects on SM. The majority of the explorers bind an epithelium-dependent release phenomenon SM to an activation of a solvable fraction guanilatcyclase, found in the majority of cells, and effects of cGMP-dependent protein kinases. There are reports on ability of inhibitors NO-sintase to depress a release phenomenon SM of pots and bronchuses, about dependence of a mechanical strain SM of pots and respiratory tract from a contents cGMP in cells. However there are datas giving establishments to guess, that alongside with guanilatciclase in a release phenomenon SM, induced relaxing factors or nitro compounds, the immediate involvement is accepted by cAMP-dependent protein kinases. The most probable point of interaction cAMP and cGMP-dependent processes is phospodiesterase of cyclic nucleotides. It citosolium the enzyme labilized by

  5. Miro1 Regulates Activity-Driven Positioning of Mitochondria within Astrocytic Processes Apposed to Synapses to Regulate Intracellular Calcium Signaling

    PubMed Central

    Stephen, Terri-Leigh; Higgs, Nathalie F.; Sheehan, David F.; Al Awabdh, Sana; López-Doménech, Guillermo; Arancibia-Carcamo, I. Lorena


    It is fast emerging that maintaining mitochondrial function is important for regulating astrocyte function, although the specific mechanisms that govern astrocyte mitochondrial trafficking and positioning remain poorly understood. The mitochondrial Rho-GTPase 1 protein (Miro1) regulates mitochondrial trafficking and detachment from the microtubule transport network to control activity-dependent mitochondrial positioning in neurons. However, whether Miro proteins are important for regulating signaling-dependent mitochondrial dynamics in astrocytic processes remains unclear. Using live-cell confocal microscopy of rat organotypic hippocampal slices, we find that enhancing neuronal activity induces transient mitochondrial remodeling in astrocytes, with a concomitant, transient reduction in mitochondrial trafficking, mediated by elevations in intracellular Ca2+. Stimulating neuronal activity also induced mitochondrial confinement within astrocytic processes in close proximity to synapses. Furthermore, we show that the Ca2+-sensing EF-hand domains of Miro1 are important for regulating mitochondrial trafficking in astrocytes and required for activity-driven mitochondrial confinement near synapses. Additionally, activity-dependent mitochondrial positioning by Miro1 reciprocally regulates the levels of intracellular Ca2+ in astrocytic processes. Thus, the regulation of intracellular Ca2+ signaling, dependent on Miro1-mediated mitochondrial positioning, could have important consequences for astrocyte Ca2+ wave propagation, gliotransmission, and ultimately neuronal function. SIGNIFICANCE STATEMENT Mitochondria are key cellular organelles that play important roles in providing cellular energy and buffering intracellular calcium ions. The mechanisms that control mitochondrial distribution within the processes of glial cells called astrocytes and the impact this may have on calcium signaling remains unclear. We show that activation of glutamate receptors or increased neuronal

  6. Intracellular calcium affects prestin's voltage operating point indirectly via turgor-induced membrane tension

    NASA Astrophysics Data System (ADS)

    Song, Lei; Santos-Sacchi, Joseph


    Recent identification of a calmodulin binding site within prestin's C-terminus indicates that calcium can significantly alter prestin's operating voltage range as gauged by the Boltzmann parameter Vh (Keller et al., J. Neuroscience, 2014). We reasoned that those experiments may have identified the molecular substrate for the protein's tension sensitivity. In an effort to understand how this may happen, we evaluated the effects of turgor pressure on such shifts produced by calcium. We find that the shifts are induced by calcium's ability to reduce turgor pressure during whole cell voltage clamp recording. Clamping turgor pressure to 1kPa, the cell's normal intracellular pressure, completely counters the calcium effect. Furthermore, following unrestrained shifts, collapsing the cells abolishes induced shifts. We conclude that calcium does not work by direct action on prestin's conformational state. The possibility remains that calcium interaction with prestin alters water movements within the cell, possibly via its anion transport function.

  7. Nanosecond pulsed electric field induced dose dependent phosphatidylinositol-4,5-bisphosphate signaling and intracellular electro-sensitization.


    Tolstykh, Gleb P; Tarango, Melissa; Roth, Caleb C; Ibey, Bennett L


    Previously, it was demonstrated that nanometer-sized pores (nanopores) are formed in outer cellular membranes after exposure to nanosecond electric pulses (nsEPs). We reported that plasma membrane nanoporation affects phospholipids of the cell membrane, culminating in cascading phosphoinositide phosphatidylinositol-4,5-bisphosphate (PIP2) intracellular signaling. In the current study, we show that nsEPs initiated electric field (EF) dose-dependent PIP2 hydrolysis and/or depletion from the plasma membrane. This process was confirmed using fluorescent optical probes of PIP2 hydrolysis: PLCδ-PH-EGFP and GFP-C1-PKCγ-C1a. The 50% maximum response occurs with a single 600ns pulse achieving an effective dose (ED50) of EF~8kV/cm within our model cell system. At 16.2kV/cm, the ED50 for the pulse width was 484ns. Reduction of the pulse width or EF amplitude gradually reduced the observed effect, but twenty 60ns 16.2kV/cm pulses produced an effect similar to a single 600ns pulse of the same amplitude. Propidium iodide (PI) uptake after the nsEP exposure confirmed a strong relationship between EF-induced plasma membrane impact and PIP2 depletion. These results have expanded our current knowledge of nsEPs dependent cell physiological effects, and serve as a basis for model development of new exposure standards, providing novel tools for drug independent stimulation and approaches to differential modulation of key cellular functions.

  8. Ehrlichia chaffeensis TRP120 Activates Canonical Notch Signaling To Downregulate TLR2/4 Expression and Promote Intracellular Survival

    PubMed Central

    Lina, Taslima T.; Dunphy, Paige S.; Luo, Tian


    ABSTRACT Ehrlichia chaffeensis preferentially targets mononuclear phagocytes and survives through a strategy of subverting innate immune defenses, but the mechanisms are unknown. We have shown E. chaffeensis type 1 secreted tandem repeat protein (TRP) effectors are involved in diverse molecular pathogen-host interactions, such as the TRP120 interaction with the Notch receptor-cleaving metalloprotease ADAM17. In the present study, we demonstrate E. chaffeensis, via the TRP120 effector, activates the canonical Notch signaling pathway to promote intracellular survival. We found that nuclear translocation of the transcriptionally active Notch intracellular domain (NICD) occurs in response to E. chaffeensis or recombinant TRP120, resulting in upregulation of Notch signaling pathway components and target genes notch1, adam17, hes, and hey. Significant differences in canonical Notch signaling gene expression levels (>40%) were observed during early and late stages of infection, indicating activation of the Notch pathway. We linked Notch pathway activation specifically to the TRP120 effector, which directly interacts with the Notch metalloprotease ADAM17. Using pharmacological inhibitors and small interfering RNAs (siRNAs) against γ-secretase enzyme, Notch transcription factor complex, Notch1, and ADAM17, we demonstrated that Notch signaling is required for ehrlichial survival. We studied the downstream effects and found that E. chaffeensis TRP120-mediated activation of the Notch pathway causes inhibition of the extracellular signal-regulated kinase 1/2 (ERK1/2) and p38 mitogen-activated protein kinase (MAPK) pathways required for PU.1 and subsequent Toll-like receptor 2/4 (TLR2/4) expression. This investigation reveals a novel mechanism whereby E. chaffeensis exploits the Notch pathway to evade the host innate immune response for intracellular survival. PMID:27381289

  9. Intracellular Heat Shock Protein-70 Negatively Regulates Toll-like Receptor-4 Signaling in the Newborn Intestinal Epithelium1

    PubMed Central

    Afrazi, Amin; Sodhi, Chhinder P.; Good, Misty; Jia, Hongpeng; Siggers, Richard; Yazji, Ibrahim; Neal, Matthew D.; Prindle, Thomas; Grant, Zachary; Branca, Maria F.; Ozolek, John; Chang, Eugene; Hackam, David J.


    Necrotizing enterocolitis (NEC) is the leading cause of gastrointestinal-related mortality in premature infants, and develops under conditions of exaggerated Toll-like receptor-4 (TLR4) signaling in the newborn intestinal epithelium. Since NEC does not develop spontaneously despite the presence of seemingly tonic stimulation of intestinal TLR4, we hypothesized that mechanisms must exist to constrain TLR4 signaling that become diminished during NEC pathogenesis, and focused on the intracellular stress response protein and chaperone Heat Shock Protein-70 (Hsp70). We now demonstrate that the induction of intracellular Hsp70 in enterocytes dramatically reduced TLR4 signaling as assessed by LPS-induced NFkB translocation, cytokine expression and apoptosis. These findings were confirmed in vivo, using mice that either globally lacked Hsp70 or which over-expressed Hsp70 within the intestinal epithelium. TLR4 activation itself significantly increased Hsp70 expression in enterocytes, which provided a mechanism of auto-inhibition of TLR4 signaling in enterocytes. In seeking to define the mechanisms involved, intracellular Hsp70-mediated inhibition of TLR4 signaling required both its substrate-binding EEVD-domain and association with the co-chaperone CHIP, resulting in ubiquitination and proteosomal degradation of TLR4. The expression of Hsp70 in the intestinal epithelium was significantly decreased in murine and human NEC compared to healthy controls, suggesting loss of Hsp70 protection from TLR4 could lead to NEC. In support of this, intestinal-Hsp70 overexpression in mice and pharmacologic upregulation of Hsp70 reversed TLR4-induced cytokines and enterocyte apoptosis, and prevented and treated experimental NEC. Thus, a novel TLR4 regulatory pathway exists within the newborn gut involving Hsp70 that may be pharmacologically activated to limit NEC severity. PMID:22461698

  10. Intracellular degradation and localization of NS1 of TBEV affects its protective properties.


    Kuzmenko, Yulia; Starodubova, Elizaveta; Shevtsova, Anastasia; Chernokhaeva, Lubov; Latanova, Anastasia; Preobrazhenskaia, Olga; Timofeev, Andrey; Karganova, Galina; Karpov, Vadim


    Currently many DNA vaccines against infectious diseases are in clinical trials however their efficacy is needed to be improved. Potency of DNA immunogen can be optimized by targeting technologies. In a current study to increase the efficacy of NS1encoded by plasmid the proteasome targeting was applied. NS1 variants with or without translocation sequence and with signal of proteasomal degradation of ornithine decarboxylase were tested for expression, localization, protein turnover, proteasomal degradation and protection properties. Deletion of translocation signal abrogated presentation of NS1 on the cell surface and increased proteasomal processing of NS1. Fusion with ODC signal led to increase of protein turnover and proteasome degradation rate of NS1. Immunization with NS1 variants with increased proteasome processing protected mice from viral challenge only partially, however, the survival time of infected mice was prolonged in these groups. This data can give a presupposition for formulation of specific immune therapy for infected individuals.

  11. Intracellular composition of fatty acid affects the processing and function of tyrosinase through the ubiquitin–proteasome pathway

    PubMed Central

    Ando, Hideya; Wen, Zhi-Ming; Kim, Hee-Yong; Valencia, Julio C.; Costin, Gertrude-E.; Watabe, Hidenori; Yasumoto, Ken-ichi; Niki, Yoko; Kondoh, Hirofumi; Ichihashi, Masamitsu; Hearing, Vincent J.


    Proteasomes are multicatalytic proteinase complexes within cells that selectively degrade ubiquitinated proteins. We have recently demonstrated that fatty acids, major components of cell membranes, are able to regulate the proteasomal degradation of tyrosinase, a critical enzyme required for melanin biosynthesis, in contrasting manners by relative increases or decreases in the ubiquitinated tyrosinase. In the present study, we show that altering the intracellular composition of fatty acids affects the post-Golgi degradation of tyrosinase. Incubation with linoleic acid (C18:2) dramatically changed the fatty acid composition of cultured B16 melanoma cells, i.e. the remarkable increase in polyunsaturated fatty acids such as linoleic acid and arachidonic acid (C20:4) was compensated by the decrease in monounsaturated fatty acids such as oleic acid (C18:1) and palmitoleic acid (C16:1), with little effect on the proportion of saturated to unsaturated fatty acid. When the composition of intracellular fatty acids was altered, tyrosinase was rapidly processed to the Golgi apparatus from the ER (endoplasmic reticulum) and the degradation of tyrosinase was increased after its maturation in the Golgi. Retention of tyrosinase in the ER was observed when cells were treated with linoleic acid in the presence of proteasome inhibitors, explaining why melanin synthesis was decreased in cells treated with linoleic acid and a proteasome inhibitor despite the abrogation of tyrosinase degradation. These results suggest that the intracellular composition of fatty acid affects the processing and function of tyrosinase in connection with the ubiquitin–proteasome pathway and suggest that this might be a common physiological approach to regulate protein degradation. PMID:16232122

  12. Dynamic changes in intracellular ROS levels regulate airway basal stem cell homeostasis through Nrf2-dependent Notch signaling.


    Paul, Manash K; Bisht, Bharti; Darmawan, Daphne O; Chiou, Richard; Ha, Vi L; Wallace, William D; Chon, Andrew T; Hegab, Ahmed E; Grogan, Tristan; Elashoff, David A; Alva-Ornelas, Jackelyn A; Gomperts, Brigitte N


    Airways are exposed to myriad environmental and damaging agents such as reactive oxygen species (ROS), which also have physiological roles as signaling molecules that regulate stem cell function. However, the functional significance of both steady and dynamically changing ROS levels in different stem cell populations, as well as downstream mechanisms that integrate ROS sensing into decisions regarding stem cell homeostasis, are unclear. Here, we show in mouse and human airway basal stem cells (ABSCs) that intracellular flux from low to moderate ROS levels is required for stem cell self-renewal and proliferation. Changing ROS levels activate Nrf2, which activates the Notch pathway to stimulate ABSC self-renewal and an antioxidant program that scavenges intracellular ROS, returning overall ROS levels to a low state to maintain homeostatic balance. This redox-mediated regulation of lung stem cell function has significant implications for stem cell biology, repair of lung injuries, and diseases such as cancer.

  13. The Role of the Francisella Tularensis Pathogenicity Island in Type VI Secretion, Intracellular Survival, and Modulation of Host Cell Signaling

    PubMed Central

    Bröms, Jeanette E.; Sjöstedt, Anders; Lavander, Moa


    Francisella tularensis is a highly virulent gram-negative intracellular bacterium that causes the zoonotic disease tularemia. Essential for its virulence is the ability to multiply within host cells, in particular monocytic cells. The bacterium has developed intricate means to subvert host immune mechanisms and thereby facilitate its intracellular survival by preventing phagolysosomal fusion followed by escape into the cytosol, where it multiplies. Moreover, it targets and manipulates numerous host cell signaling pathways, thereby ameliorating the otherwise bactericidal capacity. Many of the underlying molecular mechanisms still remain unknown but key elements, directly or indirectly responsible for many of the aforementioned mechanisms, rely on the expression of proteins encoded by the Francisella pathogenicity island (FPI), suggested to constitute a type VI secretion system. We here describe the current knowledge regarding the components of the FPI and the roles that have been ascribed to them. PMID:21687753

  14. Calcium influx affects intracellular transport and membrane repair following nanosecond pulsed electric field exposure

    NASA Astrophysics Data System (ADS)

    Thompson, Gary Lee; Roth, Caleb C.; Dalzell, Danielle R.; Kuipers, Marjorie; Ibey, Bennett L.


    The cellular response to subtle membrane damage following exposure to nanosecond pulsed electric fields (nsPEF) is not well understood. Recent work has shown that when cells are exposed to nsPEF, ion permeable nanopores (<2 nm) are created in the plasma membrane in contrast to larger diameter pores (>2 nm) created by longer micro- and millisecond duration pulses. Nanoporation of the plasma membrane by nsPEF has been shown to cause a transient increase in intracellular calcium concentration within milliseconds after exposure. Our research objective is to determine the impact of nsPEF on calcium-dependent structural and repair systems in mammalian cells. Chinese hamster ovary (CHO-K1) cells were exposed in the presence and absence of calcium ions in the outside buffer to either 1 or 20, 600-ns duration electrical pulses at 16.2 kV/cm, and pore size was determined using propidium iodide and calcium green. Membrane organization was observed with morphological changes and increases in FM1-43 fluorescence. Migration of lysosomes, implicated in membrane repair, was followed using confocal microscopy of red fluorescent protein-tagged LAMP1. Microtubule structure was imaged using mEmerald-tubulin. We found that at high 600-ns PEF dosage, calcium-induced membrane restructuring and microtubule depolymerization coincide with interruption of membrane repair via lysosomal exocytosis.

  15. Calcium influx affects intracellular transport and membrane repair following nanosecond pulsed electric field exposure.


    Thompson, Gary Lee; Roth, Caleb C; Dalzell, Danielle R; Kuipers, Marjorie; Ibey, Bennett L


    The cellular response to subtle membrane damage following exposure to nanosecond pulsed electric fields (nsPEF) is not well understood. Recent work has shown that when cells are exposed to nsPEF, ion permeable nanopores (<2  nm) are created in the plasma membrane in contrast to larger diameter pores (>2  nm) created by longer micro- and millisecond duration pulses. Nanoporation of the plasma membrane by nsPEF has been shown to cause a transient increase in intracellular calcium concentration within milliseconds after exposure. Our research objective is to determine the impact of nsPEF on calcium-dependent structural and repair systems in mammalian cells. Chinese hamster ovary (CHO-K1) cells were exposed in the presence and absence of calcium ions in the outside buffer to either 1 or 20, 600-ns duration electrical pulses at 16.2  kV/cm, and pore size was determined using propidium iodide and calcium green. Membrane organization was observed with morphological changes and increases in FM1-43 fluorescence. Migration of lysosomes, implicated in membrane repair, was followed using confocal microscopy of red fluorescent protein-tagged LAMP1. Microtubule structure was imaged using mEmerald-tubulin. We found that at high 600-ns PEF dosage, calcium-induced membrane restructuring and microtubule depolymerization coincide with interruption of membrane repair via lysosomal exocytosis.

  16. Long distance effect on ligand-gated ion channels extracellular domain may affect interactions with the intracellular machinery.


    Garret, Maurice; Boué-Grabot, Eric; Taly, Antoine


    Modulation of receptor trafficking is critical for controlling neurotransmission. A γ2(R43Q) point mutation on GABAA receptor subunit is linked to epilepsy in human. We recently analyzed the effect of this amino-acid substitution on GABAA receptor trafficking and showed that this mutation as well as agonist application, both affecting GABAA receptor extracellular domain, have an effect on receptor endocytosis. By comparing homology models based on ligand gated ion channels in their active and resting states, we reveal that the γ2R43 domain is located in a loop that is affected by motion resulting from receptor activation. Taken together, these results suggest that endocytosis of GABAA receptors is linked to agonist induced conformational changes. We propose that ligand or modulator binding is followed by a whole chain of interconnections, including the intracellular domain, that may influence ligand-gated channel trafficking.

  17. Long distance effect on ligand-gated ion channels extracellular domain may affect interactions with the intracellular machinery

    PubMed Central

    Garret, Maurice; Boué-Grabot, Eric; Taly, Antoine


    Modulation of receptor trafficking is critical for controlling neurotransmission. A γ2(R43Q) point mutation on GABAA receptor subunit is linked to epilepsy in human. We recently analyzed the effect of this amino-acid substitution on GABAA receptor trafficking and showed that this mutation as well as agonist application, both affecting GABAA receptor extracellular domain, have an effect on receptor endocytosis. By comparing homology models based on ligand gated ion channels in their active and resting states, we reveal that the γ2R43 domain is located in a loop that is affected by motion resulting from receptor activation. Taken together, these results suggest that endocytosis of GABAA receptors is linked to agonist induced conformational changes. We propose that ligand or modulator binding is followed by a whole chain of interconnections, including the intracellular domain, that may influence ligand-gated channel trafficking. PMID:25254078

  18. The Analysis of Intracellular and Intercellular Calcium Signaling in Human Anterior Lens Capsule Epithelial Cells with Regard to Different Types and Stages of the Cataract.


    Gosak, Marko; Markovič, Rene; Fajmut, Aleš; Marhl, Marko; Hawlina, Marko; Andjelić, Sofija


    In this work we investigated how modifications of the Ca2+ homeostasis in anterior lens epithelial cells (LECs) are associated with different types of cataract (cortical or nuclear) and how the progression of the cataract (mild or moderate) affects the Ca2+ signaling. We systematically analyzed different aspects of intra- and inter-cellular Ca2+ signaling in the human LECs, which are attached to surgically isolated lens capsule (LC), obtained during cataract surgery. We monitored the temporal and spatial changes in intracellular Ca2+ concentration after stimulation with acetylcholine by means of Fura-2 fluorescence captured with an inverted microscope. In our analysis we compared the features of Ca2+ signals in individual cells, synchronized activations, spatio-temporal grouping and the nature of intercellular communication between LECs. The latter was assessed by using the methodologies of the complex network theory. Our results point out that at the level of individual cells there are no significant differences when comparing the features of the signals with regard either to the type or the stage of the cataract. On the other hand, noticeable differences are observed at the multicellular level, despite inter-capsule variability. LCs associated with more developed cataracts were found to exhibit a slower collective response to stimulation, a less pronounced spatio-temporal clustering of LECs with similar signaling characteristics. The reconstructed intercellular networks were found to be sparser and more segregated than in LCs associated with mild cataracts. Moreover, we show that spontaneously active LECs often operate in localized groups with quite well aligned Ca2+ activity. The presence of spontaneous activity was also found to affect the stimulated Ca2+ responses of individual cells. Our findings indicate that the cataract progression entails the impairment of intercellular signaling thereby suggesting the functional importance of altered Ca2+ signaling of

  19. The Analysis of Intracellular and Intercellular Calcium Signaling in Human Anterior Lens Capsule Epithelial Cells with Regard to Different Types and Stages of the Cataract

    PubMed Central

    Gosak, Marko; Markovič, Rene; Fajmut, Aleš; Marhl, Marko; Hawlina, Marko; Andjelić, Sofija


    In this work we investigated how modifications of the Ca2+ homeostasis in anterior lens epithelial cells (LECs) are associated with different types of cataract (cortical or nuclear) and how the progression of the cataract (mild or moderate) affects the Ca2+ signaling. We systematically analyzed different aspects of intra- and inter-cellular Ca2+ signaling in the human LECs, which are attached to surgically isolated lens capsule (LC), obtained during cataract surgery. We monitored the temporal and spatial changes in intracellular Ca2+ concentration after stimulation with acetylcholine by means of Fura-2 fluorescence captured with an inverted microscope. In our analysis we compared the features of Ca2+ signals in individual cells, synchronized activations, spatio-temporal grouping and the nature of intercellular communication between LECs. The latter was assessed by using the methodologies of the complex network theory. Our results point out that at the level of individual cells there are no significant differences when comparing the features of the signals with regard either to the type or the stage of the cataract. On the other hand, noticeable differences are observed at the multicellular level, despite inter-capsule variability. LCs associated with more developed cataracts were found to exhibit a slower collective response to stimulation, a less pronounced spatio-temporal clustering of LECs with similar signaling characteristics. The reconstructed intercellular networks were found to be sparser and more segregated than in LCs associated with mild cataracts. Moreover, we show that spontaneously active LECs often operate in localized groups with quite well aligned Ca2+ activity. The presence of spontaneous activity was also found to affect the stimulated Ca2+ responses of individual cells. Our findings indicate that the cataract progression entails the impairment of intercellular signaling thereby suggesting the functional importance of altered Ca2+ signaling of

  20. Phospholipase C-η1 is activated by intracellular Ca(2+) mobilization and enhances GPCRs/PLC/Ca(2+) signaling.


    Kim, Jung Kuk; Choi, Jung Woong; Lim, Seyoung; Kwon, Ohman; Seo, Jeong Kon; Ryu, Sung Ho; Suh, Pann-Ghill


    Phospholipase C-η1 (PLC-η1) is the most recently identified PLC isotype and is primarily expressed in nerve tissue. However, its functional role is unclear. In the present study, we report for the first time that PLC-η1 acts as a signal amplifier in G protein-coupled receptor (GPCR)-mediated PLC and Ca(2+) signaling. Short-hairpin RNA (shRNA)-mediated knockdown of endogenous PLC-η1 reduced lysophosphatidic acid (LPA)-, bradykinin (BK)-, and PACAP-induced PLC activity in mouse neuroblastoma Neuro2A (N2A) cells, indicating that PLC-η1 participates in GPCR-mediated PLC activation. Interestingly, ionomycin-induced PLC activity was significantly decreased by PLC-η1, but not PLC-η2, knockdown. In addition, we found that intracellular Ca(2+) source is enough for PLC-η1 activation. Furthermore, the IP(3) receptor inhibitor, 2-APB, inhibited LPA-induced PLC activity in control N2A cells, whereas this effect was not observed in PLC-η1 knockdown N2A cells, suggesting a pivotal role of intracellular Ca(2+) mobilization in PLC-η1 activation. Finally, we found that LPA-induced ERK1/2 phosphorylation and expression of the downstream target gene, krox-24, were significantly decreased by PLC-η1 knockdown, and these knockdown effects were abolished by 2-APB. Taken together, our results strongly suggest that PLC-η1 is activated via intracellular Ca(2+) mobilization from the ER, and therefore amplifies GPCR-mediated signaling.

  1. EphrinA2 Receptor (EphA2) Is an Invasion and Intracellular Signaling Receptor for Chlamydia trachomatis

    PubMed Central

    Subbarayal, Prema; Karunakaran, Karthika; Winkler, Ann-Cathrin; Rother, Marion; Gonzalez, Erik; Meyer, Thomas F.; Rudel, Thomas


    The obligate intracellular bacterium Chlamydia trachomatis invades into host cells to replicate inside a membrane-bound vacuole called inclusion. Multiple different host proteins are recruited to the inclusion and are functionally modulated to support chlamydial development. Invaded and replicating Chlamydia induces a long-lasting activation of the PI3 kinase signaling pathway that is required for efficient replication. We identified the cell surface tyrosine kinase EphrinA2 receptor (EphA2) as a chlamydial adherence and invasion receptor that induces PI3 kinase (PI3K) activation, promoting chlamydial replication. Interfering with binding of C. trachomatis serovar L2 (Ctr) to EphA2, downregulation of EphA2 expression or inhibition of EphA2 activity significantly reduced Ctr infection. Ctr interacts with and activates EphA2 on the cell surface resulting in Ctr and receptor internalization. During chlamydial replication, EphA2 remains active accumulating around the inclusion and interacts with the p85 regulatory subunit of PI3K to support the activation of the PI3K/Akt signaling pathway that is required for normal chlamydial development. Overexpression of full length EphA2, but not the mutant form lacking the intracellular cytoplasmic domain, enhanced PI3K activation and Ctr infection. Despite the depletion of EphA2 from the cell surface, Ctr infection induces upregulation of EphA2 through the activation of the ERK pathway, which keeps the infected cell in an apoptosis-resistant state. The significance of EphA2 as an entry and intracellular signaling receptor was also observed with the urogenital C. trachomatis-serovar D. Our findings provide the first evidence for a host cell surface receptor that is exploited for invasion as well as for receptor-mediated intracellular signaling to facilitate chlamydial replication. In addition, the engagement of a cell surface receptor at the inclusion membrane is a new mechanism by which Chlamydia subverts the host cell and

  2. Dextran sulfate sodium upregulates MAPK signaling for the uptake and subsequent intracellular survival of Brucella abortus in murine macrophages.


    Reyes, Alisha Wehdnesday Bernardo; Arayan, Lauren Togonon; Simborio, Hannah Leah Tadeja; Hop, Huynh Tan; Min, WonGi; Lee, Hu Jang; Kim, Dong Hee; Chang, Hong Hee; Kim, Suk


    Brucellosis is one of the major zoonoses worldwide that inflicts important health problems in animal and human. Here, we demonstrated that dextran sulfate sodium (DSS) significantly increased adhesion of Brucella (B.) abortus in murine macrophages compared to untreated cells. Even without infection, Brucella uptake into macrophages increased and F-actin reorganization was induced compared with untreated cells. Furthermore, DSS increased the phosphorylation of MAPKs (ERK1/2 and p38α) in Brucella-infected, DSS-treated cells compared with the control cells. Lastly, DSS markedly increased the intracellular survival of Brucella abortus in macrophages by up to 48 h. These results suggest that DSS enhanced the adhesion and phagocytosis of B. abortus into murine macrophages by stimulating the MAPK signaling proteins phospho-ERK1/2 and p38α and that DSS increased the intracellular survival of B. abortus by inhibiting colocalization of Brucella-containing vacuoles (BCVs) with the late endosome marker LAMP-1. This study emphasizes the enhancement of the phagocytic and intracellular modulatory effects of DSS, which may suppress the innate immune system and contribute to prolonged Brucella survival and chronic infection.

  3. Imaging intracellular Ca²⁺ signals in striatal astrocytes from adult mice using genetically-encoded calcium indicators.


    Jiang, Ruotian; Haustein, Martin D; Sofroniew, Michael V; Khakh, Baljit S


    Astrocytes display spontaneous intracellular Ca(2+) concentration fluctuations ([Ca(2+)]i) and in several settings respond to neuronal excitation with enhanced [Ca(2+)]i signals. It has been proposed that astrocytes in turn regulate neurons and blood vessels through calcium-dependent mechanisms, such as the release of signaling molecules. However, [Ca(2+)]i imaging in entire astrocytes has only recently become feasible with genetically encoded calcium indicators (GECIs) such as the GCaMP series. The use of GECIs in astrocytes now provides opportunities to study astrocyte [Ca(2+)]i signals in detail within model microcircuits such as the striatum, which is the largest nucleus of the basal ganglia. In the present report, detailed surgical methods to express GECIs in astrocytes in vivo, and confocal imaging approaches to record [Ca(2+)]i signals in striatal astrocytes in situ, are described. We highlight precautions, necessary controls and tests to determine if GECI expression is selective for astrocytes and to evaluate signs of overt astrocyte reactivity. We also describe brain slice and imaging conditions in detail that permit reliable [Ca(2+)]i imaging in striatal astrocytes in situ. The use of these approaches revealed the entire territories of single striatal astrocytes and spontaneous [Ca(2+)]i signals within their somata, branches and branchlets. The further use and expansion of these approaches in the striatum will allow for the detailed study of astrocyte [Ca(2+)]i signals in the striatal microcircuitry.

  4. Imaging Intracellular Ca2+ Signals in Striatal Astrocytes from Adult Mice Using Genetically-encoded Calcium Indicators

    PubMed Central

    Jiang, Ruotian; Haustein, Martin D.; Sofroniew, Michael V.; Khakh, Baljit S.


    Astrocytes display spontaneous intracellular Ca2+ concentration fluctuations ([Ca2+]i) and in several settings respond to neuronal excitation with enhanced [Ca2+]i signals. It has been proposed that astrocytes in turn regulate neurons and blood vessels through calcium-dependent mechanisms, such as the release of signaling molecules. However, [Ca2+]i imaging in entire astrocytes has only recently become feasible with genetically encoded calcium indicators (GECIs) such as the GCaMP series. The use of GECIs in astrocytes now provides opportunities to study astrocyte [Ca2+]i signals in detail within model microcircuits such as the striatum, which is the largest nucleus of the basal ganglia. In the present report, detailed surgical methods to express GECIs in astrocytes in vivo, and confocal imaging approaches to record [Ca2+]i signals in striatal astrocytes in situ, are described. We highlight precautions, necessary controls and tests to determine if GECI expression is selective for astrocytes and to evaluate signs of overt astrocyte reactivity. We also describe brain slice and imaging conditions in detail that permit reliable [Ca2+]i imaging in striatal astrocytes in situ. The use of these approaches revealed the entire territories of single striatal astrocytes and spontaneous [Ca2+]i signals within their somata, branches and branchlets. The further use and expansion of these approaches in the striatum will allow for the detailed study of astrocyte [Ca2+]i signals in the striatal microcircuitry. PMID:25490346

  5. Intracellular calcium signalling in magnocellular neurones of the rat supraoptic nucleus: understanding the autoregulatory mechanisms.


    Dayanithi, G; Sabatier, N; Widmer, H


    Oxytocin and vasopressin, released at the soma and dendrites of neurones, bind to specific autoreceptors and induce an increase in [Ca2+]i. In oxytocin cells, the increase results from a mobilisation of Ca2+ from intracellular stores, whereas in vasopressin cells, it results mainly from an influx of Ca2+ through voltage-dependent channels. The response to vasopressin is coupled to phospholipase C and adenylyl-cyclase pathways which are activated by V1 (V1a and V1b)- and V2-type receptors respectively. Measurements of [Ca2+]i in response to V1a and V2 agonists and antagonists suggest the functional expression of these two types of receptors in vasopressin neurones. The intracellular mechanisms involved are similar to those observed for the action of the pituitary adenylyl-cyclase-activating peptide (PACAP). Isolated vasopressin neurones exhibit spontaneous [Ca2+]i oscillations and these are synchronised with phasic bursts of electrical activity. Vasopressin modulates these spontaneous [Ca2+]i oscillations in a manner that depends on the initial state of the neurone, and such varied effects of vasopressin may be related to those observed on the electrical activity of vasopressin neurones in vivo.

  6. An inside job: hacking into Janus kinase/signal transducer and activator of transcription signaling cascades by the intracellular protozoan Toxoplasma gondii.


    Denkers, Eric Y; Bzik, David J; Fox, Barbara A; Butcher, Barbara A


    The intracellular protozoan Toxoplasma gondii is well known for its skill at invading and living within host cells. New discoveries are now also revealing the astounding ability of the parasite to inject effector proteins into the cytoplasm to seize control of the host cell. This review summarizes recent advances in our understanding of one such secretory protein called ROP16. This molecule is released from rhoptries into the host cell during invasion. The ROP16 molecule acts as a kinase, directly activating both signal transducer and activator of transcription 3 (STAT3) and STAT6 signaling pathways. In macrophages, an important and preferential target cell of parasite infection, the injection of ROP16 has multiple consequences, including downregulation of proinflammatory cytokine signaling and macrophage deviation to an alternatively activated phenotype.

  7. ZIP7-mediated intracellular zinc transport contributes to aberrant growth factor signaling in antihormone-resistant breast cancer Cells.


    Taylor, Kathryn M; Vichova, Petra; Jordan, Nicola; Hiscox, Stephen; Hendley, Rhiannon; Nicholson, Robert I


    Antiestrogens such as tamoxifen are the mainstay of treatment for estrogen receptor-positive breast cancer. However, their effectiveness is limited by the development of endocrine resistance, allowing tumor regrowth and progression. Importantly, in vitro MCF7 cell models of acquired tamoxifen resistance (TamR cells) display an aggressive, invasive phenotype in which activation of epithelial growth factor receptor/IGF-I receptor/Src signaling plays a critical role. In this study, we report that TamR cells have increased levels of zinc and zinc transporter, ZIP7 [solute carrier family 39 (zinc transporter) member 7, also known as SLC39A7], resulting in an enhanced response to exogenous zinc, which is manifested as a greatly increased growth factor receptor activation, leading to increased growth and invasion. Removal of ZIP7, using small interfering RNA, destroys this activation of epithelial growth factor receptor/IGF-I receptor/Src signaling by reducing intracellular zinc levels. Similarly, it also blocks the activation of HER2, -3, and -4. These data suggest that intracellular zinc levels may be a critical factor in determining growth factor responses and that the targeting of zinc transporters may have novel therapeutic implications. We show that ZIP7 is a critical component in the redistribution of zinc from intracellular stores to the cytoplasm and, as such, is essential for the zinc-induced inhibition of phosphatases, which leads to activation of growth factor receptors. Removal of ZIP7 therefore offers a means through which zinc-induced activation of growth factor receptors may be effectively suppressed and provides a mechanism of targeting multiple growth factor pathways, increasing tumor kill, and preventing further development of resistance in breast cancer.

  8. Dual chemotaxis signalling regulates Dictyostelium development: intercellular cyclic AMP pulses and intracellular F-actin disassembly waves induce each other.


    Vicker, Michael G; Grutsch, James F


    Aggregating Dictyostelium discoideum amoebae periodically emit and relay cAMP, which regulates their chemotaxis and morphogenesis into a multicellular, differentiated organism. Cyclic AMP also stimulates F-actin assembly and chemotactic pseudopodium extension. We used actin-GFP expression to visualise for the first time intracellular F-actin assembly as a spatio-temporal indicator of cell reactions to cAMP, and thus the kinematics of cell communication, in aggregating streams. Every natural cAMP signal pulse induces an autowave of F-actin disassembly, which propagates from each cell's leading end to its trailing end at a linear rate, much slower than the calculated and measured velocities of cAMP diffusion in aggregating Dictyostelium. A sequence of transient reactions follows behind the wave, including anterior F-actin assembly, chemotactic pseudopodium extension and cell advance at the cell front and, at the back, F-actin assembly, extension of a small retrograde pseudopodium (forcing a brief cell retreat) and chemotactic stimulation of the following cell, yielding a 20s cAMP relay delay. These dynamics indicate that stream cell behaviour is mediated by a dual signalling system: a short-range cAMP pulse directed from one cell tail to an immediately following cell front and a slower, long-range wave of intracellular F-actin disassembly, each inducing the other.

  9. The γ-secretase-generated intracellular domain of β-amyloid precursor protein binds Numb and inhibits Notch signaling

    PubMed Central

    Roncarati, Roberta; Šestan, Nenad; Scheinfeld, Meir H.; Berechid, Bridget E.; Lopez, Peter A.; Meucci, Olimpia; McGlade, Jane C.; Rakic, Pasko; D'Adamio, Luciano


    The β-amyloid precursor protein (APP) and the Notch receptor undergo intramembranous proteolysis by the Presenilin-dependent γ-secretase. The cleavage of APP by γ-secretase releases amyloid-β peptides, which have been implicated in the pathogenesis of Alzheimer's disease, and the APP intracellular domain (AID), for which the function is not yet well understood. A similar γ-secretase-mediated cleavage of the Notch receptor liberates the Notch intracellular domain (NICD). NICD translocates to the nucleus and activates the transcription of genes that regulate the generation, differentiation, and survival of neuronal cells. Hence, some of the effects of APP signaling and Alzheimer's disease pathology may be mediated by the interaction of APP and Notch. Here, we show that membrane-tethered APP binds to the cytosolic Notch inhibitors Numb and Numb-like in mouse brain lysates. AID also binds Numb and Numb-like, and represses Notch activity when released by APP. Thus, γ-secretase may have opposing effects on Notch signaling; positive by cleaving Notch and generating NICD, and negative by processing APP and generating AID, which inhibits the function of NICD. PMID:12011466

  10. Bacterial translocation affects intracellular neuroinflammatory pathways in a depression-like model in rats.


    Martín-Hernández, David; Caso, Javier R; Bris, Álvaro G; Maus, Sandra R; Madrigal, José L M; García-Bueno, Borja; MacDowell, Karina S; Alou, Luis; Gómez-Lus, Maria Luisa; Leza, Juan C


    Recent studies have suggested that depression is accompanied by an increased intestinal permeability which would be related to the inflammatory pathophysiology of the disease. This study aimed to evaluate whether experimental depression presents with bacterial translocation that in turn can lead to the TLR-4 in the brain affecting the mitogen-activated protein kinases (MAPK) and antioxidant pathways. Male Wistar rats were exposed to chronic mild stress (CMS) and the intestinal integrity, presence of bacteria in tissues and plasma lipopolysaccharide levels were analyzed. We also studied the expression in the prefrontal cortex of activated forms of MAPK and some of their activation controllers and the effects of CMS on the antioxidant Nrf2 pathway. Our results indicate that after exposure to a CMS protocol there is increased intestinal permeability and bacterial translocation. CMS also increases the expression of the activated form of the MAPK p38 while decreasing the expression of the antioxidant transcription factor Nrf2. The actions of antibiotic administration to prevent bacterial translocation on elements of the MAPK and Nrf2 pathways indicate that the translocated bacteria are playing a role in these effects. In effect, our results propose a role of the translocated bacteria in the pathophysiology of depression through the p38 MAPK pathway which could aggravate the neuroinflammation and the oxidative/nitrosative damage present in this pathology. Moreover, our results reveal that the antioxidant factor Nrf2 and its activators may be involved in the consequences of the CMS on the brain.

  11. Dendritic diameters affect the spatial variability of intracellular calcium dynamics in computer models

    PubMed Central

    Anwar, Haroon; Roome, Christopher J.; Nedelescu, Hermina; Chen, Weiliang; Kuhn, Bernd; De Schutter, Erik


    There is growing interest in understanding calcium dynamics in dendrites, both experimentally and computationally. Many processes influence these dynamics, but in dendrites there is a strong contribution of morphology because the peak calcium levels are strongly determined by the surface to volume ratio (SVR) of each branch, which is inversely related to branch diameter. In this study we explore the predicted variance of dendritic calcium concentrations due to local changes in dendrite diameter and how this is affected by the modeling approach used. We investigate this in a model of dendritic calcium spiking in different reconstructions of cerebellar Purkinje cells and in morphological analysis of neocortical and hippocampal pyramidal neurons. We report that many published models neglect diameter-dependent effects on calcium concentration and show how to implement this correctly in the NEURON simulator, both for phenomenological pool based models and for implementations using radial 1D diffusion. More detailed modeling requires simulation of 3D diffusion and we demonstrate that this does not dissipate the local concentration variance due to changes of dendritic diameter. In many cases 1D diffusion of models of calcium buffering give a good approximation provided an increased morphological resolution is implemented. PMID:25100945

  12. Modelling intracellular competition for calcium: kinetic and thermodynamic control of different molecular modes of signal decoding

    PubMed Central

    Antunes, Gabriela; Roque, Antonio C.; Simoes de Souza, Fabio M.


    Frequently, a common chemical entity triggers opposite cellular processes, which implies that the components of signalling networks must detect signals not only through their chemical natures, but also through their dynamic properties. To gain insights on the mechanisms of discrimination of the dynamic properties of cellular signals, we developed a computational stochastic model and investigated how three calcium ion (Ca2+)-dependent enzymes (adenylyl cyclase (AC), phosphodiesterase 1 (PDE1), and calcineurin (CaN)) differentially detect Ca2+ transients in a hippocampal dendritic spine. The balance among AC, PDE1 and CaN might determine the occurrence of opposite Ca2+-induced forms of synaptic plasticity, long-term potentiation (LTP) and long-term depression (LTD). CaN is essential for LTD. AC and PDE1 regulate, indirectly, protein kinase A, which counteracts CaN during LTP. Stimulations of AC, PDE1 and CaN with artificial and physiological Ca2+ signals demonstrated that AC and CaN have Ca2+ requirements modulated dynamically by different properties of the signals used to stimulate them, because their interactions with Ca2+ often occur under kinetic control. Contrarily, PDE1 responds to the immediate amplitude of different Ca2+ transients and usually with the same Ca2+ requirements observed under steady state. Therefore, AC, PDE1 and CaN decode different dynamic properties of Ca2+ signals. PMID:27033299

  13. Differential functions of the Apoer2 intracellular domain in selenium uptake and cell signaling.


    Masiulis, Irene; Quill, Timothy A; Burk, Raymond F; Herz, Joachim


    Apolipoprotein E receptor 2 (Apoer2) is a multifunctional transport and signaling receptor that regulates the uptake of selenium into the mouse brain and testis through endocytosis of selenoprotein P (Sepp1). Mice deficient in Apoer2 or Sepp1 are infertile, with kinked and hypomotile spermatozoa. They also develop severe neurological defects on a low selenium diet, due to a profound impairment of selenium uptake. Little is known about the function of Apoer2 in the testis beyond its role as a Sepp1 receptor. By contrast, in the brain, Apoer2 is an essential component of the Reelin signaling pathway, which is required for proper neuronal organization and synapse function. Using knock-in mice, we have functionally dissociated the signaling motifs in the Apoer2 cytoplasmic domain from Sepp1 uptake. Selenium concentration of brain and testis was normal in the knock-in mutants, in contrast to Apoer2 knock-outs. Thus, the neurological defects in the signaling impaired knock-in mice are not caused by a selenium uptake defect, but instead are a direct consequence of a disruption of the Reelin signal. Reduced sperm motility was observed in some of the knock-in mice, indicating a novel signaling role for Apoer2 in sperm development and function that is independent of selenium uptake.

  14. Replacement of Val3 in Human Thymidylate Synthase Affects Its Kinetic Properties and Intracellular Stability

    SciTech Connect

    Huang, Xiao; Gibson, Lydia M.; Bell, Brittnaie J.; Lovelace, Leslie L.; Pea, Maria Marjorette O.; Berger, Franklin G.; Berger, Sondra H.; Lebioda, Lukasz


    Human and other mammalian thymidylate synthase (TS) enzymes have an N-terminal extension of {approx}27 amino acids that is not present in bacterial TSs. The extension, which is disordered in all reported crystal structures of TSs, has been considered to play a primary role in protein turnover but not in catalytic activity. In mammalian cells, the variant V3A has a half-life similar to that of wild-type human TS (wt hTS) while V3T is much more stable; V3L, V3F, and V3Y have half-lives approximately half of that for wt hTS. Catalytic turnover rates for most Val3 mutants are only slightly diminished, as expected. However, two mutants, V3L and V3F, have strongly compromised dUMP binding, with K{sub m,app} values increased by factors of 47 and 58, respectively. For V3L, this observation can be explained by stabilization of the inactive conformation of the loop of residues 181-197, which prevents substrate binding. In the crystal structure of V3L, electron density corresponding to a leucine residue is present in a position that stabilizes the loop of residues 181-197 in the inactive conformation. Since this density is not observed in other mutants and all other leucine residues are ordered in this structure, it is likely that this density represents Leu3. In the crystal structure of a V3F {center_dot} FdUMP binary complex, the nucleotide is bound in an alternative mode to that proposed for the catalytic complex, indicating that the high K{sub m,app} value is caused not by stabilization of the inactive conformer but by substrate binding in a nonproductive, inhibitory site. These observations show that the N-terminal extension affects the conformational state of the hTS catalytic region. Each of the mechanisms leading to the high K{sub m,app} values can be exploited to facilitate design of compounds acting as allosteric inhibitors of hTS.

  15. Difference between Extra- and Intracellular T1 Values of Carboxylic Acids Affects the Quantitative Analysis of Cellular Kinetics by Hyperpolarized NMR.


    Karlsson, Magnus; Jensen, Pernille Rose; Ardenkjaer-Larsen, Jan Henrik; Lerche, Mathilde H


    Incomplete knowledge of the longitudinal relaxation time constant (T1 ) leads to incorrect assumptions in quantitative kinetic models of cellular systems, studied by hyperpolarized real-time NMR. Using an assay that measures the intracellular signal of small carboxylic acids in living cells, the intracellular T1 of the carboxylic acid moiety of acetate, keto-isocaproate, pyruvate, and butyrate was determined. The intracellular T1 is shown to be up to four-fold shorter than the extracellular T1 . Such a large difference in T1 values between the inside and the outside of the cell has significant influence on the quantification of intracellular metabolic activity. It is expected that the significantly shorter T1 value of the carboxylic moieties inside cells is a result of macromolecular crowding. An artificial cytosol has been prepared and applied to predict the T1 of other carboxylic acids. We demonstrate the value of this prediction tool.

  16. Intracellular signaling in the regulation of renal Na-K-ATPase. II. Role of eicosanoids.

    PubMed Central

    Satoh, T; Cohen, H T; Katz, A I


    We recently reported a novel intracellular mechanism of renal Na-K-ATPase regulation by agents that increase cell cAMP, which involves protein kinase A-phospholipase A2 and is mediated by one or more arachidonic acid metabolites (Satoh, T., H. T. Cohen, and A. I. Katz. 1992. J. Clin. Invest. 89:1496). The present studies were, therefore, designed to assess the role of eicosanoids in the modulation of Na-K-ATPase activity in the rat cortical collecting duct. The effect of various cAMP agonists (dopamine, fenoldopam, vasopressin, forskolin, and dibutyryl cAMP), which inhibited the pump to a similar extent (approximately 50%), was independent of altered Na entry as it was elicited in the presence of amiloride or nystatin, or when NaCl was replaced with choline Cl. This effect was completely blocked by SKF 525A or ethoxyresorufin, two inhibitors of the cytochrome P450-dependent monooxygenase pathway, or by pretreating the animals with CoCl2, which depletes cytochrome P450. Equimolar concentrations (10(-7) M) of the cyclooxygenase inhibitors indomethacin or meclofenamate caused only a partial inhibition of the cAMP agonists' effect on the pump, whereas nordihydroguaiaretic acid or A 63162, two inhibitors of the lipoxygenase pathway, were without effect. Furthermore, two products of this pathway, leukotriene B4 and leukotriene D4, had no effect on Na-K-ATPase activity, and ICI 198615, a leukotriene receptor antagonist, did not alter pump inhibition by cAMP agonists. Several P450 monoxygenase arachidonic acid metabolites (5,6-epoxyeicosatrienoic acid; 11,12-epoxyeicosatrienoic acid; 11,12-dihydroxyeicosatrienoic acid; and 12(R)-hydroxyeicosatetraenoic acid) as well as PGE2 inhibited the Na:K pump in dose-dependent manner, but the effect of PGE2 was blocked when Na availability was altered, whereas that of 12(R)-HETE remained unchanged. We conclude that the cytochrome P450-monooxygenase pathway of the arachidonic acid cascade plays a major role in the modulation of Na

  17. [Signal transduction and intracellular recruitment of gastric proton pump in the parietal cell].


    Urushidani, T; Nagao, T


    The parietal cell has three types of activating receptors for acid secretion on its basolateral membrane, i.e., histamine H2, acetylcholine M3, and gastrin CCKB. Activation of acid secretion is achieved by two concomitant functional changes namely: (i) tubulovesicles fuse with the apical secretory membrane, thus recruiting functional pumps to the expanded microvillar surface, and (ii) the apical membrane acquires a permeability to KCl. The major path for parietal cell stimulation is via H2-receptor-mediated adenylate cyclase and elevation of cAMP to activate protein kinase A (PKA), which phosphorylates key effector proteins, e.g., ezrin, a membrane-cytoskeletal linker, apical Cl- or K(+)-channels. Ca2+ is liberated from intracellular stores by IP3, which in turn is the result of M3-, CCKB-, or possibly H2-coupled activation of phospholipase C. The resulting protein kinase C activation may have both inhibitory and excitatory roles. Elevated Ca2+ activates calmodulin-dependent kinases, e.g., calmodulin kinase II and myosin light chain kinase, that could promote vesicular motor activity. Ezrin is considered to play a main role in the vesicular transport system of the parietal cell. The regulation might be conducted through the phosphorylation of the molecule to modify its property to interact with the cytoskeletal components, membranes or membrane proteins.

  18. Endocannabinoid signaling enhances visual responses through modulation of intracellular chloride levels in retinal ganglion cells

    PubMed Central

    Miraucourt, Loïs S; Tsui, Jennifer; Gobert, Delphine; Desjardins, Jean-François; Schohl, Anne; Sild, Mari; Spratt, Perry; Castonguay, Annie; De Koninck, Yves; Marsh-Armstrong, Nicholas; Wiseman, Paul W; Ruthazer, Edward S


    Type 1 cannabinoid receptors (CB1Rs) are widely expressed in the vertebrate retina, but the role of endocannabinoids in vision is not fully understood. Here, we identified a novel mechanism underlying a CB1R-mediated increase in retinal ganglion cell (RGC) intrinsic excitability acting through AMPK-dependent inhibition of NKCC1 activity. Clomeleon imaging and patch clamp recordings revealed that inhibition of NKCC1 downstream of CB1R activation reduces intracellular Cl− levels in RGCs, hyperpolarizing the resting membrane potential. We confirmed that such hyperpolarization enhances RGC action potential firing in response to subsequent depolarization, consistent with the increased intrinsic excitability of RGCs observed with CB1R activation. Using a dot avoidance assay in freely swimming Xenopus tadpoles, we demonstrate that CB1R activation markedly improves visual contrast sensitivity under low-light conditions. These results highlight a role for endocannabinoids in vision and present a novel mechanism for cannabinoid modulation of neuronal activity through Cl− regulation. DOI: PMID:27501334

  19. Intracellular calcium signaling regulates autophagy via calcineurin-mediated TFEB dephosphorylation

    PubMed Central

    Tong, Yanju; Song, Fuyong


    The transcription-regulating activity of TFEB is dependent on its phosphorylation modification, but the phosphatase(s) involved in TFEB dephosphorylation have remained elusive. It has now become clear that lysosomal calcium signaling activates calcineurin, an endogenous serine/threonine phosphatase, which dephosphorylate TFEB leading to upregulation of autophagy. PMID:26043755

  20. Valproic Acid Influences MTNR1A Intracellular Trafficking and Signaling in a β-Arrestin 2-Dependent Manner.


    Hong, Ling-juan; Jiang, Quan; Long, Sen; Wang, Huan; Zhang, Ling-di; Tian, Yun; Wang, Cheng-kun; Cao, Jing-jing; Tao, Rong-rong; Huang, Ji-yun; Liao, Mei-hua; Lu, Ying-mei; Fukunaga, Kohji; Zhou, Nai-ming; Han, Feng


    Valproate exposure is associated with increased risks of autism spectrum disorder. To date, the mechanistic details of disturbance of melatonin receptor subtype 1 (MTNR1A) internalization upon valproate exposure remain elusive. By expressing epitope-tagged receptors (MTNR1A-EGFP) in HEK-293 and Neuro-2a cells, we recorded the dynamic changes of MTNR1A intracellular trafficking after melatonin treatment. Using time-lapse confocal microscopy, we showed in living cells that valproic acid interfered with the internalization kinetics of MTNR1A in the presence of melatonin. This attenuating effect was associated with a decrease in the phosphorylation of PKA (Thr197) and ERK (Thr202/Tyr204). VPA treatment did not alter the whole-cell currents of cells with or without melatonin. Furthermore, fluorescence resonance energy transfer imaging data demonstrated that valproic acid reduced the melatonin-initiated association between YFP-labeled β-arrestin 2 and CFP-labeled MTNR1A. Together, we suggest that valproic acid influences MTNR1A intracellular trafficking and signaling in a β-arrestin 2-dependent manner.

  1. Juglanthraquinone C Induces Intracellular ROS Increase and Apoptosis by Activating the Akt/Foxo Signal Pathway in HCC Cells.


    Hou, Ya-Qin; Yao, Yao; Bao, Yong-Li; Song, Zhen-Bo; Yang, Cheng; Gao, Xiu-Li; Zhang, Wen-Jing; Sun, Lu-Guo; Yu, Chun-Lei; Huang, Yan-Xin; Wang, Guan-Nan; Li, Yu-Xin


    Juglanthraquinone C (JC), a naturally occurring anthraquinone extracted from Juglans mandshurica, could induce apoptosis of cancer cells. This study aims to investigate the detailed cytotoxicity mechanism of JC in HepG2 and BEL-7402 cells. The Affymetrix HG-U133 Plus 2.0 arrays were first used to analyze the mRNA expression exposed to JC or DMSO in HepG2 cells. Consistent with the previous results, the data indicated that JC could induce apoptosis and hyperactivated Akt. The Western blot analysis further revealed that Akt, a well-known survival protein, was strongly activated in HepG2 and BEL-7402 cells. Furthermore, an obvious inhibitory effect on JC-induced apoptosis was observed when the Akt levels were decreased, while the overexpression of constitutively active mutant Akt greatly accelerated JC-induced apoptosis. The subsequent results suggested that JC treatment suppressed nuclear localization and increased phosphorylated levels of Foxo3a, and the overexpression of Foxo3a abrogated JC-induced apoptosis. Most importantly, the inactivation of Foxo3a induced by JC further led to an increase of intracellular ROS levels by suppressing ROS scavenging enzymes, and the antioxidant N-acetyl-L-cysteine and catalase successfully decreased JC-induced apoptosis. Collectively, this study demonstrated that JC induced the apoptosis of hepatocellular carcinoma (HCC) cells by activating Akt/Foxo signaling pathway and increasing intracellular ROS levels.

  2. Regulation of monocarboxylate transporter 1 in skeletal muscle cells by intracellular signaling pathways.


    Narumi, Katsuya; Furugen, Ayako; Kobayashi, Masaki; Otake, Sho; Itagaki, Shirou; Iseki, Ken


    Skeletal muscle is the major producer of lactic acid in the body, but its oxidative fibers also use lactic acid as a respiratory fuel. Monocarboxylate transporter (MCT) 1 has been suggested to play a major role in influx of L-lactic acid for oxidation. The regulation mechanism of MCT1 was characterized utilizing rhabdomyosarcoma cells as an in vitro skeletal muscle model. The uptake of L-lactic acid via MCT1 was studied in the presence of various intracellular regulatory pathways, including pathways mediated by protein kinases A, C and G (PKA, PKC and PKG), protein tyrosine kinase (PTK), and Ca2+/calmodulin modulators. The results showed that PKG-, PTK-, and Ca2+/calmodulin-mediated regulatory pathways play no role in the regulation of L-lactic acid uptake, but a role for PKC- and PKA-mediated pathways was apparent. Uptake of L-lactic acid appeared to be stimulated by phorbol 12-myristate 13-acetate (PMA, a PKC activator) via an increase in Vmax of transport processes with no alteration in Km. In parallel, PMA treatment also resulted in an increase in the level of MCT1 expression. On the other hand, exposure to 8-Br-cAMP, a cAMP analog, and to forskolin, an adenylyl cyclase activator, resulted in a significant decrease in L-lactic acid uptake. Additionally, 8-Br-cAMP reduced Vmax but not Km values. Parallel to the decrease in Vmax of L-lactic acid uptake, the level of MCT1 expression was decreased in response to incubation with 8-Br-cAMP. These results indicate the possible involvement of a PKC- and PKA-mediated pathway associated with expression of MCT1 and lactate transport.

  3. Pathways of intracellular communication: tetrapyrroles and plastid-to-nucleus signaling.


    Rodermel, Steve; Park, Sungsoon


    Retrograde plastid-to-nucleus signaling plays a central role in coordinating nuclear and plastid gene expression. The gun (genomes uncoupled) mutants of Arabidopsis have been used to demonstrate that Mg-protoporphyrin (Mg-Proto) acts as a plastid signal to repress the transcription of nuclear photosynthesis genes (1). It is unclear how Mg-Proto triggers repression, but several components of this pathway have been recently identified. These include the products of GUN4 and GUN5. GUN5 is the ChlH subunit of Mg-chelatase, which produces Mg-Proto, and GUN4 is a regulator of ChlH activity (2). GUN4 might also play a role in photoprotection and in the trafficking of Mg-Proto.

  4. In Vivo Characterization of Intracellular Signaling Pathways Activated by the Nerve Agent Sarin

    DTIC Science & Technology


    Ca+2/calmodulin-dependent protein phosphatase signaling cascade, which dephosphorylates T34- DARPP-32 (Nishi et al., 1999). Activation of the D 1...phosphorylation state of DARPP-32 at Ser-102 (S102) and Ser-137 (S137) (see Figure 1). For example, S 102 on DARPP-32 is phosphorylated by casein kinase...cGMP-dependent protein kinase (PKG) (Girault et al., 1989). DARPP-32 is also phosphorylated on amino acid S137 by casein kinase I (CK1). Increases in

  5. Dysregulated intracellular signaling in the striatum in a pathophysiologically grounded model of Tourette syndrome.


    Rapanelli, Maximiliano; Frick, Luciana R; Pogorelov, Vladimir; Ota, Kristie T; Abbasi, Eeman; Ohtsu, Hiroshi; Pittenger, Christopher


    Tic disorders produce substantial morbidity, but their pathophysiology remains poorly understood. Convergent evidence suggests that dysregulation of the cortico-basal ganglia circuitry is central to the pathogenesis of tics. Tourette syndrome (TS), the most severe end of the continuum of tic disorders, is substantially genetic, but causative mutations have been elusive. We recently described a mouse model, the histidine decarboxylase (Hdc) knockout mouse, that recapitulates a rare, highly penetrant mutation found in a single family; these mice exhibit TS-like phenomenology. These animals have a global deficit in brain histamine and a consequent dysregulation of DA in the basal ganglia. Histamine modulation of DA effects is increasingly appreciated, but the mechanisms underlying this modulation remain unclear; the consequences of modest DA elevation in the context of profound HA deficiency are difficult to predict, but understanding them in the Hdc knockout mouse may provide generalizable insights into the pathophysiology of TS. Here we characterized signaling pathways in striatal cells in this model system, at baseline and after amphetamine challenge. In vivo microdialysis confirms elevated DA in Hdc-KO mice. We find dephosphorylation of Akt and its target GSK3β and activation of the MAPK signaling cascade and its target rpS6; these are characteristic of the effects of DA on D2- and D1-expressing striatal neurons, respectively. Strikingly, there is no alteration in mTOR signaling, which can be regulated by DA in both cell types. These cellular effects help elucidate striatal signaling abnormalities in a uniquely validated mouse model of TS and move towards the identification of new potential therapeutic targets for tic disorders.

  6. Intracellular Signal Triggered by Cholera Toxin in Saccharomyces boulardii and Saccharomyces cerevisiae

    PubMed Central

    Brandão, Rogelio L.; Castro, Ieso M.; Bambirra, Eduardo A.; Amaral, Sheila C.; Fietto, Luciano G.; Tropia, Maria José M.; Neves, Maria José; Dos Santos, Raquel G.; Gomes, Newton C. M.; Nicoli, Jacques R.


    As is the case for Saccharomyces boulardii, Saccharomyces cerevisiae W303 protects Fisher rats against cholera toxin (CT). The addition of glucose or dinitrophenol to cells of S. boulardii grown on a nonfermentable carbon source activated trehalase in a manner similar to that observed for S. cerevisiae. The addition of CT to the same cells also resulted in trehalase activation. Experiments performed separately on the A and B subunits of CT showed that both are necessary for activation. Similarly, the addition of CT but not of its separate subunits led to a cyclic AMP (cAMP) signal in both S. boulardii and S. cerevisiae. These data suggest that trehalase stimulation by CT probably occurred through the cAMP-mediated protein phosphorylation cascade. The requirement of CT subunit B for both the cAMP signal and trehalase activation indicates the presence of a specific receptor on the yeasts able to bind to the toxin, a situation similar to that observed for mammalian cells. This hypothesis was reinforced by experiments with 125I-labeled CT showing specific binding of the toxin to yeast cells. The adhesion of CT to a receptor on the yeast surface through the B subunit and internalization of the A subunit (necessary for the cAMP signal and trehalase activation) could be one more mechanism explaining protection against the toxin observed for rats treated with yeasts. PMID:9464394

  7. Intracellular signal triggered by cholera toxin in Saccharomyces boulardii and Saccharomyces cerevisiae.


    Brandão, R L; Castro, I M; Bambirra, E A; Amaral, S C; Fietto, L G; Tropia, M J; Neves, M J; Dos Santos, R G; Gomes, N C; Nicoli, J R


    As is the case for Saccharomyces boulardii, Saccharomyces cerevisiae W303 protects Fisher rats against cholera toxin (CT). The addition of glucose or dinitrophenol to cells of S. boulardii grown on a nonfermentable carbon source activated trehalase in a manner similar to that observed for S.cerevisiae. The addition of CT to the same cells also resulted in trehalase activation. Experiments performed separately on the A and B subunits of CT showed that both are necessary for activation. Similarly, the addition of CT but not of its separate subunits led to a cyclic AMP (cAMP) signal in both S. boulardii and S. cerevisiae. These data suggest that trehalase stimulation by CT probably occurred through the cAMP-mediated protein phosphorylation cascade. The requirement of CT subunit B for both the cAMP signal and trehalase activation indicates the presence of a specific receptor on the yeasts able to bind to the toxin, a situation similar to that observed for mammalian cells. This hypothesis was reinforced by experiments with 125I-labeled CT showing specific binding of the toxin to yeast cells. The adhesion of CT to a receptor on the yeast surface through the B subunit and internalization of the A subunit (necessary for the cAMP signal and trehalase activation) could be one more mechanism explaining protection against the toxin observed for rats treated with yeasts.

  8. Co-Encapsulating the Fusogenic Peptide INF7 and Molecular Imaging Probes in Liposomes Increases Intracellular Signal and Probe Retention

    PubMed Central

    Martin, Erik W.; Li, Changqing; Lu, Wuyuan; Kao, Joseph P. Y.


    Liposomes are promising vehicles to deliver diagnostic and therapeutic agents to cells in vivo. After uptake into cells by endocytosis, liposomes are degraded in the endolysosomal system. Consequently, the encapsulated cargo molecules frequently remain sequestered in endosomal compartments; this limits their usefulness in many applications (e.g. gene delivery). To overcome this, various fusogenic peptides have been developed to facilitate delivery of liposomally-encapsulated molecules into the cytosol. One such peptide is the pH-sensitive influenza-derived peptide INF7. Liposomal delivery of imaging agents is an attractive approach for enabling cell imaging and cell tracking in vivo, but can be hampered by inadequate intracellular accumulation and retention of probes caused by exocytosis (and possible degradation) of endosome-entrapped probes. Such signal loss could be minimized by facilitating escape of probe molecules from endolysosomal compartments into the cytosol. We investigated the ability of co-encapsulated INF7 to release liposomally-delivered rhodamine fluorophores into the cytosol after endosomal acidification/maturation. We co-encapsulated INF7 and fluorescent rhodamine derivatives having vastly different transport properties to show that after endocytosis by CV1 cells, the INF7 peptide is activated by acidic endosomal pH and facilitates efficient release of the fluorescent tracers into the cytosol. Furthermore, we show that INF7-facilitated escape from endosomes markedly enhanced retention of tracers that cannot be actively extruded from the cytosol. Minimizing loss of intracellular probes improves cellular imaging by increasing the signal-to-noise ratio of images and lengthening the time window that imaging can be performed. In particular, this will enhance in vivo electron paramagnetic resonance imaging, an emergent magnetic resonance imaging modality requires exogenous paramagnetic imaging agents and is highly promising for cellular and molecular

  9. The Keap1/Nrf2 Protein Axis Plays a Role in Osteoclast Differentiation by Regulating Intracellular Reactive Oxygen Species Signaling*

    PubMed Central

    Kanzaki, Hiroyuki; Shinohara, Fumiaki; Kajiya, Mikihito; Kodama, Tetsuya


    Reactive oxygen species (ROS) act as intracellular signaling molecules in the regulation of receptor activator of nuclear factor-κB ligand (RANKL)-dependent osteoclast differentiation, but they also have cytotoxic effects that include peroxidation of lipids and oxidative damage to proteins and DNA. Cellular protective mechanisms against oxidative stress include transcriptional control of cytoprotective enzymes by the transcription factor, nuclear factor E2-related factor 2 (Nrf2). This study investigated the relationship between Nrf2 and osteoclastogenesis. Stimulation of osteoclast precursors (mouse primary peritoneal macrophages and RAW 264.7 cells) with RANKL resulted in the up-regulation of kelch-like ECH-associated protein 1 (Keap1), a negative regulator of Nrf2. It also decreased the Nrf2/Keap1 ratio, and it down-regulated cytoprotective enzymes (heme oxygenase-1, γ-glutamylcysteine synthetase, and glucose-6-phosphate dehydrogenase). Nrf2 overexpression up-regulated the expression of cytoprotective enzymes, decreased ROS levels, decreased the number of tartrate-resistant acid phosphatase-positive multinucleated cells, reduced marker genes for osteoclast differentiation, and attenuated bone destruction in both in vitro and in vivo models. Overexpression of Keap1 or RNAi knockdown of Nrf2 exerted the opposite actions. In addition, in vivo local Nrf2 overexpression attenuated lipopolysaccharide-mediated RANKL-dependent cranial bone destruction in vivo. This is the first study to show that the Keap1/Nrf2 axis regulates RANKL-dependent osteoclastogenesis through modulation of intracellular ROS signaling via expression of cytoprotective enzymes. This raises the exciting possibility that the Keap1-Nrf2 axis may be a therapeutic target for the treatment of bone destructive disease. PMID:23801334

  10. Synaptic generation of an intracellular retrograde signal requires activation of the tyrosine kinase and mitogen-activated protein kinase signaling cascades in Aplysia.


    Stough, Shara; Kopec, Ashley M; Carew, Thomas J


    Cellular changes underlying memory formation can be generated in an activity-dependent manner at specific synapses. Thus an important question concerns the mechanisms by which synaptic signals communicate with the cell body to mediate these cellular changes. A monosynaptic circuit that is enhanced by sensitization in Aplysia is well-suited to study this question because three different subcellular compartments: (i) the sensorimotor SN-MN synapses, (ii) the SN projections to MNs via axonal connections, (iii) the SN cell bodies, can all be manipulated and studied independently. Here, we report that activity-dependent (AD) training in either the entire SN-MN circuit or in only the synaptic compartment, activates MAPK in a temporally and spatially specific pattern. Specifically, we find (i) MAPK activation is first transiently generated at SN-MN synapses during training, (ii) immediately after training MAPK is transiently activated in SN-MN axonal connections and persistently activated in SN cell bodies, and finally, (iii) MAPK is activated in SN cell bodies and SN-MN synapses 1h after training. These data suggest that there is an intracellularly transported retrograde signal generated at the synapse which is later responsible for delayed MAPK activation at SN somata. Finally, we find that this retrograde signal requires activation of tyrosine kinase (TK) and MEK signaling cascades at the synapses.

  11. Intracellular calcium during signal transduction in the lymphocyte is altered by ELF magnetic and electric fields

    SciTech Connect

    Liburdy, R.P. )


    Research has shown that ELF magnetic and electric fields alter calcium transport in rat thymic T-lymphocytes during signal transduction initiated by mitogen. Interestingly activated T-lymphocytes display a nonlinear dose-response for this basic field interaction which scales with the induced electric field in contrast to the applied magnetic field. Specialized multiring annular well cell culture plates based on Faraday's Law of Current Induction were used to demonstrate that the electric field associated with the magnetic field is the exposure metric of biological interest. The first real-time measurements of (Ca{sup 2+}){sub i} were recently presented and (Ca{sup 2+}){sub i} was shown to be altered by sinusoidal 60 Hz electric fields; magnetic fields that induced comparable electric fields yielded similar alterations in (Ca{sup 2+}){sub i}. The author now presents evidence that both parameters, (Ca{sup 2+}){sub i} and calcium transport, are altered by ELF fields during calcium signaling in thymocytes and scale with the induced electric field. In addition, (Ca{sup 2+}){sub i} studies have been conducted that provide evidence supporting the hypothesis that the mitogen-gated calcium channel present in the plasma cell membrane represents a specific site of interaction for ELF fields.

  12. Danger, intracellular signaling, and the orchestration of dendritic cell function in skin sensitization.


    Ainscough, Joseph S; Frank Gerberick, G; Dearman, Rebecca J; Kimber, Ian


    Allergic contact dermatitis is an important occupational and environmental disease caused by topical exposure to chemical allergens. An area of considerable interest and, in the context of hazard identification and characterization, an area of great importance is developing an understanding of the characteristics that confer on chemicals the ability to cause skin sensitization. For the successful acquisition of skin sensitization, it is necessary that a chemical must gain access to the viable epidermis, form stable immunogenic associations with host proteins, and provide the necessary stimuli for the activation, mobilization, and maturation of skin dendritic cells (DC). It is the last of these properties that is the subject of this article. The purpose here is to review the mechanisms through which skin sensitizers provide the triggers necessary for engagement of cutaneous DC. Of particular interest are the nature and function of danger signals elicited by skin sensitizing chemicals. Among the pathways considered here are those involving Toll-like receptors, C-type lectin receptors, neuropeptide receptors, prostanoid receptors, and the inflammasome. Collectively, danger signals in the skin provide a bridge between the innate and adaptive immune systems and are of pivotal importance for the initiation of cutaneous immune responses, including those to chemical allergens that result in skin sensitization.

  13. Fluorescent protein pair emit intracellular FRET signal suitable for FACS screening

    SciTech Connect

    Johansson, Daniel X.; Brismar, Hjalmar . E-mail:


    The fluorescent proteins ECFP and HcRed were shown to give an easily resolved FRET-signal when expressed as a fusion inside mammalian cells. HeLa-tat cells expressing ECFP, pHcRed, or the fusion protein pHcRed-ECFP were analyzed by flow cytometry after excitation of ECFP. Cells expressing HcRed-ECFP, or ECFP and HcRed, were mixed and FACS-sorted for FRET positive cells: HcRed-ECFP cells were greatly enriched (72 times). Next, cloned human antibodies were fused with ECFP and expressed anchored to the ER membrane. Their cognate antigens (HIV-1 gp120 or gp41) were fused to HcRed and co-expressed in the ER. An increase of 13.5 {+-} 1.5% (mean {+-} SEM) and 8.0 {+-} 0.7% in ECFP fluorescence for the specific antibodies reacting with gp120 or gp41, respectively, was noted after photobleaching. A positive control (HcRed-ECFP) gave a 14.8 {+-} 2.6% increase. Surprisingly, the unspecific antibody (anti-TT) showed 12.1 {+-} 1.1% increase, possibly because overexpression in the limited ER compartment gave false FRET signals.

  14. Crosstalk between intracellular and extracellular signals regulating interneuron production, migration and integration into the cortex

    PubMed Central

    Peyre, Elise; Silva, Carla G.; Nguyen, Laurent


    During embryogenesis, cortical interneurons are generated by ventral progenitors located in the ganglionic eminences of the telencephalon. They travel along multiple tangential paths to populate the cortical wall. As they reach this structure they undergo intracortical dispersion to settle in their final destination. At the cellular level, migrating interneurons are highly polarized cells that extend and retract processes using dynamic remodeling of microtubule and actin cytoskeleton. Different levels of molecular regulation contribute to interneuron migration. These include: (1) Extrinsic guidance cues distributed along migratory streams that are sensed and integrated by migrating interneurons; (2) Intrinsic genetic programs driven by specific transcription factors that grant specification and set the timing of migration for different subtypes of interneurons; (3) Adhesion molecules and cytoskeletal elements/regulators that transduce molecular signalings into coherent movement. These levels of molecular regulation must be properly integrated by interneurons to allow their migration in the cortex. The aim of this review is to summarize our current knowledge of the interplay between microenvironmental signals and cell autonomous programs that drive cortical interneuron porduction, tangential migration, and intergration in the developing cerebral cortex. PMID:25926769

  15. Measles virus hemagglutinin triggers intracellular signaling in CD150-expressing dendritic cells and inhibits immune response

    PubMed Central

    Romanets-Korbut, Olga; Kovalevska, Larysa M.; Seya, Tsukasa; Sidorenko, Svetlana P.; Horvat, Branka


    Measles virus (MV) is highly contagious pathogen, which causes a profound immunosuppression, resulting in high infant mortality. This virus infects dendritic cells (DCs) following the binding of MV hemagglutinin (MV-H) to CD150 receptor and alters DC functions by a mechanism that is not completely understood. We have analyzed the effect of MV-H interaction with CD150-expressing DCs on the DC signaling pathways and consequent phenotypic and functional changes in the absence of infectious context. We demonstrated that contact between CD150 on human DCs and MV-H expressed on membrane of transfected CHO cells was sufficient to modulate the activity of two major regulatory pathways of DC differentiation and function: to stimulate Akt and inhibit p38 MAPK phosphorylation, without concomitant ERK1/2 activation. Furthermore, interaction with MV-H decreased the expression level of DC activation markers CD80, CD83, CD86, and HLA-DR and strongly downregulated IL-12 production but did not modulate IL-10 secretion. Moreover, contact with MV-H suppressed DC-mediated T-cell alloproliferation, demonstrating profound alteration of DC maturation and functions. Finally, engagement of CD150 by MV-H in mice transgenic for human CD150 decreased inflammatory responses, showing the immunosuppressive effect of CD150–MV-H interaction in vivo. Altogether, these results uncover novel mechanism of MV-induced immunosuppression, implicating modulation of cell signaling pathways following MV-H interaction with CD150-expressing DCs and reveal anti-inflammatory effects of CD150 stimulation. PMID:26073466

  16. Partial equilibrium approximations in apoptosis. I. The intracellular-signaling subsystem.


    Huang, Ya-Jing; Yong, Wen-An


    Apoptosis is one of the most basic biological processes. In apoptosis, tens of species are involved in many biochemical reactions with times scales of widely differing orders of magnitude. By the law of mass action, the process is mathematically described with a large and stiff system of ODEs (ordinary differential equations). The goal of this work is to simplify such systems of ODEs with the PEA (partial equilibrium approximation) method. In doing so, we propose a general framework of the PEA method together with some conditions, under which the PEA method can be justified rigorously. The main condition is the principle of detailed balance for fast reactions as a whole and the framework provides some meaningful physical insights of the full chemical kinetics. With the justified method as a tool, we simplify the Fas-signaling pathway model due to Hua et al. [6] under the empirical assumption that nine reactions therein can be well regarded as relatively fast. This paper reports our simplification, together with numerical results which confirm the reliability of both our simplified model and the empirical assumption.

  17. Study of local intracellular signals regulating axonal morphogenesis using a microfluidic device

    PubMed Central

    Uryu, Daiki; Tamaru, Tomohiro; Suzuki, Azusa; Sakai, Rie; Konishi, Yoshiyuki


    Abstract The establishment and maintenance of axonal patterning is crucial for neuronal function. To identify the molecular systems that operate locally to control axonal structure, it is important to manipulate molecular functions in restricted subcellular areas for a long period of time. Microfluidic devices can be powerful tools for such purposes. In this study, we demonstrate the application of a microfluidic device to clarify the function of local Ca2+ signals in axons. Membrane depolarization significantly induced axonal branch-extension in cultured cerebellar granule neurons (CGNs). Local application of nifedipine using a polydimethylsiloxane (PDMS)-based microfluidic device demonstrated that Ca2+ entry from the axonal region via L-type voltage-dependent calcium channels (L-VDCC) is required for branch extension. Furthermore, we developed a method for locally controlling protein levels by combining genetic techniques and use of a microfluidic culture system. A vector for enhanced green fluorescent protein (EGFP) fused to a destabilizing domain derived from E. coli dihydrofolate reductase (ecDHFR) is introduced in neurons by electroporation. By local application of the DHFR ligand, trimethoprim (TMP) using a microfluidic device, we were able to manipulate differentially the level of fusion protein between axons and somatodendrites. The present study revealed the effectiveness of microfluidic devices to address fundamental biological issues at subcellular levels, and the possibility of their development in combination with molecular techniques. PMID:27877916

  18. Polymodal Responses in C. elegans Phasmid Neurons Rely on Multiple Intracellular and Intercellular Signaling Pathways

    PubMed Central

    Zou, Wenjuan; Cheng, Hankui; Li, Shitian; Yue, Xiaomin; Xue, Yadan; Chen, Sixi; Kang, Lijun


    Animals utilize specialized sensory neurons enabling the detection of a wide range of environmental stimuli from the presence of toxic chemicals to that of touch. However, how these neurons discriminate between different kinds of stimuli remains poorly understood. By combining in vivo calcium imaging and molecular genetic manipulation, here we investigate the response patterns and the underlying mechanisms of the C. elegans phasmid neurons PHA/PHB to a variety of sensory stimuli. Our observations demonstrate that PHA/PHB neurons are polymodal sensory neurons which sense harmful chemicals, hyperosmotic solutions and mechanical stimulation. A repulsive concentration of IAA induces calcium elevations in PHA/PHB and both OSM-9 and TAX-4 are essential for IAA-sensing in PHA/PHB. Nevertheless, the PHA/PHB neurons are inhibited by copper and post-synaptically activated by copper removal. Neuropeptide is likely involved in copper removal-induced calcium elevations in PHA/PHB. Furthermore, mechanical stimulation activates PHA/PHB in an OSM-9-dependent manner. Our work demonstrates how PHA/PHB neurons respond to multiple environmental stimuli and lays a foundation for the further understanding of the mechanisms of polymodal signaling, such as nociception, in more complex organisms. PMID:28195191

  19. Modulation of Intracellular Calcium Levels by Calcium Lactate Affects Colon Cancer Cell Motility through Calcium-Dependent Calpain

    PubMed Central

    Sundaramoorthy, Pasupathi; Sim, Jae Jun; Jang, Yeong-Su; Mishra, Siddhartha Kumar; Jeong, Keun-Yeong; Mander, Poonam; Chul, Oh Byung; Shim, Won-Sik; Oh, Seung Hyun; Nam, Ky-Youb; Kim, Hwan Mook


    Cancer cell motility is a key phenomenon regulating invasion and metastasis. Focal adhesion kinase (FAK) plays a major role in cellular adhesion and metastasis of various cancers. The relationship between dietary supplementation of calcium and colon cancer has been extensively investigated. However, the effect of calcium (Ca2+) supplementation on calpain-FAK-motility is not clearly understood. We sought to identify the mechanism of FAK cleavage through Ca2+ bound lactate (CaLa), its downstream signaling and role in the motility of human colon cancer cells. We found that treating HCT116 and HT-29 cells with CaLa immediately increased the intracellular Ca2+ (iCa2+) levels for a prolonged period of time. Ca2+ influx induced cleavage of FAK into an N-terminal FAK (FERM domain) in a dose-dependent manner. Phosphorylated FAK (p-FAK) was also cleaved in to its p-N-terminal FAK. CaLa increased colon cancer cells motility. Calpeptin, a calpain inhibitor, reversed the effects of CaLa on FAK and pFAK cleavage in both cancer cell lines. The cleaved FAK translocates into the nucleus and modulates p53 stability through MDM2-associated ubiquitination. CaLa-induced Ca2+ influx increased the motility of colon cancer cells was mediated by calpain activity through FAK and pFAK protein destabilization. In conclusion, these results suggest that careful consideration may be given in deciding dietary Ca2+ supplementation to patient undergoing treatment for metastatic cancer. PMID:25629974

  20. Cyproheptadine enhances the I(K) of mouse cortical neurons through sigma-1 receptor-mediated intracellular signal pathway.


    He, Yan-Lin; Zhang, Chun-Lei; Gao, Xiao-Fei; Yao, Jin-Jing; Hu, Chang-Long; Mei, Yan-Ai


    Cyproheptadine (CPH) is a histamine- and serotonin-receptor antagonist, and its effects are observed recently in the modulation of multiple intracellular signals. In this study, we used cortical neurons and HEK-293 cells transfected with Kv2.1 α-subunit to address whether CPH modify neural voltage-gated K(+) channels by a mechanism independent of its serotonergic and histaminergic properties. Our results demonstrate that intracellularly delivered CPH increased the I(K) by reducing the activity of protein kinas A (PKA). Inhibition of G(i) eliminated the CPH-induced effect on both the I(K) and PKA. Blocking of 5-HT-, M-, D(2)-, H(1)- or H(2)-type GPCR receptors with relevant antagonists did not eliminate the CPH-induced effect on the I(K). Antagonists of the sigma-1 receptor, however, blocked the effect of CPH. Moreover, the inhibition of sigma-1 by siRNA knockdown significantly reduced the CPH-induced effect on the I(K). On the contrary, sigma-1 receptor agonist mimicked the effects of CPH on the induction of I(K). A ligand-receptor binding assay indicated that CPH bound to the sigma-1 receptor. Similar effect of CPH were obtained from HEK-293 cells transfected with the α-subunit of Kv2.1. In overall, we reveal for the first time that CPH enhances the I(K) by modulating activity of PKA, and that the associated activation of the sigma-1 receptor/G(i)-protein pathway might be involved. Our findings illustrate an uncharacterized effect of CPH on neuron excitability through the I(K), which is independent of histamine H(1) and serotonin receptors.

  1. Cyproheptadine Enhances the IK of Mouse Cortical Neurons through Sigma-1 Receptor-Mediated Intracellular Signal Pathway

    PubMed Central

    He, Yan-Lin; Zhang, Chun-Lei; Gao, Xiao-Fei; Yao, Jin-Jing; Hu, Chang-Long; Mei, Yan-Ai


    Cyproheptadine (CPH) is a histamine- and serotonin-receptor antagonist, and its effects are observed recently in the modulation of multiple intracellular signals. In this study, we used cortical neurons and HEK-293 cells transfected with Kv2.1 α-subunit to address whether CPH modify neural voltage-gated K+ channels by a mechanism independent of its serotonergic and histaminergic properties. Our results demonstrate that intracellularly delivered CPH increased the IK by reducing the activity of protein kinas A (PKA). Inhibition of Gi eliminated the CPH-induced effect on both the IK and PKA. Blocking of 5-HT-, M-, D2-, H1- or H2- type GPCR receptors with relevant antagonists did not eliminate the CPH-induced effect on the IK. Antagonists of the sigma-1 receptor, however, blocked the effect of CPH. Moreover, the inhibition of sigma-1 by siRNA knockdown significantly reduced the CPH-induced effect on the IK. On the contrary, sigma-1 receptor agonist mimicked the effects of CPH on the induction of IK. A ligand-receptor binding assay indicated that CPH bound to the sigma-1 receptor. Similar effect of CPH were obtained from HEK-293 cells transfected with the α-subunit of Kv2.1. In overall, we reveal for the first time that CPH enhances the IK by modulating activity of PKA, and that the associated activation of the sigma-1 receptor/Gi-protein pathway might be involved. Our findings illustrate an uncharacterized effect of CPH on neuron excitability through the IK, which is independent of histamine H1 and serotonin receptors. PMID:22844454

  2. Cinnamaldehyde inhibits pro-inflammatory cytokines secretion from monocytes/macrophages through suppression of intracellular signaling.


    Chao, Louis Kuoping; Hua, Kuo-Feng; Hsu, Hsien-Yeh; Cheng, Sen-Sung; Lin, I-Fan; Chen, Chia-Jung; Chen, Shui-Tein; Chang, Shang-Tzen


    We investigated the in vitro anti-inflammatory effects of Cinnamaldehyde, a cytokine production inhibitor isolated from an essential oil produced from the leaves of Cinnamomum osmophloeum Kaneh, and its mechanism of action. Although Cinnamaldehyde has been reported to have contact sensitizing properties at high concentration (mM), we found that low concentration of Cinnamaldehyde (muM) inhibited the secretion of interleukin-1beta and tumor necrosis factor alpha within lipopolysaccharide (LPS) or lipoteichoic acid (LTA) stimulated murine J774A.1 macrophages. Cinnamaldehyde also suppressed the production of these cytokines from LPS stimulated human blood monocytes derived primary macrophages and human THP-1 monocytes. Furthermore, Cinnamaldehyde also inhibited the production of prointerleukin-1beta within LPS or LTA stimulated human THP-1 monocytes. Reactive oxygen species release from LPS stimulated J774A.1 macrophages was reduced by Cinnamaldehyde. The phosphorylation of extracellular signal-regulated kinase 1/2 and c-Jun N-terminal kinase 1/2 induced by LPS was also inhibited by Cinnamaldehyde; however, Cinnamaldehyde neither antagonize the binding of LPS to the cells nor alter the cell surface expression of toll-like receptor 4 and CD14. In addition, we also noted that Cinnamaldehyde appeared to elicit no cytotoxic effect upon J774A.1 macrophages under our experimental conditions, although Cinnamaldehyde reduced J774A.1 macrophages proliferation as analysed by MTT assay. Our current results have demonstrated the anti-oxidation and anti-inflammatory properties of Cinnamaldehyde that could provide the possibility for Cinnamaldehyde's future pharmaceutical application in the realm of immuno-modulation.

  3. Regulation of spine and synapse formation by activity-dependent intracellular signaling pathways

    PubMed Central

    Saneyoshi, Takeo; Fortin, Dale A; Soderling, Thomas R


    Formation of the human brain during embryonic and postnatal development is an extraordinarily complex process resulting at maturity in billions of neurons with trillions of specialized connections called synapses. These synapses, composed of a varicosity or bouton from a presynaptic neuron that communicates with a dendritic spine of the postsynaptic neuron, comprise the neural network that is essential for complex behavioral phenomena and cognition. Inappropriate synapse formation or structure is thought to underlie several developmental neuropathologies. Even in the mature CNS, alterations in synapse structure and function continues to be a very dynamic process that is foundational to learning and memory as well as other adaptive abilities of the brain. This synaptic plasticity in mature neurons, which is often triggered by certain patterns of neural activity, is again multifaceted and involves post-translational modifications (e.g. phosphorylation) and subcellular relocalization or trafficking (endocytosis/exocytosis) of existing synaptic proteins, initiation of protein synthesis from existing mRNAs localized in dendrites or spines, and triggering of new gene transcription in the nucleus. These various cellular processes support varying temporal components of synaptic plasticity that begin within 1–2 min but can persist for hours to days. This review will give a critical assessment of activity-dependent molecular modulations of synapses reported over the past couple years. Owing to space limitations, it will focus on mammalian excitatory (i.e. glutamatergic) synapses and will not consider several activity-independent signaling pathways (e.g. ephrinB receptor) that also modulate spine and synapse formation [1,2]. PMID:19896363

  4. Adiponectin Receptors Form Homomers and Heteromers Exhibiting Distinct Ligand Binding and Intracellular Signaling Properties*

    PubMed Central

    Almabouada, Farid; Diaz-Ruiz, Alberto; Rabanal-Ruiz, Yoana; Peinado, Juan R.; Vazquez-Martinez, Rafael; Malagon, Maria M.


    Adiponectin binds to two widely expressed receptors (AdipoR1 and AdipoR2) that contain seven transmembrane domains but, unlike G-protein coupled receptors, present an extracellular C terminus and a cytosolic N terminus. Recently, AdipoR1 was found to associate in high order complexes. However, it is still unknown whether AdipoR2 may also form homomers or heteromers with AdipoR1 or if such interactions may be functionally relevant. Herein, we have analyzed the oligomerization pattern of AdipoRs by FRET and immunoprecipitation and evaluated both the internalization of AdipoRs in response to various adiponectin isoforms and the effect of adiponectin binding to different AdipoR combinations on AMP-activated protein kinase phosphorylation and peroxisome proliferator-activated receptor α activation. Transfection of HEK293AD cells with AdipoR1 and AdipoR2 showed that both receptors colocalize at both the plasma membrane and the endoplasmic reticulum. Co-transfection with the different AdipoR pairs yielded high FRET efficiencies in non-stimulated cells, which indicates that AdipoR1 and AdipoR2 form homo- and heteromeric complexes under resting conditions. Live FRET imaging suggested that both homo- and heteromeric AdipoR complexes dissociate in response to adiponectin, but heteromers separate faster than homomers. Finally, phosphorylation of AMP-activated protein kinase in response to adiponectin was delayed in cells wherein heteromer formation was favored. In sum, our findings indicate that AdipoR1 and AdipoR2 form homo- and heteromers that present unique interaction behaviors and signaling properties. This raises the possibility that the pleiotropic, tissue-dependent functions of adiponectin depend on the expression levels of AdipoR1 and AdipoR2 and, therefore, on the steady-state proportion of homo- and heteromeric complexes. PMID:23255609

  5. The role of polymorphisms in Toll-like receptors and their associated intracellular signaling genes in measles vaccine immunity

    PubMed Central

    Ovsyannikova, Inna G.; Haralambieva, Iana H.; Vierkant, Robert A.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.


    Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11–22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892 mIU/ml, p = 0.002) and a dose-related decrease (2,209 vs. 830 mIU/ml, p = 0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p = 0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-γ Elispot responses (38 vs. 26 spot-forming cells per 2 × 105 PBMCs, p = 0.00002). We observed an additional 12 associations (p < 0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR 2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-α, IFN-γ, IFNλ-1, and TNF-α secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines. PMID:21424379

  6. Expression of the potential therapeutic target CXXC5 in primary acute myeloid leukemia cells - high expression is associated with adverse prognosis as well as altered intracellular signaling and transcriptional regulation

    PubMed Central

    Bruserud, Øystein; Reikvam, Håkon; Fredly, Hanne; Skavland, Jørn; Hagen, Karen-Marie; van Hoang, Tuyen Thy; Brenner, Annette K.; Kadi, Amir; Astori, Audrey; Gjertsen, Bjørn Tore; Pendino, Frederic


    The CXXC5 gene encodes a transcriptional activator with a zinc-finger domain, and high expression in human acute myeloid leukemia (AML) cells is associated with adverse prognosis. We now characterized the biological context of CXXC5 expression in primary human AML cells. The global gene expression profile of AML cells derived from 48 consecutive patients was analyzed; cells with high and low CXXC5 expression then showed major differences with regard to extracellular communication and intracellular signaling. We observed significant differences in the phosphorylation status of several intracellular signaling mediators (CREB, PDK1, SRC, STAT1, p38, STAT3, rpS6) that are important for PI3K-Akt-mTOR signaling and/or transcriptional regulation. High CXXC5 expression was also associated with high mRNA expression of several stem cell-associated transcriptional regulators, the strongest associations being with WT1, GATA2, RUNX1, LYL1, DNMT3, SPI1, and MYB. Finally, CXXC5 knockdown in human AML cell lines caused significantly increased expression of the potential tumor suppressor gene TSC22 and genes encoding the growth factor receptor KIT, the cytokine Angiopoietin 1 and the selenium-containing glycoprotein Selenoprotein P. Thus, high CXXC5 expression seems to affect several steps in human leukemogenesis, including intracellular events as well as extracellular communication. PMID:25605239

  7. Intracellular Signaling and Desmoglein 2 Shedding Triggered by Human Adenoviruses Ad3, Ad14, and Ad14P1

    PubMed Central

    Wang, Hongjie; Ducournau, Corinne; Saydaminova, Kamola; Richter, Maximilian; Yumul, Roma; Ho, Martin; Carter, Darrick; Zubieta, Chloé


    ABSTRACT We recently discovered that desmoglein 2 (DSG2) is a receptor for human adenovirus species B serotypes Ad3, Ad7, Ad11, and Ad14. Ad3 is considered to be a widely distributed human pathogen. Ad3 binding to DSG2 triggers the transient opening of epithelial junctions. Here, we further delineate the mechanism that leads to DSG2-mediated epithelial junction opening in cells exposed to Ad3 and recombinant Ad3 fiber proteins. We identified an Ad3 fiber knob-dependent pathway that involves the phosphorylation of mitogen-activated protein (MAP) kinases triggering the activation of the matrix-metalloproteinase ADAM17. ADAM17, in turn, cleaves the extracellular domain of DSG2 that links epithelial cells together. The shed DSG2 domain can be detected in cell culture supernatant and also in serum of mice with established human xenograft tumors. We then extended our studies to Ad14 and Ad14P1. Ad14 is an important research and clinical object because of the recent appearance of a new, more pathogenic strain (Ad14P1). In a human epithelial cancer xenograft model, Ad14P1 showed more efficient viral spread and oncolysis than Ad14. Here, we tested the hypothesis that a mutation in the Ad14P1 fiber knob could account for the differences between the two strains. While our X-ray crystallography studies suggested an altered three-dimensional (3D) structure of the Ad14P1 fiber knob in the F-G loop region, this did not significantly change the fiber knob affinity to DSG2 or the intracellular signaling and DSG2 shedding in epithelial cancer cells. IMPORTANCE A number of widely distributed adenoviruses use the epithelial junction protein DSG2 as a receptor for infection and lateral spread. Interaction with DSG2 allows the virus not only to enter cells but also to open epithelial junctions which form a physical barrier to virus spread. Our study elucidates the mechanism beyond virus-triggered junction opening with a focus on adenovirus serotype 3. Ad3 binds to DSG2 with its fiber

  8. Intracellular calcium overloading and oxidative stress in cardiomyocyte necrosis via a mitochondriocentric signal-transducer-effector pathway

    PubMed Central

    Shaheen, Mazen; Cheema, Yaser; Shahbaz, Atta U; Bhattacharya, Syamal K; Weber, Karl T


    Congestive heart failure (CHF), a common clinical syndrome, has reached epidemic proportions. Its disabling symptoms account for frequent hospitalizations and readmissions. Pathophysiological mechanisms that lead to CHF and account for its progressive nature are of considerable interest. Important scientific observations obtained from Dr Pawan K Singal’s laboratory in Winnipeg, Manitoba, have provided crucial insights to our understanding of the pathophysiological factors that contribute to cardiomyocyte necrosis (the heart is a postmitotic organ incapable of tolerating an ongoing loss of these cells without adverse functional consequences). This increment in knowledge and the mechanistic insights afforded by Dr Singal and his colleagues have highlighted the role of excessive intracellular calcium accumulation and the appearance of oxidative stress in CHF, in which the rate of reactive oxygen species generation overwhelms their rate of detoxification by antioxidant defenses. They have shown that this common pathophysiological scenario applies to diverse entities such as ischemia/reperfusion and hypoxia/reoxygenation forms of injury, myocardial infarction and the cardiomyopathies that accompany diabetes and excess levels of catecholamines and adriamycin. The authors are honoured to be invited to contribute to the present focus issue of Experimental & Clinical Cardiology in recognizing Dr Singal’s numerous scholarly accomplishments. The present article reviews the authors’ recent work on a mitochondriocentric signal-transducer-effector pathway to cardiomyocyte necrosis found in rats with either an acute stressor state that accompanies isoproterenol administration or a chronic stressor state manifested after four weeks of aldosterone/salt treatment. PMID:22131852

  9. Viral infectivity and intracellular distribution of matrix (M) protein of canine distemper virus are affected by actin filaments.


    Klauschies, F; Gützkow, T; Hinkelmann, S; von Messling, V; Vaske, B; Herrler, G; Haas, L


    To investigate the role of cytoskeletal components in canine distemper virus (CDV) replication, various agents were used that interfere with turnover of actin filaments and microtubules. Only inhibition of actin filaments significantly reduced viral infectivity. Analysis of the intracellular localization of the viral matrix (M) protein revealed that it aligned along actin filaments. Treatment with actin filament-disrupting drugs led to a marked intracellular redistribution of M protein during infection as well as transfection. In contrast, the localization of the CDV fusion (F) protein was not significantly changed during transfection. Thus, a M protein-actin filament interaction appears to be important for generation of infectious CDV.

  10. The effects of red ginseng saponin fraction-A (RGSF-A) on phagocytosis and intracellular signaling in Brucella abortus infected RAW 264.7 cells.


    Arayan, Lauren Togonon; Simborio, Hannah Leah; Reyes, Alisha Wehdnesday Bernardo; Hop, Huynh Tan; Min, WonGi; Lee, Hu Jang; Rhee, Man Hee; Chang, Hong Hee; Kim, Suk


    This study indicated that RGSF-A caused a marked reduction in the adherence, internalization and intracellular growth of Brucella abortus in RGSF-A-treated cells. Furthermore, a decline in the intensity of F-actin fluorescence was observed in RGSF-A-treated cells compared with untreated B. abortus-infected cells. In addition, an evaluation of phagocytic signaling proteins by Western blot analysis revealed an apparent reduction of ERK and p38α phosphorylation levels in B. abortus-infected RGSF-A-treated cells compared with the control. Upon intracellular trafficking of the pathogen, a higher number of B. abortus-containing phagosomes colocalized with LAMP-1 in RGSF-A-treated cells compared with control cells. These results strongly suggest that inhibition of B. abortus uptake could be mediated by suppression in the activation of MAPKs signaling proteins phospho-ERK 1/2, and p38 levels. On the other hand, inhibition of intracellular replication results from the enhancement of phagolysosome fusion in host macrophages. This study highlights the phagocytic and intracellular modulating effect of RGSF-A and its potential as an alternative remedy to control B. abortus infection.

  11. Does low intensity He-Ne laser radiation affect the intracellular pH of intact Escherichia coli cells?

    NASA Astrophysics Data System (ADS)

    Quickenden, Terence I.; Daniels, Lillian L. L.; Byrne, Lyndsay T.


    Claims that low levels of He-Ne laser light (cw, (lambda) equals 632.8 nm) can provide clinical benefits and can enhance in vitro cellular growth are still controversial (T.I. Quickenden and L.L. Daniels, 1993, Photochem. Photobiol. 57, 272-278; L.L. Daniels and T.I. Quickenden, 1994, Photochem. Photobiol., 60, 481-485). The present study tests the suggestion (T.I. Karu, 1988, Lasers life Sci. 2, 53-74; H. Friedmann, R. Lubart, I. Laulicht and S. Rochkink, 1991, J. Photochem. Photobiol. B: Biol. 11, 87-91) that red light stimulates mitosis by raising intracellular pH via absorption by chromophores in the respiratory chain. In order to search for photoinduced changes in intracellular pH, the effect of 5 mW He-Ne laser irradiation on cultures of E. coli was examined using a 300 MHz Nuclear Magnetic Resonance (NMR) spectrometer. The pH difference between the intracellular and extracellular fluid was monitored in the presence and absence of radiation by determining the difference in chemical shift for 31P resonances arising from the H2PO4- ⇔ HPO42- + H+ equilibrium in the two environments.

  12. Does Signal Degradation Affect Top-Down Processing of Speech?


    Wagner, Anita; Pals, Carina; de Blecourt, Charlotte M; Sarampalis, Anastasios; Başkent, Deniz


    Speech perception is formed based on both the acoustic signal and listeners' knowledge of the world and semantic context. Access to semantic information can facilitate interpretation of degraded speech, such as speech in background noise or the speech signal transmitted via cochlear implants (CIs). This paper focuses on the latter, and investigates the time course of understanding words, and how sentential context reduces listeners' dependency on the acoustic signal for natural and degraded speech via an acoustic CI simulation.In an eye-tracking experiment we combined recordings of listeners' gaze fixations with pupillometry, to capture effects of semantic information on both the time course and effort of speech processing. Normal-hearing listeners were presented with sentences with or without a semantically constraining verb (e.g., crawl) preceding the target (baby), and their ocular responses were recorded to four pictures, including the target, a phonological (bay) competitor and a semantic (worm) and an unrelated distractor.The results show that in natural speech, listeners' gazes reflect their uptake of acoustic information, and integration of preceding semantic context. Degradation of the signal leads to a later disambiguation of phonologically similar words, and to a delay in integration of semantic information. Complementary to this, the pupil dilation data show that early semantic integration reduces the effort in disambiguating phonologically similar words. Processing degraded speech comes with increased effort due to the impoverished nature of the signal. Delayed integration of semantic information further constrains listeners' ability to compensate for inaudible signals.

  13. Heteromerization of dopamine D2 receptors with dopamine D1 or D5 receptors generates intracellular calcium signaling by different mechanisms

    PubMed Central

    Hasbi, Ahmed; O’Dowd, Brian F.; George, Susan R.


    The repertoire of signal transduction pathways activated by dopamine in brain includes the increase of intracellular calcium. However the mechanism(s) by which dopamine activated this important second messenger system was unknown. Although we showed that activation of the D5 dopamine receptor increased calcium concentrations, the restricted anatomic distribution of this receptor made this unlikely to be the major mechanism in brain. We have identified novel heteromeric dopamine receptor complexes that are linked to calcium signaling. The calcium pathway activated through the D1–D2 receptor heteromer involved coupling to Gq, through phospholipase C and IP3 receptors to result in a rise in intracellular calcium. The calcium rise activated through the D2–D5 receptor heteromer involved a small rise in intracellular calcium through the Gq pathway that triggered a store operated channel mediated influx of extracellular calcium. These novel receptor heteromeric complexes, for the first time, establish the link between dopamine action and rapid calcium signaling. PMID:19897420

  14. Role of intracellular Ca2+ signal in the ascorbate-induced apoptosis in a human hepatoma cell line.


    Lee, Yong Soo


    Although ascorbate (vitamin C) has been shown to have anti-cancer actions, its effect on human hepatoma cells has not yet been investigated, and thus, the exact mechanism of this action is not fully understood. In this study, the mechanism by which ascorbate induces apoptosis using HepG2 human hepatoblastoma cells is investigated. Ascorbate induced apoptotic cell death in a dose-dependent manner in the cells, was assessed through flow cytometric analysis. Contrary to expectation, ascorbate did not alter the cellular redox status, and treatment with antioxidants (N-acetyl cysteine and N,N-diphenyl-p-phenylenediamine) had no influence on the ascorbate-induced apoptosis. However, ascorbate induced a rapid and sustained increase in intracellular Ca2+ concentration. EGTA, an extracellular Ca2+ chelator did not significantly alter the ascorbate-induced intracellular Ca2+ increase and apoptosis, whereas dantrolene, an intracellular Ca2+ release blocker, completely blocked these actions of ascorbate. In addition, phospholipase C (PLC) inhibitors (U-73122 and manoalide) significantly suppressed the intracellular Ca2+ release and apoptosis induced by ascorbate. Collectively, these results suggest that ascorbate induced apoptosis without changes in the cellular redox status in HepG2 cells, and that the PLC-coupled intracellular Ca2+ release mechanism may mediate ascorbate-induced apoptosis.

  15. Intracellular mechanisms involved in copper-gonadotropin-releasing hormone (Cu-GnRH) complex-induced cAMP/PKA signaling in female rat anterior pituitary cells in vitro.


    Gajewska, Alina; Zielinska-Gorska, Marlena; Wolinska-Witort, Ewa; Siawrys, Gabriela; Baran, Marta; Kotarba, Grzegorz; Biernacka, Katarzyna


    The copper-gonadotropin-releasing hormone molecule (Cu-GnRH) is a GnRH analog, which preserves its amino acid sequence, but which contains a Cu(2+) ion stably bound to the nitrogen atoms including that of the imidazole ring of Histidine(2). A previous report indicated that Cu-GnRH was able to activate cAMP/PKA signaling in anterior pituitary cells in vitro, but raised the question of which intracellular mechanism(s) mediated the Cu-GnRH-induced cAMP synthesis in gonadotropes. To investigate this mechanism, in the present study, female rat anterior pituitary cells in vitro were pretreated with 0.1 μM antide, a GnRH antagonist; 0.1 μM cetrorelix, a GnRH receptor antagonist; 0.1 μM PACAP6-38, a PAC-1 receptor antagonist; 2 μM GF109203X, a protein kinase C inhibitor; 50 mM PMA, a protein kinase C activator; the protein kinase A inhibitors H89 (30 μM) and KT5720 (60 nM); factors affecting intracellular calcium activity: 2.5 mM EGTA; 2 μM thapsigargin; 5 μM A23187, a Ca(2+) ionophore; or 10 μg/ml cycloheximide, a protein synthesis inhibitor. After one of the above pretreatments, cells were incubated in the presence of 0.1 μM Cu-GnRH for 0.5, 1, and 3 h. Radioimmunoassay analysis of cAMP confirmed the functional link between Cu-GnRH stimulation and cAMP/PKA signal transduction in rat anterior pituitary cells, demonstrating increased intracellular cAMP, which was reduced in the presence of specific PKA inhibitors. The stimulatory effect of Cu-GnRH on cAMP production was partly dependent on GnRH receptor activation. In addition, an indirect and Ca(2+)-dependent mechanism might be involved in intracellular adenylate cyclase stimulation. Neither activation of protein kinase C nor new protein synthesis was involved in the Cu-GnRH-induced increase of cAMP in the rat anterior pituitary primary cultures. Presented data indicate that conformational changes of GnRH molecule resulting from cooper ion coordination affect specific pharmacological properties of Cu

  16. Electrochemically triggered release of acetylcholine from scCO2 impregnated conductive polymer films evokes intracellular Ca(2+) signaling in neurotypic SH-SY5Y cells.


    Löffler, Susanne; Seyock, Silke; Nybom, Rolf; Jacobson, Gunilla B; Richter-Dahlfors, Agneta


    Implantable devices for electronically triggered drug release are attractive to achieve spatial and temporal control over drug concentrations in patients. Realization of such devices is, however, associated with technical and biological challenges. Among these are containment of drug reservoirs, lack of precise control cues, as well as the charge and size of the drug. Here, we present a method for electronically triggered release of the quaternary ammonium cation acetylcholine (ACh) from an impregnated conductive polymer film. Using supercritical carbon dioxide (scCO2), a film of PEDOT/PSS (poly(3,4)-ethylenedioxythiophene doped with poly(styrenesulfonate)) is impregnated with the neurotransmitter acetylcholine. The gentle scCO2 process generated a dry, drug-impregnated surface, well suited for interaction with biological material, while maintaining normal electrochemical properties of the polymer. Electrochemical switching of impregnated PEDOT/PSS films stimulated release of ACh from the polymer matrix, likely due to swelling mediated by the influx and efflux of charged and solvated ions. Triggered release of ACh did not affect the biological activity of the drug. This was shown by real-time monitoring of intracellular Ca(2+) signaling in neurotypic cells growing on the impregnated polymer surface. Collectively, scCO2 impregnation of conducting polymers offers the first one-step, dopant-independent drug impregnation process, potentially facilitating loading of both anionic and cationic drugs that can be dissolved in scCO2 on its own or by using a co-solvent. We foresee that scCO2-loaded devices for electronically triggered drug release will create novel opportunities when generating active bio-coatings, tunable for specific needs, in a variety of medical settings.

  17. Ethanol Tolerance Affects Endogenous Adenosine Signaling in Mouse Hippocampus

    PubMed Central

    Zhang, Dali; Xiong, Wei; Jackson, Michael F.


    Ethanol has many pharmacological effects, including increases in endogenous adenosine levels and adenosine receptor activity in brain. Ethanol consumption is associated with both positive and negative health outcomes, but tolerance to the behavioral effects of ethanol can lead to increased consumption, which increases the risk of negative health outcomes. The present study was performed to test whether a 7-day treatment with ethanol is linked to reduced adenosine signaling and whether this is a consequence of reduced ecto-5′-nucleotidase activity. Wild-type (CD73+/+) and ecto-5′-nucleotidase-deficient (CD73−/−) mice were treated with ethanol (2 g/kg) or saline for 7 days. In CD73+/+ mice, repeated ethanol treatment reduced the hypothermic and ataxic effects of acute ethanol, indicating the development of tolerance to the acute effects of ethanol. In CD73+/+ mice, this 7-day ethanol treatment led to increased hippocampal synaptic activity and reduced adenosine A1 receptor activity under both basal and low Mg2+ conditions. These effects of ethanol tolerance were associated with an 18% decrease in activity of ecto-5′-nucleotidase activity in hippocampal cell membranes. In contrast, ethanol treatment was not associated with changes in synaptic activity or adenosine signaling in hippocampus from CD73−/− mice. These data indicate that ethanol treatment is associated with a reduction in adenosine signaling through adenosine A1 receptors in hippocampus, mediated, at least in part, via reduced ecto-5′-nucleotidase activity. PMID:27189965

  18. Intracellular pH and calcium signaling as molecular targets of diclofenac-induced apoptosis against colon cancer.


    Kaur, Jasmeet; Sanyal, Sankar Nath


    The role of intracellular pH and Ca2+ and their association with mitochondrial dysfunction and intracellular reactive oxygen species (ROS) are explored in the chemoprevention of colon cancer. 1,2-dimethylhydrazine dihydrochloride (DMH), a potent procarcinogen with selectivity for the colon, at a dose of 30 mg/kg body weight was used to induce initial stages of colon cancer when administered for 6 weeks in male Sprague-Dawley rats. Diclofenac, a preferential cyclooxygenase-2 inhibitor, was used at the anti-inflammatory dose (8 mg/kg body weight) for chemoprevention. The control group was administered vehicles for both DMH and diclofenac. A diclofenac-alone group with the same dose was also run simultaneously. Intracellular pH values as determined by biscarboxyethyl carboxyfluorescein fluorescence assay showed an alkaline pH in colonocytes from the DMH-treated group as compared with the control group. Moreover, the level of intracellular Ca2+ was also found to be decreased with DMH treatment, as shown by the fura-2 acetoxymethyl study and chlortetracycline assay. Apoptosis was studied by comet assay and Apaf-1 immunofluorescent expression and was found to be markedly decreased in this group, indicating that disturbances in pH and Ca2+ homeostasis promoted proliferation in colon and inhibited apoptosis. Changes in mitochondrial membrane potential and ROS levels were analyzed in isolated colonocytes by rhodamine 123 and 2,7-dichlorofluorescein diacetate labeling, respectively. DMH treatment promoted a higher mitochondrial membrane potential while reducing ROS levels. These parameters are known to be associated with pH and Ca2+ changes intracellularly and hence can be suggested to be linked with them in this study also. Diclofenac promoted apoptosis in colonocytes when coadministered with DMH and also ameliorated the changes observed in the above parameters, confirming these mechanisms as early events for the onset of apoptosis in cancer cells.

  19. Limiting angiotensin II signaling with a cell penetrating peptide mimicking the second intracellular loop of the angiotensin II type I receptor

    PubMed Central

    Yu, Jun; Taylor, Linda; Mierke, Dale; Berg, Eric; Shia, Michael; Fishman, Jordan; Sallum, Christine; Polgar, Peter


    A cell-penetrating peptide consisting of the second intracellular loop (IC2) of the Angiotensin II (AngII) type I receptor (AT1) linked to the HIV transactivating regulatory protein (TAT) domain was used to identify the role of this motif for intracellular signal transduction. HEK-293 cells stably transfected with AT1R cDNA and primary cultures of human pulmonary artery smooth muscle cells expressing endogenous AT1 receptor were exposed to the cell-penetrating peptide construct and the effect on angiotensin II signaling determined. The AT1 IC2 peptide effectively inhibited AngII stimulated phosphatidylinositol turnover and calcium influx. It also limited the activation of Akt/PKB as determined by an inhibition of phosphorylation of Akt at Ser473 and completely abolished the AngII dependent activation of the transcriptional factor NFκB. In contrast, the AT1 IC2 peptide had no effect on AngII/AT1 receptor activation of ERK. These results illustrate the potential of using cell penetrating peptides to both delineate receptor-mediated signal transduction as well as to selectively regulate G protein coupled receptor signaling. PMID:20492449

  20. Identification of an endocytosis motif in an intracellular loop of Wntless protein, essential for its recycling and the control of Wnt protein signaling.


    Gasnereau, Isabelle; Herr, Patrick; Chia, Pei Zhi Cheryl; Basler, Konrad; Gleeson, Paul A


    The secretion of Wnt signaling proteins is dependent upon the transmembrane sorting receptor, Wntless (Wls), which recycles between the trans-Golgi network and the cell surface. Loss of Wls results in impairment of Wnt secretion and defects in development and homeostasis in Drosophila, Caenorhabditis elegans, and the mouse. The sorting signals for the internalization and trafficking of Wls have not been defined. Here, we demonstrate that Wls internalization requires clathrin and dynamin I, components of the clathrin-mediated endocytosis pathway. Moreover, we have identified a conserved YXXϕ endocytosis motif in the third intracellular loop of the multipass membrane protein Wls. Mutation of the tyrosine-based motif YEGL to AEGL (Y425A) resulted in the accumulation of human mutant Wls on the cell surface of transfected HeLa cells. The cell surface accumulation of Wls(AEGL) was rescued by the insertion of a classical YXXϕ motif in the cytoplasmic tail. Significantly, a Drosophila Wls(AEGL) mutant displayed a wing notch phenotype, with reduced Wnt secretion and signaling. These findings demonstrate that YXXϕ endocytosis motifs can occur in the intracellular loops of multipass membrane proteins and, moreover, provide direct evidence that the trafficking of Wls is required for efficient secretion of Wnt signaling proteins.

  1. Identification of an Endocytosis Motif in an Intracellular Loop of Wntless Protein, Essential for Its Recycling and the Control of Wnt Protein Signaling*

    PubMed Central

    Gasnereau, Isabelle; Herr, Patrick; Chia, Pei Zhi Cheryl; Basler, Konrad; Gleeson, Paul A.


    The secretion of Wnt signaling proteins is dependent upon the transmembrane sorting receptor, Wntless (Wls), which recycles between the trans-Golgi network and the cell surface. Loss of Wls results in impairment of Wnt secretion and defects in development and homeostasis in Drosophila, Caenorhabditis elegans, and the mouse. The sorting signals for the internalization and trafficking of Wls have not been defined. Here, we demonstrate that Wls internalization requires clathrin and dynamin I, components of the clathrin-mediated endocytosis pathway. Moreover, we have identified a conserved YXXφ endocytosis motif in the third intracellular loop of the multipass membrane protein Wls. Mutation of the tyrosine-based motif YEGL to AEGL (Y425A) resulted in the accumulation of human mutant Wls on the cell surface of transfected HeLa cells. The cell surface accumulation of WlsAEGL was rescued by the insertion of a classical YXXφ motif in the cytoplasmic tail. Significantly, a Drosophila WlsAEGL mutant displayed a wing notch phenotype, with reduced Wnt secretion and signaling. These findings demonstrate that YXXφ endocytosis motifs can occur in the intracellular loops of multipass membrane proteins and, moreover, provide direct evidence that the trafficking of Wls is required for efficient secretion of Wnt signaling proteins. PMID:22027831

  2. 47 CFR 73.4157 - Network signals which adversely affect affiliate broadcast service.

    Code of Federal Regulations, 2010 CFR


    ....4157 Network signals which adversely affect affiliate broadcast service. See Public Notice, FCC 79-387... 47 Telecommunication 4 2010-10-01 2010-10-01 false Network signals which adversely affect affiliate broadcast service. 73.4157 Section 73.4157 Telecommunication FEDERAL COMMUNICATIONS...

  3. Short food deprivation inhibits orexin receptor 1 expression and orexin-A induced intracellular calcium signaling in acutely isolated duodenal enterocytes.


    Bengtsson, Magnus W; Mäkelä, Kari; Herzig, Karl-Heinz; Flemström, Gunnar


    Close intra-arterial infusion of the appetite regulating peptide orexin-A stimulates bicarbonate secretion from the duodenal mucosa. The aim of the present study was to elucidate the ability of orexin-A to induce intracellular calcium signaling in acutely isolated duodenal enterocytes. Freshly isolated clusters of enterocytes, obtained from rat duodenal mucosa or human duodenal biopsies, were loaded with fura 2-AM and mounted in a perfusion chamber. Cryptlike enterocytes were selected (caged), and changes in intracellular calcium concentration ([Ca2+]i) were evaluated by fluorescence imaging. Total RNA was extracted from pellets of enterocytes and reverse transcribed to cDNA, and expression of orexin receptors 1 and 2 (OX1R and OX2R) was measured by quantitative real-time PCR. Orexin-A at all concentrations tested (1-100 nM) increased [Ca2+]i in enterocytes isolated from continuously fed rats, and the OX1R-antagonist SB-334867 (10 nM) attenuated the response. The primary [Ca2+]i response was a slow increase to a sustained plateau persisting after orexin-A removal, and a similar response was observed in enterocytes from human biopsies. In contrast to orexin-A, the OX2R agonist (Ala11,D-Leu15)-orexin-B (1-10 nM) did not induce calcium signaling. There were no significant [Ca2+]i responses in enterocytes from animals food deprived overnight, and overnight fasting decreased (P<0.01) enterocyte OX1R as well as OX2R mRNA. Induction of intracellular calcium signaling in isolated duodenal enterocytes is thus mediated primarily by OX1R receptors. Short (overnight) food deprivation markedly depresses receptor expression and inhibits orexin-A induced increases in [Ca2+]i. Studies of enterocyte signaling and intestinal secretion requires particular evaluation regarding feeding status.

  4. Systems Biomedicine of Rabies Delineates the Affected Signaling Pathways.


    Azimzadeh Jamalkandi, Sadegh; Mozhgani, Sayed-Hamidreza; Gholami Pourbadie, Hamid; Mirzaie, Mehdi; Noorbakhsh, Farshid; Vaziri, Behrouz; Gholami, Alireza; Ansari-Pour, Naser; Jafari, Mohieddin


    The prototypical neurotropic virus, rabies, is a member of the Rhabdoviridae family that causes lethal encephalomyelitis. Although there have been a plethora of studies investigating the etiological mechanism of the rabies virus and many precautionary methods have been implemented to avert the disease outbreak over the last century, the disease has surprisingly no definite remedy at its late stages. The psychological symptoms and the underlying etiology, as well as the rare survival rate from rabies encephalitis, has still remained a mystery. We, therefore, undertook a systems biomedicine approach to identify the network of gene products implicated in rabies. This was done by meta-analyzing whole-transcriptome microarray datasets of the CNS infected by strain CVS-11, and integrating them with interactome data using computational and statistical methods. We first determined the differentially expressed genes (DEGs) in each study and horizontally integrated the results at the mRNA and microRNA levels separately. A total of 61 seed genes involved in signal propagation system were obtained by means of unifying mRNA and microRNA detected integrated DEGs. We then reconstructed a refined protein-protein interaction network (PPIN) of infected cells to elucidate the rabies-implicated signal transduction network (RISN). To validate our findings, we confirmed differential expression of randomly selected genes in the network using Real-time PCR. In conclusion, the identification of seed genes and their network neighborhood within the refined PPIN can be useful for demonstrating signaling pathways including interferon circumvent, toward proliferation and survival, and neuropathological clue, explaining the intricate underlying molecular neuropathology of rabies infection and thus rendered a molecular framework for predicting potential drug targets.

  5. Animal signals and emotion in music: coordinating affect across groups

    PubMed Central

    Bryant, Gregory A.


    Researchers studying the emotional impact of music have not traditionally been concerned with the principled relationship between form and function in evolved animal signals. The acoustic structure of musical forms is related in important ways to emotion perception, and thus research on non-human animal vocalizations is relevant for understanding emotion in music. Musical behavior occurs in cultural contexts that include many other coordinated activities which mark group identity, and can allow people to communicate within and between social alliances. The emotional impact of music might be best understood as a proximate mechanism serving an ultimately social function. Recent work reveals intimate connections between properties of certain animal signals and evocative aspects of human music, including (1) examinations of the role of nonlinearities (e.g., broadband noise) in non-human animal vocalizations, and the analogous production and perception of these features in human music, and (2) an analysis of group musical performances and possible relationships to non-human animal chorusing and emotional contagion effects. Communicative features in music are likely due primarily to evolutionary by-products of phylogenetically older, but still intact communication systems. But in some cases, such as the coordinated rhythmic sounds produced by groups of musicians, our appreciation and emotional engagement might be driven by an adaptive social signaling system. Future empirical work should examine human musical behavior through the comparative lens of behavioral ecology and an adaptationist cognitive science. By this view, particular coordinated sound combinations generated by musicians exploit evolved perceptual response biases – many shared across species – and proliferate through cultural evolutionary processes. PMID:24427146

  6. Systems Biomedicine of Rabies Delineates the Affected Signaling Pathways

    PubMed Central

    Azimzadeh Jamalkandi, Sadegh; Mozhgani, Sayed-Hamidreza; Gholami Pourbadie, Hamid; Mirzaie, Mehdi; Noorbakhsh, Farshid; Vaziri, Behrouz; Gholami, Alireza; Ansari-Pour, Naser; Jafari, Mohieddin


    The prototypical neurotropic virus, rabies, is a member of the Rhabdoviridae family that causes lethal encephalomyelitis. Although there have been a plethora of studies investigating the etiological mechanism of the rabies virus and many precautionary methods have been implemented to avert the disease outbreak over the last century, the disease has surprisingly no definite remedy at its late stages. The psychological symptoms and the underlying etiology, as well as the rare survival rate from rabies encephalitis, has still remained a mystery. We, therefore, undertook a systems biomedicine approach to identify the network of gene products implicated in rabies. This was done by meta-analyzing whole-transcriptome microarray datasets of the CNS infected by strain CVS-11, and integrating them with interactome data using computational and statistical methods. We first determined the differentially expressed genes (DEGs) in each study and horizontally integrated the results at the mRNA and microRNA levels separately. A total of 61 seed genes involved in signal propagation system were obtained by means of unifying mRNA and microRNA detected integrated DEGs. We then reconstructed a refined protein–protein interaction network (PPIN) of infected cells to elucidate the rabies-implicated signal transduction network (RISN). To validate our findings, we confirmed differential expression of randomly selected genes in the network using Real-time PCR. In conclusion, the identification of seed genes and their network neighborhood within the refined PPIN can be useful for demonstrating signaling pathways including interferon circumvent, toward proliferation and survival, and neuropathological clue, explaining the intricate underlying molecular neuropathology of rabies infection and thus rendered a molecular framework for predicting potential drug targets. PMID:27872612

  7. Retinoic Acid Signaling Affects Cortical Synchrony During Sleep

    NASA Astrophysics Data System (ADS)

    Maret, Stéphanie; Franken, Paul; Dauvilliers, Yves; Ghyselinck, Norbert B.; Chambon, Pierre; Tafti, Mehdi


    Delta oscillations, characteristic of the electroencephalogram (EEG) of slow wave sleep, estimate sleep depth and need and are thought to be closely linked to the recovery function of sleep. The cellular mechanisms underlying the generation of delta waves at the cortical and thalamic levels are well documented, but the molecular regulatory mechanisms remain elusive. Here we demonstrate in the mouse that the gene encoding the retinoic acid receptor beta determines the contribution of delta oscillations to the sleep EEG. Thus, retinoic acid signaling, which is involved in the patterning of the brain and dopaminergic pathways, regulates cortical synchrony in the adult.

  8. Cell wall assembly and intracellular trafficking in plant cells are directly affected by changes in the magnitude of gravitational acceleration.


    Chebli, Youssef; Pujol, Lauranne; Shojaeifard, Anahid; Brouwer, Iman; van Loon, Jack J W A; Geitmann, Anja


    Plants are able to sense the magnitude and direction of gravity. This capacity is thought to reside in selected cell types within the plant body that are equipped with specialized organelles called statoliths. However, most plant cells do not possess statoliths, yet they respond to changes in gravitational acceleration. To understand the effect of gravity on the metabolism and cellular functioning of non-specialized plant cells, we investigated a rapidly growing plant cell devoid of known statoliths and without gravitropic behavior, the pollen tube. The effects of hyper-gravity and omnidirectional exposure to gravity on intracellular trafficking and on cell wall assembly were assessed in Camellia pollen tubes, a model system with highly reproducible growth behavior in vitro. Using an epi-fluorescence microscope mounted on the Large Diameter Centrifuge at the European Space Agency, we were able to demonstrate that vesicular trafficking is reduced under hyper-gravity conditions. Immuno-cytochemistry confirmed that both in hyper and omnidirectional gravity conditions, the characteristic spatial profiles of cellulose and callose distribution in the pollen tube wall were altered, in accordance with a dose-dependent effect on pollen tube diameter. Our findings suggest that in response to gravity induced stress, the pollen tube responds by modifying cell wall assembly to compensate for the altered mechanical load. The effect was reversible within few minutes demonstrating that the pollen tube is able to quickly adapt to changing stress conditions.

  9. Intracellular carbonic anhydrase activity sensitizes cancer cell pH signaling to dynamic changes in CO2 partial pressure.


    Hulikova, Alzbeta; Aveyard, Nicholas; Harris, Adrian L; Vaughan-Jones, Richard D; Swietach, Pawel


    Carbonic anhydrase (CA) enzymes catalyze the chemical equilibration among CO2, HCO3(-) and H(+). Intracellular CA (CAi) isoforms are present in certain types of cancer, and growing evidence suggests that low levels correlate with disease severity. However, their physiological role remains unclear. Cancer cell CAi activity, measured as cytoplasmic CO2 hydration rate (kf), ranged from high in colorectal HCT116 (∼2 s(-1)), bladder RT112 and colorectal HT29, moderate in fibrosarcoma HT1080 to negligible (i.e. spontaneous kf = 0.18 s(-1)) in cervical HeLa and breast MDA-MB-468 cells. CAi activity in cells correlated with CAII immunoreactivity and enzymatic activity in membrane-free lysates, suggesting that soluble CAII is an important intracellular isoform. CAi catalysis was not obligatory for supporting acid extrusion by H(+) efflux or HCO3(-) influx, nor for maintaining intracellular pH (pHi) uniformity. However, in the absence of CAi activity, acid loading from a highly alkaline pHi was rate-limited by HCO3(-) supply from spontaneous CO2 hydration. In solid tumors, time-dependence of blood flow can result in fluctuations of CO2 partial pressure (pCO2) that disturb cytoplasmic CO2-HCO3(-)-H(+) equilibrium. In cancer cells with high CAi activity, extracellular pCO2 fluctuations evoked faster and larger pHi oscillations. Functionally, these resulted in larger pH-dependent intracellular [Ca(2+)] oscillations and stronger inhibition of the mTORC1 pathway reported by S6 kinase phosphorylation. In contrast, the pHi of cells with low CAi activity was less responsive to pCO2 fluctuations. Such low pass filtering would "buffer" cancer cell pHi from non-steady-state extracellular pCO2. Thus, CAi activity determines the coupling between pCO2 (a function of tumor perfusion) and pHi (a potent modulator of cancer cell physiology).

  10. Membrane lipids, EGF receptors, and intracellular signals colocalize and are polarized in epithelial cells moving directionally in a physiological electric field.


    Zhao, Min; Pu, Jin; Forrester, John V; McCaig, Colin D


    Directed cell migration is essential for tissue formation, inflammation, and wound healing. Chemotaxis plays a major role in these situations and is underpinned by asymmetric intracellular signaling. Endogenous electric fields (EFs) are common where cell movement occurs, such as in wound healing, and cells respond to electric field gradients by reorienting and migrating directionally (galvanotaxis/electrotaxis). We show that a physiological EF redistributed both EGF (epidermal growth factor) receptors and detergent-insoluble membrane lipids asymmetrically, leading to cathodal polarization and enhanced activation of the MAP kinase, ERK1/2. This induced leading-edge actin polymerization in directionally migrating mammalian epithelial cells. Inhibiting the EGF receptor-MAP kinase signaling pathway significantly decreased leading edge actin asymmetry and directional migration. We propose a model in which EF-polarized membrane lipid domains and EGF receptors cause asymmetric signaling through MAP kinase, which drives directional cell migration. A comparison is made with the mechanisms underpinning chemotaxis.

  11. Radiofrequency signal affects alpha band in resting electroencephalogram

    PubMed Central

    Ghosn, Rania; Yahia-Cherif, Lydia; Hugueville, Laurent; Ducorps, Antoine; Lemaréchal, Jean-Didier; Thuróczy, György; de Seze, René


    The aim of the present work was to investigate the effects of the radiofrequency (RF) electromagnetic fields (EMFs) on human resting EEG with a control of some parameters that are known to affect alpha band, such as electrode impedance, salivary cortisol, and caffeine. Eyes-open and eyes-closed resting EEG data were recorded in 26 healthy young subjects under two conditions: sham exposure and real exposure in double-blind, counterbalanced, crossover design. Spectral power of EEG rhythms was calculated for the alpha band (8–12 Hz). Saliva samples were collected before and after the study. Salivary cortisol and caffeine were assessed by ELISA and HPLC, respectively. The electrode impedance was recorded at the beginning of each run. Compared with the sham session, the exposure session showed a statistically significant (P < 0.0001) decrease of the alpha band spectral power during closed-eyes condition. This effect persisted in the postexposure session (P < 0.0001). No significant changes were detected in electrode impedance, salivary cortisol, and caffeine in the sham session compared with the exposure one. These results suggest that GSM-EMFs of a mobile phone affect the alpha band within spectral power of resting human EEG. PMID:25695646

  12. Conjugated Bilirubin Differentially Regulates CD4+ T Effector Cells and T Regulatory Cell Function through Outside-In and Inside-Out Mechanisms: The Effects of HAV Cell Surface Receptor and Intracellular Signaling

    PubMed Central

    Corral-Jara, Karla F.; Gómez-Leyva, Juan F.; Rosenstein, Yvonne; Jose-Abrego, Alexis; Roman, Sonia


    We recently reported an immune-modulatory role of conjugated bilirubin (CB) in hepatitis A virus (HAV) infection. During this infection the immune response relies on CD4+ T lymphocytes (TLs) and it may be affected by the interaction of HAV with its cellular receptor (HAVCR1/TIM-1) on T cell surface. How CB might affect T cell function during HAV infection remains to be elucidated. Herein, in vitro stimulation of CD4+ TLs from healthy donors with CB resulted in a decrease in the degree of intracellular tyrosine phosphorylation and an increase in the activity of T regulatory cells (Tregs) expressing HAVCR1/TIM-1. A comparison between CD4+ TLs from healthy donors and HAV-infected patients revealed changes in the TCR signaling pathway relative to changes in CB levels. The proportion of CD4+CD25+ TLs increased in patients with low CB serum levels and an increase in the percentage of Tregs expressing HAVCR1/TIM-1 was found in HAV-infected patients relative to controls. A low frequency of 157insMTTTVP insertion in the viral receptor gene HAVCR1/TIM-1 was found in patients and controls. Our data revealed that, during HAV infection, CB differentially regulates CD4+ TLs and Tregs functions by modulating intracellular pathways and by inducing changes in the proportion of Tregs expressing HAVCR1/TIM-1. PMID:27578921

  13. Conjugated Bilirubin Differentially Regulates CD4+ T Effector Cells and T Regulatory Cell Function through Outside-In and Inside-Out Mechanisms: The Effects of HAV Cell Surface Receptor and Intracellular Signaling.


    Corral-Jara, Karla F; Trujillo-Ochoa, Jorge L; Realpe, Mauricio; Panduro, Arturo; Gómez-Leyva, Juan F; Rosenstein, Yvonne; Jose-Abrego, Alexis; Roman, Sonia; Fierro, Nora A


    We recently reported an immune-modulatory role of conjugated bilirubin (CB) in hepatitis A virus (HAV) infection. During this infection the immune response relies on CD4+ T lymphocytes (TLs) and it may be affected by the interaction of HAV with its cellular receptor (HAVCR1/TIM-1) on T cell surface. How CB might affect T cell function during HAV infection remains to be elucidated. Herein, in vitro stimulation of CD4+ TLs from healthy donors with CB resulted in a decrease in the degree of intracellular tyrosine phosphorylation and an increase in the activity of T regulatory cells (Tregs) expressing HAVCR1/TIM-1. A comparison between CD4+ TLs from healthy donors and HAV-infected patients revealed changes in the TCR signaling pathway relative to changes in CB levels. The proportion of CD4+CD25+ TLs increased in patients with low CB serum levels and an increase in the percentage of Tregs expressing HAVCR1/TIM-1 was found in HAV-infected patients relative to controls. A low frequency of 157insMTTTVP insertion in the viral receptor gene HAVCR1/TIM-1 was found in patients and controls. Our data revealed that, during HAV infection, CB differentially regulates CD4+ TLs and Tregs functions by modulating intracellular pathways and by inducing changes in the proportion of Tregs expressing HAVCR1/TIM-1.

  14. Quercetin regulates the sestrin 2-AMPK-p38 MAPK signaling pathway and induces apoptosis by increasing the generation of intracellular ROS in a p53-independent manner.


    Kim, Guen Tae; Lee, Se Hee; Kim, Jong Il; Kim, Young Min


    The induction of apoptosis in cancer cells is a therapeutic strategy for the treatment of cancer. In the present study, we investigated the regulatory mechanisms responsible for quercetin-induced apoptosis, mamely the increased expression of sestrin 2 and the activation of the 5' AMP-activated protein kinase (AMPK)/p38 MAPK signaling pathway. Our results revealed that quercetin induced apoptosis by generating the production of intracellular reactive oxygen species (ROS) and increasing the expression of sestrin 2. The induction of apoptosis by quercetin occurred through the activation of the AMPK/p38 signaling pathway and was dependent on sestrin 2. However, the silencing of sestrin 2 using small interfering RNA (siRNA) targeting sestrin 2 revealed that quercetin did not regulate AMPK or p38 phosphorylation in the cells in which sestrin 2 was silenced. On the other hand, it has been previously reported that sestrin 2 expression is not dependent on p53 expression under hypoxic conditions, whereas DNA damage is dependent on p53. We demonstrate that the increase in the expression of sestrin 2 by quercetin-generated intracellular ROS is p53-independent. The increased expression of sestrin 2 induced apoptosis through the AMPK/p38 signaling pathway in the HT-29 colon cancer cells, which are p53 mutant, treated with quercetin. Thus, our data suggest that quercetin induces apoptosis by reducing mitochondrial membrane potential, generating intracellular ROS production and increasing sestrin 2 expression through the AMPK/p38 pathway. In addition, p53 is not a necessary element for an apoptotic event induced by sestrin 2.

  15. Amastin Knockdown in Leishmania braziliensis Affects Parasite-Macrophage Interaction and Results in Impaired Viability of Intracellular Amastigotes

    PubMed Central

    Nakagaki, Brenda Naemi; Mendonça-Neto, Rondon Pessoa; Canavaci, Adriana Monte Cassiano; Souza Melo, Normanda; Martinelli, Patrícia Massara; Fernandes, Ana Paula; daRocha, Wanderson Duarte; Teixeira, Santuza M. R.


    Leishmaniasis, a human parasitic disease with manifestations ranging from cutaneous ulcerations to fatal visceral infection, is caused by several Leishmania species. These protozoan parasites replicate as extracellular, flagellated promastigotes in the gut of a sandfly vector and as amastigotes inside the parasitophorous vacuole of vertebrate host macrophages. Amastins are surface glycoproteins encoded by large gene families present in the genomes of several trypanosomatids and highly expressed in the intracellular amastigote stages of Trypanosoma cruzi and Leishmania spp. Here, we showed that the genome of L. braziliensis contains 52 amastin genes belonging to all four previously described amastin subfamilies and that the expression of members of all subfamilies is upregulated in L. braziliensis amastigotes. Although primary sequence alignments showed no homology to any known protein sequence, homology searches based on secondary structure predictions indicate that amastins are related to claudins, a group of proteins that are components of eukaryotic tight junction complexes. By knocking-down the expression of δ-amastins in L. braziliensis, their essential role during infection became evident. δ-amastin knockdown parasites showed impaired growth after in vitro infection of mouse macrophages and completely failed to produce infection when inoculated in BALB/c mice, an attenuated phenotype that was reverted by the re-expression of an RNAi-resistant amastin gene. Further highlighting their essential role in host-parasite interactions, electron microscopy analyses of macrophages infected with amastin knockdown parasites showed significant alterations in the tight contact that is normally observed between the surface of wild type amastigotes and the membrane of the parasitophorous vacuole. PMID:26641088

  16. Intracellular degradation and localization of NS1 of tick-borne encephalitis virus affect its protective properties.


    Kuzmenko, Yulia V; Starodubova, Elizaveta S; Shevtsova, Anastasia S; Chernokhaeva, Liubov L; Latanova, Anastasia A; Preobrazhenskaia, Olga V; Timofeev, Andrey V; Karganova, Galina G; Karpov, Vadim L


    Currently, many DNA vaccines against infectious diseases are in clinical trials; however, their efficacy needs to be improved. The potency of DNA immunogen can be optimized by targeting technologies. In the current study, to increase the efficacy of NS1 encoded by plasmid, proteasome targeting was applied. NS1 variants with or without translocation sequence and with ornithine decarboxylase as a signal of proteasomal degradation were tested for expression, localization, protein turnover, proteasomal degradation and protection properties. Deletion of translocation signal abrogated presentation of NS1 on the cell surface and increased proteasomal processing of NS1. Fusion with ornithine decarboxylase led to an increase of protein turnover and the proteasome degradation rate of NS1. Immunization with NS1 variants with increased proteasome processing protected mice from viral challenge only partially; however, the survival time of infected mice was prolonged in these groups. These data can give a presupposition for formulation of specific immune therapy for infected individuals.

  17. Ethylene signalling affects susceptibility of tomatoes to Salmonella

    PubMed Central

    Marvasi, Massimiliano; Noel, Jason T; George, Andrée S; Farias, Marcelo A; Jenkins, Keith T; Hochmuth, George; Xu, Yimin; Giovanonni, Jim J; Teplitski, Max


    Fresh fruits and vegetables are increasingly recognized as important reservoirs of human pathogens, and therefore, significant attention has been directed recently to understanding mechanisms of the interactions between plants and enterics, like Salmonella. A screen of tomato cultivars for their susceptibility to Salmonella revealed significant differences in the ability of this human pathogen to multiply within fruits; expression of the Salmonella genes (cysB, agfB, fadH) involved in the interactions with tomatoes depended on the tomato genotype and maturity stage. Proliferation of Salmonella was strongly reduced in the tomato mutants with defects in ethylene synthesis, perception and signal transduction. While mutation in the ripening-related ethylene receptor Nr resulted only in a modest reduction in Salmonella numbers within tomatoes, strong inhibition of the Salmonella proliferation was observed in rin and nor tomato mutants. RIN and NOR are regulators of ethylene synthesis and ripening. A commercial tomato variety heterozygous for rin was less susceptible to Salmonella under the greenhouse conditions but not when tested in the field over three production seasons. PMID:24888884

  18. 4-Hydroxy-2-nonenal induces apoptosis by activating ERK1/2 signaling and depleting intracellular glutathione in intestinal epithelial cells

    PubMed Central

    Ji, Yun; Dai, Zhaolai; Wu, Guoyao; Wu, Zhenlong


    Excessive reactive oxygen species (ROS) induces oxidative damage to cellular constituents, ultimately leading to induction of apoptotic cell death and the pathogenesis of various diseases. The molecular mechanisms for the action of ROS in intestinal diseases remain poorly defined. Here, we reported that 4-hydroxy-2-nonenal (4-HNE) treatment led to capses-3-dependent apoptosis accompanied by increased intracellular ROS level and reduced glutathione concentration in intestinal epithelial cells. These effects of 4-HNE were markedly abolished by the antioxidant L-cysteine derivative N-acetylcysteine (NAC). Further studies demonstrated that the protective effect of NAC was associated with restoration of intracellular redox state by Nrf2-related regulation of expression of genes involved in intracellular glutathione (GSH) biosynthesis and inactivation of 4-HNE-induced phosphorylation of extracellular signal-regulated protein kinases (ERK1/2). The 4-HNE-induced ERK1/2 activation was mediated by repressing mitogen-activated protein kinase phosphatase-1 (MKP-1), a negative regulator of ERK1/2, through a proteasome-dependent degradation mechanism. Importantly, either overexpression of MKP-1 or NAC treatment blocked 4-HNE-induced MKP-1 degradation, thereby protecting cell from apoptosis. These novel findings provide new insights into a functional role of MKP-1 in oxidative stress-induced cell death by regulating ERK1/2 MAP kinase in intestinal epithelial cells. PMID:27620528

  19. The Aer protein and the serine chemoreceptor Tsr independently sense intracellular energy levels and transduce oxygen, redox, and energy signals for Escherichia coli behavior

    PubMed Central

    Rebbapragada, Anuradha; Johnson, Mark S.; Harding, Gordon P.; Zuccarelli, Anthony J.; Fletcher, Hansel M.; Zhulin, Igor B.; Taylor, Barry L.


    We identified a protein, Aer, as a signal transducer that senses intracellular energy levels rather than the external environment and that transduces signals for aerotaxis (taxis to oxygen) and other energy-dependent behavioral responses in Escherichia coli. Domains in Aer are similar to the signaling domain in chemotaxis receptors and the putative oxygen-sensing domain of some transcriptional activators. A putative FAD-binding site in the N-terminal domain of Aer shares a consensus sequence with the NifL, Bat, and Wc-1 signal-transducing proteins that regulate gene expression in response to redox changes, oxygen, and blue light, respectively. A double mutant deficient in aer and tsr, which codes for the serine chemoreceptor, was negative for aerotaxis, redox taxis, and glycerol taxis, each of which requires the proton motive force and/or electron transport system for signaling. We propose that Aer and Tsr sense the proton motive force or cellular redox state and thereby integrate diverse signals that guide E. coli to environments where maximal energy is available for growth. PMID:9380671

  20. Desnitro-imidacloprid activates the extracellular signal-regulated kinase cascade via the nicotinic receptor and intracellular calcium mobilization in N1E-115 cells.


    Tomizawa, Motohiro; Casida, John E


    Imidacloprid (IMI) is the principal neonicotinoid (the only major new class of synthetic insecticides of the past three decades). The excellent safety profile of IMI is not shared with a metabolite, desnitro-IMI (DNIMI), which displays high toxicity to mammals associated with agonist action at the alpha4beta2 nicotinic acetylcholine receptor (nAChR) in brain. This study examines the hypothesis that IMI, DNIMI, and (-)-nicotine activate the extracellular signal-regulated kinase (ERK) cascade via primary interaction with the alpha4beta2 nAChR in mouse neuroblastoma N1E-115 cells. These three nicotinic agonists induce phosphorylation of ERK (p44/p42) in a concentration-dependent manner with an optimal incubation period of 30 min. DNIMI (1 microM)-induced ERK activation is blocked by nicotinic antagonist mecamylamine but not by alpha-bungarotoxin and muscarinic antagonist atropine. This activation is prevented by intracellular Ca(2+) chelator BAPTA-AM but not by removal of external Ca(2+) using EGTA and Ca(2+)-free medium. 2-Aminoethoxy-diphenylborate, a blocker for inositol 1,4,5-trisphosphate (IP(3))-mediated Ca(2+) release from intracellular stores, inhibits DNIMI-induced ERK activation but a high level of ryanodine (to block ryanodine receptor-mediated Ca(2+) release) does not. The inhibitor U-73122 for phospholipase C (to suppress IP(3) production) prevents ERK activation evoked by DNIMI. Inhibitors for protein kinase C (PKC) (GF109203X) and ERK kinase (PD98059) block this activation whereas an inhibitor (H-89) for cyclic AMP-dependent protein kinase does not. Thus, neonicotinoids activate the ERK cascade triggered by primary action at the alpha4beta2 nAChR with an involvement of intracellular Ca(2+) mobilization possibly mediated by IP(3). It is further suggested that intracellular Ca(2+) activates a sequential pathway from PKC to ERK.

  1. Intracellular Parasite Invasion Strategies

    NASA Astrophysics Data System (ADS)

    Sibley, L. D.


    Intracellular parasites use various strategies to invade cells and to subvert cellular signaling pathways and, thus, to gain a foothold against host defenses. Efficient cell entry, ability to exploit intracellular niches, and persistence make these parasites treacherous pathogens. Most intracellular parasites gain entry via host-mediated processes, but apicomplexans use a system of adhesion-based motility called ``gliding'' to actively penetrate host cells. Actin polymerization-dependent motility facilitates parasite migration across cellular barriers, enables dissemination within tissues, and powers invasion of host cells. Efficient invasion has brought widespread success to this group, which includes Toxoplasma, Plasmodium, and Cryptosporidium.

  2. Genetic interactions between the RhoA and Stubble-stubbloid loci suggest a role for a type II transmembrane serine protease in intracellular signaling during Drosophila imaginal disc morphogenesis.

    PubMed Central

    Bayer, Cynthia A; Halsell, Susan R; Fristrom, James W; Kiehart, Daniel P; von Kalm, Laurence


    The Drosophila RhoA (Rho1) GTPase is essential for postembryonic morphogenesis of leg and wing imaginal discs. Mutations in RhoA enhance leg and wing defects associated with mutations in zipper, the gene encoding the heavy chain of nonmuscle myosin II. We demonstrate here that mutations affecting the RhoA signaling pathway also interact genetically with mutations in the Stubble-stubbloid (Sb-sbd) locus that encodes an unusual type II transmembrane serine protease required for normal leg and wing morphogenesis. In addition, a leg malformation phenotype associated with overexpression of Sb-sbd in prepupal leg discs is suppressed when RhoA gene dose is reduced, suggesting that RhoA and Sb-sbd act in a common pathway during leg morphogenesis. We also characterized six mutations identified as enhancers of zipper mutant leg defects. Three of these genes encode known members of the RhoA signaling pathway (RhoA, DRhoGEF2, and zipper). The remaining three enhancer of zipper mutations interact genetically with both RhoA and Sb-sbd mutations, suggesting that they encode additional components of the RhoA signaling pathway in imaginal discs. Our results provide evidence that the type II transmembrane serine proteases, a class of proteins linked to human developmental abnormalities and pathology, may be associated with intracellular signaling required for normal development. PMID:14668391

  3. Contractility and calcium signaling of human myometrium are profoundly affected by cholesterol manipulation: implications for labor?


    Jie Zhang; Kendrick, Annabelle; Quenby, Siobhan; Wray, Susan


    The authors elucidate cholesterol's effect on human uterine contractility and calcium signaling to test the hypotheses that elevation of cholesterol decreases uterine activity and that oxytocin cannot augment contraction when cholesterol is elevated. The effects of cholesterol extraction with methyl beta-cyclodextrin and enrichment with low-density lipoproteins and cholesterol on contractile activity and intracellular calcium signaling in spontaneous or oxytocin-stimulated myometrium are determined. Force occurring spontaneously and with oxytocin is significantly increased by cholesterol extraction. Cholesterol enrichment profoundly inhibits force production in a dose-dependent manner and could reverse the effects of cholesterol extraction. Qualitatively similar results are found for nonpregnant and pregnant laboring and non-laboring myometrium. These contractile changes are related to changes in intracellular Ca2+ . Thus, elevated cholesterol is deleterious to contractility and Ca2+ signaling in human myometrium. Cholesterol may contribute to uterine quiescence but could cause difficulties in labor in obese/dyslipidemic women, consistent with their increased cesarean delivery rates.

  4. Receptor-activated Ca2+ inflow in animal cells: a variety of pathways tailored to meet different intracellular Ca2+ signalling requirements.

    PubMed Central

    Barritt, G J


    Receptor-activated Ca2+ channels (RACCs) play a central role in regulation of the functions of animal cells. Together with voltage-operated Ca2+ channels (VOCCs) and ligand-gated non-selective cation channels, RACCs provide a variety of pathways by which Ca2+ can be delivered to the cytoplasmic space and the endoplasmic reticulum (ER) in order to initiate or maintain specific types of intracellular Ca2+ signal. Store-operated Ca2+ channels (SOCs), which are activated by a decrease in Ca2+ in the ER, are a major subfamily of RACCs. A careful analysis of the available data is required in order to discern the different types of RACCs (differentiated chiefly on the basis of ion selectivity and mechanism of activation) and to properly develop hypotheses for structures and mechanisms of activation. Despite much intensive research, the structures and mechanisms of activation of RACCs are only now beginning to be understood. In considering the physiological functions of the different RACCs, it is useful to consider the specificity for Ca2+ of each type of cation channel and the rate at which Ca2+ flows through a single open channel; the locations of the channels on the plasma membrane (in relation to the ER, cytoskeleton and other intracellular units of structure and function); the Ca2+-responsive enzymes and proteins; and the intracellular buffers and proteins that control the distribution of Ca2+ in the cytoplasmic space. RACCs which are non-selective cation channels can deliver Ca2+ directly to specific regions of the cytoplasmic space, and can also admit Na+, which induces depolarization of the plasma membrane, the opening of VOCCs and the subsequent inflow of Ca2+. SOCs appear to deliver Ca2+ specifically to the ER, thereby maintaining oscillating Ca2+ signals. PMID:9882611

  5. Large-conductance channel formation mediated by P2X7 receptor activation is regulated through distinct intracellular signaling pathways in peritoneal macrophages and 2BH4 cells.


    Faria, R X; Cascabulho, C M; Reis, R A M; Alves, Luiz Anastácio


    The P2X(7) receptor (P2X7R) is a ligand-gated ATP receptor that acts as a low- and large-conductance channel (pore) and is known to be coupled to several downstream effectors. Recently, we demonstrated that the formation of a large-conductance channel associated with the P2X(7) receptor is induced by increasing the intracellular Ca(2+) concentration (Faria et al., Am J Physiol Cell Physiol 297:C28-C42, 2005). Here, we investigated the intracellular signaling pathways associated with P2X(7) large-conductance channel formation using the patch clamp technique in conjunction with fluorescent imaging and flow cytometry assays in 2BH4 cells and peritoneal macrophages. Different antagonists were applied to investigate the following pathways: Ca(2+)-calmodulin, phospholipase A, phospholipase D, phospholipase C, protein kinase C (PKC), mitogen-activated protein kinase (MAPK), MAPK/extracellular signal-regulated kinase, phosphoinositide 3-kinase (PI3K), and cytoskeletal proteins. Macroscopic ionic currents induced by 1 mM ATP were reduced by 85% in the presence of PKC antagonists. The addition of antagonists for MAPK, PI3K, and the cytoskeleton (actin, intermediary filament, and microtubule) blocked 92%, 83%, and 95% of the ionic currents induced by 1 mM ATP, respectively. Our results show that PKC, MAPK, PI3K, and cytoskeletal components are involved in P2X(7) receptor large-channel formation in 2BH4 cells and peritoneal macrophages.

  6. Isomer-nonspecific action of dichlorodiphenyltrichloroethane on aryl hydrocarbon receptor and G-protein-coupled receptor 30 intracellular signaling in apoptotic neuronal cells.


    Kajta, M; Litwa, E; Rzemieniec, J; Wnuk, A; Lason, W; Zelek-Molik, A; Nalepa, I; Grzegorzewska-Hiczwa, M; Tokarski, K; Golas, A; Guzik, E; Grochowalski, A; Szychowski, K A; Wojtowicz, A K


    Extended residual persistence of the pesticide dichlorodiphenyltrichloroethane (DDT) raises concerns about its long-term neurotoxic effects. Little is known, however, about DDT toxicity during the early stages of neural development. This study demonstrated that DDT-induced apoptosis of mouse embryonic neuronal cells is a caspase-9-, caspase-3-, and GSK-3β-dependent process, which involves p,p'-DDT-specific impairment of classical ERs. It also provided evidence for DDT-isomer-nonspecific alterations of AhR- and GPR30-mediated intracellular signaling, including changes in the levels of the receptor and receptor-regulated mRNAs, and also changes in the protein levels of the receptors. DDT-induced stimulation of AhR-signaling and reduction of GPR30-signaling were verified using selective ligands and specific siRNAs. Co-localization of the receptors was demonstrated with confocal microscopy, and the presence of functional GPR30 was detected by electrophysiology. This study demonstrates that stimulation of AhR-signaling and impairment of GPR30-signaling play important roles in the propagation of DDT-induced apoptosis during the early stages of neural development.

  7. A label-free optical biosensor with microfluidics identifies an intracellular signalling wave mediated through the β(2)-adrenergic receptor.


    Ferrie, Ann M; Wang, Chaoming; Deng, Huayun; Fang, Ye


    The canonical model of G protein-coupled receptor (GPCR) signalling states that it is solely initiated at the cell surface. In recent years, a handful of evidence has started emerging from high-resolution molecular assays that the internalized receptors can mediate the third wave of signalling, besides G protein- and β-arrestin-mediated signalling both initiating at the cell surface. However, little is known about the functional consequences of distinct waves of GPCR signalling, in particular, at the whole cell system level. We here report the development of label-free biosensor antagonist reverse assays and their use to differentiate the signalling waves of an endogenous β2-adrenergic receptor (β2-AR) in A431 cells. Results showed that the persistent agonist treatment activated the β2-ARs, leading to a long-term sustained dynamic mass redistribution (DMR) signal, a whole cell phenotypic response. Under the persistent treatment scheme in microplates, a panel of known β-blockers all dose-dependently and completely reversed the DMR signal of epinephrine at a relatively low dose (10 nM), except for sotalol which partially reversed the DMR. Under the perfusion conditions with microfluidics, the subsequent perfusion with sotalol only reversed the DMR induced by epinephrine or isoproterenol at 10 nM, but not at 10 μM. Furthermore, the degree of the DMR reversion by sotalol was found to be in an opposite relation with the duration of the initial agonist treatment. Together, these results suggest that the hydrophilic antagonist sotalol is constrained outside the cells throughout the assays, and the early signalling wave initiated at the cell surface dominates the DMR induced by epinephrine or isoproterenol at relatively low doses, while a secondary and late signalling wave is initiated once the receptors are internalized and contributes partially to the long-term sustainability of the DMR of epinephrine or isoproterenol at high doses.

  8. Brucella suis Vaccine Strain 2 Induces Endoplasmic Reticulum Stress that Affects Intracellular Replication in Goat Trophoblast Cells In vitro.


    Wang, Xiangguo; Lin, Pengfei; Li, Yang; Xiang, Caixia; Yin, Yanlong; Chen, Zhi; Du, Yue; Zhou, Dong; Jin, Yaping; Wang, Aihua


    Brucella has been reported to impair placental trophoblasts, a cellular target where Brucella efficiently replicates in association with the endoplasmic reticulum (ER), and ultimately trigger abortion in pregnant animals. However, the precise effects of Brucella on trophoblast cells remain unclear. Here, we describe the infection and replication of Brucella suis vaccine strain 2 (B.suis.S2) in goat trophoblast cells (GTCs) and the cellular and molecular responses induced in vitro. Our studies demonstrated that B.suis.S2 was able to infect and proliferate to high titers, hamper the proliferation of GTCs and induce apoptosis due to ER stress. Tunicamycin (Tm), a pharmacological chaperone that strongly mounts ER stress-induced apoptosis, inhibited B.suis.S2 replication in GTCs. In addition, 4 phenyl butyric acid (4-PBA), a pharmacological chaperone that alleviates ER stress-induced apoptosis, significantly enhanced B.suis.S2 replication in GTCs. The Unfolded Protein Response (UPR) chaperone molecule GRP78 also promoted B.suis.S2 proliferation in GTCs by inhibiting ER stress-induced apoptosis. We also discovered that the IRE1 pathway, but not the PERK or ATF6 pathway, was activated in the process. However, decreasing the expression of phosphoIRE1α and IRE1α proteins with Irestatin 9389 (IRE1 antagonist) in GTCs did not affect the proliferation of B.suis.S2. Although GTC implantation was not affected upon B.suis.S2 infection, progesterone secretion was suppressed, and prolactin and estrogen secretion increased; these effects were accompanied by changes in the expression of genes encoding key steroidogenic enzymes. This study systematically explored the mechanisms of abortion in Brucella infection from the viewpoint of pathogen invasion, ER stress and reproductive endocrinology. Our findings may provide new insight for understanding the mechanisms involved in goat abortions caused by Brucella infection.

  9. Brucella suis Vaccine Strain 2 Induces Endoplasmic Reticulum Stress that Affects Intracellular Replication in Goat Trophoblast Cells In vitro

    PubMed Central

    Wang, Xiangguo; Lin, Pengfei; Li, Yang; Xiang, Caixia; Yin, Yanlong; Chen, Zhi; Du, Yue; Zhou, Dong; Jin, Yaping; Wang, Aihua


    Brucella has been reported to impair placental trophoblasts, a cellular target where Brucella efficiently replicates in association with the endoplasmic reticulum (ER), and ultimately trigger abortion in pregnant animals. However, the precise effects of Brucella on trophoblast cells remain unclear. Here, we describe the infection and replication of Brucella suis vaccine strain 2 (B.suis.S2) in goat trophoblast cells (GTCs) and the cellular and molecular responses induced in vitro. Our studies demonstrated that B.suis.S2 was able to infect and proliferate to high titers, hamper the proliferation of GTCs and induce apoptosis due to ER stress. Tunicamycin (Tm), a pharmacological chaperone that strongly mounts ER stress-induced apoptosis, inhibited B.suis.S2 replication in GTCs. In addition, 4 phenyl butyric acid (4-PBA), a pharmacological chaperone that alleviates ER stress-induced apoptosis, significantly enhanced B.suis.S2 replication in GTCs. The Unfolded Protein Response (UPR) chaperone molecule GRP78 also promoted B.suis.S2 proliferation in GTCs by inhibiting ER stress-induced apoptosis. We also discovered that the IRE1 pathway, but not the PERK or ATF6 pathway, was activated in the process. However, decreasing the expression of phosphoIRE1α and IRE1α proteins with Irestatin 9389 (IRE1 antagonist) in GTCs did not affect the proliferation of B.suis.S2. Although GTC implantation was not affected upon B.suis.S2 infection, progesterone secretion was suppressed, and prolactin and estrogen secretion increased; these effects were accompanied by changes in the expression of genes encoding key steroidogenic enzymes. This study systematically explored the mechanisms of abortion in Brucella infection from the viewpoint of pathogen invasion, ER stress and reproductive endocrinology. Our findings may provide new insight for understanding the mechanisms involved in goat abortions caused by Brucella infection. PMID:26904517

  10. Affective assessment of computer users based on processing the pupil diameter signal.


    Ren, Peng; Barreto, Armando; Gao, Ying; Adjouadi, Malek


    Detecting affective changes of computer users is a current challenge in human-computer interaction which is being addressed with the help of biomedical engineering concepts. This article presents a new approach to recognize the affective state ("relaxation" vs. "stress") of a computer user from analysis of his/her pupil diameter variations caused by sympathetic activation. Wavelet denoising and Kalman filtering methods are first used to remove abrupt changes in the raw Pupil Diameter (PD) signal. Then three features are extracted from the preprocessed PD signal for the affective state classification. Finally, a random tree classifier is implemented, achieving an accuracy of 86.78%. In these experiments the Eye Blink Frequency (EBF), is also recorded and used for affective state classification, but the results show that the PD is a more promising physiological signal for affective assessment.

  11. Single-cell mass cytometry reveals intracellular survival/proliferative signaling in FLT3-ITD-mutated AML stem/progenitor cells.


    Han, Lina; Qiu, Peng; Zeng, Zhihong; Jorgensen, Jeffrey L; Mak, Duncan H; Burks, Jared K; Schober, Wendy; McQueen, Teresa J; Cortes, Jorge; Tanner, Scott D; Roboz, Gail J; Kantarjian, Hagop M; Kornblau, Steven M; Guzman, Monica L; Andreeff, Michael; Konopleva, Marina


    Understanding the unique phenotypes and complex signaling pathways of leukemia stem cells (LSCs) will provide insights and druggable targets that can be used to eradicate acute myeloid leukemia (AML). Current work on AML LSCs is limited by the number of parameters that conventional flow cytometry (FCM) can analyze because of cell autofluorescence and fluorescent dye spectral overlap. Single-cell mass cytometry (CyTOF) substitutes rare earth elements for fluorophores to label antibodies, which allows measurements of up to 120 parameters in single cells without correction for spectral overlap. The aim of this study was the evaluation of intracellular signaling in antigen-defined stem/progenitor cell subsets in primary AML. CyTOF and conventional FCM yielded comparable results on LSC phenotypes defined by CD45, CD34, CD38, CD123, and CD99. Intracellular phosphoprotein responses to ex vivo cell signaling inhibitors and cytokine stimulation were assessed in myeloid leukemia cell lines and one primary AML sample. CyTOF and conventional FCM results were confirmed by western blotting. In the primary AML sample, we investigated the cell responses to ex vivo stimulation with stem cell factor and BEZ235-induced inhibition of PI3K and identified activation patterns in multiple PI3K downstream signaling pathways including p-4EBP1, p-AKT, and p-S6, particularly in CD34(+) subsets. We evaluated multiple signaling pathways in antigen-defined subpopulations in primary AML cells with FLT3-ITD mutations. The data demonstrated the heterogeneity of cell phenotype distribution and distinct patterns of signaling activation across AML samples and between AML and normal samples. The mTOR targets p-4EBP1 and p-S6 were exclusively found in FLT3-ITD stem/progenitor cells, but not in their normal counterparts, suggesting both as novel targets in FLT3 mutated AML. Our data suggest that CyTOF can identify functional signaling pathways in antigen-defined subpopulations in primary AML, which may

  12. Lymphotropic Virions Affect Chemokine Receptor-Mediated Neural Signaling and Apoptosis: Implications for Human Immunodeficiency Virus Type 1-Associated Dementia

    PubMed Central

    Zheng, Jialin; Ghorpade, Anuja; Niemann, Douglas; Cotter, Robin L.; Thylin, Michael R.; Epstein, Leon; Swartz, Jennifer M.; Shepard, Robin B.; Liu, Xiaojuan; Nukuna, Adeline; Gendelman, Howard E.


    Chemokine receptors pivotal for human immunodeficiency virus type 1 (HIV-1) infection in lymphocytes and macrophages (CCR3, CCR5, and CXCR4) are expressed on neural cells (microglia, astrocytes, and/or neurons). It is these cells which are damaged during progressive HIV-1 infection of the central nervous system. We theorize that viral coreceptors could effect neural cell damage during HIV-1-associated dementia (HAD) without simultaneously affecting viral replication. To these ends, we studied the ability of diverse viral strains to affect intracellular signaling and apoptosis of neurons, astrocytes, and monocyte-derived macrophages. Inhibition of cyclic AMP, activation of inositol 1,4,5-trisphosphate, and apoptosis were induced by diverse HIV-1 strains, principally in neurons. Virions from T-cell-tropic (T-tropic) strains (MN, IIIB, and Lai) produced the most significant alterations in signaling of neurons and astrocytes. The HIV-1 envelope glycoprotein, gp120, induced markedly less neural damage than purified virions. Macrophage-tropic (M-tropic) strains (ADA, JR-FL, Bal, MS-CSF, and DJV) produced the least neural damage, while 89.6, a dual-tropic HIV-1 strain, elicited intermediate neural cell damage. All T-tropic strain-mediated neuronal impairments were blocked by the CXCR4 antibody, 12G5. In contrast, the M-tropic strains were only partially blocked by 12G5. CXCR4-mediated neuronal apoptosis was confirmed in pure populations of rat cerebellar granule neurons and was blocked by HA1004, an inhibitor of calcium/calmodulin-dependent protein kinase II, protein kinase A, and protein kinase C. Taken together, these results suggest that progeny HIV-1 virions can influence neuronal signal transduction and apoptosis. This process occurs, in part, through CXCR4 and is independent of CD4 binding. T-tropic viruses that traffic in and out of the brain during progressive HIV-1 disease may play an important role in HAD neuropathogenesis. PMID:10482576

  13. Intracellular proteoglycans.

    PubMed Central

    Kolset, Svein Olav; Prydz, Kristian; Pejler, Gunnar


    Proteoglycans (PGs) are proteins with glycosaminoglycan chains, are ubiquitously expressed and have a wide range of functions. PGs in the extracellular matrix and on the cell surface have been the subject of extensive structural and functional studies. Less attention has so far been given to PGs located in intracellular compartments, although several reports suggest that these have biological functions in storage granules, the nucleus and other intracellular organelles. The purpose of this review is, therefore, to present some of these studies and to discuss possible functions linked to PGs located in different intracellular compartments. Reference will be made to publications relevant for the topics we present. It is beyond the scope of this review to cover all publications on PGs in intracellular locations. PMID:14759226

  14. Dietary flavonoid apigenin is a potential inducer of intracellular oxidative stress: the role in the interruptive apoptotic signal.


    Miyoshi, Noriyuki; Naniwa, Kisa; Yamada, Takayo; Osawa, Toshihiko; Nakamura, Yoshimasa


    Apigenin is a representative dietary flavone (2-phenyl-4H-1-benzopyran-4-one) inhibiting cancer cell growth both in cell culture systems and in vivo. The prooxidant potential of apigenin was confirmed by the observations using flowcytometric and immunoblotting techniques that the intracellular accumulations of reactive oxygen species (ROS) and protein carbonyls were detected in the cells treated with apigenin in a dose-dependent manner. Conversely, chrysin (5,7-dihydroxyflavone) did not show any prooxidant effect. A structure-activity relationship data thus indicated that a 4'-monohydroxyl group, which can be oxidized to semiquinone radical but not up to quinone-like metabolite, is essential for prooxidant effect. When HL-60 cells were treated with not only a heme synthesis inhibitor succinyl acetone (SA) but also myeloperoxidase (MPO) inhibitors, the ROS level enhanced by apigenin was significantly reduced. The gathered data suggested that peroxidase-catalyzed production of apigenin B-ring phenoxyl radicals might be responsible for the prooxidant effect. This is supported by the observation that MPO is able to catalyze production of apigenin phenoxyl radicals, detected by an electron spin resonance-spin trapping technique. We also reveal that both SA and alpha-tocopherol enhance cellular susceptibility to apoptosis-inducing stimuli by apigenin. In conclusion, the prooxidant effect of apigenin is likely to oxidize a variety of thiols through the formation of phenoxyl radicals and thus seems to play a significant role in the abortive apoptotic pathway switching to necrotic cell death.

  15. Nonsteroidal anti-inflammatory drugs modulate cellular glycosaminoglycan synthesis by affecting EGFR and PI3K signaling pathways

    PubMed Central

    Mozolewski, Paweł; Moskot, Marta; Jakóbkiewicz-Banecka, Joanna; Węgrzyn, Grzegorz; Bocheńska, Katarzyna; Banecki, Bogdan; Gabig-Cimińska, Magdalena


    In this report, selected non-steroidal anti-inflammatory drugs (NSAIDs), indomethacin and nimesulide, and analgesics acetaminophen, alone, as well as in combination with isoflavone genistein as potential glycosaminoglycan (GAG) metabolism modulators were considered for the treatment of mucopolysaccharidoses (MPSs) with neurological symptoms due to the effective blood-brain barrier (BBB) penetration properties of these compounds. We found that indomethacin and nimesulide, but not acetaminophen, inhibited GAG synthesis in fibroblasts significantly, while the most pronounced impairment of glycosaminoglycan production was observed after exposure to the mixture of nimesulide and genistein. Phosphorylation of the EGF receptor (EGFR) was inhibited even more effective in the presence of indomethacin and nimesulide than in the presence of genistein. When examined the activity of phosphatidylinositol-3-kinase (PI3K) production, we observed its most significant decrease in the case of fibroblast exposition to nimesulide, and afterwards to indomethacin and genistein mix, rather than indomethacin used alone. Some effects on expression of individual GAG metabolism-related and lysosomal function genes, and significant activity modulation of a number of genes involved in intracellular signal transduction pathways and metabolism of DNA and proteins were detected. This study documents that NSAIDs, and their mixtures with genistein modulate cellular glycosaminoglycan synthesis by affecting EGFR and PI3K signaling pathways. PMID:28240227

  16. From intracellular signaling networks to cell death: the dual role of reactive oxygen species in seed physiology.


    Bailly, Christophe; El-Maarouf-Bouteau, Hayat; Corbineau, Françoise


    Reactive Oxygen Species (ROS) are continuously produced during seed development, from embryogenesis to germination, but also during seed storage. ROS play a dual role in seed physiology behaving, on the one hand, as actors of cellular signaling pathways and, on the other hand, as toxic products that accumulate under stress conditions. ROS, provided that their amount is tightly regulated by the balance between production and scavenging, appear now as being beneficial for germination, and in particular to act as a positive signal for seed dormancy release. Such an effect might result from the interplay between ROS and hormone signaling pathways thus leading to changes in gene expression or in cellular redox status. We also propose that changes in ROS homeostasis would play a role in perception of environmental factors by seeds during their germination, and thus act as a signal controlling the completion of germination. However, uncontrolled accumulation of ROS is likely to occur during seed aging or seed desiccation thus leading to oxidative damage toward a wide range of biomolecules and ultimately to necroses and cell death. We present here the concept of the "oxidative window for germination", which restricts the occurrence of the cellular events associated with germination to a critical range of ROS level, enclosed by lower and higher limits. Above or below the "oxidative window for germination", weak or high amounts of ROS, respectively, would not permit progress toward germination.

  17. Intracellular signaling of the Ufo/Axl receptor tyrosine kinase is mediated mainly by a multi-substrate docking-site.


    Braunger, J; Schleithoff, L; Schulz, A S; Kessler, H; Lammers, R; Ullrich, A; Bartram, C R; Janssen, J W


    Ufo/Axl belongs to a new family of receptor tyrosine kinases with an extracellular structure similar to that of neural cell adhesion molecules. In order to elucidate intracellular signaling, the cytoplasmic moiety of Ufo/Axl was used to screen an expression library according to the CORT (cloning of receptor targets) method. Three putative Ufo substrates were identified: phospholipase Cgamma1 (PLCgamma), as well as p85alpha and p85beta subunits of phosphatidylinositol 3'-kinase (PI3-kinase). Subsequently, chimeric EGFR/Ufo receptors consisting of the extracellular domains of the epidermal growth factor receptor (EGFR) and the transmembrane and intracellular moiety of Ufo were engineered. Using different far-Western blot analyses and coimmunoprecipitation assays, receptor binding of PLCgamma and p85 proteins as well as GRB2, c-src and lck was examined in vitro and in vivo. Competitive inhibition of substrate binding and mutagenesis experiments with EGFR/Ufo constructs revealed C-terminal tyrosine 821 (EILpYVNMDEG) as a docking site for multiple effectors, namely PLCgamma, p85 proteins, GRB2, c-src and lck. Tyrosine 779 (DGLpYALMSRC) demonstrated an additional, but lower binding affinity for the p85 proteins in vitro. In addition, binding of PLCgamma occurred through tyrosine 866 (AGRpYVLCPST). Moreover, our in vivo data indicate that further direct or indirect binding sites for PLCgamma, GRB2, c-src and lck on the human Ufo receptor may exist.

  18. The Role of DARPP-32, an Intracellular Signaling Molecule, in the Actions of the Nerve Agent Sarin

    DTIC Science & Technology


    calmodulin-dependent protein phosphatase signaling cascade, which dephosphorylates phospho-T34-DARPP-32 (Nishi et al., 1999). DARPP-32 is also...32 at Ser-102 (S102) and Ser-137 (S137). For example, S102 on DARPP-32 is phosphorylated by casein kinase II (CK2). In previously, 1989). DARPP-32 is also phosphorylated on amino acid S137 by casein kinase I (CK1). Increases in phosphorylation at this site decrease the rate

  19. Cell-Cell Contact Area Affects Notch Signaling and Notch-Dependent Patterning.


    Shaya, Oren; Binshtok, Udi; Hersch, Micha; Rivkin, Dmitri; Weinreb, Sheila; Amir-Zilberstein, Liat; Khamaisi, Bassma; Oppenheim, Olya; Desai, Ravi A; Goodyear, Richard J; Richardson, Guy P; Chen, Christopher S; Sprinzak, David


    During development, cells undergo dramatic changes in their morphology. By affecting contact geometry, these morphological changes could influence cellular communication. However, it has remained unclear whether and how signaling depends on contact geometry. This question is particularly relevant for Notch signaling, which coordinates neighboring cell fates through direct cell-cell signaling. Using micropatterning with a receptor trans-endocytosis assay, we show that signaling between pairs of cells correlates with their contact area. This relationship extends across contact diameters ranging from micrometers to tens of micrometers. Mathematical modeling predicts that dependence of signaling on contact area can bias cellular differentiation in Notch-mediated lateral inhibition processes, such that smaller cells are more likely to differentiate into signal-producing cells. Consistent with this prediction, analysis of developing chick inner ear revealed that ligand-producing hair cell precursors have smaller apical footprints than non-hair cells. Together, these results highlight the influence of cell morphology on fate determination processes.

  20. Identification of intracellular localization signals and of mechanisms underlining the nucleocytoplasmic shuttling of human aryl hydrocarbon receptor repressor

    SciTech Connect

    Kanno, Yuichiro Miyama, Yasuo; Takane, Yusuke; Nakahama, Takayuki; Inouye, Yoshio


    Two members of the 'AhR family' (a family which is part of the bHLH-PAS superfamily), aryl hydrocarbon receptor (AhR) and AhR repressor (AhRR), originated from a common ancestor and form a regulatory circuit in xenobiotic signal transduction. AhRR is a nucleocytoplasmic shuttle protein, harboring both a nuclear localization signal (NLS) and a nuclear export signal (NES). Because NLS is dominant over NES, AhRR resides predominantly in the nuclear compartment. The NES of AhRR resembles that of AhR in sensitivity to leptomycin B, whereas the NLS of AhRR is monopartite and is, therefore, distinguished from the reported bipartite NLS of AhR. The NLS deletion mutant of GFP-AhRR was transported into the nuclear compartment in the presence of AhR nuclear translocator (Arnt), suggesting the assembly of an AhRR/Arnt heterodimer complex in the cytoplasmic compartment and Arnt-dependent nuclear translocation of this complex.

  1. p190-B RhoGAP and intracellular cytokine signals balance hematopoietic stem and progenitor cell self-renewal and differentiation

    PubMed Central

    Hinge, Ashwini; Xu, Juying; Javier, Jose; Mose, Eucabeth; Kumar, Sachin; Kapur, Reuben; Srour, Edward F.; Malik, Punam; Aronow, Bruce J.; Filippi, Marie-Dominique


    The mechanisms regulating hematopoietic stem and progenitor cell (HSPC) fate choices remain ill-defined. Here, we show that a signalling network of p190-B RhoGAP-ROS-TGF-β-p38MAPK balances HSPC self-renewal and differentiation. Upon transplantation, HSPCs express high amounts of bioactive TGF-β1 protein, which is associated with high levels of p38MAPK activity and loss of HSC self-renewal in vivo. Elevated levels of bioactive TGF-β1 are associated with asymmetric fate choice in vitro in single HSPCs via p38MAPK activity and this is correlated with the asymmetric distribution of activated p38MAPK. In contrast, loss of p190-B, a RhoGTPase inhibitor, normalizes TGF-β levels and p38MAPK activity in HSPCs and is correlated with increased HSC self-renewal in vivo. Loss of p190-B also promotes symmetric retention of multi-lineage capacity in single HSPC myeloid cell cultures, further suggesting a link between p190-B-RhoGAP and non-canonical TGF-β signalling in HSPC differentiation. Thus, intracellular cytokine signalling may serve as ‘fate determinants' used by HSPCs to modulate their activity. PMID:28176763

  2. Dexamethasone enhances insulin-like growth factor-I effects on skeletal muscle cell proliferation. Role of specific intracellular signaling pathways.

    PubMed Central

    Giorgino, F; Smith, R J


    IGF-I stimulation of cell proliferation and c-Fos expression in skeletal muscle cells is markedly enhanced by dexamethasone. The effect of dexamethasone is not mediated by changes in IGF-binding proteins, as evidenced by similar effects of dexamethasone on the actions of insulin, PDGF-BB, and the IGF-I analogue long R3IGF-I. Dexamethasone also does not alter autocrine IGF-II secretion by muscle cells. To investigate the mechanism of the augmentation of IGF-I action, the effects of dexamethasone on intracellular IGF-I signaling pathways were determined. In dexamethasone-treated cells, the levels of IGF-I receptor tyrosine phosphorylation and receptor-associated phosphatidylinositol 3-kinase activity were increased. Dexamethasone-treated cells also showed increased and prolonged tyrosine phosphorylation of the Shc proteins. In contrast, dexamethasone decreased both tyrosine phosphorylation and expression of insulin receptor substrate 1 (IRS-1) and IRS-1-associated phosphatidylinositol 3-kinase activity. Thus, distinct signaling pathways activated by the IGF-I receptor in skeletal muscle cells are differentially regulated by dexamethasone. Potentiation of IGF-I action correlates with increased IGF-I receptor-associated phosphatidylinositol 3-kinase activity and tyrosine phosphorylation of Shc, but appears to be independent of activation of the IRS-1/phosphatidylinositol 3-kinase signaling pathway. Images PMID:7544807

  3. Activation of the neuroprotective ERK signaling pathway by fructose-1,6-bisphosphate during hypoxia involves intracellular Ca2+ and phospholipase C.


    Fahlman, C S; Bickler, P E; Sullivan, Breandan; Gregory, G A


    The mechanism of the neuroprotective action of the glycolytic pathway intermediate fructose-1,6-bisphosphate (FBP) may involve activation of a phospholipase-C (PLC) dependent MAP kinase signaling pathway. In this study, we determined whether FBP's capacity to decrease delayed cell death in hippocampal slice cultures is dependent on PLC signaling or activation of the intracellular Ca(2+)-MEK/ERK neuroprotective signaling cascade. FBP (3.5 mM) reduced delayed death from oxygen/glucose deprivation in CA1, CA3 and dentate neurons in slice cultures. The phospholipase-C inhibitor U73122 and the MEK1/2 inhibitor U0126 prevented this protection. In hippocampal and cortical neurons, FBP increased phospho-ERK1/2 (p42/44) immunostaining during hypoxic, but not normoxic conditions. Increased phospho-ERK immunostaining was dependent on PLC and also on MEK 1/2, an upstream regulator of ERK. Further, we found that FBP enhancement of phospho-ERK immunostaining depended on [Ca(2+)](i): PLC inhibition and the IP(3) receptor blocker xestospongin C prevented FBP from increasing [Ca(2+)](i) and increasing phospho-ERK levels. However, while FBP-induced increases in [Ca(2+)](i) were blocked by xestospongin and a PLC inhibitor, [Ca(2+)](i) increases induced by the neuroprotective growth factor BDNF were not prevented. We conclude that during hypoxia FBP initiates a series of neuroprotective signals which include PLC activation, small increases in [Ca(2+)](i), and increased activity of the MEK/ERK signaling pathway.

  4. Altered intracellular and extracellular signaling leads to impaired T-cell functions in ADA-SCID patients

    PubMed Central

    Cassani, Barbara; Mirolo, Massimiliano; Cattaneo, Federica; Benninghoff, Ulrike; Hershfield, Michael; Carlucci, Filippo; Tabucchi, Antonella; Bordignon, Claudio; Roncarolo, Maria Grazia


    Mutations in the adenosine deaminase (ADA) gene are responsible for a form of severe combined immunodeficiency (SCID) caused by the lymphotoxic accumulation of ADA substrates, adenosine and 2′-deoxy-adenosine. The molecular mechanisms underlying T-cell dysfunction in humans remain to be elucidated. Here, we show that CD4+ T cells from ADA-SCID patients have severely compromised TCR/CD28-driven proliferation and cytokine production, both at the transcriptional and protein levels. Such an impairment is associated with an intrinsically reduced ZAP-70 phosphorylation, Ca2+ flux, and ERK1/2 signaling and to defective transcriptional events linked to CREB and NF-κB. Moreover, exposure to 2′-deoxy-adenosine results in a stronger inhibition of T-cell activation, mediated by the aberrant A2A adenosine receptor signaling engagement and PKA hyperactivation, or in a direct apoptotic effect at higher doses. Conversely, in T cells isolated from patients after gene therapy with retrovirally transduced hematopoietic stem/progenitor cells, the biochemical events after TCR triggering occur properly, leading to restored effector functions and normal sensitivity to apoptosis. Overall, our findings provide a better understanding of the pathogenesis of the immune defects associated with an altered purine metabolism and confirm that ADA gene transfer is an efficacious treatment for ADA-SCID. The trials in this study are enrolled at as #NCT00598481 and #NCT0059978. PMID:18218852

  5. Altered intracellular and extracellular signaling leads to impaired T-cell functions in ADA-SCID patients.


    Cassani, Barbara; Mirolo, Massimiliano; Cattaneo, Federica; Benninghoff, Ulrike; Hershfield, Michael; Carlucci, Filippo; Tabucchi, Antonella; Bordignon, Claudio; Roncarolo, Maria Grazia; Aiuti, Alessandro


    Mutations in the adenosine deaminase (ADA) gene are responsible for a form of severe combined immunodeficiency (SCID) caused by the lymphotoxic accumulation of ADA substrates, adenosine and 2'-deoxy-adenosine. The molecular mechanisms underlying T-cell dysfunction in humans remain to be elucidated. Here, we show that CD4(+) T cells from ADA-SCID patients have severely compromised TCR/CD28-driven proliferation and cytokine production, both at the transcriptional and protein levels. Such an impairment is associated with an intrinsically reduced ZAP-70 phosphorylation, Ca(2+) flux, and ERK1/2 signaling and to defective transcriptional events linked to CREB and NF-kappaB. Moreover, exposure to 2'-deoxy-adenosine results in a stronger inhibition of T-cell activation, mediated by the aberrant A(2A) adenosine receptor signaling engagement and PKA hyperactivation, or in a direct apoptotic effect at higher doses. Conversely, in T cells isolated from patients after gene therapy with retrovirally transduced hematopoietic stem/progenitor cells, the biochemical events after TCR triggering occur properly, leading to restored effector functions and normal sensitivity to apoptosis. Overall, our findings provide a better understanding of the pathogenesis of the immune defects associated with an altered purine metabolism and confirm that ADA gene transfer is an efficacious treatment for ADA-SCID. The trials in this study are enrolled at as #NCT00598481 and #NCT0059978.

  6. Intracellular Signal Transduction and Modification of the Tumor Microenvironment Induced by RET/PTCs in Papillary Thyroid Carcinoma

    PubMed Central

    Menicali, Elisa; Moretti, Sonia; Voce, Pasquale; Romagnoli, Serena; Avenia, Nicola; Puxeddu, Efisio


    RET gene rearrangements (RET/PTCs) represent together with BRAF point mutations the two major groups of mutations involved in papillary thyroid carcinoma (PTC) initiation and progression. In this review, we will examine the mechanisms involved in RET/PTC-induced thyroid cell transformation. In detail, we will summarize the data on the molecular mechanisms involved in RET/PTC formation and in its function as a dominant oncogene, on the activated signal transduction pathways and on the induced gene expression modifications. Moreover, we will report on the effects of RET/PTCs on the tumor microenvironment. Finally, a short review of the literature on RET/PTC prognostic significance will be presented. PMID:22661970

  7. Social competition affects electric signal plasticity and steroid levels in the gymnotiform fish Brachyhypopomus gauderio.


    Salazar, Vielka L; Stoddard, Philip K


    Sexually-selected communication signals can be used by competing males to settle contests without incurring the costs of fighting. Steroid regulation of these signals can render them as reliable indicators of a male's physiological state. We investigated how plasticity in electrocommunication signals is driven by social competition for mates, mediated by steroid hormones, and subject to the effects of past social experience. We measured the electric waveform's amplitude and duration and steroid hormone levels of male gymnotiform electric fish (Brachyhypopomus gauderio) following week-long periods of social isolation, and low or high social competition. To quantify the effect of social history on the modulation of the electric signal, six groups of six males experienced all three social conditions but in different order. We found that males differentially modulate their electric signals depending on the order they experienced these conditions. Thus, past social interactions affect both present and future social electric signals. Cortisol levels and the amplitude of the electric signal appeared to track the intensity of competition, while androgen levels and the duration of the electric signal only responded to the presence (low and high competition) or absence (isolation) of a social environment (low and high androgens respectively). In addition, cortisol levels were related to the body size of the males at high social competition. Taken together, these findings suggest that the capacity of males to modulate their signals in response to social competition is regulated by steroids.

  8. A traditional herbal medicine, rikkunshi-to (TJ-43), prevents intracellular signaling disorders in gastric smooth muscle of diabetic rats.


    Sakai, Yasushi; Nobe, Koji; Maruyama, Yoshiaki; Momose, Kazutaka; Homma, Ikuo


    Prevention of diabetic gastrointestinal dysfunction is of utmost importance. The present study demonstrated that diacylglycerol kinase (DGK) activity in diabetic gastric smooth muscle in the resting state was approximately 3.5-fold greater than that in controls. However, oral administration of TJ-43 (1% of food intake) or subcutaneous insulin injection (12 units/kg/day) in streptozotocin-induced diabetic rats (DM) for 2 weeks prevented DGK abnormalities based on the control level. Increased DGK activity in the resting state of DM was inhibited significantly by R59022, neomycin or staurosporine; in contrast, these drugs did not affect DGK activity in controls, insulin-treated DM or TJ-43-treated DM. In controls, the endogenous phosphatidic acid (PA) level was inhibited significantly by R59022 or neomycin but not affected by staurosporine. On the other hand, these three drugs significantly inhibited endogenous PA levels in DM, and neomycin significantly inhibited endogenous PA levels in insulin-treated and TJ-43-treated DM. This suggests that TJ-43 could prevent alteration of DGK activity and PA formation without reduction of blood glucose levels. Moreover, these effects were greater than those of insulin treatment. Results suggested that TJ-43 treatment influenced the hyperreactivity of DGK and DAG formation via phospholipase C activity. In conclusion, TJ-43 can be recommended with respect to enhancement of the quality of life in patients displaying diabetic gastrointestinal complications.

  9. New applications of pHluorin--measuring intracellular pH of prototrophic yeasts and determining changes in the buffering capacity of strains with affected potassium homeostasis.


    Maresová, Lydie; Hosková, Barbora; Urbánková, Eva; Chaloupka, Roman; Sychrová, Hana


    pHluorin is a pH-sensitive variant of green fluorescent protein for measuring intracellular pH (pH(in)) in living cells. We constructed a new pHluorin plasmid with the dominant selection marker KanMX. This plasmid allows pH measurements in cells without auxotrophic mutations and/or grown in chemically indefinite media. We observed differing values of pH(in) for three prototrophic wild-types. The new construct was also used to determine the pH(in) in strains differing in the activity of the plasma membrane Pma1 H(+)-ATPase and the influence of glucose on pH(in). We describe in detail pHluorin measurements performed in a microplate reader, which require much less hands-on time and much lower cell culture volumes compared to standard cuvettes measurements. We also utilized pHluorin in a new method of measuring the buffering capacity of yeast cell cytosol in vivo, shown to be ca. 52 mM/pH for wild-type yeast and moderately decreased in mutants with affected potassium transport.

  10. Parathyroid hormone inhibition of Na{sup +}/H{sup +} exchanger 3 transcription: Intracellular signaling pathways and transcription factor expression

    SciTech Connect

    Neri, Elida Adalgisa; Bezerra, Camila Nogueira Alves Queiroz-Leite, Gabriella Duarte; Polidoro, Juliano Zequini; Rebouças, Nancy Amaral


    The main transport mechanism of reabsorption of sodium bicarbonate and fluid in the renal proximal tubules involves Na{sup +}/H{sup +} exchanger 3 (NHE3), which is acutely and chronically downregulated by parathyroid hormone (PTH). Although PTH is known to exert an inhibitory effect on NHE3 expression and transcription, the molecular mechanisms involved remain unclear. Here, we demonstrated that, in opossum kidney proximal tubule (OKP) cells, PTH-induced inhibition of Nhe3 gene promoter occurs even in the core promoter that controls expression of the reporter gene. We found that inhibition of the protein kinase A (PKA) and Janus kinase/signal transducer and activator of transcription (JAK/STAT) pathways transformed PTH from an inhibitor of promoter activity into an activator of that same activity, as did point mutations in the EGR1, Sp1, and Sp3 binding consensus elements in the promoter. In nuclear extracts of PTH-treated OKP cells, we also observed increased expression of EGR1 mRNA and of some Sp3 isoforms. Electrophoretic mobility shift assay showed a supershift of the −61 to −42-bp probe with an anti-EGR1 antibody in PTH-treated cells, suggesting that EGR1 binding is relevant for the inhibitory activity of PTH. We conclude that PTH-induced inhibition of NHE3 transcription is related to higher EGR1 expression; to EGR1 binding to the proximal and core promoters; and to PKA and JAK/STAT pathway activation. This mechanism might be responsible, at least in part, for lower NHE3 expression and sodium reabsorption in renal proximal tubules in the presence of high PTH levels. - Highlights: • PTH regulation of Nhe3 promoter depends on EGR1 binding. • EGR1, PKA and JAK/STAT are involved in PTH inhibition of the Nhe3 promoter. • PTH alters expression of EGR1 and Sp3. • PTH inhibits the Nhe3 promoter by regulating PKA and JAK/STAT signaling.

  11. The effect of pulsed electric fields on the electrotactic migration of human neural progenitor cells through the involvement of intracellular calcium signaling.


    Hayashi, Hisamitsu; Edin, Fredrik; Li, Hao; Liu, Wei; Rask-Andersen, Helge


    Endogenous electric fields (EFs) are required for the physiological control of the central nervous system development. Application of the direct current EFs to neural stem cells has been studied for the possibility of stem cell transplantation as one of the therapies for brain injury. EFs generated within the nervous system are often associated with action potentials and synaptic activity, apparently resulting in a pulsed current in nature. The aim of this study is to investigate the effect of pulsed EF, which can reduce the cytotoxicity, on the migration of human neural progenitor cells (hNPCs). We applied the mono-directional pulsed EF with a strength of 250mV/mm to hNPCs for 6h. The migration distance of the hNPCs exposed to pulsed EF was significantly greater compared with the control not exposed to the EF. Pulsed EFs, however, had less of an effect on the migration of the differentiated hNPCs. There was no significant change in the survival of hNPCs after exposure to the pulsed EF. To investigate the role of Ca(2+) signaling in electrotactic migration of hNPCs, pharmacological inhibition of Ca(2+) channels in the EF-exposed cells revealed that the electrotactic migration of hNPCs exposed to Ca(2+) channel blockers was significantly lower compared to the control group. The findings suggest that the pulsed EF induced migration of hNPCs is partly influenced by intracellular Ca(2+) signaling.

  12. Characteristics of intracellular Ca2+ signals consisting of two successive peaks in hepatocytes during liver regeneration after 70% partial hepatectomy in rats

    PubMed Central

    Taira, Zenei; Ueda, Yukari; Monmasu, Hiroshi; Yamase, Daisuke; Miyake, Sayaka; Shiraishi, Maya


    Two specific signals for regulating liver regeneration were found after 70% partial hepatectomy (PH) in rats. The first finding was a sustained increasing signal of intracellular Ca2+ ([Ca2+]i) in hepatocytes, consisting of two successive peaks with the first narrow peak at 1 hour and the second broad peak increasing by day 3 and then returning to normal by day 4. The second finding was an abnormal peak in the restoring ratio (Rr) curve of liver regeneration after 70% PH at day 4, where the Rr exceeded 100% temporarily, returned to a lower level, and then proceeded to a termination phase of liver regeneration. For 4 days around the two successive [Ca2+]i peaks and abnormal peak, various physiological activities were induced to promote liver regeneration after 70% PH. mRNA expression of genes encoding Ca2+-binding proteins S100A4 and calpain was induced between the two Ca2+ peaks. Hepatocytes underwent synchronous cell proliferation as the liver was restored from 30% to 70% at day 4, and significant expression of VEGF mRNA at around day 4 promoted angiogenesis to remodel the sinusoidal system. Cytochrome P450 activity levels in microsomes and alanine aminotransferase values at 24 hours after CCl4 administration were decreased after 70% PH, which recovered transiently to the control level at day 4, returned to the decreased level, and then slowly recovered by day 10. Thus, these results indicate that day 4 is important during liver regeneration after 70% PH. PMID:27757054

  13. Toll-like receptor 2 (TLR2) mediates intracellular signalling in human keratinocytes in response to Malassezia furfur.


    Baroni, Adone; Orlando, Manuela; Donnarumma, Giovanna; Farro, Pietro; Iovene, Maria Rosaria; Tufano, Maria Antonietta; Buommino, Elisabetta


    Toll-like receptors (TLRs) are crucial players in the innate immune response to microbial invaders. The lipophilic yeast Malassezia furfur has been implicated in the triggering of scalp lesions in psoriasis. The aim of the present study was to assess the role of TLRs in the defence against M. furfur infection. The expression of the myeloid differentiation factor 88 (MyD88) gene, which is involved in the signalling pathway of many TLRs, was also analysed. In addition, a possible correlation of antimicrobial peptides of the beta-defensin family to TLRs was tested. Human keratinocytes infected with M. furfur and a variety of M. furfur-positive psoriatic skin biopsies were analysed by RT-PCR, for TLRs, MyD88, human beta-defensin 2 (HBD-2), HBD-3 and interleukin-8 (IL-8) mRNA expression. When keratinocytes were infected with M. furfur, an up-regulation for TLR2, MyD88, HBD-2, HBD-3 and IL-8 mRNA was demonstrated, compared to the untreated cells. The same results were obtained when psoriatic skin biopsies were analysed. The M. furfur-induced increase in HBD-2 and IL-8 gene expression is inhibited by anti-TLR2 neutralising antibodies, suggesting that TLR2 is involved in the M. furfur-induced expression of these molecules. These findings suggest the importance of TLRs in skin protection against fungi and the importance of keratinocytes as a component of innate immunity.

  14. Microdamage induced calcium efflux from bone matrix activates intracellular calcium signaling in osteoblasts via L-type and T-type voltage-gated calcium channels.


    Jung, Hyungjin; Best, Makenzie; Akkus, Ozan


    Mechanisms by which bone microdamage triggers repair response are not completely understood. It has been shown that calcium efflux ([Ca(2+)]E) occurs from regions of bone undergoing microdamage. Such efflux has also been shown to trigger intracellular calcium signaling ([Ca(2+)]I) in MC3T3-E1 cells local to damaged regions. Voltage-gated calcium channels (VGCCs) are implicated in the entry of [Ca(2+)]E to the cytoplasm. We investigated the involvement of VGCC in the extracellular calcium induced intracellular calcium response (ECIICR). MC3T3-E1 cells were subjected to one dimensional calcium efflux from their basal aspect which results in an increase in [Ca(2+)]I. This increase was concomitant with membrane depolarization and it was significantly reduced in the presence of Bepridil, a non-selective VGCC inhibitor. To identify specific type(s) of VGCC in ECIICR, the cells were treated with selective inhibitors for different types of VGCC. Significant changes in the peak intensity and the number of [Ca(2+)]I oscillations were observed when L-type and T-type specific VGCC inhibitors (Verapamil and NNC55-0396, respectively) were used. So as to confirm the involvement of L- and T-type VGCC in the context of microdamage, cells were seeded on devitalized notched bone specimen, which were loaded to induce microdamage in the presence and absence of Verapamil and NNC55-0396. The results showed significant decrease in [Ca(2+)]I activity of cells in the microdamaged regions of bone when L- and T-type blockers were applied. This study demonstrated that extracellular calcium increase in association with damage depolarizes the cell membrane and the calcium ions enter the cell cytoplasm by L- and T-type VGCCs.

  15. Two-Component Signaling System VgrRS Directly Senses Extracytoplasmic and Intracellular Iron to Control Bacterial Adaptation under Iron Depleted Stress

    PubMed Central

    Wang, Li; Pan, Yue; Yuan, Zhi-Hui; Zhang, Huan; Peng, Bao-Yu; Wang, Fang-Fang


    Both iron starvation and excess are detrimental to cellular life, especially for animal and plant pathogens since they always live in iron-limited environments produced by host immune responses. However, how organisms sense and respond to iron is incompletely understood. Herein, we reveal that in the phytopathogenic bacterium Xanthomonas campestris pv. campestris, VgrS (also named ColS) is a membrane-bound receptor histidine kinase that senses extracytoplasmic iron limitation in the periplasm, while its cognate response regulator, VgrR (ColR), detects intracellular iron excess. Under iron-depleted conditions, dissociation of Fe3+ from the periplasmic sensor region of VgrS activates the VgrS autophosphorylation and subsequent phosphotransfer to VgrR, an OmpR-family transcription factor that regulates bacterial responses to take up iron. VgrR-VgrS regulon and the consensus DNA binding motif of the transcription factor VgrR were dissected by comparative proteomic and ChIP-seq analyses, which revealed that in reacting to iron-depleted environments, VgrR directly or indirectly controls the expressions of hundreds of genes that are involved in various physiological cascades, especially those associated with iron-uptake. Among them, we demonstrated that the phosphorylated VgrR tightly represses the transcription of a special TonB-dependent receptor gene, tdvA. This regulation is a critical prerequisite for efficient iron uptake and bacterial virulence since activation of tdvA transcription is detrimental to these processes. When the intracellular iron accumulates, the VgrR-Fe2+ interaction dissociates not only the binding between VgrR and the tdvA promoter, but also the interaction between VgrR and VgrS. This relieves the repression in tdvA transcription to impede continuous iron uptake and avoids possible toxic effects of excessive iron accumulation. Our results revealed a signaling system that directly senses both extracytoplasmic and intracellular iron to modulate

  16. Human T cell lymphotropic virus type I genomic expression and impact on intracellular signaling pathways during neurodegenerative disease and leukemia.


    Yao, J; Wigdahl, B


    HTLV-I has been identified as the etiologic agent of neoplasia within the human peripheral blood T lymphocyte population, and a progressive neurologic disorder based primarily within the central nervous system. We have examined the role of HTLV-I in these two distinctly different clinical syndromes by examining the life cycle of the virus, with emphasis on the regulation of viral gene expression within relevant target cell populations. In particular, we have examined the impact of specific viral gene products, particularly Tax, on cellular metabolic function. Tax is a highly promiscuous and pleiotropic viral oncoprotein, and is the most important factor contributing to the initial stages of viral-mediated transformation of T cells after HTLV-I infection. Tax, which weakly binds to Tax response element 1 (TRE-1) in the viral long terminal repeat (LTR), can dramatically trans-activate viral gene expression by interacting with cellular transcription factors, such as activated transcription factors and cyclic AMP response element binding proteins (ATF/CREB), CREB binding protein (CBP/p300), and factors involved with the basic transcription apparatus. At the same time, Tax alters cellular gene expression by directly or indirectly interacting with a variety of cellular transcription factors, cell cycle control elements, and cellular signal transduction molecules ultimately resulting in dysregulated cell proliferation. The mechanisms associated with HTLV-I infection, leading to tropical spastic paraparesis (TSP) are not as clearly resolved. Possible explanations of viral-induced neurologic disease range from central nervous system (CNS) damage caused by direct viral invasion of the CNS to bystander CNS damage caused by the immune response to HTLV-I infection. It is interesting to note that it is very rare for an HTLV-I infected individual to develop both adult T cell leukemia (ATL) and TSP in his/her life time, suggesting that the mechanisms governing development of these

  17. Internal affairs: investigating the Brucella intracellular lifestyle.


    von Bargen, Kristine; Gorvel, Jean-Pierre; Salcedo, Suzana P


    Bacteria of the genus Brucella are Gram-negative pathogens of several animal species that cause a zoonotic disease in humans known as brucellosis or Malta fever. Within their hosts, brucellae reside within different cell types where they establish a replicative niche and remain protected from the immune response. The aim of this article is to discuss recent advances in the field in the specific context of the Brucella intracellular 'lifestyle'. We initially discuss the different host cell targets and their relevance during infection. As it represents the key to intracellular replication, the focus is then set on the maturation of the Brucella phagosome, with particular emphasis on the Brucella factors that are directly implicated in intracellular trafficking and modulation of host cell signalling pathways. Recent data on the role of the type IV secretion system are discussed, novel effector molecules identified and how some of them impact on trafficking events. Current knowledge on Brucella gene regulation and control of host cell death are summarized, as they directly affect intracellular persistence. Understanding how Brucella molecules interplay with their host cell targets to modulate cellular functions and establish the intracellular niche will help unravel how this pathogen causes disease.

  18. Filamin A interaction with the CXCR4 third intracellular loop regulates endocytosis and signaling of WT and WHIM-like receptors.


    Gómez-Moutón, Concepción; Fischer, Thierry; Peregil, Rosa M; Jiménez-Baranda, Sonia; Stossel, Thomas P; Nakamura, Fumihiko; Mañes, Santos


    Warts, hypogammaglobulinemia, infections, and myelokathexis (WHIM) syndrome is a rare congenital immunodeficiency often caused by mutations in the last 10 to 19 C-terminal amino acids of CXCR4. These mutations impair CXCR4 internalization and increase responsiveness to CXCL12. The CXCR4 C-terminal domain (C-tail) also has a binding site for the actin-binding protein filamin A (FLNA); it is not known whether FLNA binds to WHIM CXCR4 mutants or whether this interaction is implicated in the hyperfunction of these receptors. Here we show that, in addition to interacting with the CXCR4 C-tail, FLNA interacted with a region in the receptor third intracellular loop (ICL3) spanning amino acids 238 to 246. This interaction involved specific FLNA repeats and was sensitive to Rho kinase inhibition. Deletion of the 238-246 motif accelerated CXCL12-induced wild-type (WT) receptor endocytosis but enabled CXCL12-mediated endocytosis and normalized signaling by the WHIM-associated receptor CXCR4(R334X). CXCL12 stimulation triggered CXCR4(R334X) internalization in FLNA-deficient M2 cells but not in the FLNA-expressing M2 subclone A7; this suggests a role for FLNA in stabilization of WHIM-like CXCR4 at the cell surface. FLNA increased β-arrestin2 binding to CXCR4(R334X) in vivo, which provides a molecular basis for FLNA-mediated hyperactivation of WHIM receptor signaling. We propose that FLNA interaction with ICL3 is central for endocytosis and signaling of WT and WHIM-like CXCR4 receptors.

  19. Intracellular ice and cell survival in cryo-exposed embryonic axes of recalcitrant seeds of Acer saccharinum: an ultrastructural study of factors affecting cell and ice structures

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cryogenic technologies are required to preserve embryonic axes of recalcitrant seeds. Formation of potentially lethal intracellular ice limits successful cryopreservation; thus, it is important to understand the relationships among cryo-exposure techniques, water content and survival. In this pap...

  20. Evolution of cytokine responses: IL-1beta directly affects intracellular Ca2+ concentration of teleost fish leukocytes through a receptor-mediated mechanism.


    Benedetti, S; Randelli, E; Buonocore, F; Zou, J; Secombes, C J; Scapigliati, G


    In this work we studied the biological activities of recombinant IL-1beta from the teleosts sea bass (Dicentrarchus labrax) and rainbow trout (Oncorhynchus mykiss) by investigating the effects induced on intracellular Ca2+ concentrations ([Ca2+]i) of spleen leucocytes. Splenocytes were loaded with the Ca2+-permeant Fura-2AM, and then stimulated with rIL-1beta. The emitted fluorescence was read for 5 min at 1 min intervals on a dual excitation fluorescence fluorimeter. Results showed that rIL-1beta induced in both species a rise in [Ca2+]i, and a subsequent decrease until 5 min after stimulation. The stimulating effect was dose-dependent in both species reaching a plateau at 200 ng/ml of rIL-1beta, was abolished by heat-treatment of rIL-1beta, and affected in a dose-dependent fashion by treatment of leucocytes with trypsin. These features suggested a functional IL-1 receptor was involved in the binding. The observed rise in [Ca2+]i was not detected in human PBMC and was species-specific, since rIL-1beta from sea bass, trout, and human were unable to interfere each other in the assay. Moreover, incubation of splenocytes with rIL-1beta induced a rapid tyrosine phosphorylation of a 24 kDa polypeptide in both species. This work represents the first evidence of a direct effect on [Ca2+]i induced by IL-1beta and suggests that in the evolution of IL-1 activities, teleost fishes display a peculiar IL-1-associated behaviour that is lacking in mammals.

  1. Factors Affecting the Timing of Signal Detection of Adverse Drug Reactions.


    Hashiguchi, Masayuki; Imai, Shungo; Uehara, Keiko; Maruyama, Junya; Shimizu, Mikiko; Mochizuki, Mayumi


    We investigated factors affecting the timing of signal detection by comparing variations in reporting time of known and unknown ADRs after initial drug release in the USA. Data on adverse event reactions (AERs) submitted to U.S. FDA was used. Six ADRs associated with 6 drugs (rosuvastatin, aripiprazole, teriparatide, telithromycin, exenatide, varenicline) were investigated: Changes in the proportional reporting ratio, reporting odds ratio, and information component as indexes of signal detection were followed every 3 months after each drugs release, and the time for detection of signals was investigated. The time for the detection of signal to be detected after drug release in the USA was 2-10 months for known ADRs and 19-44 months for unknown ones. The median lag time for known and unknown ADRs was 99.0-122.5 days and 185.5-306.0 days, respectively. When the FDA released advisory information on rare but potentially serious health risks of an unknown ADR, the time lag to report from the onset of ADRs to the FDA was shorter. This study suggested that one factor affecting signal detection time is whether an ADR was known or unknown at release.

  2. Extra and intracellular calcium signaling pathway(s) differentially regulate histamine-induced myometrial contractions during early and mid-pregnancy stages in buffaloes (Bubalus bubalis).


    Sharma, Abhishek; Nakade, Udayraj P; Choudhury, Soumen; Yadav, Rajkumar Singh; Garg, Satish Kumar


    This study examines the differential role of calcium signaling pathway(s) in histamine-induced uterotonic action during early and mid-pregnancy stages in buffaloes. Compared to mid pregnancy, tonic contraction, amplitude and mean-integral tension were significantly increased by histamine to produce myometrial contraction during early pregnancy with small effects on phasic contraction and frequency. Although uterotonic action of histamine during both stages of pregnancy is sensitive to nifedipine (a L-type Ca(2+) channels blocker) and NNC55-0396 (T-type Ca(2+) channels blocker), the role of extracellular calcium seems to be more significant during mid-pregnancy as in this stage histamine produced only 9.38±0.96% contraction in Ca(2+) free-RLS compared to 21.60±1.45% in uteri of early pregnancy stage. Intracellular calcium plays major role in histamine-induced myometrial contraction during early pregnancy as compared to mid pregnancy, as in the presence of cyclopiazonic acid (CPA) Ca(2+)-free RLS, histamine produced significantly higher contraction in myometrial strips of early-pregancy in comparison to mid-pregnancy (10.59±1.58% and 3.13±0.46%, respectively). In the presence of U-73122, the DRC of histamine was significantly shifted towards right with decrease in maximal effect (Emax) only in early pregnancy suggesting the predominant role of phospholipase-C (PL-C) in this stage of pregnancy.

  3. Intracellular signaling is changed after clustering of the neural cell adhesion molecules axonin-1 and NgCAM during neurite fasciculation

    PubMed Central


    Neural cell adhesion molecules of the immunoglobulin/fibronectin type III family on axons have been implicated in promotion of neurite outgrowth, fasciculation, and the mediation of specific cell adhesion. The present study demonstrates that two of these molecules on dorsal root ganglion neurons are associated with distinct protein kinases, axonin-1 with the src-related nonreceptor tyrosine kinase fyn and NgCAM with a casein kinase II-related activity and a serine/ threonine kinase related to S6 kinase. When neurites grew without contacts involving axonin-1 and NgCAM, strong fyn kinase activity was associated with axonin-1, whereas the NgCAM-associated kinase activities were low. Clustering of axonin-1 with NgCAM induced by the formation of cell-cell contacts correlated with a reduction of the axonin-1-associated fyn activity and an increased phosphorylation of NgCAM by the associated casein kinase II-related activity. Thus, axonin-1 and NgCAM trigger distinctive intracellular signals during in vitro differentiation depending on their state of association. PMID:8858178

  4. Intracellular β2-adrenergic receptor signaling specificity in mouse skeletal muscle in response to single-dose β2-agonist clenbuterol treatment and acute exercise.


    Sato, Shogo; Shirato, Ken; Mitsuhashi, Ryosuke; Inoue, Daisuke; Kizaki, Takako; Ohno, Hideki; Tachiyashiki, Kaoru; Imaizumi, Kazuhiko


    The aim of this study was to clarify the intracellular β2-adrenergic receptor signaling specificity in mouse slow-twitch soleus and fast-twitch tibialis anterior (TA) muscles, resulting from single-dose β2-agonist clenbuterol treatment and acute exercise. At 1, 4, and 24 h after single-dose treatment with clenbuterol or after acute running exercise, the soleus and TA muscles were isolated and subjected to analysis. The phosphorylation of p38 mitogen-activated protein kinase (MAPK) increased after single-dose clenbuterol treatment and acute exercise in the soleus muscle but not in the TA muscle. Although there was no change in the phosphorylation of Akt after acute exercise in either muscle, phosphorylation of Akt in the soleus muscle increased after single-dose clenbuterol treatment, whereas that in the TA muscle remained unchanged. These results suggest that p38 MAPK and Akt pathways play a functional role in the adaptation to clenbuterol treatment and exercise, particularly in slow-twitch muscles.

  5. Mutation of Glycosylation Sites in BST-2 Leads to Its Accumulation at Intracellular CD63-Positive Vesicles without Affecting Its Antiviral Activity against Multivesicular Body-Targeted HIV-1 and Hepatitis B Virus.


    Han, Zhu; Lv, Mingyu; Shi, Ying; Yu, Jinghua; Niu, Junqi; Yu, Xiao-Fang; Zhang, Wenyan


    BST-2/tetherin blocks the release of various enveloped viruses including HIV-1 with a "physical tethering" model. The detailed contribution of N-linked glycosylation to this model is controversial. Here, we confirmed that mutation of glycosylation sites exerted an effect of post-translational mis-trafficking, leading to an accumulation of BST-2 at intracellular CD63-positive vesicles. BST-2 with this phenotype potently inhibited the release of multivesicular body-targeted HIV-1 and hepatitis B virus, without affecting the co-localization of BST-2 with EEA1 and LAMP1. These results suggest that N-linked glycosylation of human BST-2 is dispensable for intracellular virion retention and imply that this recently discovered intracellular tethering function may be evolutionarily distinguished from the canonical antiviral function of BST-2 by tethering nascent virions at the cell surface.

  6. Enhanced glucose-induced intracellular signaling promotes insulin hypersecretion: pancreatic beta-cell functional adaptations in a model of genetic obesity and prediabetes.


    Irles, Esperanza; Ñeco, Patricia; Lluesma, Mónica; Villar-Pazos, Sabrina; Santos-Silva, Junia Carolina; Vettorazzi, Jean F; Alonso-Magdalena, Paloma; Carneiro, Everardo M; Boschero, Antonio C; Nadal, Ángel; Quesada, Ivan


    Obesity is associated with insulin resistance and is known to be a risk factor for type-2 diabetes. In obese individuals, pancreatic beta-cells try to compensate for the increased insulin demand in order to maintain euglycemia. Most studies have reported that this adaptation is due to morphological changes. However, the involvement of beta-cell functional adaptations in this process needs to be clarified. For this purpose, we evaluated different key steps in the glucose-stimulated insulin secretion (GSIS) in intact islets from female ob/ob obese mice and lean controls. Obese mice showed increased body weight, insulin resistance, hyperinsulinemia, glucose intolerance and fed hyperglycemia. Islets from ob/ob mice exhibited increased glucose-induced mitochondrial activity, reflected by enhanced NAD(P)H production and mitochondrial membrane potential hyperpolarization. Perforated patch-clamp examination of beta-cells within intact islets revealed several alterations in the electrical activity such as increased firing frequency and higher sensitivity to low glucose concentrations. A higher intracellular Ca(2+) mobilization in response to glucose was also found in ob/ob islets. Additionally, they displayed a change in the oscillatory pattern and Ca(2+) signals at low glucose levels. Capacitance experiments in intact islets revealed increased exocytosis in individual ob/ob beta-cells. All these up-regulated processes led to increased GSIS. In contrast, we found a lack of beta-cell Ca(2+) signal coupling, which could be a manifestation of early defects that lead to beta-cell malfunction in the progression to diabetes. These findings indicate that beta-cell functional adaptations are an important process in the compensatory response to obesity.

  7. In vivo optical microprobe imaging for intracellular Ca2+ dynamics in response to dopaminergic signaling in deep brain evoked by cocaine

    NASA Astrophysics Data System (ADS)

    Luo, Zhongchi; Pan, Yingtian; Du, Congwu


    Ca2+ plays a vital role as second messenger in signal transduction and the intracellular Ca2+ ([Ca2+]i) change is an important indicator of neuronal activity in the brain, including both cortical and subcortical brain regions. Due to the highly scattering and absorption of brain tissue, it is challenging to optically access the deep brain regions (e.g., striatum at >3mm under the brain surface) and image [Ca2+]i changes with cellular resolutions. Here, we present two micro-probe approaches (i.e., microlens, and micro-prism) integrated with a fluorescence microscope modified to permit imaging of neuronal [Ca2+]i signaling in the striatum using a calcium indicator Rhod2(AM). While a micro-prism probe provides a larger field of view to image neuronal network from cortex to striatum, a microlens probe enables us to track [Ca2+]i dynamic change in individual neurons within the brain. Both techniques are validated by imaging neuronal [Ca2+]i changes in transgenic mice with dopamine receptors (D1R, D2R) expressing EGFP. Our results show that micro-prism images can map the distribution of D1R- and D2R-expressing neurons in various brain regions and characterize their different mean [Ca2+]i changes induced by an intervention (e.g., cocaine administration, 8mg/kg., i.p). In addition, microlens images can characterize the different [Ca2+]i dynamics of D1 and D2 neurons in response to cocaine, including new mechanisms of these two types of neurons in striatum. These findings highlight the power of the optical micro-probe imaging for dissecting the complex cellular and molecular insights of cocaine in vivo.

  8. The C-terminal domains of the GABA(b) receptor subunits mediate intracellular trafficking but are not required for receptor signaling.


    Calver, A R; Robbins, M J; Cosio, C; Rice, S Q; Babbs, A J; Hirst, W D; Boyfield, I; Wood, M D; Russell, R B; Price, G W; Couve, A; Moss, S J; Pangalos, M N


    GABA(B) receptors are G-protein-coupled receptors that mediate slow synaptic inhibition in the brain and spinal cord. These receptors are heterodimers assembled from GABA(B1) and GABA(B2) subunits, neither of which is capable of producing functional GABA(B) receptors on homomeric expression. GABA(B1,) although able to bind GABA, is retained within the endoplasmic reticulum (ER) when expressed alone. In contrast, GABA(B2) is able to access the cell surface when expressed alone but does not couple efficiently to the appropriate effector systems or produce any detectable GABA-binding sites. In the present study, we have constructed chimeric and truncated GABA(B1) and GABA(B2) subunits to explore further GABA(B) receptor signaling and assembly. Removal of the entire C-terminal intracellular domain of GABA(B1) results in plasma membrane expression without the production of a functional GABA(B) receptor. However, coexpression of this truncated GABA(B1) subunit with either GABA(B2) or a truncated GABA(B2) subunit in which the C terminal has also been removed is capable of functional signaling via G-proteins. In contrast, transferring the entire C-terminal tail of GABA(B1) to GABA(B2) leads to the ER retention of the GABA(B2) subunit when expressed alone. These results indicate that the C terminal of GABA(B1) mediates the ER retention of this protein and that neither of the C-terminal tails of GABA(B1) or GABA(B2) is an absolute requirement for functional coupling of heteromeric receptors. Furthermore although GABA(B1) is capable of producing GABA-binding sites, GABA(B2) is of central importance in the functional coupling of heteromeric GABA(B) receptors to G-proteins and the subsequent activation of effector systems.

  9. Using neurophysiological signals that reflect cognitive or affective state: six recommendations to avoid common pitfalls.


    Brouwer, Anne-Marie; Zander, Thorsten O; van Erp, Jan B F; Korteling, Johannes E; Bronkhorst, Adelbert W


    Estimating cognitive or affective state from neurophysiological signals and designing applications that make use of this information requires expertise in many disciplines such as neurophysiology, machine learning, experimental psychology, and human factors. This makes it difficult to perform research that is strong in all its aspects as well as to judge a study or application on its merits. On the occasion of the special topic "Using neurophysiological signals that reflect cognitive or affective state" we here summarize often occurring pitfalls and recommendations on how to avoid them, both for authors (researchers) and readers. They relate to defining the state of interest, the neurophysiological processes that are expected to be involved in the state of interest, confounding factors, inadvertently "cheating" with classification analyses, insight on what underlies successful state estimation, and finally, the added value of neurophysiological measures in the context of an application. We hope that this paper will support the community in producing high quality studies and well-validated, useful applications.

  10. Encoding physiological signals as images for affective state recognition using convolutional neural networks.


    Yu, Guangliang; Li, Xiang; Song, Dawei; Zhao, Xiaozhao; Zhang, Peng; Hou, Yuexian; Hu, Bin; Guangliang Yu; Xiang Li; Dawei Song; Xiaozhao Zhao; Peng Zhang; Yuexian Hou; Bin Hu; Zhao, Xiaozhao; Hou, Yuexian; Li, Xiang; Hu, Bin; Zhang, Peng; Song, Dawei; Yu, Guangliang


    Affective state recognition based on multiple modalities of physiological signals has been a hot research topic. Traditional methods require designing hand-crafted features based on domain knowledge, which is time-consuming and has not achieved a satisfactory performance. On the other hand, conducting classification on raw signals directly can also cause some problems, such as the interference of noise and the curse of dimensionality. To address these problems, we propose a novel approach that encodes different modalities of data as images and use convolutional neural networks (CNN) to perform the affective state recognition task. We validate our aproach on the DECAF dataset in comparison with two state-of-the-art methods, i.e., the Support Vector Machines (SVM) and Random Forest (RF). Experimental results show that our aproach outperforms the baselines by 5% to 9%.

  11. Traffic signal phasing at intersections to improve safety for alcohol-affected pedestrians.


    Lenné, Michael G; Corben, Bruce F; Stephan, Karen


    Alcohol-affected pedestrians are among the highest-risk groups involved in pedestrian casualty crashes. This paper investigates the opportunities to use a modified form of traffic signal operation during high-risk periods and at high-risk locations to reduce alcohol-affected pedestrian crashes and the severity of injuries that might otherwise occur. The 'Dwell-on-Red' treatment involves displaying a red traffic signal to all vehicle directions during periods when no vehicular traffic is detected, so that drivers approach high-risk intersections at a lower speed than if a green signal were displayed. Vehicle speed data were collected before and after treatment activation at both a control and treatment site. Speed data were collected both 30 m prior to and at the intersection stop line. The treatment was associated with a reduction in mean vehicle speeds of 3.9 kph (9%) and 11.0 kph (28%) at 30 m and stop line collection points, respectively, and substantial reductions in the proportion of vehicles travelling at threatening speeds with regard to the severity of pedestrian injury. Other important road safety concerns may also benefit from this form of traffic signal modification, and it is recommended that other areas of application be explored, including the other severe trauma categories typically concentrated around signalised intersections.

  12. Retinoic Acid Signaling Is Essential for Valvulogenesis by Affecting Endocardial Cushions Formation in Zebrafish Embryos.


    Li, Junbo; Yue, Yunyun; Zhao, Qingshun


    Retinoic acid (RA) plays important roles in many stages of heart morphogenesis. Zebrafish embryos treated with exogenous RA display defective atrio-ventricular canal (AVC) specification. However, whether endogenous RA signaling takes part in cardiac valve formation remains unknown. Herein, we investigated the role of RA signaling in cardiac valve development by knocking down aldh1a2, the gene encoding an enzyme that is mainly responsible for RA synthesis during early development, in zebrafish embryos. The results showed that partially knocking down aldh1a2 caused defective formation of primitive cardiac valve leaflets at 108 hpf (hour post-fertilization). Inhibiting endogenous RA signaling by 4-diethylaminobenzal-dehyde revealed that 16-26 hpf was a key time window when RA signaling affects the valvulogenesis. The aldh1a2 morphants had defective formation of endocardial cushion (EC) at 76 hpf though they had almost normal hemodynamics and cardiac chamber specification at early development. Examining the expression patterns of AVC marker genes including bmp4, bmp2b, nppa, notch1b, and has2, we found the morphants displayed abnormal development of endocardial AVC but almost normal development of myocardial AVC at 50 hpf. Being consistent with the reduced expression of notch1b in endocardial AVC, the VE-cadherin gene cdh5, the downstream gene of Notch signaling, was ectopically expressed in AVC of aldh1a2 morphants at 50 hpf, and overexpression of cdh5 greatly affected the formation of EC in the embryos at 76 hpf. Taken together, our results suggest that RA signaling plays essential roles in zebrafish cardiac valvulogenesis.

  13. Reconstruction and analysis of the pupil dilation signal: Application to a psychophysiological affective protocol.


    Onorati, Francesco; Barbieri, Riccardo; Mauri, Maurizio; Russo, Vincenzo; Mainardi, Luca


    Pupil dilation (PD) dynamics reflect the interactions of sympathetic and parasympathetic innervations in the iris muscle. Different pupillary responses have been observed with respect to emotionally characterized stimuli. Evidences of the correlation between PD and respiration, heart rate variability (HRV) and blood pressure (BP) are present in literature, making the pupil dilation a candidate for estimating the activity state of the Autonomic Nervous System (ANS), in particular during stressful and/or emotionally characterized stimuli. The aim of this study is to investigate whether both slow and fast PD dynamics can be addressed to characterized different affective states. Two different frequency bands were considered: the classical autonomic band [0-0.45] Hz and a very high frequency (VHF) band [0.45-5] Hz. The pupil dilation signals from 13 normal subjects were recorded during a psychological protocol suitable to evoke particular affective states. An elaborate reconstruction of the missing data (blink events and artifacts) was performed to obtain a more reliable signal, particularly in the VHF band. Results show a high correlation between the arousal of the event and the power characteristics of the signal, in all frequencies. In particular, for the "Anger" condition, we can observe 10 indices out of 13 significantly different with respect to "Baseline" counterparts. These preliminary results suggest that both slow and fast oscillations of the PD can be used to characterize affective states.

  14. An insulin-like signaling pathway affects both longevity and reproduction in Caenorhabditis elegans.

    PubMed Central

    Tissenbaum, H A; Ruvkun, G


    Mutations in daf-2 and age-1 cause a dramatic increase in longevity as well as developmental arrest at the dauer diapause stage in Caenorhabditis elegans. daf-2 and age-1 encode components of an insulin-like signaling pathway. Both daf-2 and age-1 act at a similar point in the genetic epistasis pathway for dauer arrest and longevity and regulate the activity of the daf-16 gene. Mutations in daf-16 cause a dauer-defective phenotype and are epistatic to the diapause arrest and life span extension phenotypes of daf-2 and age-1 mutants. Here we show that mutations in this pathway also affect fertility and embryonic development. Weak daf-2 alleles, and maternally rescued age-1 alleles that cause life span extension but do not arrest at the dauer stage, also reduce fertility and viability. We find that age-1(hx546) has reduced both maternal and zygotic age-1 activity. daf-16 mutations suppress all of the daf-2 and age-1 phenotypes, including dauer arrest, life span extension, reduced fertility, and viability defects. These data show that insulin signaling, mediated by DAF-2 through the AGE-1 phosphatidylinositol-3-OH kinase, regulates reproduction and embryonic development, as well as dauer diapause and life span, and that DAF-16 transduces these signals. The regulation of fertility, life span, and metabolism by an insulin-like signaling pathway is similar to the endocrine regulation of metabolism and fertility by mammalian insulin signaling. PMID:9504918

  15. Combining S-cone and luminance signals adversely affects discrimination of objects within backgrounds

    PubMed Central

    Jennings, Ben J.; Tsattalios, Konstantinos; Chakravarthi, Ramakrishna; Martinovic, Jasna


    The visual system processes objects embedded in complex scenes that vary in both luminance and colour. In such scenes, colour contributes to the segmentation of objects from backgrounds, but does it also affect perceptual organisation of object contours which are already defined by luminance signals, or are these processes unaffected by colour’s presence? We investigated if luminance and chromatic signals comparably sustain processing of objects embedded in backgrounds, by varying contrast along the luminance dimension and along the two cone-opponent colour directions. In the first experiment thresholds for object/non-object discrimination of Gaborised shapes were obtained in the presence and absence of background clutter. Contrast of the component Gabors was modulated along single colour/luminance dimensions or co-modulated along multiple dimensions simultaneously. Background clutter elevated discrimination thresholds only for combined S-(L + M) and L + M signals. The second experiment replicated and extended this finding by demonstrating that the effect was dependent on the presence of relatively high S-(L + M) contrast. These results indicate that S-(L + M) signals impair spatial vision when combined with luminance. Since S-(L + M) signals are characterised by relatively large receptive fields, this is likely to be due to an increase in the size of the integration field over which contour-defining information is summed. PMID:26856308

  16. Parasites and health affect multiple sexual signals in male common wall lizards, Podarcis muralis

    NASA Astrophysics Data System (ADS)

    Martín, José; Amo, Luisa; López, Pilar


    Multiple advertising sexual traits may either advertise different characteristics of male condition or be redundant to reinforce reliability of signals. Research has focused on multiple visual traits. However, in animals that use different multiple additional sensory systems, such as chemoreception, different types of traits might have evolved to signal similar characteristics of a male quality using different sensory channels. We examined whether ventral coloration and chemicals in femoral gland secretions of male common wall lizards, Podarcis muralis, are affected by their health state (blood-parasite load and cell-mediated immune response). Our results indicated that less parasitized lizards had brighter and more yellowish ventral colorations and also femoral secretions with higher proportions of two esters of octadecenoic acid. In addition, lizards with a greater immune response had more saturated coloration and secretions with higher proportions of octadecenoic acid methyl ester. We suggest that these signals would be reliable because only healthier males seemed able to allocate more carotenoids to coloration and presumably costly chemicals to secretions. The use of multiple sensory channels may provide more opportunities to signal a male quality under different circumstances, but also may reinforce the reliability of the signal when both types of traits may be perceived simultaneously.

  17. Neural mechanisms underlying the effects of face-based affective signals on memory for faces: a tentative model

    PubMed Central

    Tsukiura, Takashi


    In our daily lives, we form some impressions of other people. Although those impressions are affected by many factors, face-based affective signals such as facial expression, facial attractiveness, or trustworthiness are important. Previous psychological studies have demonstrated the impact of facial impressions on remembering other people, but little is known about the neural mechanisms underlying this psychological process. The purpose of this article is to review recent functional MRI (fMRI) studies to investigate the effects of face-based affective signals including facial expression, facial attractiveness, and trustworthiness on memory for faces, and to propose a tentative concept for understanding this affective-cognitive interaction. On the basis of the aforementioned research, three brain regions are potentially involved in the processing of face-based affective signals. The first candidate is the amygdala, where activity is generally modulated by both affectively positive and negative signals from faces. Activity in the orbitofrontal cortex (OFC), as the second candidate, increases as a function of perceived positive signals from faces; whereas activity in the insular cortex, as the third candidate, reflects a function of face-based negative signals. In addition, neuroscientific studies have reported that the three regions are functionally connected to the memory-related hippocampal regions. These findings suggest that the effects of face-based affective signals on memory for faces could be modulated by interactions between the regions associated with the processing of face-based affective signals and the hippocampus as a memory-related region. PMID:22837740

  18. Short inter-set rest blunts resistance exercise-induced increases in myofibrillar protein synthesis and intracellular signalling in young males.


    McKendry, James; Pérez-López, Alberto; McLeod, Michael; Luo, Dan; Dent, Jessica R; Smeuninx, Benoit; Yu, Jinglei; Taylor, Angela E; Philp, Andrew; Breen, Leigh


    What is the central question of this study? Does shorter rest between sets of resistance exercise promote a superior circulating hormonal and acute muscle anabolic response compared with longer rest periods? What is the main finding and its importance? We demonstrate that short rest (1 min) between sets of moderate-intensity, high-volume resistance exercise blunts the acute muscle anabolic response compared with a longer rest period (5 min), despite a superior circulating hormonal milieu. These data have important implications for the development of training regimens to maximize muscle hypertrophy. Manipulating the rest-recovery interval between sets of resistance exercise may influence training-induced muscle remodelling. The aim of this study was to determine the acute muscle anabolic response to resistance exercise performed with short or long inter-set rest intervals. In a study with a parallel-group design, 16 males completed four sets of bilateral leg-press and knee-extension exercise at 75% of one-repetition maximum to momentary muscular failure, followed by ingestion of 25 g of whey protein. Resistance exercise sets were interspersed by 1 min (n = 8) or 5 min of passive rest (n = 8). Muscle biopsies were obtained at rest, 0, 4, 24 and 28 h postexercise during a primed continuous infusion of l-[ring-(13) C6 ]phenylalanine to determine myofibrillar protein synthesis and intracellular signalling. We found that the rate of myofibrillar protein synthesis increased above resting values from 0 to 4 h postexercise with 1 (76%; P = 0.047) and 5 min inter-set rest (152%; P < 0.001) and was significantly greater in the 5 min inter-set rest group (P = 0.001). Myofibrillar protein synthesis rates at 24-28 h postexercise remained elevated above resting values (P < 0.05) and were indistinguishable between groups. Postexercise p70S6K(Thr389) and rpS6(Ser240/244) phosphorylation were reduced with 1 compared with 5 min inter-set rest, whereas

  19. Regulation of Leukemic Cell Differentiation through the Vitamin D Receptor at the Levels of Intracellular Signal Transduction, Gene Transcription, and Protein Trafficking and Stability

    PubMed Central

    Gocek, Elżbieta; Baurska, Hanna; Marchwicka, Aleksandra; Marcinkowska, Ewa


    1α,25-Dihydroxyvitamin D3 (1,25(OH)2D) exerts its biological activities through vitamin D receptor (VDR), which is a member of the superfamily of steroid receptors, that act as ligand-dependent transcription factors. Ligated VDR in complex with retinoid X receptor (RXR) binds to regulatory regions of 1,25(OH)2D-target genes. 1,25(OH)2D is able to induce differentiation of leukemic blasts towards macrophage-like cells. Many different acute myeloid leukemia (AML) cell lines respond to 1,25(OH)2D by increasing CD14 cell surface receptor, some additionally upregulate CD11b and CD11c integrins. In untreated AML cells VDR protein is present in cytosol at a very low level, even though its mRNA is continuously expressed. Ligation of VDR causes protein stabilization and translocation to the cell nuclei, where it regulates transcription of target genes. Several important groups of genes are regulated by 1,25(OH)2D in HL60 cells. These genes include differentiation-related genes involved in macrophage function, as well as a gene regulating degradation of 1,25(OH)2D, namely CYP24A1. We summarize here the data which demonstrate that though some cellular responses to 1,25(OH)2D in AML cells are transcription-dependent, there are many others which depend on intracellular signal transduction, protein trafficking and stabilization. The final effect of 1,25(OH)2D action in leukemic cells requires all these acting together. PMID:23213549

  20. Potential involvement of extracellular signal-regulated kinase 1 and 2 in encystation of a primitive eukaryote, Giardia lamblia. Stage-specific activation and intracellular localization.


    Ellis, John G; Davila, Monica; Chakrabarti, Ratna


    Mitogen-activated protein kinase (MAPK) pathways are major signaling systems by which eukaryotic cells convert environmental cues to intracellular events such as proliferation and differentiation. We have identified Giardia lamblia homologues of two members of the MAPK family ERK1 and ERK2. Functional characterization of giardial ERK1 and ERK2 revealed that both kinases were expressed in trophozoites and encysting cells as 44- and 41-kDa polypeptides, respectively, and were catalytically active. Analysis of the kinetic parameters of the recombinant proteins showed that ERK2 is approximately 5 times more efficient than ERK1 in phosphorylating myelin basic protein as a substrate, although the phosphorylating efficiency of the native ERK1 and ERK2 appeared to be the same. Immunofluorescence analysis of the subcellular localization of ERK1 and ERK2 in trophozoites showed ERK1 staining mostly in the median body and in the outer edges of the adhesive disc and ERK2 staining in the nuclei and in the caudal flagella. Our study also showed a noticeable change in the subcellular distribution of ERK2 during encystation, which became more punctate and mostly cytoplasmic, but no significant change in the ERK1 localization at any time during encystation. Interestingly, both ERK1 and ERK2 enzymes exhibited a significantly reduced kinase activity during encystation reaching a minimum at 24 h, except for an initial approximately 2.5-fold increase in the ERK1 activity at 2 h, which resumed back to the normal levels at 48 h despite no apparent change in the expression level of either one of these kinases in encysting cells. A reduced concentration of the phosphorylated ERK1 and ERK2 was also evident in these cells at 24 h. Our study suggests a functional distinction between ERK1 and ERK2 and that these kinases may play a critical role in trophozoite differentiation into cysts.

  1. Enhancement of intracellular signaling associated with hematopoietic progenitor cell survival in response to SDF-1/CXCL12 in synergy with other cytokines.


    Lee, Younghee; Gotoh, Akihiko; Kwon, Hyung-Joo; You, Minute; Kohli, Lisa; Mantel, Charlie; Cooper, Scott; Hangoc, Giao; Miyazawa, Keisuke; Ohyashiki, Kazuma; Broxmeyer, Hal E


    Stromal cell-derived factor 1 (SDF-1/CXCL12) is a multifunctional cytokine. We previously reported that myelopoiesis was enhanced in SDF-1 alpha transgenic mice, probably due in part to SDF-1 alpha enhancement of myeloid progenitor cell (MPC) survival. To understand signaling pathways involved in this activity, we studied the effects on factor-dependent cell line MO7e cells incubated with SDF-1 alpha alone or in combination with other cytokines. SDF-1 alpha induced transient activation of extracellular stress-regulated kinase (ERK1/2), ribosomal S6 kinase (p90RSK) and Akt, molecules implicated in cell survival. Moreover, ERK1/2, p90RSK, and Akt were synergistically activated by SDF-1 alpha in combination with granulocyte-macrophage colony-stimulating factor (GM-CSF), Steel factor (SLF), or thrombopoietin (TPO). Similar effects were seen after pretreatment of MO7e cells with SDF-1 alpha followed by stimulation with the other cytokines, suggesting a priming effect of SDF-1 alpha. Nuclear factor-kappa B (NF-kappa B) did not appear to be involved in SDF-1 alpha actions, alone or in combination with other cytokines. These intracellular effects were consistent with enhanced myeloid progenitor cell survival by SDF-1 alpha after delayed addition of growth factors. SDF-1 alpha alone supported survival of highly purified human cord blood CD34(+++) cells, less purified human cord blood, and MO7e cells; this effect was synergistically enhanced when SDF-1 alpha was combined with low amounts of other survival-promoting cytokines (GM-CSF, SLF, TPO, and FL). SDF-1 may contribute to maintenance of MPCs in bone marrow by enhancing cell survival alone and in combination with other cytokines.

  2. Lyn mediates FIP1L1-PDGFRA signal pathway facilitating IL- 5RA intracellular signal through FIP1L1-PDGFRA/JAK2/Lyn/Akt network complex in CEL.


    Li, Bin; Zhang, Guangsen; Li, Cui; Li, Ruijuan; Lu, Jingchen; He, Zhengxi; Wang, Quan; Peng, Zhenzi; Wang, Jun; Dong, Yeping; Zhang, Chunfang; Tan, Jie Qiong; Bahri, Nacef; Wang, Yuexiang; Duan, Chaojun


    The Fip1-like1 (FIP1L1)-platelet-derived growth factor receptor alpha (PDGFRA) (F/P) oncogene can cause chronic eosinophilic leukemia (CEL), but requires IL-5 cytokine participation. In this study, we investigate the mechanism of F/P in collaboration with IL-5 in CEL. The results showed that Lyn, a key effector in the IL-5-motivated eosinophil production, is extensively activated in F/P-positive CEL cells. Lyn can associate and phosphorylate IL-5 receptor α (IL-5RA) in F/P-positive cells. Moreover, the activation of Lyn and IL-5R kinase were strengthened when the cells were stimulated by IL-5. Lyn inhibition in F/P-positive CEL cells attenuated cellular proliferation, induced apoptosis, and blocked cell migration and major basic protein (MBP) release. We identified the FIP1L1-PDGFRA/JAK2/Lyn/Akt complex in the F/P-expressing cells which can be disrupted by dual inhibition of JAK2 and Lyn, repressing cell proliferation in both EOL-1(F/P-positive human eosinophilic cell line) and imatinib-resistance (IR) cells. Altogether, our data demonstrate that Lyn is a vital downstream kinase activated by F/P converged with IL-5 signals in CEL cells. Lyn activate and expand IL-5RA intracellular signaling through FIP1L1-PDGFRA/JAK2/Lyn/Akt network complex, provoking eosinophils proliferation and exaggerated activation manifested as CEL.

  3. Eccentric exercise activates novel transcriptional regulation of hypertrophic signaling pathways not affected by hormone changes.


    MacNeil, Lauren G; Melov, Simon; Hubbard, Alan E; Baker, Steven K; Tarnopolsky, Mark A


    Unaccustomed eccentric exercise damages skeletal muscle tissue, activating mechanisms of recovery and remodeling that may be influenced by the female sex hormone 17beta-estradiol (E2). Using high density oligonucleotide based microarrays, we screened for differences in mRNA expression caused by E2 and eccentric exercise. After random assignment to 8 days of either placebo (CON) or E2 (EXP), eighteen men performed 150 single-leg eccentric contractions. Muscle biopsies were collected at baseline (BL), following supplementation (PS), +3 hours (3H) and +48 hours (48H) after exercise. Serum E2 concentrations increased significantly with supplementation (P<0.001) but did not affect microarray results. Exercise led to early transcriptional changes in striated muscle activator of Rho signaling (STARS), Rho family GTPase 3 (RND3), mitogen activated protein kinase (MAPK) regulation and the downstream transcription factor FOS. Targeted RT-PCR analysis identified concurrent induction of negative regulators of calcineurin signaling RCAN (P<0.001) and HMOX1 (P = 0.009). Protein contents were elevated for RND3 at 3H (P = 0.02) and FOS at 48H (P<0.05). These findings indicate that early RhoA and NFAT signaling and regulation are altered following exercise for muscle remodeling and repair, but are not affected by E2.

  4. Attention enhances stimulus representations in macaque visual cortex without affecting their signal-to-noise level

    PubMed Central

    Daliri, Mohammad Reza; Kozyrev, Vladislav; Treue, Stefan


    The magnitude of the attentional modulation of neuronal responses in visual cortex varies with stimulus contrast. Whether the strength of these attentional influences is similarly dependent on other stimulus properties is unknown. Here we report the effect of spatial attention on responses in the medial-temporal area (MT) of macaque visual cortex to moving random dots pattern of various motion coherences, i.e. signal-to-noise ratios. Our data show that allocating spatial attention causes a gain change in MT neurons. The magnitude of this attentional modulation is independent of the attended stimulus’ motion coherence, creating a multiplicative scaling of the neuron’s coherence-response function. This is consistent with the characteristics of gain models of attentional modulation and suggests that attention strengthens the neuronal representation of behaviorally relevant visual stimuli relative to unattended stimuli, but without affecting their signal-to-noise ratios. PMID:27283275

  5. Light intensity and temperature affect systemic spread of silencing signal in transient agroinfiltration studies.


    Patil, Basavaprabhu L; Fauquet, Claude M


    RNA silencing is a sequence-specific post-transcriptional gene inactivation mechanism that operates in diverse organisms and that can extend beyond its site of initiation, owing to the movement of the silencing signal, called non-autonomous gene silencing. Previous studies have shown that several factors manifest the movement of the silencing signal, such as the size (21 or 24 nucleotides) of the secondary small interfering RNA (siRNA) produced, the steady-state concentration of siRNAs and their cognate messenger RNA (mRNA) or a change in the sink-source status of plant parts affecting phloem translocation. Our study shows that both light intensity and temperature have a significant impact on the systemic movement of the silencing signal in transient agroinfiltration studies in Nicotiana benthamiana. At higher light intensities (≥ 450 μE/m(2)/s) and higher temperatures (≥ 30 °C), gene silencing was localized to leaf tissue that was infiltrated, without any systemic spread. Interestingly, in these light and temperature conditions (≥ 450 μE/m(2) /s and ≥ 30 °C), the N. benthamiana plants showed recovery from the viral symptoms. However, the reduced systemic silencing and reduced viral symptom severity at higher light intensities were caused by a change in the sink-source status of the plant, ultimately affecting the phloem translocation of small RNAs or the viral genome. In contrast, at lower light intensities (<300 μE/m(2)/s) with a constant temperature of 25 °C, there was strong systemic movement of the silencing signal in the N. benthamiana plants and reduced recovery from virus infections. The accumulation of gene-specific siRNAs was reduced at higher temperature as a result of a reduction in the accumulation of transcript on transient agroinfiltration of RNA interference (RNAi) constructs, mostly because of poor T-DNA transfer activity of Agrobacterium, possibly also accompanied by reduced phloem translocation.

  6. Effect of different chemical bonds in pegylation of zinc protoporphyrin that affects drug release, intracellular uptake, and therapeutic effect in the tumor.


    Tsukigawa, Kenji; Nakamura, Hideaki; Fang, Jun; Otagiri, Masaki; Maeda, Hiroshi


    Pegylated zinc protoporphyrin (PEG-ZnPP) is a water-soluble inhibitor of heme oxygenase-1. In this study, we prepared two types of PEG-ZnPP conjugates with different chemical bonds between PEG and ZnPP, i.e., ester bonds and ether bonds, where both conjugates also contain amide bonds. Cleavability of these bonds in vitro and in vivo, especially cancer tissue, and upon intracellular uptake, was investigated in parallel with biological activities of the conjugates. Each conjugate showed different cleavability by plasma esterases and tumor proteases, as revealed by HPLC analyses. PEG-ZnPP with ester bond (esPEG-ZnPP) was more sensitive than PEG-ZnPP with ether bond (etPEG-ZnPP) for cleavage of PEG chains. etPEG-ZnPP showed no cleavage of PEG chains and had lower intracellular uptake and antitumor activity than did esPEG-ZnPP. The degradation of esPEG-ZnPP appeared to be facilitated by both serine and cysteine proteases in tumor tissues, whereas it was significantly slower in normal organs except the liver. Depegylated products such as free ZnPP had higher intracellular uptake than did intact PEG-ZnPP. We also studied hydrolytic cleavage by blood plasma of different animal species; mouse plasma showed the fastest cleavage whereas human plasma showed the slowest. These results suggest that ester-linked conjugates manifest more efficient cleavage of PEG, and greater yield of the active principle from the conjugates in tumor tissues than in normal tissues. More efficient intracellular uptake and thus an improved therapeutic effect with ester-linked conjugates are thus anticipated with fain stability, particularly in human blood.

  7. Factors affecting the activation and inhibition of intracellular enzymes for degradation of 1,2 diamino benzene: kinetics and thermodynamic studies.


    P, Saranya; G, Sekaran


    Citrobacter freundii, the bacterium isolated from marine sediments was capable of degrading 1,2 diamino benzene (DAB), an endocrine disruptor. The mixed intracellular enzymes from C. freundii were extracted and purified. The mixed intracellular enzymes were used for the degradation of DAB and degree of degradation was evaluated in terms of pyruvic acid, the end product, formed. The variables such as effect of pH, temperature and metal ions on the degradation of DAB using mixed intracellular enzymes (MICE) were investigated. The maximum amount of pyruvic acid formed was found to be 569 ± 5 µg with 96% degradation efficiency at pH 7; temperature 25 °C; zinc nitrate 0.1 mM; and copper sulphate ions 0.15 mM. The stability of MICE at different temperatures and the interaction of MICE with metal ions were confirmed using FT-IR spectroscopy. The formation of pyruvic acid from degradation of DAB followed pseudo-second-order rate kinetics and it was a spontaneous, exothermic process. The activation energy of degradation of DAB by MICE was found to be 82.55 kJ/mol.

  8. Ror2 Receptor Mediates Wnt11 Ligand Signaling and Affects Convergence and Extension Movements in Zebrafish*

    PubMed Central

    Bai, Yan; Tan, Xungang; Zhang, Haifeng; Liu, Chengdong; Zhao, Beibei; Li, Yun; Lu, Ling; Liu, Yunzhang; Zhou, Jianfeng


    The receptor-tyrosine kinase Ror2 acts as an alternative receptor or co-receptor for Wnt5a and mediates Wnt5a-induced convergent extension movements during embryogenesis in mice and Xenopus as well as the polarity and migration of several cell types during development. However, little is known about whether Ror2 function is conserved in other vertebrates or is involved in other non-canonical Wnt ligands in vivo. In this study we demonstrated that overexpression of dominant-negative ror2 (ror2-TM) mRNA in zebrafish embryos resulted in convergence and extension defects and incompletely separated eyes, which is consistent with observations from slb/wnt11 mutants or wnt11 knockdown morphants. Moreover, the co-injection of ror2-TM mRNA and a wnt11 morpholino or the coexpression of ror2 and wnt11 in zebrafish embryos synergetically induced more severe convergence and extension defects. Transplantation studies further demonstrated that the Ror2 receptor responded to the Wnt11 ligand and regulated cell migration and cell morphology during gastrulation. DnRor2 inhibited the action of Wnt11, which was revealed by a decreased percentage of Wnt11-induced convergence and extension defects. Ror2 physically interacts with Wnt11. The intracellular Tyr-647 and Ser-863 sites of Ror2 are essential for mediating the action of Wnt11. Dishevelled and RhoA act downstream of Wnt11-Ror2 to regulate convergence and extension movements. Overall, our data suggest an important role of Ror2 in mediating Wnt11 signaling and in regulating convergence and extension movements in zebrafish. PMID:24928507

  9. Using neurophysiological signals that reflect cognitive or affective state: six recommendations to avoid common pitfalls

    PubMed Central

    Brouwer, Anne-Marie; Zander, Thorsten O.; van Erp, Jan B. F.; Korteling, Johannes E.; Bronkhorst, Adelbert W.


    Estimating cognitive or affective state from neurophysiological signals and designing applications that make use of this information requires expertise in many disciplines such as neurophysiology, machine learning, experimental psychology, and human factors. This makes it difficult to perform research that is strong in all its aspects as well as to judge a study or application on its merits. On the occasion of the special topic “Using neurophysiological signals that reflect cognitive or affective state” we here summarize often occurring pitfalls and recommendations on how to avoid them, both for authors (researchers) and readers. They relate to defining the state of interest, the neurophysiological processes that are expected to be involved in the state of interest, confounding factors, inadvertently “cheating” with classification analyses, insight on what underlies successful state estimation, and finally, the added value of neurophysiological measures in the context of an application. We hope that this paper will support the community in producing high quality studies and well-validated, useful applications. PMID:25983676

  10. Fusarium Oxysporum Volatiles Enhance Plant Growth Via Affecting Auxin Transport and Signaling.


    Bitas, Vasileios; McCartney, Nathaniel; Li, Ningxiao; Demers, Jill; Kim, Jung-Eun; Kim, Hye-Seon; Brown, Kathleen M; Kang, Seogchan


    Volatile organic compounds (VOCs) have well-documented roles in plant-plant communication and directing animal behavior. In this study, we examine the less understood roles of VOCs in plant-fungal relationships. Phylogenetically and ecologically diverse strains of Fusarium oxysporum, a fungal species complex that often resides in the rhizosphere of assorted plants, produce volatile compounds that augment shoot and root growth of Arabidopsis thaliana and tobacco. Growth responses of A. thaliana hormone signaling mutants and expression patterns of a GUS reporter gene under the auxin-responsive DR5 promoter supported the involvement of auxin signaling in F. oxysporum volatile-mediated growth enhancement. In addition, 1-naphthylthalamic acid, an inhibitor of auxin efflux, negated F. oxysporum volatile-mediated growth enhancement in both plants. Comparison of the profiles of volatile compounds produced by F. oxysporum strains that differentially affected plant growth suggests that the relative compositions of both growth inhibitory and stimulatory compounds may determine the degree of plant growth enhancement. Volatile-mediated signaling between fungi and plants may represent a potentially conserved, yet mostly overlooked, mechanism underpinning plant-fungus interactions and fungal niche adaption.

  11. Bone morphogenetic protein Smads signaling in mesenchymal stem cells affected by osteoinductive calcium phosphate ceramics.


    Tang, Zhurong; Wang, Zhe; Qing, Fangzhu; Ni, Yilu; Fan, Yujiang; Tan, Yanfei; Zhang, Xingdong


    Porous calcium phosphate ceramics (CaP ceramics) could induce ectopic bone formation which was regulated by various signal molecules. In this work, bone marrow mesenchymal stem cells (MSCs) were cultured on the surface of osteoinductive hydroxyapatite (HA) and biphasic calcium phosphate (BCP) ceramics in comparison with control (culture plate) for up to 14 days to detect the signal molecules which might be affected by the CaP ceramics. Without adding osteogenic factors, MSCs cultured on HA and BCP both expressed higher Runx2, Osterix, collagen type I, osteopontin, bone sialoprotein, and osteocalcin at various stages compared with control, thus confirmed the osteoblastic differentiation of MSCs. Later study demonstrated the messenger RNA level of bone morphogenetic protein 2 (BMP2) and BMP4 were also significantly enhanced by HA and BCP. Furthermore, Smad1, 4, 5, and Dlx5, the main molecules in the BMP/Smads signaling pathway, were upregulated by HA and BCP. Moreover, the higher expression of Smads and BMP2, 4 in BCP over HA, corresponded to the better performance of BCP in stimulating in vitro osteoblastic differentiation of MSCs. This was in accordance with the better osteoinductivity of BCP over HA in vivo. Altogether, these results implied that the CaP ceramics may initiate the osteoblastic differentiation of MSCs by influencing the expression of molecules in BMP/Smads pathway.

  12. Mutations in TSPEAR, Encoding a Regulator of Notch Signaling, Affect Tooth and Hair Follicle Morphogenesis

    PubMed Central

    Samuelov, Liat; Bertolini, Marta; Weissglas-Volkov, Daphna; Eskin-Schwartz, Marina; Malchin, Natalia; Bochner, Ron; Fainberg, Gilad; Goldberg, Ilan; Sugawara, Koji; Tsuruta, Daisuke; Morasso, Maria; Shalev, Stavit; Gallo, Richard L.; Shomron, Noam; Paus, Ralf; Sprecher, Eli


    Despite recent advances in our understanding of the pathogenesis of ectodermal dysplasias (EDs), the molecular basis of many of these disorders remains unknown. In the present study, we aimed at elucidating the genetic basis of a new form of ED featuring facial dysmorphism, scalp hypotrichosis and hypodontia. Using whole exome sequencing, we identified 2 frameshift and 2 missense mutations in TSPEAR segregating with the disease phenotype in 3 families. TSPEAR encodes the thrombospondin-type laminin G domain and EAR repeats (TSPEAR) protein, whose function is poorly understood. TSPEAR knock-down resulted in altered expression of genes known to be regulated by NOTCH and to be involved in murine hair and tooth development. Pathway analysis confirmed that down-regulation of TSPEAR in keratinocytes is likely to affect Notch signaling. Accordingly, using a luciferase-based reporter assay, we showed that TSPEAR knock-down is associated with decreased Notch signaling. In addition, NOTCH1 protein expression was reduced in patient scalp skin. Moreover, TSPEAR silencing in mouse hair follicle organ cultures was found to induce apoptosis in follicular epithelial cells, resulting in decreased hair bulb diameter. Collectively, these observations indicate that TSPEAR plays a critical, previously unrecognized role in human tooth and hair follicle morphogenesis through regulation of the Notch signaling pathway. PMID:27736875

  13. Fusarium Oxysporum Volatiles Enhance Plant Growth Via Affecting Auxin Transport and Signaling

    PubMed Central

    Bitas, Vasileios; McCartney, Nathaniel; Li, Ningxiao; Demers, Jill; Kim, Jung-Eun; Kim, Hye-Seon; Brown, Kathleen M.; Kang, Seogchan


    Volatile organic compounds (VOCs) have well-documented roles in plant-plant communication and directing animal behavior. In this study, we examine the less understood roles of VOCs in plant-fungal relationships. Phylogenetically and ecologically diverse strains of Fusarium oxysporum, a fungal species complex that often resides in the rhizosphere of assorted plants, produce volatile compounds that augment shoot and root growth of Arabidopsis thaliana and tobacco. Growth responses of A. thaliana hormone signaling mutants and expression patterns of a GUS reporter gene under the auxin-responsive DR5 promoter supported the involvement of auxin signaling in F. oxysporum volatile-mediated growth enhancement. In addition, 1-naphthylthalamic acid, an inhibitor of auxin efflux, negated F. oxysporum volatile-mediated growth enhancement in both plants. Comparison of the profiles of volatile compounds produced by F. oxysporum strains that differentially affected plant growth suggests that the relative compositions of both growth inhibitory and stimulatory compounds may determine the degree of plant growth enhancement. Volatile-mediated signaling between fungi and plants may represent a potentially conserved, yet mostly overlooked, mechanism underpinning plant-fungus interactions and fungal niche adaption. PMID:26617587

  14. Do circadian genes and ambient temperature affect substrate-borne signalling during Drosophila courtship?

    PubMed Central

    Medina, Izarne; Casal, José; Fabre, Caroline C. G.


    ABSTRACT Courtship vibratory signals can be air-borne or substrate-borne. They convey distinct and species-specific information from one individual to its prospective partner. Here, we study the substrate-borne vibratory signals generated by the abdominal quivers of the Drosophila male during courtship; these vibrations travel through the ground towards courted females and coincide with female immobility. It is not known which physical parameters of the vibrations encode the information that is received by the females and induces them to pause. We examined the intervals between each vibratory pulse, a feature that was reported to carry information for animal communication. We were unable to find evidence of periodic variations in the lengths of these intervals, as has been reported for fly acoustical signals. Because it was suggested that the genes involved in the circadian clock may also regulate shorter rhythms, we search for effects of period on the interval lengths. Males that are mutant for the period gene produced vibrations with significantly altered interpulse intervals; also, treating wild type males with constant light results in similar alterations to the interpulse intervals. Our results suggest that both the clock and light/dark cycles have input into the interpulse intervals of these vibrations. We wondered if we could alter the interpulse intervals by other means, and found that ambient temperature also had a strong effect. However, behavioural analysis suggests that only extreme ambient temperatures can affect the strong correlation between female immobility and substrate-borne vibrations. PMID:26519517

  15. Impact of adrenaline and metabolic stress on exercise-induced intracellular signaling and PGC-1α mRNA response in human skeletal muscle.


    Brandt, Nina; Gunnarsson, Thomas P; Hostrup, Morten; Tybirk, Jonas; Nybo, Lars; Pilegaard, Henriette; Bangsbo, Jens


    This study tested the hypothesis that elevated plasma adrenaline or metabolic stress enhances exercise-induced PGC-1α mRNA and intracellular signaling in human muscle. Trained (VO2-max: 53.8 ± 1.8 mL min(-1) kg(-1)) male subjects completed four different exercise protocols (work load of the legs was matched): C - cycling at 171 ± 6 W for 60 min (control); A - cycling at 171 ± 6 W for 60 min, with addition of intermittent arm exercise (98 ± 4 W). DS - cycling at 171 ± 6 W interspersed by 30 sec sprints (513 ± 19 W) every 10 min (distributed sprints); and CS - cycling at 171 ± 6 W for 40 min followed by 20 min of six 30 sec sprints (clustered sprints). Sprints were followed by 3:24 min:sec at 111 ± 4 W. A biopsy was obtained from m. vastus lateralis at rest and immediately, and 2 and 5 h after exercise. Muscle PGC-1α mRNA content was elevated (P < 0.05) three- to sixfold 2 h after exercise relative to rest in C, A, and DS, with no differences between protocols. AMPK and p38 phosphorylation was higher (P < 0.05) immediately after exercise than at rest in all protocols, and 1.3- to 2-fold higher (P < 0.05) in CS than in the other protocols. CREB phosphorylation was higher (P < 0.05) 2 and 5 h after exercise than at rest in all protocols, and higher (P < 0.05) in DS than CS 2 h after exercise. This suggests that neither plasma adrenaline nor muscle metabolic stress determines the magnitude of PGC-1α mRNA response in human muscle. Furthermore, higher exercise-induced changes in AMPK, p38, and CREB phosphorylation are not associated with differences in the PGC-1α mRNA response.

  16. Targeting the cis-dimerization of LINGO-1 with low MW compounds affects its downstream signalling

    PubMed Central

    Cobret, L; De Tauzia, M L; Ferent, J; Traiffort, E; Hénaoui, I; Godin, F; Kellenberger, E; Rognan, D; Pantel, J; Bénédetti, H; Morisset-Lopez, S


    Background and Purpose The transmembrane protein LINGO-1 is a negative regulator in the nervous system mainly affecting axonal regeneration, neuronal survival, oligodendrocyte differentiation and myelination. However, the molecular mechanisms regulating its functions are poorly understood. In the present study, we investigated the formation and the role of LINGO-1 cis-dimers in the regulation of its biological activity. Experimental Approach LINGO-1 homodimers were identified in both HEK293 and SH-SY5Y cells using co-immunoprecipitation experiments and BRET saturation analysis. We performed a hypothesis-driven screen for identification of small-molecule protein–protein interaction modulators of LINGO-1 using a BRET-based assay, adapted for screening. The compound identified was further assessed for effects on LINGO-1 downstream signalling pathways using Western blotting analysis and AlphaScreen technology. Key Results LINGO-1 was present as homodimers in primary neuronal cultures. LINGO-1 interacted homotypically in cis-orientation and LINGO-1 cis-dimers were formed early during LINGO-1 biosynthesis. A BRET-based assay allowed us to identify phenoxybenzamine as the first conformational modulator of LINGO-1 dimers. In HEK-293 cells, phenoxybenzamine was a positive modulator of LINGO-1 function, increasing the LINGO-1-mediated inhibition of EGF receptor signalling and Erk phosphorylation. Conclusions and Implications Our data suggest that LINGO-1 forms constitutive cis-dimers at the plasma membrane and that low MW compounds affecting the conformational state of these dimers can regulate LINGO-1 downstream signalling pathways. We propose that targeting the LINGO-1 dimerization interface opens a new pharmacological approach to the modulation of its function and provides a new strategy for drug discovery. PMID:25257685

  17. Beta2-adrenergic signaling affects the phenotype of human cardiac progenitor cells through EMT modulation.


    Pagano, Francesca; Angelini, Francesco; Siciliano, Camilla; Tasciotti, Julia; Mangino, Giorgio; De Falco, Elena; Carnevale, Roberto; Sciarretta, Sebastiano; Frati, Giacomo; Chimenti, Isotta


    Human cardiac progenitor cells (CPCs) offer great promises to cardiac cell therapy for heart failure. Many in vivo studies have shown their therapeutic benefits, paving the way for clinical translation. The 3D model of cardiospheres (CSs) represents a unique niche-like in vitro microenvironment, which includes CPCs and supporting cells. CSs have been shown to form through a process mediated by epithelial-to-mesenchymal transition (EMT). β2-Adrenergic signaling significantly affects stem/progenitor cells activation and mobilization in multiple tissues, and crosstalk between β2-adrenergic signaling and EMT processes has been reported. In the present study, we aimed at investigating the biological response of CSs to β2-adrenergic stimuli, focusing on EMT modulation in the 3D culture system of CSs. We treated human CSs and CS-derived cells (CDCs) with the β2-blocker butoxamine (BUT), using either untreated or β2 agonist (clenbuterol) treated CDCs as control. BUT-treated CS-forming cells displayed increased migration capacity and a significant increase in their CS-forming ability, consistently associated with increased expression of EMT-related genes, such as Snai1. Moreover, long-term BUT-treated CDCs contained a lower percentage of CD90+ cells, and this feature has been previously correlated with higher cardiogenic and therapeutic potential of the CDCs population. In addition, long-term BUT-treated CDCs had an increased ratio of collagen-III/collagen-I gene expression levels, and showed decreased release of inflammatory cytokines, overall supporting a less fibrosis-prone phenotype. In conclusion, β2 adrenergic receptor block positively affected the stemness vs commitment balance within CSs through the modulation of type1-EMT (so called "developmental"). These results further highlight type-1 EMT to be a key process affecting the features of resident cardiac progenitor cells, and mediating their response to the microenvironment.

  18. Novel Evidence That Attributing Affectively Salient Signal to Random Noise Is Associated with Psychosis

    PubMed Central

    Catalan, Ana; Simons, Claudia J. P.; Bustamante, Sonia; Drukker, Marjan; Madrazo, Aranzazu; de Artaza, Maider Gonzalez; Gorostiza, Iñigo; van Os, Jim; Gonzalez-Torres, Miguel A.


    We wished to replicate evidence that an experimental paradigm of speech illusions is associated with psychotic experiences. Fifty-four patients with a first episode of psychosis (FEP) and 150 healthy subjects were examined in an experimental paradigm assessing the presence of speech illusion in neutral white noise. Socio-demographic, cognitive function and family history data were collected. The Positive and Negative Syndrome Scale (PANSS) was administered in the patient group and the Structured Interview for Schizotypy-Revised (SIS-R), and the Community Assessment of Psychic Experiences (CAPE) in the control group. Patients had a much higher rate of speech illusions (33.3% versus 8.7%, ORadjusted: 5.1, 95% CI: 2.3–11.5), which was only partly explained by differences in IQ (ORadjusted: 3.4, 95% CI: 1.4–8.3). Differences were particularly marked for signals in random noise that were perceived as affectively salient (ORadjusted: 9.7, 95% CI: 1.8–53.9). Speech illusion tended to be associated with positive symptoms in patients (ORadjusted: 3.3, 95% CI: 0.9–11.6), particularly affectively salient illusions (ORadjusted: 8.3, 95% CI: 0.7–100.3). In controls, speech illusions were not associated with positive schizotypy (ORadjusted: 1.1, 95% CI: 0.3–3.4) or self-reported psychotic experiences (ORadjusted: 1.4, 95% CI: 0.4–4.6). Experimental paradigms indexing the tendency to detect affectively salient signals in noise may be used to identify liability to psychosis. PMID:25020079

  19. The vasopressin-induced excitation of hypoglossal and facial motoneurons in young rats is mediated by V1a but not V1b receptors, and is independent of intracellular calcium signalling.


    Reymond-Marron, I; Tribollet, E; Raggenbass, M


    As a hormone, vasopressin binds to three distinct receptors: V1a and V1b receptors, which induce phospholipase-Cbeta (PLCbeta) activation and Ca2+ mobilization; and V2 receptors, which are coupled to adenylyl cyclase. V1a and V1b receptors are also present in neurons. In particular, hypoglossal (XII) and facial (VII) motoneurons are excited following vasopressin-V1a receptor binding. The aim of the present study was double: (i) to determine whether V1b receptors contribute to the excitatory effect of vasopressin in XII and VII motoneurons; and (ii) to establish whether the action of vasopressin on motoneurons is mediated by Ca2+ signalling. Patch-clamp recordings were performed in brainstem slices of young rats. Vasopressin depolarized the membrane or generated an inward current. By contrast, [1-deamino-4-cyclohexylalanine] arginine vasopressin (d[Cha4]AVP), a V1b agonist, had no effect. The action of vasopressin was suppressed by Phaa-D-Tyr(Et)-Phe-Gln-Asn-Lys-Pro-Arg-NH2, a V1a antagonist, but not by SSR149415, a V1b antagonist. Thus, the vasopressin-induced excitation of brainstem motoneurons was exclusively mediated by V1a receptors. Light microscopic autoradiography failed to detect V1b binding sites in the facial nucleus. In motoneurons loaded with GTP-gamma-S, a non-hydrolysable analogue of GTP, the effect of vasopressin was suppressed, indicating that neuronal V1a receptors are G-protein-coupled. Intracellular Ca2+ chelation suppressed a Ca2+-activated potassium current, but did not affect the vasopressin-evoked current. H7 and GF109203, inhibitors of protein kinase C, were without effect on the vasopressin-induced excitation. U73122 and D609, PLCbeta inhibitors, were also without effect. Thus, excitation of brainstem motoneurons by V1a receptor activation is probably mediated by a second messenger distinct from that associated with peripheral V1a receptors.

  20. Loligomers: design of de novo peptide-based intracellular vehicles.

    PubMed Central

    Sheldon, K; Liu, D; Ferguson, J; Gariépy, J


    Defined branched peptides (loligomers) incorporating cytoplasmic translocation signals, nuclear localization sequences, and fluorescent probes were designed and synthesized to demonstrate the feasibility and simplicity of creating novel classes of intracellular vehicles. Loligomers containing all the above signals were rapidly internalized by Chinese hamster ovary (CHO) cells and accumulated in their nucleus. At 4 degrees C, the interaction of peptide constructs with CHO cells was limited to membrane association. Loligomers entered cells at higher temperatures by adsorptive endocytosis. Inhibitors of ATP synthesis affected cytoplasmic import only weakly but abolished nuclear uptake. The peptide signals guided both cytoplasmic and nuclear localization events. The properties exhibited by loligomers suggest a strategy for the facile design of "guided" classes of intracellular agents. Images Fig. 3 PMID:7892224

  1. Reciprocal projections in hierarchically organized evolvable neural circuits affect EEG-like signals.


    Shaposhnyk, Vladyslav; Villa, Alessandro E P


    Modular architecture is a hallmark of many brain circuits. In the cerebral cortex, in particular, it has been observed that reciprocal connections are often present between functionally interconnected areas that are hierarchically organized. We investigate the effect of reciprocal connections in a network of modules of simulated spiking neurons. The neural activity is recorded by means of virtual electrodes and EEG-like signals, called electrochipograms (EChG), analyzed by time- and frequency-domain methods. A major feature of our approach is the implementation of important bio-inspired processes that affect the connectivity within a neural module: synaptogenesis, cell death, spike-timing-dependent plasticity and synaptic pruning. These bio-inspired processes drive the build-up of auto-associative links within each module, which generate an areal activity, recorded by EChG, that reflect the changes in the corresponding functional connectivity within and between neuronal modules. We found that circuits with intra-layer reciprocal projections exhibited enhanced stimulus-locked response. We show evidence that all networks of modules are able to process and maintain patterns of activity associated with the stimulus after its offset. The presence of feedback and horizontal projections was necessary to evoke cross-layer coherence in bursts of -frequency at regular intervals. These findings bring new insights to the understanding of the relation between the functional organization of neural circuits and the electrophysiological signals generated by large cell assemblies. This article is part of a Special Issue entitled "Neural Coding".

  2. Huntington disease iPSCs show early molecular changes in intracellular signaling, the expression of oxidative stress proteins and the p53 pathway.


    Szlachcic, Wojciech J; Switonski, Pawel M; Krzyzosiak, Wlodzimierz J; Figlerowicz, Marek; Figiel, Maciej


    Huntington disease (HD) is a brain disorder characterized by the late onset of motor and cognitive symptoms, even though the neurons in the brain begin to suffer dysfunction and degeneration long before symptoms appear. There is currently no cure. Several molecular and developmental effects of HD have been identified using neural stem cells (NSCs) and differentiated cells, such as neurons and astrocytes. Still, little is known regarding the molecular pathogenesis of HD in pluripotent cells, such as embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs). Therefore, we examined putative signaling pathways and processes involved in HD pathogenesis in pluripotent cells. We tested naïve mouse HD YAC128 iPSCs and two types of human HD iPSC that were generated from HD and juvenile-HD patients. Surprisingly, we found that a number of changes affecting cellular processes in HD were also present in undifferentiated pluripotent HD iPSCs, including the dysregulation of the MAPK and Wnt signaling pathways and the dysregulation of the expression of genes related to oxidative stress, such as Sod1. Interestingly, a common protein interactor of the huntingtin protein and the proteins in the above pathways is p53, and the expression of p53 was dysregulated in HD YAC128 iPSCs and human HD iPSCs. In summary, our findings demonstrate that multiple molecular pathways that are characteristically dysregulated in HD are already altered in undifferentiated pluripotent cells and that the pathogenesis of HD might begin during the early stages of life.

  3. Huntington disease iPSCs show early molecular changes in intracellular signaling, the expression of oxidative stress proteins and the p53 pathway

    PubMed Central

    Szlachcic, Wojciech J.; Switonski, Pawel M.; Krzyzosiak, Wlodzimierz J.; Figlerowicz, Marek; Figiel, Maciej


    ABSTRACT Huntington disease (HD) is a brain disorder characterized by the late onset of motor and cognitive symptoms, even though the neurons in the brain begin to suffer dysfunction and degeneration long before symptoms appear. There is currently no cure. Several molecular and developmental effects of HD have been identified using neural stem cells (NSCs) and differentiated cells, such as neurons and astrocytes. Still, little is known regarding the molecular pathogenesis of HD in pluripotent cells, such as embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs). Therefore, we examined putative signaling pathways and processes involved in HD pathogenesis in pluripotent cells. We tested naïve mouse HD YAC128 iPSCs and two types of human HD iPSC that were generated from HD and juvenile-HD patients. Surprisingly, we found that a number of changes affecting cellular processes in HD were also present in undifferentiated pluripotent HD iPSCs, including the dysregulation of the MAPK and Wnt signaling pathways and the dysregulation of the expression of genes related to oxidative stress, such as Sod1. Interestingly, a common protein interactor of the huntingtin protein and the proteins in the above pathways is p53, and the expression of p53 was dysregulated in HD YAC128 iPSCs and human HD iPSCs. In summary, our findings demonstrate that multiple molecular pathways that are characteristically dysregulated in HD are already altered in undifferentiated pluripotent cells and that the pathogenesis of HD might begin during the early stages of life. PMID:26092128

  4. Production of cercosporin toxin by the phytopathogenic Cercospora fungi is affected by diverse environmental signals.


    You, Bang-Jau; Lee, Miin-Hui; Chung, Kuang-Ren


    Cercosporin is a polyketide phytotoxin produced by many phytopathogenic Cercospora spp. We investigated environmental signals that have elaborate control of cercosporin production. Light is the most critical factor for cercosporin production. Cercospora nicotianae accumulated substantial quantities of cercosporin only when grown on a particular potato dextrose agar under light but produced little cercosporin on other brands of potato dextrose agar or media with defined ingredients. In addition to light regulation, numerous factors including salts, buffers, and ions markedly affected cercosporin production. By contrast, pH had little effect on cercosporin production. Depletion or alteration of the carbon or nitrogen sources also affected cercosporin production. Production of cercosporin was elevated to varying levels by metal ions, such as cobalt, ferric, manganese, and zinc. Significant differences in cercosporin production were observed among various Cercospora species. Further, regulation of cercosporin production by phosphate buffer, ammonium, LiCl, but not metal ions appeared to occur at transcriptional levels. Expression of the genes involved in cercosporin biosynthesis and regulation decreased markedly and was closely concomitant with the amounts of cercosporin reduced as the fungus was grown on medium containing phosphate, LiCl, ammonium, or dimethyl sulfoxide. The results reveal the complexity of cercosporin production at the physiological and genetic levels. A model delineating regulatory controls of cercosporin biosynthesis is proposed and discussed.

  5. Epigenetic Alterations Affecting Transcription Factors and Signaling Pathways in Stromal Cells of Endometriosis

    PubMed Central

    Yotova, Iveta; Hsu, Emily; Do, Catherine; Gaba, Aulona; Sczabolcs, Matthias; Dekan, Sabine; Kenner, Lukas; Wenzl, Rene; Tycko, Benjamin


    Endometriosis is characterized by growth of endometrial-like tissue outside the uterine cavity. Since its pathogenesis may involve epigenetic changes, we used Illumina 450K Methylation Beadchips to profile CpG methylation in endometriosis stromal cells compared to stromal cells from normal endometrium. We validated and extended the Beadchip data using bisulfite sequencing (bis-seq), and analyzed differential methylation (DM) at the CpG-level and by an element-level classification for groups of CpGs in chromatin domains. Genes found to have DM included examples encoding transporters (SLC22A23), signaling components (BDNF, DAPK1, ROR1, and WNT5A) and transcription factors (GATA family, HAND2, HOXA cluster, NR5A1, OSR2, TBX3). Intriguingly, among the TF genes with DM we also found JAZF1, a proto-oncogene affected by chromosomal translocations in endometrial stromal tumors. Using RNA-Seq we identified a subset of the DM genes showing differential expression (DE), with the likelihood of DE increasing with the extent of the DM and its location in enhancer elements. Supporting functional relevance, treatment of stromal cells with the hypomethylating drug 5aza-dC led to activation of DAPK1 and SLC22A23 and repression of HAND2, JAZF1, OSR2, and ROR1 mRNA expression. We found that global 5hmC is decreased in endometriotic versus normal epithelial but not stroma cells, and for JAZF1 and BDNF examined by oxidative bis-seq, found that when 5hmC is detected, patterns of 5hmC paralleled those of 5mC. Together with prior studies, these results define a consistent epigenetic signature in endometriosis stromal cells and nominate specific transcriptional and signaling pathways as therapeutic targets. PMID:28125717

  6. Number and brightness analysis of sFRP4 domains in live cells demonstrates vesicle association signal of the NLD domain and dynamic intracellular responses to Wnt3a

    PubMed Central

    Perumal, Vanathi; Krishnan, Kannan; Gratton, Enrico; Dharmarajan, Arun M; Fox, Simon A


    The Wnts are secreted, lipidated glycoproteins that play a role in cellular processes of differentiation, proliferation, migration, survival, polarity and stem cell self-renewal. The majority of Wnts biological effects are through binding to specific frizzled (Fzd) receptor complexes leading to activation of downstream pathways. Secreted Frizzled-related proteins (sFRPs) were first identified as antagonists of Wnt signalling by binding directly to Wnts. They comprise two domains, a Fzd-like cysteine rich domain (CRD) and a netrin-like domain (NLD). Subsequently sFRPs have been shown to also interact with Fzd receptors and more diverse functions have been identified, including potentiation of Wnt signalling. Many aspects of the biology of this family remain to be elucidated. We used the number and brightness (N&B) method, a technique based on fluorescence fluctuation analysis, to characterise the intracellular aggregation and trafficking of sFRP4 domains. We expressed sFRP4 and its’ domains as EGFP fusions and then characterised the effect of endogenous Wnt3a by fluorescence confocal imaging. We observed vesicular trafficking of sFRP4 and that the NLD domain has a vesicular association signal. We found that sFRP4 and the CRD formed oligomeric aggregates in the perinuclear region while the NLD was distributed evenly throughout the cell with a larger proportion of aggregates. Most significantly we observed intracellular redistribution of sFRP4 in response to Wnt3a suggesting that Wnt3a can modulate intracellular localisation and secretion of sFRP4. Our results reveal a number of novel findings regarding sFRP4 which are likely to have relevance to this wider family. PMID:25805505

  7. Sonic Hedgehog Signaling Affected by Promoter Hypermethylation Induces Aberrant Gli2 Expression in Spina Bifida.


    Lu, Xiao-Lin; Wang, Li; Chang, Shao-Yan; Shangguan, Shao-Fang; Wang, Zhen; Wu, Li-Hua; Zou, Ji-Zhen; Xiao, Ping; Li, Rui; Bao, Yi-Hua; Qiu, Z-Y; Zhang, Ting


    GLI2 is a key mediator of the sonic hedgehog (Shh) signaling pathway and plays an important role in neural tube development during vertebrate embryogenesis; however, the role of gli2 in human folate-related neural tube defects remains unclear. In this study, we compared methylation status and polymorphisms of gli2 between spina bifida patients and a control group to explore the underlying mechanisms related to folate deficiency in spina bifida. No single nucleotide polymorphism was found to be significantly different between the two groups, although gli2 methylation levels were significantly increased in spina bifida samples, accompanied by aberrant GLI2 expression. Moreover, a prominent negative correlation was found between the folate level in brain tissue and the gli2 methylation status (r = -0.41, P = 0.014), and gli2 hypermethylation increased the risk of spina bifida with an odds ratio of 12.45 (95 % confidence interval: 2.71-57.22, P = 0.001). In addition, we established a cell model to illustrate the effect of gli2 expression and the accessibility of chromatin affected by methylation. High gli2 and gli1 mRNA expression was detected in 5-Aza-treated cells, while gli2 hypermethylation resulted in chromatin inaccessibility and a reduced association with nuclear proteins containing transcriptional factors. More meaningful to the pathway, the effect gene of the Shh pathway, gli1, was found to have a reduced level of expression along with a decreased expression of gli2 in our cell model. Aberrant high methylation resulted in the low expression of gli2 in spina bifida, which was affected by the change in chromatin status and the capacity of transcription factor binding.

  8. Cell and Signal Components of the Microenvironment of Bone Metastasis Are Affected by Hypoxia

    PubMed Central

    Bendinelli, Paola; Maroni, Paola; Matteucci, Emanuela; Desiderio, Maria Alfonsina


    Bone metastatic cells release bone microenvironment proteins, such as the matricellular protein SPARC (secreted protein acidic and rich in cysteine), and share a cell signaling typical of the bone metabolism controlled by Runx2. The megakaryocytes in the bone marrow engrafted by the metastases seem to be one of the principal microenvironment sources of the biological stimuli, implicated in the formation of an osteoblastic niche, and affecting metastasis phenotype and colonization. Educated platelets in the circulation might derive from megakaryocytes in bone metastasis. The evaluation of predictive markers in the circulating platelets might be useful for the stratification of patients for therapeutic purposes. The hypoxic environment in bone metastasis is one of the key regulators of the network of the biological soluble and structural components of the matrix. In bone metastatic cells under hypoxia, similar patterns of Runx2 and SPARC are observed, both showing downregulation. Conversely, hypoxia induces Endothelin 1, which upregulates SPARC, and these biological stimuli may be considered prognostic markers of bone metastasis in breast carcinoma patients. PMID:27187355

  9. High fructose-mediated attenuation of insulin receptor signaling does not affect PDGF-induced proliferative signaling in vascular smooth muscle cells.


    Osman, Islam; Poulose, Ninu; Ganapathy, Vadivel; Segar, Lakshman


    Insulin resistance is associated with accelerated atherosclerosis. Although high fructose is known to induce insulin resistance, it remains unclear as to how fructose regulates insulin receptor signaling and proliferative phenotype in vascular smooth muscle cells (VSMCs), which play a major role in atherosclerosis. Using human aortic VSMCs, we investigated the effects of high fructose treatment on insulin receptor substrate-1 (IRS-1) serine phosphorylation, insulin versus platelet-derived growth factor (PDGF)-induced phosphorylation of Akt, S6 ribosomal protein, and extracellular signal-regulated kinase (ERK), and cell cycle proteins. In comparison with PDGF (a potent mitogen), neither fructose nor insulin enhanced VSMC proliferation and cyclin D1 expression. d-[(14)C(U)]fructose uptake studies revealed a progressive increase in fructose uptake in a time-dependent manner. Concentration-dependent studies with high fructose (5-25mM) showed marked increases in IRS-1 serine phosphorylation, a key adapter protein in insulin receptor signaling. Accordingly, high fructose treatment led to significant diminutions in insulin-induced phosphorylation of downstream signaling components including Akt and S6. In addition, high fructose significantly diminished insulin-induced ERK phosphorylation. Nevertheless, high fructose did not affect PDGF-induced key proliferative signaling events including phosphorylation of Akt, S6, and ERK and expression of cyclin D1 protein. Together, high fructose dysregulates IRS-1 phosphorylation state and proximal insulin receptor signaling in VSMCs, but does not affect PDGF-induced proliferative signaling. These findings suggest that systemic insulin resistance rather than VSMC-specific dysregulation of insulin receptor signaling by high fructose may play a major role in enhancing atherosclerosis and neointimal hyperplasia.

  10. Dithiocarbamate fungicides increase intracellular Zn(2+) levels by increasing influx of Zn(2+) in rat thymic lymphocytes.


    Kanemoto-Kataoka, Yumiko; Oyama, Tomohiro M; Ishibashi, Hitoshi; Oyama, Yasuo


    Dithiocarbamate fungicides are used as alternative antifouling agents to highly toxic organotin antifouling agents, such as tri-n-butyltin and triphenyltin. There are some concerns regarding their environmental and health risks. It has been shown that tri-n-butyltin increases intracellular Zn(2+) levels of mammalian lymphocytes. Therefore, we examined the effects of dithiocarbamate fungicides (Ziram, Thiram, and Zineb) on rat thymic lymphocytes using a flow-cytometric technique to elucidate how these fungicides affect intracellular Zn(2+) levels. We further determined whether the agents increase intracellular Zn(2+) and/or Ca(2+), because both Zn(2+) and Ca(2+) are intracellular signals in lymphocytes, and excessive increases in their intracellular concentrations can have adverse effects. Dithiocarbamate fungicides increased intracellular Zn(2+) levels, without affecting intracellular Ca(2+) levels. Ziram was the most potent compound, increasing intracellular Zn(2+) levels via Zn(2+) influx. Ziram (1μM) greatly decreased the cellular nonprotein thiol content, and Zn(2+) chelators attenuated the Ziram-induced decrease. Ziram increased the population of annexin V-positive cells in a Zn(2+)-dependent manner. Therefore, we propose that dithiocarbamate fungicides induce Zn(2+) influx, resulting in an excessive elevation of intracellular Zn(2+) levels, leading to the induction of apoptosis. This study gives a basic insight into the mechanisms of dithiocarbamate fungicide-induced adverse events.

  11. Protein v. carbohydrate intake differentially affects liking- and wanting-related brain signalling.


    Born, Jurriaan M; Martens, Mieke J I; Lemmens, Sofie G T; Goebel, Rainer; Westerterp-Plantenga, Margriet S


    Extreme macronutrient intakes possibly lead to different brain signalling. The aim of the present study was to determine the effects of ingesting high-protein v. high-carbohydrate food on liking and wanting task-related brain signalling (TRS) and subsequent macronutrient intake. A total of thirty female subjects (21.6 (SD 2.2) years, BMI 25.0 (SD 3.7) kg/m²) completed four functional MRI scans: two fasted and two satiated on two different days. During the scans, subjects rated all food items for liking and wanting, thereby choosing the subsequent meal. The results show that high-protein (PROT) v. high-carbohydrate (CARB) conditions were generated using protein or carbohydrate drinks at the first meal. Energy intake and hunger were recorded. PROT (protein: 53.7 (SD 2.1) percentage of energy (En%); carbohydrate: 6.4 (SD 1.3) En%) and CARB conditions (protein: 11.8 (SD 0.6) En%; carbohydrate: 70.0 (SD 2.4) En%) were achieved during the first meal, while the second meals were not different between the conditions. Hunger, energy intake, and behavioural liking and wanting ratings were decreased after the first meal (P< 0.001). Comparing the first with the second meal, the macronutrient content changed: carbohydrate -26.9 En% in the CARB condition, protein -37.8 En% in the PROT condition. After the first meal in the CARB condition, wanting TRS was increased in the hypothalamus. After the first meal in the PROT condition, liking TRS was decreased in the putamen (P< 0.05). The change in energy intake from the first to the second meal was inversely related to the change in liking TRS in the striatum and hypothalamus in the CARB condition and positively related in the PROT condition (P< 0.05). In conclusion, wanting and liking TRS were affected differentially with a change in carbohydrate or protein intake, underscoring subsequent energy intake and shift in macronutrient composition.

  12. Inflammasome signaling affects anxiety- and depressive-like behavior and gut microbiome composition.


    Wong, M-L; Inserra, A; Lewis, M D; Mastronardi, C A; Leong, L; Choo, J; Kentish, S; Xie, P; Morrison, M; Wesselingh, S L; Rogers, G B; Licinio, J


    The inflammasome is hypothesized to be a key mediator of the response to physiological and psychological stressors, and its dysregulation may be implicated in major depressive disorder. Inflammasome activation causes the maturation of caspase-1 and activation of interleukin (IL)-1β and IL-18, two proinflammatory cytokines involved in neuroimmunomodulation, neuroinflammation and neurodegeneration. In this study, C57BL/6 mice with genetic deficiency or pharmacological inhibition of caspase-1 were screened for anxiety- and depressive-like behaviors, and locomotion at baseline and after chronic stress. We found that genetic deficiency of caspase-1 decreased depressive- and anxiety-like behaviors, and conversely increased locomotor activity and skills. Caspase-1 deficiency also prevented the exacerbation of depressive-like behaviors following chronic stress. Furthermore, pharmacological caspase-1 antagonism with minocycline ameliorated stress-induced depressive-like behavior in wild-type mice. Interestingly, chronic stress or pharmacological inhibition of caspase-1 per se altered the fecal microbiome in a very similar manner. When stressed mice were treated with minocycline, the observed gut microbiota changes included increase in relative abundance of Akkermansia spp. and Blautia spp., which are compatible with beneficial effects of attenuated inflammation and rebalance of gut microbiota, respectively, and the increment in Lachnospiracea abundance was consistent with microbiota changes of caspase-1 deficiency. Our results suggest that the protective effect of caspase-1 inhibition involves the modulation of the relationship between stress and gut microbiota composition, and establishes the basis for a gut microbiota-inflammasome-brain axis, whereby the gut microbiota via inflammasome signaling modulate pathways that will alter brain function, and affect depressive- and anxiety-like behaviors. Our data also suggest that further elucidation of the gut microbiota

  13. Inflammasome signaling affects anxiety- and depressive-like behavior and gut microbiome composition

    PubMed Central

    Wong, M-L; Inserra, A; Lewis, M D; Mastronardi, C A; Leong, L; Choo, J; Kentish, S; Xie, P; Morrison, M; Wesselingh, S L; Rogers, G B; Licinio, J


    The inflammasome is hypothesized to be a key mediator of the response to physiological and psychological stressors, and its dysregulation may be implicated in major depressive disorder. Inflammasome activation causes the maturation of caspase-1 and activation of interleukin (IL)-1β and IL-18, two proinflammatory cytokines involved in neuroimmunomodulation, neuroinflammation and neurodegeneration. In this study, C57BL/6 mice with genetic deficiency or pharmacological inhibition of caspase-1 were screened for anxiety- and depressive-like behaviors, and locomotion at baseline and after chronic stress. We found that genetic deficiency of caspase-1 decreased depressive- and anxiety-like behaviors, and conversely increased locomotor activity and skills. Caspase-1 deficiency also prevented the exacerbation of depressive-like behaviors following chronic stress. Furthermore, pharmacological caspase-1 antagonism with minocycline ameliorated stress-induced depressive-like behavior in wild-type mice. Interestingly, chronic stress or pharmacological inhibition of caspase-1 per se altered the fecal microbiome in a very similar manner. When stressed mice were treated with minocycline, the observed gut microbiota changes included increase in relative abundance of Akkermansia spp. and Blautia spp., which are compatible with beneficial effects of attenuated inflammation and rebalance of gut microbiota, respectively, and the increment in Lachnospiracea abundance was consistent with microbiota changes of caspase-1 deficiency. Our results suggest that the protective effect of caspase-1 inhibition involves the modulation of the relationship between stress and gut microbiota composition, and establishes the basis for a gut microbiota–inflammasome–brain axis, whereby the gut microbiota via inflammasome signaling modulate pathways that will alter brain function, and affect depressive- and anxiety-like behaviors. Our data also suggest that further elucidation of the gut microbiota

  14. A replacement of the active-site aspartic acid residue 293 in mouse cathepsin D affects its intracellular stability, processing and transport in HEK-293 cells.

    PubMed Central

    Partanen, Sanna; Storch, Stephan; Löffler, Hans-Gerhard; Hasilik, Andrej; Tyynelä, Jaana; Braulke, Thomas


    The substitution of an active-site aspartic acid residue by asparagine in the lysosomal protease cathepsin D (CTSD) results in a loss of enzyme activity and severe cerebrocortical atrophy in a novel form of neuronal ceroid lipofuscinosis in sheep [Tyynelä, Sohar, Sleat, Gin, Donnelly, Baumann, Haltia and Lobel (2000) EMBO J. 19, 2786-2792]. In the present study we have introduced the corresponding mutation by replacing aspartic acid residue 293 with asparagine (D293N) into the mouse CTSD cDNA to analyse its effect on synthesis, transport and stability in transfected HEK-293 cells. The complete inactivation of mutant D293N mouse CTSD was confirmed by a newly developed fluorimetric quantification system. Moreover, in the heterologous overexpression systems used, mutant D293N mouse CTSD was apparently unstable and proteolytically modified during early steps of the secretory pathway, resulting in a loss of mass by about 1 kDa. In the affected sheep, the endogenous mutant enzyme was stable but also showed the shift in its molecular mass. In HEK-293 cells, the transport of the mutant D293N mouse CTSD to the lysosome was delayed and associated with a low secretion rate compared with wild-type CTSD. These data suggest that the mutation may result in a conformational change which affects stability, processing and transport of the enzyme. PMID:12350228

  15. Human I-mfa domain proteins specifically interact with KSHV LANA and affect its regulation of Wnt signaling-dependent transcription

    SciTech Connect

    Kusano, Shuichi; Eizuru, Yoshito


    Kaposi's sarcoma-associated herpes virus (KSHV)-encoded latency-associated nuclear antigen (LANA) protein has been reported to interact with glycogen synthase kinase 3{beta} (GSK-3{beta}) and to negatively regulate its activity, leading to stimulation of GSK-3{beta}-dependent {beta}-catenin degradation. We show here that the I-mfa domain proteins, HIC (human I-mfa domain-containing protein) and I-mfa (inhibitor of MyoD family a), interacted in vivo with LANA through their C-terminal I-mfa domains. This interaction affected the intracellular localization of HIC, inhibited the LANA-dependent transactivation of a {beta}-catenin-regulated reporter construct, and decreased the level of the LANA.GSK-3{beta} complex. These data reveal for the first time that I-mfa domain proteins interact with LANA and negatively regulate LANA-mediated activation of Wnt signaling-dependent transcription by inhibiting the formation of the LANA.GSK-3{beta} complex.

  16. The Conserved Arginine Cluster in the Insert of the Third Cytoplasmic Loop of the Long Form of the D₂ Dopamine Receptor (D2L-R) Acts as an Intracellular Retention Signal.


    Kubale, Valentina; Blagotinšek, Kaja; Nøhr, Jane; Eidne, Karin A; Vrecl, Milka


    This study examined whether the conserved arginine cluster present within the 29-amino acid insert of the long form of the D₂ dopamine receptor (D2L-R) confers its predominant intracellular localization. We hypothesized that the conserved arginine cluster (RRR) located within the insert could act as an RXR-type endoplasmic reticulum (ER) retention signal. Arginine residues (R) within the cluster at positions 267, 268, and 269 were charge-reserved to glutamic acids (E), either individually or in clusters, thus generating single, double, and triple D2L-R mutants. Through analyses of cellular localization by confocal microscopy and enzyme-linked immunosorbent assay (ELISA), radioligand binding assay, bioluminescence resonance energy transfer (BRET²) β-arrestin 2 (βarr2) recruitment assay, and cAMP signaling, it was revealed that charge reversal of the R residues at all three positions within the motif impaired their colocalization with ER marker calnexin and led to significantly improved cell surface expression. Additionally, these data demonstrate that an R to glutamic acid (E) substitution at position 2 within the RXR motif is not functionally permissible. Furthermore, all generated D2L-R mutants preserved their functional integrity regarding ligand binding, agonist-induced βarr2 recruitment and Gαi-mediated signaling. In summary, our results show that the conserved arginine cluster within the 29-amino acid insert of third cytoplasmic loop (IC3) of the D2L-R appears to be the ER retention signal.

  17. Glycosaminoglycans: Sorting determinants in intracellular protein traffic.


    Mihov, Deyan; Spiess, Martin


    Intracellular transport of proteins to their appropriate destinations is crucial for the maintenance of cellular integrity and function. Sorting information is contained either directly in the amino acid sequence or in a protein's post-translational modifications. Glycosaminoglycans (GAGs) are characteristic modifications of proteoglycans. GAGs are long unbranched polysaccharide chains with unique structural and functional properties also contributing to protein sorting in various ways. By deletion or insertion of GAG attachment sites it has been shown that GAGs affect polarized sorting in epithelial cells, targeting to and storage in secretory granules, and endocytosis. Most recently, the role of GAGs as signals for rapid trans-Golgi-to-cell surface transport, dominant over the cytosolic sorting motifs in the core protein, was demonstrated. Here, we provide an overview on existing data on the roles of GAGs on protein and proteoglycan trafficking.

  18. Sesamol decreases melanin biosynthesis in melanocyte cells and zebrafish: Possible involvement of MITF via the intracellular cAMP and p38/JNK signalling pathways.


    Baek, Seung-hwa; Lee, Sang-Han


    The development of antimelanogenic agents is important for the prevention of serious aesthetic problems such as melasma, freckles, age spots and chloasma. The aim of this study was to investigate the antimelanogenic effect of sesamol, an active lignan isolated from Sesamum indicum, in melan-a cells. Sesamol strongly inhibited melanin biosynthesis and the activity of intracellular tyrosinase by decreasing cyclic adenosine monophosphate (cAMP) accumulation. Sesamol significantly decreased the expression of melanogenesis-related genes, such as tyrosinase, tyrosinase-related protein-1,2 (TRP-1,2), microphthalmia-associated transcription factor (MITF) and melanocortin 1 receptor (MC1R). In addition, sesamol also induces phosphorylation of p38 mitogen-activated protein kinase (p38 MAPK) and c-Jun N-terminal kinase (JNK). Moreover, sesamol dose-dependently decreased zebrafish pigment formation, tyrosinase activity and expression of melanogenesis-related genes. These findings indicate that sesamol inhibited melanin biosynthesis by down-regulating tyrosinase activity and melanin production via regulation of gene expression of melanogenesis-related proteins through modulation of MITF activity, which promoted phosphorylation of p38 and JNK in melan-a cells. Together, these results suggest that sesamol strongly inhibits melanin biosynthesis, and therefore, sesamol represents a new skin-whitening agent for use in cosmetics.

  19. Role of I-TAC-binding receptors CXCR3 and CXCR7 in proliferation, activation of intracellular signaling pathways and migration of various tumor cell lines.


    Miekus, Katarzyna; Jarocha, Danuta; Trzyna, Elzbieta; Majka, Marcin


    Chemokines and its receptors stimulate tumor growth, migration and invasion. In this study we evaluated the expression and function of CXCR3 and CXCR7 receptors in cervical carcinoma, rhabdomyosarcoma and glioblastoma cell lines. We found that both receptors were expressed at different degree by tumor cells. CXCR7 was expressed at both mRNA and protein level by all tumor cell lines. The expression of CXCR7 differed between rhabdomyosarcoma subtypes. The receptor was highly expressed in alveolar rhabdomyosarcoma and the expression was low in embryonal rhabdomyosarcoma. The expression of CXCR3 was low in majority of the tumor cell lines. Upon I-TAC stimulation AKT and MAPK kinases were activated. However, the activation of growth promoting pathways did not increased the proliferation rate of tumor cells. Since chemokines stimulate the migration of various cell types the ability of I-TAC to stimulate migration of tumor cells were studied. We did not observe the migration of tumor cells toward I-TAC gradient alone. However, at the low dose, I-TAC sensitized tumor cells toward SDF-1beta gradient and synergized with SDF-1beta in activation of intracellular pathways. Our data suggest an important role of I-TAC and its receptors in biology of solid tumors and we postulate that I-TAC-binding receptors might be used as the potential targets for antitumor therapy.

  20. Knockdown of apoptosis signal-regulating kinase 1 affects ischaemia-induced astrocyte activation and glial scar formation.


    Cheon, So Yeong; Cho, Kyoung Joo; Song, Juhyun; Kim, Gyung Whan


    Reactive astrocytes play an essential role in determining the tissue response to ischaemia. Formation of a glial scar can block the neuronal outgrowth that is required for restoration of damaged tissue. Therefore, regulation of astrocyte activation is important; however, the mediator of this process has not been fully elucidated. Apoptosis signal-regulating kinase 1 (ASK1) is an early responder to oxidative stress, and plays a pivotal role in the intracellular signalling pathway of apoptosis, inflammation, and differentiation. To confirm whether ASK1 mediates astrocyte activation and leads to glial scar formation after cerebral ischaemia, we conducted in vivo and in vitro experiments. C57BL/6 mice were subjected to occlusion of the middle cerebral artery, and astrocyte cultures were exposed to oxygen-glucose deprivation. After silencing of ASK1 , astrocyte-associated genes were downregulated, as seen with the use of microarrays. The glial fibrillary acidic protein (GFAP) level was decreased, and correlated with the reduction in the ASK1 level. In astrocytes, reduction in the ASK1 level decreased the activity of the p38 pathway, and the levels of transcription factors for GFAP and GFAP transcripts after hypoxia. In the chronic phase, ASK1 depletion reduced glial scar formation and conserved neuronal structure, which may lead to better functional recovery. These data suggest that ASK1 may be an important mediator of ischaemia-induced astrocyte activation and scar formation, and could provide a potential therapeutic target for treatment after ischaemic stroke.

  1. Single-chain antibody-mediated intracellular retention of ErbB-2 impairs Neu differentiation factor and epidermal growth factor signaling.

    PubMed Central

    Graus-Porta, D; Beerli, R R; Hynes, N E


    ErbB-2 becomes rapidly phosphorylated and activated following treatment of many cell lines with epidermal growth factor (EGF) or Neu differentiation factor (NDF). However, these factors do not directly bind ErbB-2, and its activation is likely to be mediated via transmodulation by other members of the type I/EGF receptor (EGFR)-related family of receptor tyrosine kinases. The precise role of ErbB-2 in the transduction of the signals elicited by EGF and NDF is unclear. We have used a novel approach to study the role of ErbB-2 in signaling through this family of receptors. An ErbB-2-specific single-chain antibody, designed to prevent transit through the endoplasmic reticulum and cell surface localization of ErbB-2, has been expressed in T47D mammary carcinoma cells, which express all four known members of the EGFR family. We show that cell surface expression of ErbB-2 was selectively suppressed in these cells and that the activation of the mitogen-activated protein kinase pathway and p70/p85S6K, induction of c-fos expression, and stimulation of growth by NDF were dramatically impaired. Activation of mitogen-activated protein kinase and p70/p85S6K and induction of c-fos expression by EGF were also significantly reduced. We conclude that in T47D cells, ErbB-2 is a major NDF signal transducer and a potentiator of the EGF signal. Thus, our observations demonstrate that ErbB-2 plays a central role in the type I/EGFR-related family of receptors and that receptor transmodulation represents a crucial step in growth factor signaling. PMID:7532277

  2. Inhibitory mechanisms of two Uncaria tomentosa extracts affecting the Wnt-signaling pathway.


    Gurrola-Díaz, Carmen Magdalena; García-López, Pedro Macedonio; Gulewicz, Krzysztof; Pilarski, Radoslaw; Dihlmann, Susanne


    Uncaria tomentosa ("uña de gato"; "cat's claw"), a woody vine native to the Amazon rainforest, is commonly used in South American traditional medicine to treat a broad spectrum of diseases. Although recent studies have reported anti-inflammatory and anti-proliferative properties of different alkaloids extracted from this plant, the underlying molecular mechanisms of these effects have not been elucidated yet. Our study investigates the inhibitory mechanisms of Uncaria tomentosa extracts on the Wnt-signaling pathway, a central regulator of development and tissue homoeostasis. A modified cell-based luciferase assay for screening inhibitors of the Wnt-pathway was used for analysis. Three cancer cell lines displaying different levels of aberrant Wnt-signaling activity were transfected with Wnt-signaling responsive Tcf-reporter plasmids and treated with increasing concentrations of two Uncaria tomentosa bark extracts. Wnt-signaling activity was assessed by luciferase activity and by expression of Wnt-responsive target genes. We show that both, an aqueous and an alkaloid-enriched extract specifically inhibit Wnt-signaling activity in HeLa, HCT116 and SW480 cancer cells resulting in reduced expression of the Wnt-target gene: c-Myc. The alkaloid-enriched extract (B/S(rt)) was found to be more effective than the aqueous extract (B/W(37)). The strongest effect was observed in SW480 cells, displaying the highest endogenous Wnt-signaling activity. Downregulation of Wnt-signaling by a dominant negative-TCF-4 variant in non-cancer cells rendered the cells insensitive towards treatment with B/S(rt). B/Srt was less toxic in non-cancer cells than in cancer cells. Our data suggest that the broad spectrum of pharmacological action of Uncaria tomentosa involves inhibition of the Wnt-signaling pathway, downstream of beta-Catenin activity.

  3. Antileukemia Effect of Ciclopirox Olamine Is Mediated by Downregulation of Intracellular Ferritin and Inhibition β-Catenin-c-Myc Signaling Pathway in Glucocorticoid Resistant T-ALL Cell Lines

    PubMed Central

    Zhang, Ge; Gu, Ling; Zhang, Yanle; Gao, Ju; Wei, Yuquan


    Ciclopirox olamine (CPX) is an antifungal drug that has been reported to have antitumor effects. In this study we investigated the antileukemia effects and the possible mechanisms of CPX on glucocorticoid (GC)-resistant T-cell acute lymphoblastic leukemia (T-ALL) cell lines. The results indicated that CPX inhibited the growth of GC-resistant T-ALL cells in a time- and dose-dependent manner, and this effect was closely correlated with the downregulation of intracellular ferritin. CPX induced cell cycle arrest at G1 phase by upregulation of cyclin-dependent kinase (CDK) inhibitor of p21 and downregulation of the expressions of cyclin D, retinoblastoma protein (Rb), and phosphorylated Rb (pRb). CPX also enhanced apoptotic cell death by downregulation of anti-apoptotic proteins such as Bcl-2, Bcl-xL, and Mcl-1. More importantly, CPX demonstrated a strong synergistic antileukemia effect with GC and this effect was mediated, at least in part, by inhibition of the β-catenin-c-Myc signaling pathway. These findings suggest that CPX could be a promising antileukemia drug, and modulation of the intracellular ferritin expression might be an effective method in the treatment of ALL. Therefore, integrating CPX into the current GC-containing ALL protocols could lead to the improvement of the outcome of ALL, especially GC-resistant ALL. PMID:27551974

  4. A Temperature-Sensitive Lesion in the N-Terminal Domain of the Rotavirus Polymerase Affects Its Intracellular Localization and Enzymatic Activity.


    McKell, Allison O; LaConte, Leslie E W; McDonald, Sarah M


    Temperature-sensitive (ts) mutants of simian rotavirus (RV) strain SA11 have been previously created to investigate the functions of viral proteins during replication. One mutant, SA11-tsC, has a mutation that maps to the gene encoding the VP1 polymerase and shows diminished growth and RNA synthesis at 39°C compared to that at 31°C. In the present study, we sequenced all 11 genes of SA11-tsC, confirming the presence of an L138P mutation in the VP1 N-terminal domain and identifying 52 additional mutations in four other viral proteins (VP4, VP7, NSP1, and NSP2). To investigate whether the L138P mutation induces a ts phenotype in VP1 outside the SA11-tsC genetic context, we employed ectopic expression systems. Specifically, we tested whether the L138P mutation affects the ability of VP1 to localize to viroplasms, which are the sites of RV RNA synthesis, by expressing the mutant form as a green fluorescent protein (GFP) fusion protein (VP1L138P-GFP) (i) in wild-type SA11-infected cells or (ii) in uninfected cells along with viroplasm-forming proteins NSP2 and NSP5. We found that VP1L138P-GFP localized to viroplasms and interacted with NSP2 and/or NSP5 at 31°C but not at 39°C. Next, we tested the enzymatic activity of a recombinant mutant polymerase (rVP1L138P) in vitro and found that it synthesized less RNA at 39°C than at 31°C, as well as less RNA than the control at all temperatures. Together, these results provide a mechanistic basis for the ts phenotype of SA11-tsC and raise important questions about the role of leucine 138 in supporting key protein interactions and the catalytic function of the VP1 polymerase.IMPORTANCE RVs cause diarrhea in the young of many animal species, including humans. Despite their medical and economic importance, gaps in knowledge exist about how these viruses replicate inside host cells. Previously, a mutant simian RV (SA11-tsC) that replicates worse at higher temperatures was identified. This virus has an amino acid mutation in VP

  5. Individual Differences in Ethanol Locomotor Sensitization Are Associated with Dopamine D1 Receptor Intra-Cellular Signaling of DARPP-32 in the Nucleus Accumbens

    PubMed Central

    Abrahao, Karina Possa; Oliveira Goeldner, Francine; Souza-Formigoni, Maria Lucia Oliveira


    In mice there are clear individual differences in the development of behavioral sensitization to ethanol, a progressive potentiation of its psychomotor stimulant effect. Variability in the behavioral responses to ethanol has been associated with alcohol preference. Here we investigated if the functional hyperresponsiveness of D1 receptors observed in ethanol sensitized mice leads to an increased activation of DARPP-32, a central regulatory protein in medium spiny neurons, in the nucleus accumbens - a brain region known to play a role in drug reinforcement. Swiss Webster mice received ethanol (2.2 g/kg/day) or saline i.p. administrations for 21 days and were weekly evaluated regarding their locomotor activity. From those treated with ethanol, the 33% with the highest levels of locomotor activity were classified as “sensitized” and the 33% with the lowest levels as "non-sensitized”. The latter presented similar locomotor levels to those of saline-treated mice. Different subgroups of mice received intra-accumbens administrations of saline and, 48 h later, SKF-38393, D1 receptor agonist 0.1 or 1 µg/side. Indeed, sensitized mice presented functional hyperresponsiveness of D1 receptors in the accumbens. Two weeks following the ethanol treatment, other subgroups received systemic saline or SKF 10 mg/kg, 20 min before the euthanasia. The nucleus accumbens were dissected for the Western Blot analyses of total DARPP-32 and phospho-Thr34-DARPP-32 expression. D1 receptor activation induced higher phospho-Thr34-DARPP-32 expression in sensitized mice than in non-sensitized or saline. The functionally hyperresponsiveness of D1 receptors in the nucleus accumbens is associated with an increased phospho-Thr34-DARPP-32 expression after D1 receptor activation. These data suggest that an enduring increase in the sensitivity of the dopamine D1 receptor intracellular pathway sensitivity represents a neurobiological correlate associated with the development of locomotor

  6. Intracellular Uptake of Curcumin-Loaded Solid Lipid Nanoparticles Exhibit Anti-Inflammatory Activities Superior to Those of Curcumin Through the NF-κB Signaling Pathway.


    Wang, Jiao; Zhu, Rongrong; Sun, Dongmei; Sun, Xiaoyu; Geng, Zhengsong; Liu, Hui; Wang, Shi-Long


    Curcumin (Cur) is a naturally derived, novel anti-inflammatory agent, but its poor solubility limits its clinical use. The aim of the present study was to encapsulate Cur into solid lipid nanoparticles (SLNs) to improve its anti-inflammatory activity. The Cur-loaded SLNs (Cur-SLNs) were prepared using emulsification and low-temperature solidification methods. In contrast to free Cur, the particles were well dispersed in aqueous medium, showing a narrow size distribution with a range of 55 : 1.2 nm, a zeta potential value of -26.2 ± 1.3 mV, and a high drug loading efficiency of 37% ± 2.5%. The sustained release of Cur was observed for up to 6 days. The particles displayed enhanced stability in phosphate-buffered saline by protecting the encapsulated Cur against hydrolysis and biotransformation, as well as increasing biocompatibility. Cur-SLNs were more effective than free Cur at reducing the expression levels of several pro- inflammatory mediators, including inflammatory cytokines (IL-6, TNF-α, and IL-1β) and nitric oxide (NO), under in vitro conditions. By Western blotting, we found that Cur-SLNs were more active than free Cur in inhibiting the LPS-induced activation of the inflammatory transcription factor NF-κB through the suppression of IκB kinase activation. Compared to free Cur, Cur-SLNs had an increased intracellular uptake over time (observed after 24 h) in RAW264.7 cells. Moreover, the Cur-SLNs (≥ 20 μM) significantly improved RAW264.7 cell viability by inhibiting apoptosis. Thus, these results demonstrated that SLNs could be used as potential anti-inflammatory drug carriers for the treatment of various chronic diseases.

  7. FosB Null Mutant Mice Show Enhanced Methamphetamine Neurotoxicity: Potential Involvement of FosB in Intracellular Feedback Signaling and Astroglial Function

    PubMed Central

    Kuroda, Kumi O; Ornthanalai, Veravej G; Kato, Tadafumi; Murphy, Niall P


    Previous studies show that (1) two members of fos family transcription factors, c-Fos and FosB, are induced in frontal brain regions by methamphetamine; (2) null mutation of c-Fos exacerbates methamphetamine-induced neurotoxicity; and (3) null mutation of FosB enhances behavioral responses to cocaine. Here we sought a role of FosB in responses to methamphetamine by studying FosB null mutant (−/−) mice. After a 10 mg/kg methamphetamine injection, FosB(−/−) mice were more prone to self-injury. Concomitantly, the intracellular feedback regulators of Sprouty and Rad-Gem-Kir (RGK) family transcripts had lower expression profiles in the frontoparietal cortex and striatum of the FosB(−/−) mice. Three days after administration of four 10 mg/kg methamphetamine injections, the frontoparietal cortex and striatum of FosB(−/−) mice contained more degenerated neurons as determined by Fluoro-Jade B staining. The abundance of the small neutral amino acids, serine, alanine, and glycine, was lower and/or was poorly induced after methamphetamine administration in the frontoparietal cortex and striatum of FosB(−/−) mice. In addition, methamphetamine-treated FosB(−/−) frontoparietal and piriform cortices showed more extravasation of immunoglobulin, which is indicative of blood–brain barrier dysfunction. Methamphetamine-induced hyperthermia, brain dopamine content, and loss of tyrosine hydroxylase immunoreactivity in the striatum, however, were not different between genotypes. These data indicate that FosB is involved in thermoregulation-independent protective functions against methamphetamine neurotoxicity in postsynaptic neurons. Our findings suggest two possible mechanisms of FosB-mediated neuroprotection: one is induction of negative feedback regulation within postsynaptic neurons through Sprouty and RGK. Another is supporting astroglial function such as maintenance of the blood–brain barrier, and metabolism of serine and glycine, which are important

  8. H⁺-activated Na⁺ influx in the ventricular myocyte couples Ca²⁺-signalling to intracellular pH.


    Garciarena, Carolina D; Youm, Jae Boum; Swietach, Pawel; Vaughan-Jones, Richard D


    Acid extrusion on Na(+)-coupled pH-regulatory proteins (pH-transporters), Na(+)/H(+) exchange (NHE1) and Na(+)-HCO3(-) co-transport (NBC), drives Na(+) influx into the ventricular myocyte. This H(+)-activated Na(+)-influx is acutely up-regulated at pHi<7.2, greatly exceeding Na(+)-efflux on the Na(+)/K(+) ATPase. It is spatially heterogeneous, due to the co-localisation of NHE1 protein (the dominant pH-transporter) with gap-junctions at intercalated discs. Overall Na(+)-influx via NBC is considerably lower, but much is co-localised with L-type Ca(2+)-channels in transverse-tubules. Through a functional coupling with Na(+)/Ca(2+) exchange (NCX), H(+)-activated Na(+)-influx increases sarcoplasmic-reticular Ca(2+)-loading and release during intracellular acidosis. This raises Ca(2+)-transient amplitude, rescuing it from direct H(+)-inhibition. Functional coupling is biochemically regulated and linked to membrane receptors, through effects on NHE1 and NBC. It requires adequate cytoplasmic Na(+)-mobility, as NHE1 and NCX are spatially separated (up to 60μm). The relevant functional NCX activity must be close to dyads, as it exerts no effect on bulk diastolic Ca(2+). H(+)-activated Na(+)-influx is up-regulated during ischaemia-reperfusion and some forms of maladaptive hypertrophy and heart failure. It is thus an attractive system for therapeutic manipulation. This article is part of a Special Issue entitled "Na(+) Regulation in Cardiac Myocytes".

  9. FosB null mutant mice show enhanced methamphetamine neurotoxicity: potential involvement of FosB in intracellular feedback signaling and astroglial function.


    Kuroda, Kumi O; Ornthanalai, Veravej G; Kato, Tadafumi; Murphy, Niall P


    Previous studies show that (1) two members of fos family transcription factors, c-Fos and FosB, are induced in frontal brain regions by methamphetamine; (2) null mutation of c-Fos exacerbates methamphetamine-induced neurotoxicity; and (3) null mutation of FosB enhances behavioral responses to cocaine. Here we sought a role of FosB in responses to methamphetamine by studying FosB null mutant (-/-) mice. After a 10 mg/kg methamphetamine injection, FosB(-/-) mice were more prone to self-injury. Concomitantly, the intracellular feedback regulators of Sprouty and Rad-Gem-Kir (RGK) family transcripts had lower expression profiles in the frontoparietal cortex and striatum of the FosB(-/-) mice. Three days after administration of four 10 mg/kg methamphetamine injections, the frontoparietal cortex and striatum of FosB(-/-) mice contained more degenerated neurons as determined by Fluoro-Jade B staining. The abundance of the small neutral amino acids, serine, alanine, and glycine, was lower and/or was poorly induced after methamphetamine administration in the frontoparietal cortex and striatum of FosB(-/-) mice. In addition, methamphetamine-treated FosB(-/-) frontoparietal and piriform cortices showed more extravasation of immunoglobulin, which is indicative of blood-brain barrier dysfunction. Methamphetamine-induced hyperthermia, brain dopamine content, and loss of tyrosine hydroxylase immunoreactivity in the striatum, however, were not different between genotypes. These data indicate that FosB is involved in thermoregulation-independent protective functions against methamphetamine neurotoxicity in postsynaptic neurons. Our findings suggest two possible mechanisms of FosB-mediated neuroprotection: one is induction of negative feedback regulation within postsynaptic neurons through Sprouty and RGK. Another is supporting astroglial function such as maintenance of the blood-brain barrier, and metabolism of serine and glycine, which are important glial modulators of nerve cells.

  10. RETRACTED: 6-OHDA-induced apoptosis and mitochondrial dysfunction are mediated by early modulation of intracellular signals and interaction of Nrf2 and NF-κB factors.


    Tobón-Velasco, Julio C; Limón-Pacheco, Jorge H; Orozco-Ibarra, Marisol; Macías-Silva, Marina; Vázquez-Victorio, Genaro; Cuevas, Elvis; Ali, Syed F; Cuadrado, Antonio; Pedraza-Chaverrí, José; Santamaría, Abel


    6-Hydroxydopamine (6-OHDA) is a neurotoxin that generates an experimental model of Parkinson's disease in rodents and is commonly employed to induce a lesion in dopaminergic pathways. The characterization of those molecular mechanisms linked to 6-OHDA-induced early toxicity is needed to better understand the cellular events further leading to neurodegeneration. The present work explored how 6-OHDA triggers early downstream signaling pathways that activate neurotoxicity in the rat striatum. Mitochondrial function, caspases-dependent apoptosis, kinases signaling (Akt, ERK 1/2, SAP/JNK and p38) and crosstalk between nuclear factor kappa B (NF-κB) and nuclear factor-erythroid-2-related factor 2 (Nrf2) were evaluated at early times post-lesion. We found that 6-OHDA initiates cell damage via mitochondrial complex I inhibition, cytochrome c and apoptosis-inducing factor (AIF) release, as well as activation of caspases 9 and 3 to induce apoptosis, kinase signaling modulation and NF-κB-mediated inflammatory responses, accompanied by inhibition of antioxidant systems regulated by the Nrf2 pathway. Our results suggest that kinases SAP/JNK and p38 up-regulation may play a role in the early stages of 6-OHDA toxicity to trigger intrinsic pathways for apoptosis and enhanced NF-κB activation. In turn, these cellular events inhibit the activation of cytoprotective mechanisms, thereby leading to a condition of general damage.

  11. Regulation of Pleiotrophin, Midkine, Receptor Protein Tyrosine Phosphatase β/ζ, and Their Intracellular Signaling Cascades in the Nucleus Accumbens During Opiate Administration

    PubMed Central

    Laorden, María Luisa; Milanés, María Victoria


    Background: Most classes of addictive substances alter the function and structural plasticity of the brain reward circuitry. Midkine (MK) and pleiotrophin (PTN) are growth/differentiation cytokines which, similarly to neurotrophins, play an important role in repair, neurite outgrowth, and cell differentiation. PTN or MK signaling through receptor protein tyrosine phosphatase β/ζ (RPTPβ/ζ), leads to the activation of extracellular signal-regulated kinases and thymoma viral proto-oncogene. This activation induces morphological changes and modulates addictive behaviors. Besides, there is increasing evidence that during the development of drug addiction, astrocytes contribute to the synaptic plasticity by synthesizing and releasing substances such as cytokines. Methods: In the present work we studied the effect of acute morphine administration, chronic morphine administration, and morphine withdrawal on PTN, MK, and RPTPβ/ζ expression and on their signaling pathways in the nucleus accumbens. Results: Present results indicated that PTN, MK, and RPTPβ/ζ levels increased after acute morphine injection, returned to basal levels during chronic opioid treatment, and were up-regulated again during morphine withdrawal. We also observed an activation of astrocytes after acute morphine injection and during opiate dependence and withdrawal. In addition, immunofluorescence analysis revealed that PTN, but not MK, was overexpressed in astrocytes and that dopaminoceptive neurons expressed RPTPβ/ζ. Conclusions: All these observations suggest that the neurotrophic and behavioral adaptations that occur during opiate addiction could be, at least partly, mediated by cytokines. PMID:26164717

  12. ER stress stimulates production of the key antimicrobial peptide, cathelicidin, by forming a previously unidentified intracellular S1P signaling complex.


    Park, Kyungho; Ikushiro, Hiroko; Seo, Ho Seong; Shin, Kyong-Oh; Kim, Young Il; Kim, Jong Youl; Lee, Yong-Moon; Yano, Takato; Holleran, Walter M; Elias, Peter; Uchida, Yoshikazu


    We recently identified a previously unidentified sphingosine-1-phosphate (S1P) signaling mechanism that stimulates production of a key innate immune element, cathelicidin antimicrobial peptide (CAMP), in mammalian cells exposed to external perturbations, such as UVB irradiation and other oxidative stressors that provoke subapoptotic levels of endoplasmic reticulum (ER) stress, independent of the well-known vitamin D receptor-dependent mechanism. ER stress increases cellular ceramide and one of its distal metabolites, S1P, which activates NF-κB followed by C/EBPα activation, leading to CAMP production, but in a S1P receptor-independent fashion. We now show that S1P activates NF-κB through formation of a previously unidentified signaling complex, consisting of S1P, TRAF2, and RIP1 that further associates with three stress-responsive proteins; i.e., heat shock proteins (GRP94 and HSP90α) and IRE1α. S1P specifically interacts with the N-terminal domain of heat shock proteins. Because this ER stress-initiated mechanism is operative in both epithelial cells and macrophages, it appears to be a universal, highly conserved response, broadly protective against diverse external perturbations that lead to increased ER stress. Finally, these studies further illuminate how ER stress and S1P orchestrate critical stress-specific signals that regulate production of one protective response by stimulating production of the key innate immune element, CAMP.

  13. Multiple signals and male spacing affect female preference at cocktail parties in treefrogs

    PubMed Central

    Richardson, Christina; Lengagne, Thierry


    Effective acoustic communication in the face of intense conspecific background noise constitutes a constant sensory challenge in chorusing and colonial species. An evolutionary approach suggests that behavioural and environmental constraints in these species should have shaped signal design and signalling behaviour to enable communication in noisy conditions. This could be attained both through the use of multicomponent signals and through short-term adjustments in the spatial separation of calling males. We investigated these two hypotheses in a chorusing anuran, the hylid Hyla arborea, through a series of phonotaxis experiments conducted within a six-speaker arena in a high background noise situation, by presenting females with male calls containing either single or multiple attractive call components, and by modifying distances between speakers. We found that female ability to discriminate attractive calls increased when several attractive call components were available, providing novel evidence that the use of multicomponent signals enhances communication in complex acoustic conditions. Signal discrimination in females also improved with speaker separation, demonstrating that within natural choruses, spatial unmasking conditioned by male density and spatial separation probably improves female discrimination of competing males. Implications of these results for the accuracy of mate choice within choruses are discussed. PMID:20018785

  14. Moderate folate depletion modulates the expression of selected genes involved in cell cycle, intracellular signaling, and folate uptake in human colonic epithelial cell lines

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Folate deficiency may affect gene expression by disrupting DNA methylation patterns or by inducing base substitution, DNA breaks, gene deletions and gene amplification. Changes in expression may explain the inverse relationship observed between folate status and risk of colorectal cancer. Three cell...

  15. Aroclor-1254, a developmental neurotoxicant, alters energy metabolism-and intracellular signaling-associated protein networks in rat cerebellum and hippocampus

    EPA Science Inventory

    The vast literature on the mode of action of polychlorinated biphenyls (PCBs) indicates that PCBs are a unique model for understanding the mechanisms of toxicity of environmental mixtures of persistent chemicals. PCBs have been shown to adversely affect psychomotor function and l...

  16. Intracellular signaling modifications involved in the anti-inflammatory effect of 4-alkoxy-6,9-dichloro[1,2,4]triazolo[4,3-a]quinoxalines on macrophages.


    Ruiz-Alcaraz, Antonio J; Tristán-Manzano, María; Guirado, Antonio; Gálvez, Jesús; Martínez-Esparza, María; García-Peñarrubia, Pilar


    Inflammation is part of a complex biological response directed by the immune system to fight pathogens and maintain homeostasis. Dysregulation of the inflammatory process leads to development of chronic inflammatory or autoimmune diseases. Several cell types, such as macrophages, and cytokines such as interleukin 6 (IL-6) and tumor necrosis factor alpha (TNF-α) are involved in the regulation of inflammation. The important role played by these cytokines as mediators of the inflammatory process and the side effects of current therapies have promoted the search of new therapeutic alternatives. Quinoxalines are important compounds allowing a wide range of chemical modifications in order to provide an extensive repertoire of biological activities. We have previously shown that a series of 4-alkoxy-6,9-dichloro[1,2,4]triazolo[4,3-a]quinoxalines exhibit potent anti-inflammatory activity, inhibiting the production of TNF-α and IL-6. Our aim here was to study the mechanism thereby this series of compounds act upon different intracellular signaling pathways to uncover their potential molecular targets. By using immunoblotting assays, we found that these compounds inhibit ERK 1/2 and JNK/c-Jun cascades, and reduce c-Fos expression, while activate the anti-inflammatory PI3K/Akt route. These results provide further information on their effect upon the intracellular signal transduction mechanisms leading to inhibition of TNF-α and IL-6 secretion. Our results may be of great interest for the pharmaceutical industry, and could be used as a starting point for the development of new and more potent anti-inflammatory drugs derived from the quinoxaline core.

  17. Linear and nonlinear analysis of normal and CAD-affected heart rate signals.


    Acharya, U Rajendra; Faust, Oliver; Sree, Vinitha; Swapna, G; Martis, Roshan Joy; Kadri, Nahrizul Adib; Suri, Jasjit S


    Coronary artery disease (CAD) is one of the dangerous cardiac disease, often may lead to sudden cardiac death. It is difficult to diagnose CAD by manual inspection of electrocardiogram (ECG) signals. To automate this detection task, in this study, we extracted the heart rate (HR) from the ECG signals and used them as base signal for further analysis. We then analyzed the HR signals of both normal and CAD subjects using (i) time domain, (ii) frequency domain and (iii) nonlinear techniques. The following are the nonlinear methods that were used in this work: Poincare plots, Recurrence Quantification Analysis (RQA) parameters, Shannon entropy, Approximate Entropy (ApEn), Sample Entropy (SampEn), Higher Order Spectra (HOS) methods, Detrended Fluctuation Analysis (DFA), Empirical Mode Decomposition (EMD), Cumulants, and Correlation Dimension. As a result of the analysis, we present unique recurrence, Poincare and HOS plots for normal and CAD subjects. We have also observed significant variations in the range of these features with respect to normal and CAD classes, and have presented the same in this paper. We found that the RQA parameters were higher for CAD subjects indicating more rhythm. Since the activity of CAD subjects is less, similar signal patterns repeat more frequently compared to the normal subjects. The entropy based parameters, ApEn and SampEn, are lower for CAD subjects indicating lower entropy (less activity due to impairment) for CAD. Almost all HOS parameters showed higher values for the CAD group, indicating the presence of higher frequency content in the CAD signals. Thus, our study provides a deep insight into how such nonlinear features could be exploited to effectively and reliably detect the presence of CAD.

  18. Stimulation of PPC Affects the Mapping between Motion and Force Signals for Stiffness Perception But Not Motion Control.


    Leib, Raz; Mawase, Firas; Karniel, Amir; Donchin, Opher; Rothwell, John; Nisky, Ilana; Davare, Marco


    How motion and sensory inputs are combined to assess an object's stiffness is still unknown. Here, we provide evidence for the existence of a stiffness estimator in the human posterior parietal cortex (PPC). We showed previously that delaying force feedback with respect to motion when interacting with an object caused participants to underestimate its stiffness. We found that applying theta-burst transcranial magnetic stimulation (TMS) over the PPC, but not the dorsal premotor cortex, enhances this effect without affecting movement control. We explain this enhancement as an additional lag in force signals. This is the first causal evidence that the PPC is not only involved in motion control, but also has an important role in perception that is disassociated from action. We provide a computational model suggesting that the PPC integrates position and force signals for perception of stiffness and that TMS alters the synchronization between the two signals causing lasting consequences on perceptual behavior.

  19. Missense mutations in Otopetrin 1 affect subcellular localization and inhibition of purinergic signaling in vestibular supporting cells.


    Kim, Euysoo; Hyrc, Krzysztof L; Speck, Judith; Salles, Felipe T; Lundberg, Yunxia W; Goldberg, Mark P; Kachar, Bechara; Warchol, Mark E; Ornitz, David M


    Otopetrin 1 (Otop1) encodes a protein that is essential for the development of otoconia. Otoconia are the extracellular calcium carbonate containing crystals that are important for vestibular mechanosensory transduction of linear motion and gravity. There are two mutant alleles of Otop1 in mice, titled (tlt) and mergulhador (mlh), which result in non-syndromic otoconia agenesis and a consequent balance defect. Biochemically, Otop1 has been shown to modulate purinergic control of intracellular calcium in vestibular supporting cells, which could be one of the mechanisms by which Otop1 participates in the mineralization of otoconia. To understand how tlt and mlh mutations affect the biochemical function of Otop1, we examined the purinergic response of COS7 cells expressing mutant Otop1 proteins, and dissociated sensory epithelial cells from tlt and mlh mice. We also examined the subcellular localization of Otop1 in whole sensory epithelia from tlt and mlh mice. Here we show that tlt and mlh mutations uncouple Otop1 from inhibition of P2Y receptor function. Although the in vitro biochemical function of the Otop1 mutant proteins is normal, in vivo they behave as null alleles. We show that in supporting cells the apical membrane localization of the mutant Otop1 proteins is lost. These data suggest that the tlt and mlh mutations primarily affect the localization of Otop1, which interferes with its ability to interact with other proteins that are important for its cellular and biochemical function.

  20. IL-6 signaling blockade increases inflammation but does not affect muscle function in the mdx mouse

    PubMed Central


    Background IL-6 is a pleiotropic cytokine that modulates inflammatory responses and plays critical roles in muscle maintenance and remodeling. In the mouse model (mdx) of Duchenne Muscular Dystrophy, IL-6 and muscle inflammation are elevated, which is believed to contribute to the chronic inflammation and failure of muscle regeneration in DMD. The purpose of the current study was to examine the effect of blocking IL-6 signaling on the muscle phenotype including muscle weakness and pathology in the mdx mouse. Methods A monoclonal antibody against the IL-6 receptor (IL-6r mAb) that blocks local and systemic IL-6 signaling was administered to mdx and BL-10 mice for 5 weeks and muscle function, histology, and inflammation were examined. Results IL-6r mAb treatment increased mdx muscle inflammation including total inflammation score and ICAM-1 positive lumens in muscles. There was no significant improvement in muscle strength nor muscle pathology due to IL-6r mAb treatment in mdx mice. Conclusions These results showed that instead of reducing inflammation, IL-6 signaling blockade for 5 weeks caused an increase in muscle inflammation, with no significant change in indices related to muscle regeneration and muscle function. The results suggest a potential anti-inflammatory instead of the original hypothesized pro-inflammatory role of IL-6 signaling in the mdx mice. PMID:22716658

  1. Grafting of Beads into Developing Chicken Embryo Limbs to Identify Signal Transduction Pathways Affecting Gene Expression.


    Mohammed, Rabeea H; Sweetman, Dylan


    Using chicken embryos it is possible to test directly the effects of either growth factors or specific inhibitors of signaling pathways on gene expression and activation of signal transduction pathways. This technique allows the delivery of signaling molecules at precisely defined developmental stages for specific times. After this embryos can be harvested and gene expression examined, for example by in situ hybridization, or activation of signal transduction pathways observed with immunostaining. In this video heparin beads soaked in FGF18 or AG 1-X2 beads soaked in U0126, a MEK inhibitor, are grafted into the limb bud in ovo. This shows that FGF18 induces expression of MyoD and ERK phosphorylation and both endogenous and FGF18 induced MyoD expression is inhibited by U0126. Beads soaked in a retinoic acid antagonist can potentiate premature MyoD induction by FGF18. This approach can be used with a wide range of different growth factors and inhibitors and is easily adapted to other tissues in the developing embryo.

  2. The order of ostensive and referential signals affects dogs' responsiveness when interacting with a human.


    Tauzin, Tibor; Csík, Andor; Kis, Anna; Kovács, Krisztina; Topál, József


    Ostensive signals preceding referential cues are crucial in communication-based human knowledge acquisition processes. Since dogs are sensitive to both human ostensive and referential signals, here we investigate whether they also take into account the order of these signals and, in an object-choice task, respond to human pointing more readily when it is preceded by an ostensive cue indicating communicative intent. Adult pet dogs (n = 75) of different breeds were presented with different sequences of a three-step human action. In the relevant sequence (RS) condition, subjects were presented with an ostensive attention getter (verbal addressing and eye contact), followed by referential pointing at one of two identical targets and then a non-ostensive attention getter (clapping of hands). In the irrelevant sequence (IS) condition, the order of attention getters was swapped. We found that dogs chose the target indicated by pointing more frequently in the RS as compared to the IS condition. While dogs selected randomly between the target locations in the IS condition, they performed significantly better than chance in the RS condition. Based on a further control experiment (n = 22), it seems that this effect is not driven by the aversive or irrelevant nature of the non-ostensive cue. This suggests that dogs are sensitive to the order of signal sequences, and the exploitation of human referential pointing depends on the behaviour pattern in which the informing cue is embedded.

  3. Differential regulation of Gli proteins by Sufu in the lung affects PDGF signaling and myofibroblast development

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Mammalian Hedgehog (Hh) signaling relies on three Gli transcription factors to mediate Hh responses. This process is controlled in part by a major negative regulator, Sufu, through its effects on Gli protein level, distribution and activity. In this report, we showed that Sufu regulates Gli1 protein...

  4. Prior mating success can affect allocation towards future sexual signaling in crickets

    PubMed Central

    Chiswell, Rachel; Girard, Madeline; Fricke, Claudia


    Fitness is often correlated with the expression level of a sexually selected trait. However, sexually selected traits are costly to express such that investment in their expression should be optimised to maximize their overall fitness gains. Social interactions, in the form of successful and unsuccessful matings, may offer males one type of feedback allowing them to gauge how to allocate their resources towards sexual signaling. Here we tested whether adult male black field crickets (Teleogryllus commodus) modify the extent of their calling effort (the sexually selected trait) in response to successful and unsuccessful matings with females. To examine the effect that mating interactions with females have on investment into sexual signaling, we monitored male calling effort after maturation and then provided males with a female at two points within their life, manipulating whether or not males were able to successfully mate each time. Our results demonstrate that males alter their investment towards sexual signaling in response to successful matings, but only if the experience occurs early in their life. Males that mated early decreased their calling effort sooner than males that were denied a mating. Our results demonstrate that social feedback in the form of successful and unsuccessful matings has the potential to alter the effort a male places towards sexual signaling. PMID:25392758

  5. ESCRT-I Component VPS23A Affects ABA Signaling by Recognizing ABA Receptors for Endosomal Degradation.


    Yu, Feifei; Lou, Lijuan; Tian, Miaomiao; Li, Qingliang; Ding, Yanglin; Cao, Xiaoqiang; Wu, Yaorong; Belda-Palazon, Borja; Rodriguez, Pedro L; Yang, Shuhua; Xie, Qi


    Recent discovery of PYR/PYL/RCAR-type abscisic acid (ABA) receptors has become one of most significant advances in plant science in the past decade. In mammals, endosomal sorting acts as an important pathway to downregulate different types of receptors, but its role in plant hormone signaling is poorly understood. Here, we report that an ubiquitin E2-like protein, VPS23A, which is a key component of ESCRT-I, negatively regulates ABA signaling. VPS23A has epistatic relationship with PYR/PYL/RCAR-type ABA receptors and disruption of VPS23A enhanced the activity of key kinase OST1 in the ABA signaling pathway under ABA treatment. Moreover, VPS23A interacts with PYR1/PYLs and K63-linked diubiquitin, and PYL4 possesses K63-linked ubiquitinated modification in vivo. Further analysis revealed that VPS23A affects the subcellular localization of PYR1 and the stability of PYL4. Taken together, our results suggest that VPS23A affects PYR1/PYL4 via vacuole-mediated degradation, providing an advanced understanding of both the turnover of ABA receptors and ESCRTs in plant hormone signaling.

  6. Integration of distinct intracellular signaling pathways at distal regulatory elements directs T-bet expression in human CD4+ T cells.


    Placek, Katarzyna; Gasparian, Sona; Coffre, Maryaline; Maiella, Sylvie; Sechet, Emmanuel; Bianchi, Elisabetta; Rogge, Lars


    T-bet is a key regulator controlling Th1 cell development. This factor is not expressed in naive CD4(+) T cells, and the mechanisms controlling expression of T-bet are incompletely understood. In this study, we defined regulatory elements at the human T-bet locus and determined how signals originating at the TCR and at cytokine receptors are integrated to induce chromatin modifications and expression of this gene during human Th1 cell differentiation. We found that T cell activation induced two strong DNase I-hypersensitive sites (HS) and rapid histone acetylation at these elements in CD4(+) T cells. Histone acetylation and T-bet expression were strongly inhibited by cyclosporine A, and we detected binding of NF-AT to a HS in vivo. IL-12 and IFN-gamma signaling alone were not sufficient to induce T-bet expression in naive CD4(+) T cells, but enhanced T-bet expression in TCR/CD28-stimulated cells. We detected a third HS 12 kb upstream of the mRNA start site only in developing Th1 cells, which was bound by IL-12-induced STAT4. Our data suggest that T-bet locus remodeling and gene expression are initiated by TCR-induced NF-AT recruitment and amplified by IL-12-mediated STAT4 binding to distinct distal regulatory elements during human Th1 cell differentiation.

  7. Efficient Differentiation of Human Pluripotent Stem Cells into Mesenchymal Stem Cells by Modulating Intracellular Signaling Pathways in a Feeder/Serum-Free System

    PubMed Central

    Tran, Ngoc-Tung; Trinh, Quynh-Mai


    Mesenchymal stem cells (MSCs) derived from human pluripotent stem cells (hPSC-derived MSCs) will be one promising alternative cell source for MSC-based therapies. Here, an efficient protocol is demonstrated for generating hPSC-derived MSCs under a feeder-free culture system by regulating signaling pathways. Simultaneous treatments with Activin A, BIO (6-bromoindirubin-3′-oxime), and bone morphogenetic protein 4 (ABB) activated the transcription of mesoderm-lineage genes such as T, MIXL1, and WNT3 in hPSCs. The ABB-treated hPSCs could develop into CD105+ cells with a high efficiency of 20% in the MSC-induction medium. The properties of the hPSC-derived CD105+ cells were similar to those of adult MSCs in terms of surface antigens. Also, hPSC-derived MSCs had the potential to differentiate into adipocytes, osteoblasts, and chondrocytes in vitro. The results demonstrated that functional MSCs could be generated efficiently from hPSCs by the combined modulation of signaling pathways. PMID:21793661

  8. Skin Aging-Dependent Activation of the PI3K Signaling Pathway via Downregulation of PTEN Increases Intracellular ROS in Human Dermal Fibroblasts

    PubMed Central

    Park, Jinny; Song, Hwa-Ryung; Lee, Minok; Hong, On-Yu; Whang, Pyoung H.; Han, Myung-Kwan; Kwon, Kang-Beom


    Reactive oxygen species (ROS) play a major role in both chronological aging and photoaging. ROS induce skin aging through their damaging effect on cellular constituents. However, the origins of ROS have not been fully elucidated. We investigated that ROS generation of replicative senescent fibroblasts is generated by the modulation of phosphatidylinositol 3,4,5-triphosphate (PIP3) metabolism. Reduction of the PTEN protein, which dephosphorylates PIP3, was responsible for maintaining a high level of PIP3 in replicative cells and consequently mediated the activation of the phosphatidylinositol-3-OH kinase (PI3K)/Akt pathway. Increased ROS production was blocked by inhibition of PI3K or protein kinase C (PKC) or by NADPH oxidase activating in replicative senescent cells. These data indicate that the signal pathway to ROS generation in replicative aged skin cells can be stimulated by reduced PTEN level. Our results provide new insights into skin aging-associated modification of the PI3K/NADPH oxidase signaling pathway and its relationship with a skin aging-dependent increase of ROS in human dermal fibroblasts. PMID:28003865

  9. Differentially expressed microRNAs and affected signaling pathways in placentae of transgenic cloned cattle.


    Liu, Feng-Jun; Jin, Li-Jun; Ma, Xue-Gang; Zhang, Yu-Ling; Zhai, Xiao-Wei; Chen, Jun-Jie; Yang, Xue-Yi


    Placental deficiencies are related to the developmental abnormalities of transgenic cattle produced by somatic cell nuclear transfer, but the concrete molecular mechanism is not very clear. Studies have shown that placental development can be regulated by microRNAs (miRNAs) in normal pregnancy. Thus, this study screened differentially expressed miRNAs by the next-generation sequencing technology to reveal the relationship between miRNAs expression and aberrant development of placentae produced by the transgenic-clone technology. Expressions of miRNAs and mRNAs in different placentae were compared, the placentae derived from one natural pregnancy counterpart (PNC), one natural pregnancy of a cloned offspring as a mother (PCM), and two transgenic (human beta-defensin-3) cloned pregnancy: one offspring was alive after birth (POL) and the other offspring was dead in 2 days after birth (POD). Further, signaling pathway analysis was conducted. The results indicated that 694 miRNAs were differentially expressed in four placental samples, such as miR-210, miR-155, miR-21, miR-128, miR-183, and miR-145. Signaling pathway analysis revealed that compared with PNC, significantly upregulated pathways in POL, POD, and PCM mainly included focal adhesion, extracellular matrix-receptor interaction, pathways in cancer, regulation of actin cytoskeleton, endosytosis, and adherens junction, and significantly downregulated pathways mainly included malaria, nucleotide binding oligomerization domain-like receptor signaling, cytokine-cytokine receptor interaction, Jak-STAT signaling pathway. In conclusion, this study confirmed alterations of the expression profile of miRNAs and signaling pathways in placentae from transgenic (hBD-3) cloned cattle (PTCC), which could lead to the morphologic and histologic deficiencies of PTCC. This information would be useful for the relative research in future.

  10. Intracellular Sterol Dynamics

    PubMed Central

    Mesmin, Bruno; Maxfield, Frederick R.


    We review the cellular mechanisms implicated in cholesterol trafficking and distribution. Recent studies have provided new information about the distribution of sterols within cells, including analysis of its transbilayer distribution. The cholesterol interaction with other lipids and its engagement in various trafficking processes will determine its proper level in a specific membrane; making the cholesterol distribution uneven among the various intracellular organelles. The cholesterol content is important since cholesterol plays an essential role in membranes by controlling their physicochemical properties as well as key cellular events such as signal transduction and protein trafficking. Cholesterol movement between cellular organelles is highly dynamic, and can be achieved by vesicular and non-vesicular processes. Various studies have analyzed the proteins that play a significant role in these processes, giving us new information about the relative importance of these two trafficking pathways in cholesterol transport. Although still poorly characterized in many trafficking routes, several potential sterol transport proteins have been described in detail; as a result, molecular mechanisms for sterol transport among membranes start to be appreciated. PMID:19286471

  11. Resistance exercise-induced increases in putative anabolic hormones do not enhance muscle protein synthesis or intracellular signalling in young men

    PubMed Central

    West, Daniel W D; Kujbida, Gregory W; Moore, Daniel R; Atherton, Philip; Burd, Nicholas A; Padzik, Jan P; De Lisio, Michael; Tang, Jason E; Parise, Gianni; Rennie, Michael J; Baker, Steven K; Phillips, Stuart M


    We aimed to determine whether exercise-induced elevations in systemic concentration of testosterone, growth hormone (GH) and insulin-like growth factor-1 (IGF-1) enhanced post-exercise myofibrillar protein synthesis (MPS) and phosphorylation of signalling proteins important in regulating mRNA translation. Eight young men (20 ± 1.1 years, BMI = 26 ± 3.5 kg m−2) completed two exercise protocols designed to maintain basal hormone concentrations (low hormone, LH) or elicit increases in endogenous hormones (high hormone, HH). In the LH protocol, participants performed a bout of unilateral resistance exercise with the elbow flexors. The HH protocol consisted of the same elbow flexor exercise with the contralateral arm followed immediately by high-volume leg resistance exercise. Participants consumed 25 g of protein after arm exercise to maximize MPS. Muscle biopsies and blood samples were taken as appropriate. There were no changes in serum testosterone, GH or IGF-1 after the LH protocol, whereas there were marked elevations after HH (testosterone, P < 0.001; GH, P < 0.001; IGF-1, P < 0.05). Exercise stimulated a rise in MPS in the biceps brachii (rest = 0.040 ± 0.007, LH = 0.071 ± 0.008, HH = 0.064 ± 0.014% h−1; P < 0.05) with no effect of elevated hormones (P= 0.72). Phosphorylation of the 70 kDa S6 protein kinase (p70S6K) also increased post-exercise (P < 0.05) with no differences between conditions. We conclude that the transient increases in endogenous purportedly anabolic hormones do not enhance fed-state anabolic signalling or MPS following resistance exercise. Local mechanisms are likely to be of predominant importance for the post-exercise increase in MPS. PMID:19736298

  12. TPL-2-ERK1/2 signaling promotes host resistance against intracellular bacterial infection by negative regulation of type I IFN production.


    McNab, Finlay W; Ewbank, John; Rajsbaum, Ricardo; Stavropoulos, Evangelos; Martirosyan, Anna; Redford, Paul S; Wu, Xuemei; Graham, Christine M; Saraiva, Margarida; Tsichlis, Philip; Chaussabel, Damien; Ley, Steven C; O'Garra, Anne


    Tuberculosis, caused by Mycobacterium tuberculosis, remains a leading cause of mortality and morbidity worldwide, causing ≈ 1.4 million deaths per year. Key immune components for host protection during tuberculosis include the cytokines IL-12, IL-1, and TNF-α, as well as IFN-γ and CD4(+) Th1 cells. However, immune factors determining whether individuals control infection or progress to active tuberculosis are incompletely understood. Excess amounts of type I IFN have been linked to exacerbated disease during tuberculosis in mouse models and to active disease in patients, suggesting tight regulation of this family of cytokines is critical to host resistance. In addition, the immunosuppressive cytokine IL-10 is known to inhibit the immune response to M. tuberculosis in murine models through the negative regulation of key proinflammatory cytokines and the subsequent Th1 response. We show in this study, using a combination of transcriptomic analysis, genetics, and pharmacological inhibitors, that the TPL-2-ERK1/2 signaling pathway is important in mediating host resistance to tuberculosis through negative regulation of type I IFN production. The TPL-2-ERK1/2 signaling pathway regulated production by macrophages of several cytokines important in the immune response to M. tuberculosis as well as regulating induction of a large number of additional genes, many in a type I IFN-dependent manner. In the absence of TPL-2 in vivo, excess type I IFN promoted IL-10 production and exacerbated disease. These findings describe an important regulatory mechanism for controlling tuberculosis and reveal mechanisms by which type I IFN may promote susceptibility to this important disease.

  13. fundTPL-2 – ERK1/2 Signaling Promotes Host Resistance against Intracellular Bacterial Infection by Negative Regulation of Type I Interferon Production3

    PubMed Central

    McNab, Finlay W.; Ewbank, John; Rajsbaum, Ricardo; Stavropoulos, Evangelos; Martirosyan, Anna; Redford, Paul S.; Wu, Xuemei; Graham, Christine M.; Saraiva, Margarida; Tsichlis, Philip; Chaussabel, Damien; Ley, Steven C.; O’Garra, Anne


    Tuberculosis, caused by Mycobacterium tuberculosis (Mtb), remains a leading cause of mortality and morbidity worldwide, causing approximately 1.4 million deaths per year. Key immune components for host protection during tuberculosis include the cytokines IL-12, IL-1 and TNF-α, as well as IFN-γ and CD4+ Th1 cells. However, immune factors determining whether individuals control infection or progress to active tuberculosis are incompletely understood. Excess amounts of type I interferon have been linked to exacerbated disease during tuberculosis in mouse models and to active disease in patients, suggesting tight regulation of this family of cytokines is critical to host resistance. In addition, the immunosuppressive cytokine IL-10 is known to inhibit the immune response to Mtb in murine models through the negative regulation of key pro-inflammatory cytokines and the subsequent Th1 response. We show here, using a combination of transcriptomic analysis, genetics and pharmacological inhibitors that the TPL-2-ERK1/2 signaling pathway is important in mediating host resistance to tuberculosis through negative regulation of type I interferon production. The TPL-2-ERK1/2 signalling pathway regulated production by macrophages of several cytokines important in the immune response to Mtb as well as regulating induction of a large number of additional genes, many in a type I IFN dependent manner. In the absence of TPL-2 in vivo, excess type I interferon promoted IL-10 production and exacerbated disease. These findings describe an important regulatory mechanism for controlling tuberculosis and reveal mechanisms by which type I interferon may promote susceptibility to this important disease. PMID:23842752

  14. SERCA2a controls the mode of agonist-induced intracellular Ca2+ signal, transcription factor NFAT and proliferation in human vascular smooth muscle cells

    PubMed Central

    Bobe, Regis; Hadri, Lahouaria; Lopez, Jose J.; Sassi, Yassine; Atassi, Fabrice; Karakikes, Ioannis; Liang, Lifan; Limon, Isabelle; Lompré, Anne-Marie; Hatem, Stephane N.; Hajjar, Roger J.; Lipskaia, Larissa


    In blood vessels, tone is maintained by agonist-induced cytosolic Ca2+ oscillations of quiescent/contractile vascular smooth muscle cells (VSMCs). However, in synthetic/proliferative VSMCs, Gq/phosphoinositide receptor-coupled agonists trigger a steady-state increase in cytosolic Ca2+ followed by a Store Operated Calcium Entry (SOCE) which translates into activation of the proliferation-associated transcription factor NFAT. Here, we report that in human coronary artery smooth muscle cells (hCASMCs), the sarco/endoplasmic reticulum calcium ATPase type 2a (SERCA2a) expressed in the contractile form of the hCASMCs, controls the nature of the agonist-induced Ca2+ transient and the resulting down-stream signaling pathway. Indeed, restoring SERCA2a expression by gene transfer in synthetic hCASMCs 1) increased Ca2+ storage capacity; 2) modified agonist-induced IP3R Ca2+ release from steady-state to oscillatory mode (the frequency of agonist-induced IP3R Ca2+ signal was 11.66 ± 1.40/100 sec in SERCA2a-expressing cells (n=39) vs 1.37 ± 0.20/100 sec in control cell (n=45), p<0.01); 3) suppressed SOCE by preventing interactions between SR calcium sensor STIM1 and pore forming unit ORAI1; 4) inhibited calcium regulated transcription factor NFAT and its down-stream physiological function such as proliferation and migration. This study provides evidence for the first time that oscillatory and steady-state patterns of Ca2+ transients have different effects on calcium-dependent physiological functions in smooth muscle cells. PMID:21195084

  15. BMP and Hh signaling affects primordial germ cell division in Drosophila.


    Sato, Takuya; Ogata, Jun; Niki, Yuzo


    The germline is segregated from the remainder of the soma during early embryonic development in metazoan species. In Drosophila, female primordial germ cells (PGCs) continue to proliferate during larval development, and become germline stem cells at the early pupal stage. To elucidate the roles of growth factors in larval PGC division, we examined expression patterns of a bone morphogenetic protein (BMP) growth factor, Decapentaplegic (Dpp), and Hedgehog (Hh), along with factors downstream of each, in the ovary during larval development. Dpp signaling appeared in the ovarian soma from early larval development, and was prominent in the terminal filament cells at late larval stage, whereas Hh appeared in the ovarian soma and PGCs from the third instar larval stage. The number of PGCs decreased when components of these signal transduction pathways were abrogated by RNAi in the PGCs, indicating that both Dpp and Hh signals directly regulate PGC proliferation. Experiments on the up- and down-regulation of Dpp and Hh with a tissue-specific Gal4 driver indicated that Dpp and Hh act as extrinsic and autocrine growth factors. Furthermore, heat-pulse experiments with hs-Gal4 showed that Dpp is active in PGC proliferation throughout larval development, whereas Hh has effects only during late larval development. In addition to Dpp, the reduction of Glass bottom boat (Gbb), another BMP molecule, caused a decrease in the number of PGCs and initiation of larval PGCs differentiation into cystocytes, indicating that Gbb functions to promote PGC division and repress differentiation.

  16. Regulatory RNAs controlling vascular (dys)function by affecting TGF-ß family signalling

    PubMed Central

    Kurakula, Kondababu; Goumans, Marie-Jose; ten Dijke, Peter


    Cardiovascular disease (CVD) is a leading cause of morbidity and mortality worldwide. Over the last few years, microRNAs (miRNAs) have emerged as master regulators of gene expression in cardiovascular biology and disease. miRNAs are small endogenous non-coding RNAs that usually bind to 3′ untranslated region (UTR) of their target mRNAs and inhibit mRNA stability or translation of their target genes. miRNAs play a dynamic role in the pathophysiology of many CVDs through their effects on target mRNAs in vascular cells. Recently, numerous miRNAs have been implicated in the regulation of the transforming growth factor-β (TGF-β)/bone morphogenetic protein (BMP) signalling pathway which plays crucial roles in diverse biological processes, and is involved in pathogenesis of many diseases including CVD. This review gives an overview of current literature on the role of miRNAs targeting TGF-β/BMP signalling in vascular cells, including endothelial cells and smooth muscle cells. We also provide insight into how this miRNA-mediated regulation of TGF-β/BMP signalling might be used to harness CVD. PMID:26862319

  17. Cerebellin and des-cerebellin exert ACTH-like effects on corticosterone secretion and the intracellular signaling pathway gene expression in cultured rat adrenocortical cells--DNA microarray and QPCR studies.


    Rucinski, Marcin; Ziolkowska, Agnieszka; Szyszka, Marta; Malendowicz, Ludwik K


    Precerebellins (Cbln) belong to the C1q/TNF superfamily of secreted proteins which have diverse functions. They are abundantly expressed in the cerebellum, however, three of them are also expressed in the rat adrenal gland. All members of the Cbln family form homomeric and heteromeric complexes with each other in vitro and it was suggested that such complexes play a crucial role in normal development of the cerebellum. The aim of our study was to investigate whether Cbln1-derived peptides, cerebellin (CER) and des-Ser1-cerebellin (desCER) are involved in regulating biological functions of rat adrenocortical cells. In the primary culture of rat adrenocortical cells, 24 h exposure to CER or desCER notably stimulated corticosterone output and inhibited proliferative activity and similar effects were evoked by ACTH. To study gene transcript regulation by CER, desCER and ACTH, we applied Oligo GEArray DNA Microarray: Rat Signal Transduction Pathway Finder. In relation to the control culture, 13 of the 113 transcripts present on the array were differentially expressed. These transcripts were either up- or down-regulated by ACTH and/or CER or desCER treatment. Validation of DNA Microarray data by QPCR revealed that only 5 of 13 genes studied were differentially expressed. Of those genes, Fos and Icam1 were up-regulated and Egr1 was down-regulated by ACTH, CER and desCER. The remaining two genes, Fasn (insulin signaling pathway) and Hspb1 (HSP27) (stress signaling pathway), were regulated only by CER and desCER, but not by ACTH. Thus, both CER and desCER have effects similar to and different from corticotrophin on the intracellular signaling pathway gene expression in cultured rat adrenocortical cells.

  18. The Conserved Arginine Cluster in the Insert of the Third Cytoplasmic Loop of the Long Form of the D2 Dopamine Receptor (D2L-R) Acts as an Intracellular Retention Signal

    PubMed Central

    Kubale, Valentina; Blagotinšek, Kaja; Nøhr, Jane; Eidne, Karin A.; Vrecl, Milka


    This study examined whether the conserved arginine cluster present within the 29-amino acid insert of the long form of the D2 dopamine receptor (D2L-R) confers its predominant intracellular localization. We hypothesized that the conserved arginine cluster (RRR) located within the insert could act as an RXR-type endoplasmic reticulum (ER) retention signal. Arginine residues (R) within the cluster at positions 267, 268, and 269 were charge-reserved to glutamic acids (E), either individually or in clusters, thus generating single, double, and triple D2L-R mutants. Through analyses of cellular localization by confocal microscopy and enzyme-linked immunosorbent assay (ELISA), radioligand binding assay, bioluminescence resonance energy transfer (BRET2) β-arrestin 2 (βarr2) recruitment assay, and cAMP signaling, it was revealed that charge reversal of the R residues at all three positions within the motif impaired their colocalization with ER marker calnexin and led to significantly improved cell surface expression. Additionally, these data demonstrate that an R to glutamic acid (E) substitution at position 2 within the RXR motif is not functionally permissible. Furthermore, all generated D2L-R mutants preserved their functional integrity regarding ligand binding, agonist-induced βarr2 recruitment and Gαi-mediated signaling. In summary, our results show that the conserved arginine cluster within the 29-amino acid insert of third cytoplasmic loop (IC3) of the D2L-R appears to be the ER retention signal. PMID:27447620

  19. Intra-day signal instabilities affect decoding performance in an intracortical neural interface system

    NASA Astrophysics Data System (ADS)

    Perge, János A.; Homer, Mark L.; Malik, Wasim Q.; Cash, Sydney; Eskandar, Emad; Friehs, Gerhard; Donoghue, John P.; Hochberg, Leigh R.


    Objective. Motor neural interface systems (NIS) aim to convert neural signals into motor prosthetic or assistive device control, allowing people with paralysis to regain movement or control over their immediate environment. Effector or prosthetic control can degrade if the relationship between recorded neural signals and intended motor behavior changes. Therefore, characterizing both biological and technological sources of signal variability is important for a reliable NIS. Approach. To address the frequency and causes of neural signal variability in a spike-based NIS, we analyzed within-day fluctuations in spiking activity and action potential amplitude recorded with silicon microelectrode arrays implanted in the motor cortex of three people with tetraplegia (BrainGate pilot clinical trial, IDE). Main results. 84% of the recorded units showed a statistically significant change in apparent firing rate (3.8 ± 8.71 Hz or 49% of the mean rate) across several-minute epochs of tasks performed on a single session, and 74% of the units showed a significant change in spike amplitude (3.7 ± 6.5 µV or 5.5% of mean spike amplitude). 40% of the recording sessions showed a significant correlation in the occurrence of amplitude changes across electrodes, suggesting array micro-movement. Despite the relatively frequent amplitude changes, only 15% of the observed within-day rate changes originated from recording artifacts such as spike amplitude change or electrical noise, while 85% of the rate changes most likely emerged from physiological mechanisms. Computer simulations confirmed that systematic rate changes of individual neurons could produce a directional ‘bias’ in the decoded neural cursor movements. Instability in apparent neuronal spike rates indeed yielded a directional bias in 56% of all performance assessments in participant cursor control (n = 2 participants, 108 and 20 assessments over two years), resulting in suboptimal performance in these sessions

  20. Menstrual cycle and reproductive aging alters immune reactivity, NGF expression, antioxidant enzyme activities, and intracellular signaling pathways in the peripheral blood mononuclear cells of healthy women.


    Priyanka, Hannah P; Sharma, Utsav; Gopinath, Srinivasan; Sharma, Varun; Hima, Lalgi; ThyagaRajan, Srinivasan


    Reproductive senescence in women is a process that begins with regular menstrual cycles and culminates in menopause followed by gradual development of diseases such as autoimmune diseases, osteoporosis, neurodegenerative diseases, and hormone-dependent cancers. The age-associated impairment in the functions of neuroendocrine system and immune system results in menopause which contributes to subsequent development of diseases and cancer. The aim of this study is to characterize the alterations in immune responses, compensatory factors such as nerve growth factor (NGF) and antioxidant enzyme activities, and the molecular mechanisms of actions in the peripheral blood mononuclear cells (PBMCs) of young (follicular and luteal phases), middle-aged, and old healthy women. Peripheral blood mononuclear cells were isolated from young women in follicular and luteal phases of the menstrual cycle (n=20; 22.6±2.9 yrs), middle-aged women (n=19; 47.1±3.8 yrs; perimenopausal) and old (n=16; 63.2±4.7 yrs; post-menopausal) women and analyzed for Concanavalin (Con A)-induced proliferation of lymphocytes and cytokine (IL-2 and IFN-γ) production, expression of NGF, p-NF-κB, p-ERK, p-CREB, and p-Akt, antioxidant enzymes [superoxide dismutase (SOD), catalase, and glutathione peroxidase (GPx), glutathione-S-transferase (GST)], extent of lipid peroxidation, and nitric oxide (NO) production. Serum gonadal hormones (17β-estradiol and progesterone) were also measured. A characteristic age- and menstrual cycle-related change was observed in the serum gonadal hormone secretion (estrogen and progesterone), T lymphocyte proliferation and IFN-γ production. Salient features include the age-related decline observed in target-derived growth factors (lymphocyte NGF expression), signaling molecules (p-ERK/ERK and p-CREB/CREB ratios) and compensatory factors such as the activities of plasma and PBMC antioxidant enzymes (SOD and catalase) and NO production. Further, an age-associated increase in p

  1. Estrogen modulates neural-immune interactions through intracellular signaling pathways and antioxidant enzyme activity in the spleen of middle-aged ovariectomized female rats.


    Kale, Prathamesh; Mohanty, Aparna; Patil, Anushree; Mishra, Miti; Pratap, Uday P; Priyanka, Hannah P; ThyagaRajan, Srinivasan


    Modulation of neural-immune interactions by estrogen in the spleens of ovariectomized (OVX) middle-aged female rats was examined. Con A-induced lymphoproliferation, splenic tyrosine hydroxylase (TH) and nerve growth factor (NGF) expression, levels of p-ERK 1/2, p-CREB, and p-Akt, and activity of superoxide dismutase decreased in OVX rats while estrogen treatment enhanced their expression, levels, and activity. Also, estrogen treatment enhanced Con A-induced IFN-γ production and decreased Con A-induced IL-2 production compared to OVX animals. In contrast, estrogen increased the extent of lipid peroxidation and protein carbonyl formation while OVX induced a decline in protein carbonyl formation. These results suggest that estrogen enhances neural-immune interactions while simultaneously affecting it through generation of free radicals as reflected by increased lipid peroxidation and protein carbonyl formation.

  2. Intracellular signal transduction pathways in the regulation of fowl sperm motility: evidence for the involvement of phosphatidylinositol 3-kinase (PI3-K) cascade.


    Ashizawa, Koji; Omura, Yusuke; Katayama, Seiichi; Tatemoto, Hideki; Narumi, Kazunori; Tsuzuki, Yasuhiro


    The possible role of PI3-K in the reversible temperature-dependent immobilization of fowl sperm motility was investigated by using PI3-K inhibitor (LY294002) and its inactive analogue (LY303511). The existence of the PI3-K in fowl spermatozoa was also confirmed by Western blotting analysis. Fowl sperm motility in TES/NaCl buffer remained negligible at the avian body temperature of 40 degrees C but was maintained vigorously when the temperature was decreased to 30 degrees C. At 30 degrees C, no stimulation or inhibition of motility was observed after the addition of 2 mM CaCl2 and 10 microM LY294002 or LY303511: around 70-80% of spermatozoa remained motile. In contrast, at 40 degrees C, the motility of spermatozoa was activated immediately after the addition of Ca(2+), but the subsequent addition of LY294002 inhibited the motility again. The addition of LY303511 did not appreciably affect the Ca(2+)-supplemented sperm motility, which was maintained for at least 15 min. The ATP concentrations of spermatozoa after the addition of LY294002 + Ca(2+) or LY303511 + Ca(2+) were almost the same values compared with those of Ca(2+) alone at 40 degrees C, suggesting that the addition of LY294002 was not simply affecting membrane damage or inhibiting energy production in the spermatozoa, but may be acting on some part of the motility-regulating cascade. Immunoblotting of sperm extract using an antibody to PI3-K revealed a major cross-reacting protein of 85 kDa, which corresponds to the molecular weight of the subunit of PI3-K. These results suggest that PI3-K may be positively involved in the calcium-regulated maintenance of flagellar movement of fowl spermatozoa at 40 degrees C.

  3. The macrophage galactose-type lectin-1 (MGL1) recognizes Taenia crassiceps antigens, triggers intracellular signaling, and is critical for resistance to this infection.


    Montero-Barrera, Daniel; Valderrama-Carvajal, Héctor; Terrazas, César A; Rojas-Hernández, Saúl; Ledesma-Soto, Yadira; Vera-Arias, Laura; Carrasco-Yépez, Maricela; Gómez-García, Lorena; Martínez-Saucedo, Diana; Becerra-Díaz, Mireya; Terrazas, Luis I


    C-type lectins are multifunctional sugar-binding molecules expressed on dendritic cells (DCs) and macrophages that internalize antigens for processing and presentation. Macrophage galactose-type lectin 1 (MGL1) recognizes glycoconjugates expressing Lewis X structures which contain galactose residues, and it is selectively expressed on immature DCs and macrophages. Helminth parasites contain large amounts of glycosylated components, which play a role in the immune regulation induced by such infections. Macrophages from MGL1(-/-) mice showed less binding ability toward parasite antigens than their wild-type (WT) counterparts. Exposure of WT macrophages to T. crassiceps antigens triggered tyrosine phosphorylation signaling activity, which was diminished in MGL1(-/-) macrophages. Following T. crassiceps infection, MGL1(-/-) mice failed to produce significant levels of inflammatory cytokines early in the infection compared to WT mice. In contrast, MGL1(-/-) mice developed a Th2-dominant immune response that was associated with significantly higher parasite loads, whereas WT mice were resistant. Flow cytometry and RT-PCR analyses showed overexpression of the mannose receptors, IL-4Rα, PDL2, arginase-1, Ym1, and RELM-α on MGL1(-/-) macrophages. These studies indicate that MGL1 is involved in T. crassiceps recognition and subsequent innate immune activation and resistance.

  4. The Macrophage Galactose-Type Lectin-1 (MGL1) Recognizes Taenia crassiceps Antigens, Triggers Intracellular Signaling, and Is Critical for Resistance to This Infection

    PubMed Central

    Montero-Barrera, Daniel; Valderrama-Carvajal, Héctor; Terrazas, César A.; Rojas-Hernández, Saúl; Ledesma-Soto, Yadira; Vera-Arias, Laura; Carrasco-Yépez, Maricela; Gómez-García, Lorena; Martínez-Saucedo, Diana; Becerra-Díaz, Mireya; Terrazas, Luis I.


    C-type lectins are multifunctional sugar-binding molecules expressed on dendritic cells (DCs) and macrophages that internalize antigens for processing and presentation. Macrophage galactose-type lectin 1 (MGL1) recognizes glycoconjugates expressing Lewis X structures which contain galactose residues, and it is selectively expressed on immature DCs and macrophages. Helminth parasites contain large amounts of glycosylated components, which play a role in the immune regulation induced by such infections. Macrophages from MGL1−/− mice showed less binding ability toward parasite antigens than their wild-type (WT) counterparts. Exposure of WT macrophages to T. crassiceps antigens triggered tyrosine phosphorylation signaling activity, which was diminished in MGL1−/− macrophages. Following T. crassiceps infection, MGL1−/− mice failed to produce significant levels of inflammatory cytokines early in the infection compared to WT mice. In contrast, MGL1−/− mice developed a Th2-dominant immune response that was associated with significantly higher parasite loads, whereas WT mice were resistant. Flow cytometry and RT-PCR analyses showed overexpression of the mannose receptors, IL-4Rα, PDL2, arginase-1, Ym1, and RELM-α on MGL1−/− macrophages. These studies indicate that MGL1 is involved in T. crassiceps recognition and subsequent innate immune activation and resistance. PMID:25664320

  5. Low-dose radiation affects cardiac physiology: gene networks and molecular signaling in cardiomyocytes

    PubMed Central

    Coleman, Matthew A.; Sasi, Sharath P.; Onufrak, Jillian; Natarajan, Mohan; Manickam, Krishnan; Schwab, John; Muralidharan, Sujatha; Peterson, Leif E.; Alekseyev, Yuriy O.; Yan, Xinhua


    There are 160,000 cancer patients worldwide treated with particle radiotherapy (RT). With the advent of proton, and high (H) charge (Z) and energy (E) HZE ionizing particle RT, the cardiovascular diseases risk estimates are uncertain. In addition, future deep space exploratory-type missions will expose humans to unknown but low doses of particle irradiation (IR). We examined molecular responses using transcriptome profiling in left ventricular murine cardiomyocytes isolated from mice that were exposed to 90 cGy, 1 GeV proton (1H) and 15 cGy, 1 GeV/nucleon iron (56Fe) over 28 days after exposure. Unsupervised clustering analysis of gene expression segregated samples according to the IR response and time after exposure, with 56Fe-IR showing the greatest level of gene modulation. 1H-IR showed little differential transcript modulation. Network analysis categorized the major differentially expressed genes into cell cycle, oxidative responses, and transcriptional regulation functional groups. Transcriptional networks identified key nodes regulating expression. Validation of the signal transduction network by protein analysis and gel shift assay showed that particle IR clearly regulates a long-lived signaling mechanism for ERK1/2, p38 MAPK signaling and identified NFATc4, GATA4, STAT3, and NF-κB as regulators of the response at specific time points. These data suggest that the molecular responses and gene expression to 56Fe-IR in cardiomyocytes are unique and long-lasting. Our study may have significant implications for the efforts of National Aeronautics and Space Administration to develop heart disease risk estimates for astronauts and for patients receiving conventional and particle RT via identification of specific HZE-IR molecular markers. PMID:26408534

  6. Low-dose radiation affects cardiac physiology: gene networks and molecular signaling in cardiomyocytes.


    Coleman, Matthew A; Sasi, Sharath P; Onufrak, Jillian; Natarajan, Mohan; Manickam, Krishnan; Schwab, John; Muralidharan, Sujatha; Peterson, Leif E; Alekseyev, Yuriy O; Yan, Xinhua; Goukassian, David A


    There are 160,000 cancer patients worldwide treated with particle radiotherapy (RT). With the advent of proton, and high (H) charge (Z) and energy (E) HZE ionizing particle RT, the cardiovascular diseases risk estimates are uncertain. In addition, future deep space exploratory-type missions will expose humans to unknown but low doses of particle irradiation (IR). We examined molecular responses using transcriptome profiling in left ventricular murine cardiomyocytes isolated from mice that were exposed to 90 cGy, 1 GeV proton ((1)H) and 15 cGy, 1 GeV/nucleon iron ((56)Fe) over 28 days after exposure. Unsupervised clustering analysis of gene expression segregated samples according to the IR response and time after exposure, with (56)Fe-IR showing the greatest level of gene modulation. (1)H-IR showed little differential transcript modulation. Network analysis categorized the major differentially expressed genes into cell cycle, oxidative responses, and transcriptional regulation functional groups. Transcriptional networks identified key nodes regulating expression. Validation of the signal transduction network by protein analysis and gel shift assay showed that particle IR clearly regulates a long-lived signaling mechanism for ERK1/2, p38 MAPK signaling and identified NFATc4, GATA4, STAT3, and NF-κB as regulators of the response at specific time points. These data suggest that the molecular responses and gene expression to (56)Fe-IR in cardiomyocytes are unique and long-lasting. Our study may have significant implications for the efforts of National Aeronautics and Space Administration to develop heart disease risk estimates for astronauts and for patients receiving conventional and particle RT via identification of specific HZE-IR molecular markers.

  7. Recurrent somatic mutations affecting B-cell receptor signaling pathway genes in follicular lymphoma

    PubMed Central

    Matlock, Matthew; Trani, Lee; Fronick, Catrina C.; Fulton, Robert S.; Kreisel, Friederike; Cashen, Amanda F.; Carson, Kenneth R.; Bartlett, Nancy L.


    Follicular lymphoma (FL) is the most common form of indolent non-Hodgkin lymphoma, yet it remains only partially characterized at the genomic level. To improve our understanding of the genetic underpinnings of this incurable and clinically heterogeneous disease, whole-exome sequencing was performed on tumor/normal pairs from a discovery cohort of 24 patients with FL. Using these data and mutations identified in other B-cell malignancies, 1716 genes were sequenced in 113 FL tumor samples from 105 primarily treatment-naive individuals. We identified 39 genes that were mutated significantly above background mutation rates. CREBBP mutations were associated with inferior PFS. In contrast, mutations in previously unreported HVCN1, a voltage-gated proton channel-encoding gene and B-cell receptor signaling modulator, were associated with improved PFS. In total, 47 (44.8%) patients harbor mutations in the interconnected B-cell receptor (BCR) and CXCR4 signaling pathways. Histone gene mutations were more frequent than previously reported (identified in 43.8% of patients) and often co-occurred (17.1% of patients). A novel, recurrent hotspot was identified at a posttranslationally modified residue in the histone H2B family. This study expands the number of mutated genes described in several known signaling pathways and complexes involved in lymphoma pathogenesis (BCR, Notch, SWitch/sucrose nonfermentable (SWI/SNF), vacuolar ATPases) and identified novel recurrent mutations (EGR1/2, POU2AF1, BTK, ZNF608, HVCN1) that require further investigation in the context of FL biology, prognosis, and treatment. PMID:28064239

  8. Sub-toxic nicotine concentrations affect extracellular matrix and growth factor signaling gene expressions in human osteoblasts.


    Marinucci, Lorella; Bodo, Maria; Balloni, Stefania; Locci, Paola; Baroni, Tiziano


    Exposure to nicotine and other compounds contained in cigarette smoking affects human health. This study examined the effects of exposure to a single or multiple sub-toxic nicotine concentrations on human osteoblasts. Cell growth and expression of genes involved in bone differentiation, extracellular matrix (ECM) metabolism, and growth factor signaling pathways were investigated in nicotine-treated cells compared to untreated cells. Depending on osteoblast concentration and maturation stages, nicotine differently regulated cell growth. Real-time PCR showed regulated expressions of genes expressed by nicotine-treated osteoblasts compared to untreated cells. Among ECM genes, type I collagen was down-regulated and osteonectin was up-regulated in nicotine-treated osteoblasts; similarly, fibroblast growth factor-1 (FGF1) and fibroblast growth factor-2 (FGF2), two members of FGF signaling system, were discordantly modulated; genes involved in osteoblast maturation and differentiation such as alkaline phosphatase (ALP), runt-related transcription factor-2 (RUNX2), and bone sialoprotein (BSP) were over-expressed after drug treatment. Our results show a positive association between nicotine exposure and osteoblast phenotype and illustrate for the first time a mechanism whereby acute or chronic exposure to sub-toxic nicotine concentrations may affect bone formation through the impairment of growth factor signaling system and ECM metabolism.

  9. Low power laser irradiation does not affect the generation of signals in a sensory receptor

    SciTech Connect

    Lundeberg, T.; Zhou, J.


    The effect of low power Helium-Neon (He-Ne) and Gallium-Arsenide (Ga-As) laser on the slowly adapting crustacean stretch receptor was studied. The results showed that low power laser irradiation did not affect the membrane potential of the stretch receptor. These results are discussed in relation to the use of low power laser irradiation on the skin overlaying acupuncture points in treatment of pain syndrome.

  10. p38 mitogen-activated protein kinase-dependent and -independent intracellular signal transduction pathways leading to apoptosis in human neutrophils.


    Frasch, S C; Nick, J A; Fadok, V A; Bratton, D L; Worthen, G S; Henson, P M


    Human neutrophils undergo apoptosis spontaneously when cultured in vitro; however, the signal transduction pathways involved remain largely unknown. In some cell types, c-Jun NH2-terminal kinase and p38 mitogen-activated protein kinase (MAPK) have been implicated in the pathways leading to stress-induced apoptosis. In this study, we begin to define two pathways leading to apoptosis in the neutrophil induced either by stress stimuli (UV, hyperosmolarity, sphingosine) or by anti-Fas antibody or overnight culture in vitro (spontaneous apoptosis). Apoptosis induced by stress stimuli activated p38 MAPK, and apoptosis was inhibited by the specific p38 MAPK inhibitor, 6-(4-Fluorophenyl)-2.3-dihydro-5-(4-puridinyl)imidazo(2, 1-beta)thiazole dihydrochloride. Furthermore, differentiation of HL-60 cells toward the neutrophil phenotype resulted in a loss in c-Jun NH2-terminal kinase activation with concomitant acquisition of formylmethionylleucylphenylalanine-stimulatable and stress-inducible p38 MAPK activity as well as apoptosis blockade by the p38 MAPK inhibitor. In contrast, anti-Fas-induced or spontaneous apoptosis occurred independent of p38 MAPK activation and was not blocked by the inhibitor. Both pathways appear to utilize member(s) of the caspase family, since pretreatment with either Val-Ala-Asp-fluoromethyl ketone or Asp-Glu-Val-Asp-fluoromethyl ketone inhibited apoptosis induced by each of the stimuli. We propose the presence of at least two pathways leading to apoptosis in human neutrophils, a stress-activated pathway that is dependent on p38 MAPK activation and an anti-FAS/spontaneous pathway that is p38 MAPK-independent.

  11. Conserved Anti-Müllerian Hormone: Anti-Müllerian Hormone Type-2 Receptor Specific Interaction and Intracellular Signaling in Teleosts.


    Rocha, Ana; Zanuy, Silvia; Gómez, Ana


    In higher vertebrates, anti-Müllerian hormone (AMH) is required for Müllerian duct regression in fetal males. AMH is also produced during postnatal life in both sexes regulating steroidogenesis and early stages of folliculogenesis. Teleosts lack Müllerian ducts, but Amh has been identified in several species including European sea bass. However, information on Amh type-2 receptor (Amhr2), the specific receptor for Amh binding, is restricted to a couple of fish species. Here, we report on cloning sea bass amhr2, the production of a recombinant sea bass Amh, and the functional analysis of this ligand-receptor couple. Phylogenetic analysis revealed that sea bass amhr2 segregates with Amhr2 from other vertebrates. This piscine receptor is capable of activating Smad proteins. Antibodies raised against sea bass Amh were used to study native and recombinant Amh, revealing proteins in the range of 66-70 kDa corresponding to the full length Amh. Once proteolytically treated, recombinant sea bass Amh generates a 12 kDa C-terminal mature protein, suggesting that contrary to what has been described for other fish Amh proteins, this protein is processed in a similar way as mammalian AMH. The mature sea bass Amh is a biologically active protein able to bind sea bass Amhr2 and, surprisingly, also human AMHR2. In prepubertal sea bass testes, Amh was detected by immunohistochemistry mostly in Sertoli cells surrounding early germ-cell generations. During spermatogenesis, a weaker staining signal could be observed in Sertoli cells surrounding spermatocytes.

  12. The atypical N-glycosylation motif, Asn-Cys-Cys, in human GPR109A is required for normal cell surface expression and intracellular signaling.


    Yasuda, Daisuke; Imura, Yuki; Ishii, Satoshi; Shimizu, Takao; Nakamura, Motonao


    Asparagine-linked glycosylation (N-glycosylation) is necessary for the proper folding of secreted and membrane proteins, including GPCRs. Thus, many GPCRs possess the N-glycosylation motif Asn-X-Ser/Thr at their N-termini and/or extracellular loops. We found that human GPR109A (hGPR109A) has an N-glycosylation site at Asn(17) in the N-terminal atypical motif, Asn(17)-Cys(18)-Cys(19). Why does hGPR109A require the atypical motif, rather than the typical sequence? Here we show that Asn(17)-Cys(18)-Cys(19) sequence of hGPR109A possesses 2 biologic roles. First, Asn(17)-X-Cys(19) contributed to hGPR109A N-glycosylation by acting as an atypical motif. This modification is required for the normal surface expression of hGPR109A, as evidenced by the reduced surface expression of the nonglycosylated mutants, hGPR109A/N17A, and the finding that hGPR109A/C19S and hGPR109A/C19T, which are N-glycosylated at Asn(17), exhibited expression similar to the wild-type receptor. Second, the X-Cys(18)-Cys(19) dicysteine is indispensable for hGPR109A function. Substitution of Cys(18) or Cys(19) residue to Ala impaired Gi-mediated signaling via hGPR109A. We propose the disulfide bond formations of these residues with other Cys existed in the extracellular loops for the proper folding. Together, these results suggest that the atypical motif Asn(17)-Cys(18)-Cys(19) is crucial for the normal surface trafficking and function of hGPR109A.

  13. UDP-glucose is a potential intracellular signal molecule in the control of expression of sigma S and sigma S-dependent genes in Escherichia coli.

    PubMed Central

    Böhringer, J; Fischer, D; Mosler, G; Hengge-Aronis, R


    The sigma S subunit of RNA polymerase is the master regulator of a regulatory network that controls stationary-phase induction as well as osmotic regulation of many genes in Escherichia coli. In an attempt to identify additional regulatory components in this network, we have isolated Tn10 insertion mutations that in trans alter the expression of osmY and other sigma S-dependent genes. One of these mutations conferred glucose sensitivity and was localized in pgi (encoding phosphoglucose isomerase). pgi::Tn10 strains exhibit increased basal levels of expression of osmY and otsBA in exponentially growing cells and reduced osmotic inducibility of these genes. A similar phenotype was also observed for pgm and galU mutants, which are deficient in phosphoglucomutase and UDP-glucose pyrophosphorylase, respectively. This indicates that the observed effects on gene expression are related to the lack of UDP-glucose (or a derivative thereof), which is common to all three mutants. Mutants deficient in UDP-galactose epimerase (galE mutants) and trehalose-6-phosphate synthase (otsA mutants) do not exhibit such an effect on gene expression, and an mdoA mutant that is deficient in the first step of the synthesis of membrane-derived oligosaccharides, shows only a partial increase in the expression of osmY. We therefore propose that the cellular content of UDP-glucose serves as an internal signal that controls expression of osmY and other sigma S-dependent genes. In addition, we demonstrate that pgi, pgm, and galU mutants contain increased levels of sigma S during steady-state growth, indicating that UDP-glucose interferes with the expression of sigma S itself. PMID:7814331

  14. The Intracellular Signaling Molecule Darpp-32 Is a Marker for Principal Neurons in the Cerebellum and Cerebellum-Like Circuits of Zebrafish

    PubMed Central

    Robra, Lena; Thirumalai, Vatsala


    The dopamine and cAMP regulated phosphoprotein of apparent molecular weight 32 kDa (Darpp-32) is an inhibitory subunit of protein phosphatase-1 (PP-1). Darpp-32 activity is regulated by multiple ligand-activated G-protein coupled receptors (GPCRs). This protein is coded for by the protein phosphatase-1 regulatory subunit 1b (ppp1r1b) gene. Here, we provide experimental evidence for the presence of multiple isoforms of ppp1r1b in zebrafish. We show that these isoforms are differentially expressed during development with the full-length isoform being maternally deposited. Next, with a custom polyclonal antibody generated against the full-length protein, we show that in the adult, Darpp-32 is strongly expressed in principal neurons of the cerebellum and cerebellum-like circuits. These include Purkinje neurons in the cerebellum, Type-I neurons in the optic tectum, and crest cells in the medial octavolateralis nucleus (MON). We confirmed the identity of these neurons through their colocalization with Parvalbumin 7 immunoreactivity. Darpp-32 is seen in the somata and dendrites of these neurons with faint staining in the axons. In all of these regions, Darpp-32-immunoreactive cells were in close proximity to tyrosine hydroxylase (TH) immunoreactive puncta indicating the presence of direct catecholaminergic input to these neurons. Darpp-32 immunoreactivity was seen in Purkinje neurons as early as 3 days post-fertilization (dpf) when Purkinje neurons are first specified. In sum, we show that Darpp-32, a signaling integrator, is a specific marker of principal neurons in the cerebellum and cerebellum-like circuits in zebrafish. PMID:27540357

  15. Crosstalk events in the estrogen signaling pathway may affect tamoxifen efficacy in breast cancer molecular subtypes.


    de Anda-Jáuregui, Guillermo; Mejía-Pedroza, Raúl A; Espinal-Enríquez, Jesús; Hernández-Lemus, Enrique


    Steroid hormones are involved on cell growth, development and differentiation. Such effects are often mediated by steroid receptors. One paradigmatic example of this coupling is the estrogen signaling pathway. Its dysregulation is involved in most tumors of the mammary gland. It is thus an important pharmacological target in breast cancer. This pathway, however, crosstalks with several other molecular pathways, a fact that may have consequences for the effectiveness of hormone modulating drug therapies, such as tamoxifen. For this work, we performed a systematic analysis of the major routes involved in crosstalk phenomena with the estrogen pathway - based on gene expression experiments (819 samples) and pathway analysis (493 samples) - for biopsy-captured tissue and contrasted in two independent datasets with in vivo and in vitro pharmacological stimulation. Our results confirm the presence of a number of crosstalk events across the estrogen signaling pathway with others that are dysregulated in different molecular subtypes of breast cancer. These may be involved in proliferation, invasiveness and apoptosis-evasion in patients. The results presented may open the way to new designs of adjuvant and neoadjuvant therapies for breast cancer treatment.

  16. Paracrine Met signaling triggers epithelial–mesenchymal transition in mammary luminal progenitors, affecting their fate

    PubMed Central

    Di-Cicco, Amandine; Petit, Valérie; Chiche, Aurélie; Bresson, Laura; Romagnoli, Mathilde; Orian-Rousseau, Véronique; Vivanco, Maria dM; Medina, Daniel; Faraldo, Marisa M; Glukhova, Marina A; Deugnier, Marie-Ange


    HGF/Met signaling has recently been associated with basal-type breast cancers, which are thought to originate from progenitor cells residing in the luminal compartment of the mammary epithelium. We found that ICAM-1 efficiently marks mammary luminal progenitors comprising hormone receptor-positive and receptor-negative cells, presumably ductal and alveolar progenitors. Both cell populations strongly express Met, while HGF is produced by stromal and basal myoepithelial cells. We show that persistent HGF treatment stimulates the clonogenic activity of ICAM1-positive luminal progenitors, controlling their survival and proliferation, and leads to the expression of basal cell characteristics, including stem cell potential. This is accompanied by the induction of Snai1 and Snai2, two major transcription factors triggering epithelial–mesenchymal transition, the repression of the luminal-regulatory genes Elf5 and Hey1, and claudin down-regulation. Our data strongly indicate that paracrine Met signaling can control the function of luminal progenitors and modulate their fate during mammary development and tumorigenesis. DOI: PMID:26165517

  17. Transcriptome Changes Affecting Hedgehog and Cytokine Signalling in the Umbilical Cord: Implications for Disease Risk

    PubMed Central

    Stünkel, Walter; Tng, Emilia; Tan, Jun Hao; Chen, Li; Joseph, Roy; Cheong, Clara Y.; Ong, Mei-Lyn; Lee, Yung Seng; Chong, Yap-Seng; Saw, Seang Mei; Meaney, Michael J.; Kwek, Kenneth; Sheppard, Allan M.; Gluckman, Peter D.; Holbrook, Joanna D.


    Background Babies born at lower gestational ages or smaller birthweights have a greater risk of poorer health in later life. Both the causes of these sub-optimal birth outcomes and the mechanism by which the effects are transmitted over decades are the subject of extensive study. We investigated whether a transcriptomic signature of either birthweight or gestational age could be detected in umbilical cord RNA. Methods The gene expression patterns of 32 umbilical cords from Singaporean babies of Chinese ethnicity across a range of birthweights (1698–4151 g) and gestational ages (35–41 weeks) were determined. We confirmed the differential expression pattern by gestational age for 12 genes in a series of 127 umbilical cords of Chinese, Malay and Indian ethnicity. Results We found that the transcriptome is substantially influenced by gestational age; but less so by birthweight. We show that some of the expression changes dependent on gestational age are enriched in signal transduction pathways, such as Hedgehog and in genes with roles in cytokine signalling and angiogenesis. We show that some of the gene expression changes we report are reflected in the epigenome. Conclusions We studied the umbilical cord which is peripheral to disease susceptible tissues. The results suggest that soma-wide transcriptome changes, preserved at the epigenetic level, may be a mechanism whereby birth outcomes are linked to the risk of adult metabolic and arthritic disease and suggest that greater attention be given to the association between premature birth and later disease risk. PMID:22808055

  18. Pin1-dependent signalling negatively affects GABAergic transmission by modulating neuroligin2/gephyrin interaction

    PubMed Central

    Antonelli, Roberta; Pizzarelli, Rocco; Pedroni, Andrea; Fritschy, Jean-Marc; Del Sal, Giannino; Cherubini, Enrico; Zacchi, Paola


    The cell adhesion molecule Neuroligin2 (NL2) is localized selectively at GABAergic synapses, where it interacts with the scaffolding protein gephyrin in the post-synaptic density. However, the role of this interaction for formation and plasticity of GABAergic synapses is unclear. Here, we demonstrate that endogenous NL2 undergoes proline-directed phosphorylation at its unique S714-P consensus site, leading to the recruitment of the peptidyl-prolyl cis–trans isomerase Pin1. This signalling cascade negatively regulates NL2’s ability to interact with gephyrin at GABAergic post-synaptic sites. As a consequence, enhanced accumulation of NL2, gephyrin and GABAA receptors was detected at GABAergic synapses in the hippocampus of Pin1-knockout mice (Pin1−/−) associated with an increase in amplitude of spontaneous GABAA-mediated post-synaptic currents. Our results suggest that Pin1-dependent signalling represents a mechanism to modulate GABAergic transmission by regulating NL2/gephyrin interaction. PMID:25297980

  19. Stimulation of PPC Affects the Mapping between Motion and Force Signals for Stiffness Perception But Not Motion Control

    PubMed Central

    Mawase, Firas; Karniel, Amir; Donchin, Opher; Rothwell, John; Nisky, Ilana; Davare, Marco


    How motion and sensory inputs are combined to assess an object's stiffness is still unknown. Here, we provide evidence for the existence of a stiffness estimator in the human posterior parietal cortex (PPC). We showed previously that delaying force feedback with respect to motion when interacting with an object caused participants to underestimate its stiffness. We found that applying theta-burst transcranial magnetic stimulation (TMS) over the PPC, but not the dorsal premotor cortex, enhances this effect without affecting movement control. We explain this enhancement as an additional lag in force signals. This is the first causal evidence that the PPC is not only involved in motion control, but also has an important role in perception that is disassociated from action. We provide a computational model suggesting that the PPC integrates position and force signals for perception of stiffness and that TMS alters the synchronization between the two signals causing lasting consequences on perceptual behavior. SIGNIFICANCE STATEMENT When selecting an object such as a ripe fruit or sofa, we need to assess the object's stiffness. Because we lack dedicated stiffness sensors, we rely on an as yet unknown mechanism that generates stiffness percepts by combining position and force signals. Here, we found that the posterior parietal cortex (PPC) contributes to combining position and force signals for stiffness estimation. This finding challenges the classical view about the role of the PPC in regulating position signals only for motion control because we highlight a key role of the PPC in perception that is disassociated from action. Altogether this sheds light on brain mechanisms underlying the interaction between action and perception and may help in the development of better teleoperation systems and rehabilitation of patients with sensory impairments. PMID:27733607

  20. Cell-cell and intracellular lactate shuttles.


    Brooks, George A


    Once thought to be the consequence of oxygen lack in contracting skeletal muscle, the glycolytic product lactate is formed and utilized continuously in diverse cells under fully aerobic conditions. 'Cell-cell' and 'intracellular lactate shuttle' concepts describe the roles of lactate in delivery of oxidative and gluconeogenic substrates as well as in cell signalling. Examples of the cell-cell shuttles include lactate exchanges between between white-glycolytic and red-oxidative fibres within a working muscle bed, and between working skeletal muscle and heart, brain, liver and kidneys. Examples of intracellular lactate shuttles include lactate uptake by mitochondria and pyruvate for lactate exchange in peroxisomes. Lactate for pyruvate exchanges affect cell redox state, and by itself lactate is a ROS generator. In vivo, lactate is a preferred substrate and high blood lactate levels down-regulate the use of glucose and free fatty acids (FFA). As well, lactate binding may affect metabolic regulation, for instance binding to G-protein receptors in adipocytes inhibiting lipolysis, and thus decreasing plasma FFA availability. In vitro lactate accumulation upregulates expression of MCT1 and genes coding for other components of the mitochondrial reticulum in skeletal muscle. The mitochondrial reticulum in muscle and mitochondrial networks in other aerobic tissues function to establish concentration and proton gradients necessary for cells with high mitochondrial densities to oxidize lactate. The presence of lactate shuttles gives rise to the realization that glycolytic and oxidative pathways should be viewed as linked, as opposed to alternative, processes, because lactate, the product of one pathway, is the substrate for the other.

  1. Cell–cell and intracellular lactate shuttles

    PubMed Central

    Brooks, George A


    Once thought to be the consequence of oxygen lack in contracting skeletal muscle, the glycolytic product lactate is formed and utilized continuously in diverse cells under fully aerobic conditions. ‘Cell–cell’ and ‘intracellular lactate shuttle’ concepts describe the roles of lactate in delivery of oxidative and gluconeogenic substrates as well as in cell signalling. Examples of the cell–cell shuttles include lactate exchanges between between white-glycolytic and red-oxidative fibres within a working muscle bed, and between working skeletal muscle and heart, brain, liver and kidneys. Examples of intracellular lactate shuttles include lactate uptake by mitochondria and pyruvate for lactate exchange in peroxisomes. Lactate for pyruvate exchanges affect cell redox state, and by itself lactate is a ROS generator. In vivo, lactate is a preferred substrate and high blood lactate levels down-regulate the use of glucose and free fatty acids (FFA). As well, lactate binding may affect metabolic regulation, for instance binding to G-protein receptors in adipocytes inhibiting lipolysis, and thus decreasing plasma FFA availability. In vitro lactate accumulation upregulates expression of MCT1 and genes coding for other components of the mitochondrial reticulum in skeletal muscle. The mitochondrial reticulum in muscle and mitochondrial networks in other aerobic tissues function to establish concentration and proton gradients necessary for cells with high mitochondrial densities to oxidize lactate. The presence of lactate shuttles gives rise to the realization that glycolytic and oxidative pathways should be viewed as linked, as opposed to alternative, processes, because lactate, the product of one pathway, is the substrate for the other. PMID:19805739

  2. Emotion affects action: Midcingulate cortex as a pivotal node of interaction between negative emotion and motor signals.


    Pereira, Mirtes Garcia; de Oliveira, Letícia; Erthal, Fátima Smith; Joffily, Mateus; Mocaiber, Izabela F; Volchan, Eliane; Pessoa, Luiz


    Affective pictures drive the activity of brain networks and impact behavior. We showed previously that viewing unpleasant pictures interfered in the performance of a basic nonemotional visual detection task. In the present study, we employed functional magnetic resonance imaging to test the hypothesis that behavioral interference may result from the interaction between negatively valenced and motor-related signals in the brain. As in our previous study (Pereira et al., 2006), participants performed a simple target detection task that followed the presentation of unpleasant or neutral pictures. Our results revealed that an unpleasant emotional context modulated evoked responses in several regions engaged by the simple target detection task. In particular, the midcingulate cortex was recruited when participants performed target detection trials during the unpleasant context, and signal responses in this region closely mirrored the pattern of behavioral interference (as revealed via reaction time). Our findings suggest that the midcingulate cortex may be an important site for the interaction between negatively valenced signals and motor signals in the brain and that it may be involved in the implementation of defensive responses, such as freezing.

  3. TNF-alpha/IFN-gamma-induced iNOS expression increased by prostaglandin E2 in rat primary astrocytes via EP2-evoked cAMP/PKA and intracellular calcium signaling.


    Hsiao, Han-Yun; Mak, Oi-Tong; Yang, Chung-Shi; Liu, Yu-Peng; Fang, Kuan-Ming; Tzeng, Shun-Fen


    Astrocytes, the most abundant glia in the central nervous system (CNS), produce a large amount of prostaglandin E(2) (PGE(2)) in response to proinflammatory mediators after CNS injury. However, it is unclear whether PGE(2) has a regulatory role in astrocytic activity under the inflamed condition. In the present work, we showed that PGE(2) increased inducible nitric oxide synthase (iNOS) production by tumor necrosis factor-alpha and interferon-gamma (T/I) in astrocytes. Pharmacological and RNA interference approaches further indicated the involvement of the receptor EP2 in PGE(2)-induced iNOS upregulation in T/I-treated astrocytes. Quantitative real-time polymerase chain reaction and gel mobility shift assays also demonstrated that PGE(2) increased iNOS transcription through EP2-induced cAMP/protein kinase A (PKA)-dependent pathway. Consistently, the effect of EP2 was significantly attenuated by the PKA inhibitor KT-5720 and partially suppressed by the inhibitor (SB203580) of p38 mitogen-activated protein kinase (p38MAPK), which serves as one of the downstream components of the PKA-dependent pathway. Interestingly, EP2-mediated PKA signaling appeared to increase intracellular Ca(2+) release through inositol triphosphate (IP3) receptor activation, which might in turn stimulate protein kinase C (PKC) activation to promote iNOS production in T/I-primed astrocytes. By analyzing the expression of astrocytic glial fibrillary acidic protein (GFAP), we found that PGE(2) alone only triggered the EP2-induced cAMP/PKA/p38MAPK signaling pathway in astrocytes. Collectively, PGE(2) may enhance T/I-induced astrocytic activation by augmenting iNOS/NO production through EP2-mediated cross-talk between cAMP/PKA and IP3/Ca(2+) signaling pathways.

  4. [The role of the class A scavenger receptors, SR-A and MARCO, in the immune system. Part 1. The structure of receptors, their ligand binding repertoires and ability to initiate intracellular signaling].


    Józefowski, Szczepan


    Recognition of pathogens by innate immune cells is mediated by pattern recognition receptors (PRR), which include scavenger receptors (SR). The class A SR, SR-A/CD204 and MARCO, are characterized by the presence of collagenous and SR cysteine-rich domains in their extracellular portions. Both receptors are expressed mainly on macrophages and dendritic cells. Thanks to their ability to bind to a wide range of polyanionic ligands, the class A SR may participate in numerous functions of these cells, such as endocytosis, and adhesion to extracellular matrix and to other cells. Among SR-A ligands are oxidized lipoproteins and β-amyloid fibrils, which link SR-A to the pathogenesis of arteriosclerosis and Alzheimer's disease. Despite the demonstration of class A SR involvement in so many processes, the lack of selective ligands precluded reaching definite conclusions concerning their signaling abilities. Using specific receptor ligation with antibodies, we showed that SR-A and MARCO trigger intracellular signaling, modulating pro-inflammatory and microbicidal activities of macrophages. Surprisingly, despite similarities in structure and ligand binding repertoires, SR-A and MARCO exert opposite effects on interleukin-12 (IL-12) production in macrophages. SR-A ligation also stimulated H₂O₂ and IL-10 production, but had no effect on the release of several other cytokines. These limited effects of specific SR-A ligation contrast with generalized enhancement of immune responses observed in SR-A-deficient mice. Recent studies have revealed that many of these effects of SR-A deficiency may be caused by compensatory changes in the expression of other receptors and/or disinhibition of signal transduction from receptors belonging to the Toll/IL-1R family, rather than by the loss of the receptor function of SR-A.

  5. Reelin Proteolysis Affects Signaling Related to Normal Synapse Function and Neurodegeneration

    PubMed Central

    Lussier, April L.; Weeber, Edwin J.; Rebeck, G. William


    Reelin is a neurodevelopmental protein important in adult synaptic plasticity and learning and memory. Recent evidence points to the importance for Reelin proteolysis in normal signaling and in cognitive function. Support for the dysfunction of Reelin proteolysis in neurodegeneration and cognitive dysfunction comes from postmortem analysis of Alzheimer’s diseases (AD) tissues including cerebral spinal fluid (CSF), showing that levels of Reelin fragments are altered in AD compared to control. Potential key proteases involved in Reelin proteolysis have recently been defined, identifying processes that could be altered in neurodegeneration. Introduction of full-length Reelin and its proteolytic fragments into several mouse models of neurodegeneration and neuropsychiatric disorders quickly promote learning and memory. These findings support a role for Reelin in learning and memory and suggest further understanding of these processes are important to harness the potential of this pathway in treating cognitive symptoms in neuropsychiatric and neurodegenerative diseases. PMID:27065802

  6. Historical contingency affects signaling strategies and competitive abilities in evolving populations of simulated robots.


    Wischmann, Steffen; Floreano, Dario; Keller, Laurent


    One of the key innovations during the evolution of life on earth has been the emergence of efficient communication systems, yet little is known about the causes and consequences of the great diversity within and between species. By conducting experimental evolution in 20 independently evolving populations of cooperatively foraging simulated robots, we found that historical contingency in the occurrence order of novel phenotypic traits resulted in the emergence of two distinct communication strategies. The more complex foraging strategy was less efficient than the simpler strategy. However, when the 20 populations were placed in competition with each other, the populations with the more complex strategy outperformed the populations with the less complex strategy. These results demonstrate a tradeoff between communication efficiency and robustness and suggest that stochastic events have important effects on signal evolution and the outcome of competition between distinct populations.

  7. Do GSM 900MHz signals affect cerebral blood circulation? A near-infrared spectrophotometry study

    NASA Astrophysics Data System (ADS)

    Wolf, Martin; Haensse, Daniel; Morren, Geert; Froehlich, Juerg


    Effects of GSM 900MHz signals (EMF) typical for a handheld mobile phone on the cerebral blood circulation were investigated using near-infrared spectrophotometry (NIRS) in a three armed (12W/kg, 1.2W/kg, sham), double blind, randomized crossover trial in 16 healthy volunteers. During exposure we observed borderline significant short term responses of oxyhemoglobin and deoxyhemoglobin concentration, which correspond to a decrease of cerebral blood flow and volume and were smaller than regular physiological changes. Due to the relatively high number of statistical tests, these responses may be spurious and require further studies. There was no detectable dose-response relation or long term response within 20min. The detection limit was a fraction of the regular physiological changes elicited by functional activation. Compared to previous studies using PET, NIRS provides a much higher time resolution, which allowed investigating the short term effects efficiently, noninvasively, without the use of radioactive tracers and with high sensitivity.

  8. Fibroblast growth factor signaling affects vascular outgrowth and is required for the maintenance of blood vessel integrity.


    De Smet, Frederik; Tembuyser, Bieke; Lenard, Anna; Claes, Filip; Zhang, Jie; Michielsen, Christof; Van Schepdael, Ann; Herbert, Jean-Marc; Bono, Françoise; Affolter, Markus; Dewerchin, Mieke; Carmeliet, Peter


    Angiogenesis contributes to the development of numerous disorders. Even though fibroblast growth factors (FGFs) were discovered as mediators of angiogenesis more than 30 years ago, their role in developmental angiogenesis still remains elusive. We use a recently described chemical probe, SSR128129E (SSR), that selectively inhibits the action of multiple FGF receptors (FGFRs), in combination with the zebrafish model to examine the role of FGF signaling in vascular development. We observe that while FGFR signaling is less important for vessel guidance, it affects vascular outgrowth and is especially required for the maintenance of blood vessel integrity by ensuring proper cell-cell junctions between endothelial cells. In conclusion, our work illustrates the power of a small molecule probe to reveal insights into blood vessel formation and stabilization and thus of broad interest to the vascular biology community.

  9. Amino-modified polystyrene nanoparticles affect signalling pathways of the sea urchin (Paracentrotus lividus) embryos.


    Pinsino, Annalisa; Bergami, Elisa; Della Torre, Camilla; Vannuccini, Maria Luisa; Addis, Piero; Secci, Marco; Dawson, Kenneth A; Matranga, Valeria; Corsi, Ilaria


    Polystyrene nanoparticles have been shown to pose serious risk to marine organisms including sea urchin embryos based on their surface properties and consequently behaviour in natural sea water. The aim of this study is to investigate the toxicity pathways of amino polystyrene nanoparticles (PS-NH2, 50 nm) in Paracentrotus lividus embryos in terms of development and signalling at both protein and gene levels. Two sub-lethal concentrations of 3 and 4 μg/mL of PS-NH2 were used to expose sea urchin embryos in natural sea water (PS-NH2 as aggregates of 143 ± 5 nm). At 24 and 48 h post-fertilisation (hpf) embryonic development was monitored and variations in the levels of key proteins involved in stress response and development (Hsp70, Hsp60, MnSOD, Phospho-p38 Mapk) as well as the modulation of target genes (Pl-Hsp70, Pl-Hsp60, Pl-Cytochrome b, Pl-p38 Mapk, Pl-Caspase 8, Pl-Univin) were measured. At 48 hpf various striking teratogenic effects were observed such as the occurrence of cells/masses randomly distributed, severe skeletal defects and delayed development. At 24 hpf a significant up-regulation of Pl-Hsp70, Pl-p38 Mapk, Pl-Univin and Pl-Cas8 genes was found, while at 48 hpf only for Pl-Univin was observed. Protein profile showed different patterns as a significant increase of Hsp70 and Hsp60 only after 48 hpf compared to controls. Conversely, P-p38 Mapk protein significantly increased at 24 hpf and decreased at 48 hpf. Our findings highlight that PS-NH2 are able to disrupt sea urchin embryos development by modulating protein and gene profile providing new understandings into the signalling pathways involved.

  10. Quorum sensing signals affect spoilage of refrigerated large yellow croaker (Pseudosciaena crocea) by Shewanella baltica.


    Zhu, Junli; Zhao, Aifei; Feng, Lifang; Gao, Haichun


    In this work we investigated the specific spoilage organism (SSO) of large yellow croaker (Pseudosciaena crocea) stored at 4°C and role of quorum sensing (QS) system of SSO isolated from the spoiled fish. According to microbial count and 16S rRNA gene of the isolated pure strains, Shewanella, mainly Shewanella baltica and Shewanella putrefaciens, was predominant genera at the end of shelf-life of P. crocea. Among Shewanella isolates, S.baltica02 was demonstrated as SSO in spoilage potential characteristics by inoculation into sterile fish juice using sensory and chemical analyses. Autoinducer 2 and two cyclic dipeptides (DKPs) including cyclo-(l-Pro-l-Leu) and cyclo-(l-Pro-l-Phe), no any AHLs, were detected in cell-free S. baltica culture. Interestingly, S.baltica02 had the highest QS activity among three spoilers of S. baltica. The production of biofilm, trimethylamines (TMA) and putrescine in these spoilers significantly increased in the presence of cyclo-(l-Pro-l-Leu), rather than cyclo-(l-Pro-l-Phe) and 4,5-dihydroxy-2,3-pentanedione (the AI-2 precursor, DPD). In accordance with the effect of signal molecules on the spoilage phenotype, exposure to exogenous cyclo-(l-Pro-l-Leu) was also showed to up-regulate the transcription levels of luxR, torA and ODC, and no effect of luxS indicated that S. baltica could sense cyclo-(l-Pro-l-Leu). In the fish homogenate, exogenous cyclo-(l-Pro-l-Leu) shortened lag phase durations and enhanced growth rates of the dominant bacteria, H2S producing bacteria, under refrigerated storage, while exogenous DPD retarded growth of competing bacteria, such as Enterobacteriaceae. Meanwhile, cyclo-(l-Pro-l-Leu) also promoted the accumulation of metabolites on the spoilage process of homogenate. S.baltica02 luxS mutant preliminarily proved that AI-2 might not play a signaling role in the spoilage. The present study suggested that the spoilage potential of S. baltica in P. crocea might be regulated by DKP-based quorum sensing.

  11. Berberine affects osteosarcoma via downregulating the caspase-1/IL-1β signaling axis

    PubMed Central

    Jin, Hao; Jin, Xin; Cao, Boran; Wang, Wenbo


    Osteosarcoma is one of the most devastating cancers with associated poor prognosis. Chronic bone inflammation frequently predisposes to tumorigenesis and progression of osteosarcoma. In the tumor inflammatory microenvironment, caspase-1 and its processed cytokines such as interleukin 1β (IL-1β) play an important role in the occurrence and development of cancer. Berberine is an isoquinoline alkaloid extracted from the dry root of Coptidis Rhizoma, which has been found to exhibit significant anticancer effects on a wide spectrum of carcinomas including osteosarcoma. However, the mechanisms underlying the anticancer effects of berberine in osteosarcoma remain poorly understood and their elucidation is critical for developing improved therapies. In the present study, we investigated the potential mechanism underlying the anticancer effect of berberine in osteosarcoma. We found that the expression of caspase-1 and its downstream target IL-1β were higher in osteosarcoma cells compared with normal cells both in vitro and in vivo. Furthermore, administration of berberine is capable of reducing the expression of caspase-1 and IL-1β in osteosarcoma cells and inhibiting the growth of tumor cells. Based on the above, for the first time, we propose the hyposis that berberine could gengerate an anti-osteosarcoma property through downregulating caspase-1/IL-1β inflammatory signaling axis. PMID:28000894

  12. Caffeine modulates tau phosphorylation and affects Akt signaling in postmitotic neurons.


    Currais, Antonio; Kato, Kiyoko; Canuet, Leonides; Ishii, Ryouhei; Tanaka, Toshihisa; Takeda, Masatoshi; Soriano, Salvador


    Neuronal cell cycle reentry, which is associated with aberrant tau phosphorylation, is thought to be a mechanism of neurodegeneration in AD. Caffeine is a neuroprotective drug known to inhibit the cell cycle, suggesting that its neuroprotective nature may rely, at least in part, on preventing tau abnormalities secondary to its inhibitory effect on neuronal cell cycle-related pathways. Accordingly, we have explored in the present study the impact of caffeine on cell cycle-linked parameters and tau phosphorylation patterns in an attempt to identify molecular clues to its neuroprotective effect. We show that caffeine blocks the cell cycle at G1 phase in neuroblastoma cells and leads to a decrease in tau phosphorylation; similarly, exposure of postmitotic neurons to caffeine led to changes in tau phosphorylation concomitantly with downregulation of Akt signaling. Taken together, our results show a unique impact of caffeine on tau phosphorylation and warrant further investigation to address whether caffeine may help prevent neuronal death by preventing tau abnormalities secondary to aberrant entry into the cell cycle.

  13. Integration of Ethylene and Light Signaling Affects Hypocotyl Growth in Arabidopsis

    PubMed Central

    Yu, Yanwen; Huang, Rongfeng


    As an ideal model for studying ethylene effects on cell elongation, Arabidopsis hypocotyl growth is widely used due to the unique characteristic that ethylene stimulates hypocotyl elongation in the light but inhibits it in the dark. Although the contrasting effect of ethylene on hypocotyl growth has long been known, the molecular basis of this effect has only gradually been identified in recent years. In the light, ethylene promotes the expression of PHYTOCHROME INTERACTING FACTOR 3 (PIF3) and the degradation of ELONGATED HYPOCOTYL 5 (HY5) protein, thus stimulating hypocotyl growth. In the dark, ETHYLENE RESPONSE FACTOR 1 (ERF1) and WAVE-DAMPENED 5 (WDL5) induced by ethylene are responsible for its inhibitory effect on hypocotyl elongation. Moreover, CONSTITUTIVE PHOTOMORPHOGENIC 1 (COP1) and PHYTOCHROME B (phyB) mediate the light-suppressed ethylene response in different ways. Here, we review several pivotal advances associated with ethylene-regulated hypocotyl elongation, focusing on the integration of ethylene and light signaling during seedling emergence from the soil. PMID:28174592

  14. Transgene expression patterns indicate that spaceflight affects stress signal perception and transduction in arabidopsis

    NASA Technical Reports Server (NTRS)

    Paul, A. L.; Daugherty, C. J.; Bihn, E. A.; Chapman, D. K.; Norwood, K. L.; Ferl, R. J.


    The use of plants as integral components of life support systems remains a cornerstone of strategies for long-term human habitation of space and extraterrestrial colonization. Spaceflight experiments over the past few decades have refined the hardware required to grow plants in low-earth orbit and have illuminated fundamental issues regarding spaceflight effects on plant growth and development. Potential incipient hypoxia, resulting from the lack of convection-driven gas movement, has emerged as a possible major impact of microgravity. We developed transgenic Arabidopsis containing the alcohol dehydrogenase (Adh) gene promoter linked to the beta-glucuronidase (GUS) reporter gene to address specifically the possibility that spaceflight induces the plant hypoxia response and to assess whether any spaceflight response was similar to control terrestrial hypoxia-induced gene expression patterns. The staining patterns resulting from a 5-d mission on the orbiter Columbia during mission STS-93 indicate that the Adh/GUS reporter gene was activated in roots during the flight. However, the patterns of expression were not identical to terrestrial control inductions. Moreover, although terrestrial hypoxia induces Adh/GUS expression in the shoot apex, no apex staining was observed in the spaceflight plants. This indicates that either the normal hypoxia response signaling is impaired in spaceflight or that spaceflight inappropriately induces Adh/GUS activity for reasons other than hypoxia.

  15. Transgene Expression Patterns Indicate That Spaceflight Affects Stress Signal Perception and Transduction in Arabidopsis1

    PubMed Central

    Paul, Anna-Lisa; Daugherty, Christine J.; Bihn, Elizabeth A.; Chapman, David K.; Norwood, Kelly L.L.; Ferl, Robert J.


    The use of plants as integral components of life support systems remains a cornerstone of strategies for long-term human habitation of space and extraterrestrial colonization. Spaceflight experiments over the past few decades have refined the hardware required to grow plants in low-earth orbit and have illuminated fundamental issues regarding spaceflight effects on plant growth and development. Potential incipient hypoxia, resulting from the lack of convection-driven gas movement, has emerged as a possible major impact of microgravity. We developed transgenic Arabidopsis containing the alcohol dehydrogenase (Adh) gene promoter linked to the β-glucuronidase (GUS) reporter gene to address specifically the possibility that spaceflight induces the plant hypoxia response and to assess whether any spaceflight response was similar to control terrestrial hypoxia-induced gene expression patterns. The staining patterns resulting from a 5-d mission on the orbiter Columbia during mission STS-93 indicate that the Adh/GUS reporter gene was activated in roots during the flight. However, the patterns of expression were not identical to terrestrial control inductions. Moreover, although terrestrial hypoxia induces Adh/GUS expression in the shoot apex, no apex staining was observed in the spaceflight plants. This indicates that either the normal hypoxia response signaling is impaired in spaceflight or that spaceflight inappropriately induces Adh/GUS activity for reasons other than hypoxia. PMID:11402191

  16. Lysine and Leucine Deficiencies Affect Myocytes Development and IGF Signaling in Gilthead Sea Bream (Sparus aurata).


    Azizi, Sheida; Nematollahi, Mohammad Ali; Mojazi Amiri, Bagher; Vélez, Emilio J; Lutfi, Esmail; Navarro, Isabel; Capilla, Encarnación; Gutiérrez, Joaquim


    Optimizing aquaculture production requires better knowledge of growth regulation and improvement in diet formulation. A great effort has been made to replace fish meal for plant protein sources in aquafeeds, making necessary the supplementation of such diets with crystalline amino acids (AA) to cover the nutritional requirements of each species. Lysine and Leucine are limiting essential AA in fish, and it has been demonstrated that supplementation with them improves growth in different species. However, the specific effects of AA deficiencies in myogenesis are completely unknown and have only been studied at the level of hepatic metabolism. It is well-known that the TOR pathway integrates the nutritional and hormonal signals to regulate protein synthesis and cell proliferation, to finally control muscle growth, a process also coordinated by the expression of myogenic regulatory factors (MRFs). This study aimed to provide new information on the impact of Lysine and Leucine deficiencies in gilthead sea bream cultured myocytes examining their development and the response of insulin-like growth factors (IGFs), MRFs, as well as key molecules involved in muscle growth regulation like TOR. Leucine deficiency did not cause significant differences in most of the molecules analyzed, whereas Lysine deficiency appeared crucial in IGFs regulation, decreasing significantly IGF-I, IGF-II and IGF-IRb mRNA levels. This treatment also down-regulated the gene expression of different MRFs, including Myf5, Myogenin and MyoD2. These changes were also corroborated by a significant decrease in proliferation and differentiation markers in the Lysine-deficient treatment. Moreover, both Lysine and Leucine limitation induced a significant down-regulation in FOXO3 gene expression, which deserves further investigation. We believe that these results will be relevant for the production of a species as appreciated for human consumption as it is gilthead sea bream and demonstrates the importance of

  17. Lysine and Leucine Deficiencies Affect Myocytes Development and IGF Signaling in Gilthead Sea Bream (Sparus aurata)

    PubMed Central

    Azizi, Sheida; Nematollahi, Mohammad Ali; Mojazi Amiri, Bagher; Vélez, Emilio J.; Lutfi, Esmail; Navarro, Isabel; Capilla, Encarnación; Gutiérrez, Joaquim


    Optimizing aquaculture production requires better knowledge of growth regulation and improvement in diet formulation. A great effort has been made to replace fish meal for plant protein sources in aquafeeds, making necessary the supplementation of such diets with crystalline amino acids (AA) to cover the nutritional requirements of each species. Lysine and Leucine are limiting essential AA in fish, and it has been demonstrated that supplementation with them improves growth in different species. However, the specific effects of AA deficiencies in myogenesis are completely unknown and have only been studied at the level of hepatic metabolism. It is well-known that the TOR pathway integrates the nutritional and hormonal signals to regulate protein synthesis and cell proliferation, to finally control muscle growth, a process also coordinated by the expression of myogenic regulatory factors (MRFs). This study aimed to provide new information on the impact of Lysine and Leucine deficiencies in gilthead sea bream cultured myocytes examining their development and the response of insulin-like growth factors (IGFs), MRFs, as well as key molecules involved in muscle growth regulation like TOR. Leucine deficiency did not cause significant differences in most of the molecules analyzed, whereas Lysine deficiency appeared crucial in IGFs regulation, decreasing significantly IGF-I, IGF-II and IGF-IRb mRNA levels. This treatment also down-regulated the gene expression of different MRFs, including Myf5, Myogenin and MyoD2. These changes were also corroborated by a significant decrease in proliferation and differentiation markers in the Lysine-deficient treatment. Moreover, both Lysine and Leucine limitation induced a significant down-regulation in FOXO3 gene expression, which deserves further investigation. We believe that these results will be relevant for the production of a species as appreciated for human consumption as it is gilthead sea bream and demonstrates the importance of

  18. The MICA-129 dimorphism affects NKG2D signaling and outcome of hematopoietic stem cell transplantation

    PubMed Central

    Isernhagen, Antje; Malzahn, Dörthe; Viktorova, Elena; Elsner, Leslie; Monecke, Sebastian; von Bonin, Frederike; Kilisch, Markus; Wermuth, Janne Marieke; Walther, Neele; Balavarca, Yesilda; Stahl-Hennig, Christiane; Engelke, Michael; Walter, Lutz; Bickeböller, Heike; Kube, Dieter; Wulf, Gerald; Dressel, Ralf


    The MHC class I chain-related molecule A (MICA) is a highly polymorphic ligand for the activating natural killer (NK)-cell receptor NKG2D. A single nucleotide polymorphism causes a valine to methionine exchange at position 129. Presence of a MICA-129Met allele in patients (n = 452) undergoing hematopoietic stem cell transplantation (HSCT) increased the chance of overall survival (hazard ratio [HR] = 0.77, P = 0.0445) and reduced the risk to die due to acute graft-versus-host disease (aGVHD) (odds ratio [OR] = 0.57, P = 0.0400) although homozygous carriers had an increased risk to experience this complication (OR = 1.92, P = 0.0371). Overall survival of MICA-129Val/Val genotype carriers was improved when treated with anti-thymocyte globulin (HR = 0.54, P = 0.0166). Functionally, the MICA-129Met isoform was characterized by stronger NKG2D signaling, triggering more NK-cell cytotoxicity and interferon-γ release, and faster co-stimulation of CD8+ T cells. The MICA-129Met variant also induced a faster and stronger down-regulation of NKG2D on NK and CD8+ T cells than the MICA-129Val isoform. The reduced cell surface expression of NKG2D in response to engagement by MICA-129Met variants appeared to reduce the severity of aGVHD. PMID:26483398

  19. QapR (PA5506) represses an operon that negatively affects the Pseudomonas quinolone signal in Pseudomonas aeruginosa.


    Tipton, Kyle A; Coleman, James P; Pesci, Everett C


    Pseudomonas aeruginosa is a Gram-negative, opportunistic pathogen that can cause disease in varied sites within the human body and is a significant source of morbidity and mortality in those afflicted with cystic fibrosis. P. aeruginosa is able to coordinate group behaviors, such as virulence factor production, through the process of cell-to-cell signaling. There are three intercellular signaling systems employed by P. aeruginosa, and one of these systems utilizes the small molecule 2-heptyl-3-hydroxy-4-quinolone (Pseudomonas quinolone signal [PQS]). PQS is required for virulence in multiple infection models and has been found in the lungs of cystic fibrosis patients colonized by P. aeruginosa. In this study, we have identified an RpiR family transcriptional regulator, QapR, which is an autoregulatory repressor. We found that mutation of qapR caused overexpression of the qapR operon. We characterized the qapR operon to show that it contains genes qapR, PA5507, PA5508, and PA5509 and that QapR directly controls the transcription of these genes in a negative manner. We also show that derepression of this operon greatly reduces PQS concentration in P. aeruginosa. Our results suggest that qapR affects PQS concentration by repressing an enzymatic pathway that acts on PQS or a PQS precursor to lower the PQS concentration. We believe that this operon comprises a novel mechanism to regulate PQS concentration in P. aeruginosa.

  20. The Gustatory Signaling Pathway and Bitter Taste Receptors Affect the Development of Obesity and Adipocyte Metabolism in Mice

    PubMed Central

    Avau, Bert; Bauters, Dries; Steensels, Sandra; Vancleef, Laurien; Laermans, Jorien; Lesuisse, Jens; Buyse, Johan; Lijnen, H. Roger; Tack, Jan; Depoortere, Inge


    Intestinal chemosensory signaling pathways involving the gustatory G-protein, gustducin, and bitter taste receptors (TAS2R) have been implicated in gut hormone release. Alterations in gut hormone profiles may contribute to the success of bariatric surgery. This study investigated the involvement of the gustatory signaling pathway in the development of diet-induced obesity and the therapeutic potential of targeting TAS2Rs to induce body weight loss. α-gustducin-deficient (α-gust-/-) mice became less obese than wild type (WT) mice when fed a high-fat diet (HFD). White adipose tissue (WAT) mass was lower in α-gust-/- mice due to increased heat production as a result of increases in brown adipose tissue (BAT) thermogenic activity, involving increased protein expression of uncoupling protein 1. Intra-gastric treatment of obese WT and α-gust-/- mice with the bitter agonists denatonium benzoate (DB) or quinine (Q) during 4 weeks resulted in an α-gustducin-dependent decrease in body weight gain associated with a decrease in food intake (DB), but not involving major changes in gut peptide release. Both WAT and 3T3-F442A pre-adipocytes express TAS2Rs. Treatment of pre-adipocytes with DB or Q decreased differentiation into mature adipocytes. In conclusion, interfering with the gustatory signaling pathway protects against the development of HFD-induced obesity presumably through promoting BAT activity. Intra-gastric bitter treatment inhibits weight gain, possibly by directly affecting adipocyte metabolism. PMID:26692363

  1. QapR (PA5506) Represses an Operon That Negatively Affects the Pseudomonas Quinolone Signal in Pseudomonas aeruginosa

    PubMed Central

    Tipton, Kyle A.; Coleman, James P.


    Pseudomonas aeruginosa is a Gram-negative, opportunistic pathogen that can cause disease in varied sites within the human body and is a significant source of morbidity and mortality in those afflicted with cystic fibrosis. P. aeruginosa is able to coordinate group behaviors, such as virulence factor production, through the process of cell-to-cell signaling. There are three intercellular signaling systems employed by P. aeruginosa, and one of these systems utilizes the small molecule 2-heptyl-3-hydroxy-4-quinolone (Pseudomonas quinolone signal [PQS]). PQS is required for virulence in multiple infection models and has been found in the lungs of cystic fibrosis patients colonized by P. aeruginosa. In this study, we have identified an RpiR family transcriptional regulator, QapR, which is an autoregulatory repressor. We found that mutation of qapR caused overexpression of the qapR operon. We characterized the qapR operon to show that it contains genes qapR, PA5507, PA5508, and PA5509 and that QapR directly controls the transcription of these genes in a negative manner. We also show that derepression of this operon greatly reduces PQS concentration in P. aeruginosa. Our results suggest that qapR affects PQS concentration by repressing an enzymatic pathway that acts on PQS or a PQS precursor to lower the PQS concentration. We believe that this operon comprises a novel mechanism to regulate PQS concentration in P. aeruginosa. PMID:23708133

  2. Disruption of sonic hedgehog signaling in Ellis-van Creveld dwarfism confers protection against bipolar affective disorder.


    Ginns, E I; Galdzicka, M; Elston, R C; Song, Y E; Paul, S M; Egeland, J A


    Ellis-van Creveld syndrome, an autosomal recessively inherited chondrodysplastic dwarfism, is frequent among Old Order Amish of Pennsylvania. Decades of longitudinal research on bipolar affective disorder (BPAD) revealed cosegregation of high numbers of EvC and Bipolar I (BPI) cases in several large Amish families descending from the same pioneer. Despite the high prevalence of both disorders in these families, no EvC individual has ever been reported with BPI. The proximity of the EVC gene to our previously reported chromosome 4p16 BPAD locus with protective alleles, coupled with detailed clinical observations that EvC and BPI do not occur in the same individuals, led us to hypothesize that the genetic defect causing EvC in the Amish confers protection from BPI. This hypothesis is supported by a significant negative association of these two disorders when contrasted with absence of disease (P=0.029, Fisher's exact test, two-sided, verified by permutation to estimate the null distribution of the test statistic). As homozygous Amish EVC mutations causing EvC dwarfism do so by disrupting sonic hedgehog (Shh) signaling, our data implicate Shh signaling in the underlying pathophysiology of BPAD. Understanding how disrupted Shh signaling protects against BPI could uncover variants in the Shh pathway that cause or increase risk for this and related mood disorders.

  3. Emotion affects action: Midcingulate cortex as a pivotal node of interaction between negative emotion and motor signals

    PubMed Central

    Pereira, M.G.; Oliveira, L; Erthal, FS; Joffily, M; Mocaiber, I.F.; Volchan, E.; Pessoa, L.


    Affective pictures drive the activity of brain networks and impact behavior. We showed previously that viewing unpleasant pictures interfered in the performance of a basic non-emotional visual detection task. In the present study, we employed functional magnetic resonance imaging to test the hypothesis that behavioral interference may result from the interaction between negatively valenced and motor-related signals in the brain. As in our previous study, subjects performed a simple target-detection task that followed the presentation of unpleasant or neutral pictures. Our results revealed that an unpleasant emotional context modulated evoked responses in several regions engaged by the simple target-detection task. In particular, the midcingulate cortex was recruited when participants performed target-detection trials during the unpleasant context and signal responses in this region closely mirrored the pattern of behavioral interference (as revealed via reaction time). Our findings suggest that the midcingulate cortex may be an important site for the interaction between negatively valenced and motor signals in the brain, and that it may be involved in the implementation of defensive responses, such as freezing. PMID:20233958

  4. NMDA-dependent mechanisms only affect the BOLD response in the rat dentate gyrus by modifying local signal processing

    PubMed Central

    Tiede, Regina; Krautwald, Karla; Fincke, Anja; Angenstein, Frank


    The role of N-methyl--aspartate (NMDA) receptor-mediated mechanisms in the formation of a blood oxygen level-dependent (BOLD) response was studied using electrical stimulation of the right perforant pathway. Stimulation of this fiber bundle triggered BOLD responses in the right hippocampal formation and in the left entorhinal cortex. The perforant pathway projects to and activates the dentate gyrus monosynaptically, activation in the contralateral entorhinal cortex is multisynaptic and requires forwarding and processing of signals. Application of the NMDA receptor antagonist MK801 during stimulation had no effect on BOLD responses in the right dentate gyrus, but reduced the BOLD responses in the left entorhinal cortex. In contrast, application of MK801 before the first stimulation train reduced the BOLD response in both regions. Electrophysiological recordings revealed that the initial stimulation trains changed the local processing of the incoming signals in the dentate gyrus. This altered electrophysiological response was not further changed by a subsequent application of MK801, which is in agreement with an unchanged BOLD response. When MK801 was present during the first stimulation train, a dissimilar electrophysiological response pattern was observed and corresponds to an altered BOLD response, indicating that NMDA-dependent mechanisms indirectly affect the BOLD response, mainly via modifying local signal processing and subsequent propagation. PMID:22167232

  5. Resistance exercise volume affects myofibrillar protein synthesis and anabolic signalling molecule phosphorylation in young men

    PubMed Central

    Burd, Nicholas A; Holwerda, Andrew M; Selby, Keegan C; West, Daniel W D; Staples, Aaron W; Cain, Nathan E; Cashaback, Joshua G A; Potvin, James R; Baker, Steven K; Phillips, Stuart M


    We aimed to determine if any mechanistic differences exist between a single set (1SET) and multiple sets (i.e. 3 sets; 3SET) of resistance exercise by utilizing a primed constant infusion of [ring-13C6]phenylalanine to determine myofibrillar protein synthesis (MPS) and Western blot analysis to examine anabolic signalling molecule phosphorylation following an acute bout of resistance exercise. Eight resistance-trained men (24 ± 5 years, BMI = 25 ± 4 kg m−2) were randomly assigned to perform unilateral leg extension exercise at 70% concentric one repetition maximum (1RM) until volitional fatigue for 1SET or 3SET. Biopsies from the vastus lateralis were taken in the fasted state (Fast) and fed state (Fed; 20 g of whey protein isolate) at rest, 5 h Fed, 24 h Fast and 29 h Fed post-exercise. Fed-state MPS was transiently elevated above rest at 5 h for 1SET (2.3-fold) and returned to resting levels by 29 h post-exercise. However, the exercise induced increase in MPS following 3SET was superior in amplitude and duration as compared to 1SET at both 5 h (3.1-fold above rest) and 29 h post-exercise (2.3-fold above rest). Phosphorylation of 70 kDa S6 protein kinase (p70S6K) demonstrated a coordinated increase with MPS at 5 h and 29 h post-exercise such that the extent of p70S6K phosphorylation was related to the MPS response (r = 0.338, P = 0.033). Phosphorylation of 90 kDa ribosomal S6 protein kinase (p90RSK) and ribosomal protein S6 (rps6) was similar for 1SET and 3SET at 24 h Fast and 29 h Fed, respectively. However, 3SET induced a greater activation of eukaryotic translation initiation factor 2Bɛ (eIF2Bɛ) and rpS6 at 5 h Fed. These data suggest that 3SET of resistance exercise is more anabolic than 1SET and may lead to greater increases in myofibrillar protein accretion over time. PMID:20581041

  6. A quantum mechanical study on phosphotyrosyl peptide binding to the SH2 domain of p56lck tyrosine kinase with insights into the biochemistry of intracellular signal transduction events.


    Pichierri, Fabio


    A study on the interaction between a phosphotyrosyl peptide with the SH2 domain of Lck kinase has been undertaken with the aid of semiempirical linear-scaling quantum mechanical methods. The structure of this complex has been solved at atomic resolution and, hence, it represents the ideal candidate for studying the charge deformation effects induced by the phosphopeptide on the binding site. Substantial changes in the charge of amino acid residues located in the binding pocket of the protein are observed upon ligand binding. More specifically, our quantum chemical calculations indicate that H-bonds involving charged side-chains are subject to consistent charge deformation effects whereas those forming salt bridges are unaffected by ligand binding. Furthermore, ligand binding has the effect of changing both the magnitude and direction of the protein's macrodipole, which rotates approximately 150 degrees with respect that of the unliganded protein. This suggests that a change in the polarization state of the protein might acts as a switch during the transmission of intracellular signals. The binding energy calculated with the aid of the COSMO solvation model corresponds to about -200 kcal/mol, most of which is attributed to the interaction of the phosphotyrosine head with the amino acid chains located in the binding site of the SH2 domain.

  7. Sildenafil attenuates LPS-induced pro-inflammatory responses through down-regulation of intracellular ROS-related MAPK/NF-κB signaling pathways in N9 microglia.


    Zhao, Siqi; Zhang, Lijia; Lian, Guoning; Wang, Xiaoxiao; Zhang, Haotian; Yao, Xuechun; Yang, Jingyu; Wu, Chunfu


    Excessive activation of microglial cells has been implicated in various neuroinflammation. The present study showed that sildenafil, a PDE5 inhibitor, significantly suppressed NO, interleukin 1β (IL-1β) and tumor necrosis factor α (TNF-α) production induced by LPS in microglial cells through decreasing the protein and/or mRNA expressions of inducible NO synthase (iNOS), IL-1β and TNF-α in a concentration-dependent manner. Sildenafil also blocked IκBα phosphorylation and degradation, inhibited the phosphorylation of mitogen-activated protein kinases (MAPKs), extracellular signal-regulated kinases 1 and 2 (ERK1/2), p38 MAPK, and c-Jun N-terminal kinase (JNK). Moreover, the increase of the expression of gp91phox, a critical and catalytic subunit of NADPH oxidase, and the levels of intracellular reactive oxygen species (iROS) induced by LPS were markedly inhibited by sildenafil. In summary, these data suggest that sildenafil exerts its in vitro anti-inflammatory effect in LPS-activated N9 microglial cells by blocking nuclear factor-κB (NF-κB) and MAPKs activation, which may be partly due to its potent down-regulation of the NADPH-derived iROS production.

  8. Colocalization of β-catenin with Notch intracellular domain in colon cancer: a possible role of Notch1 signaling in activation of CyclinD1-mediated cell proliferation.


    Gopalakrishnan, Natarajan; Saravanakumar, Marimuthu; Madankumar, Perumal; Thiyagu, Mani; Devaraj, Halagowder


    The Wnt and Notch1 signaling pathways play major roles in intestinal development and tumorigenesis. Sub-cellular localization of β-catenin has been implicated in colorectal carcinogenesis. However, the β-catenin and Notch intracellular domain (NICD) interaction has to be addressed. Immunohistochemistries of β-catenin, NICD, and dual immunofluorescence of β-catenin and NICD were analyzed in colorectal tissues and HT29 cell line. Moreover, real-time PCR analysis of CyclinD1, Hes1 and MUC2 was done in HT29 cells upon N-[N-(3, 5-difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT) treatment. Dual staining emphasized the strong interaction of β-catenin and NICD in adenoma and adenocarcinoma than in normal tissues. Hes1 transcript levels were decreased 1.5- and 7.1-fold in 12.5 and 25 µM DAPT-treated HT29 cells. CyclinD1 transcript levels decreased 1.2- and 1.6-fold, and MUC2 transcript level increased 4.3- and 7.5-fold in 12.5 and 25 µM DAPT-treated HT29 cells. The results of this study showed that the sub-cellular localization of β-catenin converges with NICD inducing proliferation through the activation of CyclinD1 and Hes1. Moreover, the inhibition of Notch1 signaling by DAPT leads to the arrest of cell proliferation and induces apoptosis leading to the upregulation of MUC2, a secretory cell lineage marker.

  9. ROCK activity affects IL-1-induced signaling possibly through MKK4 and p38 MAPK in Caco-2 cells.


    Banerjee, Sayantan; McGee, Dennis W


    Elevated levels of interleukin-1 (IL-1) accompany inflammatory bowel disease. IL-1-stimulated intestinal epithelial cells can secrete potent chemokines like CXCL8 to exacerbate inflammation. Previously, we found that inhibiting the Rho-associated kinase (ROCK) could inhibit IL-1- or TNF-α-induced CXCL8 secretion by the Caco-2 colonic epithelial cell line. This ROCK inhibition did not affect IκBα phosphorylation and degradation, but suppressed the phosphorylation of c-Jun N-terminal kinase (JNK). Therefore, ROCK must play an important role in epithelial cell CXCL8 responses through an effect on the JNK signaling pathway. Here, we extend these studies by showing that inhibiting ROCK suppressed the IL-1-induced phosphorylation of MKK4, a known activator of JNK, but not MKK7. Yet, ROCK inhibition had no significant effect on the IL-1-induced phosphorylation of extracellular-signal-regulated kinase (ERK) 1/2. Inhibiting ROCK also suppressed the phosphorylation of p38 MAPK after IL-1 stimulation, but this inhibition had no significant effect on the stability of CXCL8 messenger RNA (mRNA) after IL-1 stimulation. These results suggest that ROCK may be important in IL-1-induced signaling through MKK4 to JNK and the activation of p38 MAPK. Finally, inhibiting ROCK in IL-1 and TNF-α co-stimulated Caco-2 cells also resulted in a significant suppression of CXCL8 secretion and mRNA levels suggesting that inhibiting ROCK may be a mechanism to inhibit the overall response of epithelial cells to both cytokines. These studies indicate a novel signaling event, which could provide a target for suppressing intestinal epithelial cells (IEC) chemokine responses involved in mucosal inflammation.

  10. Caffeine and rolipram affect Smad signalling and TGF-β1 stimulated CTGF and transgelin expression in lung epithelial cells.


    Fehrholz, Markus; Speer, Christian P; Kunzmann, Steffen


    Caffeine administration is an important part of the therapeutic treatment of bronchopulmonary dysplasia (BPD) in preterm infants. However, caffeine mediated effects on airway remodelling are still undefined. The TGF-β/Smad signalling pathway is one of the key pathways involved in airway remodelling. Connective tissue growth factor (CTGF), a downstream mediator of TGF-β, and transgelin, a binding and stabilising protein of the cytoskeleton, are both regulated by TGF-β1 and play an important role in airway remodelling. Both have also been implicated in the pathogenesis of BPD. The aim of the present study was to clarify whether caffeine, an unspecific phosphodiesterase (PDE) inhibitor, and rolipram, a prototypical PDE-4 selective inhibitor, were both able to affect TGF-β1-induced Smad signalling and CTGF/transgelin expression in lung epithelial cells. Furthermore, the effect of transgelin knock-down on Smad signalling was studied. The pharmacological effect of caffeine and rolipram on Smad signalling was investigated by means of a luciferase assay via transfection of a TGF-β1-inducible reporter plasmid in A549 cells. The regulation of CTGF and transgelin expression by caffeine and rolipram were studied by promoter analysis, real-time PCR and Western blot. Endogenous transgelin expression was down-regulated by lentiviral transduction mediating transgelin-specific shRNA expression. The addition of caffeine and rolipram inhibited TGF-β1 induced reporter gene activity in a concentration-related manner. They also antagonized the TGF-β1 induced up-regulation of CTGF and transgelin on the promoter-, the mRNA-, and the protein-level. Functional analysis showed that transgelin silencing reduced TGF-β1 induced Smad-signalling and CTGF induction in lung epithelial cells. The present study highlights possible new molecular mechanisms of caffeine and rolipram including an inhibition of Smad signalling and of TGF-β1 regulated genes involved in airway remodelling. An

  11. [Intracellular signals involved in glucose control].


    Cruz, M; Velasco, E; Kumate, J


    Many proteins are involved in glucose control. The first step for glucose uptake is insulin receptor-binding. Stimulation of the insulin receptor results in rapid autophosphorylation and conformational changes in the beta chain and the subsequent phosphorylation of the insulin receptor substrate. This results in the docking of several SH2 domain proteins, including PI 3-kinase and other adapters. The final event is glucose transporter (GLUT) translocation to the cell surface. GLUT is in the cytosol but after insulin stimulation, several proteins are activated either in the GLUT vesicles or in the inner membrane. The role of the cytoskeleton is not well known, but it apparently participates in membrane fusion and vesicle mobilization. After glucose uptake, several hexokines metabolize the glucose to generate energy, convert the glucose in glycogen and store it. Type 2 diabetes is characterized by high glucose levels and insulin resistance. The insulin receptor is diminished on the cell surface membrane, tyrosine phosphorylation is decreased, serine and threonine phosphorylation is augmented. Apparently, the main problem with GLUT protein is in its translocation to the cell surface. At present, we know the role of many proteins involved in glucose control. However, we do not understand the significance of insulin resistance at the molecular level with type 2 diabetes.

  12. TORC1 signaling inhibition by rapamycin and caffeine affect lifespan, global gene expression, and cell proliferation of fission yeast.


    Rallis, Charalampos; Codlin, Sandra; Bähler, Jürg


    Target of rapamycin complex 1 (TORC1) is implicated in growth control and aging from yeast to humans. Fission yeast is emerging as a popular model organism to study TOR signaling, although rapamycin has been thought to not affect cell growth in this organism. Here, we analyzed the effects of rapamycin and caffeine, singly and combined, on multiple cellular processes in fission yeast. The two drugs led to diverse and specific phenotypes that depended on TORC1 inhibition, including prolonged chronological lifespan, inhibition of global translation, inhibition of cell growth and division, and reprograming of global gene expression mimicking nitrogen starvation. Rapamycin and caffeine differentially affected these various TORC1-dependent processes. Combined drug treatment augmented most phenotypes and effectively blocked cell growth. Rapamycin showed a much more subtle effect on global translation than did caffeine, while both drugs were effective in prolonging chronological lifespan. Rapamycin and caffeine did not affect the lifespan via the pH of the growth media. Rapamycin prolonged the lifespan of nongrowing cells only when applied during the growth phase but not when applied after cells had stopped proliferation. The doses of rapamycin and caffeine strongly correlated with growth inhibition and with lifespan extension. This comprehensive analysis will inform future studies into TORC1 function and cellular aging in fission yeast and beyond.

  13. Intracellular Biosynthesis of Fluorescent CdSe Quantum Dots in Bacillus subtilis: A Strategy to Construct Signaling Bacterial Probes for Visually Detecting Interaction Between Bacillus subtilis and Staphylococcus aureus.


    Yan, Zheng-Yu; Ai, Xiao-Xia; Su, Yi-Long; Liu, Xin-Ying; Shan, Xiao-Hui; Wu, Sheng-Mei


    In this work, fluorescent Bacillus subtilis (B. subtilis) cells were developed as probes for imaging applications and to explore behaviorial interaction between B. subtilis and Staphylococcus aureus (S. aureus). A novel biological strategy of coupling intracellular biochemical reactions for controllable biosynthesis of CdSe quantum dots by living B. subtilis cells was demonstrated, through which highly luminant and photostable fluorescent B. subtilis cells were achieved with good uniformity. With the help of the obtained fluorescent B. subtilis cells probes, S. aureus cells responded to co-cultured B. subtilis and to aggregate. The degree of aggregation was calculated and nonlinearly fitted to a polynomial model. Systematic investigations of their interactions implied that B. subtilis cells inhibit the growth of neighboring S. aureus cells, and this inhibition was affected by both the growth stage and the amount of surrounding B. subtilis cells. Compared to traditional methods of studying bacterial interaction between two species, such as solid culture medium colony observation and imaging mass spectrometry detection, the procedures were more simple, vivid, and photostable due to the efficient fluorescence intralabeling with less influence on the cells' surface, which might provide a new paradigm for future visualization of microbial behavior.

  14. Photosensory transduction in ciliates. Role of intracellular pH and comparison between Stentor coeruleus and Blepharisma japonicum.


    Fabczak, H; Fabczak, S; Song, P S; Checcucci, G; Ghetti, F; Lenci, F


    To test the hypothesis that light signal transduction in the unicellular ciliates Stentor coeruleus and Blepharisma japonicum involves a change in intracellular pH as an initial signal following photoexcitation, we studied the dependence of the photophobic responses of the cells to changes in extracellular pH and to reagents that specifically affect intracellular pH. The extracellular pH can modify not only the intracellular pH, but can even reverse the sign of the pH gradient across the cell membrane. Thus, as predicted by the hypothesis, low extracellular pH reversibly inhibited the photophobic response of the ciliates. The intracellular pH-modulating reagents tested included ammonium chloride, a membrane-permeable weak acid that lowers the intracellular pH, and the protonophores carbonylcyanide m-chlorophenyl-hydrazone (CCCP) and carbonylcyanide p-(trifluoromethoxy)-phenyl-hydrazone (FCCP), which collapse the pH gradient across the cell membrane. The low pH and protonophore treatments caused a gradual inhibition of the photophobic responses in both ciliates. The observed reduction of the responsiveness of the cells to visible light can be attributed to the alteration of the intracellular pH, which is suggested to play a specific role in the photosensory transduction in both Stentor coeruleus and Blepharisma japonicum.

  15. Theoretical aspects of calcium signaling

    NASA Astrophysics Data System (ADS)

    Pencea, Corneliu Stefan


    Experiments investigating intracellular calcium dynamics have revealed that calcium signals differentially affect a variety of intracellular processes, from fertilization and cell development and differentiation to subsequent cellular activity, ending with cell death. As an intracellular messenger, calcium transmits information within and between cells, thus regulating their activity. To control such a variety of processes, calcium signals have to be very flexible and also precisely regulated. The cell uses a calcium signaling ``toolkit'', where calcium ions can act in different contexts of space, amplitude and time. For different tasks, the cell selects the particular signal, or combination of signals, that triggers the appropriate physiological response. The physical foundations of such a versatile cellular signaling toolkit involving calcium are not completely understood, despite important experimental and theoretical progress made recently. The declared goal of this work is to investigate physical mechanisms on which the propagation of differential signals can be based. The dynamics of calcium near a cluster of inositol trisphosphate (IP3) activated calcium channels has been investigated analytically and numerically. Our work has demonstrated that clusters of different IP3 receptors can show similar bistable behavior, but differ in both the transient and long term dynamics. We have also investigated the conditions under which a calcium signal propagates between a pair of localized stores. We have shown that the propagation of the signal across a random distribution of such stores shows a percolation transition manifested in the shape of the wave front. More importantly, our work indicates that specific distribution of stores can be interpreted as calcium circuits that can perform important signal analyzing task, from unidirectional propagation and coincidence detection to a complete set of logic gates. We believe that phenomena like the ones described are

  16. Ethanol affects NMDA receptor signaling at climbing fiber-Purkinje cell synapses in mice and impairs cerebellar LTD.


    He, Qionger; Titley, Heather; Grasselli, Giorgio; Piochon, Claire; Hansel, Christian


    Ethanol profoundly influences cerebellar circuit function and motor control. It has recently been demonstrated that functional N-methyl-(D)-aspartate (NMDA) receptors are postsynaptically expressed at climbing fiber (CF) to Purkinje cell synapses in the adult cerebellum. Using whole cell patch-clamp recordings from mouse cerebellar slices, we examined whether ethanol can affect NMDA receptor signaling in mature Purkinje cells. NMDA receptor-mediated currents were isolated by bath application of the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA) receptor antagonist 2,3-dihydroxy-6-nitro-7-sulfamoylbenzol[f]quinoxaline (NBQX). The remaining (D)-2-amino-5-phosphonovaleric acid ((D)-APV)-sensitive current was reduced by ethanol at concentrations as low as 10 mM. At a concentration of 50 mM ethanol, the blockade of (D)-APV-sensitive CF-excitatory postsynaptic currents was significantly stronger. Ethanol also altered the waveform of CF-evoked complex spikes by reducing the afterdepolarization. This effect was not seen when NMDA receptors were blocked by (D)-APV before ethanol wash-in. In contrast to CF synaptic transmission, parallel fiber (PF) synaptic inputs were not affected by ethanol. Finally, ethanol (10 mM) impaired long-term depression (LTD) at PF to Purkinje cell synapses as induced under control conditions by paired PF and CF activity. However, LTD induced by pairing PF stimulation with depolarizing voltage steps (substituting for CF activation) was not blocked by ethanol. These observations suggest that the sensitivity of cerebellar circuit function and plasticity to low concentrations of ethanol may be caused by an ethanol-mediated impairment of NMDA receptor signaling at CF synapses onto cerebellar Purkinje cells.

  17. Optimization of parameters affecting signal intensity in an LTQ-orbitrap in negative ion mode: A design of experiments approach.


    Lemonakis, Nikolaos; Skaltsounis, Alexios-Leandros; Tsarbopoulos, Anthony; Gikas, Evagelos


    A multistage optimization of all the parameters affecting detection/response in an LTQ-orbitrap analyzer was performed, using a design of experiments methodology. The signal intensity, a critical issue for mass analysis, was investigated and the optimization process was completed in three successive steps, taking into account the three main regions of an orbitrap, the ion generation, the ion transmission and the ion detection regions. Oleuropein and hydroxytyrosol were selected as the model compounds. Overall, applying this methodology the sensitivity was increased more than 24%, the resolution more than 6.5%, whereas the elapsed scan time was reduced nearly to its half. A high-resolution LTQ Orbitrap Discovery mass spectrometer was used for the determination of the analytes of interest. Thus, oleuropein and hydroxytyrosol were infused via the instruments syringe pump and they were analyzed employing electrospray ionization (ESI) in the negative high-resolution full-scan ion mode. The parameters of the three main regions of the LTQ-orbitrap were independently optimized in terms of maximum sensitivity. In this context, factorial design, response surface model and Plackett-Burman experiments were performed and analysis of variance was carried out to evaluate the validity of the statistical model and to determine the most significant parameters for signal intensity. The optimum MS conditions for each analyte were summarized and the method optimum condition was achieved by maximizing the desirability function. Our observation showed good agreement between the predicted optimum response and the responses collected at the predicted optimum conditions.

  18. Transforming Growth Factor β1/Smad4 Signaling Affects Osteoclast Differentiation via Regulation of miR-155 Expression

    PubMed Central

    Zhao, Hongying; Zhang, Jun; Shao, Haiyu; Liu, Jianwen; Jin, Mengran; Chen, Jinping; Huang, Yazeng


    Transforming growth factor β1 (TGFβ1)/Smad4 signaling plays a pivotal role in maintenance of the dynamic balance between bone formation and resorption. The microRNA miR-155 has been reported to exert a significant role in the differentiation of macrophage and dendritic cells. The goal of this study was to determine whether miR-155 regulates osteoclast differentiation through TGFβ1/Smad4 signaling. Here, we present that TGFβ1 elevated miR-155 levels during osteoclast differentiation through the stimulation of M-CSF and RANKL. Additionally, we found that silencing Smad4 attenuated the upregulation of miR-155 induced by TGFβ1. The results of luciferase reporter experiments and ChIP assays demonstrated that TGFβ1 promoted the binding of Smad4 to the miR-155 promoter at a site located in 454 bp from the transcription start site in vivo, further verifying that miR-155 is a transcriptional target of the TGFβ1/Smad4 pathway. Subsequently, TRAP staining and qRT-PCR analysis revealed that silencing Smad4 impaired the TGFβ1-mediated inhibition on osteoclast differentiation. Finally, we found that miR-155 may target SOCS1 and MITF to suppress osteoclast differentiation. Taken together, we provide the first evidence that TGFβ1/Smad4 signaling affects osteoclast differentiation by regulation of miR-155 expression and the use of miR-155 as a potential therapeutic target for osteoclast-related diseases shows great promise. PMID:28359146

  19. Psoralen and Ultraviolet A Light Treatment Directly Affects Phosphatidylinositol 3-Kinase Signal Transduction by Altering Plasma Membrane Packing.


    Van Aelst, Britt; Devloo, Rosalie; Zachée, Pierre; t'Kindt, Ruben; Sandra, Koen; Vandekerckhove, Philippe; Compernolle, Veerle; Feys, Hendrik B


    Psoralen and ultraviolet A light (PUVA) are used to kill pathogens in blood products and as a treatment of aberrant cell proliferation in dermatitis, cutaneous T-cell lymphoma, and graft-versus-host disease. DNA damage is well described, but the direct effects of PUVA on cell signal transduction are poorly understood. Because platelets are anucleate and contain archetypal signal transduction machinery, they are ideally suited to address this. Lipidomics on platelet membrane extracts showed that psoralen forms adducts with unsaturated carbon bonds of fatty acyls in all major phospholipid classes after PUVA. Such adducts increased lipid packing as measured by a blue shift of an environment-sensitive fluorescent probe in model liposomes. Furthermore, the interaction of these liposomes with lipid order-sensitive proteins like amphipathic lipid-packing sensor and α-synuclein was inhibited by PUVA. In platelets, PUVA caused poor membrane binding of Akt and Bruton's tyrosine kinase effectors following activation of the collagen glycoprotein VI and thrombin protease-activated receptor (PAR) 1. This resulted in defective Akt phosphorylation despite unaltered phosphatidylinositol 3,4,5-trisphosphate levels. Downstream integrin activation was furthermore affected similarly by PUVA following PAR1 (effective half-maximal concentration (EC50), 8.4 ± 1.1 versus 4.3 ± 1.1 μm) and glycoprotein VI (EC50, 1.61 ± 0.85 versus 0.26 ± 0.21 μg/ml) but not PAR4 (EC50, 50 ± 1 versus 58 ± 1 μm) signal transduction. Our findings were confirmed in T-cells from graft-versus-host disease patients treated with extracorporeal photopheresis, a form of systemic PUVA. In conclusion, PUVA increases the order of lipid phases by covalent modification of phospholipids, thereby inhibiting membrane recruitment of effector kinases.

  20. Co-incident signalling between mu-opioid and M3 muscarinic receptors at the level of Ca2+ release from intracellular stores: lack of evidence for Ins(1,4,5)P3 receptor sensitization.

    PubMed Central

    Samways, Damien S K; Li, Wen-hong; Conway, Stuart J; Holmes, Andrew B; Bootman, Martin D; Henderson, Graeme


    Activation of G(i)/G(o)-coupled opioid receptors increases [Ca2+]i (intracellular free-Ca2+ concentration), but only if there is concomitant G(q)-coupled receptor activation. This G(i)/G(o)-coupled receptor-mediated [Ca2+]i increase does not appear to result from further production of Ins P3 [Ins(1,4,5) P3] in SH-SY5Y cells. In the present study, fast-scanning confocal microscopy revealed that activation of mu-opioid receptors alone by 1 muM DAMGO ([L-Ala, NMe-Phe, Gly-ol]-enkephalin) did not stimulate the Ins P3-dependent elementary Ca2+-signalling events (Ca2+ puffs), whereas DAMGO did evoke Ca2+ puffs when applied during concomitant activation of M3 muscarinic receptors with 1 muM carbachol. We next determined whether mu-opioid receptor activation might increase [Ca2+]i by sensitizing the Ins P3 receptor to Ins P3. DAMGO did not potentiate the amplitude of the [Ca2+]i increase evoked by flash photolysis of the caged Ins P3 receptor agonist, caged 2,3-isopropylidene-Ins P3, whereas the Ins P3 receptor sensitizing agent, thimerosal (10 muM), did potentiate this response. DAMGO also did not prolong the rate of decay of the increase in [Ca2+]i evoked by flash photolysis of caged 2,3-isopropylidene-Ins P3. Furthermore, DAMGO did not increase [Ca2+]i in the presence of the cell-membrane-permeable Ins P3 receptor agonist, Ins P3 hexakis(butyryloxymethyl) ester. Therefore it appears that mu-opioid receptors do not increase [Ca2+]i through either Ins P3 receptor sensitization, enhancing the releasable pool of Ca2+ or inhibition of Ca2+ removal from the cytoplasm. PMID:12880387

  1. Genetic modification of corticosteroid receptor signalling: novel insights into pathophysiology and treatment strategies of human affective disorders.


    Müller, Marianne; Holsboer, Florian; Keck, Martin E


    Every disturbance of the body, either real or imagined, evokes a stress response. Essential to this stress response is the activation of the hypothalamic-pituitary-adrenocortical (HPA) system, finally resulting in the release of glucocorticoid hormones from the adrenal cortex. Glucocorticoid hormones, in turn, feed back to this system by central activation of two types of corticosteroid receptors: the glucocorticoid receptor (GR) and the mineralocorticoid receptor (MR) which markedly differ in their neuroanatomical distribution and ligand affinity. Whereas a brief period of controllable stress, experienced with general arousal and excitement, can be a challenge and might thus be beneficial, chronically elevated levels of circulating corticosteroids are believed to enhance vulnerability to a variety of diseases, including affective disorders. Corticosteroids are known to influence emotions and cognitive processes, such as learning and memory. In addition, corticosteroids play extremely important roles in modulating fear and anxiety-related behaviour. The mechanisms by which corticosteroids exert their effects on behaviour are often indirect, by modulating particular sets of neurons or neurotransmitter systems. In addition, the timing of corticosteroid increase (before, during or after exposure to a stressor) determines whether and how behaviour is affected. The cumulative evidence makes a strong case implicating corticosteroid receptor dysfunction in the pathogenesis of affective disorders. Although definitive controlled trials remain to be conducted, there is evidence indicating that cortisol-lowering or corticosteroid receptor antagonist treatments may be of clinical benefit in selected individuals with major depression. A more detailed knowledge of the GR signalling pathways therefore opens up the possibility to specifically target GR function. In recent years, refined molecular technologies and the generation of genetically engineered mice (e.g. "conventional

  2. The pyrrolidinoindoline alkaloid Psm2 inhibits platelet aggregation and thrombus formation by affecting PI3K/Akt signaling

    PubMed Central

    Su, Xing-li; Su, Wen; Wang, Ying; Wang, Yue-hu; Ming, Xin; Kong, Yi


    Aim: Psm2, one of the pyrrolidinoindoline alkaloids isolated from whole Selaginella moellendorffii plants, has shown a potent antiplatelet activity. In this study, we further evaluated the antiplatelet effects of Psm2, and elucidated the underlying mechanisms. Methods: Human platelet aggregation in vitro and rat platelet aggregation ex vivo were investigated. Agonist-induced platelet aggregation was measured using a light transmission aggregometer. The antithrombotic effects of Psm2 were evaluated in arteriovenous shunt thrombosis model in rats. To elucidate the mechanisms underlying the antiplatelet activity of Psm2, ELISAs, Western blotting and molecular docking were performed. The bleeding risk of Psm2 administration was assessed in a mouse tail cutting model, and the cytotoxicity of Psm2 was measured with MTT assay in EA.hy926 cells. Results: Psm2 dose-dependently inhibited human platelet aggregation induced by ADP, U4619, thrombin and collagen with IC50 values of 0.64, 0.37, 0.35 and 0.87 mg/mL, respectively. Psm2 (1, 3, 10 mg/kg) administered to rats significantly inhibited platelet aggregation ex vivo induced by ADP. Psm2 (1, 3, 10 mg/mL, iv) administered to rats with the A–V shunt dose-dependently decreased the thrombus formation. Psm2 inhibited platelet adhesion to fibrinogen and collagen with IC50 values of 84.5 and 96.5 mg/mL, respectively, but did not affect the binding of fibrinogen to GPIIb/IIIa. Furthermore, Psm2 inhibited AktSer473 phosphorylation, but did not affect MAPK signaling and Src kinase activation. Molecular docking showed that Psm2 bound to phosphatidylinositol 3-kinase β (PI3Kβ) with a binding free energy of −13.265 kcal/mol. In addition, Psm2 did not cause toxicity in EA.hy926 cells and produced only slight bleeding in a mouse tail cutting model. Conclusion: Psm2 inhibits platelet aggregation and thrombus formation by affecting PI3K/Akt signaling. Psm2 may be a lead compound or drug candidate that could be developed for the

  3. A single-point mutation (Ala280Val) in the third intracellular loop alters the signalling properties of the human histamine H3 receptor stably expressed in CHO-K1 cells

    PubMed Central

    Flores-Clemente, Cecilia; Osorio-Espinoza, Angélica; Escamilla-Sánchez, Juan; Leurs, Rob; Arias, Juan-Manuel; Arias-Montaño, José-Antonio


    Background and Purpose An alanine to valine exchange at amino acid position 280 (A280V) in the third intracellular loop of the human histamine H3 receptor was first identified in a patient suffering from Shy–Drager syndrome and later reported as a risk factor for migraine. Here, we have compared the pharmacological and signalling properties of wild-type (hH3RWT) and A280V mutant (hH3RA280V) receptors stably expressed in CHO-K1 cells. Experimental Approach The hH3RA280V cDNA was created by overlapping extension PCR amplification. Receptor expression and affinity were assessed by radioligand (N-α-[methyl-3H]-histamine) binding to cell membranes, and receptor function by the inhibition of forskolin-induced cAMP accumulation and stimulation of ERK1/2 phosphorylation in intact cells, as well as stimulation of [35S]-GTPγS binding to cell membranes. Key Results Both receptors were expressed at similar levels with no significant differences in their affinities for H3 receptor ligands. Upon activation the hH3RWT was significantly more efficacious to inhibit forskolin-induced cAMP accumulation and to stimulate [35S]-GTPγS binding, with no difference in pEC50 estimates. The hH3RWT was also more efficacious to stimulate ERK1/2 phosphorylation, but this difference was not significant. The inverse agonist ciproxifan was more efficacious at hH3RWT to reduce [35S]-GTPγS binding but, for both receptors, failed to enhance forskolin-induced cAMP accumulation. Conclusions and Implications The A280V mutation reduces the signalling efficacy of the human H3 receptor. This effect may be relevant to the pathophysiology of disorders associated with the mutation. Linked Articles This article is part of a themed issue on Histamine Pharmacology Update. To view the other articles in this issue visit PMID:23713487

  4. Exogenous Modulation of Retinoic Acid Signaling Affects Adult RGC Survival in the Frog Visual System after Optic Nerve Injury

    PubMed Central

    Duprey-Díaz, Mildred V.; Blagburn, Jonathan M.; Blanco, Rosa E.


    After lesions to the mammalian optic nerve, the great majority of retinal ganglion cells (RGCs) die before their axons have even had a chance to regenerate. Frog RGCs, on the other hand, suffer only an approximately 50% cell loss, and we have previously investigated the mechanisms by which the application of growth factors can increase their survival rate. Retinoic acid (RA) is a vitamin A-derived lipophilic molecule that plays major roles during development of the nervous system. The RA signaling pathway is also present in parts of the adult nervous system, and components of it are upregulated after injury in peripheral nerves but not in the CNS. Here we investigate whether RA signaling affects long-term RGC survival at 6 weeks after axotomy. Intraocular injection of all-trans retinoic acid (ATRA), the retinoic acid receptor (RAR) type-α agonist AM80, the RARβ agonist CD2314, or the RARγ agonist CD1530, returned axotomized RGC numbers to almost normal levels. On the other hand, inhibition of RA synthesis with disulfiram, or of RAR receptors with the pan-RAR antagonist Ro-41-5253, or the RARβ antagonist LE135E, greatly reduced the survival of the axotomized neurons. Axotomy elicited a strong activation of the MAPK, STAT3 and AKT pathways; this activation was prevented by disulfiram or by RAR antagonists. Finally, addition of exogenous ATRA stimulated the activation of the first two of these pathways. Future experiments will investigate whether these strong survival-promoting effects of RA are mediated via the upregulation of neurotrophins. PMID:27611191

  5. Natural mixtures of POPs affected body weight gain and induced transcription of genes involved in weight regulation and insulin signaling.


    Lyche, Jan L; Nourizadeh-Lillabadi, Rasoul; Karlsson, Camilla; Stavik, Benedicte; Berg, Vidar; Skåre, Janneche Utne; Alestrøm, Peter; Ropstad, Erik


    Obesity is reaching epidemic proportions worldwide, and is associated with chronic illnesses such as diabetes, cardiovascular disease, hypertension and dyslipidemias (metabolic syndrome). Commonly held causes of obesity are overeating coupled with a sedentary lifestyle. However, it has also been postulated that exposure to endocrine disrupting chemicals (EDCs) may be related to the significant increase in the prevalence of obesity and associated diseases. In the present study, developmental and reproductive effects of lifelong exposure to environmentally relevant concentrations of two natural mixtures of persistent organic pollutants (POPs) were investigated using classical and molecular methods in a controlled zebrafish model. The mixtures used were extracted from burbot (Lota lota) liver originating from freshwater systems in Norway (Lake Mjøsa and Lake Losna). The concentration of POPs in the zebrafish ranged from levels detected in wild fish (Lake Mjøsa and Lake Losna), to concentrations reported in human and wildlife populations. Phenotypic effects observed in both exposure groups included (1) earlier onset of puberty, (2) elevated male/female sex ratio, and (3) increased body weight at 5 months of age. Interestingly, genome-wide transcription profiling identified functional networks of genes, in which key regulators of weight homeostasis (PPARs, glucocoricoids, CEBPs, estradiol), steroid hormone functions (glucocoricoids, estradiol, NCOA3) and insulin signaling (HNF4A, CEBPs, PPARG) occupied central positions. The increased weight and the regulation of genes associated with weight homeostasis and insulin signaling observed in the present study suggest that environmental pollution may affect the endocrine regulation of the metabolism, possibly leading to increased weight gain and obesity.

  6. Hydrogen peroxide attenuates refilling of intracellular calcium store in mouse pancreatic acinar cells

    PubMed Central

    Yoon, Mi Na; Kim, Dong Kwan; Kim, Se Hoon


    Intracellular calcium (Ca2+) oscillation is an initial event in digestive enzyme secretion of pancreatic acinar cells. Reactive oxygen species are known to be associated with a variety of oxidative stress-induced cellular disorders including pancreatitis. In this study, we investigated the effect of hydrogen peroxide (H2O2) on intracellular Ca2+ accumulation in mouse pancreatic acinar cells. Perfusion of H2O2 at 300 µM resulted in additional elevation of intracellular Ca2+ levels and termination of oscillatory Ca2+ signals induced by carbamylcholine (CCh) in the presence of normal extracellular Ca2+. Antioxidants, catalase or DTT, completely prevented H2O2-induced additional Ca2+ increase and termination of Ca2+ oscillation. In Ca2+-free medium, H2O2 still enhanced CCh-induced intracellular Ca2+ levels and thapsigargin (TG) mimicked H2O2-induced cytosolic Ca2+ increase. Furthermore, H2O2-induced elevation of intracellular Ca2+ levels was abolished under sarco/endoplasmic reticulum Ca2+ ATPase-inactivated condition by TG pretreatment with CCh. H2O2 at 300 µM failed to affect store-operated Ca2+ entry or Ca2+ extrusion through plasma membrane. Additionally, ruthenium red, a mitochondrial Ca2+ uniporter blocker, failed to attenuate H2O2-induced intracellular Ca2+ elevation. These results provide evidence that excessive generation of H2O2 in pathological conditions could accumulate intracellular Ca2+ by attenuating refilling of internal Ca2+ stores rather than by inhibiting Ca2+ extrusion to extracellular fluid or enhancing Ca2+ mobilization from extracellular medium in mouse pancreatic acinar cells. PMID:28280417

  7. Chronic hypoxia in pregnancy affects thymus development in Balb/c mouse offspring via IL2 Signaling.


    Zhang, Xiaopeng; Zhou, Xiuwen; Li, Lingjun; Sun, Miao; Gao, Qingqing; Zhang, Pengjie; Tang, Jiaqi; He, Yu; Zhu, Di; Xu, Zhice


    Hypoxia during pregnancy can adversely affect development. This study, addressed the impact of prenatal hypoxia on thymus development in the rodent offspring. Pregnant Balb/c mice were exposed to hypoxia or normoxia during pregnancy, and the thymuses of their offspring were tested. Chronic hypoxia during pregnancy resulted in significantly decreased fetal body weight, with an increased thymus-to-body weight ratio. Histological analysis revealed a smaller cortical zone in the thymus of the offspring exposed to hypoxia. A reduction in the cortical T lymphocyte population corresponded to increased mRNA abundance of caspase 3 (Casp3) and decreased expression of the proliferation marker Ki-67 (Mki67). Differences in T lymphocyte sub-populations in the thymus further indicate that thymus development in offspring was retarded or stagnated by prenatal hypoxia. The abundance of IL2 and its receptor was reduced in the thymus following prenatal hypoxia. This was accompanied by an increase in thymus HIF1A and IKKβ and a decrease in phosphorylated NFKB, MAP2K1, and MAPK1/3 compared to control pregnancies. Together, these results implicate deficiencies in IL2-mediated signaling as one source of prenatal-hypoxia-impaired thymus development.

  8. Therapeutic effects of tyroservatide on metastasis of lung cancer and its mechanism affecting integrin-focal adhesion kinase signal transduction.


    Huang, Yu-ting; Zhao, Lan; Fu, Zheng; Zhao, Meng; Song, Xiao-meng; Jia, Jing; Wang, Song; Li, Jin-ping; Zhu, Zhi-feng; Lin, Gang; Lu, Rong; Yao, Zhi


    Tyroservatide (YSV) can inhibit the growth and metastasis of mouse lung cancer significantly. This study investigated the therapeutic effects of tripeptide YSV on metastasis of human lung cancer cells and explored its possible mechanism that affects integrin-focal adhesion kinase (FAK) signal transduction in tumor cells. YSV significantly inhibited the adhesion and the invasion of highly metastatic human lung cancer cell lines 95D, A549, and NCI-H1299. In addition, YSV significantly inhibited phosphorylation of FAK Tyr397 and FAK Tyr576/577 in the 95D, A549, and NCI-H1299 human lung cancer cells in vitro. And the mRNA level and protein expression of FAK in these human lung cancer cells decreased at the same time. YSV also significantly inhibited mRNA and protein levels of integrin β1 and integrin β3 in the 95D, A549, and NCI-H1299 human lung cancer cells. Our research showed that YSV inhibited adhesion and invasion of human lung cancer cells and exhibited therapeutic effects on metastasis of lung cancer.

  9. Stanniocalcin-1 Protects a Mouse Model from Renal Ischemia-Reperfusion Injury by Affecting ROS-Mediated Multiple Signaling Pathways

    PubMed Central

    Liu, Dajun; Shang, Huiping; Liu, Ying


    Stanniocalcin-1 (STC-1) protects against renal ischemia-reperfusion injury (RIRI). However, the molecular mechanisms remain widely unknown. STC-1 inhibits reactive oxygen species (ROS), whereas most ROS-mediated pathways are associated with ischemic injury. Therefore, to explore the mechanism, the effects of STC-1 on ROS-medicated pathways were studied. Non-traumatic vascular clamps were used to establish RIRI mouse models. The serum levels of STC-1, interleukin-6 (IL-6), interferon (IFN) γ, P53, and capase-3 were measured by ELISA kits. Superoxide dismutase (SOD) and malondialdehyde (MDA) were measured by fluorescence spectrofluorometer. All these molecules changed significantly in a RIRI model mouse when compared with those in a sham control. Kidney cells were isolated from sham and model mice. STC-1 was overexpressed or knockout in these kidney cells. The molecules in ROS-medicated pathways were measured by real-time quantitative PCR and Western blot. The results showed that STC-1 is an effective ROS scavenger. The serum levels of STC-1, MDA and SOD activity were increased while the serum levels of IL-6, iIFN-γ, P53, and capase-3 were decreased in a model group when compared with a sham control (p < 0.05). Furthermore, the levels of STC-1,p53, phosphorylated mitogen-activated protein kinase kinase (p-MEKK-1), c-Jun N-terminal kinase (p-JNK), extracellular signal-regulated kinase (p-ERK), IkB kinase (p-IKK), nuclear factor (NF) κB, apoptosis signal-regulating kinase 1 (ASK-1) and caspase-3 changed significantly in kidney cells isolated from a RIRI model when compared to those isolated from a sham control (p < 0.05). Meanwhile, STC-1 overexpression or silence caused significant changes of the levels of these ROS-mediated molecules. Therefore, STC-1 maybe improve anti-inflammation, anti-oxidant and anti-apoptosis activities by affecting ROS-mediated pathways, especially the phospho-modifications of the respective proteins, resulting in the increase of SOD and

  10. Ubr3, a Novel Modulator of Hh Signaling Affects the Degradation of Costal-2 and Kif7 through Poly-ubiquitination.


    Li, Tongchao; Fan, Junkai; Blanco-Sánchez, Bernardo; Giagtzoglou, Nikolaos; Lin, Guang; Yamamoto, Shinya; Jaiswal, Manish; Chen, Kuchuan; Zhang, Jie; Wei, Wei; Lewis, Michael T; Groves, Andrew K; Westerfield, Monte; Jia, Jianhang; Bellen, Hugo J


    Hedgehog (Hh) signaling regulates multiple aspects of metazoan development and tissue homeostasis, and is constitutively active in numerous cancers. We identified Ubr3, an E3 ubiquitin ligase, as a novel, positive regulator of Hh signaling in Drosophila and vertebrates. Hh signaling regulates the Ubr3-mediated poly-ubiquitination and degradation of Cos2, a central component of Hh signaling. In developing Drosophila eye discs, loss of ubr3 leads to a delayed differentiation of photoreceptors and a reduction in Hh signaling. In zebrafish, loss of Ubr3 causes a decrease in Shh signaling in the developing eyes, somites, and sensory neurons. However, not all tissues that require Hh signaling are affected in zebrafish. Mouse UBR3 poly-ubiquitinates Kif7, the mammalian homologue of Cos2. Finally, loss of UBR3 up-regulates Kif7 protein levels and decreases Hh signaling in cultured cells. In summary, our work identifies Ubr3 as a novel, evolutionarily conserved modulator of Hh signaling that boosts Hh in some tissues.

  11. Ubr3, a Novel Modulator of Hh Signaling Affects the Degradation of Costal-2 and Kif7 through Poly-ubiquitination

    PubMed Central

    Li, Tongchao; Giagtzoglou, Nikolaos; Lin, Guang; Jaiswal, Manish; Chen, Kuchuan; Zhang, Jie; Wei, Wei; Lewis, Michael T.; Groves, Andrew K.; Westerfield, Monte; Jia, Jianhang; Bellen, Hugo J.


    Hedgehog (Hh) signaling regulates multiple aspects of metazoan development and tissue homeostasis, and is constitutively active in numerous cancers. We identified Ubr3, an E3 ubiquitin ligase, as a novel, positive regulator of Hh signaling in Drosophila and vertebrates. Hh signaling regulates the Ubr3-mediated poly-ubiquitination and degradation of Cos2, a central component of Hh signaling. In developing Drosophila eye discs, loss of ubr3 leads to a delayed differentiation of photoreceptors and a reduction in Hh signaling. In zebrafish, loss of Ubr3 causes a decrease in Shh signaling in the developing eyes, somites, and sensory neurons. However, not all tissues that require Hh signaling are affected in zebrafish. Mouse UBR3 poly-ubiquitinates Kif7, the mammalian homologue of Cos2. Finally, loss of UBR3 up-regulates Kif7 protein levels and decreases Hh signaling in cultured cells. In summary, our work identifies Ubr3 as a novel, evolutionarily conserved modulator of Hh signaling that boosts Hh in some tissues. PMID:27195754

  12. The signaling protein MucG negatively affects the production and the molecular mass of alginate in Azotobacter vinelandii.


    Ahumada-Manuel, Carlos Leonel; Guzmán, Josefina; Peña, Carlos; Quiroz-Rocha, Elva; Espín, Guadalupe; Núñez, Cinthia


    Azotobacter vinelandii is a soil bacterium that produces the polysaccharide alginate. In this work, we identified a miniTn5 mutant, named GG9, which showed increased alginate production of higher molecular mass, and increased expression of the alginate biosynthetic genes algD and alg8 when compared to its parental strain. The miniTn5 was inserted within ORF Avin07920 encoding a hypothetical protein. Avin07910, located immediately downstream and predicted to form an operon with Avin07920, encodes an inner membrane multi-domain signaling protein here named mucG. Insertional inactivation of mucG resulted in a phenotype of increased alginate production of higher molecular mass similar to that of mutant GG9. The MucG protein contains a periplasmic and putative HAMP and PAS domains, which are linked to GGDEF and EAL domains. The last two domains are potentially involved in the synthesis and degradation, respectively, of bis-(3'-5')-cyclic dimeric GMP (c-di-GMP), a secondary messenger that has been reported to be essential for alginate production. Therefore, we hypothesized that the negative effect of MucG on the production of this polymer could be explained by the putative phosphodiesterase activity of the EAL domain. Indeed, we found that alanine replacement mutagenesis of the MucG EAL motif or deletion of the entire EAL domain resulted in increased alginate production of higher molecular mass similar to the GG9 and mucG mutants. To our knowledge, this is the first reported protein that simultaneous affects the production of alginate and its molecular mass.

  13. "Flashes in eyes" at Space Fl