Sample records for affymetrix oligonucleotide arrays

  1. Development and Evaluation of an Affymetrix array for Aspergillus flavus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A multi-species Affymetrix GeneChip array was developed to study development, metabolism and pathogenicity of A. flavus. This chip based on the whole genome sequence of A. flavus, contains 13,000 A. flavus genes, 8,000 maize genes and 25 human and mouse innate immune response genes, as well as the ...

  2. Qualitative assessment of gene expression in affymetrix genechip arrays

    NASA Astrophysics Data System (ADS)

    Nagarajan, Radhakrishnan; Upreti, Meenakshi


    Affymetrix Genechip microarrays are used widely to determine the simultaneous expression of genes in a given biological paradigm. Probes on the Genechip array are atomic entities which by definition are randomly distributed across the array and in turn govern the gene expression. In the present study, we make several interesting observations. We show that there is considerable correlation between the probe intensities across the array which defy the independence assumption. While the mechanism behind such correlations is unclear, we show that scaling behavior and the profiles of perfect match (PM) as well as mismatch (MM) probes are similar and immune-to-background subtraction. We believe that the observed correlations are possibly an outcome of inherent non-stationarities or patchiness in the array devoid of biological significance. This is demonstrated by inspecting their scaling behavior and profiles of the PM and MM probe intensities obtained from publicly available Genechip arrays from three eukaryotic genomes, namely: Drosophila melanogaster (fruit fly), Homo sapiens (humans) and Mus musculus (house mouse) across distinct biological paradigms and across laboratories, with and without background subtraction. The fluctuation functions were estimated using detrended fluctuation analysis (DFA) with fourth-order polynomial detrending. The results presented in this study provide new insights into correlation signatures of PM and MM probe intensities and suggests the choice of DFA as a tool for qualitative assessment of Affymetrix Genechip microarrays prior to their analysis. A more detailed investigation is necessary in order to understand the source of these correlations.

  3. Working with Oligonucleotide Arrays.


    Carvalho, Benilton S


    Preprocessing microarray data consists of a number of statistical procedures that convert the observed intensities into quantities that represent biological events of interest, like gene expression and allele-specific abundances. Here, we present a summary of the theory behind microarray data preprocessing for expression, whole transcriptome and SNP designs and focus on the computational protocol used to obtain processed data that will be used on downstream analyses. We describe the main features of the oligo Bioconductor package, an application designed to support oligonucleotide microarrays using the R statistical environment and the infrastructure provided by Bioconductor, allowing the researcher to handle probe-level data and interface with advanced statistical tools under a simplified framework. We demonstrate the use of the package by preprocessing data originated from three different designs. PMID:27008013

  4. A comparison of statistical tests for detecting differential expression using Affymetrix oligonucleotide microarrays.


    Vardhanabhuti, Saran; Blakemore, Steven J; Clark, Steven M; Ghosh, Sujoy; Stephens, Richard J; Rajagopalan, Dilip


    Signal quantification and detection of differential expression are critical steps in the analysis of Affymetrix microarray data. Many methods have been proposed in the literature for each of these steps. The goal of this paper is to evaluate several signal quantification methods (GCRMA, RSVD, VSN, MAS5, and Resolver) and statistical methods for differential expression (t test, Cyber-T, SAM, LPE, RankProducts, Resolver RatioBuild). Our particular focus is on the ability to detect differential expression via statistical tests. We have used two different datasets for our evaluation. First, we have used the HG-U133 Latin Square spike in dataset developed by Affymetrix. Second, we have used data from an in-house rat liver transcriptomics study following 30 different drug treatments generated using the Affymetrix RAE230A chip. Our overall recommendation based on this study is to use GCRMA for signal quantification. For detection of differential expression, GCRMA coupled with Cyber-T or SAM is the best approach, as measured by area under the receiver operating characteristic (ROC) curve. The integrated pipeline in Resolver RatioBuild combining signal quantification and detection of differential expression is an equally good alternative for detecting differentially expressed genes. For most of the differential expression algorithms we considered, the performance using MAS5 signal quantification was inferior to that of the other methods we evaluated. PMID:17233564

  5. Software comparison for evaluating genomic copy number variation for Affymetrix 6.0 SNP array platform

    PubMed Central


    Background Copy number data are routinely being extracted from genome-wide association study chips using a variety of software. We empirically evaluated and compared four freely-available software packages designed for Affymetrix SNP chips to estimate copy number: Affymetrix Power Tools (APT), Aroma.Affymetrix, PennCNV and CRLMM. Our evaluation used 1,418 GENOA samples that were genotyped on the Affymetrix Genome-Wide Human SNP Array 6.0. We compared bias and variance in the locus-level copy number data, the concordance amongst regions of copy number gains/deletions and the false-positive rate amongst deleted segments. Results APT had median locus-level copy numbers closest to a value of two, whereas PennCNV and Aroma.Affymetrix had the smallest variability associated with the median copy number. Of those evaluated, only PennCNV provides copy number specific quality-control metrics and identified 136 poor CNV samples. Regions of copy number variation (CNV) were detected using the hidden Markov models provided within PennCNV and CRLMM/VanillaIce. PennCNV detected more CNVs than CRLMM/VanillaIce; the median number of CNVs detected per sample was 39 and 30, respectively. PennCNV detected most of the regions that CRLMM/VanillaIce did as well as additional CNV regions. The median concordance between PennCNV and CRLMM/VanillaIce was 47.9% for duplications and 51.5% for deletions. The estimated false-positive rate associated with deletions was similar for PennCNV and CRLMM/VanillaIce. Conclusions If the objective is to perform statistical tests on the locus-level copy number data, our empirical results suggest that PennCNV or Aroma.Affymetrix is optimal. If the objective is to perform statistical tests on the summarized segmented data then PennCNV would be preferred over CRLMM/VanillaIce. Specifically, PennCNV allows the analyst to estimate locus-level copy number, perform segmentation and evaluate CNV-specific quality-control metrics within a single software package

  6. Exon array data analysis using Affymetrix power tools and R statistical software

    PubMed Central


    The use of microarray technology to measure gene expression on a genome-wide scale has been well established for more than a decade. Methods to process and analyse the vast quantity of expression data generated by a typical microarray experiment are similarly well-established. The Affymetrix Exon 1.0 ST array is a relatively new type of array, which has the capability to assess expression at the individual exon level. This allows a more comprehensive analysis of the transcriptome, and in particular enables the study of alternative splicing, a gene regulation mechanism important in both normal conditions and in diseases. Some aspects of exon array data analysis are shared with those for standard gene expression data but others present new challenges that have required development of novel tools. Here, I will introduce the exon array and present a detailed example tutorial for analysis of data generated using this platform. PMID:21498550

  7. SFP Genotyping from Affymetrix Arrays is Robust but Largely Detects Cis-acting Expression Regulators

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The recent development of Affymetrix chips designed from assembled EST sequences has spawned considerable interest in identifying single-feature polymorphisms (SFPs) from transcriptome data. SFPs are valuable genetic markers that potentially offer a physical link to the structural genes themselves....

  8. Discovery and mapping of single feature polymorphisms in wheat using affymetrix arrays

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Single feature polymorphisms (SFPs) can be a rich source of markers for gene mapping and function studies. To explore the feasibility of using the Affymetrix GeneChip to discover and map SFPs in the large hexaploid wheat genome, six wheat varieties of diverse origins were analyzed for significant pr...

  9. MMBGX: a method for estimating expression at the isoform level and detecting differential splicing using whole-transcript Affymetrix arrays

    PubMed Central

    Turro, Ernest; Lewin, Alex; Rose, Anna; Dallman, Margaret J.; Richardson, Sylvia


    Affymetrix has recently developed whole-transcript GeneChips—‘Gene’ and ‘Exon’ arrays—which interrogate exons along the length of each gene. Although each probe on these arrays is intended to hybridize perfectly to only one transcriptional target, many probes match multiple transcripts located in different parts of the genome or alternative isoforms of the same gene. Existing statistical methods for estimating expression do not take this into account and are thus prone to producing inflated estimates. We propose a method, Multi-Mapping Bayesian Gene eXpression (MMBGX), which disaggregates the signal at ‘multi-match’ probes. When applied to Gene arrays, MMBGX removes the upward bias of gene-level expression estimates. When applied to Exon arrays, it can further disaggregate the signal between alternative transcripts of the same gene, providing expression estimates of individual splice variants. We demonstrate the performance of MMBGX on simulated data and a tissue mixture data set. We then show that MMBGX can estimate the expression of alternative isoforms within one experimental condition, confirming our results by RT-PCR. Finally, we show that our method for detecting differential splicing has a lower error rate than standard exon-level approaches on a previously validated colon cancer data set. PMID:19854940

  10. Oligonucleotide Array for Identification and Detection of Pythium Species†

    PubMed Central

    Tambong, J. T.; de Cock, A. W. A. M.; Tinker, N. A.; Lévesque, C. A.


    A DNA array containing 172 oligonucleotides complementary to specific diagnostic regions of internal transcribed spacers (ITS) of more than 100 species was developed for identification and detection of Pythium species. All of the species studied, with the exception of Pythium ostracodes, exhibited a positive hybridization reaction with at least one corresponding species-specific oligonucleotide. Hybridization patterns were distinct for each species. The array hybridization patterns included cluster-specific oligonucleotides that facilitated the recognition of species, including new ones, belonging to groups such as those producing filamentous or globose sporangia. BLAST analyses against 500 publicly available Pythium sequences in GenBank confirmed that species-specific oligonucleotides were unique to all of the available strains of each species, of which there were numerous economically important ones. GenBank entries of newly described species that are not putative synonyms showed no homology to sequences of the spotted species-specific oligonucleotides, but most new species did match some of the cluster-specific oligonucleotides. Further verification of the specificity of the DNA array was done with 50 additional Pythium isolates obtained by soil dilution plating. The hybridization patterns obtained were consistent with the identification of these isolates based on morphology and ITS sequence analyses. In another blind test, total DNA of the same soil samples was amplified and hybridized on the array, and the results were compared to those of 130 Pythium isolates obtained by soil dilution plating and root baiting. The 13 species detected by the DNA array corresponded to the isolates obtained by a combination of soil dilution plating and baiting, except for one new species that was not represented on the array. We conclude that the reported DNA array is a reliable tool for identification and detection of the majority of Pythium species in environmental samples

  11. A Single-Array-Based Method for Detecting Copy Number Variants Using Affymetrix High Density SNP Arrays and its Application to Breast Cancer

    PubMed Central

    Li, Ming; Wen, Yalu; Fu, Wenjiang


    Cumulative evidence has shown that structural variations, due to insertions, deletions, and inversions of DNA, may contribute considerably to the development of complex human diseases, such as breast cancer. High-throughput genotyping technologies, such as Affymetrix high density single-nucleotide polymorphism (SNP) arrays, have produced large amounts of genetic data for genome-wide SNP genotype calling and copy number estimation. Meanwhile, there is a great need for accurate and efficient statistical methods to detect copy number variants. In this article, we introduce a hidden-Markov-model (HMM)-based method, referred to as the PICR-CNV, for copy number inference. The proposed method first estimates copy number abundance for each single SNP on a single array based on the raw fluorescence values, and then standardizes the estimated copy number abundance to achieve equal footing among multiple arrays. This method requires no between-array normalization, and thus, maintains data integrity and independence of samples among individual subjects. In addition to our efforts to apply new statistical technology to raw fluorescence values, the HMM has been applied to the standardized copy number abundance in order to reduce experimental noise. Through simulations, we show our refined method is able to infer copy number variants accurately. Application of the proposed method to a breast cancer dataset helps to identify genomic regions significantly associated with the disease. PMID:26279618

  12. Multiplex pairwise assembly of array-derived DNA oligonucleotides

    PubMed Central

    Klein, Jason C.; Lajoie, Marc J.; Schwartz, Jerrod J.; Strauch, Eva-Maria; Nelson, Jorgen; Baker, David; Shendure, Jay


    While the cost of DNA sequencing has dropped by five orders of magnitude in the past decade, DNA synthesis remains expensive for many applications. Although DNA microarrays have decreased the cost of oligonucleotide synthesis, the use of array-synthesized oligos in practice is limited by short synthesis lengths, high synthesis error rates, low yield and the challenges of assembling long constructs from complex pools. Toward addressing these issues, we developed a protocol for multiplex pairwise assembly of oligos from array-synthesized oligonucleotide pools. To evaluate the method, we attempted to assemble up to 2271 targets ranging in length from 192–252 bases using pairs of array-synthesized oligos. Within sets of complexity ranging from 131–250 targets, we observed error-free assemblies for 90.5% of all targets. When all 2271 targets were assembled in one reaction, we observed error-free constructs for 70.6%. While the assembly method intrinsically increased accuracy to a small degree, we further increased accuracy by using a high throughput ‘Dial-Out PCR’ protocol, which combines Illumina sequencing with an in-house set of unique PCR tags to selectively amplify perfect assemblies from complex synthetic pools. This approach has broad applicability to DNA assembly and high-throughput functional screens. PMID:26553805

  13. Multiplex pairwise assembly of array-derived DNA oligonucleotides.


    Klein, Jason C; Lajoie, Marc J; Schwartz, Jerrod J; Strauch, Eva-Maria; Nelson, Jorgen; Baker, David; Shendure, Jay


    While the cost of DNA sequencing has dropped by five orders of magnitude in the past decade, DNA synthesis remains expensive for many applications. Although DNA microarrays have decreased the cost of oligonucleotide synthesis, the use of array-synthesized oligos in practice is limited by short synthesis lengths, high synthesis error rates, low yield and the challenges of assembling long constructs from complex pools. Toward addressing these issues, we developed a protocol for multiplex pairwise assembly of oligos from array-synthesized oligonucleotide pools. To evaluate the method, we attempted to assemble up to 2271 targets ranging in length from 192-252 bases using pairs of array-synthesized oligos. Within sets of complexity ranging from 131-250 targets, we observed error-free assemblies for 90.5% of all targets. When all 2271 targets were assembled in one reaction, we observed error-free constructs for 70.6%. While the assembly method intrinsically increased accuracy to a small degree, we further increased accuracy by using a high throughput 'Dial-Out PCR' protocol, which combines Illumina sequencing with an in-house set of unique PCR tags to selectively amplify perfect assemblies from complex synthetic pools. This approach has broad applicability to DNA assembly and high-throughput functional screens. PMID:26553805

  14. Spatially Defined Oligonucleotide Arrays. Technical Report for Phase II

    SciTech Connect


    The goal of the Human Genome Project is to sequence all 3 billion base pairs of the human genome. Progress in this has been rapid; GenBank{reg_sign} finished 1994 with 286 million bases of sequence and grew by 2470 in the first quarter of 1995. The challenge to the scientific community is to understand the biological relevance of this genetic information. In most cases the sequence being generated for any single region of the genome represents the genotype of a single individual. A complete understanding of the function of specific genes and other regions of the genome and their role in human disease and development will only become apparent when the sequence of many more individuals is known. Access to genetic information is ultimately limited by the ability to screen DNA sequence. Although the pioneering sequencing methods of Sanger et al. (15) and Maxam and Gilbert (11) have become standard in virtually all molecular biology laboratories, the basic protocols remain largely unchanged. The throughput of this sequencing technology is now becoming the rate-limiting step in both large-scale sequencing projects such as the Human Genome Project and the subsequent efforts to understand genetic diversity. This has inspired the development of advanced DNA sequencing technologies (9), Incremental improvements to Sanger sequencing have been made in DNA labeling and detection. High-speed electrophoresis methods using ultrathin gels or capillary arrays are now being more widely employed. However, these methods are throughput-limited by their sequential nature and the speed and resolution of separations. This limitation will become more pronounced as the need to rapidly screen newly discovered genes for biologically relevant polymorphisms increases. An alternative to gel-based sequencing is to use high-density oligonucleotide probe arrays. Oligonucleotide probe arrays display specific oligonucleotide probes at precise locations in a high density, information-rich format (5

  15. A model of binding on DNA microarrays: understanding the combined effect of probe synthesis failure, cross-hybridization, DNA fragmentation and other experimental details of affymetrix arrays

    PubMed Central


    Background DNA microarrays are used both for research and for diagnostics. In research, Affymetrix arrays are commonly used for genome wide association studies, resequencing, and for gene expression analysis. These arrays provide large amounts of data. This data is analyzed using statistical methods that quite often discard a large portion of the information. Most of the information that is lost comes from probes that systematically fail across chips and from batch effects. The aim of this study was to develop a comprehensive model for hybridization that predicts probe intensities for Affymetrix arrays and that could provide a basis for improved microarray analysis and probe development. The first part of the model calculates probe binding affinities to all the possible targets in the hybridization solution using the Langmuir isotherm. In the second part of the model we integrate details that are specific to each experiment and contribute to the differences between hybridization in solution and on the microarray. These details include fragmentation, wash stringency, temperature, salt concentration, and scanner settings. Furthermore, the model fits probe synthesis efficiency and target concentration parameters directly to the data. All the parameters used in the model have a well-established physical origin. Results For the 302 chips that were analyzed the mean correlation between expected and observed probe intensities was 0.701 with a range of 0.88 to 0.55. All available chips were included in the analysis regardless of the data quality. Our results show that batch effects arise from differences in probe synthesis, scanner settings, wash strength, and target fragmentation. We also show that probe synthesis efficiencies for different nucleotides are not uniform. Conclusions To date this is the most complete model for binding on microarrays. This is the first model that includes both probe synthesis efficiency and hybridization kinetics/cross-hybridization. These

  16. Direct fluorescence analysis of genetic polymorphisms by hybridization with oligonucleotide arrays on glass supports.

    PubMed Central

    Guo, Z; Guilfoyle, R A; Thiel, A J; Wang, R; Smith, L M


    A simple and rapid method for the analysis of genetic polymorphisms has been developed using allele-specific oligonucleotide arrays bound to glass supports. Allele-specific oligonucleotides are covalently immobilized on glass slides in arrays of 3 mm spots. Genomic DNA is amplified by PCR using one fluorescently tagged primer oligonucleotide and one biotinylated primer oligonucleotide. The two complementary DNA strands are separated, the fluorescently tagged strand is hybridized to the support-bound oligonucleotide array, and the hybridization pattern is detected by fluorescence scanning. Multiple polymorphisms present in the PCR product may be detected in parallel. The effect of spacer length, surface density and hybridization conditions were evaluated, as was the relative efficacy of hybridization with single or double-stranded PCR products. The utility of the method was demonstrated in the parallel analysis of 5 point mutations from exon 4 of the human tyrosinase gene. Images PMID:7816638

  17. Evolutionary sequence comparisons using high-density oligonucleotide arrays.


    Hacia, J G; Makalowski, W; Edgemon, K; Erdos, M R; Robbins, C M; Fodor, S P; Brody, L C; Collins, F S


    We explored the utility of high-density oligonucleotide arrays (DNA chips) for obtaining sequence information from homologous genes in closely related species. Orthologues of the human BRCA1 exon 11, all approximately 3.4 kb in length and ranging from 98.2% to 83.5% nucleotide identity, were subjected to hybridization-based and conventional dideoxysequencing analysis. Retrospective guidelines for identifying high-fidelity hybridization-based sequence calls were formulated based upon dideoxysequencing results. Prospective application of these rules yielded base-calling with at least 98.8% accuracy over orthologous sequence tracts shown to have approximately 99% identity. For higher primate sequences with greater than 97% nucleotide identity, base-calling was made with at least 99.91% accuracy covering a minimum of 97% of the sequence. Using a second-tier confirmatory hybridization chip strategy, shown in several cases to confirm the identity of predicted sequence changes, the complete sequence of the chimpanzee, gorilla and orangutan orthologues should be deducible solely through hybridization-based methodologies. Analysis of less highly conserved orthologues can still identify conserved nucleotide tracts of at least 15 nucleotides and can provide useful information for designing primers. DNA-chip based assays can be a valuable new technology for obtaining high-throughput cost-effective sequence information from related genomes. PMID:9462745

  18. Application of oligonucleotide array technology for the rapid detection of pathogenic bacteria of foodborne infections.


    Hong, Bang-Xing; Jiang, Li-Fang; Hu, Yu-Shan; Fang, Dan-Yun; Guo, Hui-Yu


    A rapid and accurate method for detection for common pathogenic bacteria in foodborne infections was established by using oligonucleotide array technology. Nylon membrane was used as the array support. A mutation region of the 23S rRNA gene was selected as the discrimination target from 14 species (genera) of bacteria causing foodborne infections and two unrelated bacterial species. A pair of universal primers was designed for PCR amplification of the 23S rRNA gene. Twenty-one species (genera)-specific oligonucleotide detection probes were synthesized and spotted onto the nylon membranes. The 23S rRNA gene amplification products of 14 species of pathogenic bacteria were hybridized to the oligonucleotide array. Hybridization results were analyzed with digoxigenin-linked enzyme reaction. Results indicated that nine species of pathogenic bacteria (Escherichia coli, Campylobacter jejuni, Shigella dysenteriae, Vibrio cholerae, Vibrio parahaemolyticus, Proteus vulgaris, Bacillus cereus, Listeria monocytogenes and Clostridium botulinum) showed high sensitivity and specificity for the oligonucleotide array. Two other species (Salmonella enterica and Yersinia enterocolitica) gave weak cross-reaction with E. coli, but the reaction did not affect their detection. After redesigning the probes, positive hybridization results were obtained with Staphylococcus aureus, but not with Clostridium perfringens and Streptococcus pyogenes. The oligonucleotide array can also be applied to samples collected in clinical settings of foodborne infections. The superiority of oligonucleotide array over other tests lies on its rapidity, accuracy and efficiency in the diagnosis, treatment and control of foodborne infections. PMID:15279944

  19. Evaluating the Influence of Quality Control Decisions and Software Algorithms on SNP Calling for the Affymetrix 6.0 SNP Array Platform

    PubMed Central

    de Andrade, Mariza; Atkinson, Elizabeth J.; Bamlet, William R.; Matsumoto, Martha E.; Maharjan, Sooraj; Slager, Susan L.; Vachon, Celine M.; Cunningham, Julie M.; Kardia, Sharon L.R.


    Objective Our goal was to evaluate the influence of quality control (QC) decisions using two genotype calling algorithms, CRLMM and Birdseed, designed for the Affymetrix SNP Array 6.0. Methods Various QC options were tried using the two algorithms and comparisons were made on subject and call rate and on association results using two data sets. Results For Birdseed, we recommend using the contrast QC instead of QC call rate for sample QC. For CRLMM, we recommend using the signal-to-noise rate ≥4 for sample QC and a posterior probability of 90% for genotype accuracy. For both algorithms, we recommend calling the genotype separately for each plate, and dropping SNPs with a lower call rate (<95%) before evaluating samples with lower call rates. To investigate whether the genotype calls from the two algorithms impacted the genome-wide association results, we performed association analysis using data from the GENOA cohort; we observed that the number of significant SNPs were similar using either CRLMM or Birdseed. Conclusions Using our suggested workflow both algorithms performed similarly; however, fewer samples were removed and CRLMM took half the time to run our 854 study samples (4.2 h) compared to Birdseed (8.4 h). PMID:21734406

  20. Global Expression Patterns of Three Festuca Species Exposed to Different Doses of Glyphosate Using the Affymetrix GeneChip Wheat Genome Array

    PubMed Central

    Cebeci, Ozge; Budak, Hikmet


    Glyphosate has been shown to act as an inhibitor of an aromatic amino acid biosynthetic pathway, while other pathways that may be affected by glyphosate are not known. Cross species hybridizations can provide a tool for elucidating biological pathways conserved among organisms. Comparative genome analyses have indicated a high level of colinearity among grass species and Festuca, on which we focus here, and showed rearrangements common to the Pooideae family. Based on sequence conservation among grass species, we selected the Affymetrix GeneChip Wheat Genome Array as a tool for the analysis of expression profiles of three Festuca (fescue) species with distinctly different tolerances to varying levels of glyphosate. Differences in transcript expression were recorded upon foliar glyphosate application at 1.58 mM and 6.32 mM, representing 5% and 20%, respectively, of the recommended rate. Differences highlighted categories of general metabolic processes, such as photosynthesis, protein synthesis, stress responses, and a larger number of transcripts responded to 20% glyphosate application. Differential expression of genes encoding proteins involved in the shikimic acid pathway could not be identified by cross hybridization. Microarray data were confirmed by RT-PCR and qRT-PCR analyses. This is the first report to analyze the potential of cross species hybridization in Fescue species and the data and analyses will help extend our knowledge on the cellular processes affected by glyphosate. PMID:20182642

  1. In situ Synthesis of Oligonucleotide Arrays on Surfaces Coated with Crosslinked Polymer Multilayers.


    Broderick, Adam H; Lockett, Matthew R; Buck, Maren E; Yuan, Yuan; Smith, Lloyd M; Lynn, David M


    We report an approach to the in situ synthesis of oligonucleotide arrays on surfaces coated with crosslinked polymer multilayers. Our approach makes use of methods for the 'reactive' layer-by-layer assembly of thin, amine-reactive multilayers using branched polyethyleneimine (PEI) and the azlactone-functionalized polymer poly(2-vinyl-4,4'-dimethylazlactone) (PVDMA). Post-fabrication treatment of film-coated glass substrates with d-glucamine or 4-amino-1-butanol yielded hydroxyl-functionalized films suitable for the Maskless Array Synthesis (MAS) of oligonucleotide arrays. Glucamine-functionalized films yielded arrays of oligonucleotides with fluorescence intensities and signal-to-noise ratios (after hybridization with fluorescently labeled complementary strands) comparable to those of arrays fabricated on conventional silanized glass substrates. These arrays could be exposed to multiple hybridization-dehybridization cycles with only moderate loss of hybridization density. The versatility of the layer-by-layer approach also permitted synthesis directly on thin sheets of film-coated poly(ethylene terephthalate) (PET) to yield flexible oligonucleotide arrays that could be readily manipulated (e.g., bent) and cut into smaller arrays. To our knowledge, this work presents the first use of polymer multilayers as a substrate for the multi-step synthesis of complex molecules. Our results demonstrate that these films are robust and able to withstand the ~450 individual chemical processing steps associated with MAS (as well as manipulations required to hybridize, image, and dehybridize the arrays) without large-scale cracking, peeling, or delamination of the thin films. The combination of layer-by-layer assembly and MAS provides a means of fabricating functional oligonucleotide arrays on a range of different materials and substrates. This approach may also prove useful for the fabrication of supports for the solid-phase synthesis and screening of other macromolecular or small

  2. Discovery of Genomic DNA Polymorphisms using oligonucleotide arrays

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We are applying oligonucleotide microarray technology as a means of rapidly discovering DNA-based markers for genetic mapping in finger millet and rice. A test genome scan was conducted using the full genome sequences of rice varieties 93-11 (indica) and Nipponbare (japonica) compared with the Affy...

  3. Development of a New Oligonucleotide Array To Identify Staphylococcal Strains at Species Level

    PubMed Central

    Giammarinaro, Philippe; Leroy, Sabine; Chacornac, Jean-Paul; Delmas, Julien; Talon, Regine


    The genus Staphylococcus is made up of 36 validated species which contain strains that are pathogenic, saprophytic, or used as starter cultures for the food industry. An oligonucleotide array targeting the manganese-dependent superoxide dismutase (sodA) gene was developed to overcome the drawbacks of the conventional methods of identification. Divergences of the sodA gene were used to design oligonucleotide probes, and we showed that each of the 36 species had a characteristic pattern of hybridization. To evaluate the array, we analyzed 38 clinical and 38 food or food plant Staphylococcus isolates identified by the phenotype-based system VITEK 2 (bioMérieux). This commercial kit failed to identify 8 (21%) of the clinical isolates and 32 (84%) of the food and food plant isolates. In contrast, the oligonucleotide array we designed provided an accurate and rapid method for the identification of staphylococcal strains, isolated from clinical, environmental, or food samples, at species level. PMID:16081895

  4. Strategies in the preparation of DNA oligonucleotide arrays for diagnostic applications.


    Beaucage, S L


    This report emphasizes the interfacial chemistry that is required to ensure proper attachment of oligonucleotides onto the surface of microarrays. For example, strategies for the covalent attachment of pre-synthesized oligonucleotides to glass slides, gold films, polyacrylamide gel pads, polypyrrole films, and optical fibers are surveyed in an attempt to better define the parameters for optimal formation and detection of DNA hybrids. These parameters include among others, the nature and length of the linkers attaching oligonucleotides to the arrays, and the surface density of oligonucleotides required for unhindered hybridization with DNA targets. Sensitive detection methods such as the use of light-scattering techniques, molecular beacons, surface plasmon resonance, attenuated total internal reflection-FTIR, and the evanescent field excitation of fluorescence from surface-bound fluorophores have been developed to study the kinetics and specificity of hybridization events. Finally, the synthesis of oligonucleotides directly on glass surfaces and polypropylene sheets has been investigated to enable DNA sequencing by hybridization and achieve oligonucleotide densities of ca. 10(6) sequences per cm(2) on DNA chips. PMID:11472237

  5. SuperSAGE array: the direct use of 26-base-pair transcript tags in oligonucleotide arrays.


    Matsumura, Hideo; Bin Nasir, Khairun Hisam; Yoshida, Kentaro; Ito, Akiko; Kahl, Günter; Krüger, Detlev H; Terauchi, Ryohei


    We developed a new platform for genome-wide gene expression analysis in any eukaryotic organism, which we called SuperSAGE array. The SuperSAGE array is a microarray onto which 26-bp oligonucleotides corresponding to SuperSAGE tag sequences are directly synthesized. A SuperSAGE array combines the advantages of the highly quantitative SuperSAGE expression analysis with the high-throughput microarray technology. We demonstrated highly reproducible gene expression profiling by the SuperSAGE array for 1,000 genes (tags) in rice. We also applied this technology to the detailed study of expressed genes identified by SuperSAGE in Nicotiana benthamiana, an organism for which sufficient genome sequence information is not available. We propose that the SuperSAGE array system represents a new paradigm for microarray construction, as no genomic or cDNA sequence data are required for its preparation. PMID:16721381

  6. Evaluation of 50-mer oligonucleotide arrays for detectingmicrobial populations in environmental samples.

    SciTech Connect

    Tiquia, S.M.; Wu, L.; Chong, S.C.; Passovets, S.; Xu, D.; Xu, Y.; Zhou, J.


    Microarrays fabricated with oligonucleotides longer than 40bp have been introduced for monitoring whole genome expression but havenot been evaluated with environmental samples. To determine the potentialof this type of microarray for environmental studies, a 50-meroligonucleotide microarray was constructed using 763 genes involved innitrogen cycling: nitrite reductase (nirS and nirK), ammoniamonooxygenase (amoA), nitrogenase (nifH), methane monooxygenase (pmoA),and sulfite reductase (dsrAB) from public databases and our own sequencecollections. The comparison of the sequences from pure cultures indicatedthat the developed microarrays could provide species-level resolution foranalyzing microorganisms involved in nitrification, denitrification,nitrogen fixation, methane oxidation, and sulfite reduction. Sensitivitytests suggested that the 50-mer oligonucleotide arrays could detectdominant populations in the environments, although sensitivity stillneeds to be improved. A significant quantitative relationship was alsoobtained with a mixture of DNAs from eight different bacteria. Theseresults suggest that the 50-mer oligonucleotide array can be used as aspecific and quantitative parallel tool for the detection of microbialpopulations in environmental samples.

  7. A high density COX1 barcode oligonucleotide array for identification and detection of species of Penicillium subgenus Penicillium.


    Chen, W; Seifert, K A; Lévesque, C A


    We developed a COX1 barcode oligonucleotide array based on 358 sequences, including 58 known and two new species of Penicillium subgenus Penicillium, and 12 allied species. The array was robotically spotted at near microarray density on membranes. Species and clade-specific oligonucleotides were selected using the computer programs SigOli and Array Designer. Robotic spotting allowed 768 spots with duplicate sets of perfect match and the corresponding mismatch and positive control oligonucleotides, to be printed on 2 × 6 cm(2) nylon membranes. The array was validated with hybridizations between the array and digoxigenin (DIG)-labelled COX1 polymerase chain reaction amplicons from 70 pure DNA samples, and directly from environmental samples (cheese and plants) without culturing. DNA hybridization conditions were optimized, but undesired cross-reactions were detected frequently, reflecting the relatively high sequence similarity of the COX1 gene among Penicillium species. Approximately 60% of the perfect match oligonucleotides were rejected because of low specificity and 76 delivered useful group-specific or species-specific reactions and could be used for detecting certain species of Penicillium in environmental samples. In practice, the presence of weak signals on arrays exposed to amplicons from environmental samples, which could have represented weak detections or weak cross reactions, made interpretation difficult for over half of the oligonucleotides. DNA regions with very few single nucleotide polymorphisms or lacking insertions/deletions among closely related species are not ideal for oligonucleotide-based diagnostics, and supplementing the COX1-based array with oligonucleotides derived from additional genes would result in a more robust hierarchical identification system. PMID:21564971

  8. Analysis of oligonucleotide array experiments with repeated measures using mixed models

    PubMed Central

    Li, Hao; Wood, Constance L; Getchell, Thomas V; Getchell, Marilyn L; Stromberg, Arnold J


    Background Two or more factor mixed factorial experiments are becoming increasingly common in microarray data analysis. In this case study, the two factors are presence (Patients with Alzheimer's disease) or absence (Control) of the disease, and brain regions including olfactory bulb (OB) or cerebellum (CER). In the design considered in this manuscript, OB and CER are repeated measurements from the same subject and, hence, are correlated. It is critical to identify sources of variability in the analysis of oligonucleotide array experiments with repeated measures and correlations among data points have to be considered. In addition, multiple testing problems are more complicated in experiments with multi-level treatments or treatment combinations. Results In this study we adopted a linear mixed model to analyze oligonucleotide array experiments with repeated measures. We first construct a generalized F test to select differentially expressed genes. The Benjamini and Hochberg (BH) procedure of controlling false discovery rate (FDR) at 5% was applied to the P values of the generalized F test. For those genes with significant generalized F test, we then categorize them based on whether the interaction terms were significant or not at the α-level (αnew = 0.0033) determined by the FDR procedure. Since simple effects may be examined for the genes with significant interaction effect, we adopt the protected Fisher's least significant difference test (LSD) procedure at the level of αnew to control the family-wise error rate (FWER) for each gene examined. Conclusions A linear mixed model is appropriate for analysis of oligonucleotide array experiments with repeated measures. We constructed a generalized F test to select differentially expressed genes, and then applied a specific sequence of tests to identify factorial effects. This sequence of tests applied was designed to control for gene based FWER. PMID:15626348

  9. Oligonucleotide arrays vs. metaphase-comparative genomic hybridisation and BAC arrays for single-cell analysis: first applications to preimplantation genetic diagnosis for Robertsonian translocation carriers.


    Ramos, Laia; del Rey, Javier; Daina, Gemma; García-Aragonés, Manel; Armengol, Lluís; Fernandez-Encinas, Alba; Parriego, Mònica; Boada, Montserrat; Martinez-Passarell, Olga; Martorell, Maria Rosa; Casagran, Oriol; Benet, Jordi; Navarro, Joaquima


    Comprehensive chromosome analysis techniques such as metaphase-Comparative Genomic Hybridisation (CGH) and array-CGH are available for single-cell analysis. However, while metaphase-CGH and BAC array-CGH have been widely used for Preimplantation Genetic Diagnosis, oligonucleotide array-CGH has not been used in an extensive way. A comparison between oligonucleotide array-CGH and metaphase-CGH has been performed analysing 15 single fibroblasts from aneuploid cell-lines and 18 single blastomeres from human cleavage-stage embryos. Afterwards, oligonucleotide array-CGH and BAC array-CGH were also compared analysing 16 single blastomeres from human cleavage-stage embryos. All three comprehensive analysis techniques provided broadly similar cytogenetic profiles; however, non-identical profiles appeared when extensive aneuploidies were present in a cell. Both array techniques provided an optimised analysis procedure and a higher resolution than metaphase-CGH. Moreover, oligonucleotide array-CGH was able to define extra segmental imbalances in 14.7% of the blastomeres and it better determined the specific unbalanced chromosome regions due to a higher resolution of the technique (≈ 20 kb). Applicability of oligonucleotide array-CGH for Preimplantation Genetic Diagnosis has been demonstrated in two cases of Robertsonian translocation carriers 45,XY,der(13;14)(q10;q10). Transfer of euploid embryos was performed in both cases and pregnancy was achieved by one of the couples. This is the first time that an oligonucleotide array-CGH approach has been successfully applied to Preimplantation Genetic Diagnosis for balanced chromosome rearrangement carriers. PMID:25415307

  10. Oligonucleotide Arrays vs. Metaphase-Comparative Genomic Hybridisation and BAC Arrays for Single-Cell Analysis: First Applications to Preimplantation Genetic Diagnosis for Robertsonian Translocation Carriers

    PubMed Central

    Ramos, Laia; del Rey, Javier; Daina, Gemma; García-Aragonés, Manel; Armengol, Lluís; Fernandez-Encinas, Alba; Parriego, Mònica; Boada, Montserrat; Martinez-Passarell, Olga; Martorell, Maria Rosa; Casagran, Oriol; Benet, Jordi; Navarro, Joaquima


    Comprehensive chromosome analysis techniques such as metaphase-Comparative Genomic Hybridisation (CGH) and array-CGH are available for single-cell analysis. However, while metaphase-CGH and BAC array-CGH have been widely used for Preimplantation Genetic Diagnosis, oligonucleotide array-CGH has not been used in an extensive way. A comparison between oligonucleotide array-CGH and metaphase-CGH has been performed analysing 15 single fibroblasts from aneuploid cell-lines and 18 single blastomeres from human cleavage-stage embryos. Afterwards, oligonucleotide array-CGH and BAC array-CGH were also compared analysing 16 single blastomeres from human cleavage-stage embryos. All three comprehensive analysis techniques provided broadly similar cytogenetic profiles; however, non-identical profiles appeared when extensive aneuploidies were present in a cell. Both array techniques provided an optimised analysis procedure and a higher resolution than metaphase-CGH. Moreover, oligonucleotide array-CGH was able to define extra segmental imbalances in 14.7% of the blastomeres and it better determined the specific unbalanced chromosome regions due to a higher resolution of the technique (≈20 kb). Applicability of oligonucleotide array-CGH for Preimplantation Genetic Diagnosis has been demonstrated in two cases of Robertsonian translocation carriers 45,XY,der(13;14)(q10;q10). Transfer of euploid embryos was performed in both cases and pregnancy was achieved by one of the couples. This is the first time that an oligonucleotide array-CGH approach has been successfully applied to Preimplantation Genetic Diagnosis for balanced chromosome rearrangement carriers. PMID:25415307

  11. Hybridization modeling of oligonucleotide SNP arrays for accurate DNA copy number estimation

    PubMed Central

    Wan, Lin; Sun, Kelian; Ding, Qi; Cui, Yuehua; Li, Ming; Wen, Yalu; Elston, Robert C.; Qian, Minping; Fu, Wenjiang J


    Affymetrix SNP arrays have been widely used for single-nucleotide polymorphism (SNP) genotype calling and DNA copy number variation inference. Although numerous methods have achieved high accuracy in these fields, most studies have paid little attention to the modeling of hybridization of probes to off-target allele sequences, which can affect the accuracy greatly. In this study, we address this issue and demonstrate that hybridization with mismatch nucleotides (HWMMN) occurs in all SNP probe-sets and has a critical effect on the estimation of allelic concentrations (ACs). We study sequence binding through binding free energy and then binding affinity, and develop a probe intensity composite representation (PICR) model. The PICR model allows the estimation of ACs at a given SNP through statistical regression. Furthermore, we demonstrate with cell-line data of known true copy numbers that the PICR model can achieve reasonable accuracy in copy number estimation at a single SNP locus, by using the ratio of the estimated AC of each sample to that of the reference sample, and can reveal subtle genotype structure of SNPs at abnormal loci. We also demonstrate with HapMap data that the PICR model yields accurate SNP genotype calls consistently across samples, laboratories and even across array platforms. PMID:19586935

  12. Rapid oligonucleotide suspension array-based multiplex detection of bacterial pathogens.


    Zhao, Jinyin; Kang, Lin; Hu, Rui; Gao, Shan; Xin, Wenwen; Chen, Weijun; Wang, Jinglin


    A gene-specific microsphere suspension array coupled with 15-plex polymerase chain reaction (PCR) was developed to screen bacterial samples rapidly for 10 strains of bacteria: Shigella spp. (S. flexneri, S. dysenteriae, and S. sonnei), Staphylococcus aureus, Vibrio cholerae (serology O1 and O139), Legionella pneumophila, and Clostridium botulinum (types A, B, and E). Fifteen sets of highly validated primers were chosen to amplify target genes simultaneously. Corresponding oligonucleotide probes directly conjugated with microsphere sets were used to specifically identify PCR amplicons. Sensitivity tests revealed that the array coupled with single PCR was able to detect purified genomic DNA at concentrations as low as 10 copies/μL, while the multiplex detection limit was 10-10⁴ copies/μL. The assay was validated using water samples artificially spiked with S. aureus and S. dysenteriae, as well as water specimens from swimming pools previously identified to contain S. aureus. PMID:23947819

  13. Genetic diversity in yeast assessed with whole-genome oligonucleotide arrays.

    PubMed Central

    Winzeler, Elizabeth A; Castillo-Davis, Cristian I; Oshiro, Guy; Liang, David; Richards, Daniel R; Zhou, Yingyao; Hartl, Daniel L


    The availability of a complete genome sequence allows the detailed study of intraspecies variability. Here we use high-density oligonucleotide arrays to discover 11,115 single-feature polymorphisms (SFPs) existing in one or more of 14 different yeast strains. We use these SFPs to define regions of genetic identity between common laboratory strains of yeast. We assess the genome-wide distribution of genetic variation on the basis of this yeast population. We find that genome variability is biased toward the ends of chromosomes and is more likely to be found in genes with roles in fermentation or in transport. This subtelomeric bias may arise through recombination between nonhomologous sequences because full-gene deletions are more common in these regions than in more central regions of the chromosome. PMID:12586698

  14. Detection and Genotyping of Arcobacter and Campylobacter Isolates from Retail Chicken Samples by Use of DNA Oligonucleotide Arrays

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To explore the use of DNA microarrays for pathogen detection in food, we have produced DNA oligonucleotide arrays to identify the presence of Arcobacter and Campylobacter in retail chicken. Probes were selected that target housekeeping and virulence-associated genes in both Arcobacter butzleri and ...

  15. Refinement of light-responsive transcript lists using rice oligonucleotide arrays: evaluation of gene-redundancy.


    Jung, Ki-Hong; Dardick, Christopher; Bartley, Laura E; Cao, Peijian; Phetsom, Jirapa; Canlas, Patrick; Seo, Young-Su; Shultz, Michael; Ouyang, Shu; Yuan, Qiaoping; Frank, Bryan C; Ly, Eugene; Zheng, Li; Jia, Yi; Hsia, An-Ping; An, Kyungsook; Chou, Hui-Hsien; Rocke, David; Lee, Geun Cheol; Schnable, Patrick S; An, Gynheung; Buell, C Robin; Ronald, Pamela C


    Studies of gene function are often hampered by gene-redundancy, especially in organisms with large genomes such as rice (Oryza sativa). We present an approach for using transcriptomics data to focus functional studies and address redundancy. To this end, we have constructed and validated an inexpensive and publicly available rice oligonucleotide near-whole genome array, called the rice NSF45K array. We generated expression profiles for light- vs. dark-grown rice leaf tissue and validated the biological significance of the data by analyzing sources of variation and confirming expression trends with reverse transcription polymerase chain reaction. We examined trends in the data by evaluating enrichment of gene ontology terms at multiple false discovery rate thresholds. To compare data generated with the NSF45K array with published results, we developed publicly available, web-based tools ( The Oligo and EST Anatomy Viewer enables visualization of EST-based expression profiling data for all genes on the array. The Rice Multi-platform Microarray Search Tool facilitates comparison of gene expression profiles across multiple rice microarray platforms. Finally, we incorporated gene expression and biochemical pathway data to reduce the number of candidate gene products putatively participating in the eight steps of the photorespiration pathway from 52 to 10, based on expression levels of putatively functionally redundant genes. We confirmed the efficacy of this method to cope with redundancy by correctly predicting participation in photorespiration of a gene with five paralogs. Applying these methods will accelerate rice functional genomics. PMID:18836531

  16. Mutation Screening and Array Comparative Genomic Hybridization Using a 180K Oligonucleotide Array in VACTERL Association

    PubMed Central

    Winberg, Johanna; Gustavsson, Peter; Papadogiannakis, Nikos; Sahlin, Ellika; Bradley, Frideborg; Nordenskjöld, Edvard; Svensson, Pär-Johan; Annerén, Göran; Iwarsson, Erik; Nordgren, Ann; Nordenskjöld, Agneta


    In order to identify genetic causes of VACTERL association (V vertebral defects, A anorectal malformations, C cardiac defects, T tracheoesofageal fistula, E esophageal atresia, R renal anomalies, L limb deformities), we have collected DNA samples from 20 patients diagnosed with VACTERL or with a VACTERL-like phenotype as well as samples from 19 aborted fetal cases with VACTERL. To investigate the importance of gene dose alterations in the genetic etiology of VACTERL association we have performed a systematic analysis of this cohort using a 180K array comparative genomic hybridization (array-CGH) platform. In addition, to further clarify the significance of PCSK5, HOXD13 and CHD7 genes in the VACTERL phenotype, mutation screening has been performed. We identified pathogenic gene dose imbalances in two fetal cases; a hemizygous deletion of the FANCB gene and a (9;18)(p24;q12) unbalanced translocation. In addition, one pathogenic mutation in CHD7 was detected, while no apparent disease-causing mutations were found in HOXD13 or PCSK5. Our study shows that although large gene dose alterations do not seem to be a common cause in VACTERL association, array-CGH is still important in clinical diagnostics to identify disease cause in individual cases. PMID:24416387

  17. Microfluidic Reactor Array Device for Massively Parallel In-situ Synthesis of Oligonucleotides

    PubMed Central

    Srivannavit, Onnop; Gulari, Mayurachat; Hua, Zhishan.; Gao, Xiaolian; Zhou, Xiaochuan; Hong, Ailing; Zhou, Tiecheng; Gulari, Erdogan


    We have designed and fabricated a microfluidic reactor array device for massively parallel in-situ synthesis of oligonucleotides (oDNA). The device is made of glass anodically bonded to silicon consisting of three level features: microreactors, microchannels and through inlet/outlet holes. Main challenges in the design of this device include preventing diffusion of photogenerated reagents upon activation and achieving uniform reagent flow through thousands of parallel reactors. The device embodies a simple and effective dynamic isolation mechanism which prevents the intermixing of active reagents between discrete microreactors. Depending on the design parameters, it is possible to achieve uniform flow and synthesis reaction in all of the reactors by proper design of the microreactors and the microchannels. We demonstrated the use of this device on a solution-based, light-directed parallel in-situ oDNA synthesis. We were able to synthesize long oDNA, up to 120 mers at stepwise yield of 98 %. The quality of our microfluidic oDNA microarray including sensitivity, signal noise, specificity, spot variation and accuracy was characterized. Our microfluidic reactor array devices show a great potential for genomics and proteomics researches. PMID:20161215

  18. Complete genome sequence of Treponema pallidum ssp. pallidum strain SS14 determined with oligonucleotide arrays

    PubMed Central

    Matějková, Petra; Strouhal, Michal; Šmajs, David; Norris, Steven J; Palzkill, Timothy; Petrosino, Joseph F; Sodergren, Erica; Norton, Jason E; Singh, Jaz; Richmond, Todd A; Molla, Michael N; Albert, Thomas J; Weinstock, George M


    Background Syphilis spirochete Treponema pallidum ssp. pallidum remains the enigmatic pathogen, since no virulence factors have been identified and the pathogenesis of the disease is poorly understood. Increasing rates of new syphilis cases per year have been observed recently. Results The genome of the SS14 strain was sequenced to high accuracy by an oligonucleotide array strategy requiring hybridization to only three arrays (Comparative Genome Sequencing, CGS). Gaps in the resulting sequence were filled with targeted dideoxy-terminators (DDT) sequencing and the sequence was confirmed by whole genome fingerprinting (WGF). When compared to the Nichols strain, 327 single nucleotide substitutions (224 transitions, 103 transversions), 14 deletions, and 18 insertions were found. On the proteome level, the highest frequency of amino acid-altering substitution polymorphisms was in novel genes, while the lowest was in housekeeping genes, as expected by their evolutionary conservation. Evidence was also found for hypervariable regions and multiple regions showing intrastrain heterogeneity in the T. pallidum chromosome. Conclusion The observed genetic changes do not have influence on the ability of Treponema pallidum to cause syphilitic infection, since both SS14 and Nichols are virulent in rabbit. However, this is the first assessment of the degree of variation between the two syphilis pathogens and paves the way for phylogenetic studies of this fascinating organism. PMID:18482458

  19. Application of custom-designed oligonucleotide array CGH in 145 patients with autistic spectrum disorders.


    Wiśniowiecka-Kowalnik, Barbara; Kastory-Bronowska, Monika; Bartnik, Magdalena; Derwińska, Katarzyna; Dymczak-Domini, Wanda; Szumbarska, Dorota; Ziemka, Ewa; Szczałuba, Krzysztof; Sykulski, Maciej; Gambin, Tomasz; Gambin, Anna; Shaw, Chad A; Mazurczak, Tadeusz; Obersztyn, Ewa; Bocian, Ewa; Stankiewicz, Paweł


    Autism spectrum disorders (ASDs) are a heterogeneous group of neurodevelopmental disorders, including childhood autism, atypical autism, and Asperger syndrome, with an estimated prevalence of 1.0-2.5% in the general population. ASDs have a complex multifactorial etiology, with genetic causes being recognized in only 10-20% of cases. Recently, copy-number variants (CNVs) have been shown to contribute to over 10% of ASD cases. We have applied a custom-designed oligonucleotide array comparative genomic hybridization with an exonic coverage of over 1700 genes, including 221 genes known to cause autism and autism candidate genes, in a cohort of 145 patients with ASDs. The patients were classified according to ICD-10 standards and the Childhood Autism Rating Scale protocol into three groups consisting of 45 individuals with and 69 individuals without developmental delay/intellectual disability (DD/ID), and 31 patients, in whom DD/ID could not be excluded. In 12 patients, we have identified 16 copy-number changes, eight (5.5%) of which likely contribute to ASDs. In addition to known recurrent CNVs such as deletions 15q11.2 (BP1-BP2) and 3q13.31 (including DRD3 and ZBTB20), and duplications 15q13.3 and 16p13.11, our analysis revealed two novel genes clinically relevant for ASDs: ARHGAP24 (4q21.23q21.3) and SLC16A7 (12q14.1). Our results further confirm the diagnostic importance of array CGH in detection of CNVs in patients with ASDs and demonstrate that CNVs are an important cause of ASDs as a heterogeneous condition with a variety of contributory genes. PMID:23032108

  20. Application of custom-designed oligonucleotide array CGH in 145 patients with autistic spectrum disorders

    PubMed Central

    Wiśniowiecka-Kowalnik, Barbara; Kastory-Bronowska, Monika; Bartnik, Magdalena; Derwińska, Katarzyna; Dymczak-Domini, Wanda; Szumbarska, Dorota; Ziemka, Ewa; Szczałuba, Krzysztof; Sykulski, Maciej; Gambin, Tomasz; Gambin, Anna; Shaw, Chad A; Mazurczak, Tadeusz; Obersztyn, Ewa; Bocian, Ewa; Stankiewicz, Paweł


    Autism spectrum disorders (ASDs) are a heterogeneous group of neurodevelopmental disorders, including childhood autism, atypical autism, and Asperger syndrome, with an estimated prevalence of 1.0–2.5% in the general population. ASDs have a complex multifactorial etiology, with genetic causes being recognized in only 10–20% of cases. Recently, copy-number variants (CNVs) have been shown to contribute to over 10% of ASD cases. We have applied a custom-designed oligonucleotide array comparative genomic hybridization with an exonic coverage of over 1700 genes, including 221 genes known to cause autism and autism candidate genes, in a cohort of 145 patients with ASDs. The patients were classified according to ICD-10 standards and the Childhood Autism Rating Scale protocol into three groups consisting of 45 individuals with and 69 individuals without developmental delay/intellectual disability (DD/ID), and 31 patients, in whom DD/ID could not be excluded. In 12 patients, we have identified 16 copy-number changes, eight (5.5%) of which likely contribute to ASDs. In addition to known recurrent CNVs such as deletions 15q11.2 (BP1-BP2) and 3q13.31 (including DRD3 and ZBTB20), and duplications 15q13.3 and 16p13.11, our analysis revealed two novel genes clinically relevant for ASDs: ARHGAP24 (4q21.23q21.3) and SLC16A7 (12q14.1). Our results further confirm the diagnostic importance of array CGH in detection of CNVs in patients with ASDs and demonstrate that CNVs are an important cause of ASDs as a heterogeneous condition with a variety of contributory genes. PMID:23032108

  1. Kinetics of Oligonucleotide Hybridization to DNA Probe Arrays on High-Capacity Porous Silica Substrates

    PubMed Central

    Glazer, Marc I.; Fidanza, Jacqueline A.; McGall, Glenn H.; Trulson, Mark O.; Forman, Jonathan E.; Frank, Curtis W.


    We have investigated the kinetics of DNA hybridization to oligonucleotide arrays on high-capacity porous silica films that were deposited by two techniques. Films created by spin coating pure colloidal silica suspensions onto a substrate had pores of ∼23 nm, relatively low porosity (35%), and a surface area of 17 times flat glass (for a 0.3-μm film). In the second method, latex particles were codeposited with the silica by spin coating and then pyrolyzed, which resulted in larger pores (36 nm), higher porosity (65%), and higher surface area (26 times flat glass for a 0.3-μm film). As a result of these favorable properties, the templated silica hybridized more quickly and reached a higher adsorbed target density (11 vs. 8 times flat glass at 22°C) than the pure silica. Adsorption of DNA onto the high-capacity films is controlled by traditional adsorption and desorption coefficients, as well as by morphology factors and transient binding interactions between the target and the probes. To describe these effects, we have developed a model based on the analogy to diffusion of a reactant in a porous catalyst. Adsorption values (ka, kd, and K) measured on planar arrays for the same probe/target system provide the parameters for the model and also provide an internally consistent comparison for the stability of the transient complexes. The interpretation of the model takes into account factors not previously considered for hybridization in three-dimensional films, including the potential effects of heterogeneous probe populations, partial probe/target complexes during diffusion, and non-1:1 binding structures. The transient complexes are much less stable than full duplexes (binding constants for full duplexes higher by three orders of magnitude or more), which may be a result of the unique probe density and distribution that is characteristic of the photolithographically patterned arrays. The behavior at 22°C is described well by the predictive equations for

  2. Genomic Characterization of Prenatally Detected Chromosomal Structural Abnormalities Using Oligonucleotide Array Comparative Genomic Hybridization

    PubMed Central

    Li, Peining; Pomianowski, Pawel; DiMaio, Miriam S.; Florio, Joanne R.; Rossi, Michael R.; Xiang, Bixia; Xu, Fang; Yang, Hui; Geng, Qian; Xie, Jiansheng; Mahoney, Maurice J.


    Detection of chromosomal structural abnormalities using conventional cytogenetic methods poses a challenge for prenatal genetic counseling due to unpredictable clinical outcomes and risk of recurrence. Of the 1,726 prenatal cases in a 3-year period, we performed oligonucleotide array comparative genomic hybridization (aCGH) analysis on 11 cases detected with various structural chromosomal abnormalities. In nine cases, genomic aberrations and gene contents involving a 3p distal deletion, a marker chromosome from chromosome 4, a derivative chromosome 5 from a 5p/7q translocation, a de novo distal 6q deletion, a recombinant chromosome 8 comprised of an 8p duplication and an 8q deletion, an extra derivative chromosome 9 from an 8p/9q translocation, mosaicism for chromosome 12q with added material of initially unknown origin, an unbalanced 13q/15q rearrangement, and a distal 18q duplication and deletion were delineated. An absence of pathogenic copy number changes was noted in one case with a de novo 11q/14q translocation and in another with a familial insertion of 21q into a 19q. Genomic characterization of the structural abnormalities aided in the prediction of clinical outcomes. These results demonstrated the value of aCGH analysis in prenatal cases with subtle or complex chromosomal rearrangements. Furthermore, a retrospective analysis of clinical indications of our prenatal cases showed that approximately 20% of them had abnormal ultrasound findings and should be considered as high risk pregnancies for a combined chromosome and aCGH analysis. PMID:21671377

  3. VIZARD: analysis of Affymetrix Arabidopsis GeneChip data

    NASA Technical Reports Server (NTRS)

    Moseyko, Nick; Feldman, Lewis J.


    SUMMARY: The Affymetrix GeneChip Arabidopsis genome array has proved to be a very powerful tool for the analysis of gene expression in Arabidopsis thaliana, the most commonly studied plant model organism. VIZARD is a Java program created at the University of California, Berkeley, to facilitate analysis of Arabidopsis GeneChip data. It includes several integrated tools for filtering, sorting, clustering and visualization of gene expression data as well as tools for the discovery of regulatory motifs in upstream sequences. VIZARD also includes annotation and upstream sequence databases for the majority of genes represented on the Affymetrix Arabidopsis GeneChip array. AVAILABILITY: VIZARD is available free of charge for educational, research, and not-for-profit purposes, and can be downloaded at CONTACT:

  4. An imputation approach for oligonucleotide microarrays.


    Li, Ming; Wen, Yalu; Lu, Qing; Fu, Wenjiang J


    Oligonucleotide microarrays are commonly adopted for detecting and qualifying the abundance of molecules in biological samples. Analysis of microarray data starts with recording and interpreting hybridization signals from CEL images. However, many CEL images may be blemished by noises from various sources, observed as "bright spots", "dark clouds", and "shadowy circles", etc. It is crucial that these image defects are correctly identified and properly processed. Existing approaches mainly focus on detecting defect areas and removing affected intensities. In this article, we propose to use a mixed effect model for imputing the affected intensities. The proposed imputation procedure is a single-array-based approach which does not require any biological replicate or between-array normalization. We further examine its performance by using Affymetrix high-density SNP arrays. The results show that this imputation procedure significantly reduces genotyping error rates. We also discuss the necessary adjustments for its potential extension to other oligonucleotide microarrays, such as gene expression profiling. The R source code for the implementation of approach is freely available upon request. PMID:23505547

  5. Validation of the Agilent 244K oligonucleotide array-based comparative genomic hybridization platform for clinical cytogenetic diagnosis.


    Yu, Shihui; Bittel, Douglas C; Kibiryeva, Nataliya; Zwick, David L; Cooley, Linda D


    High-resolution microarray comparative genomic hybridization (aCGH) is being adopted for diagnostic evaluation of genomic disorders, but validation for clinical diagnosis has not yet been reported. We present validation data for the Agilent Human Genome Microarray Kit 244K for clinical application. The platform contains approximately 240,000 distinct 60-mer oligonucleotide probes spanning the entire human genome. We studied 45 previously characterized samples (43 abnormal, 2 normal), 32 with knowledge of prior results and 13 in a blinded manner with 11 performed in a reference laboratory providing microarray testing. Array analysis confirmed known aberrations in 43 samples and a normal result in 2. The array analysis corrected 1 karyotype and clarified 2 additional cases. Array data from 6 patients with 22q11.2 deletion found an average of 2.56 megabases (Mb; range, 2.49-2.62 Mb) with a common 2.43-Mb deleted region. Approximately 7 copy number variants from 400 base pairs to 1.6 Mb were identified per sample. Results demonstrate the usefulness of the aCGH-244K platform as a powerful diagnostic tool. PMID:19687311

  6. Discovery of molecular mechanisms of neuroprotection using cell-based bioassays and oligonucleotide arrays.


    Sarang, Satinder S; Yoshida, Takumi; Cadet, Rodolphe; Valeras, Andrew S; Jensen, Roderick V; Gullans, Steven R


    Oxidative injury and the resulting death of neurons is a major pathological factor involved in numerous neurodegenerative diseases. However, the development of drugs that target this mechanism remains limited. The goal of this study was to test a compound library of approved Food and Drug Administration drugs against a hydrogen peroxide-induced oxidant injury model in neuroblastoma cells. We identified 26 neuroprotective compounds, of which megestrol, meclizine, verapamil, methazolamide, sulindac, and retinol were examined in greater detail. Using large-scale oligonucleotide microarray analysis, we identified genes modulated by these drugs that might underlie the cytoprotection. Five key genes were either uniformly upregulated or downregulated by all six drug treatments, namely, tissue inhibitor of matrix metalloproteinase (TIMP1), ret-proto-oncogene, clusterin, galanin, and growth associated protein (GAP43). Exogenous addition of the neuropeptide galanin alone conferred survival to oxidant-stressed cells, comparable to that seen with the drugs. Our approach, which we term "interventional profiling," represents a general and powerful strategy for identifying new bioactive agents for any biological process, as well as identifying key downstream genes and pathways that are involved. PMID:12388792

  7. Regions of homozygosity identified by oligonucleotide SNP arrays: evaluating the incidence and clinical utility.


    Wang, Jia-Chi; Ross, Leslie; Mahon, Loretta W; Owen, Renius; Hemmat, Morteza; Wang, Boris T; El Naggar, Mohammed; Kopita, Kimberly A; Randolph, Linda M; Chase, John M; Matas Aguilera, Maria J; Siles, Juan López; Church, Joseph A; Hauser, Natalie; Shen, Joseph J; Jones, Marilyn C; Wierenga, Klaas J; Jiang, Zhijie; Haddadin, Mary; Boyar, Fatih Z; Anguiano, Arturo; Strom, Charles M; Sahoo, Trilochan


    Copy neutral segments with allelic homozygosity, also known as regions of homozygosity (ROHs), are frequently identified in cases interrogated by oligonucleotide single-nucleotide polymorphism (oligo-SNP) microarrays. Presence of ROHs may be because of parental relatedness, chromosomal recombination or rearrangements and provides important clues regarding ancestral homozygosity, consanguinity or uniparental disomy. In this study of 14 574 consecutive cases, 832 (6%) were found to harbor one or more ROHs over 10 Mb, of which 651 cases (78%) had multiple ROHs, likely because of identity by descent (IBD), and 181 cases (22%) with ROHs involving a single chromosome. Parental relatedness was predicted to be first degree or closer in 5%, second in 9% and third in 19%. Of the 181 cases, 19 had ROHs for a whole chromosome revealing uniparental isodisomy (isoUPD). In all, 25 cases had significant ROHs involving a single chromosome; 5 cases were molecularly confirmed to have a mixed iso- and heteroUPD15 and 1 case each with segmental UPD9pat and segmental UPD22mat; 17 cases were suspected to have a mixed iso- and heteroUPD including 2 cases with small supernumerary marker and 2 cases with mosaic trisomy. For chromosome 15, 12 (92%) of 13 molecularly studied cases had either Prader-Willi or Angelman syndrome. Autosomal recessive disorders were confirmed in seven of nine cases from eight families because of the finding of suspected gene within a ROH. This study demonstrates that ROHs are much more frequent than previously recognized and often reflect parental relatedness, ascertain autosomal recessive diseases or unravel UPD in many cases. PMID:25118026

  8. Regions of homozygosity identified by oligonucleotide SNP arrays: evaluating the incidence and clinical utility

    PubMed Central

    Wang, Jia-Chi; Ross, Leslie; Mahon, Loretta W; Owen, Renius; Hemmat, Morteza; Wang, Boris T; El Naggar, Mohammed; Kopita, Kimberly A; Randolph, Linda M; Chase, John M; Matas Aguilera, Maria J; Siles, Juan López; Church, Joseph A; Hauser, Natalie; Shen, Joseph J; Jones, Marilyn C; Wierenga, Klaas J; Jiang, Zhijie; Haddadin, Mary; Boyar, Fatih Z; Anguiano, Arturo; Strom, Charles M; Sahoo, Trilochan


    Copy neutral segments with allelic homozygosity, also known as regions of homozygosity (ROHs), are frequently identified in cases interrogated by oligonucleotide single-nucleotide polymorphism (oligo-SNP) microarrays. Presence of ROHs may be because of parental relatedness, chromosomal recombination or rearrangements and provides important clues regarding ancestral homozygosity, consanguinity or uniparental disomy. In this study of 14 574 consecutive cases, 832 (6%) were found to harbor one or more ROHs over 10 Mb, of which 651 cases (78%) had multiple ROHs, likely because of identity by descent (IBD), and 181 cases (22%) with ROHs involving a single chromosome. Parental relatedness was predicted to be first degree or closer in 5%, second in 9% and third in 19%. Of the 181 cases, 19 had ROHs for a whole chromosome revealing uniparental isodisomy (isoUPD). In all, 25 cases had significant ROHs involving a single chromosome; 5 cases were molecularly confirmed to have a mixed iso- and heteroUPD15 and 1 case each with segmental UPD9pat and segmental UPD22mat; 17 cases were suspected to have a mixed iso- and heteroUPD including 2 cases with small supernumerary marker and 2 cases with mosaic trisomy. For chromosome 15, 12 (92%) of 13 molecularly studied cases had either Prader–Willi or Angelman syndrome. Autosomal recessive disorders were confirmed in seven of nine cases from eight families because of the finding of suspected gene within a ROH. This study demonstrates that ROHs are much more frequent than previously recognized and often reflect parental relatedness, ascertain autosomal recessive diseases or unravel UPD in many cases. PMID:25118026

  9. Custom oligonucleotide array-based CGH: a reliable diagnostic tool for detection of exonic copy-number changes in multiple targeted genes

    PubMed Central

    Vasson, Aurélie; Leroux, Céline; Orhant, Lucie; Boimard, Mathieu; Toussaint, Aurélie; Leroy, Chrystel; Commere, Virginie; Ghiotti, Tiffany; Deburgrave, Nathalie; Saillour, Yoann; Atlan, Isabelle; Fouveaut, Corinne; Beldjord, Cherif; Valleix, Sophie; Leturcq, France; Dodé, Catherine; Bienvenu, Thierry; Chelly, Jamel; Cossée, Mireille


    The frequency of disease-related large rearrangements (referred to as copy-number mutations, CNMs) varies among genes, and search for these mutations has an important place in diagnostic strategies. In recent years, CGH method using custom-designed high-density oligonucleotide-based arrays allowed the development of a powerful tool for detection of alterations at the level of exons and made it possible to provide flexibility through the possibility of modeling chips. The aim of our study was to test custom-designed oligonucleotide CGH array in a diagnostic laboratory setting that analyses several genes involved in various genetic diseases, and to compare it with conventional strategies. To this end, we designed a 12-plex CGH array (135k; 135 000 probes/subarray) (Roche Nimblegen) with exonic and intronic oligonucleotide probes covering 26 genes routinely analyzed in the laboratory. We tested control samples with known CNMs and patients for whom genetic causes underlying their disorders were unknown. The contribution of this technique is undeniable. Indeed, it appeared reproducible, reliable and sensitive enough to detect heterozygous single-exon deletions or duplications, complex rearrangements and somatic mosaicism. In addition, it improves reliability of CNM detection and allows determination of boundaries precisely enough to direct targeted sequencing of breakpoints. All of these points, associated with the possibility of a simultaneous analysis of several genes and scalability ‘homemade' make it a valuable tool as a new diagnostic approach of CNMs. PMID:23340513

  10. Using probe secondary structure information to enhance Affymetrix GeneChip background estimates

    PubMed Central

    Gharaibeh, Raad Z.; Fodor, Anthony A.; Gibas, Cynthia J.


    High-density short oligonucleotide microarrays are a primary research tool for assessing global gene expression. Background noise on microarrays comprises a significant portion of the measured raw data. A number of statistical techniques have been developed to correct for this background noise. Here, we demonstrate that probe minimum folding energy and structure can be used to enhance a previously existing model for background noise correction. We estimate that probe secondary structure accounts for up to 3% of all variation on Affymetrix microarrays. PMID:17387043

  11. Micro-Analyzer: automatic preprocessing of Affymetrix microarray data.


    Guzzi, Pietro Hiram; Cannataro, Mario


    A current trend in genomics is the investigation of the cell mechanism using different technologies, in order to explain the relationship among genes, molecular processes and diseases. For instance, the combined use of gene-expression arrays and genomic arrays has been demonstrated as an effective instrument in clinical practice. Consequently, in a single experiment different kind of microarrays may be used, resulting in the production of different types of binary data (images and textual raw data). The analysis of microarray data requires an initial preprocessing phase, that makes raw data suitable for use on existing analysis platforms, such as the TIGR M4 (TM4) Suite. An additional challenge to be faced by emerging data analysis platforms is the ability to treat in a combined way those different microarray formats coupled with clinical data. In fact, resulting integrated data may include both numerical and symbolic data (e.g. gene expression and SNPs regarding molecular data), as well as temporal data (e.g. the response to a drug, time to progression and survival rate), regarding clinical data. Raw data preprocessing is a crucial step in analysis but is often performed in a manual and error prone way using different software tools. Thus novel, platform independent, and possibly open source tools enabling the semi-automatic preprocessing and annotation of different microarray data are needed. The paper presents Micro-Analyzer (Microarray Analyzer), a cross-platform tool for the automatic normalization, summarization and annotation of Affymetrix gene expression and SNP binary data. It represents the evolution of the μ-CS tool, extending the preprocessing to SNP arrays that were not allowed in μ-CS. The Micro-Analyzer is provided as a Java standalone tool and enables users to read, preprocess and analyse binary microarray data (gene expression and SNPs) by invoking TM4 platform. It avoids: (i) the manual invocation of external tools (e.g. the Affymetrix Power


    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have evaluated the new Swine Protein-Annotated Oligonucleotide Microarray ( by analyzing transcriptional profiles for longissimus dorsi muscle (LD), Bronchial lymph node (BLN) and Lung. Four LD samples were used to assess the stringency of hybridization conditions com...

  13. Motif effects in Affymetrix GeneChips seriously affect probe intensities

    PubMed Central

    Upton, Graham J. G.; Harrison, Andrew P.


    An Affymetrix GeneChip consists of an array of hundreds of thousands of probes (each a sequence of 25 bases) with the probe values being used to infer the extent to which genes are expressed in the biological material under investigation. In this article, we demonstrate that these probe values are also strongly influenced by their precise base sequence. We use data from >28 000 CEL files relating to 10 different Affymetrix GeneChip platforms and involving nearly 1000 experiments. Our results confirm known effects (those due to the T7-primer and the formation of G-quadruplexes) but reveal other effects. We show that there can be huge variations from one experiment to another, and that there may also be sizeable disparities between batches within an experiment and between CEL files within a batch. PMID:22904084

  14. Guidelines for Optimisation of a Multiplex Oligonucleotide Ligation-PCR for Characterisation of Microbial Pathogens in a Microsphere Suspension Array

    PubMed Central

    Wuyts, Véronique; Roosens, Nancy H. C.; Marchal, Kathleen; De Keersmaecker, Sigrid C. J.


    With multiplex oligonucleotide ligation-PCR (MOL-PCR) different molecular markers can be simultaneously analysed in a single assay and high levels of multiplexing can be achieved in high-throughput format. As such, MOL-PCR is a convenient solution for microbial detection and identification assays where many markers should be analysed, including for routine further characterisation of an identified microbial pathogenic isolate. For an assay aimed at routine use, optimisation in terms of differentiation between positive and negative results and of cost and effort is indispensable. As MOL-PCR includes a multiplex ligation step, followed by a singleplex PCR and analysis with microspheres on a Luminex device, several parameters are accessible for optimisation. Although MOL-PCR performance may be influenced by the markers used in the assay and the targeted bacterial species, evaluation of the method of DNA isolation, the probe concentration, the amount of microspheres, and the concentration of reporter dye is advisable in the development of any MOL-PCR assay. Therefore, we here describe our observations made during the optimisation of a 20-plex MOL-PCR assay for subtyping of Salmonella Typhimurium with the aim to provide a possible workflow as guidance for the development and optimisation of a MOL-PCR assay for the characterisation of other microbial pathogens. PMID:25705689

  15. A Brassica Exon Array for Whole-Transcript Gene Expression Profiling

    PubMed Central

    Love, Christopher G.; Graham, Neil S.; Ó Lochlainn, Seosamh; Bowen, Helen C.; May, Sean T.; White, Philip J.


    Affymetrix GeneChip® arrays are used widely to study transcriptional changes in response to developmental and environmental stimuli. GeneChip® arrays comprise multiple 25-mer oligonucleotide probes per gene and retain certain advantages over direct sequencing. For plants, there are several public GeneChip® arrays whose probes are localised primarily in 3′ exons. Plant whole-transcript (WT) GeneChip® arrays are not yet publicly available, although WT resolution is needed to study complex crop genomes such as Brassica, which are typified by segmental duplications containing paralogous genes and/or allopolyploidy. Available sequence data were sampled from the Brassica A and C genomes, and 142,997 gene models identified. The assembled gene models were then used to establish a comprehensive public WT exon array for transcriptomics studies. The Affymetrix GeneChip® Brassica Exon 1.0 ST Array is a 5 µM feature size array, containing 2.4 million 25-base oligonucleotide probes representing 135,201 gene models, with 15 probes per gene distributed among exons. Discrimination of the gene models was based on an E-value cut-off of 1E−5, with ≤98% sequence identity. The 135 k Brassica Exon Array was validated by quantifying transcriptome differences between leaf and root tissue from a reference Brassica rapa line (R-o-18), and categorisation by Gene Ontologies (GO) based on gene orthology with Arabidopsis thaliana. Technical validation involved comparison of the exon array with a 60-mer array platform using the same starting RNA samples. The 135 k Brassica Exon Array is a robust platform. All data relating to the array design and probe identities are available in the public domain and are curated within the BrassEnsembl genome viewer at PMID:20862292

  16. High-resolution SNP arrays in mental retardation diagnostics: how much do we gain?

    PubMed Central

    Bernardini, Laura; Alesi, Viola; Loddo, Sara; Novelli, Antonio; Bottillo, Irene; Battaglia, Agatino; Digilio, Maria Cristina; Zampino, Giuseppe; Ertel, Adam; Fortina, Paolo; Surrey, Saul; Dallapiccola, Bruno


    We used Affymetrix 6.0 GeneChip SNP arrays to characterize copy number variations (CNVs) in a cohort of 70 patients previously characterized on lower-density oligonucleotide arrays affected by idiopathic mental retardation and dysmorphic features. The SNP array platform includes ∼900 000 SNP probes and 900 000 non-SNP oligonucleotide probes at an average distance of 0.7 Kb, which facilitates coverage of the whole genome, including coding and noncoding regions. The high density of probes is critical for detecting small CNVs, but it can lead to data interpretation problems. To reduce the number of false positives, parameters were set to consider only imbalances >75 Kb encompassing at least 80 probe sets. The higher resolution of the SNP array platform confirmed the increased ability to detect small CNVs, although more than 80% of these CNVs overlapped to copy number ‘neutral' polymorphism regions and 4.4% of them did not contain known genes. In our cohort of 70 patients, of the 51 previously evaluated as ‘normal' on the Agilent 44K array, the SNP array platform disclosed six additional CNV changes, including three in three patients, which may be pathogenic. This suggests that about 6% of individuals classified as ‘normal' using the lower-density oligonucleotide array could be found to be affected by a genomic disorder when evaluated with the higher-density microarray platforms. PMID:19809473

  17. Application of Sequence-Specific Labeled 16S rRNA Gene Oligonucleotide Probes for Genetic Profiling of Cyanobacterial Abundance and Diversity by Array Hybridization

    PubMed Central

    Rudi, Knut; Skulberg, Olav M.; Skulberg, Randi; Jakobsen, Kjetill S.


    DNA sequence information for the small-subunit rRNA gene (16S rDNA) obtained from cyanobacterial cultures was used to investigate the presence of cyanobacteria and their abundance in natural habitats. Eight planktonic communities developing in lakes characterized by relatively low algal biomass (mesotrophic) and in lakes with correspondingly high biomass (eutrophic) were selected for the study. The organismal compositions of the water samples were analyzed genetically, using multiplex sequence-specific labeling of oligonucleotide probes targeted to 16S rDNA and subsequent hybridization of the labeled probes to their respective complements spotted onto a solid support (DNA array). Ten probes were established to determine the relative abundances of the discernible cyanobacteria encountered in the selected lakes. The probes were generally specific for their targets, as determined through analyses of clone cultures. Reproducible abundance profiles were established for the lakes investigated in the subsequent analyses of natural cyanobacterial communities. The results from the genetic analyses were then compared with information obtained from standard hydrobiological and hydrochemical analyses. Qualitatively, there were relatively good correlations among the groups of organisms (Nostoc, Microcystis, and Planktothrix species) found in the different lakes. The levels of correlation were lower for the quantitative data. This may, however, be due to differences in sample processing technique. The conclusions from these comparisons are that the genetic abundance profiles may provide a foundation for separating and quantifying genetically distinct groups of cyanobacteria in their natural habitats. PMID:10966421

  18. Cytokines and therapeutic oligonucleotides.


    Hartmann, G; Bidlingmaier, M; Eigler, A; Hacker, U; Endres, S


    Therapeutic oligonucleotides - short strands of synthetic nucleic acids - encompass antisense and aptamer oligonucleotides. Antisense oligonucleotides are designed to bind to target RNA by complementary base pairing and to inhibit translation of the target protein. Antisense oligonucleotides enable specific inhibition of cytokine synthesis. In contrast, aptamer oligonucleotides are able to bind directly to specific proteins. This binding depends on the sequence of the oligonucleotide. Aptamer oligonucleotides with CpG motifs can exert strong immunostimulatory effects. Both kinds of therapeutic oligonucleotides - antisense and aptamer oligonucleotides - provide promising tools to modulate immunological functions. Recently, therapeutic oligonucleotides have moved towards clinical application. An antisense oligonucleotide directed against the proinflammatory intercellular adhesion molecule 1 (ICAM-1) is currently being tested in clinical trials for therapy of inflammatory disease. Immunostimulatory aptamer oligonucleotides are in preclinical development for immunotherapy. In the present review we summarize the application of therapeutic oligonucleotides to modulate immunological functions. We include technological aspects as well as current therapeutic concepts and clinical studies. PMID:9740353

  19. Pigeons: A Novel GUI Software for Analysing and Parsing High Density Heterologous Oligonucleotide Microarray Probe Level Data

    PubMed Central

    Lai, Hung-Ming; May, Sean T.; Mayes, Sean


    Genomic DNA-based probe selection by using high density oligonucleotide arrays has recently been applied to heterologous species (Xspecies). With the advent of this new approach, researchers are able to study the genome and transcriptome of a non-model or an underutilised crop species through current state-of-the-art microarray platforms. However, a software package with a graphical user interface (GUI) to analyse and parse the oligonucleotide probe pair level data is still lacking when an experiment is designed on the basis of this cross species approach. A novel computer program called Pigeons has been developed for customised array data analysis to allow the user to import and analyse Affymetrix GeneChip® probe level data through XSpecies. One can determine empirical boundaries for removing poor probes based on genomic hybridisation of the test species to the Xspecies array, followed by making a species-specific Chip Description File (CDF) file for transcriptomics in the heterologous species, or Pigeons can be used to examine an experimental design to identify potential Single-Feature Polymorphisms (SFPs) at the DNA or RNA level. Pigeons is also focused around visualization and interactive analysis of the datasets. The software with its manual (the current release number version 1.2.1) is freely available at the website of the Nottingham Arabidopsis Stock Centre (NASC).

  20. Application of oligonucleotide array CGH to the simultaneous detection of a deletion in the nuclear TK2 gene and mtDNA depletion.


    Zhang, Shulin; Li, Fang-Yuan; Bass, Harold N; Pursley, Amber; Schmitt, Eric S; Brown, Blaire L; Brundage, Ellen K; Mardach, Rebecca; Wong, Lee-Jun


    Thymidine kinase 2 (TK2), encoded by the TK2 gene on chromosome 16q22, is one of the deoxyribonucleoside kinases responsible for the maintenance of mitochondrial deoxyribonucleotide pools. Defects in TK2 mainly cause a myopathic form of the mitochondrial DNA depletion syndrome (MDDS). Currently, only point mutations and small insertions and deletions have been reported in TK2 gene; gross rearrangements of TK2 gene and possible hepatic involvement in patients with TK2 mutations have not been described. We report a non-consanguineous Jordanian family with three deceased siblings due to mtDNA depletion. Sequence analysis of the father detected a heterozygous c.761T>A (p.I254N) mutation in his TK2 gene; however, point mutations in the mother were not detected. Subsequent gene dosage analysis using oligonucleotide array CGH identified an intragenic approximately 5.8-kb deletion encompassing the 5'UTR to intron 2 of her TK2 gene. Sequence analysis confirmed that the deletion spans c.1-495 to c.283-2899 of the TK2 gene (nucleotide 65,136,256-65,142,086 of chromosome 16). Analysis of liver and muscle specimens from one of the deceased infants in this family revealed compound heterozygosity for the paternal point mutation and maternal intragenic deletion. In addition, a significant reduction of the mtDNA content in liver and muscle was detected (10% and 20% of age- and tissue-matched controls, respectively). Prenatal diagnosis was performed in the third pregnancy. The fetus was found to carry both the point mutation and the deletion. This child died 6months after birth due to myopathy. A serum specimen demonstrated elevated liver transaminases in two of the infants from whom results were available. This report expands the mutation spectrum associated with TK2 deficiency. While the myopathic form of MDDS appears to be the main phenotype of TK2 mutations, liver dysfunction may also be a part of the mitochondrial depletion syndrome caused by TK2 gene defects. PMID:19815440

  1. Using The Affymetrix Wheat Microarray As An Oat Expression Platform

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Recent advances in sequencing have resulted in the sequence of a large number of plant expressed sequence tags (ESTs) to entire plant genomes. Using these EST sequences, oligonucleotide microarray chips have been developed for several species including barley (Hordeum vulgare), maize (Zea mays), ric...

  2. Axiom turkey genotyping array

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Axiom®Turkey Genotyping Array interrogates 643,845 probesets on the array, covering 643,845 SNPs. The array development was led by Dr. Julie Long of the USDA-ARS Beltsville Agricultural Research Center under a public-private partnership with Hendrix Genetics, Aviagen, and Affymetrix. The Turk...


    Technology Transfer Automated Retrieval System (TEKTRAN)

    CEL_Interrogator Package is a suite of programs designed to extract the average probe intensity and other information for each probe sequence from an Affymetrix GeneChip CEL file and unite them with their human-readable Affymetrix consensus sequence names. The resulting text file is suitable for di...

  4. Development and application of a 6.5 million feature Affymetrix Genechip® for massively parallel discovery of single position polymorphisms in lettuce (Lactuca spp.)

    PubMed Central


    . Conclusion By hybridizing genomic DNA to a custom oligonucleotide array designed for maximum gene coverage, we were able to identify polymorphisms using two approaches for pair-wise comparisons, as well as a highly parallel method that compared all 52 genotypes simultaneously. PMID:22583801

  5. Template-Directed Ligation of Peptides to Oligonucleotides

    NASA Technical Reports Server (NTRS)

    Bruick, Richard K.; Dawson, Philip E.; Kent, Stephen BH; Usman, Nassim; Joyce, Gerald F.


    Synthetic oligonucleotides and peptides have enjoyed a wide range of applications in both biology and chemistry. As a consequence, oligonucleotide-peptide conjugates have received considerable attention, most notably in the development of antisense constructs with improved pharmacological properties. In addition, oligonucleotide-peptide conjugates have been used as molecular tags, in the assembly of supramolecular arrays and in the construction of encoded combinatorial libraries. To make these chimeric molecules more accessible for a broad range of investigations, we sought to develop a facile method for joining fully deprotected oligonucleotides and peptides through a stable amide bond linkage. Furthermore, we wished to make this ligation reaction addressable, enabling one to direct the ligation of specific oligonucleotide and peptide components.To confer specificity and accelerate the rate of the reaction, the ligation process was designed to be dependent on the presence of a complementary oligonucleotide template.

  6. Cross reactive arrays of three-way junction sensors for steroid determination

    NASA Technical Reports Server (NTRS)

    Stojanovic, Milan N. (Inventor); Landry, Donald (Inventor); Nikic, Dragan B. (Inventor)


    This invention provides analyte sensitive oligonucleotide compositions for detecting and analyzing analytes in solution, including complex solutions using cross reactive arrays of analyte sensitive oligonucleotide compositions.


    PubMed Central

    Lee, Myoyong; Xiang, Charlie C.; Trent, Jeffrey M.; Bittner, Michael L.


    Microarray fabrication using pre-synthesized long oligonucleotide is becoming increasingly important, but a study of large-scale array productions is not published yet. We addressed the issue of fabricating oligonucleotide microarrays by spotting commercial, pre-synthesized 65-mers with 5′ amines representing 7500 murine genes. Amine-modified oligonucleotides were immobilized on glass slides having aldehyde groups via transient Schiff base formation followed by reduction to produce a covalent conjugate. When RNA derived from the same source was used for Cy3 and Cy5 labeling and hybridized to the same array, signal intensities spanning three orders of magnitude were observed, and the coefficient of variation between the two channels for all spots was 8–10%. To ascertain the reproducibility of ratio determination of these arrays, two triplicate hybridizations (with fluorochrome reversal) comparing RNAs from a fibroblast (NIH3T3) and a breast cancer (JC) cell line were carried out. The 95% confidence interval for all spots in the six hybridizations was 0.60 – 1.66. This level of reproducibility allows use of the full range of pattern finding and discriminant analysis typically applied to cDNA microarrays. Further comparative testing was carried out with oligonucleotide microarrays, cDNA microarrays and RT-PCR assays to examine the comparability of results across these different methodologies. PMID:17617369

  8. Starr: Simple Tiling ARRay analysis of Affymetrix ChIP-chip data

    PubMed Central


    Background Chromatin immunoprecipitation combined with DNA microarrays (ChIP-chip) is an assay used for investigating DNA-protein-binding or post-translational chromatin/histone modifications. As with all high-throughput technologies, it requires thorough bioinformatic processing of the data for which there is no standard yet. The primary goal is to reliably identify and localize genomic regions that bind a specific protein. Further investigation compares binding profiles of functionally related proteins, or binding profiles of the same proteins in different genetic backgrounds or experimental conditions. Ultimately, the goal is to gain a mechanistic understanding of the effects of DNA binding events on gene expression. Results We present a free, open-source R/Bioconductor package Starr that facilitates comparative analysis of ChIP-chip data across experiments and across different microarray platforms. The package provides functions for data import, quality assessment, data visualization and exploration. Starr includes high-level analysis tools such as the alignment of ChIP signals along annotated features, correlation analysis of ChIP signals with complementary genomic data, peak-finding and comparative display of multiple clusters of binding profiles. It uses standard Bioconductor classes for maximum compatibility with other software. Moreover, Starr automatically updates microarray probe annotation files by a highly efficient remapping of microarray probe sequences to an arbitrary genome. Conclusion Starr is an R package that covers the complete ChIP-chip workflow from data processing to binding pattern detection. It focuses on the high-level data analysis, e.g., it provides methods for the integration and combined statistical analysis of binding profiles and complementary functional genomics data. Starr enables systematic assessment of binding behaviour for groups of genes that are alingned along arbitrary genomic features. PMID:20398407

  9. Pentopyranosyl Oligonucleotide Systems

    NASA Technical Reports Server (NTRS)

    Reck, Folkert; Kudick, Rene; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert; Wippo, Harald


    To determine whether the remarkable chemical properties of the pyranosyl isomer of RNA as an informational Watson-Crick base-pairing system are unique to the pentopyranosyl-(4 + 2)-oligonucleotide isomer derived from the RNA-building block D-ribose, studies on the entire family of diastereoisomeric pyranosyL(4 - Z)-oligonucleotide systems deriving from D-ribose. L-lyxose. D-xylose, and L-arabinose were carried out. The result of these extended studies is unambiguous: not only pyranosyl-RNA, but all members of the pentopyranosyl(4 + 2)-oligonucleotide family are highly efficient Watson-Crick base-pairing systems. Their synthesis and pairing properties will be described in a series of publications in this journal.

  10. Poly(oligonucleotide)

    PubMed Central


    Here we report the preparation of poly(oligonucleotide) brush polymers and amphiphilic brush copolymers from nucleic acid monomers via graft-through polymerization. We describe the polymerization of PNA-norbornyl monomers to yield poly-PNA (poly(peptide nucleic acid)) via ring-opening metathesis polymerization (ROMP) with the initiator, (IMesH2)(C5H5N)2(Cl)2RuCHPh.1 In addition, we present the preparation of poly-PNA nanoparticles from amphiphilic block copolymers and describe their hybridization to a complementary single-stranded DNA (ssDNA) oligonucleotide. PMID:25077676

  11. The delivery of therapeutic oligonucleotides.


    Juliano, Rudolph L


    The oligonucleotide therapeutics field has seen remarkable progress over the last few years with the approval of the first antisense drug and with promising developments in late stage clinical trials using siRNA or splice switching oligonucleotides. However, effective delivery of oligonucleotides to their intracellular sites of action remains a major issue. This review will describe the biological basis of oligonucleotide delivery including the nature of various tissue barriers and the mechanisms of cellular uptake and intracellular trafficking of oligonucleotides. It will then examine a variety of current approaches for enhancing the delivery of oligonucleotides. This includes molecular scale targeted ligand-oligonucleotide conjugates, lipid- and polymer-based nanoparticles, antibody conjugates and small molecules that improve oligonucleotide delivery. The merits and liabilities of these approaches will be discussed in the context of the underlying basic biology. PMID:27084936

  12. High-resolution oligonucleotide array comparative genomic hybridization study and methylation status of the RPS14 gene in de novo myelodysplastic syndromes.


    Borze, Ioana; Juvonen, Eeva; Ninomiya, Shinsuke; Jee, Kowan Ja; Elonen, Erkki; Knuutila, Sakari


    In myelodysplastic syndromes (MDS), close to one half of patients do not have any visible karyotypic change. In order to study submicroscopic genomic alterations, we applied high-resolution array comparative genomic hybridization techniques (aCGH) in 37 patients with de novo MDS. Furthermore, we studied the methylation status of the RPS14 gene in 5q deletion (5q21.3q33.1) in 24 patients. In all, 21 of the 37 patients (57%) had copy number alterations. The most frequent copy number losses with minimal common overlapping areas were 5q21.3q33.1 (21%) and 7q22.1q33 (19%); the most frequent copy number gain was gain of the whole chromosome 8 (8%). Recurrent, but less frequent copy number losses were detected in two cases each: 11q14.1q22.1, 11q22.3q24.2, 12p12.2p13.31, 17p13.2, 18q12.1q12.2, 18q12.3q21.3, 18q21.2qter, and 20q11.23q12; the gains 8p23.2pter, 8p22p23.1, 8p12p21.1, and 8p11.21q21.2 were similarly found in two cases each. No homozygous losses or amplifications were observed. The RPS14 gene was not methylated in any of the patients. PMID:20193850

  13. Development of a human mitochondrial oligonucleotide microarray (h-MitoArray) and gene expression analysis of fibroblast cell lines from 13 patients with isolated F1Fo ATP synthase deficiency

    PubMed Central

    Čížková, Alena; Stránecký, Viktor; Ivánek, Robert; Hartmannová, Hana; Nosková, Lenka; Piherová, Lenka; Tesařová, Markéta; Hansíková, Hana; Honzík, Tomáš; Zeman, Jiří; Divina, Petr; Potocká, Andrea; Paul, Jan; Sperl, Wolfgang; Mayr, Johannes A; Seneca, Sara; Houštĕk, Josef; Kmoch, Stanislav


    Background To strengthen research and differential diagnostics of mitochondrial disorders, we constructed and validated an oligonucleotide microarray (h-MitoArray) allowing expression analysis of 1632 human genes involved in mitochondrial biology, cell cycle regulation, signal transduction and apoptosis. Using h-MitoArray we analyzed gene expression profiles in 9 control and 13 fibroblast cell lines from patients with F1Fo ATP synthase deficiency consisting of 2 patients with mt9205ΔTA microdeletion and a genetically heterogeneous group of 11 patients with not yet characterized nuclear defects. Analysing gene expression profiles, we attempted to classify patients into expected defect specific subgroups, and subsequently reveal group specific compensatory changes, identify potential phenotype causing pathways and define candidate disease causing genes. Results Molecular studies, in combination with unsupervised clustering methods, defined three subgroups of patient cell lines – M group with mtDNA mutation and N1 and N2 groups with nuclear defect. Comparison of expression profiles and functional annotation, gene enrichment and pathway analyses of differentially expressed genes revealed in the M group a transcription profile suggestive of synchronized suppression of mitochondrial biogenesis and G1/S arrest. The N1 group showed elevated expression of complex I and reduced expression of complexes III, V, and V-type ATP synthase subunit genes, reduced expression of genes involved in phosphorylation dependent signaling along MAPK, Jak-STAT, JNK, and p38 MAP kinase pathways, signs of activated apoptosis and oxidative stress resembling phenotype of premature senescent fibroblasts. No specific functionally meaningful changes, except of signs of activated apoptosis, were detected in the N2 group. Evaluation of individual gene expression profiles confirmed already known ATP6/ATP8 defect in patients from the M group and indicated several candidate disease causing genes for

  14. DNA analysis and diagnostics on oligonucleotide microchips.

    PubMed Central

    Yershov, G; Barsky, V; Belgovskiy, A; Kirillov, E; Kreindlin, E; Ivanov, I; Parinov, S; Guschin, D; Drobishev, A; Dubiley, S; Mirzabekov, A


    We present a further development in the technology of sequencing by hybridization to oligonucleotide microchips (SHOM) and its application to diagnostics for genetic diseases. A robot has been constructed to manufacture sequencing "microchips." The microchip is an array of oligonucleotides immobilized into gel elements fixed on a glass plate. Hybridization of the microchip with fluorescently labeled DNA was monitored in real time simultaneously for all microchip elements with a two-wavelength fluorescent microscope equipped with a charge-coupled device camera. SHOM has been used to detect beta-thalassemia mutations in patients by hybridizing PCR-amplified DNA with the microchips. A contiguous stacking hybridization technique has been applied for the detection of mutations; it can simplify medical diagnostics and enhance its reliability. The use of multicolor monitoring of contiguous stacking hybridization is suggested for large-scale diagnostics and gene polymorphism studies. Other applications of the SHOM technology are discussed. Images Fig. 2 Fig. 3 Fig. 4 PMID:8643503

  15. Normalization of Affymetrix miRNA Microarrays for the Analysis of Cancer Samples.


    Wu, Di; Gantier, Michael P


    microRNA (miRNA) microarray normalization is a critical step for the identification of truly differentially expressed miRNAs. This is particularly important when dealing with cancer samples that have a global miRNA decrease. In this chapter, we provide a simple step-by-step procedure that can be used to normalize Affymetrix miRNA microarrays, relying on robust normal-exponential background correction with cyclic loess normalization. PMID:25971910

  16. Fluorescent oligonucleotides can serve as suitable alternatives to radiolabeled oligonucleotides.


    Ballal, Rahul; Cheema, Amrita; Ahmad, Waaqar; Rosen, Eliot M; Saha, Tapas


    Prolonged exposure to radiation from radionuclei used in medical research can cause DNA damage and mutation, which lead to several diseases including cancer. Radioactivity-based experiments are expensive and associated with specialized training, dedication of instruments, approvals, and cleanup with potential hazardous waste. The objective of this study was to find an alternative to the use of radioactivity in medical research using nucleic acid chemistry. FITC-labeled oligonucleotides that contain wild-type (wt) and modified base (8-oxo-G) at the same position and their complementary unlabeled strand were synthesized. Purified DNA repair enzyme, OGG1, and nuclear lysates from MCF-7 breast cancer cells were incubated with double-stranded FITC-labeled wt and 8-oxo-G oligonucleotide to demonstrate the OGG1 incision assay. We found that FITC-coupled oligonucleotides do not impose a steric hindrance during duplex formation, and the fluorescence intensity of the oligonucleotide is comparable with the intensity of the radioactive oligonucleotide. Moreover, we have seen that the OGG1 incision assay can be performed using these fluorescence oligonucleotides, replacing conventional use of radiolabeled oligonucleotides in the assay. Although the use of fluorescent-labeled oligonucleotides was described in detail for incision assays, the technique can be applied to replace a broad range of experiments, where radioactive oligonucleotides are used, eliminating the hazardous consequences of radiation. PMID:19721820

  17. Identification of Medically Important Molds by an Oligonucleotide Array†

    PubMed Central

    Hsiao, Chen Ren; Huang, Liyin; Bouchara, Jean-Philippe; Barton, Richard; Li, Hsin Chieh; Chang, Tsung Chain


    Infections caused by fungi have increased in recent years. Accurate and rapid identification of fungal pathogens is important for appropriate treatment with antifungal agents. On the basis of the internal transcribed spacer 1 (ITS 1) and ITS 2 sequences of the rRNA genes, an oligonucleotide array was developed to identify 64 species (32 genera) of clinically important filamentous (or dimorphic) fungi. These 64 species included fungi causing superficial, cutaneous, subcutaneous, and invasive infections. The method consisted of PCR amplification of the ITS regions using a pair of universal primers, followed by hybridization of the digoxigenin-labeled PCR products to a panel of species- or group-specific oligonucleotides immobilized on a nylon membrane. Of 397 fungal strains (290 target and 107 nontarget strains) tested, the sensitivity and specificity of the array was 98.3% (285/290) and 98.1% (105/107), respectively. Misidentified strains were usually those belonging to the same genus of the target species or having partial homology with oligonucleotide probes on the membrane. The whole procedure can be finished within 24 h starting from isolated colonies; reproductive structures, which are essential for the conventional identification methods, are not needed. In conclusion, the present array is a powerful tool for identification of clinically important filamentous fungi and may have the potential to be continually extended by adding further oligonucleotides to the array without significantly increasing the cost or complexity. PMID:16081907

  18. Particle-Based Microarrays of Oligonucleotides and Oligopeptides

    PubMed Central

    Nesterov-Mueller, Alexander; Maerkle, Frieder; Hahn, Lothar; Foertsch, Tobias; Schillo, Sebastian; Bykovskaya, Valentina; Sedlmayr, Martyna; Weber, Laura K.; Ridder, Barbara; Soehindrijo, Miriam; Muenster, Bastian; Striffler, Jakob; Bischoff, F. Ralf; Breitling, Frank; Loeffler, Felix F.


    In this review, we describe different methods of microarray fabrication based on the use of micro-particles/-beads and point out future tendencies in the development of particle-based arrays. First, we consider oligonucleotide bead arrays, where each bead is a carrier of one specific sequence of oligonucleotides. This bead-based array approach, appearing in the late 1990s, enabled high-throughput oligonucleotide analysis and had a large impact on genome research. Furthermore, we consider particle-based peptide array fabrication using combinatorial chemistry. In this approach, particles can directly participate in both the synthesis and the transfer of synthesized combinatorial molecules to a substrate. Subsequently, we describe in more detail the synthesis of peptide arrays with amino acid polymer particles, which imbed the amino acids inside their polymer matrix. By heating these particles, the polymer matrix is transformed into a highly viscous gel, and thereby, imbedded monomers are allowed to participate in the coupling reaction. Finally, we focus on combinatorial laser fusing of particles for the synthesis of high-density peptide arrays. This method combines the advantages of particles and combinatorial lithographic approaches.

  19. Current progress on aptamer-targeted oligonucleotide therapeutics

    PubMed Central

    Dassie, Justin P; Giangrande, Paloma H


    Exploiting the power of the RNAi pathway through the use of therapeutic siRNA drugs has remarkable potential for treating a vast array of human disease conditions. However, difficulties in delivery of these and similar nucleic acid-based pharmacological agents to appropriate organs or tissues, remains a major impediment to their broad clinical application. Synthetic nucleic acid ligands (aptamers) have emerged as effective delivery vehicles for therapeutic oligonucleotides, including siRNAs. In this review, we summarize recent attractive developments in creatively employing cell-internalizing aptamers to deliver therapeutic oligonucleotides (e.g., siRNAs, miRNAs, anti-miRs and antisense oligos) to target cells. We also discuss advancements in aptamer-siRNA chimera technology, as well as, aptamer-functionalized nanoparticles for siRNA delivery. In addition, the challenges and future prospects of aptamer-targeted oligonucleotide drugs for clinical translation are further highlighted. PMID:24304250

  20. Heterologous oligonucleotide microarrays for transcriptomics in a non-model species; a proof-of-concept study of drought stress in Musa

    PubMed Central

    Davey, Mark W; Graham, Neil S; Vanholme, Bartel; Swennen, Rony; May, Sean T; Keulemans, Johan


    Background 'Systems-wide' approaches such as microarray RNA-profiling are ideally suited to the study of the complex overlapping responses of plants to biotic and abiotic stresses. However, commercial microarrays are only available for a limited number of plant species and development costs are so substantial as to be prohibitive for most research groups. Here we evaluate the use of cross-hybridisation to Affymetrix oligonucleotide GeneChip® microarrays to profile the response of the banana (Musa spp.) leaf transcriptome to drought stress using a genomic DNA (gDNA)-based probe-selection strategy to improve the efficiency of detection of differentially expressed Musa transcripts. Results Following cross-hybridisation of Musa gDNA to the Rice GeneChip® Genome Array, ~33,700 gene-specific probe-sets had a sufficiently high degree of homology to be retained for transcriptomic analyses. In a proof-of-concept approach, pooled RNA representing a single biological replicate of control and drought stressed leaves of the Musa cultivar 'Cachaco' were hybridised to the Affymetrix Rice Genome Array. A total of 2,910 Musa gene homologues with a >2-fold difference in expression levels were subsequently identified. These drought-responsive transcripts included many functional classes associated with plant biotic and abiotic stress responses, as well as a range of regulatory genes known to be involved in coordinating abiotic stress responses. This latter group included members of the ERF, DREB, MYB, bZIP and bHLH transcription factor families. Fifty-two of these drought-sensitive Musa transcripts were homologous to genes underlying QTLs for drought and cold tolerance in rice, including in 2 instances QTLs associated with a single underlying gene. The list of drought-responsive transcripts also included genes identified in publicly-available comparative transcriptomics experiments. Conclusion Our results demonstrate that despite the general paucity of nucleotide sequence data in

  1. Evaluation of the Affymetrix CytoScan® Dx Assay for Developmental Delay

    PubMed Central

    Webb, Bryn D.; Scharf, Rebecca J.; Spear, Emily A.; Edelmann, Lisa J.; Stroustrup, Annemarie


    The goal of molecular cytogenetic testing for children presenting with developmental delay is to identify or exclude genetic abnormalities that are associated with cognitive, behavioral, and/or motor symptoms. Until 2010, chromosome analysis was the standard first-line genetic screening test for evaluation of patients with developmental delay when a specific syndrome was not suspected. In 2010, The American College of Medical Genetics and several other groups recommended chromosomal microarray (CMA) as the first-line test in children with developmental delays, multiple congenital anomalies, and/or autism. This test is able to detect regions of genomic imbalances at a much finer resolution than G-banded karyotyping. Until recently, no CMA testing had been approved by the United States Food and Drug Administration (FDA). This review will focus on the use of the Affymetrix CytoScan® Dx Assay, the first CMA to receive FDA approval for the genetic evaluation of individuals with developmental delay. PMID:25350348

  2. The efficacy of detecting variants with small effects on the Affymetrix 6.0 platform using pooled DNA

    PubMed Central

    Chiang, Charleston W. K.; Gajdos, Zofia K. Z.; Butler, Johannah L.; Hackett, Rachel; Guiducci, Candace; Nguyen, Thutrang T.; Wilks, Rainford; Forrester, Terrence; Henderson, Katherine D.; Le Marchand, Loic; Henderson, Brian E.; Haiman, Christopher A.; Cooper, Richard S.; Lyon, Helen N.; Zhu, Xiaofeng; McKenzie, Colin A.; Palmer, Mark R.; Hirschhorn, Joel N.


    Genome-wide genotyping of a cohort using pools rather than individual samples has long been proposed as a cost-saving alternative for performing genome-wide association (GWA) studies. However, successful disease gene mapping using pooled genotyping has thus far been limited to detecting common variants with large effect sizes, which tend not to exist for many complex common diseases or traits. Therefore, for DNA pooling to be a viable strategy for conducting GWA studies, it is important to determine whether commonly used genome-wide SNP array platforms such as the Affymetrix 6.0 array can reliably detect common variants of small effect sizes using pooled DNA. Taking obesity and age at menarche as examples of human complex traits, we assessed the feasibility of genome-wide genotyping of pooled DNA as a single-stage design for phenotype association. By individually genotyping the top associations identified by pooling, we obtained a 14- to 16-fold enrichment of SNPs nominally associated with the phenotype, but we likely missed the top true associations. In addition, we assessed whether genotyping pooled DNA can serve as an inexpensive screen as the second stage of a multi-stage design with a large number of samples by comparing the most cost-effective 3-stage designs with 80% power to detect common variants with genotypic relative risk of 1.1, with and without pooling. Given the current state of the specific technology we employed and the associated genotyping costs, we showed through simulation that a design involving pooling would be 1.07 times more expensive than a design without pooling. Thus, while a significant amount of information exists within the data from pooled DNA, our analysis does not support genotyping pooled DNA as a means to efficiently identify common variants contributing small effects to phenotypes of interest. While our conclusions were based on the specific technology and study design we employed, the approach presented here will be useful for

  3. POSaM: a fast, flexible, open-source, inkjet oligonucleotide synthesizer and microarrayer

    PubMed Central

    Lausted, Christopher; Dahl, Timothy; Warren, Charles; King, Kimberly; Smith, Kimberly; Johnson, Michael; Saleem, Ramsey; Aitchison, John; Hood, Lee; Lasky, Stephen R


    DNA arrays are valuable tools in molecular biology laboratories. Their rapid acceptance was aided by the release of plans for a pin-spotting microarrayer by researchers at Stanford. Inkjet microarraying is a flexible, complementary technique that allows the synthesis of arrays of any oligonucleotide sequences de novo. We describe here an open-source inkjet arrayer capable of rapidly producing sets of unique 9,800-feature arrays. PMID:15287980

  4. A Quantitative Tool for Producing DNA-Based Diagnostic Arrays

    SciTech Connect

    Tom J. Whitaker


    The purpose of this project was to develop a precise, quantitative method to analyze oligodeoxynucleotides (ODNs) on an array to enable a systematic approach to quality control issues affecting DNA microarrays. Two types of ODN's were tested; ODN's formed by photolithography and ODN's printed onto microarrays. Initial work in Phase I, performed in conjunction with Affymetrix, Inc. who has a patent on a photolithographic in situ technique for creating DNA arrays, was very promising but did seem to indicate that the atomization process was not complete. Soon after Phase II work was under way, Affymetrix had further developed fluorescent methods and indicated they were no longer interested in our resonance ionization technique. This was communicated to the program manager and it was decided that the project would continue and be focused on printed ODNs. The method being tested is called SIRIS, Sputter-Initiated Resonance Ionization Spectroscopy. SIRIS has been shown to be a highly sensitive, selective, and quantitative tool for atomic species. This project was aimed at determining if an ODN could be labeled in such a way that SIRIS could be used to measure the label and thus provide quantitative measurements of the ODN on an array. One of the largest problems in this study has been developing a method that allows us to know the amount of an ODN on a surface independent of the SIRIS measurement. Even though we could accurately determine the amount of ODN deposited on a surface, the amount that actually attached to the surface is very difficult to measure (hence the need for a quantitative tool). A double-labeling procedure was developed in which 33P and Pt were both used to label ODNs. The radioactive 33P could be measured by a proportional counter that maps the counts in one dimension. This gave a good measurement of the amount of ODN remaining on a surface after immobilization and washing. A second label, Pt, was attached to guanine nucleotides in the ODN. Studies

  5. Oligonucleotide conjugates for therapeutic applications

    PubMed Central

    Winkler, Johannes


    Insufficient pharmacokinetic properties and poor cellular uptake are the main hurdles for successful therapeutic development of oligonucleotide agents. The covalent attachment of various ligands designed to influence the biodistribution and cellular uptake or for targeting specific tissues is an attractive possibility to advance therapeutic applications and to expand development options. In contrast to advanced formulations, which often consist of multiple reagents and are sensitive to a variety of preparation conditions, oligonucleotide conjugates are defined molecules, enabling structure-based analytics and quality control techniques. This review gives an overview of current developments of oligonucleotide conjugates for therapeutic applications. Attached ligands comprise peptides, proteins, carbohydrates, aptamers and small molecules, including cholesterol, tocopherol and folic acid. Important linkage types and conjugation methods are summarized. The distinct ligands directly influence biochemical parameters, uptake machanisms and pharmacokinetic properties. PMID:23883124

  6. The Affymetrix DMET Plus Platform Reveals Unique Distribution of ADME-Related Variants in Ethnic Arabs

    PubMed Central

    Wakil, Salma M.; Nguyen, Cao; Muiya, Nzioka P.; Andres, Editha; Lykowska-Tarnowska, Agnieszka; Baz, Batoul; Meyer, Brian F.; Morahan, Grant


    Background. The Affymetrix Drug Metabolizing Enzymes and Transporters (DMET) Plus Premier Pack has been designed to genotype 1936 gene variants thought to be essential for screening patients in personalized drug therapy. These variants include the cytochrome P450s (CYP450s), the key metabolizing enzymes, many other enzymes involved in phase I and phase II pharmacokinetic reactions, and signaling mediators associated with variability in clinical response to numerous drugs not only among individuals, but also between ethnic populations. Materials and Methods. We genotyped 600 Saudi individuals for 1936 variants on the DMET platform to evaluate their clinical potential in personalized medicine in ethnic Arabs. Results. Approximately 49% each of the 437 CYP450 variants, 56% of the 581 transporters, 56% of 419 transferases, 48% of the 104 dehydrogenases, and 58% of the remaining 390 variants were detected. Several variants, such as rs3740071, rs6193, rs258751, rs6199, rs11568421, and rs8187797, exhibited significantly either higher or lower minor allele frequencies (MAFs) than those in other ethnic groups. Discussion. The present study revealed some unique distribution trends for several variants in Arabs, which displayed partly inverse allelic prevalence compared to other ethnic populations. The results point therefore to the need to verify and ascertain the prevalence of a variant as a prerequisite for engaging it in clinical routine screening in personalized medicine in any given population. PMID:25802476

  7. Thermodynamics of Oligonucleotide Duplex Melting

    ERIC Educational Resources Information Center

    Schreiber-Gosche, Sherrie; Edwards, Robert A.


    Melting temperatures of oligonucleotides are useful for a number of molecular biology applications, such as the polymerase chain reaction (PCR). Although melting temperatures are often calculated with simplistic empirical equations, application of thermodynamics provides more accurate melting temperatures and an opportunity for students to apply…

  8. Large-scale analysis of antisense transcription in wheat using the Affymetrix GeneChip Wheat Genome Array

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Natural antisense transcripts (NATs) are transcripts of the opposite DNA strand to the sense-strand either at the same locus (cis-encoded) or a different locus (trans-encoded). They can affect gene expression at multiple stages including transcription, RNA processing and transport, and translation....

  9. [Study toward practical use of oligonucleotide therapeutics].


    Inoue, Takao; Yoshida, Tokuyuki


    Over the past decade, oligonucleotide-based therapeutics such as antisense oligonucleotides and small interfering RNAs (siRNAs) have been developed extensively. For example, mipomersen (Kynamro; ISIS Pharmaceuticals), which is a second-generation antisense oligonucleotide administered by subcutaneous injection, has recently been approved by the FDA for the treatment of homozygous familial hypercholesterolemia. On the other hands, methods for the evaluation of quality, efficacy and safety of oligonucleotide therapeutics have not been fully discussed. Furthermore, the regulatory guidance specific for oligonucleotide therapeutics has not been established yet. Under these circumstances, we started to collaborate with Osaka University and PMDA to discuss regulatory science focused on oligonucleotide therapeutics. Through the collaboration, we would like to propose the possible design of quality evaluation and preclinical safety-evaluation of oligonucleotide therapeutics. PMID:25707197

  10. Biopolymer synthesis on polypropylene supports. I. Oligonucleotides.


    Matson, R S; Rampal, J B; Coassin, P J


    We have modified polypropylene to serve as a new solid-phase support for oligonucleotide synthesis. The plastic is first surface aminated by exposure to an ammonia plasma generated by radiofrequency plasma discharge. The aminated polypropylene has been found to be useful as a support for the in situ synthesis of oligonucleotides from monomers. Furthermore, oligonucleotides synthesized on the surface of the plastic remain attached following deprotection and can be used directly for hybridization. PMID:8203760

  11. Identification of Dermatophytes by an Oligonucleotide Array▿ †

    PubMed Central

    Li, Hsin Chieh; Bouchara, Jean-Philippe; Hsu, Mark Ming-Long; Barton, Richard; Chang, Tsung Chain


    Species of dermatophytes are classified into three anamorphic (asexual) genera, Epidermophyton, Microsporum, and Trichophyton. Conventional methods used to identify dermatophytes are often lengthy and may be inconclusive because of atypical microscopic or colony morphology. Based on the internal transcribed spacer 1 (ITS-1) and ITS-2 sequences of the rRNA genes, an oligonucleotide array was developed to identify 17 dermatophyte species. The method consisted of PCR amplification of the ITS regions using universal primers, followed by hybridization of the digoxigenin-labeled PCR products to an array of oligonucleotides (17- to 30-mers) immobilized on a nylon membrane. Of 198 dermatophyte strains and 90 nontarget strains tested, the sensitivity and specificity of the array were 99.5% and 97.8%, respectively. The only strain not identified (Microsporum audouinii LMA 597) was found to have a nucleotide insertion at the ITS-2 region where the probe was designed. Two nontarget strains, Microsporum equinum LMA 40396666 and Trichophyton gourvilii var. intermedium CBS 170.65, were misidentified as Microsporum canis and Trichophyton soudanense, respectively. Sequence analysis of the ITS regions revealed that the two misidentified strains displayed high sequence homology with the probes designed for M. canis and T. soudanense, respectively. The present method can be used as a reliable alternative to conventional identification methods and can be completed with isolated colonies within 24 h. PMID:17687010

  12. The prebiotic synthesis of oligonucleotides

    NASA Technical Reports Server (NTRS)

    Oro, J.; Stephen-Sherwood, E.


    This paper is primarily a review of recent developments in the abiotic synthesis of nucleotides, short chain oligonucleotides, and their mode of replication in solution. It also presents preliminary results from this laboratory on the prebiotic synthesis of thymidine oligodeoxynucleotides. A discussion, based on the physicochemical properties of RNA and DNA oligomers, relevant to the molecular evolution of these compounds leads to the tentative hypothesis that oligodeoxyribonucleotides of about 12 units may have been of sufficient length to initiate a self replicating coding system. Two models are suggested to account for the synthesis of high molecular weight oligomers using short chain templates and primers.

  13. Computational method for estimating DNA copy numbers in normal samples, cancer cell lines, and solid tumors using array comparative genomic hybridization.


    Abkevich, Victor; Iliev, Diana; Timms, Kirsten M; Tran, Thanh; Skolnick, Mark; Lanchbury, Jerry S; Gutin, Alexander


    Genomic copy number variations are a typical feature of cancer. These variations may influence cancer outcomes as well as effectiveness of treatment. There are many computational methods developed to detect regions with deletions and amplifications without estimating actual copy numbers (CN) in these regions. We have developed a computational method capable of detecting regions with deletions and amplifications as well as estimating actual copy numbers in these regions. The method is based on determining how signal intensity from different probes is related to CN, taking into account changes in the total genome size, and incorporating into analysis contamination of the solid tumors with benign tissue. Hidden Markov Model is used to obtain the most likely CN solution. The method has been implemented for Affymetrix 500K GeneChip arrays and Agilent 244K oligonucleotide arrays. The results of CN analysis for normal cell lines, cancer cell lines, and tumor samples are presented. The method is capable of detecting copy number alterations in tumor samples with up to 80% contamination with benign tissue. Analysis of 178 cancer cell lines reveals multiple regions of common homozygous deletions and strong amplifications encompassing known tumor suppressor genes and oncogenes as well as novel cancer related genes. PMID:20706610

  14. Diagnostic Oligonucleotide Microarray Fingerprinting of Bacillus Isolates

    SciTech Connect

    Chandler, Darrell P.; Alferov, Oleg; Chernov, Boris; Daly, Don S.; Golova, Julia; Perov, Alexander N.; Protic, Miroslava; Robison, Richard; Shipma, Matthew; White, Amanda M.; Willse, Alan R.


    A diagnostic, genome-independent microbial fingerprinting method using DNA oligonucleotide microarrays was used for high-resolution differentiation between closely related Bacillus strains, including two strains of Bacillus anthracis that are monomorphic (indistinguishable) via amplified fragment length polymorphism fingerprinting techniques. Replicated hybridizations on 391-probe nonamer arrays were used to construct a prototype fingerprint library for quantitative comparisons. Descriptive analysis of the fingerprints, including phylogenetic reconstruction, is consistent with previous taxonomic organization of the genus. Newly developed statistical analysis methods were used to quantitatively compare and objectively confirm apparent differences in microarray fingerprints with the statistical rigor required for microbial forensics and clinical diagnostics. These data suggest that a relatively simple fingerprinting microarray and statistical analysis method can differentiate between species in the Bacillus cereus complex, and between strains of B. anthracis. A synthetic DNA standard was used to understand underlying microarray and process-level variability, leading to specific recommendations for the development of a standard operating procedure and/or continued technology enhancements for microbial forensics and diagnostics.

  15. Cellular Uptake and Intracellular Trafficking of Oligonucleotides: Implications for Oligonucleotide Pharmacology

    PubMed Central

    Ming, Xin; Carver, Kyle; Laing, Brian


    One of the major constraints on the therapeutic use of oligonucleotides is inefficient delivery to their sites of action in the cytosol or nucleus. Recently it has become evident that the pathways of cellular uptake and intracellular trafficking of oligonucleotides can strongly influence their pharmacological actions. Here we provide background information on the basic processes of endocytosis and trafficking and then review recent literature on targeted delivery and subcellular trafficking of oligonucleotides in that context. A variety of approaches including molecular scale ligand-oligonucleotide conjugates, ligand-targeted nanocarriers, and the use of small molecules to enhance oligonucleotide effects are discussed. PMID:24383421

  16. Electron Transfer Dissociation of Oligonucleotide Cations.


    Smith, Suncerae I; Brodbelt, Jennifer S


    Electron transfer dissociation (ETD) of multi-protonated 6 - 20-mer oligonucleotides and 12- and 14-mer duplexes is compared to collision activated dissociation (CAD). ETD causes efficient charge reduction of the multi-protonated oligonucleotides in addition to limited backbone cleavages to yield sequence ions of low abundance. Subsequent CAD of the charge-reduced oligonucleotides formed upon electron transfer, in a net process termed electron transfer collision activated dissociation (ETcaD), results in rich fragmentation in terms of w, a, z, and d products, with a marked decrease in the abundance of base loss ions and internal fragments. Complete sequencing was possible for nearly all oligonucleotides studied. ETcaD of an oligonucleotide duplex resulted in specific backbone cleavages, with conservation of weaker non-covalent bonds. PMID:20161288

  17. Design And Performance Of 44,100 SNP Genotyping Array For Rice

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To document genome-wide allelic variation within and between the different subpopulations of both O. sativa and O. rufipogon, we developed an Affymetrix custom genotyping array containing 44,100 SNPs well distributed across the 400Mb rice genome. The SNPs on this array were selected from the MBML-in...

  18. High Fidelity Copy Number Analysis of Formalin-Fixed and Paraffin-Embedded Tissues Using Affymetrix Cytoscan HD Chip

    PubMed Central

    Yu, Yan P.; Michalopoulos, Amantha; Ding, Ying; Tseng, George; Luo, Jian-Hua


    Detection of human genome copy number variation (CNV) is one of the most important analyses in diagnosing human malignancies. Genome CNV detection in formalin-fixed and paraffin-embedded (FFPE) tissues remains challenging due to suboptimal DNA quality and failure to use appropriate baseline controls for such tissues. Here, we report a modified method in analyzing CNV in FFPE tissues using microarray with Affymetrix Cytoscan HD chips. Gel purification was applied to select DNA with good quality and data of fresh frozen and FFPE tissues from healthy individuals were included as baseline controls in our data analysis. Our analysis showed a 91% overlap between CNV detection by microarray with FFPE tissues and chromosomal abnormality detection by karyotyping with fresh tissues on 8 cases of lymphoma samples. The CNV overlap between matched frozen and FFPE tissues reached 93.8%. When the analyses were restricted to regions containing genes, 87.1% concordance between FFPE and fresh frozen tissues was found. The analysis was further validated by Fluorescence In Situ Hybridization on these samples using probes specific for BRAF and CITED2. The results suggested that the modified method using Affymetrix Cytoscan HD chip gave rise to a significant improvement over most of the previous methods in terms of accuracy in detecting CNV in FFPE tissues. This FFPE microarray methodology may hold promise for broad application of CNV analysis on clinical samples. PMID:24699316

  19. Synthesis of 5'-Aldehyde Oligonucleotide.


    Lartia, Rémy


    Synthesis of oligonucleotide ending with an aldehyde functional group at their 5'-end (5'-AON) is possible for both DNA (5'-AODN) and RNA (5'-AORN) series irrespectively of the nature of the last nucleobase. The 5'-alcohol of on-support ODN is mildly oxidized under Moffat conditions. Transient protection of the resulting aldehyde by N,N'-diphenylethylenediamine derivatives allows cleavage, deprotection, and RP-HPLC purification of the protected 5'-AON. Finally, 5'-AON is deprotected by usual acetic acid treatment. In the aggregates, 5'-AON can be now synthesized and purified as routinely as non-modified ODNs, following procedures similar to the well-known "DMT-On" strategy. PMID:26967469

  20. Methods of DNA sequencing by hybridization based on optimizing concentration of matrix-bound oligonucleotide and device for carrying out same


    Khrapko, Konstantin R.; Khorlin, Alexandr A.; Ivanov, Igor B.; Ershov, Gennady M.; Lysov, Jury P.; Florentiev, Vladimir L.; Mirzabekov, Andrei D.


    A method for sequencing DNA by hybridization that includes the following steps: forming an array of oligonucleotides at such concentrations that either ensure the same dissociation temperature for all fully complementary duplexes or allows hybridization and washing of such duplexes to be conducted at the same temperature; hybridizing said oligonucleotide array with labeled test DNA; washing in duplex dissociation conditions; identifying single-base substitutions in the test DNA by analyzing the distribution of the dissociation temperatures and reconstructing the DNA nucleotide sequence based on the above analysis. A device for carrying out the method comprises a solid substrate and a matrix rigidly bound to the substrate. The matrix contains the oligonucleotide array and consists of a multiplicity of gel portions. Each gel portion contains one oligonucleotide of desired length. The gel portions are separated from one another by interstices and have a thickness not exceeding 30 .mu.m.

  1. Tandem oligonucleotide synthesis using linker phosphoramidites

    PubMed Central

    Pon, Richard T.; Yu, Shuyuan


    Multiple oligonucleotides of the same or different sequence, linked end-to-end in tandem can be synthesized in a single automated synthesis. A linker phosphoramidite [R. T. Pon and S. Yu (2004) Nucleic Acids Res., 32, 623–631] is added to the 5′-terminal OH end of a support-bound oligonucleotide to introduce a cleavable linkage (succinic acid plus sulfonyldiethanol) and the 3′-terminal base of the new sequence. Conventional phosphoramidites are then used for the rest of the sequence. After synthesis, treatment with ammonium hydroxide releases the oligonucleotides from the support and cleaves the linkages between each sequence. Mixtures of one oligonucleotide with both 5′- and 3′-terminal OH ends and other oligonucleotides with 5′-phosphorylated and 3′-OH ends are produced, which are deprotected and worked up as a single product. Tandem synthesis can be used to make pairs of PCR primers, sets of cooperative oligonucleotides or multiple copies of the same sequence. When tandem synthesis is used to make two self-complementary sequences, double-stranded structures spontaneously form after deprotection. Tandem synthesis of oligonucleotide chains containing up to six consecutive 20mer (120 bases total), various trinucleotide codons and primer pairs for PCR, or self-complementary strands for in situ formation of double-stranded DNA fragments has been demonstrated. PMID:15814811

  2. Quantitation of phosphorothioate oligonucleotides in human plasma.


    Leeds, J M; Graham, M J; Truong, L; Cummins, L L


    Methods are presented for the extraction of phosphorothioate oligonucleotides from human plasma to permit quantitation by capillary gel electrophoresis. Extraction of the phosphorothioate oligonucleotides from plasma was accomplished using two solid-phase extraction columns, a strong anion-exchange column to remove plasma proteins and lipids, followed by a reverse-phase column to remove salts. A second desalting step, achieved by dialysis utilizing a membrane with a molecular weight cutoff of 2500 Da floating on distilled water, was required to remove residual ionic material from the extracted sample. This method should be generally applicable to the analysis and quantitation of phosphorothioate oligonucleotides. PMID:8850544

  3. Gene Assembly from Chip-Synthesized Oligonucleotides

    PubMed Central

    Eroshenko, Nikolai; Kosuri, Sriram; Marblestone, Adam H; Conway, Nicholas; Church, George M.


    De novo synthesis of long double-stranded DNA constructs has a myriad of applications in biology and biological engineering. However, its widespread adoption has been hindered by high costs. Cost can be significantly reduced by using oligonucleotides synthesized on high-density DNA chips. However, most methods for using off-chip DNA for gene synthesis have failed to scale due to the high error rates, low yields, and high chemical complexity of the chip-synthesized oligonucleotides. We have recently demonstrated that some commercial DNA chip manufacturers have improved error rates, and that the issues of chemical complexity and low yields can be solved by using barcoded primers to accurately and efficiently amplify subpools of oligonucleotides. This article includes protocols for computationally designing the DNA chip, amplifying the oligonucleotide subpools, and assembling 500-800 basepair (bp) constructs. PMID:25077042

  4. Transformation of yeast with synthetic oligonucleotides.

    PubMed Central

    Moerschell, R P; Tsunasawa, S; Sherman, F


    Genomic DNA of the yeast, Saccharomyces cerevisiae, can be conveniently and specifically altered by transforming spheroplasts or lithium acetate-treated cells directly with synthetic oligonucleotides. Altered forms of iso-1-cytochrome c were generated by transforming a cyc1 mutant with oligonucleotides and selecting for at least partially functional revertants; the oligonucleotides contained a sequence that corrected the cyc1 mutation and produced additional alterations at nearby sites. Transformation has been accomplished with oligonucleotides as short as 20 nucleotides and with amounts as low as 100 micrograms. This method of site-directed mutagenesis in vivo has been used to produce alterations in the NH2-terminal region of iso-1-cytochrome c in which the NH2-terminal methionine is excised and the penultimate residue is acetylated. PMID:2829192

  5. Assessment and integration of publicly available SAGE, cDNA microarray, and oligonucleotide microarray expression data for global coexpression analyses.


    Griffith, Obi L; Pleasance, Erin D; Fulton, Debra L; Oveisi, Mehrdad; Ester, Martin; Siddiqui, Asim S; Jones, Steven J M


    Large amounts of gene expression data from several different technologies are becoming available to the scientific community. A common practice is to use these data to calculate global gene coexpression for validation or integration of other "omic" data. To assess the utility of publicly available datasets for this purpose we have analyzed Homo sapiens data from 1202 cDNA microarray experiments, 242 SAGE libraries, and 667 Affymetrix oligonucleotide microarray experiments. The three datasets compared demonstrate significant but low levels of global concordance (rc<0.11). Assessment against Gene Ontology (GO) revealed that all three platforms identify more coexpressed gene pairs with common biological processes than expected by chance. As the Pearson correlation for a gene pair increased it was more likely to be confirmed by GO. The Affymetrix dataset performed best individually with gene pairs of correlation 0.9-1.0 confirmed by GO in 74% of cases. However, in all cases, gene pairs confirmed by multiple platforms were more likely to be confirmed by GO. We show that combining results from different expression platforms increases reliability of coexpression. A comparison with other recently published coexpression studies found similar results in terms of performance against GO but with each method producing distinctly different gene pair lists. PMID:16098712

  6. Antisense oligonucleotides as therapeutics for malignant diseases.


    Ho, P T; Parkinson, D R


    The continued progress in our understanding of the biology of neoplasia and in the identification, cloning, and sequencing of genes critical to tumor cell function permits the exploitation of this information to develop specific agents that may directly modulate the function of these genes or their protein products. Antisense oligonucleotides are being investigated as a potential therapeutic modality that takes direct advantage of molecular sequencing. The antisense approach uses short oligonucleotides designed to hybridize to a target mRNA transcript through Watson-Crick base pairing. The formation of this oligonucleotide: RNA heteroduplex results in mRNA inactivation and consequent inhibition of synthesis of the protein product. A fundamental attraction of the antisense approach is that this method potentially may be applied to any gene product, in theory, for the treatment of malignant and non-malignant diseases. However, this simple and attractive model has proven to be much more complex in practice. A number of important challenges in the preclinical development of antisense oligonucleotides have been identified, including stability, sequence length, cellular uptake, target sequence selection, appropriate negative controls, oligonucleotide: protein interactions, and cost of manufacture. Although the biological activity of an oligonucleotide against its molecular target is theoretically sequence-dependent, the animal pharmacokinetics and toxicology of phosphorothioate analogues directed against vastly disparate gene products appear relatively non-sequence-specific. In oncology, a number of clinical trials have been initiated with antisense oligonucleotides directed against molecular targets including: p53; bcl-2; raf kinase; protein kinase C-alpha; c-myb. The experience gained from these early clinical trials will be applicable to the next generation of antisense agents in development. These may include molecules with novel backbones or other structural

  7. Direct microcontact printing of oligonucleotides for biochip applications

    PubMed Central

    Thibault, C; Le Berre, V; Casimirius, S; Trévisiol, E; François, J; Vieu, C


    Background A critical step in the fabrication of biochips is the controlled placement of probes molecules on solid surfaces. This is currently performed by sequential deposition of probes on a target surface with split or solid pins. In this article, we present a cost-effective procedure namely microcontact printing using stamps, for a parallel deposition of probes applicable for manufacturing biochips. Results Contrary to a previous work, we showed that the stamps tailored with an elastomeric poly(dimethylsiloxane) material did not require any surface modification to be able to adsorb oligonucleotides or PCR products. The adsorbed DNA molecules are subsequently printed efficiently on a target surface with high sub-micron resolution. Secondly, we showed that successive stamping is characterized by an exponential decay of the amount of transferred DNA molecules to the surface up the 4th print, then followed by a second regime of transfer that was dependent on the contact time and which resulted in reduced quality of the features. Thus, while consecutive stamping was possible, this procedure turned out to be less reproducible and more time consuming than simply re-inking the stamps between each print. Thirdly, we showed that the hybridization signals on arrays made by microcontact printing were 5 to 10-times higher than those made by conventional spotting methods. Finally, we demonstrated the validity of this microcontact printing method in manufacturing oligonucleotides arrays for mutations recognition in a yeast gene. Conclusion The microcontact printing can be considered as a new potential technology platform to pattern DNA microarrays that may have significant advantages over the conventional spotting technologies as it is easy to implement, it uses low cost material to make the stamp, and the arrays made by this technology are 10-times more sensitive in term of hybridization signals than those manufactured by conventional spotting technology. PMID:15992404

  8. Portable system for microbial sample preparation and oligonucleotide microarray analysis.


    Bavykin, S G; Akowski, J P; Zakhariev, V M; Barsky, V E; Perov, A N; Mirzabekov, A D


    We have developed a three-component system for microbial identification that consists of (i) a universal syringe-operated silica minicolumn for successive DNA and RNA isolation, fractionation, fragmentation, fluorescent labeling, and removal of excess free label and short oligonucleotides; (ii) microarrays of immobilized oligonucleotide probes for 16S rRNA identification; and (iii) a portable battery-powered device for imaging the hybridization of fluorescently labeled RNA fragments with the arrays. The minicolumn combines a guanidine thiocyanate method of nucleic acid isolation with a newly developed hydroxyl radical-based technique for DNA and RNA labeling and fragmentation. DNA and RNA can also be fractionated through differential binding of double- and single-stranded forms of nucleic acids to the silica. The procedure involves sequential washing of the column with different solutions. No vacuum filtration steps, phenol extraction, or centrifugation is required. After hybridization, the overall fluorescence pattern is captured as a digital image or as a Polaroid photo. This three-component system was used to discriminate Escherichia coli, Bacillus subtilis, Bacillus thuringiensis, and human HL60 cells. The procedure is rapid: beginning with whole cells, it takes approximately 25 min to obtain labeled DNA and RNA samples and an additional 25 min to hybridize and acquire the microarray image using a stationary image analysis system or the portable imager. PMID:11157263

  9. Portable system for microbial sample preparation and oligonucleotide microarray analysis.

    SciTech Connect

    Bavykin, S. G.; Akowski, J. P.; Zakhariev, V. M.; Barsky, V. E.; Mirzabekov, A. D.; Perov, A. N.; Biochip Technology Center; Engelhardt Inst. of Molecular Biology


    We have developed a three-component system for microbial identification that consists of (i) a universal syringe-operated silica minicolumn for successive DNA and RNA isolation, fractionation, fragmentation, fluorescent labeling, and removal of excess free label and short oligonucleotides; (ii) microarrays of immobilized oligonucleotide probes for 16S rRNA identification; and (iii) a portable battery-powered device for imaging the hybridization of fluorescently labeled RNA fragments with the arrays. The minicolumn combines a guanidine thiocyanate method of nucleic acid isolation with a newly developed hydroxyl radical-based technique for DNA and RNA labeling and fragmentation. DNA and RNA can also be fractionated through differential binding of double- and single-stranded forms of nucleic acids to the silica. The procedure involves sequential washing of the column with different solutions. No vacuum filtration steps, phenol extraction, or centrifugation is required. After hybridization, the overall fluorescence pattern is captured as a digital image or as a Polaroid photo. This three-component system was used to discriminate Escherichia coli, Bacillus subtilis, Bacillus thuringiensis, and human HL60 cells. The procedure is rapid: beginning with whole cells, it takes approximately 25 min to obtain labeled DNA and RNA samples and an additional 25 min to hybridize and acquire the microarray image using a stationary image analysis system or the portable imager.

  10. Caged oligonucleotides for studying biological systems

    PubMed Central

    Ruble, Brittani K.; Yeldell, Sean B.; Dmochowski, Ivan J.


    Light-activated (“caged”) compounds have been widely employed for studying biological processes with high spatial and temporal control. In the past decade, several new approaches for caging the structure and function of DNA and RNA oligonucleotides have been developed. This review focuses on caged oligonucleotides that incorporate site-specifically one or two photocleavable linkers, whose photolysis yields oligonucleotides with dramatic structural and functional changes. This technique has been employed by our laboratory and others to photoregulate gene expression in cells and living organisms, typically using near UV-activated organic chromophores. To improve capabilities for in vivo studies, we harnessed the rich inorganic photochemistry of ruthenium bipyridyl complexes to synthesize Ru-caged morpholino antisense oligonucleotides that remain inactive in zebrafish embryos until uncaged with visible light. Expanding into new caged oligonucleotide applications, our lab has developed Transcriptome In Vivo Analysis (TIVA) technology, which provides the first noninvasive, unbiased method for isolating mRNA from single neurons in brain tissues. TIVA-isolated mRNA can be amplified and then analyzed using next-generation sequencing (RNA-seq). PMID:25865001

  11. Gene Expression in the Rat Brain during Sleep Deprivation and Recovery Sleep: An Affymetrix GeneChip® Study

    PubMed Central

    Terao, A.; Wisor, J.P.; Peyron, C.; Apte-Deshpande, A.; Wurts, S.W.; Edgar, D.M.; Kilduff, T.S.


    Previous studies have demonstrated that macromolecular synthesis in the brain is modulated in association with the occurrence of sleep and wakefulness. Similarly, the spectral composition of electroencephalographic activity that occurs during sleep is dependent on the duration of prior wakefulness. Since this homeostatic relationship between wake and sleep is highly conserved across mammalian species, genes that are truly involved in the electroencephalographic response to sleep deprivation (SD) might be expected to be conserved across mammalian species. Therefore, in the rat cerebral cortex, we have studied the effects of SD on the expression of immediate early gene (IEG) and heat shock protein (HSP) mRNAs previously shown to be upregulated in the mouse brain in SD and in recovery sleep (RS) after SD. We find that the molecular response to SD and RS in the brain is highly conserved between these two mammalian species, at least in terms of expression of IEG and HSP family members. Using Affymetrix Neurobiology U34 GeneChips®, we also screened the rat cerebral cortex, basal forebrain, and hypothalamus for other genes whose expression may be modulated by SD or RS. We find that the response of the basal forebrain to SD is more similar to that of the cerebral cortex than to the hypothalamus. Together, these results suggest that sleep-dependent changes in gene expression in the cerebral cortex are similar across rodent species and therefore may underlie sleep history-dependent changes in sleep electroencephalographic activity. PMID:16257491

  12. Oligonucleotide-based therapy for neurodegenerative diseases.


    Magen, Iddo; Hornstein, Eran


    Molecular genetics insight into the pathogenesis of several neurodegenerative diseases, such as Alzheimer׳s disease, Parkinson׳s disease, Huntington׳s disease and amyotrophic lateral sclerosis, encourages direct interference with the activity of neurotoxic genes or the molecular activation of neuroprotective pathways. Oligonucleotide-based therapies are recently emerging as an efficient strategy for drug development and these can be employed as new treatments of neurodegenerative states. Here we review advances in this field in recent years which suggest an encouraging assessment that oligonucleotide technologies for targeting of RNAs will enable the development of new therapies and will contribute to preservation of brain integrity. PMID:24727531

  13. Inhibition of dengue virus by novel, modified antisense oligonucleotides.

    PubMed Central

    Raviprakash, K; Liu, K; Matteucci, M; Wagner, R; Riffenburgh, R; Carl, M


    Five different target regions along the length of the dengue virus type 2 genome were compared for inhibition of the virus following intracellular injection of the cognate antisense oligonucleotides and their analogs. Unmodified phosphodiester oligonucleotides as well as the corresponding phosphorothioate oligonucleotides were ineffective in bringing about a significant inhibition of the virus. Novel modified phosphorothioate oligonucleotides in which the C-5 atoms of uridines and cytidines were replaced by propynyl groups caused a significant inhibition of the virus. Antisense oligonucleotide directed against the target region near the translation initiation site of dengue virus RNA was the most effective, followed by antisense oligonucleotide directed against a target in the 3' untranslated region of the virus RNA. It is suggested that the inhibitory effect of these novel modified oligonucleotides is due to their increased affinity for the target sequences and that they probably function via an RNase H cleavage of the oligonucleotide:RNA heteroduplex. PMID:7983769

  14. Hetero-oligonucleotide nanoscale tiles capable of two-dimensional lattice formation as testbeds for a rapid, affordable purification methodology.


    Lukeman, Philip S


    New nanoscale hetero-oligonucleotide tiles are assembled from DNA, RNA and morpholino oligos and purified using size exclusion filtration. Homo-oligonucleotide tiles assembled from RP-cartridge processed DNA oligos are purified by nondenaturing gel electrophoresis. These tiles' purity and homogeneity are demonstrated by gel electrophoresis and their incorporation into two-dimensional arrays visualized by AFM. This purification methodology increases throughput and decreases costs for researchers who wish to screen multiple tiles for utilization in structural or analytical studies. PMID:23676891

  15. Oligonucleotide recombination in gram negative bacteria

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This report describes several key aspects of a novel form of RecA-independent homologous recombination. We found that synthetic single stranded DNA oligonucleotides (oligos) introduced into bacteria by transformation can site-specifically recombine with bacterial chromosomes in the absence of any a...

  16. An overview of custom array sequencing.


    Kothiyal, Prachi; Cox, Stephanie; Ebert, Jonathan; Aronow, Bruce J; Greinwald, John H; Rehm, Heidi L


    This unit provides an overview of oligo hybridization-based resequencing and a wide range of considerations for implementing the technology and analyzing the resulting data. The specific technology discussed is the Affymetrix GeneChip CustomSeq Resequencing Array platform. Concepts related to array design, experimental protocols, and base-calling using existing algorithms are presented. Details that should be evaluated during development of sequence tiling, target amplification, and PCR protocols are addressed. An overview of the Affymetrix GeneChip Sequence Analysis Software (GSEQ) is provided, along with factors that influence base-calling coverage and accuracy. Also outlined are performance measures that can be used to characterize base-calling with resequencing arrays, as well as factors known to affect their performance. Limitations associated with detection of insertions and deletions (indels) are discussed, with empirical data from our experiments used to outline possible approaches to indel detection. Critical topics in the design, implementation, and analysis of targeted sequencing arrays not previously discussed in detail are highlighted. PMID:19360699

  17. Identification of characteristic oligonucleotides in the bacterial 16S ribosomal RNA sequence dataset

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; Willson, Richard C.; Fox, George E.


    MOTIVATION: The phylogenetic structure of the bacterial world has been intensively studied by comparing sequences of 16S ribosomal RNA (16S rRNA). This database of sequences is now widely used to design probes for the detection of specific bacteria or groups of bacteria one at a time. The success of such methods reflects the fact that there are local sequence segments that are highly characteristic of particular organisms or groups of organisms. It is not clear, however, the extent to which such signature sequences exist in the 16S rRNA dataset. A better understanding of the numbers and distribution of highly informative oligonucleotide sequences may facilitate the design of hybridization arrays that can characterize the phylogenetic position of an unknown organism or serve as the basis for the development of novel approaches for use in bacterial identification. RESULTS: A computer-based algorithm that characterizes the extent to which any individual oligonucleotide sequence in 16S rRNA is characteristic of any particular bacterial grouping was developed. A measure of signature quality, Q(s), was formulated and subsequently calculated for every individual oligonucleotide sequence in the size range of 5-11 nucleotides and for 15mers with reference to each cluster and subcluster in a 929 organism representative phylogenetic tree. Subsequently, the perfect signature sequences were compared to the full set of 7322 sequences to see how common false positives were. The work completed here establishes beyond any doubt that highly characteristic oligonucleotides exist in the bacterial 16S rRNA sequence dataset in large numbers. Over 16,000 15mers were identified that might be useful as signatures. Signature oligonucleotides are available for over 80% of the nodes in the representative tree.

  18. Circulation of oligonucleotides by disulfide bridge formation.

    PubMed Central

    Gao, H; Yang, M; Patel, R; Cook, A F


    An effective, convenient method for the circularization of oligonucleotides has been developed. This procedure involved preparation of an oligonucleotide with backbone-linked 5'- and 3'-terminal hexamethylenethiol groups, followed by oxidation of the thiol groups with air of oxygen to produce the corresponding circular sequence bridged via a bis(hexamethylene)-disulfide moiety. The method has been applied to the circularization of oligodeoxynucleotide sequences of varying lengths (5, 10, 15, 20, 30 and 40 bases), and the circularization process was highly efficient as shown by HPLC or gel electrophoresis of the crude reaction mixtures. Competing reactions such as dimerization were not significant except for the longer sequences (30 and 40 bases). The circularization of an eight base RNA sequence was also accomplished, as well as hexa-ethylene glycol bridged poly-T sequences capable of triplex formation. PMID:7596832

  19. Arrays of nucleic acid probes on biological chips


    Chee, Mark; Cronin, Maureen T.; Fodor, Stephen P. A.; Huang, Xiaohua X.; Hubbell, Earl A.; Lipshutz, Robert J.; Lobban, Peter E.; Morris, MacDonald S.; Sheldon, Edward L.


    DNA chips containing arrays of oligonucleotide probes can be used to determine whether a target nucleic acid has a nucleotide sequence identical to or different from a specific reference sequence. The array of probes comprises probes exactly complementary to the reference sequence, as well as probes that differ by one or more bases from the exactly complementary probes.

  20. The prebiotic synthesis of deoxythymidine oligonucleotides

    NASA Technical Reports Server (NTRS)

    Stephen-Sherwood, E.; Odom, D. G.; Oro, J.


    Deoxythymidine 5 prime-triphosphate in the presence of deoxythymidine 5 prime-phosphate, cyanamide and 4-amino-5-imidazole carboxamide polymerizes under drying conditions at moderate temperatures (60 to 90 C) to yield oligonucleotides of up to four units in length. Enzymatic analysis indicated that the majority of these oligomers contained natural 3 prime-5 prime phosphodiester bonds. This reaction offers a possible method for the formation of deoxyoligonucleotides under primitive earth conditions.

  1. miRNA-based therapies: Strategies and delivery platforms for oligonucleotide and non-oligonucleotide agents

    PubMed Central

    Baumann, V; Winkler, J


    The discovery of microRNAs as important regulatory agents for gene expression has expanded the therapeutic opportunities for oligonucleotides. In contrast to siRNA, miRNA-targeted therapy is able to influence not only a single gene, but entire cellular pathways or processes. It is possible to supplement down regulated or non-functional miRNAs by synthetic oligonucleotides, as well as alleviating effects caused by overexpression of malignant miRNAs through artificial antagonists, either oligonucleotides or small molecules. Chemical oligonucleotide modifications together with an efficient delivery system seem to be mandatory for successful therapeutic application. While miRNA-based therapy benefits from the decades of research spent on other therapeutic oligonucleotides, there are some specific challenges associated with miRNA therapy, mainly caused by the short target sequence. The current status and recent progress of miRNA-targeted therapeutics is described and future challenges and potential applications in treatment of cancer and viral infections are discussed. PMID:25495987

  2. Bifunctional phosphoramidite reagents for the introduction of histidyl and dihistidyl residues into oligonucleotides.


    Smith, T H; LaTour, J V; Bochkariov, D; Chaga, G; Nelson, P S


    The synthesis and characterization of reagents for the incorporation of histidyl residues into oligonucleotides by automated chemical synthesis is described. Automated oligonucleotide synthesis utilizing a bifunctional reagent for the incorporation of a dihistidyl residue into oligonucleotides is described. Oligonucleotides incorporating one to three dihistidyl residues were prepared and characterized. The interaction of these oligonucleotides with a metal chelating IMAC matrix was explored. PMID:10411463

  3. Optically Triggered Immune Response through Photocaged Oligonucleotides

    PubMed Central

    Govan, Jeane M.; Young, Douglas D.; Lively, Mark O.


    Bacterial and viral CpG oligonculeotides are unmethylated cytosine-phosphate-guanosine dinucleotide sequences and trigger an innate immune response through activation of the toll-like receptor 9 (TLR9). We have developed synthetic photocaged CpGs via site-specific incorporation of nitropiperonyloxymethyl (NPOM)-caged thymidine residues. These oligonucleotides enable the optical control of TLR9 function and thereby provide light-activation of an immune response. We provide a proof-of-concept model by applying a reporter assay in live cells and by quantification of endogenous production of interleukin 6. PMID:26034339

  4. Terahertz spectroscopy of oligonucleotides in aqueous solutions.


    Tang, Mingjie; Huang, Qing; Wei, Dongshan; Zhao, Guozhong; Chang, Tianying; Kou, Kuan; Wang, Min; Du, Chunlei; Fu, Wei-ling; Cui, Hong-Liang


    A terahertz (THz) spectroscopic study is carried out to analyze DNA mutations in a label-free manner. Three newly designed liquid sample cells are considered and the best is selected as the sample carrier for THz transmission spectroscopic analyses. Discrimination based on spectral signatures of single-base mutations on single-stranded 20 nt oligonucleotides has been shown possible experimentally. The results clearly attest the ability of this promising approach for label-free analyses of single-base mutations of DNA molecules. This study has demonstrated that the THz spectroscopic technology can be considered as a potential diagnostic tool for investigating molecular reactions, such as DNA mutations. PMID:26385423

  5. Power enhancement via multivariate outlier testing with gene expression arrays

    PubMed Central

    Asare, Adam L.; Carey, Vincent J.; Wang, Richard; Seyfert-Margolis, Vicki


    Motivation: As the use of microarrays in human studies continues to increase, stringent quality assurance is necessary to ensure accurate experimental interpretation. We present a formal approach for microarray quality assessment that is based on dimension reduction of established measures of signal and noise components of expression followed by parametric multivariate outlier testing. Results: We applied our approach to several data resources. First, as a negative control, we found that the Affymetrix and Illumina contributions to MAQC data were free from outliers at a nominal outlier flagging rate of α=0.01. Second, we created a tunable framework for artificially corrupting intensity data from the Affymetrix Latin Square spike-in experiment to allow investigation of sensitivity and specificity of quality assurance (QA) criteria. Third, we applied the procedure to 507 Affymetrix microarray GeneChips processed with RNA from human peripheral blood samples. We show that exclusion of arrays by this approach substantially increases inferential power, or the ability to detect differential expression, in large clinical studies. Availability: and affyContam (credentials: readonly/readonly) Contact:; PMID:19015138

  6. A novel multifunctional oligonucleotide microarray for Toxoplasma gondii

    PubMed Central


    Background Microarrays are invaluable tools for genome interrogation, SNP detection, and expression analysis, among other applications. Such broad capabilities would be of value to many pathogen research communities, although the development and use of genome-scale microarrays is often a costly undertaking. Therefore, effective methods for reducing unnecessary probes while maintaining or expanding functionality would be relevant to many investigators. Results Taking advantage of available genome sequences and annotation for Toxoplasma gondii (a pathogenic parasite responsible for illness in immunocompromised individuals) and Plasmodium falciparum (a related parasite responsible for severe human malaria), we designed a single oligonucleotide microarray capable of supporting a wide range of applications at relatively low cost, including genome-wide expression profiling for Toxoplasma, and single-nucleotide polymorphism (SNP)-based genotyping of both T. gondii and P. falciparum. Expression profiling of the three clonotypic lineages dominating T. gondii populations in North America and Europe provides a first comprehensive view of the parasite transcriptome, revealing that ~49% of all annotated genes are expressed in parasite tachyzoites (the acutely lytic stage responsible for pathogenesis) and 26% of genes are differentially expressed among strains. A novel design utilizing few probes provided high confidence genotyping, used here to resolve recombination points in the clonal progeny of sexual crosses. Recent sequencing of additional T. gondii isolates identifies >620 K new SNPs, including ~11 K that intersect with expression profiling probes, yielding additional markers for genotyping studies, and further validating the utility of a combined expression profiling/genotyping array design. Additional applications facilitating SNP and transcript discovery, alternative statistical methods for quantifying gene expression, etc. are also pursued at pilot scale to inform

  7. Bioconjugation of oligonucleotides for treating liver fibrosis.


    Ye, Zhaoyang; Houssein, Houssam S Hajj; Mahato, Ram I


    Liver fibrosis results from chronic liver injury due to hepatitis B and C, excessive alcohol ingestion, and metal ion overload. Fibrosis culminates in cirrhosis and results in liver failure. Therefore, a potent antifibrotic therapy is urgently needed to reverse scarring and eliminate progression to cirrhosis. Although activated hepatic stellate cells (HSCs) remain the principle cell type responsible for liver fibrosis, perivascular fibroblasts of portal and central veins as well as periductular fibroblasts are other sources of fibrogenic cells. This review will critically discuss various treatment strategies for liver fibrosis, including prevention of liver injury, reduction of inflammation, inhibition of HSC activation, degradation of scar matrix, and inhibition of aberrant collagen synthesis. Oligonucleotides (ODNs) are short, single-stranded nucleic acids, which disrupt expression of target protein by binding to complementary mRNA or forming triplex with genomic DNA. Triplex forming oligonucleotides (TFOs) provide an attractive strategy for treating liver fibrosis. A series of TFOs have been developed for inhibiting the transcription of alpha1(I) collagen gene, which opens a new area for antifibrotic drugs. There will be in-depth discussion on the use of TFOs and how different bioconjugation strategies can be utilized for their site-specific delivery to HSCs or hepatocytes for enhanced antifibrotic activities. Various insights developed in individual strategy and the need for multipronged approaches will also be discussed. PMID:18154454


    PubMed Central

    Ye, Zhaoyang; Hajj Houssein, Houssam S.; Mahato, Ram I.


    Liver fibrosis results from chronic liver injury due to hepatitis B and C, excessive alcohol ingestion, and metal ion overload. Fibrosis culminates in cirrhosis and results in liver failure. Therefore, a potent antifibrotic therapy is in urgent need to reverse scarring and eliminate progression to cirrhosis. Although activated hepatic stellate cells (HSCs) remains the principle cell type responsible for liver fibrosis, perivascular fibroblasts of portal and central veins as well as periductular fibroblasts are other sources of fibrogenic cells. This review will critically discuss various treatment strategies for liver fibrosis, including prevention of liver injury, reduction of inflammation, inhibition of HSC activation, degradation of scar matrix, and inhibition of aberrant collagen synthesis. Oligonucleotides (ODNs) are short, single-stranded nucleic acids, which disrupt expression of target protein by binding to complementary mRNA or forming triplex with genomic DNA. Triplex forming oligonucleotides (TFOs) provide an attractive strategy for treating liver fibrosis. A series of TFOs have been developed for inhibiting the transcription of α1(I) collagen gene, which opens a new area for antifibrotic drugs. There will be in depth discussion on the use of TFOs and how different bioconjugation strategies can be utilized for their site-specific delivery to HSCs or hepatocytes for enhanced antifibrotic activities. Various insights developed in individual strategy and the need for multipronged approaches will also be discussed. PMID:18154454

  9. Template switching between PNA and RNA oligonucleotides

    NASA Technical Reports Server (NTRS)

    Bohler, C.; Nielsen, P. E.; Orgel, L. E.; Miller, S. L. (Principal Investigator)


    The origin of the RNA world is not easily understood, as effective prebiotic syntheses of the components of RNA, the beta-ribofuranoside-5'-phosphates, are hard to envisage. Recognition of this difficulty has led to the proposal that other genetic systems, the components of which are more easily formed, may have preceded RNA. This raises the question of how transitions between one genetic system and another could occur. Peptide nucleic acid (PNA) resembles RNA in its ability to form double-helical complexes stabilized by Watson-Crick hydrogen bonding between adenine and thymine and between cytosine and guanine, but has a backbone that is held together by amide rather than by phosphodiester bonds. Oligonucleotides bases on RNA are known to act as templates that catalyse the non-enzymatic synthesis of their complements from activated mononucleotides, we now show that RNA oligonucleotides facilitate the synthesis of complementary PNA strands and vice versa. This suggests that a transition between different genetic systems can occur without loss of information.

  10. Survivin Antisense Oligonucleotides Effectively Radiosensitize Colorectal Cancer Cells in Both Tissue Culture and Murine Xenograft Models

    SciTech Connect

    Roedel, Franz; Capalbo, Gianni; Weiss, Christian; Roedel, Claus


    Purpose: Survivin shows a radiation resistance factor in colorectal cancer. In the present study, we determined whether survivin messenger RNA levels in patients with rectal cancer predict tumor response after neoadjuvant radiochemotherapy and whether inhibition of survivin by the use of antisense oligonucleotides (ASOs) enhances radiation responses. Methods and Materials: SW480 colorectal carcinoma cells were transfected with survivin ASO (LY2181308) and irradiated with doses ranging from 0-8 Gy. Survivin expression, cell-cycle distribution, {gamma}H2AX fluorescence, and induction of apoptosis were monitored by means of immunoblotting, flow cytometry, and caspase 3/7 activity. Clonogenic survival was determined by using a colony-forming assay. An SW480 xenograft model was used to investigate the effect of survivin attenuation and irradiation on tumor growth. Furthermore, survivin messenger RNA levels were studied in patient biopsy specimens by using Affymetrix microarray analysis. Results: In the translational study of 20 patients with rectal cancer, increased survivin levels were associated with significantly greater risk of local tumor recurrence (p = 0.009). Treatment of SW480 cells with survivin ASOs and irradiation resulted in an increased percentage of apoptotic cells, caspase 3/7 activity, fraction of cells in the G{sub 2}/M phase, and H2AX phosphorylation. Clonogenic survival decreased compared with control-treated cells. Furthermore, treatment of SW480 xenografts with survivin ASOs and irradiation resulted in a significant delay in tumor growth. Conclusion: Survivin appears to be a molecular biomarker in patients with rectal cancer. Furthermore, in vitro and in vivo data suggest a potential role of survivin as a molecular target to improve treatment response to radiotherapy in patients with rectal cancer.

  11. Voltage-gated calcium channel and antisense oligonucleotides thereto

    NASA Technical Reports Server (NTRS)

    Hruska, Keith A. (Inventor); Friedman, Peter A. (Inventor); Barry, Elizabeth L. R. (Inventor); Duncan, Randall L. (Inventor)


    An antisense oligonucleotide of 10 to 35 nucleotides in length that can hybridize with a region of the .alpha..sub.1 subunit of the SA-Cat channel gene DNA or mRNA is provided, together with pharmaceutical compositions containing and methods utilizing such antisense oligonucleotide.

  12. Uptake and antifungal activity of oligonucleotides in Candida albicans

    PubMed Central

    Disney, Matthew D.; Haidaris, Constantine G.; Turner, Douglas H.


    Candida albicans is a significant cause of disease in immunocompromised humans. Because the number of people infected by fungal pathogens is increasing, strategies are being developed to target RNAs in fungi. This work shows that oligonucleotides can serve as therapeutics against C. albicans. In particular, oligonucleotides are taken up from cell culture medium in an energy-dependent process. After uptake, oligonucleotides, including RNA, remain mostly intact after 12 h in culture. For culture conditions designed for mammalian cells, intracellular concentrations of oligonucleotides in C. albicans exceed those in COS-7 mammalian cells, suggesting that uptake can provide selective targeting of fungi over human cells. A 19-mer 2′OMe (oligonucleotide with a 2′-O-methyl backbone) hairpin is described that inhibits growth of a C. albicans strain at pH < 4.0. This pH is easily tolerated in some parts of the body subject to C. albicans infections. In vivo dimethyl sulfate modification of ribosomal RNA and the decreased rate of protein synthesis suggest that this hairpin's activity may be due to targeting the ribosome in a way that does not depend on base pairing. Addition of anti-C. albicans oligonucleotides to COS-7 mammalian cells has no effect on cell growth. Evidently, oligonucleotides can selectively serve as therapeutics toward C. albicans and, presumably, other pathogens. Information from genome sequencing and functional genomics studies on C. albicans and other pathogens should allow rapid design and testing of other approaches for oligonucleotide therapies. PMID:12552085

  13. Disulfide-linked oligonucleotide phosphorothioates - Novel analogues of nucleic acids

    NASA Technical Reports Server (NTRS)

    Wu, Taifeng; Orgel, Leslie E.


    The synthesis of phosphorothioate analogs of oligonucleotides by the oxidation of deoxyadenosine 3',5'-bisphosphorothioate (3) was attempted. Cyclization of 3 is much more efficient than oligomerization under all the conditions investigated. However, a preformed oligonucleotide carrying a 5'-terminal phosphorotioate group undergoes efficient chain-extension when oxidized in the presence of 3.

  14. 2'-modified nucleosides for site-specific labeling of oligonucleotides

    NASA Technical Reports Server (NTRS)

    Krider, Elizabeth S.; Miller, Jeremiah E.; Meade, Thomas J.


    We report the synthesis of 2'-modified nucleosides designed specifically for incorporating labels into oligonucleotides. Conversion of these nucleosides to phosphoramidite and solid support-bound derivatives proceeds in good yield. Large-scale synthesis of 11-mer oligonucleotides possessing the 2'-modified nucleosides is achieved using these derivatives. Thermal denaturation studies indicate that the presence of 2'-modified nucleosides in 11-mer duplexes has minimal destabilizing effects on the duplex structure when the nucleosides are placed at the duplex termini. The powerful combination of phosphoramidite and support-bound derivatives of 2'-modified nucleosides affords the large-scale preparation of an entirely new class of oligonucleotides. The ability to synthesize oligonucleotides containing label attachment sites at 3', intervening, and 5' locations of a duplex is a significant advance in the development of oligonucleotide conjugates.

  15. Utility of array comparative genomic hybridization in cytogenetic analysis.


    Singh, Rashmi R; Cheung, K-John J; Horsman, Douglas E


    Conventional comparative genomic hybridization (CGH), high-resolution oligonucleotide, and BAC array CGH have modernized the field of cytogenetics to enable access to unbalanced genomic aberrations such as whole or partial chromosomal gains and losses. The basic principle of array CGH involves hybridizing differentially labeled proband/test (e.g., tumor) and normal reference DNA on an array of oligonucleotide or BAC clones instead of normal metaphases as in conventional CGH. The sub-megabase resolution tiling BAC arrays are extremely useful for the analysis of acquired aberrations in cancer genomes. Array CGH can be extremely useful to identify the chromosomal makeup of marker and ring chromosomes, to define/delineate the precise location/bands involved in structural aberrations and the accurate localization of translocation breakpoints in both simple and complex karyotypes either alone or in combination with standard karyotype analysis. PMID:21431645

  16. Long synthetic oligonucleotides for microarray expression measurement

    NASA Astrophysics Data System (ADS)

    Li, Jiong; Wang, Hong; Liu, Heping; Zhang, M.; Zhang, Chunxiu; Lu, Zu-Hong; Gao, Xiang; Kong, Dong


    There are generally two kinds of DNA microarray used for genomic-scale gene expression profiling of mRNA: cDNA and DNA chip, but both of them suffer from some drawbacks. To meet more requirements, another oligonucleotide microarray with long was produced. This type of microarray had the advantages of low cost, minimal Cross-hybridization, flexible and easy to make, which is most fit for small laboratories with special purposes. In this paper, we devised different probes with different probe lengths, GC contents and gene positions to optimization the probe design. Experiments showed 70 mer probes are suitable for both sufficient sensitivity and reasonable costs. Higher G-C content produces stronger signal intensity thus better sensitivity and probes designed at 3 untranslated region of gene within the range of 300 pb should be best for both sensitivity and specificity.

  17. Phosphoramidate Ligation of Oligonucleotides in Nanoscale Structures.


    Kalinowski, Matthäus; Haug, Rüdiger; Said, Hassan; Piasecka, Sylwia; Kramer, Markus; Richert, Clemens


    The folding of long DNA strands into designed nanostructures has evolved into an art. Being based on linear chains only, the resulting nanostructures cannot readily be transformed into covalently linked frameworks. Covalently linking strands in the context of folded DNA structures requires a robust method that avoids sterically demanding reagents or enzymes. Here we report chemical ligation of the 3'-amino termini of oligonucleotides and 5'-phosphorylated partner strands in templated reactions that produce phosphoramidate linkages. These reactions produce inter-nucleotide linkages that are isoelectronic and largely isosteric to phosphodiesters. Ligations were performed at three levels of complexity, including the extension of branched DNA hybrids and the ligation of six scaffold strands in a small origami. PMID:27225865

  18. MALDI analysis of oligonucleotides directly from montmorillonite.


    Zagorevskii, Dmitri V; Aldersley, Michael F; Ferris, James P


    Oligonucleotides synthesized on a montmorillonite catalyst were analyzed directly. By mixing the catalyst with a matrix (2,4,6-trihydroxyacetophenone or 6-aza-2-thiothymine) and dibasic ammonium citrate, higher molecular weight products were detected compared with "classical" methods such as gel electrophoresis and HPLC with UV as a detector. The oligomers (30-mers and higher) were detected by mass spectrometry even though their concentration was less than 10(-4)% of the total content of the RNA. This method is different from the (MALDI) analysis of the eluates from montmorillonite, which otherwise requires desalting. Placing reaction mixtures with a high concentration of buffers on homoionic, preferably Li-containing, montmorillonite does not require desalting. PMID:16809045

  19. Use of nanoparticles to deliver immunomodulatory oligonucleotides.


    Klinman, Dennis M; Sato, Takashi; Shimosato, Takeshi


    Synthetic oligonucleotides (ODNs) containing unmethylated 'CpG motifs' stimulate the innate immune system to produce cytokines, chemokines, and polyreactive antibodies. CpG ODNs have shown promise as vaccine adjuvants and for the treatment of infectious diseases and cancer. The immunostimulatory activity of CpG ODNs is inhibited by DNA-containing 'suppressive' motifs. ODNs expressing suppressive motifs (Sup ODNs) reduce ongoing immune reactions and show promise in the treatment of autoimmune and inflammatory diseases. This work reviews recent progress in the use of nanoparticles as carriers of CpG and Sup ODNs to target their delivery to the GI tract and lungs. WIREs Nanomed Nanobiotechnol 2016, 8:631-637. doi: 10.1002/wnan.1382 For further resources related to this article, please visit the WIREs website. PMID:26663867

  20. Preparation and application of triple helix forming oligonucleotides and single strand oligonucleotide donors for gene correction.


    Alam, Rowshon; Thazhathveetil, Arun Kalliat; Li, Hong; Seidman, Michael M


    Strategies for site-specific modulation of genomic sequences in mammalian cells require two components. One must be capable of recognizing and activating a specific target sequence in vivo, driving that site into an exploitable repair pathway. Information is transferred to the site via participation in the pathway by the second component, a donor nucleic acid, resulting in a permanent change in the target sequence. We have developed biologically active triple helix forming oligonucleotides (TFOs) as site-specific gene targeting reagents. These TFOs, linked to DNA reactive compounds (such as a cross-linking agent), activate pathways that can engage informational donors. We have used the combination of a psoralen-TFO and single strand oligonucleotide donors to generate novel cell lines with directed sequence changes at the target site. Here we describe the synthesis and purification of bioactive psoralen-linked TFOs, their co-introduction into mammalian cells with donor nucleic acids, and the identification of cells with sequence conversion of the target site. We have emphasized details in the synthesis and purification of the oligonucleotides that are essential for preparation of reagents with optimal activity. PMID:24557899

  1. DNA Oligonucleotide 3'-Phosphorylation by a DNA Enzyme.


    Camden, Alison J; Walsh, Shannon M; Suk, Sarah H; Silverman, Scott K


    T4 polynucleotide kinase is widely used for 5'-phosphorylation of DNA and RNA oligonucleotide termini, but no natural protein enzyme is capable of 3'-phosphorylation. Here, we report the in vitro selection of deoxyribozymes (DNA enzymes) capable of DNA oligonucleotide 3'-phosphorylation, using a 5'-triphosphorylated RNA transcript (pppRNA) as the phosphoryl donor. The basis of selection was the capture, during each selection round, of the 3'-phosphorylated DNA substrate terminus by 2-methylimidazole activation of the 3'-phosphate (forming 3'-MeImp) and subsequent splint ligation with a 5'-amino DNA oligonucleotide. Competing and precedented DNA-catalyzed reactions were DNA phosphodiester hydrolysis or deglycosylation, each also leading to a 3'-phosphate but at a different nucleotide position within the DNA substrate. One oligonucleotide 3'-kinase deoxyribozyme, obtained from an N40 random pool and named 3'Kin1, can 3'-phosphorylate nearly any DNA oligonucleotide substrate for which the 3'-terminus has the sequence motif 5'-NKR-3', where N denotes any oligonucleotide sequence, K = T or G, and R = A or G. These results establish the viabilty of in vitro selection for identifying DNA enzymes that 3'-phosphorylate DNA oligonucleotides. PMID:27063020

  2. The frequency of oligonucleotides in mammalian genic regions.


    Volinia, S; Gambari, R; Bernardi, F; Barrai, I


    The large body of nucleic acid sequence data now available offers a unique opportunity for the characterization of individual oligonucleotides which may be specific to sequence functional domains. We have prepared algorithms for the study of the frequency distribution of all oligonucleotides of length 2-6 in DNA sequences. We have implemented them in the study of 634 mammalian DNA sequences spanning 1.782 Mb, and have obtained the distribution of the ratio between the observed frequency of oligonucleotides and their expected frequency based on independent nucleotide probabilities. We then studied the distribution of oligonucleotides (or k-tuples) of each length in a subset of 129 complete mammalian genes spanning 0.607 Mb. Eight distinct genomic regions, namely 5'-non-transcribed, first exon, first intron, intermediate exons, intermediate introns, last intron, last exon and 3'-non-transcribed, were considered. We observed that some oligonucleotides show a statistical behaviour and a regional distribution similar to that of known signal sequences. Moreover the frequency distribution of oligonucleotides of length 5 and 6 tends to become bimodal, indicating the existence of a population of very frequent oligonucleotides. PMID:2924169

  3. Design and analysis of mismatch probes for long oligonucleotide microarrays

    SciTech Connect

    Deng, Ye; He, Zhili; Van Nostrand, Joy D.; Zhou, Jizhong


    Nonspecific hybridization is currently a major concern with microarray technology. One of most effective approaches to estimating nonspecific hybridizations in oligonucleotide microarrays is the utilization of mismatch probes; however, this approach has not been used for longer oligonucleotide probes. Here, an oligonucleotide microarray was constructed to evaluate and optimize parameters for 50-mer mismatch probe design. A perfect match (PM) and 28 mismatch (MM) probes were designed for each of ten target genes selected from three microorganisms. The microarrays were hybridized with synthesized complementary oligonucleotide targets at different temperatures (e.g., 42, 45 and 50 C). In general, the probes with evenly distributed mismatches were more distinguishable than those with randomly distributed mismatches. MM probes with 3, 4 and 5 mismatched nucleotides were differentiated for 50-mer oligonucleotide probes hybridized at 50, 45 and 42 C, respectively. Based on the experimental data generated from this study, a modified positional dependent nearest neighbor (MPDNN) model was constructed to adjust the thermodynamic parameters of matched and mismatched dimer nucleotides in the microarray environment. The MM probes with four flexible positional mismatches were designed using the newly established MPDNN model and the experimental results demonstrated that the redesigned MM probes could yield more consistent hybridizations. Conclusions: This study provides guidance on the design of MM probes for long oligonucleotides (e.g., 50 mers). The novel MPDNN model has improved the consistency for long MM probes, and this modeling method can potentially be used for the prediction of oligonucleotide microarray hybridizations.

  4. Ca2+ enrichment in culture medium potentiates effect of oligonucleotides.


    Hori, Shin-Ichiro; Yamamoto, Tsuyoshi; Waki, Reiko; Wada, Shunsuke; Wada, Fumito; Noda, Mio; Obika, Satoshi


    Antisense and RNAi-related oligonucleotides have gained attention as laboratory tools and therapeutic agents based on their ability to manipulate biological events in vitro and in vivo. We show that Ca(2+) enrichment of medium (CEM) potentiates the in vitro activity of multiple types of oligonucleotides, independent of their net charge and modifications, in various cells. In addition, CEM reflects in vivo silencing activity more consistently than conventional transfection methods. Microscopic analysis reveals that CEM provides a subcellular localization pattern of oligonucleotides resembling that obtained by unassisted transfection, but with quantitative improvement. Highly monodispersed nanoparticles ~100 nm in size are found in Ca(2+)-enriched serum-containing medium regardless of the presence or absence of oligonucleotides. Transmission electron microscopy analysis reveals that the 100-nm particles are in fact an ensemble of much smaller nanoparticles (ϕ ∼ 15 nm). The presence of these nanoparticles is critical for the efficient uptake of various oligonucleotides. In contrast, CEM is ineffective for plasmids, which are readily transfected via the conventional calcium phosphate method. Collectively, CEM enables a more accurate prediction of the systemic activity of therapeutic oligonucleotides, while enhancing the broad usability of oligonucleotides in the laboratory. PMID:26101258

  5. Ca2+ enrichment in culture medium potentiates effect of oligonucleotides

    PubMed Central

    Hori, Shin-ichiro; Yamamoto, Tsuyoshi; Waki, Reiko; Wada, Shunsuke; Wada, Fumito; Noda, Mio; Obika, Satoshi


    Antisense and RNAi-related oligonucleotides have gained attention as laboratory tools and therapeutic agents based on their ability to manipulate biological events in vitro and in vivo. We show that Ca2+ enrichment of medium (CEM) potentiates the in vitro activity of multiple types of oligonucleotides, independent of their net charge and modifications, in various cells. In addition, CEM reflects in vivo silencing activity more consistently than conventional transfection methods. Microscopic analysis reveals that CEM provides a subcellular localization pattern of oligonucleotides resembling that obtained by unassisted transfection, but with quantitative improvement. Highly monodispersed nanoparticles ∼100 nm in size are found in Ca2+-enriched serum-containing medium regardless of the presence or absence of oligonucleotides. Transmission electron microscopy analysis reveals that the 100-nm particles are in fact an ensemble of much smaller nanoparticles (ϕ ∼ 15 nm). The presence of these nanoparticles is critical for the efficient uptake of various oligonucleotides. In contrast, CEM is ineffective for plasmids, which are readily transfected via the conventional calcium phosphate method. Collectively, CEM enables a more accurate prediction of the systemic activity of therapeutic oligonucleotides, while enhancing the broad usability of oligonucleotides in the laboratory. PMID:26101258

  6. Nucleic acid sequence detection using multiplexed oligonucleotide PCR


    Nolan, John P.; White, P. Scott


    Methods for rapidly detecting single or multiple sequence alleles in a sample nucleic acid are described. Provided are all of the oligonucleotide pairs capable of annealing specifically to a target allele and discriminating among possible sequences thereof, and ligating to each other to form an oligonucleotide complex when a particular sequence feature is present (or, alternatively, absent) in the sample nucleic acid. The design of each oligonucleotide pair permits the subsequent high-level PCR amplification of a specific amplicon when the oligonucleotide complex is formed, but not when the oligonucleotide complex is not formed. The presence or absence of the specific amplicon is used to detect the allele. Detection of the specific amplicon may be achieved using a variety of methods well known in the art, including without limitation, oligonucleotide capture onto DNA chips or microarrays, oligonucleotide capture onto beads or microspheres, electrophoresis, and mass spectrometry. Various labels and address-capture tags may be employed in the amplicon detection step of multiplexed assays, as further described herein.

  7. Antisense oligonucleotide induction of progerin in human myogenic cells.


    Luo, Yue-Bei; Mitrpant, Chalermchai; Adams, Abbie M; Johnsen, Russell D; Fletcher, Sue; Mastaglia, Frank L; Wilton, Steve D


    We sought to use splice-switching antisense oligonucleotides to produce a model of accelerated ageing by enhancing expression of progerin, translated from a mis-spliced lamin A gene (LMNA) transcript in human myogenic cells. The progerin transcript (LMNA Δ150) lacks the last 150 bases of exon 11, and is translated into a truncated protein associated with the severe premature ageing disease, Hutchinson-Gilford progeria syndrome (HGPS). HGPS arises from de novo mutations that activate a cryptic splice site in exon 11 of LMNA and result in progerin accumulation in tissues of mesodermal origin. Progerin has also been proposed to play a role in the 'natural' ageing process in tissues. We sought to test this hypothesis by producing a model of accelerated muscle ageing in human myogenic cells. A panel of splice-switching antisense oligonucleotides were designed to anneal across exon 11 of the LMNA pre-mRNA, and these compounds were transfected into primary human myogenic cells. RT-PCR showed that the majority of oligonucleotides were able to modify LMNA transcript processing. Oligonucleotides that annealed within the 150 base region of exon 11 that is missing in the progerin transcript, as well as those that targeted the normal exon 11 donor site induced the LMNA Δ150 transcript, but most oligonucleotides also generated variable levels of LMNA transcript missing the entire exon 11. Upon evaluation of different oligomer chemistries, the morpholino phosphorodiamidate oligonucleotides were found to be more efficient than the equivalent sequences prepared as oligonucleotides with 2'-O-methyl modified bases on a phosphorothioate backbone. The morpholino oligonucleotides induced nuclear localised progerin, demonstrated by immunostaining, and morphological nuclear changes typical of HGPS cells. We show that it is possible to induce progerin expression in myogenic cells using splice-switching oligonucleotides to redirect splicing of LMNA. This may offer a model to investigate

  8. An Integrated ISFET Sensor Array

    PubMed Central

    Nakazato, Kazuo


    A monolithically integrated ISFET sensor array and interface circuit are described. A new high-density, low-power source-drain follower was developed for the sensor array. ISFETs were formed by depositing Au/Ti extended-gate electrodes on standard MOSFETs, then thin silicon nitride layers using catalytic chemical vapor deposition and/or SU-8 protective layers were formed on the extended-gate electrodes. Applications for the array include: (1) pH detection by statistical distribution observing time and space fluctuations; (2) DNA detection using thiol-modified or silane-coupled oligonucleotides; (3) bio-image sensing by converting photons to electrons using Photosystem I of Thermosynechococcus elongatus, and sensing the converted electric charges by ISFETs. PMID:22291539

  9. Polyphosphorylation and non-enzymatic template-directed ligation of oligonucleotides

    NASA Technical Reports Server (NTRS)

    Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)


    Oligonucleotide 5'-polyphosphates are formed under potentially prebiotic conditions from oligonucleotide 5'-phosphates and sodium trimetaphosphate. Oligonucleotides activated as polyphosphates undergo template-directed ligation. We believe that these reactions could have produced longer oligonucleotide products from shorter substrates under prebiotic conditions.

  10. Traceback identification of plant components in commercial compound feed through an oligonucleotide microarray based on tubulin intron polymorphism.


    Ponzoni, Elena; Morello, Laura; Gianì, Silvia; Breviario, Diego


    According to EU Regulations, all components of commercial compound feed need to be declared on the label. Effective protection against fraud requires severe controls based on accurate analytical methods to ascertain what is declared by the producers. The aim of this work was to develop an oligonucleotide microarray for the molecular recognition of multiple plant components in commercial feeds. We tested the potential of the highly polymorphic first intron sequences from members of the plant β-tubulin gene family as a target for plant DNA identification. 23 oligonucleotide capture probes, targeting species-specific intron sequences, were assembled within a low density microarray for the identification of 10 plant species, selected from among those most commonly used in cattle feed formulation. The ability of the array to detect specific components in complex flour blends and in compound feed was evaluated. PMID:24874359

  11. Molecular Selection, Modification and Development of Therapeutic Oligonucleotide Aptamers

    PubMed Central

    Yu, Yuanyuan; Liang, Chao; Lv, Quanxia; Li, Defang; Xu, Xuegong; Liu, Baoqin; Lu, Aiping; Zhang, Ge


    Monoclonal antibodies are the dominant agents used in inhibition of biological target molecules for disease therapeutics, but there are concerns of immunogenicity, production, cost and stability. Oligonucleotide aptamers have comparable affinity and specificity to targets with monoclonal antibodies whilst they have minimal immunogenicity, high production, low cost and high stability, thus are promising inhibitors to rival antibodies for disease therapy. In this review, we will compare the detailed advantages and disadvantages of antibodies and aptamers in therapeutic applications and summarize recent progress in aptamer selection and modification approaches. We will present therapeutic oligonucleotide aptamers in preclinical studies for skeletal diseases and further discuss oligonucleotide aptamers in different stages of clinical evaluation for various disease therapies including macular degeneration, cancer, inflammation and coagulation to highlight the bright commercial future and potential challenges of therapeutic oligonucleotide aptamers. PMID:26978355


    EPA Science Inventory

    Thoughtful data analysis is as important as experimental design, biological sample quality, and appropriate experimental procedures for making microarrays a useful supplement to traditional toxicology. In the present study, spotted oligonucleotide microarrays were used to profile...

  13. Sequence-dependent theory of oligonucleotide hybridization kinetics

    SciTech Connect

    Marimuthu, Karthikeyan; Chakrabarti, Raj E-mail:


    A theoretical approach to the prediction of the sequence and temperature-dependent rate constants for oligonucleotide hybridization reactions has been developed based on the theory of relaxation kinetics. One-sided and two-sided melting reaction mechanisms for oligonucleotide hybridization reactions have been considered, analyzed, modified, and compared to select a physically consistent as well as robust model for prediction of the relaxation times of DNA hybridization reactions that agrees with the experimental evidence. The temperature- and sequence-dependent parameters of the proposed model have been estimated using available experimental data. The relaxation time model that we developed has been combined with the nearest neighbor model of hybridization thermodynamics to estimate the temperature- and sequence-dependent rate constants of an oligonucleotide hybridization reaction. The model-predicted rate constants are compared to experimentally determined rate constants for the same oligonucleotide hybridization reactions. Finally, we consider a few important applications of kinetically controlled DNA hybridization reactions.

  14. Micro- and nano-structure based oligonucleotide sensors.


    Ferrier, David C; Shaver, Michael P; Hands, Philip J W


    This paper presents a review of micro- and nano-structure based oligonucleotide detection and quantification techniques. The characteristics of such devices make them very attractive for Point-of-Care or On-Site-Testing biosensing applications. Their small scale means that they can be robust and portable, their compatibility with modern CMOS electronics means that they can easily be incorporated into hand-held devices and their suitability for mass production means that, out of the different approaches to oligonucleotide detection, they are the most suitable for commercialisation. This review discusses the advantages of micro- and nano-structure based sensors and covers the various oligonucleotide detection techniques that have been developed to date. These include: Bulk Acoustic Wave and Surface Acoustic Wave devices, micro- and nano-cantilever sensors, gene Field Effect Transistors, and nanowire and nanopore based sensors. Oligonucleotide immobilisation techniques are also discussed. PMID:25655465

  15. Highly parallel oligonucleotide purification and functionalization using reversible chemistry

    PubMed Central

    York, Kerri T.; Smith, Ryan C.; Yang, Rob; Melnyk, Peter C.; Wiley, Melissa M.; Turk, Casey M.; Ronaghi, Mostafa; Gunderson, Kevin L.; Steemers, Frank J.


    We have developed a cost-effective, highly parallel method for purification and functionalization of 5′-labeled oligonucleotides. The approach is based on 5′-hexa-His phase tag purification, followed by exchange of the hexa-His tag for a functional group using reversible reaction chemistry. These methods are suitable for large-scale (micromole to millimole) production of oligonucleotides and are amenable to highly parallel processing of many oligonucleotides individually or in high complexity pools. Examples of the preparation of 5′-biotin, 95-mer, oligonucleotide pools of >40K complexity at micromole scale are shown. These pools are prepared in up to ~16% yield and 90–99% purity. Approaches for using this method in other applications are also discussed. PMID:22039155

  16. Highly parallel oligonucleotide purification and functionalization using reversible chemistry.


    York, Kerri T; Smith, Ryan C; Yang, Rob; Melnyk, Peter C; Wiley, Melissa M; Turk, Casey M; Ronaghi, Mostafa; Gunderson, Kevin L; Steemers, Frank J


    We have developed a cost-effective, highly parallel method for purification and functionalization of 5'-labeled oligonucleotides. The approach is based on 5'-hexa-His phase tag purification, followed by exchange of the hexa-His tag for a functional group using reversible reaction chemistry. These methods are suitable for large-scale (micromole to millimole) production of oligonucleotides and are amenable to highly parallel processing of many oligonucleotides individually or in high complexity pools. Examples of the preparation of 5'-biotin, 95-mer, oligonucleotide pools of >40K complexity at micromole scale are shown. These pools are prepared in up to ~16% yield and 90-99% purity. Approaches for using this method in other applications are also discussed. PMID:22039155

  17. Oligonucleotide-based theranostic nanoparticles in cancer therapy.


    Shahbazi, Reza; Ozpolat, Bulent; Ulubayram, Kezban


    Theranostic approaches, combining the functionality of both therapy and imaging, have shown potential in cancer nanomedicine. Oligonucleotides such as small interfering RNA and microRNA, which are powerful therapeutic agents, have been effectively employed in theranostic systems against various cancers. Nanoparticles are used to deliver oligonucleotides into tumors by passive or active targeting while protecting the oligonucleotides from nucleases in the extracellular environment. The use of quantum dots, iron oxide nanoparticles and gold nanoparticles and tagging with contrast agents, like fluorescent dyes, optical or magnetic agents and various radioisotopes, has facilitated early detection of tumors and evaluation of therapeutic efficacy. In this article, we review the advantages of theranostic applications in cancer therapy and imaging, with special attention to oligonucleotide-based therapeutics. PMID:27102380

  18. Oligonucleotide-Functionalized Anisotropic Gold Nanoparticles

    NASA Astrophysics Data System (ADS)

    Jones, Matthew Robert

    In this thesis, we describe the properties of oligonucleotide-functionalized gold colloids under the unique set of conditions where the particles are geometrically anisotropic and have nanometer-scale dimensions. While nearly two decades of previous work elucidated numerous unexpected and emergent phenomena arising from the combination of inorganic nanoparticles with surface-bound DNA strands, virtually nothing was known about how these properties are altered when the shape of the nanoparticle core is chosen to be non-spherical. In particular, we are interested in understanding, and ultimately controlling, the ways in which these DNA-conjugated anisotropic nanostructures interact when their attraction is governed by programmable DNA hybridization events. Chapter 1 introduces the field of DNA-based materials assembly by discussing how nanoscale building blocks which present rigid, directional interactions can be thought of as possessing artificial versions of the familiar chemical principles of "bonds" and "valency". In chapter 2 we explore the fundamental interparticle binding thermodynamics of DNA-functionalized spherical and anisotropic nanoparticles, which reveals enormous preferences for collective ligand interactions occurring between flat surfaces over those that occur between curved surfaces. Using these insights, chapter 3 demonstrates that when syntheses produce mixtures of different nanoparticle shapes, the tailorable nature of DNA-mediated interparticle association can be used to selectively crystallize and purify the desired anisotropic nanostructure products, leaving spherical impurity particles behind. Chapter 4 leverages the principle that the flat facets of anisotropic particles generate directional DNA-based hybridization interactions to assemble a variety of tailorable nanoparticle superlattices whose symmetry and dimensionality are a direct consequence of the shape of the nanoparticle building block used in their construction. Chapter 5 explores

  19. High-density fiber optic biosensor arrays

    NASA Astrophysics Data System (ADS)

    Epstein, Jason R.; Walt, David R.


    Novel approaches are required to coordinate the immense amounts of information derived from diverse genomes. This concept has influenced the expanded role of high-throughput DNA detection and analysis in the biological sciences. A high-density fiber optic DNA biosensor was developed consisting of oligonucleotide-functionalized, 3.1 mm diameter microspheres deposited into the etched wells on the distal face of a 500 micrometers imaging fiber bundle. Imaging fiber bundles containing thousands of optical fibers, each associated with a unique oligonucleotide probe sequence, were the foundation for an optically connected, individually addressable DNA detection platform. Different oligonucleotide-functionalized microspheres were combined in a stock solution, and randomly dispersed into the etched wells. Microsphere positions were registered from optical dyes incorporated onto the microspheres. The distribution process provided an inherent redundancy that increases the signal-to-noise ratio as the square root of the number of sensors examined. The representative amount of each probe-type in the array was dependent on their initial stock solution concentration, and as other sequences of interest arise, new microsphere elements can be added to arrays without altering the existing detection capabilities. The oligonucleotide probe sequences hybridize to fluorescently-labeled, complementary DNA target solutions. Fiber optic DNA microarray research has included DNA-protein interaction profiles, microbial strain differentiation, non-labeled target interrogation with molecular beacons, and single cell-based assays. This biosensor array is proficient in DNA detection linked to specific disease states, single nucleotide polymorphism (SNP's) discrimination, and gene expression analysis. This array platform permits multiple detection formats, provides smaller feature sizes, and enables sensor design flexibility. High-density fiber optic microarray biosensors provide a fast

  20. Fabrication of DNA Polymer Brush Arrays by Destructive Micropatterning and Rolling-Circle Amplification

    PubMed Central

    Barbee, Kristopher D.; Chandrangsu, Matt; Huang, Xiaohua


    A method for fabricating DNA polymer brush arrays using photolithography and plasma etching followed by solid-phase enzymatic DNA amplification is reported. After attaching oligonucleotide primers to the surface of a glass coverslip, a thin layer of photoresist is spin-coated on the glass and patterned via photolithography to generate an array of posts in the resist. An oxygen-based plasma is then used to destroy the exposed oligonucleotide primers. The glass coverslip with the primer array is assembled into a microfluidic chip and DNA polymer brushes are synthesized on the oligonucleotide array by rolling-circle DNA amplification. We have demonstrated that the linear polymers can be rapidly synthesized in situ with a high degree of control over their density and length. PMID:21305694

  1. Synthesis and evaluation of phosphorescent oligonucleotide probes for hybridisation assays.


    O'Sullivan, Paul J; Burke, Martina; Soini, Aleksi E; Papkovsky, Dmitri B


    Monofunctional, p-isothiocyanatophenyl-derivatives of platinum (II)-coproporphyrin-I (PtCP-NCS) were evaluated as phosphorescent labelling reagents for synthetic oligonucleotides containing a 3'- or 5'-amino modification. Synthesis and purification conditions were optimised to generate high yields and purity of PtCP-labelled oligonucleotide probes. Phosphorescent properties of the PtCP label have been shown to be largely unaffected by conjugation to oligonucleotides of various length, GC composition and label attachment site. 5'-PtCP-labelled oligonucleotides were shown to work efficiently as primers in a standard PCR. A dedicated 532 nm laser-based time-resolved fluorescence plate reader enabled highly sensitive detection of PtCP-labelled oligonucleotides and PCR products, both in solution and in agarose gels, with limits of detection in the order of 0.3 pM. A model system employing two complementary oligonucleotides labelled with PtCP and QSY 7 dye (dark quencher) showed strong (approximately 20-fold) and specific proximity quenching of PtCP label upon hybridisation in solution. The potential applications of PtCP-labelled probes in hybridisation assays were discussed. PMID:12409473

  2. Synthesis and evaluation of phosphorescent oligonucleotide probes for hybridisation assays

    PubMed Central

    O’Sullivan, Paul J.; Burke, Martina; Soini, Aleksi E.; Papkovsky, Dmitri B.


    Monofunctional, p-isothiocyanatophenyl-derivatives of platinum (II)-coproporphyrin-I (PtCP-NCS) were evaluated as phosphorescent labelling reagents for synthetic oligonucleotides containing a 3′- or 5′-amino modification. Synthesis and purification conditions were optimised to generate high yields and purity of PtCP-labelled oligonucleotide probes. Phosphorescent properties of the PtCP label have been shown to be largely unaffected by conjugation to oligonucleotides of various length, GC composition and label attachment site. 5′-PtCP-labelled oligonucleotides were shown to work efficiently as primers in a standard PCR. A dedicated 532 nm laser-based time-resolved fluorescence plate reader enabled highly sensitive detection of PtCP-labelled oligonucleotides and PCR products, both in solution and in agarose gels, with limits of detection in the order of 0.3 pM. A model system employing two complementary oligonucleotides labelled with PtCP and QSY® 7 dye (dark quencher) showed strong (∼20-fold) and specific proximity quenching of PtCP label upon hybridisation in solution. The potential applications of PtCP-labelled probes in hybridisation assays were discussed. PMID:12409473

  3. Oligonucleotide conjugates - Candidates for gene silencing therapeutics.


    Gooding, Matt; Malhotra, Meenakshi; Evans, James C; Darcy, Raphael; O'Driscoll, Caitriona M


    The potential therapeutic and diagnostic applications of oligonucleotides (ONs) have attracted great attention in recent years. The capability of ONs to selectively inhibit target genes through antisense and RNA interference mechanisms, without causing un-intended sideeffects has led them to be investigated for various biomedical applications, especially for the treatment of viral diseases and cancer. In recent years, many researchers have focused on enhancing the stability and target specificity of ONs by encapsulating/complexing them with polymers or lipid chains to formulate nanoparticles/nanocomplexes/micelles. Also, chemical modification of nucleic acids has emerged as an alternative to impart stability to ONs against nucleases and other degrading enzymes and proteins found in blood. In addition to chemically modifying the nucleic acids directly, another strategy that has emerged, involves conjugating polymers/peptide/aptamers/antibodies/proteins, preferably to the sense strand (3'end) of siRNAs. Conjugation to the siRNA not only enhances the stability and targeting specificity of the siRNA, but also allows for the development of self-administering siRNA formulations, with a much smaller size than what is usually observed for nanoparticle (∼200nm). This review concentrates mainly on approaches and studies involving ON-conjugates for biomedical applications. PMID:27521696

  4. Oligonucleotide and Long Polymeric DNA Encoding

    SciTech Connect

    Miller, E; Mariella Jr., R P; Christian, A T; Gardner, S N; Williams, J M


    This report summarizes the work done at Lawrence Livermore National Laboratory for the Oligonucleotide and Long Polymeric DNA Encoding project, part of the Microelectronic Bioprocesses Program at DARPA. The goal of the project was to develop a process by which long (circa 10,000 base-pair) synthetic DNA molecules could be synthesized in a timely and economic manner. During construction of the long molecule, errors in DNA sequence occur during hybridization and/or the subsequent enzymatic process. The work done on this project has resulted in a novel synthesis scheme that we call the parallel pyramid synthesis protocol, the development of a suit of computational tools to minimize and quantify errors in the synthesized DNA sequence, and experimental proof of this technique. The modeling consists of three interrelated modules: the bioinformatics code which determines the specifics of parallel pyramid synthesis for a given chain of long DNA, the thermodynamics code which tracks the products of DNA hybridization and polymerase extension during the later steps in the process, and the kinetics model which examines the temporal and spatial processes during one thermocycle. Most importantly, we conducted the first successful syntheses of a gene using small starting oligomers (tetramers). The synthesized sequence, 813 base pairs long, contained a 725 base pair gene, modified green fluorescent protein (mGFP), which has been shown to be a functional gene by cloning into cells and observing its green fluorescent product.

  5. Oligonucleotide Therapies: The Past and the Present

    PubMed Central

    Lundin, Karin E.; Gissberg, Olof; Smith, C.I. Edvard


    In this review we address the development of oligonucleotide (ON) medicines from a historical perspective by listing the landmark discoveries in this field. The various biological processes that have been targeted and the corresponding ON interventions found in the literature are discussed together with brief updates on some of the more recent developments. Most ON therapies act through antisense mechanisms and are directed against various RNA species, as exemplified by gapmers, steric block ONs, antagomirs, small interfering RNAs (siRNAs), micro-RNA mimics, and splice switching ONs. However, ONs binding to Toll-like receptors and those forming aptamers have completely different modes of action. Similar to other novel medicines, the path to success has been lined with numerous failures, where different therapeutic ONs did not stand the test of time. Since the first ON drug was approved for clinical use in 1998, the therapeutic landscape has changed considerably, but many challenges remain until the expectations for this new form of medicine are met. However, there is room for cautious optimism. PMID:26160334

  6. Antisense Oligonucleotide Therapy for Inherited Retinal Dystrophies.


    Gerard, Xavier; Garanto, Alejandro; Rozet, Jean-Michel; Collin, Rob W J


    Inherited retinal dystrophies (IRDs) are an extremely heterogeneous group of genetic diseases for which currently no effective treatment strategies exist. Over the last decade, significant progress has been made utilizing gene augmentation therapy for a few genetic subtypes of IRD, although several technical challenges so far prevent a broad clinical application of this approach for other forms of IRD. Many of the mutations leading to these retinal diseases affect pre-mRNA splicing of the mutated genes . Antisense oligonucleotide (AON)-mediated splice modulation appears to be a powerful approach to correct the consequences of such mutations at the pre-mRNA level , as demonstrated by promising results in clinical trials for several inherited disorders like Duchenne muscular dystrophy, hypercholesterolemia and various types of cancer. In this mini-review, we summarize ongoing pre-clinical research on AON-based therapy for a few genetic subtypes of IRD , speculate on other potential therapeutic targets, and discuss the opportunities and challenges that lie ahead to translate splice modulation therapy for retinal disorders to the clinic. PMID:26427454

  7. Photophysical deactivation pathways in adenine oligonucleotides.


    Spata, Vincent A; Matsika, Spiridoula


    In this work we study deactivation processes in adenine oligomers after absorption of UV radiation using Quantum Mechanics combined with Molecular Mechanics (QM/MM). Correlated electronic structure methods appropriate for describing the excited states are used to describe a π-stacked dimer of adenine bases incorporated into (dA)20(dT)20. The results of these calculations reveal three different types of excited state minima which play a role in deactivation processes. Within this set of minima there are minima where the excited state is localized on one adenine (monomer-like) as well as minima where the excited state is delocalized on two adenines, forming different types of excimers and bonded excimers of varying but inter-related character. The proximity of their energies reveals that the minima can decay into one another along a flat potential energy surface dependent on the interbase separation. Additionally, analysis of the emissive energies and other physical properties, including theoretical anisotropy calculations, and comparison with fluorescence experiments, provides evidence that excimers play an important role in long-lived signals in adenine oligonucleotides while the subpicosecond decay is attributed to monomer-like minima. The necessity for a close approach of the nucleobases reveals that the deactivation mechanism is tied to macro-molecular motion. PMID:26536353

  8. Development of Therapeutic Splice-Switching Oligonucleotides

    PubMed Central

    Kryczka, Adrianna; Liu, Yuqi; Badi, Yusef E.; Wong, Jessie J.; Owen, James S.; Khoo, Bernard


    Abstract Synthetic splice-switching oligonucleotides (SSOs) target nuclear pre-mRNA molecules to change exon splicing and generate an alternative protein isoform. Clinical trials with two competitive SSO drugs are underway to treat Duchenne muscular dystrophy (DMD). Beyond DMD, many additional therapeutic applications are possible, with some in phase 1 clinical trials or advanced preclinical evaluation. Here, we present an overview of the central factors involved in developing therapeutic SSOs for the treatment of diseases. The selection of susceptible pre-mRNA target sequences, as well as the design and chemical modification of SSOs to increase SSO stability and effectiveness, are key initial considerations. Identification of effective SSO target sequences is still largely empirical and published guidelines are not a universal guarantee for success. Specifically, exon-targeted SSOs, which are successful in modifying dystrophin splicing, can be ineffective for splice-switching in other contexts. Chemical modifications, importantly, are associated with certain characteristic toxicities, which need to be addressed as target diseases require chronic treatment with SSOs. Moreover, SSO delivery in adequate quantities to the nucleus of target cells without toxicity can prove difficult. Last, the means by which these SSOs are administered needs to be acceptable to the patient. Engineering an efficient therapeutic SSO, therefore, necessarily entails a compromise between desirable qualities and effectiveness. Here, we describe how the application of optimal solutions may differ from case to case. PMID:24826963

  9. Optimizing antisense oligonucleotides using phosphorodiamidate morpholino oligomers.


    Popplewell, Linda J; Malerba, Alberto; Dickson, George


    Duchenne muscular dystrophy (DMD) is caused by mutations that disrupt the reading frame of the human DMD gene. Selective removal of exons flanking an out-of-frame DMD mutation can result in an in-frame mRNA transcript that may be translated into an internally deleted Becker muscular dystrophy-like functionally active dystrophin protein with therapeutic activity. Antisense oligonucleotides (AOs) can be designed to bind to complementary sequences in the targeted mRNA and modify pre-mRNA splicing to correct the reading frame of a mutated transcript. AO-induced exon skipping resulting in functional truncated dystrophin has been demonstrated in animal models of DMD both in vitro and in vivo, in DMD patient cells in vitro in culture, and in DMD muscle explants. The recent advances made in this field suggest that it is likely that AO-induced exon skipping will be the first gene therapy for DMD to reach the clinic. However, it should be noted that personalized molecular medicine may be necessary, since the various reading frame-disrupting mutations are spread across the DMD gene. The different deletions that cause DMD would require skipping of different exons, which would require the optimization and clinical trial workup of many specific AOs. This chapter describes the methodologies available for the optimization of AOs, in particular phosphorodiamidate morpholino oligomers, for the targeted skipping of specific exons on the DMD gene. PMID:22454060

  10. Analysis of mutations in oral poliovirus vaccine by hybridization with generic oligonucleotide microchips.

    SciTech Connect

    Proudnikov, D.; Kirillov, E.; Chumakov, K.; Donion, J.; Rezapkin, G.; Mirzabekov, A.; Biochip Technology Center; Engelhardt Inst. of Molecular Biology; Center for Biologics Evaluation and Research


    This paper describes use of a new technology of hybridization with a micro-array of immobilized oligonucleotides for detection and quantification of neurovirulent mutants in Oral Poliovirus Vaccine (OPV). We used a micro-array consisting of three-dimensional gel-elements containing all possible hexamers (total of 4096 probes). Hybridization of fluorescently labelled viral cDNA samples with such microchips resulted in a pattern of spots that was registered and quantified by a computer-linked CCD camera, so that the sequence of the original cDNA could be deduced. The method could reliably identify single point mutations, since each of them affected fluorescence intensity of 12 micro-array elements. Micro-array hybridization of DNA mixtures with varying contents of point mutants demonstrated that the method can detect as little as 10% of revertants in a population of vaccine virus. This new technology should be useful for quality control of live viral vaccines, as well as for other applications requiring identification and quantification of point mutations.

  11. Performance of the Affymetrix GeneChip HIV PRT 440 Platform for Antiretroviral Drug Resistance Genotyping of Human Immunodeficiency Virus Type 1 Clades and Viral Isolates with Length Polymorphisms

    PubMed Central

    Vahey, Maryanne; Nau, Martin E.; Barrick, Sandra; Cooley, John D.; Sawyer, Robert; Sleeker, Alex A.; Vickerman, Peter; Bloor, Stuart; Larder, Brendan; Michael, Nelson L.; Wegner, Scott A.


    The performance of a silica chip-based resequencing method, the Affymetrix HIV PRT 440 assay (hereafter referred to as the Affymetrix assay), was evaluated on a panel of well-characterized nonclade B viral isolates and on isolates exhibiting length polymorphisms. Sequencing of human immunodeficiency virus type 1 (HIV-1) pol cDNAs from clades A, C, D, E, and F resulted in clade-specific regions of base-calling ambiguities in regions not known to be associated with resistance polymorphisms, as well as a small number of spurious resistance polymorphisms. The Affymetrix assay failed to detect the presence of additional serine codons distal to reverse transcriptase (RT) codon 68 that are associated with multinucleoside RT inhibitor resistance. The increasing prevalence of non-clade B HIV-1 strains in the United States and Europe and the identification of clinically relevant pol gene length polymorphisms will impact the generalizability of the Affymetrix assay, emphasizing the need to accommodate this expanding pool of pol genotypes in future assay versions. PMID:10405396

  12. Biominetic High Density Lipoproteins for the Delivery of Therapeutic Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Tripathy, Sushant

    Advances in nanotechnology have brought about novel inorganic and hybrid nanoparticles with unique physico-chemical properties that make them suitable for a broad range of applications---from nano-circuitry to drug delivery. A significant part of those advancements have led to ground-breaking discoveries that have changed the approaches to formulation of therapeutics against diseases, such as cancer. Now-a-days the focus does not lie solely on finding a candidate small-molecule therapeutic with minimal adverse effects, but researchers are looking up to nanoparticles to improve biodistribution and biocompatibility profile of clinically proven therapeutics. The plethora of conjugation chemistries offered by currently extant inorganic nanoparticles have, in recent years, led to great leaps in the field of biomimicry---a modality that promises high biocompatibility. Further, in the pursuit of highly specific therapeutic molecules, researchers have turned to silencing oligonucleotides and some have already brought together the strengths of nanoparticles and silencing oligonucleotides in search of an efficacious therapy for cancer with minimal adverse effects. This dissertation work focuses on such a biomimetic platform---a gold nanoparticle based high density lipoprotein biomimetic (HDL NP), for the delivery of therapeutic oligonucleotides. The first chapter of this body of work introduces the molecular target of the silencing oligonucleotides---VEGFR2, and its role in the progression of solid tumor cancers. The background information also covers important aspects of natural high density lipoproteins (HDL), especially their innate capacity to bind and deliver exogenous and endogenous silencing oligonucleotides to tissues that express their high affinity receptor SRB1. We subsequently describe the synthesis of the biomimetic HDL NP and its oligonucleotide conjugates, and establish their biocompatibility. Further on, experimental data demonstrate the efficacy of silencing

  13. Oligonucleotide recombination in corynebacteria without the expression of exogenous recombinases.


    Krylov, Alexander A; Kolontaevsky, Egor E; Mashko, Sergey V


    Brevibacterium lactofermentum and Corynebacterium glutamicum are important biotechnology species of the genus Corynebacterium. The single-strand DNA annealing protein (SSAP)-independent oligonucleotide-mediated recombination procedure was successfully applied to the commonly used wild-type strains B. lactofermentum AJ1511 and C. glutamicum ATCC13032. When the rpsL gene was used as a target, the optimized protocol yielded up to (1.4±0.3)×10(3) and (6.7±1.3)×10(3) streptomycin-resistant colonies per 10(8) viable cells for the corresponding strains. We tested the influence of several parameters that are known to enhance the efficiency of oligonucleotide-mediated recombination in other bacterial species. Among them, increasing the concentration of oligonucleotides and targeting the lagging strand of the chromosome have proven to have positive effects on both of the tested species. No difference in the efficiency of recombination was observed between the oligonucleotides phosphorothiorated at the 5' ends and the unmodified oligonucleotides or between the oligonucleotides with four mutated nucleotides and those with one mutated nucleotide. The described approach demonstrates that during the adaptation of the recombineering technique, testing SSAP-independent oligonucleotide-mediated recombination could be a good starting point. Such testing could decrease the probability of an incorrect interpretation of the effect of exogenous protein factors (such as SSAP and/or corresponding exonucleases) due to non-optimal experimental conditions. In addition, SSAP-independent recombination itself could be useful in combination with suitable selection/enrichment methods. PMID:25087479

  14. Injection site reactions after subcutaneous oligonucleotide therapy.


    van Meer, Leonie; Moerland, Matthijs; Gallagher, Jolie; van Doorn, Martijn B A; Prens, Errol P; Cohen, Adam F; Rissmann, Robert; Burggraaf, Jacobus


    Oligonucleotides (ONs) are short fragments of nucleic acids, currently being investigated as therapeutic agents. When administered subcutaneously (sc), ONs cause a specific local reaction originating around the injection site, such as erythema, itching, discomfort and pain, including more severe manifestations such as ulceration or necrosis. These injection site reactions (ISRs) are common, but rather poorly described in the literature. With this review, we aim to provide an overview on the extent of the problem of ISRs, based on reported incidence. A structured literature search was performed to identify reported incidence and clinical features of ISRs which yielded 70 manuscripts that contained information regarding ISRs. The data from literature was combined with data on file available at our institution. All sc administered ONs described in the literature lead to the occurrence of ISRs. The percentage of trial subjects that developed ISRs ranged from 22 to 100% depending on ON. The majority of ONs caused ISRs in more than 70% of the trial subjects. The severity of the observed reactions varied between different ONs. Occurrence rate as well as severity of ISRs increases with higher doses. For chemistry and target of the compounds, no clear association regarding ISR incidence or severity was identified. All ONs developed to date are associated with ISRs. Overcoming the problem of ISRs might add greatly to the potential success of sc-administered ONs. Knowledge of these skin reactions and their specific immunostimulatory properties should be increased in order to obtain ONs that are more suitable for long-term use and clinically applicable in a broader patient population. PMID:27061947

  15. Mechanism of oligonucleotide release from cationic liposomes.

    PubMed Central

    Zelphati, O; Szoka, F C


    We propose a mechanism for oligonucleotide (ODN) release from cationic lipid complexes in cells that accounts for various observations on cationic lipid-nucleic acid-cell interactions. Fluorescent confocal microscopy of cells treated with rhodamine-labeled cationic liposome/ fluorescein-labeled ODN (F-ODN) complexes show the F-ODN separates from the lipid after internalization and enters the nucleus leaving the fluorescent lipid in cytoplasmic structures. ODN displacement from the complex was studied by fluorescent resonance energy transfer. Anionic liposome compositions (e.g., phosphatidylserine) that mimic the cytoplasmic facing monolayer of the cell membrane released ODN from the complex at about a 1:1 (-/+) charge ratio. Release was independent of ionic strength and pH. Physical separation of the F-ODN from monovalent and multivalent cationic lipids was confirmed by gel electrophoresis. Fluid but not solid phase anionic liposomes are required, whereas the physical state of the cationic lipids does not effect the release. Water soluble molecules with a high negative linear charge density, dextran sulfate, or heparin also release ODN. However, ATP, spermidine, spermine, tRNA, DNA, polyglutamic acid, polylysine, bovine serum albumin, or histone did not release ODN, even at 100-fold charge excess (-/+). Based upon these results, we propose that the complex, after internalization by endocytosis, induces flip-flop of anionic lipids from the cytoplasmic facing monolayer. Anionic lipids laterally diffuse into the complex and form a charged neutralized ion-pair with the cationic lipids. This leads to displacement of the ODN from the cationic lipid and its release into the cytoplasm. Images Fig. 1 Fig. 3 PMID:8876163

  16. Innovative instrumentation for microarray scanning and analysis: application for characterization of oligonucleotide duplexes behavior.


    Khomyakova, E B; Dreval, E V; Tran-Dang, M; Potier, M C; Soussaline, F P


    Accuracy in microarray technology requires new approaches to microarray reader development. A microarray reader system (optical scanning array or OSA reader) based on automated microscopy with large field of view, high speed 3 axis scanning at multiple narrow-band spectra of excitation light has been developed. It allows fast capture of high-resolution, multi-fluorescence images and is characterized by a linear dynamic range and sensitivity comparable to commonly used photo-multiplier tube (PMT)-based laser scanner. Controlled by high performance software, the instrument can be used for scanning and quantitative analysis of any type of dry microarray. Studies implying temperature-controlled hybridization chamber containing a microarray can also be performed. This enables the registration of kinetics and melting curves. This feature is required in a wide range of on-chip chemical and enzymatic reactions including on-chip PCR amplification. We used the OSA reader for the characterization of hybridization and melting behaviour of oligonucleotide:oligonucleotide duplexes on three-dimensional Code Link slides. PMID:15209342

  17. Assembly of hybrid oligonucleotide modified gold (Au) and alloy nanoparticles building blocks.


    Kuo, Yu-Ching; Jen, Chun-Ping; Chen, Yu-Hung; Su, Chia-Hao; Tsai, Shu-Hui; Yeh, Chen-Sheng


    The alloy-based hybrid materials with macroscopic network arrays were developed by AuAg/Au and AuAgPd/Au nanoparticle composites through oligonucleotides hybridization. AuAg/Au and AuAgPd/Au exhibited distinct organization. The morphology of AuAg/Au conjugation assembled mainly as compact aggregates while AuAgPd/Au hybrid conjugated into the loosen network assemblies. The dehybridization temperatures were studied as a function of molar ratio of alloy/Au. It was found that higher alloy/gold molar ratio led to stronger hybridization for alloy/gold composite, accompanied with increased melting temperature. These results could be interpreted in terms of more alloy nanoparticles bound to a Au particle when the molar ratio of alloy/gold increased. The thermal analysis also showed that AuAg/Au exhibited higher dehybridization temperature. A modified model describing the dehybridization probability of an intact Au/alloy aggregate was performed to support the dehybridization temperature increased with increasing alloy/Au molar ratio. As to more oligonucleotides carried by AuAg (4.9 +/- 1.9 nm) than by AuAgPd (4.4 +/- 1.5 nm) due to larger size in AuAg, the efficient hybridization could result in higher dehybridization temperature in AuAg/Au. PMID:16573077

  18. Construction and Evaluation of a Clostridium thermocellum ATCC 27405 Whole-Genome Oligonucleotide Microarray

    NASA Astrophysics Data System (ADS)

    Brown, Steven D.; Raman, Babu; McKeown, Catherine K.; Kale, Shubha P.; He, Zhili; Mielenz, Jonathan R.

    Clostridium thermocellum is an anaerobic, thermophilic bacterium that can directly convert cellulosic substrates into ethanol. Microarray technology is a powerful tool to gain insights into cellular processes by examining gene expression under various physiological states. Oligonucleotide microarray probes were designed for 96.7% of the 3163 C. thermocellum ATCC 27405 candidate protein-encoding genes and then a partial-genome microarray containing 70 C. thermocellum specific probes was constructed and evaluated. We detected a signal-to-noise ratio of three with as little as 1.0 ng of genomic DNA and only low signals from negative control probes (nonclostridial DNA), indicating the probes were sensitive and specific. In order to further test the specificity of the array we amplified and hybridized 10 C. thermocellum polymerase chain reaction products that represented different genes and found gene specific hybridization in each case. We also constructed a whole-genome microarray and prepared total cellular RNA from the same point in early-logarithmic growth phase from two technical replicates during cellobiose fermentation. The reliability of the microarray data was assessed by cohybridization of labeled complementary DNA from the cellobiose fermentation samples and the pattern of hybridization revealed a linear correlation. These results taken together suggest that our oligonucleotide probe set can be used for sensitive and specific C. thermocellum transcriptomic studies in the future.

  19. Construction and evaluation of a Clostridium thermocellum ATCC 27405 whole-genome oligonucleotide microarray

    SciTech Connect

    Brown, Steven David; Raman, Babu; McKeown, Catherine K; Kale, Shubhangi P; He, Zhili; Mielenz, Jonathan R


    Clostridium thermocellum is an anaerobic, thermophilic bacterium that can directly convert cellulosic substrates into ethanol. Microarray technology is a powerful tool to gain insights into cellular processes by examining gene expression under various physiological states. Oligonucleotide microarray probes were designed for 96.7% of the 3163 C. thermocellum ATCC 27405 candidate protein-encoding genes and then a partial-genome microarray containing 70 C. thermocellum specific probes was constructed and evaluated. We detected a signal-to-noise ratio of three with as little as 1.0 ng of genomic DNA and only low signals from negative control probes (nonclostridial DNA), indicating the probes were sensitive and specific. In order to further test the specificity of the array we amplified and hybridized 10 C. thermocellum polymerase chain reaction products that represented different genes and found gene specific hybridization in each case. We also constructed a whole-genome microarray and prepared total cellular RNA from the same point in early-logarithmic growth phase from two technical replicates during cellobiose fermentation. The reliability of the microarray data was assessed by cohybridization of labeled complementary DNA from the cellobiose fermentation samples and the pattern of hybridization revealed a linear correlation. These results taken together suggest that our oligonucleotide probe set can be used for sensitive and specific C. thermocellum transcriptomic studies in the future.

  20. Magnetic arrays


    Trumper, D.L.; Kim, W.; Williams, M.E.


    Electromagnet arrays are disclosed which can provide selected field patterns in either two or three dimensions, and in particular, which can provide single-sided field patterns in two or three dimensions. These features are achieved by providing arrays which have current densities that vary in the windings both parallel to the array and in the direction of array thickness. 12 figs.

  1. Magnetic arrays

    SciTech Connect

    Trumper, David L.; Kim, Won-jong; Williams, Mark E.


    Electromagnet arrays which can provide selected field patterns in either two or three dimensions, and in particular, which can provide single-sided field patterns in two or three dimensions. These features are achieved by providing arrays which have current densities that vary in the windings both parallel to the array and in the direction of array thickness.

  2. Strand-Specificity in the Transformation of Yeast with Synthetic Oligonucleotides

    PubMed Central

    Yamamoto, T.; Moerschell, R. P.; Wakem, L. P.; Komar-Panicucci, S.; Sherman, F.


    Cyc1 mutants of the yeast Saccharomyces cerevisiae were directly transformed with both sense and antisense oligonucleotides to examine the involvement of the two genomic DNA strands in transformation. Sense oligonucleotides yielded approximately 20-fold more transformants than antisense oligonucleotides. This differential effect was observed with oligonucleotides designed to make alterations at six different sites along the gene and was independent of the oligonucleotide sequence and length, number of mismatches and the host strain. Competition studies showed that antisense oligonucleotides did not inhibit transformation. Although the mechanism for this strand specificity is unknown, this difference was maintained even when CYC1 transcription was diminished to approximately 2% of the normal level. PMID:1325385

  3. Characteristic archaebacterial 16S rRNA oligonucleotides

    NASA Technical Reports Server (NTRS)

    McGill, T. J.; Jurka, J.; Sobieski, J. M.; Pickett, M. H.; Woese, C. R.; Fox, G. E.


    A method of analyzing 16S rRNA catalog data has been developed in which groupings at various taxonomic levels can be characterized in terms of specific "signature" oligonucleotides. This approach provides an alternative means for evaluating higher order branching possibilities and can be used to assess the phylogenetic position of isolates that are poorly placed by the usual clustering procedures. This signature approach has been applied to forty archaebacterial catalogs and every oligonucleotide with significant signature value has been identified. Sets of specific oligonucleotides were identified for every major group on a dendrogram produced by cluster analysis procedures. Signatures that would establish between group relationships were also sought and found. In the case of the Methanobacteriaceae the clustering methods suggest a specific relationship to the Methanococcaceae. This inclusion is in fact supported by six strong signature oligonucleotides. However there are also significant numbers of signature oligonucleotides supporting a specific relationship of the Methanobacteriaceae to either the Halobacteriaceae or the Methanomicrobiaceae. Thus the placement of the Methanobacteriaceae is less certain than the usual dendrograms imply. The signature approach also was used to assess the phylogenetic position of Thermoplasma acidophilum which is found to be more closely related to the methanogen/halophile Division than to the sulfur dependent Division of the archaebacteria. This does not imply however that Thermoplasma acidophilum is properly regarded as being in the methanogen/halophile Division.

  4. Stability measurements of antisense oligonucleotides by capillary gel electrophoresis.


    Bruin, G J; Börnsen, K O; Hüsken, D; Gassmann, E; Widmer, H M; Paulus, A


    The approach of using antisense oligonucleotides as potential drugs is based on hybridization of a short chemically-modified oligonucleotide with complementary cellular DNA or RNA sequences. A critical question is the stability of chemically modified antisense oligonucleotides in cellular environments. In a model system, resistance against various nucleases was evaluated by capillary gel electrophoresis (CGE). For some of the samples, matrix assisted laser desorption and ionization mass spectrometry (MALDI-MS) was used as an additional analytical tool to perform stability measurements. Using CGE, the enzymatic degradation of single nucleotides from the oligomer can be followed after different incubation times. 10% T polyacrylamide gels give baseline resolution for oligonucleotides ranging between 5 and 30 bases in length. The kinetic influence of a specific nuclease concentration and the antisense oligonucleotide structure on the cleavage reaction are discussed. Also, a simple desalting method to improve the injection efficiency and sensitivity of the method are described. Examples of measurements of chemically modified antisense 19-mers are presented. PMID:7581844

  5. Oligonucleotide probe for detection and identification of Campylobacter pylori.

    PubMed Central

    Morotomi, M; Hoshina, S; Green, P; Neu, H C; LoGerfo, P; Watanabe, I; Mutai, M; Weinstein, I B


    We have developed a novel and practical DNA-RNA hybridization assay for the detection and identification of Campylobacter pylori in the gastric mucosa. This technique utilizes a [32P]ddATP-labeled synthetic oligonucleotide probe complementary to a nucleotide sequence present in C. pylori 16S rRNA. This probe is very sensitive and reacted with all 23 strains of C. pylori tested. It is also highly specific, since there was no cross-reactivity with the heterologous organisms Campylobacter coli, C. fetus subsp. fetus, C. jejuni, and C. laridis or with Escherichia coli. Hybridization of the oligonucleotide probe with C. pylori RNA was completely inhibited by treatment of the membrane filters with RNase but not DNase. Although a gastric mucosa tissue homogenate slightly inhibited the hybridization, as few as 10(4) C. pylori cells could be detected even in the presence of 5 mg of gastric mucosa. Gastric biopsy specimens obtained from patients referred for upper gastrointestinal tract endoscopy were tested for C. pylori infection by direct oligonucleotide hybridization, and the results were compared with those of bacteriological cultures, the urease test, and histological observations. A comparison of the urease test and the oligonucleotide hybridization results showed an excellent correlation between the two methods. The clinical usefulness of this oligonucleotide-RNA hybridization method is discussed. Images PMID:2480360

  6. A status update of modified oligonucleotides for chemotherapeutics applications.


    Sanghvi, Yogesh S


    This unit presents an update of recent developments and clinical progress in chemically modified oliogonucleotides useful for therapeutic applications. During the last decade, the number of therapeutic oligonucleotides in clinical trials has nearly tripled. This is primarily due to advances in the synthesis protocols, better understanding of the biology, improved delivery, and better formulation technologies. Currently, over 100 clinical trials with oligonucleotide-based drugs are ongoing in the United States for potential treatment of a variety of life-threatening diseases. Among various oligonucleotides, antisense technology has been at the forefront, with one product on the market. Antisense technologies represent about half of the active clinical trials. Similarly, siRNA, aptamers, spiegelmers microRNA, shRNA, IMO, and CpG have been other active classes of oligonucleotides that are also undergoing clinical trials. This review attempts to summarize the current status of synthesis, chemical modifications, purification, and analysis in light of the rapid progress with multitude of oligonucleotides pursued as therapeutic modality. PMID:21901670

  7. Event-specific detection of seven genetically modified soybean and maizes using multiplex-PCR coupled with oligonucleotide microarray.


    Xu, Jia; Zhu, Shuifang; Miao, Haizhen; Huang, Wensheng; Qiu, Minyan; Huang, Yan; Fu, Xuping; Li, Yao


    With the increasing development of genetically modified organism (GMO) detection techniques, the polymerase chain reaction (PCR) technique has been the mainstay for GMO detection. An oligonucleotide microarray is a glass chip to the surface of which an array of oligonucleotides was fixed as spots, each containing numerous copies of a sequence-specific probe that is complementary to a gene of interest. So it is used to detect ten or more targets synchronously. In this research, an event-specific detection strategy based on the unique and specific integration junction sequences between the host plant genome DNA and the integrated gene is being developed for its high specificity using multiplex-PCR together with oligonucleotide microarray. A commercial GM soybean (GTS 40-3-2) and six GM maize events (MON810, MON863, Bt176, Bt11, GA21, and T25) were detected by this method. The results indicate that it is a suitable method for the identification of these GM soybean and maizes. PMID:17559227

  8. Selection of oligonucleotide probes and experimental conditions for multiplex hybridization experiments.


    Bains, W


    Different DNA probes hybridize under different conditions. I examine the constraints of the design of oligonucleotide probes that are meant to hybridize to different unique sites in human genomic DNA under a single set of hybridization conditions as a parallel array. In 522 kb of human genomic DNA, 75% of 12-base and 89% of 22-base are unique, as opposed to 90% and 100% as expected of unstructured DNA, and this is not due solely to repetitive elements in the DNA. Hybridization in TMAC to reduce A+T content effects on melting temperature allows only 90% of unique targets to be hybridized under one set of conditions if a 2 degrees C difference between matched and mismatched sequences is required. Standard hybridization conditions allow no more than 60% of unique probes to be used together. This suggests that probe, hybridization conditions, and instrument design for multiple-probe hybridization applications will be harder than previously suggested. PMID:7803130

  9. Secondary binding sites for heavily modified triplex forming oligonucleotides

    PubMed Central

    Cardew, Antonia S.; Brown, Tom; Fox, Keith R.


    In order to enhance DNA triple helix stability synthetic oligonucleotides have been developed that bear amino groups on the sugar or base. One of the most effective of these is bis-amino-U (B), which possesses 5-propargylamino and 2′-aminoethoxy modifications. Inclusion of this modified nucleotide not only greatly enhances triplex stability, but also increases the affinity for related sequences. We have used a restriction enzyme protection, selection and amplification assay (REPSA) to isolate sequences that are bound by the heavily modified 9-mer triplex-forming oligonucleotide B6CBT. The isolated sequences contain An tracts (n = 6), suggesting that the 5′-end of this TFO was responsible for successful triplex formation. DNase I footprinting with these sequences confirmed triple helix formation at these secondary targets and demonstrated no interaction with similar oligonucleotides containing T or 5-propargylamino-dU. PMID:22180535

  10. Synthesis of chimeric oligonucleotides containing phosphodiester, phosphorothioate, and phosphoramidate linkages.


    Maier, M A; Guzaev, A P; Manoharan, M


    [reaction: see text] H-Phosphonate monomers of 2'-O-(2-methoxyethyl) ribonucleosides have been synthesized. Oxidation of oligonucleotide H-phosphonates has been optimized to allow the synthesis of oligonucleotides containing either 2'-deoxy or 2'-O-(2-methoxyethyl) ribonucleoside residues combined with three different phosphate modifications in the backbone, i.e., phosphodiester (PO), phosphorothioate (PS), and phosphoramidate (PN). Phosphodiester linkages were introduced by oxidation with a cocktail of 0.1 M Et(3)N in CCl(4)/Pyr/H(2)O (5:9:1) without affecting phosphorothioate or phosphoramidate linkages. For the synthesis of phosphoramidate-modified oligonucleotides, N(4)-acetyl deoxycytidine-3'-H-phosphonate monomers were used to avoid transamination during the oxidation step. PMID:10891166

  11. Finding a most likely clone ordering from oligonucleotide hybridization data

    SciTech Connect

    Newberg, L.A.


    Using an extension of a statistical model given by E. Lander and M. Waterman, the authors define the a posteriori probability of a clone ordering based upon oligonucleotide hybridization data. They give algorithms for computing the likelihood of a clone ordering and for finding a clone ordering of maximum likelihood. The dynamic programming algorithm for computing likelihoods runs in time O(mnc), where m is the number of oligonucleotide probes, n is the number of clones, and c is the coverage of the clone library. They use the Expectation-Maximization technique to maximize likelihoods. 21 refs., 3 figs.

  12. Use of phosphorus oxychloride in synthesizing nucleotides and oligonucleotides

    PubMed Central

    Mungall, W.S.; Greene, G.L.; Miller, P.S.; Letsinger, R.L.


    Procedures are described for phosphorylating protected nucleotides, oligonucleotides and phosphoramidate oligonucleotide derivatives at the 3′-hydroxyl group. The conditions (phosphorylation with phosphorus oxychloride and pyridine in dioxane followed by hydrolysis with aqueous pyridine) are sufficiently mild that base labile (trifluoroacetylamino; β-cyanoethyl phosphotriester) and acid labile (O-monomethoxytrityl; phosphoramidate) functions are retained intact. Application of the technique is illustrated by the synthesis of dpT, dTp, d(CF3CONH)Tp, dTpNTp, and dTpNTpNTp. In addition, the utilization of phosphorus oxychloride in joining thymidine derivatives and dinucleoside phosphotriester blocks via phosphodiester links is described. PMID:10793743

  13. Mixed-model reanalysis of primate data suggests tissue and species biases in oligonucleotide-based gene expression profiles.


    Hsieh, Wen-Ping; Chu, Tzu-Ming; Wolfinger, Russell D; Gibson, Greg


    An emerging issue in evolutionary genetics is whether it is possible to use gene expression profiling to identify genes that are associated with morphological, physiological, or behavioral divergence between species and whether these genes have undergone positive selection. Some of these questions were addressed in a recent study (Enard et al. 2002) of the difference in gene expression among human, chimp, and orangutan, which suggested an accelerated rate of divergence in gene expression in the human brain relative to liver. Reanalysis of the Affymetrix data set using analysis of variance methods to quantify the contributions of individuals and species to variation in expression of 12,600 genes indicates that as much as one-quarter of the genome shows divergent expression between primate species at the 5% level. The magnitude of fold change ranges from 1.2-fold up to 8-fold. Similar conclusions apply to reanalysis of Enard et al. 2002 parallel murine data set. However, biases inherent to short oligonucleotide microarray technology may account for some of the tissue and species effects. At high significance levels, more differences were observed in the liver than in the brain in each of the pairwise species comparisons, so it is not clear that expression divergence is accelerated in the human brain. Further, there is an apparent bias toward upregulation of gene expression in the brain in both primates and mice, whereas genes are equally likely to be up- or downregulated in the liver when these species diverge. A small subset of genes that are candidates for adaptive divergence may be identified on the basis of a high ratio of interspecific to intraspecific divergence. PMID:14573485

  14. A Comparative Study of Normalization Methods Used in Statistical Analysis of Oligonucleotide Microarray Data

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Normalization methods used in the statistical analysis of oligonucleotide microarray data were evaluated. The oligonucleotide microarray is considered an efficient analytical tool for analyzing thousands of genes simultaneously in a single experiment. However, systematic variation in microarray, ori...

  15. Kokkos Array


    The Kokkos Array library implements shared-memory array data structures and parallel task dispatch interfaces for data-parallel computational kernels that are performance-portable to multicore-CPU and manycore-accelerator (e.g., GPGPU) devices.

  16. Systolic arrays

    SciTech Connect

    Moore, W.R.; McCabe, A.P.H.; Vrquhart, R.B.


    Selected Contents of this book are: Efficient Systolic Arrays for the Solution of Toeplitz Systems, The Derivation and Utilization of Bit Level Systolic Array Architectures, an Efficient Systolic Array for Distance Computation Required in a Video-Codec Based Motion-Detection, On Realizations of Least-Squares Estimation and Kalman Filtering by Systolic Arrays, and Comparison of Systolic and SIMD Architectures for Computer Vision Computations.

  17. Nanocylinder arrays


    Tuominen, Mark; Schotter, Joerg; Thurn-Albrecht, Thomas; Russell, Thomas P.


    Pathways to rapid and reliable fabrication of nanocylinder arrays are provided. Simple methods are described for the production of well-ordered arrays of nanopores, nanowires, and other materials. This is accomplished by orienting copolymer films and removing a component from the film to produce nanopores, that in turn, can be filled with materials to produce the arrays. The resulting arrays can be used to produce nanoscale media, devices, and systems.

  18. Nanocylinder arrays


    Tuominen, Mark; Schotter, Joerg; Thurn-Albrecht, Thomas; Russell, Thomas P.


    Pathways to rapid and reliable fabrication of nanocylinder arrays are provided. Simple methods are described for the production of well-ordered arrays of nanopores, nanowires, and other materials. This is accomplished by orienting copolymer films and removing a component from the film to produce nanopores, that in turn, can be filled with materials to produce the arrays. The resulting arrays can be used to produce nanoscale media, devices, and systems.

  19. Solid-phase-supported synthesis of morpholinoglycine oligonucleotide mimics

    PubMed Central

    Belov, Sergey S; Tarasenko, Yulia V; Silnikov, Vladimir N


    Summary An efficient solid-phase-supported peptide synthesis (SPPS) of morpholinoglycine oligonucleotide (MorGly) mimics has been developed. The proposed strategy includes a novel specially designed labile linker group containing the oxalyl residue and the 2-aminomethylmorpholino nucleoside analogues as first subunits. PMID:24991266

  20. Oligonucleotide-directed mutagenesis for precision gene editing.


    Sauer, Noel J; Mozoruk, Jerry; Miller, Ryan B; Warburg, Zachary J; Walker, Keith A; Beetham, Peter R; Schöpke, Christian R; Gocal, Greg F W


    Differences in gene sequences, many of which are single nucleotide polymorphisms, underlie some of the most important traits in plants. With humanity facing significant challenges to increase global agricultural productivity, there is an urgent need to accelerate the development of these traits in plants. oligonucleotide-directed mutagenesis (ODM), one of the many tools of Cibus' Rapid Trait Development System (RTDS(™) ) technology, offers a rapid, precise and non-transgenic breeding alternative for trait improvement in agriculture to address this urgent need. This review explores the application of ODM as a precision genome editing technology, with emphasis on using oligonucleotides to make targeted edits in plasmid, episomal and chromosomal DNA of bacterial, fungal, mammalian and plant systems. The process of employing ODM by way of RTDS technology has been improved in many ways by utilizing a fluorescence conversion system wherein a blue fluorescent protein (BFP) can be changed to a green fluorescent protein (GFP) by editing a single nucleotide of the BFP gene (CAC→TAC; H66 to Y66). For example, dependent on oligonucleotide length, applying oligonucleotide-mediated technology to target the BFP transgene in Arabidopsis thaliana protoplasts resulted in up to 0.05% precisely edited GFP loci. Here, the development of traits in commercially relevant plant varieties to improve crop performance by genome editing technologies such as ODM, and by extension RTDS, is reviewed. PMID:26503400

  1. Gene expression profiling in peanut using oligonucleotide microarrays

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Transcriptome expression analysis in peanut to date has been limited to a relatively small set of genes and only recently have a moderately significant number of ESTs been released into the public domain. Utilization of these ESTs for the oligonucleotide microarrays provides a means to investigate l...

  2. Chromosome-specific painting in Cucumis species using bulked oligonucleotides

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Chromosome-specific painting is a powerful technique in molecular cytogenetic and genome research. We developed an oligonucleotide (oligo)-based chromosome painting technique in cucumber (Cucumis sativus) that will be applicable in any plant species with a sequenced genome. Oligos specific to a sing...

  3. Molecular Probe Data Base: a database on synthetic oligonucleotides.

    PubMed Central

    Romano, P; Aresu, O; Parodi, B; Manniello, A; Campi, G; Angelini, G; Romani, M; Iannotta, B; Rondanina, G; Ruzzon, T


    The Molecular Probe Data Base (MPDB) was designed to collect and make information on synthetic oligonucleotides available on-line. This paper briefly describes its purpose, contents and structure, forms and mode of data distribution. Particular emphasis is given to recent data extension and system enhancements that have been carried out in order to simplify access to MPDB for unskilled users. PMID:8332523

  4. Molecular Probe Database: a database on synthetic oligonucleotides

    PubMed Central

    Aresu, Ottavia; Parodi, Barbara; Romano, Paolo; Romani, Massimo; Angelini, Giovanna; Manniello, Assunta; Ianotta, Beatrice; Rondanina, Gabriella; Ruzzon, Tiziana; Santi, Leonardo


    The Molecular Probe Data Base (MPDB) is designed to collect and make available on-line information on synthetic oligonucleotides. This paper briefly describes the purpose of MPDB, its content and structure, forms and mode of data distribution, and a series of additional services available to scientists using MPDB. PMID:1598231

  5. Pentopyranosyl Oligonucleotide Systems. Part 11: Systems with Shortened Backbones: D)-beta-Ribopyranosyl-(4 yields 3 )- and (L)-alpha - Lyxopyranosyl-(4 yields 3 )-oligonucleotides

    NASA Technical Reports Server (NTRS)

    Wippo, Harald; Reck, Folkert; Kudick, Rene; Ramaseshan, Mahesh; Ceulemans, Griet; Bolli, Martin; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert


    The (L)-a-lyxopyranosyl-(4'yields 3')-oligonucleotide system-a member of a pentopyranosyl oligonucleotide family containing a shortened backbone-is capable of cooperative base-pairing and of cross-pairing with DNA and RNA. In contrast, corresponding (D)-beta-ribopyransoyl-(4' yields 3')-oligonucleotides do not show base-pairing under similar conditions. We conclude that oligonucleotide systems can violate the six-bonds-per-backbone-unit rule by having five bonds instead, if their vicinally bound phosphodiester bridges can assume an antiperiplanar conformation. An additional structural feature that seems relevant to the cross-pairing capability of the (L)-a-lyxopyranosyl-(4' yields 3')-oligonucleotide system is its (small) backbone/basepair axes inclination. An inclination which is similar to that in B-DNA seems to be a prerequisite for an oligonucleotide system s capability to cross-pair with DNA.

  6. Development of low-density oligonucleotide microarrays for detecting mutations causing Wilson's disease

    PubMed Central

    Mathur, Manjula; Singh, Ekta; Poduval, T.B.; Rao, Akkipeddi V.S.S.N.


    Background & objectives: Wilson's disease (WD) is an autosomal recessive disorder caused by mutations in ATP7B, a copper transporter gene, leading to hepatic and neuropsychiatric manifestations due to copper accumulation. If diagnosed early, WD patients can be managed by medicines reducing morbidity and mortality. Diagnosis of this disease requires a combination of tests and at times is inconclusive due to overlap of the symptoms with other disorders. Genetic testing is the preferred alternative in such cases particularly for individuals with a family history. Use of DNA microarray for detecting mutations in ATP7B gene is gaining popularity because of the advantages it offers in terms of throughput and sensitivity. This study attempts to establish the quality analysis procedures for microarray based diagnosis of Wilson's disease. Methods: A home-made microarrayer was used to print oligonucleotide based low-density microarrays for addressing 62 mutations causing Wilson's disease reported from Indian population. Inter- and intra- array comparisons were used to study quality of the arrays. The arrays were validated by using mutant samples generated by site directed mutagenesis. Results: The hybridization reaction were found to be consistent across the surface of a given microarray. Our results have shown that 52 °C post-hybridization wash yields better reproducibility across experiments compared to 42 °C. Our arrays have shown > 80 per cent sensitivity in detecting these 62 mutations. Interpretation & conclusions: The present results demonstrate the design and evaluation of a low-density microarray for the detection of 62 mutations in ATP7B gene, and show that a microarray based approach can be cost-effective for detecting a large number of mutations simultaneously. This study also provides information on some of the important parameters required for microarray based diagnosis of genetic disorders. PMID:25900953

  7. Design, Validation and Annotation of Transcriptome-Wide Oligonucleotide Probes for the Oligochaete Annelid Eisenia fetida

    PubMed Central

    Gong, Ping; Pirooznia, Mehdi; Guan, Xin; Perkins, Edward J.


    High density oligonucleotide probe arrays have increasingly become an important tool in genomics studies. In organisms with incomplete genome sequence, one strategy for oligo probe design is to reduce the number of unique probes that target every non-redundant transcript through bioinformatic analysis and experimental testing. Here we adopted this strategy in making oligo probes for the earthworm Eisenia fetida, a species for which we have sequenced transcriptome-scale expressed sequence tags (ESTs). Our objectives were to identify unique transcripts as targets, to select an optimal and non-redundant oligo probe for each of these target ESTs, and to annotate the selected target sequences. We developed a streamlined and easy-to-follow approach to the design, validation and annotation of species-specific array probes. Four 244K-formatted oligo arrays were designed using eArray and were hybridized to a pooled E. fetida cRNA sample. We identified 63,541 probes with unsaturated signal intensities consistently above the background level. Target transcripts of these probes were annotated using several sequence alignment algorithms. Significant hits were obtained for 37,439 (59%) probed targets. We validated and made publicly available 63.5K oligo probes so the earthworm research community can use them to pursue ecological, toxicological, and other functional genomics questions. Our approach is efficient, cost-effective and robust because it (1) does not require a major genomics core facility; (2) allows new probes to be easily added and old probes modified or eliminated when new sequence information becomes available, (3) is not bioinformatics-intensive upfront but does provide opportunities for more in-depth annotation of biological functions for target genes; and (4) if desired, EST orthologs to the UniGene clusters of a reference genome can be identified and selected in order to improve the target gene specificity of designed probes. This approach is particularly

  8. Oligonucleotide Immobilization and Hybridization on Aldehyde-Functionalized Poly(2-hydroxyethyl methacrylate) Brushes.


    Bilgic, Tugba; Klok, Harm-Anton


    DNA biosensing requires high oligonucleotide binding capacity interface chemistries that can be tuned to maximize probe presentation as well as hybridization efficiency. This contribution investigates the feasibility of aldehyde-functionalized poly(2-hydroxyethyl methacrylate) (PHEMA) brush-based interfaces for oligonucleotide binding and hybridization. These polymer brushes, which allow covalent immobilization of oligonucleotides, are prepared by surface-initiated atom transfer radical polymerization (SI-ATRP) of HEMA followed by a postpolymerization oxidation step to generate side chain aldehyde groups. A series of polymer brushes covering a range of film thicknesses and grafting densities was investigated with regard to their oligonucleotide binding capacity as well as their ability to support oligonucleotide hybridization. Densely grafted brushes were found to have probe oligonucleotide binding capacities of up to ∼30 pmol/cm(2). Increasing the thickness of these densely grafted brush films, however, resulted in a decrease in the oligonucleotide binding capacity. Less densely grafted brushes possess binding capacities of ∼10 pmol/cm(2), which did not significantly depend on film thickness. The oligonucleotide hybridization efficiencies, however, were highest (93%) on those brushes that present the lowest surface concentration of the probe oligonucleotide. These results highlight the importance of optimizing the probe oligonucleotide surface concentration and binding interface chemistry. The versatility and tunability of the PHEMA-based brushes presented herein makes these films a very attractive platform for the immobilization and hybridization of oligonucleotides. PMID:26441148

  9. [Preparative isolation of tetra-, penta- and hexapurine oligonucleotides from partial hydrolysates of depyrimidinated herring sperm DNA].


    Schott, H; Schrade, H


    Herring sperm DNA is chemically degraded to a complex mixture of purine nucleotides. The oligonucleotides are separated from the partial hydrolysates by column chromatography. The resulting mixture of trimer to hexamer purine oligonucleotides is subsequently fractionated on QAE-Sephadex into different mixtures of sequence-isomeric purine oligonucleotides. In a final separation, which uses reversed-phase (Nucleosil C18) high-performance liquid chromatography, these mixtures are separated under isocratic conditions into 35 pure defined purine oligonucleotides with four to six monomer units, 14 defined mixtures of sequence-isomeric purine oligonucleotides and several unidentified products. Purity and sequence of the isolated oligonucleotides are determined by the "fingerprint" method. The results of the high-performance liquid chromatographic and the "fingerprint" methods of the isolated oligonucleotides are discussed. PMID:6707126

  10. Targeting duplex DNA with chimeric α,β-triplex-forming oligonucleotides

    PubMed Central

    Kolganova, N. A.; Shchyolkina, A. K.; Chudinov, A. V.; Zasedatelev, A. S.; Florentiev, V. L.; Timofeev, E. N.


    Triplex-directed DNA recognition is strictly limited by polypurine sequences. In an attempt to address this problem with synthetic biology tools, we designed a panel of short chimeric α,β-triplex-forming oligonucleotides (TFOs) and studied their interaction with fluorescently labelled duplex hairpins using various techniques. The hybridization of hairpin with an array of chimeric probes suggests that recognition of double-stranded DNA follows complicated rules combining reversed Hoogsteen and non-canonical homologous hydrogen bonding. In the presence of magnesium ions, chimeric TFOs are able to form highly stable α,β-triplexes, as indicated by native gel-electrophoresis, on-array thermal denaturation and fluorescence-quenching experiments. CD spectra of chimeric triplexes exhibited features typically observed for anti-parallel purine triplexes with a GA or GT third strand. The high potential of chimeric α,β-TFOs in targeting double-stranded DNA was demonstrated in the EcoRI endonuclease protection assay. In this paper, we report, for the first time, the recognition of base pair inversions in a duplex by chimeric TFOs containing α-thymidine and α-deoxyguanosine. PMID:22641847

  11. Targeting duplex DNA with chimeric α,β-triplex-forming oligonucleotides.


    Kolganova, N A; Shchyolkina, A K; Chudinov, A V; Zasedatelev, A S; Florentiev, V L; Timofeev, E N


    Triplex-directed DNA recognition is strictly limited by polypurine sequences. In an attempt to address this problem with synthetic biology tools, we designed a panel of short chimeric α,β-triplex-forming oligonucleotides (TFOs) and studied their interaction with fluorescently labelled duplex hairpins using various techniques. The hybridization of hairpin with an array of chimeric probes suggests that recognition of double-stranded DNA follows complicated rules combining reversed Hoogsteen and non-canonical homologous hydrogen bonding. In the presence of magnesium ions, chimeric TFOs are able to form highly stable α,β-triplexes, as indicated by native gel-electrophoresis, on-array thermal denaturation and fluorescence-quenching experiments. CD spectra of chimeric triplexes exhibited features typically observed for anti-parallel purine triplexes with a GA or GT third strand. The high potential of chimeric α,β-TFOs in targeting double-stranded DNA was demonstrated in the EcoRI endonuclease protection assay. In this paper, we report, for the first time, the recognition of base pair inversions in a duplex by chimeric TFOs containing α-thymidine and α-deoxyguanosine. PMID:22641847

  12. Biorecognition by DNA oligonucleotides after exposure to photoresists and resist removers.


    Dean, Stacey L; Morrow, Thomas J; Patrick, Susan; Li, Mingwei; Clawson, Gary A; Mayer, Theresa S; Keating, Christine D


    Combining biological molecules with integrated circuit technology is of considerable interest for next generation sensors and biomedical devices. Current lithographic microfabrication methods, however, were developed for compatibility with silicon technology rather than bioorganic molecules, and consequently it cannot be assumed that biomolecules will remain attached and intact during on-chip processing. Here, we evaluate the effects of three common photoresists (Microposit S1800 series, PMGI SF6, and Megaposit SPR 3012) and two photoresist removers (acetone and 1165 remover) on the ability of surface-immobilized DNA oligonucleotides to selectively recognize their reverse-complementary sequence. Two common DNA immobilization methods were compared: adsorption of 5'-thiolated sequences directly to gold nanowires and covalent attachment of 5'-thiolated sequences to surface amines on silica coated nanowires. We found that acetone had deleterious effects on selective hybridization as compared to 1165 remover, presumably due to incomplete resist removal. Use of the PMGI photoresist, which involves a high temperature bake step, was detrimental to the later performance of nanowire-bound DNA in hybridization assays, especially for DNA attached via thiol adsorption. The other three photoresists did not substantially degrade DNA binding capacity or selectivity for complementary DNA sequences. To determine whether the lithographic steps caused more subtle damage, we also tested oligonucleotides containing a single base mismatch. Finally, a two-step photolithographic process was developed and used in combination with dielectrophoretic nanowire assembly to produce an array of doubly contacted, electrically isolated individual nanowire components on a chip. Postfabrication fluorescence imaging indicated that nanowire-bound DNA was present and able to selectively bind complementary strands. PMID:23952639

  13. Biorecognition by DNA oligonucleotides after Exposure to Photoresists and Resist Removers

    PubMed Central

    Dean, Stacey L.; Morrow, Thomas J.; Patrick, Sue; Li, Mingwei; Clawson, Gary; Mayer, Theresa S.; Keating, Christine D.


    Combining biological molecules with integrated circuit technology is of considerable interest for next generation sensors and biomedical devices. Current lithographic microfabrication methods, however, were developed for compatibility with silicon technology rather than bioorganic molecules and consequently it cannot be assumed that biomolecules will remain attached and intact during on-chip processing. Here, we evaluate the effects of three common photoresists (Microposit S1800 series, PMGI SF6, and Megaposit SPR 3012) and two photoresist removers (acetone and 1165 remover) on the ability of surface-immobilized DNA oligonucleotides to selectively recognize their reverse-complementary sequence. Two common DNA immobilization methods were compared: adsorption of 5′-thiolated sequences directly to gold nanowires and covalent attachment of 5′-thiolated sequences to surface amines on silica coated nanowires. We found that acetone had deleterious effects on selective hybridization as compared to 1165 remover, presumably due to incomplete resist removal. Use of the PMGI photoresist, which involves a high temperature bake step, was detrimental to the later performance of nanowire-bound DNA in hybridization assays, especially for DNA attached via thiol adsorption. The other three photoresists did not substantially degrade DNA binding capacity or selectivity for complementary DNA sequences. To determine if the lithographic steps caused more subtle damage, we also tested oligonucleotides containing a single base mismatch. Finally, a two-step photolithographic process was developed and used in combination with dielectrophoretic nanowire assembly to produce an array of doubly-contacted, electrically isolated individual nanowire components on a chip. Post-fabrication fluorescence imaging indicated that nanowire-bound DNA was present and able to selectively bind complementary strands. PMID:23952639

  14. Selective release of multiple DNA oligonucleotides from gold nanorods.


    Wijaya, Andy; Schaffer, Stefan B; Pallares, Ivan G; Hamad-Schifferli, Kimberly


    Combination therapy, or the use of multiple drugs, has been proven to be effective for complex diseases, but the differences in chemical properties and pharmacokinetics can be challenging in terms of the loading, delivering, and releasing multiple drugs. Here we demonstrate that we can load and selectively release two different DNA oligonucleotides from two different gold nanorods. DNA was loaded on the nanorods via thiol conjugation. Selective releases were induced by selective melting of gold nanorods via ultrafast laser irradiation at the nanorods' longitudinal surface plasmon resonance peaks. Excitation at one wavelength could selectively melt one type of gold nanorods and selectively release one type of DNA strand. Releases were efficient (50-80%) and externally tunable by laser fluence. Released oligonucleotides were still functional. This proof of concept is potentially a powerful method for multiple-drug delivery strategies. PMID:19206252

  15. Electrochemical uranyl cation biosensor with DNA oligonucleotides as receptor layer.


    Jarczewska, Marta; Ziółkowski, Robert; Górski, Łukasz; Malinowska, Elżbieta


    The present study aims at the further development of the uranyl oligonucleotide-based voltammetric biosensor, which takes advantage of strong interaction between UO2(2+) and phosphate DNA backbone. Herein we report the optimization of working parameters of previously elaborated electrochemical DNA biosensor. It is shown that the sensor sensitivity is highly dependent on the oligonucleotide probe length and the incubation time of sensor in a sample solution. Consequently, the highest sensitivity was obtained for 10-nucleotide sequence and 60 min incubation time. The lower detection limit towards uranyl cation for developed biosensor was 30 nM. The influence of mixed monolayers and the possibility of developing a non-calibration device were also investigated. The selectivity of the proposed biosensor was significantly improved via elimination of adenine nucleobases from the DNA probe. Moreover, the regeneration procedure was elaborated and tested to prolong the use of the same biosensor for 4 subsequent determinations of UO2(2+). PMID:24334186

  16. Synthesis and properties of oligonucleotides containing aminodeoxythymidine units.

    PubMed Central

    Gryaznov, S M; Letsinger, R L


    Procedures are described for synthesis via solid support methodology of oligonucleotide analogues derived in part from 3'-amino-3'-deoxythymidine or 5'-amino-5'-deoxythymidine. Oligothymidylate decamers terminated with a 3'-amino group or containing a 3'-NHP(O)(O-)O-5' internucleoside link are found to form unusually stable complexes with poly(dA), poly(A), and oligo(dA). For related derivatives of 5'-amino-5'-deoxythymidine enhancement is less or absent, and in the case of multiple substitution destabilization of the heteroduplex may be observed. That the effect of the 3'-amino group is general for oligonucleotide derivatives is indicated by enhanced Tm values for heteroduplex complexes of the mixed-base oligomer, d(TATTCAGTCAT(NH2)), and the methyl phosphonate derivatives, TmTmTmTmTmTmTmTmTmT(NH2) and d(TmAmTmTmCmAmGmTmCmAmT(NH2)). PMID:1630911

  17. Oligonucleotide-directed site-specific mutagenesis in Drosophila melanogaster.

    PubMed Central

    Banga, S S; Boyd, J B


    An efficient technique has been developed for performing in vivo site-directed mutagenesis in Drosophila melanogaster. This procedure involves directed repair of P-element-induced DNA lesions after injection of a modified DNA sequence into early embryos. An oligonucleotide of 50 base pairs, whose sequence spans the P-element insertion site, mediates base replacement in the endogenous gene. Restriction mapping, DNA sequencing, and polymerase chain reaction analysis demonstrate that base substitutions present in an injected oligonucleotide are incorporated into genomic sequences flanking a P insertion site in the white gene. This analysis suggests that progeny bearing directed mutations are recovered with a frequency of about 0.5 x 10(-3). Because Drosophila remains a premier organism for the analysis of eukaryotic gene regulation, this system should find strong application in that analysis as well as in the analysis of DNA recombination, conversion, repair, and mutagenesis. Images PMID:1311850

  18. Cell-penetrating Peptides as Versatile Vehicles for Oligonucleotide Delivery

    PubMed Central

    Margus, Helerin; Padari, Kärt; Pooga, Margus


    Short regulatory oligonucleotides (ONs) have a great therapeutic potential for the modulation of gene expression due to their high specificity and low toxicity. The major obstacles for in vivo clinical applications of ONs are the poor permeability of plasma membrane to nucleic acids and the sensitivity of ONs to enzymatic degradation. Hence, various delivery vehicles have been developed to ensure the transduction of ONs into cells. Among these, the cell-penetrating peptides (CPPs) have gained quickly broadening popularity as promising nonviral transmembrane delivery vectors. For coupling of nucleic acids to CPPs, two distinct strategies may be applied—covalent and noncovalent. The majority of earlier studies have used covalent coupling of CPPs to ONs. However, the number of studies demonstrating very high therapeutic potential of noncovalent complexes of ONs with novel CPP-based delivery vehicles is explosively increasing. In this review, the recent developments in the application of CPP-mediated oligonucleotide delivery by noncovalent strategy will be discussed. PMID:22233581

  19. Construction of a versatile SNP array for pyramiding useful genes of rice.


    Kurokawa, Yusuke; Noda, Tomonori; Yamagata, Yoshiyuki; Angeles-Shim, Rosalyn; Sunohara, Hidehiko; Uehara, Kanako; Furuta, Tomoyuki; Nagai, Keisuke; Jena, Kshirod Kumar; Yasui, Hideshi; Yoshimura, Atsushi; Ashikari, Motoyuki; Doi, Kazuyuki


    DNA marker-assisted selection (MAS) has become an indispensable component of breeding. Single nucleotide polymorphisms (SNP) are the most frequent polymorphism in the rice genome. However, SNP markers are not readily employed in MAS because of limitations in genotyping platforms. Here the authors report a Golden Gate SNP array that targets specific genes controlling yield-related traits and biotic stress resistance in rice. As a first step, the SNP genotypes were surveyed in 31 parental varieties using the Affymetrix Rice 44K SNP microarray. The haplotype information for 16 target genes was then converted to the Golden Gate platform with 143-plex markers. Haplotypes for the 14 useful allele are unique and can discriminate among all other varieties. The genotyping consistency between the Affymetrix microarray and the Golden Gate array was 92.8%, and the accuracy of the Golden Gate array was confirmed in 3 F2 segregating populations. The concept of the haplotype-based selection by using the constructed SNP array was proofed. PMID:26566831

  20. Cationic carbosilane dendrimers and oligonucleotide binding: an energetic affair

    NASA Astrophysics Data System (ADS)

    Marson, D.; Laurini, E.; Posocco, P.; Fermeglia, M.; Pricl, S.


    Generation 2 cationic carbosilane dendrimers hold great promise as internalizing agents for gene therapy as they present low toxicity and retain and internalize the genetic material as an oligonucleotide or siRNA. In this work we carried out complete in silico structural and energetical characterization of the interactions of a set of G2 carbosilane dendrimers, showing different affinity towards two single strand oligonucleotide (ODN) sequences in vitro. Our simulations predict that these four dendrimers and the relevant ODN complexes are characterized by similar size and shape, and that the molecule-specific ODN binding ability can be rationalized only by considering a critical molecular design parameter: the normalized effective binding energy ΔGbind,eff/Neff, i.e. the performance of each active individual dendrimer branch directly involved in a binding interaction.Generation 2 cationic carbosilane dendrimers hold great promise as internalizing agents for gene therapy as they present low toxicity and retain and internalize the genetic material as an oligonucleotide or siRNA. In this work we carried out complete in silico structural and energetical characterization of the interactions of a set of G2 carbosilane dendrimers, showing different affinity towards two single strand oligonucleotide (ODN) sequences in vitro. Our simulations predict that these four dendrimers and the relevant ODN complexes are characterized by similar size and shape, and that the molecule-specific ODN binding ability can be rationalized only by considering a critical molecular design parameter: the normalized effective binding energy ΔGbind,eff/Neff, i.e. the performance of each active individual dendrimer branch directly involved in a binding interaction. Electronic supplementary information (ESI) available: Additional figures and tables. See DOI: 10.1039/c4nr04510f

  1. Array2BIO: A Comprehensive Suite of Utilities for the Analysis of Microarray Data

    SciTech Connect

    Loots, G G; Chain, P G; Mabery, S; Rasley, A; Garcia, E; Ovcharenko, I


    We have developed an integrative and automated toolkit for the analysis of Affymetrix microarray data, named Array2BIO. It identifies groups of coexpressed genes using two complementary approaches--comparative analysis of signal versus control microarrays and clustering analysis of gene expression across different conditions. The identified genes are assigned to functional categories based on the Gene Ontology classification, and a detection of corresponding KEGG protein interaction pathways. Array2BIO reliably handles low-expressor genes and provides a set of statistical methods to quantify the odds of observations, including the Benjamini-Hochberg and Bonferroni multiple testing corrections. Automated interface with the ECR Browser provides evolutionary conservation analysis of identified gene loci while the interconnection with Creme allows high-throughput analysis of human promoter regions and prediction of gene regulatory elements that underlie the observed expression patterns. Array2BIO is publicly available at

  2. Therapeutic antisense oligonucleotides against cancer: hurdling to the clinic

    PubMed Central

    Moreno, Pedro M. D.; Pêgo, Ana P.


    Under clinical development since the early 90's and with two successfully approved drugs (Fomivirsen and Mipomersen), oligonucleotide-based therapeutics has not yet delivered a clinical drug to the market in the cancer field. Whilst many pre-clinical data has been generated, a lack of understanding still exists on how to efficiently tackle all the different challenges presented for cancer targeting in a clinical setting. Namely, effective drug vectorization, careful choice of target gene or synergistic multi-gene targeting are surely decisive, while caution must be exerted to avoid potential toxic, often misleading off-target-effects. Here a brief overview will be given on the nucleic acid chemistry advances that established oligonucleotide technologies as a promising therapeutic alternative and ongoing cancer related clinical trials. Special attention will be given toward a perspective on the hurdles encountered specifically in the cancer field by this class of therapeutic oligonucleotides and a view on possible avenues for success is presented, with particular focus on the contribution from nanotechnology to the field. PMID:25353019

  3. DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing.


    Nishina, Kazutaka; Piao, Wenying; Yoshida-Tanaka, Kie; Sujino, Yumiko; Nishina, Tomoko; Yamamoto, Tsuyoshi; Nitta, Keiko; Yoshioka, Kotaro; Kuwahara, Hiroya; Yasuhara, Hidenori; Baba, Takeshi; Ono, Fumiko; Miyata, Kanjiro; Miyake, Koichi; Seth, Punit P; Low, Audrey; Yoshida, Masayuki; Bennett, C Frank; Kataoka, Kazunori; Mizusawa, Hidehiro; Obika, Satoshi; Yokota, Takanori


    Antisense oligonucleotides (ASOs) are recognized therapeutic agents for the modulation of specific genes at the post-transcriptional level. Similar to any medical drugs, there are opportunities to improve their efficacy and safety. Here we develop a short DNA/RNA heteroduplex oligonucleotide (HDO) with a structure different from double-stranded RNA used for short interfering RNA and single-stranded DNA used for ASO. A DNA/locked nucleotide acid gapmer duplex with an α-tocopherol-conjugated complementary RNA (Toc-HDO) is significantly more potent at reducing the expression of the targeted mRNA in liver compared with the parent single-stranded gapmer ASO. Toc-HDO also improves the phenotype in disease models more effectively. In addition, the high potency of Toc-HDO results in a reduction of liver dysfunction observed in the parent ASO at a similar silencing effect. HDO technology offers a novel concept of therapeutic oligonucleotides, and the development of this molecular design opens a new therapeutic field. PMID:26258894

  4. Rapid bacterial identification using evanescent-waveguide oligonucleotide microarray classification.


    Francois, Patrice; Charbonnier, Yvan; Jacquet, Jean; Utinger, Dominic; Bento, Manuela; Lew, Daniel; Kresbach, Gerhard M; Ehrat, Markus; Schlegel, Werner; Schrenzel, Jacques


    Bacterial identification relies primarily on culture-based methodologies and requires 48-72 h to deliver results. We developed and used i) a bioinformatics strategy to select oligonucleotide signature probes, ii) a rapid procedure for RNA labelling and hybridization, iii) an evanescent-waveguide oligoarray with exquisite signal/noise performance, and iv) informatics methods for microarray data analysis. Unique 19-mer signature oligonucleotides were selected in the 5'-end of 16s rDNA genes of human pathogenic bacteria. Oligonucleotides spotted onto a Ta(2)O(5)-coated microarray surface were incubated with chemically labelled total bacterial RNA. Rapid hybridization and stringent washings were performed before scanning and analyzing the slide. In the present paper, the eight most abundant bacterial pathogens representing >54% of positive blood cultures were selected. Hierarchical clustering analysis of hybridization data revealed characteristic patterns, even for closely related species. We then evaluated artificial intelligence-based approaches that outperformed conventional threshold-based identification schemes on cognate probes. At this stage, the complete procedure applied to spiked blood cultures was completed in less than 6 h. In conclusion, when coupled to optimal signal detection strategy, microarrays provide bacterial identification within a few hours post-sampling, allowing targeted antimicrobial prescription. PMID:16216356

  5. Recursive construction of perfect DNA molecules from imperfect oligonucleotides

    PubMed Central

    Linshiz, Gregory; Yehezkel, Tuval Ben; Kaplan, Shai; Gronau, Ilan; Ravid, Sivan; Adar, Rivka; Shapiro, Ehud


    Making faultless complex objects from potentially faulty building blocks is a fundamental challenge in computer engineering, nanotechnology and synthetic biology. Here, we show for the first time how recursion can be used to address this challenge and demonstrate a recursive procedure that constructs error-free DNA molecules and their libraries from error-prone oligonucleotides. Divide and Conquer (D&C), the quintessential recursive problem-solving technique, is applied in silico to divide the target DNA sequence into overlapping oligonucleotides short enough to be synthesized directly, albeit with errors; error-prone oligonucleotides are recursively combined in vitro, forming error-prone DNA molecules; error-free fragments of these molecules are then identified, extracted and used as new, typically longer and more accurate, inputs to another iteration of the recursive construction procedure; the entire process repeats until an error-free target molecule is formed. Our recursive construction procedure surpasses existing methods for de novo DNA synthesis in speed, precision, amenability to automation, ease of combining synthetic and natural DNA fragments, and ability to construct designer DNA libraries. It thus provides a novel and robust foundation for the design and construction of synthetic biological molecules and organisms. PMID:18463615

  6. Therapeutic Antisense Oligonucleotides against Cancer: Hurdling to the Clinic

    NASA Astrophysics Data System (ADS)

    Moreno, Pedro; Pêgo, Ana


    Under clinical development since the early 90’s and with two successfully approved drugs (Fomivirsen and Mipomersen), oligonucleotide-based therapeutics have not yet delivered a clinical drug to the market in the cancer field. Whilst many pre-clinical data has been generated, a lack of understanding still exists on how to efficiently tackle all the different challenges presented for cancer targeting in a clinical setting. Namely, effective drug vectorization, careful choice of target gene or synergistic multi-gene targeting are surely decisive, while caution must be exerted to avoid potential toxic, often misleading off-target-effects. Here a brief overview will be given on the nucleic acid chemistry advances that established oligonucleotide technologies as a promising therapeutic alternative and ongoing cancer related clinical trials. Special attention will be given towards a perspective on the hurdles encountered specifically in the cancer field by this class of therapeutic oligonucleotides and a view on possible avenues for success is presented, with particular focus on the contribution from nanotechnology to the field.

  7. Targeting Several CAG Expansion Diseases by a Single Antisense Oligonucleotide

    PubMed Central

    Evers, Melvin M.; Pepers, Barry A.; van Deutekom, Judith C. T.; Mulders, Susan A. M.; den Dunnen, Johan T.; Aartsma-Rus, Annemieke; van Ommen, Gert-Jan B.; van Roon-Mom, Willeke M. C.


    To date there are 9 known diseases caused by an expanded polyglutamine repeat, with the most prevalent being Huntington's disease. Huntington's disease is a progressive autosomal dominant neurodegenerative disorder for which currently no therapy is available. It is caused by a CAG repeat expansion in the HTT gene, which results in an expansion of a glutamine stretch at the N-terminal end of the huntingtin protein. This polyglutamine expansion plays a central role in the disease and results in the accumulation of cytoplasmic and nuclear aggregates. Here, we make use of modified 2′-O-methyl phosphorothioate (CUG)n triplet-repeat antisense oligonucleotides to effectively reduce mutant huntingtin transcript and protein levels in patient-derived Huntington's disease fibroblasts and lymphoblasts. The most effective antisense oligonucleotide, (CUG)7, also reduced mutant ataxin-1 and ataxin-3 mRNA levels in spinocerebellar ataxia 1 and 3, respectively, and atrophin-1 in dentatorubral-pallidoluysian atrophy patient derived fibroblasts. This antisense oligonucleotide is not only a promising therapeutic tool to reduce mutant huntingtin levels in Huntington's disease but our results in spinocerebellar ataxia and dentatorubral-pallidoluysian atrophy cells suggest that this could also be applicable to other polyglutamine expansion disorders as well. PMID:21909428

  8. Targeting several CAG expansion diseases by a single antisense oligonucleotide.


    Evers, Melvin M; Pepers, Barry A; van Deutekom, Judith C T; Mulders, Susan A M; den Dunnen, Johan T; Aartsma-Rus, Annemieke; van Ommen, Gert-Jan B; van Roon-Mom, Willeke M C


    To date there are 9 known diseases caused by an expanded polyglutamine repeat, with the most prevalent being Huntington's disease. Huntington's disease is a progressive autosomal dominant neurodegenerative disorder for which currently no therapy is available. It is caused by a CAG repeat expansion in the HTT gene, which results in an expansion of a glutamine stretch at the N-terminal end of the huntingtin protein. This polyglutamine expansion plays a central role in the disease and results in the accumulation of cytoplasmic and nuclear aggregates. Here, we make use of modified 2'-O-methyl phosphorothioate (CUG)n triplet-repeat antisense oligonucleotides to effectively reduce mutant huntingtin transcript and protein levels in patient-derived Huntington's disease fibroblasts and lymphoblasts. The most effective antisense oligonucleotide, (CUG)(7), also reduced mutant ataxin-1 and ataxin-3 mRNA levels in spinocerebellar ataxia 1 and 3, respectively, and atrophin-1 in dentatorubral-pallidoluysian atrophy patient derived fibroblasts. This antisense oligonucleotide is not only a promising therapeutic tool to reduce mutant huntingtin levels in Huntington's disease but our results in spinocerebellar ataxia and dentatorubral-pallidoluysian atrophy cells suggest that this could also be applicable to other polyglutamine expansion disorders as well. PMID:21909428

  9. Sequence-selective metal ion binding to DNA oligonucleotides.


    Frøystein, N A; Davis, J T; Reid, B R; Sletten, E


    Metal ion titrations of several DNA oligonucleotides, 10 dodecamers and one decamer have been monitored by 1H NMR spectroscopy in order to elucidate metal ion binding patterns. Also, the effects of paramagnetic impurities on resonance linewidths and NOESY cross-peak intensities have been reversed by EDTA back-titration experiments. 1H 1D NMR spectra were recorded after successive additions of aliquots of different metal salts to oligonucleotide samples. Paramagnetic manganese(II) salts were used in most cases, but a few samples were also titrated with diamagnetic zinc(II). From this study, we conclude that there exists a sequence-selective metal ion binding pattern. The metal ions bind predominantly to 5'-G in the contexts 5'-GC and 5'-GA. The order of preference seems to be GG > or = GA > GT > > GC. No evidence of metal ion binding to 5'-G in 5'-GC steps or to non-G residues was found. The H6 or H8 resonances on preceding (5'-) bases were affected by the adjacent bound paramagnetic metal ion, but no effect was observed on the protons of the succeeding (3'-) base. The metal binding site in the duplexes is most likely at G-N7, as manifested by the pronounced paramagnetic line broadening or diamagnetic shift of the G-H8 signal. This sequence selectivity may be qualitatively explained by a sequence-dependent variation in the molecular electrostatic potentials of guanine residues (MEPs) along the oligonucleotide chain. PMID:8363924

  10. Peroxide-mediated desulfurization of phosphorothioate oligonucleotides and its prevention.


    Krotz, Achim H; Mehta, Rahul C; Hardee, Gregory E


    Desulfurization at the internucleotide phosphorothioate linkage of antisense oligonucleotides (ASOs) in dermatological formulations has been investigated using strong ion exchange chromatography and mass spectroscopy. The formation of phosphate diester linkages appeared to arise from a reaction between the phosphorothioate oligonucleotide and a potent oxidizing agent. Screening of excipients used in the formulation indicated that the cause of desulfurization was related to the presence of polyethylene glycol-derived nonionic surfactants MYRJ 52 or BRIJ 58. Autoxidation of the polyethylene glycol chain is suggested as the probable origin for the observed incompatibility. The ability of various antioxidants to prevent oxidative degradation of ASO-1 in simple test systems and in oil-in-water emulsions is described. It is found that in test systems both lipophilic and hydrophilic antioxidants are effective. However, in cream formulation (oil-in-water emulsions) of ASO-1 the addition of hydrophilic antioxidants L-cysteine or DL-alpha-lipoic acid has been shown to be superior in protecting the oligonucleotide from desulfurization upon storage. PMID:15614814

  11. Static magnetic field reduced exogenous oligonucleotide uptake by spermatozoa using magnetic nanoparticle gene delivery system

    NASA Astrophysics Data System (ADS)

    Katebi, Samira; Esmaeili, Abolghasem; Ghaedi, Kamran


    Spermatozoa could introduce exogenous oligonucleotides of interest to the oocyte. The most important reason of low efficiency of sperm mediated gene transfer (SMGT) is low uptake of exogenous DNA by spermatozoa. The aim of this study was to evaluate the effects of static magnetic field on exogenous oligonucleotide uptake of spermatozoa using magnetofection method. Magnetic nanoparticles (MNPs) associated with the labeled oligonucleotides were used to increase the efficiency of exogenous oligonucleotide uptake by rooster spermatozoa. We used high-field/high-gradient magnet (NdFeB) to enhance and accelerate exogenous DNA sedimentation at the spermatozoa surface. Flow cytometry analysis was performed to measure viability and percentage of exogenous oligonucleotide uptake by sperm. Flow cytometry analysis showed a significant increase in exogenous oligonucleotide uptake by rooster spermatozoa (P<0.001) when spermatozoa were incubated in exogenous oligonucleotide solution and MNPs. However, by applying static magnetic field during magnetofection method, a significant decrease in exogenous oligonucleotide uptake was observed (P<0.05). Findings of this study showed that MNPs were effective to increase exogenous oligonucleotide uptake by rooster spermatozoa; however unlike others studies, static magnetic field, was not only ineffective to enhance exogenous oligonucleotide uptake by rooster spermatozoa but also led to reduction in efficiency of magnetic nanoparticles in gene transfer.

  12. Immunodetection array.


    Pröll, Johannes; Wechselberger, Christian; Födermayr, Mathilde; Zach, Otto; Lutz, Dieter


    A novel procedure for DNA methylation analysis is described that characterizes the extent of DNA methylation in CpG islands. The basic concept relies on direct immunodetection of 5' methylcytosines (5' mCs) without the need for bisulfite treatment utilizing a microarray format. This system is designed for the application of immunofluorescence using a monoclonal antibody that specifically recognizes 5' mC in single-stranded DNA hybridized to oligonucleotide microarrays. An ultrasensitive fluorescence scanner and 170-mum thin aldehyde-functionalized glass slides are used to optimize the signal-to-noise ratio and to minimize autofluorescence. These methodological improvements allow for the direct detection of 5' mC in genomic DNA hybridized to microarrays without prior PCR amplification with high analytical sensitivity. PMID:18987805

  13. Detection and validation of single feature polymorphisms using RNA expression data from a rice genome array

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A large number of genetic variations have been identified in rice. Such variations must in many cases control phenotypic differences in abiotic stress tolerance and other traits. A single feature polymorphism (SFP) is an oligonucleotide array-based polymorphism which can be used for identification o...

  14. Construction and Evaluation of Desulfovibrio vulgaris Whole-Genome Oligonucleotide Microarrays

    SciTech Connect

    Z. He; Q. He; L. Wu; M.E. Clark; J.D. Wall; Jizhong Zhou; Matthew W. Fields


    Desulfovibrio vulgaris Hildenborough has been the focus of biochemical and physiological studies in the laboratory, and the metabolic versatility of this organism has been largely recognized, particularly the reduction of sulfate, fumarate, iron, uranium and chromium. In addition, a Desulfovibrio sp. has been shown to utilize uranium as the sole electron acceptor. D. vulgaris is a d-Proteobacterium with a genome size of 3.6 Mb and 3584 ORFs. The whole-genome microarrays of D. vulgaris have been constructed using 70mer oligonucleotides. All ORFs in the genome were represented with 3471 (97.1%) unique probes and 103 (2.9%) non-specific probes that may have cross-hybridization with other ORFs. In preparation for use of the experimental microarrays, artificial probes and targets were designed to assess specificity and sensitivity and identify optimal hybridization conditions for oligonucleotide microarrays. The results indicated that for 50mer and 70mer oligonucleotide arrays, hybridization at 45 C to 50 C, washing at 37 C and a wash time of 2.5 to 5 minutes obtained specific and strong hybridization signals. In order to evaluate the performance of the experimental microarrays, growth conditions were selected that were expected to give significant hybridization differences for different sets of genes. The initial evaluations were performed using D. vulgaris cells grown at logarithmic and stationary phases. Transcriptional analysis of D. vulgaris cells sampled during logarithmic phase growth indicated that 25% of annotated ORFs were up-regulated and 3% of annotated ORFs were downregulated compared to stationary phase cells. The up-regulated genes included ORFs predicted to be involved with acyl chain biosynthesis, amino acid ABC transporter, translational initiation factors, and ribosomal proteins. In the stationary phase growth cells, the two most up-regulated ORFs (70-fold) were annotated as a carboxynorspermidine decarboxylase and a 2C-methyl-D-erythritol-2

  15. Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries

    PubMed Central

    Schmidt, Thorsten L.; Beliveau, Brian J.; Uca, Yavuz O.; Theilmann, Mark; Da Cruz, Felipe; Wu, Chao-Ting; Shih, William M.


    Synthetic oligonucleotides are the main cost factor for studies in DNA nanotechnology, genetics and synthetic biology, which all require thousands of these at high quality. Inexpensive chip-synthesized oligonucleotide libraries can contain hundreds of thousands of distinct sequences, however only at sub-femtomole quantities per strand. Here we present a selective oligonucleotide amplification method, based on three rounds of rolling-circle amplification, that produces nanomole amounts of single-stranded oligonucleotides per millilitre reaction. In a multistep one-pot procedure, subsets of hundreds or thousands of single-stranded DNAs with different lengths can selectively be amplified and purified together. These oligonucleotides are used to fold several DNA nanostructures and as primary fluorescence in situ hybridization probes. The amplification cost is lower than other reported methods (typically around US$ 20 per nanomole total oligonucleotides produced) and is dominated by the use of commercial enzymes. PMID:26567534

  16. Flexibility of C3h -Symmetrical Linkers in Tris-oligonucleotide-Based Tetrahedral Scaffolds.


    Panagiotidis, Christos; Kath-Schorr, Stephanie; von Kiedrowski, Günter


    Flexibility of tris-oligonucleotides is determined by the length of their connecting hydrocarbon chains. Tris-oligonucleotides are branched DNA building blocks with three oligonucleotide arms attached to a C3h -symmetrical linker core at these chains. Four tris-oligonucleotides hybridise into a tetrahedral nanocage by sequence-determined self-assembly. The influence of methylene, ethylene and propylene chains was studied by synthesising sets of tris-oligonucleotides and analysing the relative stability of the hybridisation products against digestion by mung bean nuclease by using gel electrophoresis. Linkers with ethylene chains showed sufficient flexibility, whereas methylene-chain linkers were too rigid. Tris-oligonucleotides based on the latter still formed tetrahedral scaffolds in intermixing experiments with linkers of higher flexibility. Thus, a new generation of versatile isocyanurate-based linkers was established. PMID:26593127

  17. Discrimination of oligonucleotides of different lengths with a wild-type aerolysin nanopore

    NASA Astrophysics Data System (ADS)

    Cao, Chan; Ying, Yi-Lun; Hu, Zheng-Li; Liao, Dong-Fang; Tian, He; Long, Yi-Tao


    Protein nanopores offer an inexpensive, label-free method of analysing single oligonucleotides. The sensitivity of the approach is largely determined by the characteristics of the pore-forming protein employed, and typically relies on nanopores that have been chemically modified or incorporate molecular motors. Effective, high-resolution discrimination of oligonucleotides using wild-type biological nanopores remains difficult to achieve. Here, we show that a wild-type aerolysin nanopore can resolve individual short oligonucleotides that are 2 to 10 bases long. The sensing capabilities are attributed to the geometry of aerolysin and the electrostatic interactions between the nanopore and the oligonucleotides. We also show that the wild-type aerolysin nanopores can distinguish individual oligonucleotides from mixtures and can monitor the stepwise cleavage of oligonucleotides by exonuclease I.

  18. Nanoparticle-bridge assay for amplification-free electrical detection of oligonucleotides

    NASA Astrophysics Data System (ADS)

    Teimouri, Manouchehr

    The aim of this research is to investigate a highly sensitive, fast, inexpensive, and field-applicable amplification-free nanoparticle-based oligonucleotide detection method which does not rely on any enzymatic or signal amplification process. In this approach, target oligonucleotide strands are detected through the formation of nanoparticle satellites which make an electrical path between two electrodes. This method enables an extremely sensitive oligonucleotide detection because even a few oligonucleotide strands can form a single nanoparticle satellite which can solely generates an electrical output signal. Results showed that this oligonucleotide detection method can detect oligonucleotide single strands at concentrations as low as 50 femtomolar without any amplification process. This detection method can be implemented in many fields such as biodefense, food safety, clinical research, and forensics.

  19. Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries

    NASA Astrophysics Data System (ADS)

    Schmidt, Thorsten L.; Beliveau, Brian J.; Uca, Yavuz O.; Theilmann, Mark; da Cruz, Felipe; Wu, Chao-Ting; Shih, William M.


    Synthetic oligonucleotides are the main cost factor for studies in DNA nanotechnology, genetics and synthetic biology, which all require thousands of these at high quality. Inexpensive chip-synthesized oligonucleotide libraries can contain hundreds of thousands of distinct sequences, however only at sub-femtomole quantities per strand. Here we present a selective oligonucleotide amplification method, based on three rounds of rolling-circle amplification, that produces nanomole amounts of single-stranded oligonucleotides per millilitre reaction. In a multistep one-pot procedure, subsets of hundreds or thousands of single-stranded DNAs with different lengths can selectively be amplified and purified together. These oligonucleotides are used to fold several DNA nanostructures and as primary fluorescence in situ hybridization probes. The amplification cost is lower than other reported methods (typically around US$ 20 per nanomole total oligonucleotides produced) and is dominated by the use of commercial enzymes.

  20. Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries.


    Schmidt, Thorsten L; Beliveau, Brian J; Uca, Yavuz O; Theilmann, Mark; Da Cruz, Felipe; Wu, Chao-Ting; Shih, William M


    Synthetic oligonucleotides are the main cost factor for studies in DNA nanotechnology, genetics and synthetic biology, which all require thousands of these at high quality. Inexpensive chip-synthesized oligonucleotide libraries can contain hundreds of thousands of distinct sequences, however only at sub-femtomole quantities per strand. Here we present a selective oligonucleotide amplification method, based on three rounds of rolling-circle amplification, that produces nanomole amounts of single-stranded oligonucleotides per millilitre reaction. In a multistep one-pot procedure, subsets of hundreds or thousands of single-stranded DNAs with different lengths can selectively be amplified and purified together. These oligonucleotides are used to fold several DNA nanostructures and as primary fluorescence in situ hybridization probes. The amplification cost is lower than other reported methods (typically around US$ 20 per nanomole total oligonucleotides produced) and is dominated by the use of commercial enzymes. PMID:26567534

  1. Discrimination of oligonucleotides of different lengths with a wild-type aerolysin nanopore.


    Cao, Chan; Ying, Yi-Lun; Hu, Zheng-Li; Liao, Dong-Fang; Tian, He; Long, Yi-Tao


    Protein nanopores offer an inexpensive, label-free method of analysing single oligonucleotides. The sensitivity of the approach is largely determined by the characteristics of the pore-forming protein employed, and typically relies on nanopores that have been chemically modified or incorporate molecular motors. Effective, high-resolution discrimination of oligonucleotides using wild-type biological nanopores remains difficult to achieve. Here, we show that a wild-type aerolysin nanopore can resolve individual short oligonucleotides that are 2 to 10 bases long. The sensing capabilities are attributed to the geometry of aerolysin and the electrostatic interactions between the nanopore and the oligonucleotides. We also show that the wild-type aerolysin nanopores can distinguish individual oligonucleotides from mixtures and can monitor the stepwise cleavage of oligonucleotides by exonuclease I. PMID:27111839

  2. Interagency arraying

    NASA Astrophysics Data System (ADS)

    Cox, Henry G.

    Activities performed to match ground aperture requirements for the Neptune encounter in August 1989 with the expected capabilities of the JPL Deep Space Network (DSN) are discussed. Ground aperture requirements, DSN capabilities, and the capabilities of other agencies are reviewed. The design and configurations of the receiver subsystem, combiner subsystem, monitor and control subsystem, recording subsystem, and supporting subsystems are described. The implementation of the Very Large Array-Goldstone Telemetry Array is discussed, and the differences involved with the Parkes-Canberra Telemetry Array implementation are highlighted. The operational concept is addressed.

  3. Enthalpy arrays

    NASA Astrophysics Data System (ADS)

    Torres, Francisco E.; Kuhn, Peter; de Bruyker, Dirk; Bell, Alan G.; Wolkin, Michal V.; Peeters, Eric; Williamson, James R.; Anderson, Gregory B.; Schmitz, Gregory P.; Recht, Michael I.; Schweizer, Sandra; Scott, Lincoln G.; Ho, Jackson H.; Elrod, Scott A.; Schultz, Peter G.; Lerner, Richard A.; Bruce, Richard H.


    We report the fabrication of enthalpy arrays and their use to detect molecular interactions, including protein-ligand binding, enzymatic turnover, and mitochondrial respiration. Enthalpy arrays provide a universal assay methodology with no need for specific assay development such as fluorescent labeling or immobilization of reagents, which can adversely affect the interaction. Microscale technology enables the fabrication of 96-detector enthalpy arrays on large substrates. The reduction in scale results in large decreases in both the sample quantity and the measurement time compared with conventional microcalorimetry. We demonstrate the utility of the enthalpy arrays by showing measurements for two protein-ligand binding interactions (RNase A + cytidine 2'-monophosphate and streptavidin + biotin), phosphorylation of glucose by hexokinase, and respiration of mitochondria in the presence of 2,4-dinitrophenol uncoupler.

  4. MALDI MS analysis of oligonucleotides: desalting by functional magnetite beads using microwave-assisted extraction.


    Chen, Wei-Yu; Chen, Yu-Chie


    The presence of alkali cation adductions of oligonucleotides commonly deteriorates matrix-assisted laser desorption/ionization (MALDI) mass spectra. Thus, desalting is required for oligonucleotide samples prior to MALDI MS analysis in order to prevent the mass spectra from developing poor quality. In this paper, we demonstrate a new approach to extract traces of oligonucleotides from aqueous solutions containing high concentrations of salts using microwave-assisted extraction. The C18-presenting magnetite beads, capable of absorbing microwave irradiation, are used as affinity probes for oligonucleotides with the addition of triethylammonium acetate as the counterions. This new microwave-assisted extraction approach using magnetite beads as the trapping agents and as microwave-absorbers has been demonstrated to be very effective in the selective binding of oligonucleotides from aqueous solutions. The extraction of oligonucleotides from solutions onto the C18-presenting magnetite beads takes only 30 s to enrich oligonucleotides in sufficient quantities for MALDI MS analysis. After using this desalting approach, alkali cation adductions of oligonucleotides are dramatically reduced in the MALDI mass spectra. The presence of saturated NaCl (approximately 6 M) in the oligonucleotide sample is tolerated without degrading the mass spectra. The detection limit for d(A)6 is approximately 2.8 fmol. PMID:17902633

  5. Direct measurement of oligonucleotide binding stoichiometry of gene V protein by mass spectrometry.

    PubMed Central

    Cheng, X; Harms, A C; Goudreau, P N; Terwilliger, T C; Smith, R D


    The binding stoichiometry of gene V protein from bacteriophage f1 to several oligonucleotides was studied using electrospray ionization-mass spectrometry (ESI-MS). Using mild mass spectrometer interface conditions that preserve noncovalent associations in solution, gene V protein was observed as dimer ions from a 10 mM NH4OAc solution. Addition of oligonucleotides resulted in formation of protein-oligonucleotide complexes with stoichiometry of approximately four nucleotides (nt) per protein monomer. A 16-mer oligonucleotide gave predominantly a 4:1 (protein monomer: oligonucleotide) complex while oligonucleotides shorter than 15 nt showed stoichiometries of 2:1. Stoichiometries and relative binding constants for a mixture of oligonucleotides were readily measured using mass spectrometry. The binding stoichiometry of the protein with the 16-mer oligonucleotide was measured independently using size-exclusion chromatography and the results were consistent with the mass spectrometric data. These results demonstrate, for the first time, the observation and stoichiometric measurement of protein-oligonucleotide complexes using ESI-MS. The sensitivity and high resolution of ESI-MS should make it a useful too] in the study of protein-DNA interactions. PMID:8692937

  6. 2'-O-[2-(guanidinium)ethyl]-modified oligonucleotides: stabilizing effect on duplex and triplex structures

    SciTech Connect

    Prakash, T.P.; Puschl, A.; Lesnik, E.; Mohan, V.; Tereshko, V.; Egli, M.; Manoharan, M.


    Oligonucleotides with a novel 2'-O-[2-(guanidinium)ethyl] (2'-O-GE) modification have been synthesized using a novel protecting group strategy for the guanidinium group. This modification enhances the binding affinity of oligonucleotides to RNA as well as duplex DNA ({Delta}T{sub m} 3.2 C per modification). The 2'-O-GE modified oligonucleotides exhibited exceptional resistance to nuclease degradation. The crystal structure of a palindromic duplex formed by a DNA oligonucleotide with a single 2'-O-GE modification was solved at 1.16 {angstrom} resolution.

  7. Array tomography: production of arrays.


    Micheva, Kristina D; O'Rourke, Nancy; Busse, Brad; Smith, Stephen J


    Array tomography is a volumetric microscopy method based on physical serial sectioning. Ultrathin sections of a plastic-embedded tissue are cut using an ultramicrotome, bonded in an ordered array to a glass coverslip, stained as desired, and imaged. The resulting two-dimensional image tiles can then be reconstructed computationally into three-dimensional volume images for visualization and quantitative analysis. The minimal thickness of individual sections permits high-quality rapid staining and imaging, whereas the array format allows reliable and convenient section handling, staining, and automated imaging. Also, the physical stability of the arrays permits images to be acquired and registered from repeated cycles of staining, imaging, and stain elution, as well as from imaging using multiple modalities (e.g., fluorescence and electron microscopy). Array tomography makes it possible to visualize and quantify previously inaccessible features of tissue structure and molecular architecture. However, careful preparation of the tissue is essential for successful array tomography; these steps can be time consuming and require some practice to perfect. This protocol describes the sectioning of embedded tissues and the mounting of the serial arrays. The procedures require some familiarity with the techniques used for ultramicrotome sectioning for electron microscopy. PMID:21041397

  8. Array tomography: imaging stained arrays.


    Micheva, Kristina D; O'Rourke, Nancy; Busse, Brad; Smith, Stephen J


    Array tomography is a volumetric microscopy method based on physical serial sectioning. Ultrathin sections of a plastic-embedded tissue are cut using an ultramicrotome, bonded in an ordered array to a glass coverslip, stained as desired, and imaged. The resulting two-dimensional image tiles can then be reconstructed computationally into three-dimensional volume images for visualization and quantitative analysis. The minimal thickness of individual sections permits high-quality rapid staining and imaging, whereas the array format allows reliable and convenient section handling, staining, and automated imaging. Also, the physical stability of the arrays permits images to be acquired and registered from repeated cycles of staining, imaging, and stain elution, as well as from imaging using multiple modalities (e.g., fluorescence and electron microscopy). Array tomography makes it possible to visualize and quantify previously inaccessible features of tissue structure and molecular architecture. However, careful preparation of the tissue is essential for successful array tomography; these steps can be time-consuming and require some practice to perfect. In this protocol, tissue arrays are imaged using conventional wide-field fluorescence microscopy. Images can be captured manually or, with the appropriate software and hardware, the process can be automated. PMID:21041399

  9. Molecular Crowding Effects on Microgel-Tethered Oligonucleotide Probes.


    Ma, Youlong; Libera, Matthew


    Microgel tethering is a nontraditional method with which to bind oligonucleotide hybridization probes to a solid surface. Microgel-tethering physically positions the probes away from the underlying hard substrate and maintains them in a highly waterlike environment. This paper addresses the question of whether molecular crowding affects the performance of microgel-tethered molecular beacon probes. The density of probe-tethering sites is controlled experimentally using thin-film blends of biotin-terminated [PEG-B] and hydroxyl-terminated [PEG-OH] poly(ethylene glycol) from which microgels are synthesized and patterned by electron beam lithography. Fluorescence measurements indicate that the number of streptavidins, linear DNA probes, hairpin probes, and molecular beacon probes bound to the microgels increases linearly with increasing PEG-B/PEG-OH ratio. For a given tethering-site concentration, more linear probes can bind than structured probes. Crowding effects emerge during the hybridization of microgel-tethered molecular beacons but not during the hybridization of linear probes, as the tethering density increases. Crowding during hybridization is associated with conformational constraints imposed by the close proximity of closed and hybridized structured probes. The signal-to-background ratio (SBR) of hybridized beacons is highest and roughly constant for low tethering densities and decreases at the highest tethering densities. Despite differences between microgel tethering and traditional oligonucleotide surface-immobilization approaches, these results show that crowding defines an optimum tethering density for molecular beacon probes that is less than the maximum possible, which is consistent with previous studies involving various linear and structured oligonucleotide probes. PMID:27253904

  10. transcriptional response of pigs to Salmonella infection: Comparison of responses to infection with Salmonella eimerica serotype Typhimurium as that observed in S. choleraesuis infection.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Swine responses to, and control of, Salmonella enterica serotype Typhimurium (ST) infection have been compared to S. enterica serotype Choleraesuis (SC) infection. Using subtractive suppression hybridization (SSH), long oligonucleotide Qiagen and Affymetrix porcine GeneChip® arrays, and real time ge...

  11. Comparative immune responses of pigs to infection with Salmonella enterica serovars of food safety (Typhimurium) and animal health (Choleraesuis) importance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Salmonella infections cause food safety concerns for humans as well as production problems for swine. Our team has used suppression hybridization (SSH), long oligonucleotide Qiagen and Affymetrix porcine GeneChip® arrays, and real time gene expression (Q-PCR) to understand the host response to, and ...

  12. Repair of DNA lesions associated with triplex-forming oligonucleotides.


    Chin, Joanna Y; Glazer, Peter M


    Triplex-forming oligonucleotides (TFOs) are gene targeting tools that can bind in the major groove of duplex DNA in a sequence-specific manner. When bound to DNA, TFOs can inhibit gene expression, can position DNA-reactive agents to specific locations in the genome, or can induce targeted mutagenesis and recombination. There is evidence that third strand binding, alone or with an associated cross-link, is recognized and metabolized by DNA repair factors, particularly the nucleotide excision repair pathway. This review examines the evidence for DNA repair of triplex-associated lesions. PMID:19072762

  13. Species-Level Identification of Orthopoxviruses with an Oligonucleotide Microchip

    PubMed Central

    Lapa, Sergey; Mikheev, Maxim; Shchelkunov, Sergei; Mikhailovich, Vladimir; Sobolev, Alexander; Blinov, Vladimir; Babkin, Igor; Guskov, Alexander; Sokunova, Elena; Zasedatelev, Alexander; Sandakhchiev, Lev; Mirzabekov, Andrei


    A method for species-specific detection of orthopoxviruses pathogenic for humans and animals is described. The method is based on hybridization of a fluorescently labeled amplified DNA specimen with the oligonucleotide DNA probes immobilized on a microchip (MAGIChip). The probes identify species-specific sites within the crmB gene encoding the viral analogue of tumor necrosis factor receptor, one of the most important determinants of pathogenicity in this genus of viruses. The diagnostic procedure takes 6 h and does not require any sophisticated equipment (a portable fluorescence reader can be used). PMID:11880388

  14. A convenient and efficient purification method for chemically labeled oligonucleotides.


    Hwang, Jihee; Kang, Junhee; Kim, Seong Keun; Kim, Younggyu


    We developed an efficient, cost-effective, and rapid purification method for chemically-labeled oligonucleotides that requires less time than conventional procedures such as ethanol precipitation or size-exclusion chromatography. Based on the hydrophilic and hydrophobic properties of DNA and amine-reactive fluorophores, we show that n-butanol saturated with distilled water may be used to remove unreacted fluorophores by sequestering them in the organic phase, while labeled DNA remains in the aqueous phase. This phase extraction method is simple, fast, and allows for processing multiple samples simultaneously, a necessity for high-throughput labeling strategies. PMID:23662899

  15. On the rapid deprotection of synthetic oligonucleotides and analogs.

    PubMed Central

    Polushin, N N; Morocho, A M; Chen, B C; Cohen, J S


    The efficiency of oligodeoxynucleotide deprotection is greatly enhanced using a combination of: (a) ethanolamine, and especially a mixture of hydrazine, ethanolamine and methanol, in place of the usual aqueous ammonia; (b) tert-butylphenoxyacetyl amino protecting groups, and (c) oxalyl link between the first nucleotide and the polymeric support. The extent of base modification, particularly of C, is shown to be extremely low, and the quality of deprotected oligonucleotides is as high as in the case of ammonia deprotection. This method is also shown to be applicable to the preparation of phosphorothioate and methylphosphonate oligodeoxynucleotides and oligoribonucleotides. Images PMID:8127712

  16. PCR amplification on microarrays of gel immobilized oligonucleotides


    Strizhkov, Boris; Tillib, Sergei; Mikhailovich, Vladimir; Mirzabekov, Andrei


    The invention relates two general methods for performing PCR amplification, combined with the detection and analysis of the PCR products on a microchip. In the first method, the amplification occurs both outside and within a plurality of gel pads on a microchip, with at least one oligonucleotide primer immobilized in a gel pad. In the second method, PCR amplification also takes place within gel pads on a microchip, but the pads are surrounded by a hydrophobic liquid such as that which separates the individual gel pads into environments which resemble micro-miniaturized test tubes.

  17. Inhibition Of Molecular And Biological Processes Using Modified Oligonucleotides


    Kozyavkin, Sergei A.; Malykh, Andrei G.; Polouchine, Nikolai N.; Slesarev, Alexei I.


    A method of inhibiting at least one molecular process in a sample, comprising administering to the sample an oligonucleotide or polynucleotide containing at least one monomeric unit having formula (I): wherein A is an organic moiety, n is at least 1, and each X is independently selected from the group consisting of --NRCOCONu, --NHCOCR.sub.2 CR.sub.2 CONu, --NHCOCR.dbd.CRCONu, and --NHCOSSCONu, wherein each R independently represents H or a substituted or unsubstituted alkyl group, and Nu represents a nucleophile, or a salt of the compound.

  18. Oligonucleotide microarray for subtyping of influenza A viruses

    NASA Astrophysics Data System (ADS)

    Klotchenko, S. A.; Vasin, A. V.; Sandybaev, N. T.; Plotnikova, M. A.; Chervyakova, O. V.; Smirnova, E. A.; Kushnareva, E. V.; Strochkov, V. M.; Taylakova, E. T.; Egorov, V. V.; Koshemetov, J. K.; Kiselev, O. I.; Sansyzbay, A. R.


    Influenza is one of the most widespread respiratory viral diseases, infecting humans, horses, pigs, poultry and some other animal populations. Influenza A viruses (IAV) are classified into subtypes on the basis of the surface hemagglutinin (H1 to H16) and neuraminidase (N1 to N9) glycoproteins. The correct determination of IAV subtype is necessary for clinical and epidemiological studies. In this article we propose an oligonucleotide microarray for subtyping of IAV using universal one-step multisegment RT-PCR fluorescent labeling of viral gene segments. It showed to be an advanced approach for fast detection and identification of IAV.

  19. Pyrene-functionalized oligonucleotides and locked nucleic acids (LNAs): Tools for fundamental research, diagnostics, and materials science†

    PubMed Central

    Østergaard, Michael E.; Hrdlicka, Patrick J.


    Pyrene-functionalized oligonucleotides (PFOs) are increasingly explored as tools in fundamental research, diagnostics and materials science. Their popularity is linked to the ability of pyrenes to function as polarity-sensitive and quenchable fluorophores, excimer-generating units, aromatic stacking moieties and nucleic acid duplex intercalators. These characteristics have motivated development of PFOs for detection of complementary DNA/RNA targets, single nucleotide polymorphisms (SNPs), and generation of π-arrays on nucleic acid scaffolds. This Review will highlight the physical properties and applications of PFOs that are likely to provide high degree of positional control of the chromophore in nucleic acid complexes. Particular emphasis will be placed on pyrene-functionalized Locked Nucleic Acids (LNAs) since these materials display distinctive properties such as large fluorescence quantum yields, efficient discrimination of SNPs, and recognition of mixed-sequence double stranded DNA. PMID:21487621

  20. Direct detection of 16S rRNA in soil extracts by using oligonucleotide microarrays.


    Small, J; Call, D R; Brockman, F J; Straub, T M; Chandler, D P


    We report on the development and validation of a simple microarray method for the direct detection of intact 16S rRNA from unpurified soil extracts. Total RNAs from Geobacter chapellei and Desulfovibrio desulfuricans were hybridized to an oligonucleotide array consisting of universal and species-specific 16S rRNA probes. PCR-amplified products from Geobacter and Desulfovibrio were easily and specifically detected under a range of hybridization times, temperatures, and buffers. However, reproducible, specific hybridization and detection of intact rRNA could be accomplished only by using a chaperone-detector probe strategy. With this knowledge, assay conditions were developed for rRNA detection using a 2-h hybridization time at room temperature. Hybridization specificity and signal intensity were enhanced using fragmented RNA. Formamide was required in the hybridization buffer in order to achieve species-specific detection of intact rRNA. With the chaperone detection strategy, we were able to specifically hybridize and detect G. chapellei 16S rRNA directly from a total-RNA soil extract, without further purification or removal of soluble soil constituents. The detection sensitivity for G. chapellei 16S rRNA in soil extracts was at least 0.5 microg of total RNA, representing approximately 7.5 x 10(6) Geobacter cell equivalents of RNA. These results suggest that it is now possible to apply microarray technology to the direct detection of microorganisms in environmental samples, without using PCR. PMID:11571176

  1. A multiplex oligonucleotide ligation-PCR as a complementary tool for subtyping of Salmonella Typhimurium.


    Wuyts, Véronique; Mattheus, Wesley; Roosens, Nancy H C; Marchal, Kathleen; Bertrand, Sophie; De Keersmaecker, Sigrid C J


    Subtyping below the serovar level is essential for surveillance and outbreak detection and investigation of Salmonella enterica subsp. enterica serovar Typhimurium (S. Typhimurium) and its monophasic variant 1,4,[5],12:i:- (S. 1,4,[5],12:i:-), frequent causes of foodborne infections. In an attempt to overcome the intrinsic shortcomings of currently used subtyping techniques, a multiplex oligonucleotide ligation-PCR (MOL-PCR) assay was developed which combines different types of molecular markers in a high-throughput microsphere suspension array. The 52 molecular markers include prophage genes, amplified fragment length polymorphism (AFLP) elements, Salmonella genomic island 1 (SGI1), allantoinase gene allB, MLVA locus STTR10, antibiotic resistance genes, single nucleotide polymorphisms (SNPs) and phase 2 flagellar gene fljB. The in vitro stability of these markers was confirmed in a serial passage experiment. The validation of the MOL-PCR assay for subtyping of S. Typhimurium and S. 1,4,[5],12:i:- on 519 isolates shows that the method is rapid, reproducible, flexible, accessible, easy to use and relatively inexpensive. Additionally, a 100 % typeability and a discriminatory power equivalent to that of phage typing were observed, and epidemiological concordance was assessed on isolates of 2 different outbreaks. Furthermore, a data analysis method is provided so that the MOL-PCR assay allows for objective, computerised data analysis and data interpretation of which the results can be easily exchanged between different laboratories in an international surveillance network. PMID:26205523

  2. Transcription profiling of the early gravitropic response in Arabidopsis using high-density oligonucleotide probe microarrays

    NASA Technical Reports Server (NTRS)

    Moseyko, Nick; Zhu, Tong; Chang, Hur-Song; Wang, Xun; Feldman, Lewis J.


    Studies of plant tropisms, the directed growth toward or away from external stimuli such as light and gravity, began more than a century ago. Yet biochemical, physiological, and especially molecular mechanisms of plant tropic responses remain for the most part unclear. We examined expression of 8,300 genes during early stages of the gravitropic response using high-density oligonucleotide probe microarrays. Approximately 1.7% of the genes represented on the array exhibited significant expression changes within the first 30 min of gravity stimulation. Among gravity-induced genes were a number of genes previously implicated to be involved in gravitropism. However, a much larger number of the identified genes have not been previously associated with gravitropism. Because reorientation of plants may also expose plants to mechanical perturbations, we also compared the effects of a gentle mechanical perturbation on mRNA levels during the gravity response. It was found that approximately 39% of apparently gravity-regulated genes were also regulated by the mechanical perturbation caused by plant reorientation. Our study revealed the induction of complex gene expression patterns as a consequence of gravitropic reorientation and points to an interplay between the gravitropic and mechanical responses and to the extreme sensitivity of plants to even very gentle mechanical perturbations.

  3. Identification of SNPs and INDELS in swine transcribed sequences using short oligonucleotide microarrays

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genome-wide detection of single feature polymorphisms (SFP) in swine using transcriptome profiling of day 25 placental RNA by contrasting probe intensities from either Meishan or an occidental composite breed with Affymetrix porcine microarrays is presented. A linear mixed model analysis was used to...

  4. Microlens arrays

    NASA Astrophysics Data System (ADS)

    Hutley, Michael C.; Stevens, Richard F.; Daly, Daniel J.


    Microlenses have been with us for a long time as indeed the very word lens reminds us. Many early lenses,including those made by Hooke and Leeuwenhoek in the 17th century were small and resembled lentils. Many languages use the same word for both (French tilentillelt and German "Linse") and the connection is only obscure in English because we use the French word for the vegetable and the German for the optic. Many of the applications for arrays of inicrolenses are also well established. Lippmann's work on integral photography at the turn of the century required lens arrays and stimulated an interest that is very much alive today. At one stage, lens arrays played an important part in high speed photography and various schemes have been put forward to take advantage of the compact imaging properties of combinations of lens arrays. The fact that many of these ingenious schemes have not been developed to their full potential has to a large degree been due to the absence of lens arrays of a suitable quality and cost.

  5. Genetic Aberrations in Childhood Acute Lymphoblastic Leukaemia: Application of High-Density Single Nucleotide Polymorphism Array

    PubMed Central

    Sulong, Sarina


    Screening of the entire human genome using high-density single nucleotide polymorphism array (SNPA) has become a powerful technique used in cancer genetics and population genetics studies. The GeneChip® Mapping Array, introduced by Affymetrix, is one SNPA platform utilised for genotyping studies. This GeneChip system allows researchers to gain a comprehensive view of cancer biology on a single platform for the quantification of chromosomal amplifications, deletions, and loss of heterozygosity or for allelic imbalance studies. Importantly, this array analysis has the potential to reveal novel genetic findings involved in the multistep development of cancer. Given the importance of genetic factors in leukaemogenesis and the usefulness of screening the whole genome, SNPA analysis has been utilised in many studies to characterise genetic aberrations in childhood acute lymphoblastic leukaemia. PMID:22135543

  6. Oligonucleotide Aptamers: New Tools for Targeted Cancer Therapy

    PubMed Central

    Sun, Hongguang; Zhu, Xun; Lu, Patrick Y; Rosato, Roberto R; Tan, Wen; Zu, Youli


    Aptamers are a class of small nucleic acid ligands that are composed of RNA or single-stranded DNA oligonucleotides and have high specificity and affinity for their targets. Similar to antibodies, aptamers interact with their targets by recognizing a specific three-dimensional structure and are thus termed “chemical antibodies.” In contrast to protein antibodies, aptamers offer unique chemical and biological characteristics based on their oligonucleotide properties. Hence, they are more suitable for the development of novel clinical applications. Aptamer technology has been widely investigated in various biomedical fields for biomarker discovery, in vitro diagnosis, in vivo imaging, and targeted therapy. This review will discuss the potential applications of aptamer technology as a new tool for targeted cancer therapy with emphasis on the development of aptamers that are able to specifically target cell surface biomarkers. Additionally, we will describe several approaches for the use of aptamers in targeted therapeutics, including aptamer-drug conjugation, aptamer-nanoparticle conjugation, aptamer-mediated targeted gene therapy, aptamer-mediated immunotherapy, and aptamer-mediated biotherapy. PMID:25093706

  7. DOTAP/UDCA vesicles: novel approach in oligonucleotide delivery.


    Ruozi, Barbara; Battini, Renata; Montanari, Monica; Mucci, Adele; Tosi, Giovanni; Forni, Flavio; Vandelli, Maria Angela


    The relatively hydrophilic bile acid, ursodeoxycholic acid (UDCA), was used as an additive to DOTAP cationic liposomes to evaluate the effect on the cellular uptake of an oligonucleotide. Nuclear magnetic resonance studies were applied to estimate the relative amount of incorporated UDCA into the lipidic bilayers. DOTAP or DOTAP-UDCA vesicles (MixVes; DOTAP/UDCA molar ratios 1:0.25, 1:0.5, 1:1, and 1:2) formed complexes with 5'-fluorescein conjugated 29-mer phosphorothioate oligonucleotides (PS-ODNs) and studied using gel electrophoresis. In addition, the complexes were tested after transfection to assess the cellular uptake and the localization of the oligo in a HaCaT cell line by the use of cytofluorimetric and confocal microscopic analysis. DOTAP lipid formulated in the presence of a defined amount of UDCA forms more stable, flexible, and active MixVes. In particular, the MixVes at 1:0.25 and 1:0.5 molar ratios increase and modify the cellular uptake of PS-ODNs if compared with DOTAP liposomes 3 hours after the transfection studies. Moreover, the in vitro data suggest that these new formulations are not toxic. PMID:17379164

  8. Dendritic nanoconjugates for intracellular delivery of neutral oligonucleotides

    NASA Astrophysics Data System (ADS)

    Ming, Xin; Wu, Lin; Carver, Kyle; Yuan, Ahu; Min, Yuanzeng


    Dendrimer-based gene delivery has been constrained by intrinsic toxicity and suboptimal nanostructure. Conjugation of neutral morpholino oligonucleotides (ONs) with PAMAM dendrimers resulted in neutral, uniform, and ultra-small (~10 nm) nanoconjugates. The nanoconjugates dramatically enhanced cellular delivery of the ONs in cancer cells. After release from the dendrimer in the cytosol, the ONs produced potent functional activity without causing significant cytotoxicity. When carrying an apoptosis-promoting ON, the nanoconjugates produced cancer cell killing directly. Thus, the dendritic nanoconjugates may provide an effective tool for delivering ONs to tumors and other diseased tissues.Dendrimer-based gene delivery has been constrained by intrinsic toxicity and suboptimal nanostructure. Conjugation of neutral morpholino oligonucleotides (ONs) with PAMAM dendrimers resulted in neutral, uniform, and ultra-small (~10 nm) nanoconjugates. The nanoconjugates dramatically enhanced cellular delivery of the ONs in cancer cells. After release from the dendrimer in the cytosol, the ONs produced potent functional activity without causing significant cytotoxicity. When carrying an apoptosis-promoting ON, the nanoconjugates produced cancer cell killing directly. Thus, the dendritic nanoconjugates may provide an effective tool for delivering ONs to tumors and other diseased tissues. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr01665g

  9. In vivo delivery of transcription factors with multifunctional oligonucleotides

    NASA Astrophysics Data System (ADS)

    Lee, Kunwoo; Rafi, Mohammad; Wang, Xiaojian; Aran, Kiana; Feng, Xuli; Lo Sterzo, Carlo; Tang, Richard; Lingampalli, Nithya; Kim, Hyun Jin; Murthy, Niren


    Therapeutics based on transcription factors have the potential to revolutionize medicine but have had limited clinical success as a consequence of delivery problems. The delivery of transcription factors is challenging because it requires the development of a delivery vehicle that can complex transcription factors, target cells and stimulate endosomal disruption, with minimal toxicity. Here, we present a multifunctional oligonucleotide, termed DARTs (DNA assembled recombinant transcription factors), which can deliver transcription factors with high efficiency in vivo. DARTs are composed of an oligonucleotide that contains a transcription-factor-binding sequence and hydrophobic membrane-disruptive chains that are masked by acid-cleavable galactose residues. DARTs have a unique molecular architecture, which allows them to bind transcription factors, trigger endocytosis in hepatocytes, and stimulate endosomal disruption. The DARTs have enhanced uptake in hepatocytes as a result of their galactose residues and can disrupt endosomes efficiently with minimal toxicity, because unmasking of their hydrophobic domains selectively occurs in the acidic environment of the endosome. We show that DARTs can deliver the transcription factor nuclear erythroid 2-related factor 2 (Nrf2) to the liver, catalyse the transcription of Nrf2 downstream genes, and rescue mice from acetaminophen-induced liver injury.

  10. Synthesis of 3'-, or 5'-, or internal methacrylamido-modified oligonucleotides


    Golova, Julia B.; Chernov, Boris K.


    New modifiers were synthesized for incorporation of a methacrylic function in 3'-, 5'- and internal positions of oligonucleotides during solid phase synthesis. A modifier was used for synthesis of 5'-methacrylated oligonucleotides for preparation of microarrays by a co-polymerization method.

  11. HELP (high efficiency liquid phase) new oligonucleotide synthesis on soluble polymeric support.


    Bonora, G M; Scremin, C L; Colonna, F P; Garbesi, A


    A simple, rapid and high-yielding method for the synthesis of oligonucleotides by the phosphotriesters approach is described. The use of polyethylene glycol (PEG) as soluble polymeric support preserves some convenient features of the solid-phase synthesis with new interesting advantages. Short oligonucleotides in hundred milligrams scale can be obtained from few grams of functionalized PEG. PMID:2356115

  12. HELP (high efficiency liquid phase) new oligonucleotide synthesis on soluble polymeric support.

    PubMed Central

    Bonora, G M; Scremin, C L; Colonna, F P; Garbesi, A


    A simple, rapid and high-yielding method for the synthesis of oligonucleotides by the phosphotriesters approach is described. The use of polyethylene glycol (PEG) as soluble polymeric support preserves some convenient features of the solid-phase synthesis with new interesting advantages. Short oligonucleotides in hundred milligrams scale can be obtained from few grams of functionalized PEG. PMID:2356115

  13. Nonenzymatic template-directed synthesis on hairpin oligonucleotides. II - Templates containing cytidine and guanosine residues

    NASA Technical Reports Server (NTRS)

    Wu, Taifeng; Orgel, Leslie E.


    Hairpin oligonucleotides were prepared with 5-prime-terminal single-stranded sequments containing cytidylate (C) and guanylate (G) residues. It was found that incubation of these hairpin oligonucleotides with a mixutre of cytidine and guanosine 5-prime-phosphoro (2-methyl)imidazolides results in sequence-specific addition of C and G residues to the 3-prime terminus of the hairpin.

  14. Stable dye-labelled oligonucleotide-nanoparticle conjugates for nucleic acid detection

    NASA Astrophysics Data System (ADS)

    Barrett, Lee; Dougan, Jennifer A.; Faulds, Karen; Graham, Duncan


    Metallic nanoparticles functionalized with oligonucleotides are used for a number of nucleic acid detection strategies. However, oligonucleotide-nanoparticle conjugates suffer from a lack of stability when exposed to certain conditions associated with DNA detection assays. In this study, we report the synthesis of thiol and thioctic acid-modified oligonucleotide gold nanoparticle (OGNs) conjugates functionalized with a dye label and varying spacer groups. The thioctic acid-modified conjugates exhibit increased stability when treated with dithiothreitol (DTT) compared to the more commonly used thiol modification. When the dye labelled oligonucleotide nanoparticle conjugates are exposed to the same conditions there is a pronounced increase in the stability for both thioctic acid and thiol modified sequences. These results open up the possibility of simply using a dye label to enhance the stability of oligonucleotide-nanoparticle conjugates in DNA detection assays where the enhanced stability of the conjugate system can be advantageous in more complex biological environments.

  15. Human transcriptome array for high-throughput clinical studies

    PubMed Central

    Xu, Weihong; Seok, Junhee; Mindrinos, Michael N.; Schweitzer, Anthony C.; Jiang, Hui; Wilhelmy, Julie; Clark, Tyson A.; Kapur, Karen; Xing, Yi; Faham, Malek; Storey, John D.; Moldawer, Lyle L.; Maier, Ronald V.; Tompkins, Ronald G.; Wong, Wing Hung; Davis, Ronald W.; Xiao, Wenzhong; Toner, Mehmet; Warren, H. Shaw; Schoenfeld, David A.; Rahme, Laurence; McDonald-Smith, Grace P.; Hayden, Douglas; Mason, Philip; Fagan, Shawn; Yu, Yong-Ming; Cobb, J. Perren; Remick, Daniel G.; Mannick, John A.; Lederer, James A.; Gamelli, Richard L.; Silver, Geoffrey M.; West, Michael A.; Shapiro, Michael B.; Smith, Richard; Camp, David G.; Qian, Weijun; Tibshirani, Rob; Lowry, Stephen; Calvano, Steven; Chaudry, Irshad; Cohen, Mitchell; Moore, Ernest E.; Johnson, Jeffrey; Baker, Henry V.; Efron, Philip A.; Balis, Ulysses G. J.; Billiar, Timothy R.; Ochoa, Juan B.; Sperry, Jason L.; Miller-Graziano, Carol L.; De, Asit K.; Bankey, Paul E.; Herndon, David N.; Finnerty, Celeste C.; Jeschke, Marc G.; Minei, Joseph P.; Arnoldo, Brett D.; Hunt, John L.; Horton, Jureta; Cobb, J. Perren; Brownstein, Bernard; Freeman, Bradley; Nathens, Avery B.; Cuschieri, Joseph; Gibran, Nicole; Klein, Matthew; O'Keefe, Grant


    A 6.9 million-feature oligonucleotide array of the human transcriptome [Glue Grant human transcriptome (GG-H array)] has been developed for high-throughput and cost-effective analyses in clinical studies. This array allows comprehensive examination of gene expression and genome-wide identification of alternative splicing as well as detection of coding SNPs and noncoding transcripts. The performance of the array was examined and compared with mRNA sequencing (RNA-Seq) results over multiple independent replicates of liver and muscle samples. Compared with RNA-Seq of 46 million uniquely mappable reads per replicate, the GG-H array is highly reproducible in estimating gene and exon abundance. Although both platforms detect similar expression changes at the gene level, the GG-H array is more sensitive at the exon level. Deeper sequencing is required to adequately cover low-abundance transcripts. The array has been implemented in a multicenter clinical program and has generated high-quality, reproducible data. Considering the clinical trial requirements of cost, sample availability, and throughput, the GG-H array has a wide range of applications. An emerging approach for large-scale clinical genomic studies is to first use RNA-Seq to the sufficient depth for the discovery of transcriptome elements relevant to the disease process followed by high-throughput and reliable screening of these elements on thousands of patient samples using custom-designed arrays. PMID:21317363

  16. Global Arrays

    SciTech Connect


    The Global Arrays (GA) toolkit provides an efficient and portable “shared-memory” programming interface for distributed-memory computers. Each process in a MIMD parallel program can asynchronously access logical blocks of physically distributed dense multi-dimensional arrays, without need for explicit cooperation by other processes. Unlike other shared-memory environments, the GA model exposes to the programmer the non-uniform memory access (NUMA) characteristics of the high performance computers and acknowledges that access to a remote portion of the shared data is slower than to the local portion. The locality information for the shared data is available, and a direct access to the local portions of shared data is provided. Global Arrays have been designed to complement rather than substitute for the message-passing programming model. The programmer is free to use both the shared-memory and message-passing paradigms in the same program, and to take advantage of existing message-passing software libraries. Global Arrays are compatible with the Message Passing Interface (MPI).

  17. Pacific Array

    NASA Astrophysics Data System (ADS)

    Kawakatsu, H.; Takeo, A.; Isse, T.; Nishida, K.; Shiobara, H.; Suetsugu, D.


    Based on our recent results on broadband ocean bottom seismometry, we propose a next generation large-scale array experiment in the ocean. Recent advances in ocean bottom broadband seismometry (e.g., Suetsugu & Shiobara, 2014, Annual Review EPS), together with advances in the seismic analysis methodology, have now enabled us to resolve the regional 1-D structure of the entire lithosphere/asthenosphere system, including seismic anisotropy (both radial and azimuthal), with deployments of ~10-15 broadband ocean bottom seismometers (BBOBSs) (namely "ocean-bottom broadband dispersion survey"; Takeo et al., 2013, JGR; Kawakatsu et al., 2013, AGU; Takeo, 2014, Ph.D. Thesis; Takeo et al., 2014, JpGU). Having ~15 BBOBSs as an array unit for 2-year deployment, and repeating such deployments in a leap-frog way (an array of arrays) for a decade or so would enable us to cover a large portion of the Pacific basin. Such efforts, not only by giving regional constraints on the 1-D structure, but also by sharing waveform data for global scale waveform tomography, would drastically increase our knowledge of how plate tectonics works on this planet, as well as how it worked for the past 150 million years. International collaborations might be sought.

  18. Global Arrays


    The Global Arrays (GA) toolkit provides an efficient and portable “shared-memory” programming interface for distributed-memory computers. Each process in a MIMD parallel program can asynchronously access logical blocks of physically distributed dense multi-dimensional arrays, without need for explicit cooperation by other processes. Unlike other shared-memory environments, the GA model exposes to the programmer the non-uniform memory access (NUMA) characteristics of the high performance computers and acknowledges that access to a remote portion of the sharedmore » data is slower than to the local portion. The locality information for the shared data is available, and a direct access to the local portions of shared data is provided. Global Arrays have been designed to complement rather than substitute for the message-passing programming model. The programmer is free to use both the shared-memory and message-passing paradigms in the same program, and to take advantage of existing message-passing software libraries. Global Arrays are compatible with the Message Passing Interface (MPI).« less

  19. Photolithographic Synthesis of High-Density DNA and RNA Arrays on Flexible, Transparent, and Easily Subdivided Plastic Substrates.


    Holden, Matthew T; Carter, Matthew C D; Wu, Cheng-Hsien; Wolfer, Jamison; Codner, Eric; Sussman, Michael R; Lynn, David M; Smith, Lloyd M


    The photolithographic fabrication of high-density DNA and RNA arrays on flexible and transparent plastic substrates is reported. The substrates are thin sheets of poly(ethylene terephthalate) (PET) coated with cross-linked polymer multilayers that present hydroxyl groups suitable for conventional phosphoramidite-based nucleic acid synthesis. We demonstrate that by modifying array synthesis procedures to accommodate the physical and chemical properties of these materials, it is possible to synthesize plastic-backed oligonucleotide arrays with feature sizes as small as 14 μm × 14 μm and feature densities in excess of 125 000/cm(2), similar to specifications attainable using rigid substrates such as glass or glassy carbon. These plastic-backed arrays are tolerant to a wide range of hybridization temperatures, and improved synthetic procedures are described that enable the fabrication of arrays with sequences up to 50 nucleotides in length. These arrays hybridize with S/N ratios comparable to those fabricated on otherwise identical arrays prepared on glass or glassy carbon. This platform supports the enzymatic synthesis of RNA arrays and proof-of-concept experiments are presented showing that the arrays can be readily subdivided into smaller arrays (or "millichips") using common laboratory-scale laser cutting tools. These results expand the utility of oligonucleotide arrays fabricated on plastic substrates and open the door to new applications for these important bioanalytical tools. PMID:26494264

  20. Recommendations for safety pharmacology evaluations of oligonucleotide-based therapeutics.


    Berman, Cindy L; Cannon, Keri; Cui, Yi; Kornbrust, Douglas J; Lagrutta, Armando; Sun, Sunny Z; Tepper, Jeff; Waldron, Gareth; Younis, Husam S


    This document was prepared by the Safety Pharmacology Subcommittee of the Oligonucleotide Safety Working Group (OSWG), a group of industry and regulatory scientists involved in the development and regulation of therapeutic oligonucleotides. The mission of the Subcommittee was to develop scientific recommendations for the industry regarding the appropriate scope and strategies for safety pharmacology evaluations of oligonucleotides (ONs). These recommendations are the consensus opinion of the Subcommittee and do not necessarily reflect the current expectations of regulatory authorities. 1) Safety pharmacology testing, as described in the International Conference on Harmonisation (ICH) S7 guidance, is as applicable to ONs as it is to small molecule drugs and biotherapeutics. 2) Study design considerations for ONs are similar to those for other classes of drugs. In general, as with other therapeutics, studies should evaluate the drug product administered via the clinical route. Species selection should ideally consider relevance of the model with regard to the endpoints of interest, pharmacological responsiveness, and continuity with the nonclinical development program. 3) Evaluation of potential effects in the core battery (cardiovascular, central nervous, and respiratory systems) is recommended. In general: a. In vitro human ether-a-go-go-related gene (hERG) testing does not provide any specific value and is not warranted. b. Emphasis should be placed on in vivo evaluation of cardiovascular function, typically in nonhuman primates (NHPs). c. Due to the low level of concern, neurologic and respiratory function can be assessed concurrently with cardiovascular safety pharmacology evaluation in NHPs, within repeat-dose toxicity studies, or as stand-alone studies. In the latter case, rodents are most commonly used. 4) Other dedicated safety pharmacology studies, beyond the core battery, may have limited value for ONs. Although ONs can accumulate in the kidney and liver

  1. Frequent oligonucleotides and peptides of the Haemophilus influenzae genome.

    PubMed Central

    Karlin, S; Mrázek, J; Campbell, A M


    The complete Haemophilus influenzae genome (1.83 Mb, Rd strain) provides opportunities for characterizing global genomic inhomogeneities and for detecting important sequence signals. Along these lines, new methods for identifying frequent words (oligonucleotides and/or peptides) and their distributions are applied to the H.influenzae genome with some comparisons and contrasts made with frequent words of other bacterial genomes. Three major classes of frequent oligonucleotides stand out: (i) oligos related to the familiar uptake signal sequences (USSs), AAGTGCGGT (USS+) and its inverted complement (USS-), (ii) multiple tetranucleotide iterations and (iii) intergenic dyad sequences (ISDs) found as AAGCCCACCCTAC and its dyad form. The USS+ and USS- occur in almost equal counts, are remarkably evenly spaced around the genome, and appear predominantly in the same reading frame of protein coding domains (USS+ translated to Ser-Ala-Val, USS- translated to Thr-Ala-Leu). These observations suggest that USSs contribute to global genomic functions, for example, in replication and/or repair processes, or as membrane attachment sites, or as sequences helping to pack DNA. The long tetranucleotide iterations, virtually unique to H.influenzae (i.e., unknown in other prokaryotes), through polymerase slippage during replication and/or homologous recombination may produce subpopulations expressing alternative proteins. The 13 bp frequent IDS words, invariably intergenic, occur mostly in clusters and provide potential for complex secondary structures suggesting that these sequences may be important signals for regulating the activity of their flanking genes. The frequent oligopeptides of H.influenzae are principally of two kinds--those induced by oligonucleotide frequent words (USSs, tetranucleotide iterations), and those associated with ATP or GTP binding sites that are generally composed of three motifs: the A-box which contributes to delineating the binding pocket; the B-box which

  2. Comparison of Nanostring nCounter® Data on FFPE Colon Cancer Samples and Affymetrix Microarray Data on Matched Frozen Tissues

    PubMed Central

    Chen, Xi; Deane, Natasha G.; Lewis, Keeli B.; Li, Jiang; Zhu, Jing; Washington, M. Kay; Beauchamp, R. Daniel


    The prognosis of colorectal cancer (CRC) stage II and III patients remains a challenge due to the difficulties of finding robust biomarkers suitable for testing clinical samples. The majority of published gene signatures of CRC have been generated on fresh frozen colorectal tissues. Because collection of frozen tissue is not practical for routine surgical pathology practice, a clinical test that improves prognostic capabilities beyond standard pathological staging of colon cancer will need to be designed for formalin-fixed paraffin-embedded (FFPE) tissues. The NanoString nCounter® platform is a gene expression analysis tool developed for use with FFPE-derived samples. We designed a custom nCounter® codeset based on elements from multiple published fresh frozen tissue microarray-based prognostic gene signatures for colon cancer, and we used this platform to systematically compare gene expression data from FFPE with matched microarray array data from frozen tissues. Our results show moderate correlation of gene expression between two platforms and discovery of a small subset of genes as candidate biomarkers for colon cancer prognosis that are detectable and quantifiable in FFPE tissue sections. PMID:27176004

  3. Carbon Nanotube Nanoelectrode Array for Ultrasensitive DNA Detection

    NASA Technical Reports Server (NTRS)

    Li, Jun; Koehne, Jessica; Chen, Hua; Cassell, Alan; Ng, Hou Tee; Fan, Wendy; Ye, Qi; Han, Jie; Meyyappan, M.


    A reliable nanoelectrode array based on vertically aligned multi-walled carbon nanotubes (MWNTs) embedded in SiO2 is used for ultrasensitive DNA detection. Characteristic nanoelectrode behavior is observed using low-density MWNT arrays for measuring both bulk and surface immobilized redox species such as K4Fe(CN)6. The open-end of MWNTs present similar properties as graphite edge-plane electrodes with wide potential window, flexible chemical functionalities, and good biocompatibility. Oligonucleotide probes are selectively functionalized at the open ends cf the nanotube array and specifically hybridized with oligonucleotide targets. The guanine groups are employed as the signal moieties in the electrochemical measurements. Ru(bpy)3(2+) mediator is used to further amplify the guanine oxidation signal. The hybridization of subattomoles of PCR amplified DNA targets is detected electrochemically by combining the MWNT nanoelectrode array with the Ru(bpy)32' amplification mechanism. This system provides a general platform of molecular diagnostics for applications requiring ultrahigh sensitivity, high-degree of miniaturization, and simple sample preparations.

  4. L-DNAs as potential antimessenger oligonucleotides: a reassessment.


    Garbesi, A; Capobianco, M L; Colonna, F P; Tondelli, L; Arcamone, F; Manzini, G; Hilbers, C W; Aelen, J M; Blommers, M J


    Unnatural L-2'-deoxyribonucleosides L-T, L-dC, L-dA and L-dG were prepared from L-arabinose and assembled, by solution or solid phase synthesis, to give L-oligonucleotides (L-DNAs), which contain all four natural bases. The affinity of these modified oligomers for complementary D-ribo- and D-deoxyribo-oligomers was studied with NMR, UV and CD spectroscopies and mobility shift assay on native PAGE. All experimental results indicate that L-DNAs do not, in general, recognize single-stranded, natural DNA and RNA. Hence, contrary to previous suggestions, it is not possible to envisage their use as wide scope antimessenger agents in the selective control of gene expression. PMID:8414968

  5. L-DNAs as potential antimessenger oligonucleotides: a reassessment.

    PubMed Central

    Garbesi, A; Capobianco, M L; Colonna, F P; Tondelli, L; Arcamone, F; Manzini, G; Hilbers, C W; Aelen, J M; Blommers, M J


    Unnatural L-2'-deoxyribonucleosides L-T, L-dC, L-dA and L-dG were prepared from L-arabinose and assembled, by solution or solid phase synthesis, to give L-oligonucleotides (L-DNAs), which contain all four natural bases. The affinity of these modified oligomers for complementary D-ribo- and D-deoxyribo-oligomers was studied with NMR, UV and CD spectroscopies and mobility shift assay on native PAGE. All experimental results indicate that L-DNAs do not, in general, recognize single-stranded, natural DNA and RNA. Hence, contrary to previous suggestions, it is not possible to envisage their use as wide scope antimessenger agents in the selective control of gene expression. Images PMID:8414968

  6. Synthesis of oligonucleotides on cellulose by a phosphotriester method.

    PubMed Central

    Crea, R; Horn, T


    The synthesis of oligothymidilic acids, (dT)m (where m = 4, 7, 10, 13, 16, 19, 22, and 25), was carried out using a solid phase approach in combination with the modified phosphotriester methodology developed in solution. Cellulose was used as the solid support after its functionalization with a specially featured dinucleoside diphosphate, 5'-0-p-chlorophenylphospho-2'(3')-0-acetyluridilyl-[2'(3')-3']-5'-0-dimethoxytritylthymidine p-chlorophenylester. The fully protected trideoxynucleoside triphosphate containing only thymidine was repeatedly used to elongate the oligonucleotide chain in the 3'-5' direction. Individual coupling yields ranged from 45% to 75%. The total time needed to prepare (dT)25 was four days. Similarly, the tridecanucleotide d(AGAAGGTACTTTT) was synthesized in good yield. The results show that this approach can be used for a fast and economic way to synthesize oligodeoxynucleotides. Images PMID:7433092

  7. [Research progress of probe design software of oligonucleotide microarrays].


    Chen, Xi; Wu, Zaoquan; Liu, Zhengchun


    DNA microarray has become an essential medical genetic diagnostic tool for its high-throughput, miniaturization and automation. The design and selection of oligonucleotide probes are critical for preparing gene chips with high quality. Several sets of probe design software have been developed and are available to perform this work now. Every set of the software aims to different target sequences and shows different advantages and limitations. In this article, the research and development of these sets of software are reviewed in line with three main criteria, including specificity, sensitivity and melting temperature (Tm). In addition, based on the experimental results from literatures, these sets of software are classified according to their applications. This review will be helpful for users to choose an appropriate probe-design software. It will also reduce the costs of microarrays, improve the application efficiency of microarrays, and promote both the research and development (R&D) and commercialization of high-performance probe design software. PMID:24804514

  8. Efficient site-directed saturation mutagenesis using degenerate oligonucleotides.


    Steffens, David L; Williams, John G K


    We describe a reliable protocol for constructing single-site saturation mutagenesis libraries consisting of all 20 naturally occurring amino acids at a specific site within a protein. Such libraries are useful for structure-function studies and directed evolution. This protocol extends the utility of Stratagene's QuikChange Site-Directed Mutagenesis Kit, which is primarily recommended for single amino acid substitutions. Two complementary primers are synthesized, containing a degenerate mixture of the four bases at the three positions of the selected codon. These primers are added to starting plasmid template and thermal cycled to produce mutant DNA molecules, which are subsequently transformed into competent bacteria. The protocol does not require purification of mutagenic oligonucleotides or PCR products. This reduces both the cost and turnaround time in high-throughput directed evolution applications. We have utilized this protocol to generate over 200 site-saturation libraries in a DNA polymerase, with a success rate of greater than 95%. PMID:17595310

  9. Oligonucleotide synthesis catalyzed by the Zn/2+/ ion

    NASA Technical Reports Server (NTRS)

    Sawai, H.; Orgel, L. E.


    Results of experiments are reported in which Zn(2+) ion catalyzed the formation of oligonucleotides from nucleoside phosphorimidazolides in aqueous solution, even in the absence of a template. Specifically, the imidazolides (ImpU or ImpA) polymerized to form ImpApA, and pApA, pApApA, and pApApApA, or the analogous uracil compounds. In addition, the expected hydrolysis products of the hydrolysis of ImpA were formed (pA, imidazole). Judging from the ratio of pA(n) over pA (with and without zinc ion), this ion increased the efficiency of phosphodiester-bond formation by up to 10 times. Possible mechanisms for the reaction are tentatively proposed.

  10. Computer simulation in template-directed oligonucleotide synthesis

    NASA Technical Reports Server (NTRS)

    Kanavarioti, Anastassia; Benasconi, Claude F.


    It is commonly assumed that template-directed polymerizations have played a key role in prebiotic evolution. A computer simulation that models up to 33 competing reactions was used to investigate the product distribution in a template-directed oligonucleotide synthesis as a function of time and concentration of the reactants. The study focuses on the poly(C)-directed elongation reaction of oligoguanylates, and how it is affected by the competing processes of hydrolysis and dimerization of the activated monomer, which have the potential of severely curtailing the elongation and reducing the size and yield of the synthesized polymers. The simulations show that realistic and probably prebiotically plausible conditions can be found where hydrolysis and dimerization are either negligible or where a high degree of polymerization can be attained even in the face of substantial hydrolysis and/or dimerization.

  11. Insights to primitive replication derived from structures of small oligonucleotides

    NASA Technical Reports Server (NTRS)

    Smith, G. K.; Fox, G. E.


    Available information on the structure of small oligonucleotides is surveyed. It is observed that even small oligomers typically exhibit defined structures over a wide range of pH and temperature. These structures rely on a plethora of non-standard base-base interactions in addition to the traditional Watson-Crick pairings. Stable duplexes, though typically antiparallel, can be parallel or staggered and perfect complementarity is not essential. These results imply that primitive template directed reactions do not require high fidelity. Hence, the extensive use of Watson-Crick complementarity in genes rather than being a direct consequence of the primitive condensation process, may instead reflect subsequent selection based on the advantage of accuracy in maintaining the primitive genetic machinery once it arose.

  12. DNA Oligonucleotide Fragment Ion Rearrangements Upon Collision-Induced Dissociation

    NASA Astrophysics Data System (ADS)

    Harper, Brett; Neumann, Elizabeth K.; Solouki, Touradj


    Collision-induced dissociation (CID) of m/z-isolated w type fragment ions and an intact 5' phosphorylated DNA oligonucleotide generated rearranged product ions. Of the 21 studied w ions of various nucleotide sequences, fragment ion sizes, and charge states, 18 (~86%) generated rearranged product ions upon CID in a Synapt G2-S HDMS (Waters Corporation, Manchester, England, UK) ion mobility-mass spectrometer. Mass spectrometry (MS), ion mobility spectrometry (IMS), and theoretical modeling data suggest that purine bases can attack the free 5' phosphate group in w type ions and 5' phosphorylated DNA to generate sequence permuted [phosphopurine]- fragment ions. We propose and discuss a potential mechanism for generation of rearranged [phosphopurine]- and complementary y-B type product ions.

  13. Stereospecificity of Oligonucleotide Interactions Revisited: No Evidence for Heterochiral Hybridization and Ribozyme/DNAzyme Activity

    PubMed Central

    Hoehlig, Kai; Bethge, Lucas; Klussmann, Sven


    A major challenge for the application of RNA- or DNA-oligonucleotides in biotechnology and molecular medicine is their susceptibility to abundant nucleases. One intriguing possibility to tackle this problem is the use of mirror-image (l-)oligonucleotides. For aptamers, this concept has successfully been applied to even develop therapeutic agents, so-called Spiegelmers. However, for technologies depending on RNA/RNA or RNA/DNA hybridization, like antisense or RNA interference, it has not been possible to use mirror-image oligonucleotides because Watson-Crick base pairing of complementary strands is (thought to be) stereospecific. Many scientists consider this a general principle if not a dogma. A recent publication proposing heterochiral Watson-Crick base pairing and sequence-specific hydrolysis of natural RNA by mirror-image ribozymes or DNAzymes (and vice versa) prompted us to systematically revisit the stereospecificity of oligonucleotides hybridization and catalytic activity. Using hyperchromicity measurements we demonstrate that hybridization only occurs among homochiral anti-parallel complementary oligonucleotide strands. As expected, achiral PNA hybridizes to RNA and DNA irrespective of their chirality. In functional assays we could not confirm an alleged heterochiral hydrolytic activity of ribozymes or DNAzymes. Our results confirm a strict stereospecificity of oligonucleotide hybridization and clearly argue against the possibility to use mirror-image oligonucleotides for gene silencing or antisense applications. PMID:25679211

  14. Enzymatic synthesis of modified oligonucleotides by PEAR using Phusion and KOD DNA polymerases.


    Wang, Xuxiang; Zhang, Jianye; Li, Yingjia; Chen, Gang; Wang, Xiaolong


    Antisense synthetic oligonucleotides have been developed as potential gene-targeted therapeutics. We previously reported polymerase-endonuclease amplification reaction (PEAR) for amplification of natural and 5'-O-(1-thiotriphosphate) (S)-modified oligonucleotides. Here, we extended the PEAR technique for enzymatic preparation of 2'-deoxy-2'-fluoro-(2'-F) and 2'-F/S double-modified oligonucleotides. The result showed that KOD and Phusion DNA polymerase could synthesize oligonucleotides with one or two modified nucleotides, and KOD DNA polymerase is more suitable than Phusion DNA polymerase for PEAR amplification of 2'-F and 2'-F/S double modified oligonucleotides. The composition of PEAR products were analyzed by electrospray ionization liquid chromatography mass spectrometry (ESI/LC/MS) detection and showed that the sequence of the PEAR products are maintained at an extremely high accuracy (>99.9%), and after digestion the area percent of full-length modified oligonucleotides reaches 89.24%. PEAR is suitable for synthesis of modified oligonucleotides efficiently and with high purity. PMID:25517220

  15. Oligonucleotides Designed to Inhibit TLR9 Block Herpes Simplex Virus type 1 Infection at Multiple Steps

    PubMed Central

    Sauter, Monica M.; Gauger, Joshua J. L.; Brandt, Curtis R.


    Herpes simplex virus type 1 (HSV-1) is an important human pathogen which requires activation of nuclear factor–kappa B (NFκB) during its replication cycle. The persistent nature of HSV-1 infection, and the emergence of drug-resistant strains, highlights the importance of research to develop new antiviral agents. Toll-like receptors (TLR) play a prominent role during the early antiviral response by recognizing viral nucleic acid and gene products, activating NFκB, and stimulating the production of inflammatory cytokines. We demonstrate a significant effect on HSV-1 replication in ARPE-19 and Vero cells when oligonucleotides designed to inhibit TLR9 are added 2 hours prior to infection. A greater than 90% reduction in the yield of infectious virus was achieved at oligonucleotide concentrations of 10 to 20 micromolar. TLR9 inhibitory oligonucleotides prevented expression of essential immediate early herpes gene products as determined by immunofluorescence microscopy and Western blotting. TLR9 oligonucleotides also interfered with viral attachment and entry. A TLR9 inhibitory oligonucleotide containing five adjacent guanosine residues (G-ODN) exhibited virucidal activity and inhibited HSV-1 replication when added post-infection. The antiviral effect of the TLR9 inhibitory oligonucleotides did not depend on the presence of TLR9 protein, suggesting a mechanism of inhibition that is not TLR9 specific. TLR9 inhibitory oligonucleotides also reduced NFκB activity in nuclear extracts. Studies using these TLR inhibitors in the context of viral infection should be interpreted with caution. PMID:24995383

  16. 2′-Fluoro-modified phosphorothioate oligonucleotide can cause rapid degradation of P54nrb and PSF

    PubMed Central

    Shen, Wen; Liang, Xue-hai; Sun, Hong; Crooke, Stanley T.


    Synthetic oligonucleotides are used to regulate gene expression through different mechanisms. Chemical modifications of the backbone of the nucleic acid and/or of the 2′ moiety of the ribose can increase nuclease stability and/or binding affinity of oligonucleotides to target molecules. Here we report that transfection of 2′-F-modified phosphorothioate oligonucleotides into cells can reduce the levels of P54nrb and PSF proteins through proteasome-mediated degradation. Such deleterious effects of 2′-F-modified oligonucleotides were observed in different cell types from different species, and were independent of oligonucleotide sequence, positions of the 2′-F-modified nucleotides in the oligonucleotides, method of delivery or mechanism of action of the oligonucleotides. Four 2′-F-modified nucleotides were sufficient to cause the protein reduction. P54nrb and PSF belong to Drosophila behavior/human splicing (DBHS) family. The third member of the family, PSPC1, was also reduced by the 2′-F-modified oligonucleotides. Preferential association of 2′-F-modified oligonucleotides with P54nrb was observed, which is partially responsible for the protein reduction. Consistent with the role of DBHS proteins in double-strand DNA break (DSB) repair, elevated DSBs were observed in cells treated with 2′-F-modified oligonucleotides, which contributed to severe impairment in cell proliferation. These results suggest that oligonucleotides with 2′-F modifications can cause non-specific loss of cellular protein(s). PMID:25855809

  17. Synthetic Method for Oligonucleotide Block by Using Alkyl-Chain-Soluble Support.


    Matsuno, Yuki; Shoji, Takao; Kim, Shokaku; Chiba, Kazuhiro


    A straightforward method for the synthesis of oligonucleotide blocks using a Cbz-type alkyl-chain-soluble support (Z-ACSS) attached to the 3'-OH group of 3'-terminal nucleosides was developed. The Z-ACSS allowed for the preparation of fully protected deoxyribo- and ribo-oligonucleotides without chromatographic purification and released dimer- to tetramer-size oligonucleotide blocks via hydrogenation using a Pd/C catalyst without significant loss or migration of protective groups such as 5'-end 4,4'-dimethoxtrityl, 2-cyanoethyl on internucleotide bonds, or 2'-TBS. PMID:26845521

  18. The Use of Gel Electrophoresis to Study the Reactions of Activated Amino Acids with Oligonucleotides

    NASA Technical Reports Server (NTRS)

    Zieboll, Gerhard; Orgel, Leslie E.


    We have used gel electrophoresis to study the primary covalent addition of amino acids to oligonu-cleotides or their analogs and the subsequent addition of further molecules of the amino acids to generate peptides covalently linked to the oligonucleotides. We have surveyed the reactions of a variety of amino acids with the phosphoramidates derived from oligonucleotide 5 inches phosphates and ethylenediamine. We find that arginine and amino acids can interact with oligonucleotidesl through stacking interactions react most efficiently. D- and L-amino acids give indistinguishable families of products.

  19. Antisense c-myb oligonucleotides inhibit intimal arterial smooth muscle cell accumulation in vivo

    NASA Astrophysics Data System (ADS)

    Simons, Michael; Edelman, Elazer R.; Dekeyser, Jean-Luc; Langer, Robert; Rosenberg, Robert D.


    SYNTHETIC antisense oligonucleotides have been used to dissect gene function in vitro. Technical difficulties prevented the use of this approach for investigating the effect of gene products in vivo. Here we report the use of local delivery of antisense c-myb oligonu-cleotide to suppress intimal accumulation of rat carotid arterial smooth muscle cells. Our results suggest that antisense oligonucleotides can be used to define the in vivo biological role of specific macromolecules in the blood vessel wall and could potentially serve as a new class of therapeutic agents for cardiovascular disorders.

  20. Method for promoting specific alignment of short oligonucleotides on nucleic acids


    Studier, F. William; Kieleczawa, Jan; Dunn, John J.


    Disclosed is a method for promoting specific alignment of short oligonucleotides on a nucleic acid polymer. The nucleic acid polymer is incubated in a solution containing a single-stranded DNA-binding protein and a plurality of oligonucleotides which are perfectly complementary to distinct but adjacent regions of a predetermined contiguous nucleotide sequence in the nucleic acid polymer. The plurality of oligonucleotides anneal to the nucleic acid polymer to form a contiguous region of double stranded nucleic acid. Specific application of the methods disclosed include priming DNA synthesis and template-directed ligation.

  1. Development of the catfish 250K SNP array for genome-wide association studies

    PubMed Central


    Background Quantitative traits, such as disease resistance, are most often controlled by a set of genes involving a complex array of regulation. The dissection of genetic basis of quantitative traits requires large numbers of genetic markers with good genome coverage. The application of next-generation sequencing technologies has allowed discovery of over eight million SNPs in catfish, but the challenge remains as to how to efficiently and economically use such SNP resources for genetic analysis. Results In this work, we developed a catfish 250K SNP array using Affymetrix Axiom genotyping technology. The SNPs were obtained from multiple sources including gene-associated SNPs, anonymous genomic SNPs, and inter-specific SNPs. A set of 640K high-quality SNPs obtained following specific requirements of array design were submitted. A panel of 250,113 SNPs was finalized for inclusion on the array. The performance evaluated by genotyping individuals from wild populations and backcross families suggested the good utility of the catfish 250K SNP array. Conclusions This is the first high-density SNP array for catfish. The array should be a valuable resource for genome-wide association studies (GWAS), fine QTL mapping, high-density linkage map construction, haplotype analysis, and whole genome-based selection. PMID:24618043

  2. Comparative Analysis of Human Conjunctival and Corneal Epithelial Gene Expression with Oligonucleotide Microarrays

    PubMed Central

    Turner, Helen C.; Budak, Murat T.; Murat Akinci, M. A.; Wolosin, J. Mario


    Purpose To determine global mRNA expression levels in corneal and conjunctival epithelia and identify transcripts that exhibit preferential tissue expression. Methods cDNA samples derived from human conjunctival and corneal epithelia were hybridized in three independent experiments to a commercial oligonucleotide array representing more than 22,000 transcripts. The resultant signal intensities and microarray software transcript present/absent calls were used in conjunction with the local pooled error (LPE) statistical method to identify transcripts that are preferentially or exclusively expressed in one of the two tissues at significant levels (expression >1% of the β-actin level). EASE (Expression Analysis Systematic Explorer software) was used to identify biological systems comparatively overrepresented in either epithelium. Immuno-, and cytohistochemistry was performed to validate or expand on selected results of interest. Results The analysis identified 332 preferential and 93 exclusive significant corneal epithelial transcripts. The corresponding numbers of conjunctival epithelium transcripts were 592 and 211, respectively. The overrepresented biological processes in the cornea were related to cell adhesion and oxiredox equilibria and cytoprotection activities. In the conjunctiva, the biological processes that were most prominent were related to innate immunity and melanogenesis. Immunohistochemistry for antigen-presenting cells and melanocytes was consistent with these gene signatures. The transcript comparison identified a substantial number of genes that have either not been identified previously or are not known to be highly expressed in these two epithelia, including testican-1, ECM1, formin, CRTAC1, and NQO1 in the cornea and, in the conjunctiva, sPLA2-IIA, lipocalin 2, IGFBP3, multiple MCH class II proteins, and the Na-Pi cotransporter type IIb. Conclusions Comparative gene expression profiling leads to the identification of many biological processes

  3. Carboranyl Nucleosides & Oligonucleotides for Neutron Capture Therapy Final Report

    SciTech Connect

    Schinazi, Raymond F.


    This proposal enabled us to synthesize and develop boron-rich nucleosides and oligonucleotide analogues for boron neutron capture therapy (BNCT) and the treatment of various malignancies. First, we determined the relationship between structure, cellular accumulation and tissue distribution of 5-o-carboranyl-2'-deoxyuridine (D-CDU) and its derivatives D-ribo-CU and 5-o-carboranyluracil (CU), to potentially target brain and other solid tumors for neutron capture therapy. Synthesized carborane containing nucleoside derivatives of CDU, D- and L-enantiomers of CDU, D-ribo-CU and CU were used. We measured tissue disposition in xenografted mice bearing 9479 human prostate tumors xenografts and in rats bearing 9L gliosarcoma isografts in their flanks and intracranially. The accumulation of D-CDU, 1-({beta}-L-arabinosyl)-5-o-carboranyluracil, D-ribo-CU, and CU were also studied in LnCap human prostate tumor cells and their retention was measured in male nude mice bearing LnCap and 9479 human prostate tumor xenografts. D-CDU, D-ribo-CU and CU levels were measured after administration in mice bearing 9479 human prostate tumors in their flanks. D-CDU achieved high cellular concentrations in LnCap cells and up to 2.5% of the total cellular compound was recovered in the 5'-monophosphorylated form. D-CDU cellular concentrations were similar in LnCap and 9479 tumor xenografts. Studies in tumor bearing animals indicated that increasing the number of hydroxyl moieties in the sugar constituent of the carboranyl nucleosides lead to increased rate and extent of renal elimination, a decrease in serum half-lives and an increased tissue specificity. Tumor/brain ratios were greatest for CDU and D-ribo-CU, while tumor/prostate ratios were greatest with CU. CDU and D-ribo-CU have potential for BNCT of brain malignancies, while CU may be further developed for prostate cancer. A method was developed for the solid phase synthesis of oligonucleotides containing (ocarboran-1-yl

  4. The Fidelity of Template-Directed Oligonucleotide Ligation and the Inevitability of Polymerase Function

    NASA Astrophysics Data System (ADS)

    James, Kenneth D.; Ellington, Andrew D.


    The first living systems may have employed template-directed oligonucleotide ligation for replication. The utility of oligonucleotide ligation as a mechanism for the origin and evolution of life is in part dependent on its fidelity. We have devised a method for evaluating ligation fidelity in which ligation substrates are selected from random sequence libraries. The fidelities of chemical and enzymatic ligation are compared under a variety of conditions. While reaction conditions can be found that promote high fidelity copying, departure from these conditions leads to error-prone copying. In particular, ligation reactions with shorter oligonucleotide substrates are less efficient but more faithful. These results support a model for origins in which there was selective pressure for template-directed oligonucleotide ligation to be gradually supplanted by mononucleotide polymerization.

  5. On-line coupling of capillary gel electrophoresis with electrospray mass spectrometry for oligonucleotide analysis.


    Freudemann, T; von Brocke, A; Bayer, E


    Homooligodeoxyribonucleotides differing one nucleotide in length from 12- to 15-mer and from 17- to 20-mer were separated by size with capillary gel electrophoresis (CGE) using an entangled polymer solution in coated capillaries. The resolved components were analyzed by on-line coupling of CGE with electrospray mass spectrometry (ES-MS), denoted as CGE/ES-MS, in the full-scan negative ion detection mode. Baseline separation was achieved for the 12-15-mer oligonucleotide mixtures. Both synthetic phosphodiester oligonucleotide mixtures as well as their phosphorothioate analogues, serving as model compounds for antisense oligonucleotides, could be analyzed by on-line CGE/ES-MS coupling. Terminally phosphorylated and nonphosphorylated synthetic failure sequences could be electrophoretically separated and mass spectrometically characterized as well. This methodology might be a useful tool for synthesis control of phosphodiester oligonucleotides as well as for analysis of phosphorothioate analogues as they are used in antisense drug development. PMID:11403304

  6. Synthesis and thermodynamics of oligonucleotides containing chirally pure R(P) methylphosphonate linkages.

    PubMed Central

    Reynolds, M A; Hogrefe, R I; Jaeger, J A; Schwartz, D A; Riley, T A; Marvin, W B; Daily, W J; Vaghefi, M M; Beck, T A; Knowles, S K; Klem, R E; Arnold, L J


    Methylphosphonate (MP) oligodeoxynucleotides (MPOs) are metabolically stable analogs of conventional DNA containing a methyl group in place of one of the non-bonding phosphoryl oxygens. All 16 possible chiral R(P) MP dinucleotides were synthesized and derivatized for automated oligonucleotide synthesis. These dimer synthons can be used to prepare (i) all-MP linked oligonucleotides having defined R(P) chirality at every other position (R(P) chirally enriched MPOs) or (ii) alternating R(P) MP/phosphodiester backbone oligonucleotides, depending on the composition of the 3'-coupling group. Chirally pure dimer synthons were also prepared with 2'-O-methyl sugar modifications. Oligonucleotides prepared with these R(P) chiral methylphosphonate linkage synthons bind RNA with significantly higher affinity than racemic MPOs. PMID:8948653

  7. Use of synthetic oligonucleotides for genomic DNA dot hybridization to split the DQw3 haplotype.

    PubMed Central

    Martell, M; Le Gall, I; Millasseau, P; Dausset, J; Cohen, D


    Comparison of two different HLA-DQ beta gene sequences from two DR4 individuals, probably corresponding to DQw3.2 (DQR4) and DQw3.1 (DQR5) specificities, has shown several nucleotide variations. Eight oligonucleotides (24 bases long), derived from these polymorphic areas, have been synthesized. Each oligonucleotide was hybridized to BamHI-digested DNA samples from eight families with HLA-DR4 individuals. Four polymorphic BamHI fragments were detected. Two of eight oligonucleotides gave a single signal (8.9 kilobases) on DQw3.2-positive haplotypes. We used one of these oligonucleotides in a genomic DNA dot hybridization and detected a hybridization signal only in DQw3.2-positive individuals. A very simple test like this allows the screening of a large population sample within a very short period. Images PMID:2895927

  8. Sequence identity of the n-1 product of a synthetic oligonucleotide.

    PubMed Central

    Temsamani, J; Kubert, M; Agrawal, S


    After synthesis and purification of an oligonucleotide, the final product usually contains a low level of n-1 congeneric species. We have sequenced the n-1 population of a 25mer phosphodiester oligonucleotide. The n-1 band was cut from the gel and eluted. Oligonucleotides were tailed with dA and annealed to a dT-tailed plasmid. The recombinant plasmid was ligated and used to transform competent bacteria. Our results show that the n-1 population was heterogeneous. The frequency of truncated nucleotides at the 3'-end was much higher than at the 5'-end of the oligomer. No truncated nucleotides were found in the last four nucleotides at the 5'-end. Our results also show that the chain of oligonucleotides can grow on unreacted sites of a controlled-pore glass support. Images PMID:7596808

  9. Complexes of carbon nanotubes with oligonucleotides in thin Langmuir-Blodgett films to detect electrochemically hybridization

    NASA Astrophysics Data System (ADS)

    Egorov, A. S.; Egorova, V. P.; Krylova, H. V.; Lipnevich, I. V.; Orekhovskaya, T. I.; Veligura, A. A.; Govorov, M. I.; Shulitsky, B. G.


    Self-assembled complexes consisting of thin multi-walled carbon nanotubes (MWCNTs) and DNA-oligonucleotides which are able to a cooperative binding to complementary oligonucleotides have been investigated. It was establised a high-performance charge transport in nanostructured Langmuir-Blodgett complexes thin MWCNTs/DNA. A method to electrochemically detect DNA hybridization on the self-organized structures has been proposed.

  10. Cationic nanoemulsion as a delivery system for oligonucleotides targeting malarial topoisomerase II.


    Bruxel, F; Cojean, S; Bochot, A; Teixeira, H; Bories, C; Loiseau, P-M; Fattal, E


    A promising strategy based on the antisense oligonucleotides against the Plasmodium falciparum topoisomerase II has been considered using cationic nanoemulsion as oligonucleotide delivery system. Phosphodiester and chemically modified phosphorothioate oligonucleotides bearing negative charges were adsorbed on positively charged emulsion composed of medium chain triglycerides, egg lecithin, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), and water, at different +/- charge ratios (positive charges from cationic lipid/negative charges from oligonucleotide): +0.5/-, +2/-, +4/- and +6/-. The physicochemical properties of the complexes were determined, as well as their stability in culture medium. Their interaction with erythrocytes through hemolysis, binding experiments and confocal microscopy were also evaluated. Finally, the in vitro evaluation of parasite growth and reinfection capacity was performed. The overall results showed that antisense oligonucleotides against P. falciparum topoisomerase II gene can be efficiently adsorbed onto a cationic nanoemulsion forming complexes. Whereas unloaded nanoemulsion displayed an hemolytic effect due to the presence of the cationic lipid, this was not the case of loaded nanoemulsion at low +/- ratios. Oligonucleotide-loaded nanoemulsions were found to be located inside the infected erythrocytes, inhibiting efficiently parasite growth (until 80%) and causing a delay in P. falciparum life cycle. PMID:21291974

  11. Fragment-based solid-phase assembly of oligonucleotide conjugates with peptide and polyethylene glycol ligands.


    Dirin, Mehrdad; Urban, Ernst; Noe, Christian R; Winkler, Johannes


    Ligand conjugation to oligonucleotides is an attractive strategy for enhancing the therapeutic potential of antisense and siRNA agents by inferring properties such as improved cellular uptake or better pharmacokinetic properties. Disulfide linkages enable dissociation of ligands and oligonucleotides in reducing environments found in endosomal compartments after cellular uptake. Solution-phase fragment coupling procedures for producing oligonucleotide conjugates are often tedious, produce moderate yields and reaction byproducts are frequently difficult to remove. We have developed an improved method for solid-phase coupling of ligands to oligonucleotides via disulfides directly after solid-phase synthesis. A 2'-thiol introduced using a modified nucleotide building block was orthogonally deprotected on the controlled pore glass solid support with N-butylphosphine. Oligolysine peptides and a short monodisperse ethylene glycol chain were successfully coupled to the deprotected thiol. Cleavage from the resin and full removal of oligonucleotide protection groups were achieved using methanolic ammonia. After standard desalting, and without further purification, homogenous conjugates were obtained as demonstrated by HPLC, gel electrophoresis, and mass spectrometry. The attachment of both amphiphilic and cationic ligands proves the versatility of the conjugation procedure. An antisense oligonucleotide conjugate with hexalysine showed pronounced gene silencing in a cell culture tumor model in the absence of a transfection reagent and the corresponding ethylene glycol conjugate resulted in down regulation of the target gene to nearly 50% after naked application. PMID:27236069

  12. In vitro characterization of two novel biodegradable vectors for the delivery of radiolabeled antisense oligonucleotides.


    von Guggenberg, Elisabeth; Shahhosseini, Soraya; Koslowsky, Ingrid; Lavasanifar, Afsaneh; Murray, David; Mercer, John


    The development of antisense oligonucleotides suitable for tumor targeting applications is hindered by low stability and bioavailability of oligonucleotides in vivo and by the absence of efficient and safe vectors for oligonucleotide delivery. Stabilization in vivo has been achieved through chemical modification of oligonucleotides by various means, but effective approaches to enhance their intracellular delivery are lacking. This study reports on the characterization in vitro of a fully phosphorothioated 20-mer oligonucleotide, complementary to p21 mRNA, radiolabeled with fluorine-18 using a thiol reactive prosthetic group. The potential of two novel synthetic block copolymers containing grafted polyamines on their hydrophobic blocks for vector-assisted cell delivery was studied in vitro. Extensive cellular uptake studies were performed in human colon carcinoma cell lines with enhanced or deficient p21 expression to evaluate and compare the uptake mechanism of naked and vectorized radiolabeled formulations. Uptake studies with the two novel biodegradable vectors showed a moderate increase in cell uptake of the radiofluorinated antisense oligonucleotide. The two vectors show, however, promising advantages over conventional lipidic vectors regarding their biocompatibility and subcellular distribution. PMID:21204767

  13. Peptide nanoparticle delivery of charge-neutral splice-switching morpholino oligonucleotides.


    Järver, Peter; Zaghloul, Eman M; Arzumanov, Andrey A; Saleh, Amer F; McClorey, Graham; Hammond, Suzan M; Hällbrink, Mattias; Langel, Ülo; Smith, C I Edvard; Wood, Matthew J A; Gait, Michael J; El Andaloussi, Samir


    Oligonucleotide analogs have provided novel therapeutics targeting various disorders. However, their poor cellular uptake remains a major obstacle for their clinical development. Negatively charged oligonucleotides, such as 2'-O-Methyl RNA and locked nucleic acids have in recent years been delivered successfully into cells through complex formation with cationic polymers, peptides, liposomes, or similar nanoparticle delivery systems. However, due to the lack of electrostatic interactions, this promising delivery method has been unsuccessful to date using charge-neutral oligonucleotide analogs. We show here that lipid-functionalized cell-penetrating peptides can be efficiently exploited for cellular transfection of the charge-neutral oligonucleotide analog phosphorodiamidate morpholino. The lipopeptides form complexes with splice-switching phosphorodiamidate morpholino oligonucleotide and can be delivered into clinically relevant cell lines that are otherwise difficult to transfect while retaining biological activity. To our knowledge, this is the first study to show delivery through complex formation of biologically active charge-neutral oligonucleotides by cationic peptides. PMID:25594433

  14. Aptamer-mediated delivery of splice-switching oligonucleotides to the nuclei of cancer cells.


    Kotula, Jonathan W; Pratico, Elizabeth D; Ming, Xin; Nakagawa, Osamu; Juliano, Rudolph L; Sullenger, Bruce A


    To reduce the adverse effects of cancer therapies and increase their efficacy, new delivery agents that specifically target cancer cells are needed. We and others have shown that aptamers can selectively deliver therapeutic oligonucleotides to the endosome and cytoplasm of cancer cells that express a particular cell surface receptor. Identifying a single aptamer that can internalize into many different cancer cell-types would increase the utility of aptamer-mediated delivery of therapeutic agents. We investigated the ability of the nucleolin aptamer (AS1411) to internalize into multiple cancer cell types and observed that it internalizes into a wide variety of cancer cells and migrates to the nucleus. To determine if the aptamer could be utilized to deliver therapeutic oligonucleotides to modulate events in the nucleus, we evaluated the ability of the aptamer to deliver splice-switching oligonucleotides. We observed that aptamer-splice-switching oligonucleotide chimeras can alter splicing in the nuclei of treated cells and are effective at lower doses than the splice switching oligonucleotides alone. Our results suggest that aptamers can be utilized to deliver oligonucleotides to the nucleus of a wide variety of cancer cells to modulate nuclear events such as RNA splicing. PMID:22703281

  15. Improved DNA microarray detection sensitivity through immobilization of preformed in solution streptavidin/biotinylated oligonucleotide conjugates.


    Mavrogiannopoulou, E; Petrou, P S; Koukouvinos, G; Yannoukakos, D; Siafaka-Kapadai, A; Fornal, K; Awsiuk, K; Budkowski, A; Kakabakos, S E


    A novel immobilization approach involving binding of preformed streptavidin/biotinylated oligonucleotide conjugates onto surfaces coated with biotinylated bovine serum albumin is presented. Microarrays prepared according to the proposed method were compared, in terms of detection sensitivity and specificity, with other immobilization schemes employing coupling of biotinylated oligonucleotides onto directly adsorbed surface streptavidin, or sequential coupling of streptavidin and biotinylated oligonucleotides onto a layer of adsorbed biotinylated bovine serum albumin. A comparison was performed employing biotinylated oligonucleotides corresponding to wild- and mutant-type sequences of seven single point mutations of the BRCA1 gene. With respect to the other immobilization protocols, the proposed oligonucleotide immobilization approach offered the highest hybridization signals (at least 5 times higher) and permitted more elaborative washings, thus providing considerably higher discrimination between complimentary and non-complementary DNA sequences for all mutations tested. In addition, the hybridization kinetics were significantly enhanced compared to two other immobilization protocols, permitting PCR sample analysis in less than 40 min. Thus, the proposed oligonucleotide immobilization approach offered improved detection sensitivity and discrimination ability along with considerably reduced analysis time, and it is expected to find wide application in DNA mutation detection. PMID:25805150

  16. Aptamer-Mediated Delivery of Splice-Switching Oligonucleotides to the Nuclei of Cancer Cells

    PubMed Central

    Kotula, Jonathan W.; Pratico, Elizabeth D.; Ming, Xin; Nakagawa, Osamu; Juliano, Rudolph L.


    To reduce the adverse effects of cancer therapies and increase their efficacy, new delivery agents that specifically target cancer cells are needed. We and others have shown that aptamers can selectively deliver therapeutic oligonucleotides to the endosome and cytoplasm of cancer cells that express a particular cell surface receptor. Identifying a single aptamer that can internalize into many different cancer cell-types would increase the utility of aptamer-mediated delivery of therapeutic agents. We investigated the ability of the nucleolin aptamer (AS1411) to internalize into multiple cancer cell types and observed that it internalizes into a wide variety of cancer cells and migrates to the nucleus. To determine if the aptamer could be utilized to deliver therapeutic oligonucleotides to modulate events in the nucleus, we evaluated the ability of the aptamer to deliver splice-switching oligonucleotides. We observed that aptamer-splice-switching oligonucleotide chimeras can alter splicing in the nuclei of treated cells and are effective at lower doses than the splice switching oligonucleotides alone. Our results suggest that aptamers can be utilized to deliver oligonucleotides to the nucleus of a wide variety of cancer cells to modulate nuclear events such as RNA splicing. PMID:22703281

  17. Integrated Microfluidic Isolation of Aptamers Using Electrophoretic Oligonucleotide Manipulation.


    Kim, Jinho; Olsen, Timothy R; Zhu, Jing; Hilton, John P; Yang, Kyung-Ae; Pei, Renjun; Stojanovic, Milan N; Lin, Qiao


    We present a microfluidic approach to integrated isolation of DNA aptamers via systematic evolution of ligands by exponential enrichment (SELEX). The approach employs a microbead-based protocol for the processes of affinity selection and amplification of target-binding oligonucleotides, and an electrophoretic DNA manipulation scheme for the coupling of these processes, which are required to occur in different buffers. This achieves the full microfluidic integration of SELEX, thereby enabling highly efficient isolation of aptamers in drastically reduced times and with minimized consumption of biological material. The approach as such also offers broad target applicability by allowing selection of aptamers with respect to targets that are either surface-immobilized or solution-borne, potentially allowing aptamers to be developed as readily available affinity reagents for a wide range of targets. We demonstrate the utility of this approach on two different procedures, respectively for isolating aptamers against a surface-immobilized protein (immunoglobulin E) and a solution-phase small molecule (bisboronic acid in the presence of glucose). In both cases aptamer candidates were isolated in three rounds of SELEX within a total process time of approximately 10 hours. PMID:27217242

  18. Integrated Microfluidic Isolation of Aptamers Using Electrophoretic Oligonucleotide Manipulation

    PubMed Central

    Kim, Jinho; Olsen, Timothy R.; Zhu, Jing; Hilton, John P.; Yang, Kyung-Ae; Pei, Renjun; Stojanovic, Milan N.; Lin, Qiao


    We present a microfluidic approach to integrated isolation of DNA aptamers via systematic evolution of ligands by exponential enrichment (SELEX). The approach employs a microbead-based protocol for the processes of affinity selection and amplification of target-binding oligonucleotides, and an electrophoretic DNA manipulation scheme for the coupling of these processes, which are required to occur in different buffers. This achieves the full microfluidic integration of SELEX, thereby enabling highly efficient isolation of aptamers in drastically reduced times and with minimized consumption of biological material. The approach as such also offers broad target applicability by allowing selection of aptamers with respect to targets that are either surface-immobilized or solution-borne, potentially allowing aptamers to be developed as readily available affinity reagents for a wide range of targets. We demonstrate the utility of this approach on two different procedures, respectively for isolating aptamers against a surface-immobilized protein (immunoglobulin E) and a solution-phase small molecule (bisboronic acid in the presence of glucose). In both cases aptamer candidates were isolated in three rounds of SELEX within a total process time of approximately 10 hours. PMID:27217242

  19. Annexin A2 facilitates endocytic trafficking of antisense oligonucleotides

    PubMed Central

    Wang, Shiyu; Sun, Hong; Tanowitz, Michael; Liang, Xue-hai; Crooke, Stanley T.


    Chemically modified antisense oligonucleotides (ASOs) designed to mediate site-specific cleavage of RNA by RNase H1 are used as research tools and as therapeutics. ASOs modified with phosphorothioate (PS) linkages enter cells via endocytotic pathways. The mechanisms by which PS-ASOs are released from membrane-enclosed endocytotic organelles to reach target RNAs remain largely unknown. We recently found that annexin A2 (ANXA2) co-localizes with PS-ASOs in late endosomes (LEs) and enhances ASO activity. Here, we show that co-localization of ANXA2 with PS-ASO is not dependent on their direct interactions or mediated by ANXA2 partner protein S100A10. Instead, ANXA2 accompanies the transport of PS-ASOs to LEs, as ANXA2/PS-ASO co-localization was observed inside LEs. Although ANXA2 appears not to affect levels of PS-ASO internalization, ANXA2 reduction caused significant accumulation of ASOs in early endosomes (EEs) and reduced localization in LEs and decreased PS-ASO activity. Importantly, the kinetics of PS-ASO activity upon free uptake show that target mRNA reduction occurs at least 4 hrs after PS-ASOs exit from EEs and is coincident with release from LEs. Taken together, our results indicate that ANXA2 facilitates PS-ASO trafficking from early to late endosomes where it may also contribute to PS-ASO release. PMID:27378781

  20. Template-directed synthesis of oligonucleotides under eutectic conditions

    NASA Technical Reports Server (NTRS)

    Stribling, R.; Miller, S. L.


    One of the most important sets of model prebiotic experiments consists of reactions that synthesize complementary oligonucleotides from preformed templates under nonenzymatic conditions. Most of these experiments are conducted at 4 degrees C using 0.01-0.1 M concentrations of activated nucleotide monomer and template (monomer equivalent). In an attempt to extend the conditions under which this type of reaction can occur, we have concentrated the reactants by freezing at -18 degrees C, which is close to the NaCl-H2O eutectic at -21 degrees C. The results from this set of experiments suggest that successful syntheses can occur with poly(C) concentrations as low at 5 x 10(-4) M and 2MeImpG concentrations at 10(-3) M. It was also anticipated that this mechanism might allow the previously unsuccessful poly(A)-directed synthesis of oligo(U)s to occur. However, no template effect was seen with the poly(A) and ImpU system. The failure of these conditions to allow template-directed synthesis of oligo(U)s supports the previously proposed idea that pyrimidines may not have been part of the earliest genetic material. Because of the low concentrations of monomer and template that would be expected from prebiotic syntheses, this lower temperature could be considered a more plausible geologic setting for template-directed synthesis than the standard reaction conditions.

  1. Dicationic Surfactants with Glycine Counter Ions for Oligonucleotide Transportation.


    Pietralik, Zuzanna; Skrzypczak, Andrzej; Kozak, Maciej


    Gemini surfactants are good candidates to bind, protect, and deliver nucleic acids. Herein, the concept of amino acids (namely glycine) as counter ions of gemini surfactants for gene therapy application was explored. This study was conducted on DNA and RNA oligomers and two quaternary bis-imidazolium salts, having 2,5-dioxahexane and 2,8-dioxanonane spacer groups. The toxicity level of surfactants was assessed by an MTT assay, and their ability to bind nucleic acids was tested through electrophoresis. The nucleic acid conformation was established based on circular dichroism and infrared spectroscopic analyses. The structures of the formed complexes were characterized by small-angle scattering of synchrotron radiation. Both studied surfactants appear to be suitable for gene therapy; however, although they vary by only three methylene groups in the spacer, they differ in binding ability and toxicity. The tested oligonucleotides maintained their native conformations upon surfactant addition and the studied lipoplexes formed a variety of structures. In systems based on a 2,5-dioxahexane spacer, a hexagonal phase was observed for DNA-surfactant complexes and a micellar phase was dominant with RNA. For the surfactant with a 2,8-dioxanonane spacer group, the primitive cubic phase prevailed. PMID:27214208

  2. Integrated Microfluidic Isolation of Aptamers Using Electrophoretic Oligonucleotide Manipulation

    NASA Astrophysics Data System (ADS)

    Kim, Jinho; Olsen, Timothy R.; Zhu, Jing; Hilton, John P.; Yang, Kyung-Ae; Pei, Renjun; Stojanovic, Milan N.; Lin, Qiao


    We present a microfluidic approach to integrated isolation of DNA aptamers via systematic evolution of ligands by exponential enrichment (SELEX). The approach employs a microbead-based protocol for the processes of affinity selection and amplification of target-binding oligonucleotides, and an electrophoretic DNA manipulation scheme for the coupling of these processes, which are required to occur in different buffers. This achieves the full microfluidic integration of SELEX, thereby enabling highly efficient isolation of aptamers in drastically reduced times and with minimized consumption of biological material. The approach as such also offers broad target applicability by allowing selection of aptamers with respect to targets that are either surface-immobilized or solution-borne, potentially allowing aptamers to be developed as readily available affinity reagents for a wide range of targets. We demonstrate the utility of this approach on two different procedures, respectively for isolating aptamers against a surface-immobilized protein (immunoglobulin E) and a solution-phase small molecule (bisboronic acid in the presence of glucose). In both cases aptamer candidates were isolated in three rounds of SELEX within a total process time of approximately 10 hours.

  3. Triplex formation on DNA targets: how to choose the oligonucleotide.


    Vekhoff, Pierre; Ceccaldi, Alexandre; Polverari, David; Pylouster, Jean; Pisano, Claudio; Arimondo, Paola B


    Triplex-forming oligonucleotides (TFOs) are sequence-specific DNA binders. TFOs provide a tool for controlling gene expression or, when attached to an appropriate chemical reagent, for directing DNA damage. Here, we report a set of rules for predicting the best out of five different triple-helical binding motifs (TM, UM, GA, GT, and GU, where M is 5-methyldeoxycytidine and U is deoxyuridine) by taking into consideration the sequence composition of the underlying duplex target. We tested 11 different triplex targets present in genes having an oncogenic role. The rules have predictive power and are very useful in the design of TFOs for antigene applications. Briefly, we retained motifs GU and TM, and when they do form a triplex, TFOs containing G and U are preferred over those containing T and M. In the case of the G-rich TFOs, triplex formation is principally dependent on the percentage of G and the length of the TFO. In the case of the pyrimidine motif, replacement of T with U is destabilizing; triplex formation is dependent on the percentage of T and destabilized by the presence of several contiguous M residues. An equation to choose between a GU and TM motif is given. PMID:18954091

  4. Mechanism for radical cation transport in duplex DNA oligonucleotides.


    Liu, Chu-Sheng; Hernandez, Rigoberto; Schuster, Gary B


    We investigated the photoinduced one-electron oxidation of a series of DNA oligomers having a covalently linked anthraquinone group (AQ) and containing [(A)(n)GG](m) or [(T)(n)GG](m) segments. These oligomers have m GG steps, where m = 4 or 6, separated by (A)(n) or (T)(n) segments, where n = 1-7 for the (A)(n) set and 1-5 for the (T)(n) set. Irradiation with UV light that is absorbed by the AQ causes injection of a radical cation into the DNA. The radical cation migrates through the DNA, causing chemical reaction, primarily at GG steps, that leads to strand cleavage after piperidine treatment. The uniform, systematic structure of the DNA oligonucleotides investigated permits the numerical solution of a kinetic scheme that models these reactions. This analysis yields two rate constants, k(hop), for hopping of the radical cation from one site to adjacent sites, and k(trap), for irreversible reaction of the radical cation with H(2)O or O(2). Analysis of these findings indicates that radical cation hopping in these duplex DNA oligomers is a process that occurs on a microsecond time scale. The value of k(hop) depends on the number of base pairs in the (A)(n) and (T)(n) segments in a systematic way. We interpret these results in terms of a thermally activated adiabatic mechanism for radical cation hopping that we identify as phonon-assisted polaron hopping. PMID:14995205

  5. Chromosome-Specific Painting in Cucumis Species Using Bulked Oligonucleotides

    PubMed Central

    Han, Yonghua; Zhang, Tao; Thammapichai, Paradee; Weng, Yiqun; Jiang, Jiming


    Chromosome-specific painting is a powerful technique in molecular cytogenetic and genome research. We developed an oligonucleotide (oligo)-based chromosome painting technique in cucumber (Cucumis sativus) that will be applicable in any plant species with a sequenced genome. Oligos specific to a single chromosome of cucumber were identified using a newly developed bioinformatic pipeline and then massively synthesized de novo in parallel. The synthesized oligos were amplified and labeled with biotin or digoxigenin for use in fluorescence in situ hybridization (FISH). We developed three different probes with each containing 23,000–27,000 oligos. These probes spanned 8.3–17 Mb of DNA on targeted cucumber chromosomes and had the densities of 1.5–3.2 oligos per kilobases. These probes produced FISH signals on a single cucumber chromosome and were used to paint homeologous chromosomes in other Cucumis species diverged from cucumber for up to 12 million years. The bulked oligo probes allowed us to track a single chromosome in early stages during meiosis. We were able to precisely map the pairing between cucumber chromosome 7 and chromosome 1 of Cucumis hystrix in a F1 hybrid. These two homeologous chromosomes paired in 71% of prophase I cells but only 25% of metaphase I cells, which may provide an explanation of the higher recombination rates compared to the chiasma frequencies between homeologous chromosomes reported in plant hybrids. PMID:25971668

  6. Chimeric Antisense Oligonucleotide Conjugated to α-Tocopherol

    PubMed Central

    Nishina, Tomoko; Numata, Junna; Nishina, Kazutaka; Yoshida-Tanaka, Kie; Nitta, Keiko; Piao, Wenying; Iwata, Rintaro; Ito, Shingo; Kuwahara, Hiroya; Wada, Takeshi; Mizusawa, Hidehiro; Yokota, Takanori


    We developed an efficient system for delivering short interfering RNA (siRNA) to the liver by using α-tocopherol conjugation. The α-tocopherol–conjugated siRNA was effective and safe for RNA interference–mediated gene silencing in vivo. In contrast, when the 13-mer LNA (locked nucleic acid)-DNA gapmer antisense oligonucleotide (ASO) was directly conjugated with α-tocopherol it showed markedly reduced silencing activity in mouse liver. Here, therefore, we tried to extend the 5′-end of the ASO sequence by using 5′-α-tocopherol–conjugated 4- to 7-mers of unlocked nucleic acid (UNA) as a “second wing.” Intravenous injection of mice with this α-tocopherol–conjugated chimeric ASO achieved more potent silencing than ASO alone in the liver, suggesting increased delivery of the ASO to the liver. Within the cells, the UNA wing was cleaved or degraded and α-tocopherol was released from the 13-mer gapmer ASO, resulting in activation of the gapmer. The α-tocopherol–conjugated chimeric ASO showed high efficacy, with hepatic tropism, and was effective and safe for gene silencing in vivo. We have thus identified a new, effective LNA-DNA gapmer structure in which drug delivery system (DDS) molecules are bound to ASO with UNA sequences. PMID:25584900

  7. Phosphorothioate Antisense Oligonucleotides Induce the Formation of Nuclear Bodies

    PubMed Central

    Lorenz, Peter; Baker, Brenda F.; Bennett, C. Frank; Spector, David L.


    Antisense oligonucleotides are powerful tools for the in vivo regulation of gene expression. We have characterized the intracellular distribution of fluorescently tagged phosphorothioate oligodeoxynucleotides (PS-ONs) at high resolution under conditions in which PS-ONs have the potential to display antisense activity. Under these conditions PS-ONs predominantly localized to the cell nucleus where they accumulated in 20–30 bright spherical foci designated phosphorothioate bodies (PS bodies), which were set against a diffuse nucleoplasmic population excluding nucleoli. PS bodies are nuclear structures that formed in cells after PS-ON delivery by transfection agents or microinjection but were observed irrespectively of antisense activity or sequence. Ultrastructurally, PS bodies corresponded to electron-dense structures of 150–300 nm diameter and resembled nuclear bodies that were found with lower frequency in cells lacking PS-ONs. The environment of a living cell was required for the de novo formation of PS bodies, which occurred within minutes after the introduction of PS-ONs. PS bodies were stable entities that underwent noticeable reorganization only during mitosis. Upon exit from mitosis, PS bodies were assembled de novo from diffuse PS-ON pools in the daughter nuclei. In situ fractionation demonstrated an association of PS-ONs with the nuclear matrix. Taken together, our data provide evidence for the formation of a nuclear body in cells after introduction of phosphorothioate oligodeoxynucleotides. PMID:9571236

  8. Antineoplastic Effect of Decoy Oligonucleotide Derived from MGMT Enhancer

    PubMed Central

    Refael, Miri; Zrihan, Daniel; Siegal, Tali; Lavon, Iris


    Silencing of O(6)-methylguanine-DNA-methyltransferase (MGMT) in tumors, mainly through promoter methylation, correlates with a better therapeutic response and with increased survival. Therefore, it is conceivable to consider MGMT as a potential therapeutic target for the treatment of cancers. Our previous results demonstrated the pivotal role of NF-kappaB in MGMT expression, mediated mainly through p65/NF-kappaB homodimers. Here we show that the non-canonical NF-KappaB motif (MGMT-kappaB1) within MGMT enhancer is probably the major inducer of MGMT expression following NF-kappaB activation. Thus, in an attempt to attenuate the transcription activity of MGMT in tumors we designed locked nucleic acids (LNA) modified decoy oligonucleotides corresponding to the specific sequence of MGMT-kappaB1 (MGMT-kB1-LODN). Following confirmation of the ability of MGMT-kB1-LODN to interfere with the binding of p65/NF-kappaB to the NF-KappaB motif within MGMT enhancer, the efficacy of the decoy was studied in-vitro and in-vivo. The results of these experiments show that the decoy MGMT-kB1-LODN have a substantial antineoplastic effect when used either in combination with temozolomide or as monotherapy. Our results suggest that MGMT-kB1-LODN may provide a novel strategy for cancer therapy. PMID:25460932

  9. Splice-switching antisense oligonucleotides as therapeutic drugs.


    Havens, Mallory A; Hastings, Michelle L


    Splice-switching oligonucleotides (SSOs) are short, synthetic, antisense, modified nucleic acids that base-pair with a pre-mRNA and disrupt the normal splicing repertoire of the transcript by blocking the RNA-RNA base-pairing or protein-RNA binding interactions that occur between components of the splicing machinery and the pre-mRNA. Splicing of pre-mRNA is required for the proper expression of the vast majority of protein-coding genes, and thus, targeting the process offers a means to manipulate protein production from a gene. Splicing modulation is particularly valuable in cases of disease caused by mutations that lead to disruption of normal splicing or when interfering with the normal splicing process of a gene transcript may be therapeutic. SSOs offer an effective and specific way to target and alter splicing in a therapeutic manner. Here, we discuss the different approaches used to target and alter pre-mRNA splicing with SSOs. We detail the modifications to the nucleic acids that make them promising therapeutics and discuss the challenges to creating effective SSO drugs. We highlight the development of SSOs designed to treat Duchenne muscular dystrophy and spinal muscular atrophy, which are currently being tested in clinical trials. PMID:27288447

  10. Crystallization and crystal packing analysis of DNA oligonucleotides

    NASA Astrophysics Data System (ADS)

    Wang, Andrew H.-J.; Teng, M.-K.


    There are now over 30 DNA oligonucleotides that have been crystallized and their structure determined by X-ray diffraction analysis. From these studies there is a new wealth of information available to us concerning the fine details of the conformation of DNA molecules and their interactions with other ligands such as antitumor drugs and ions. In addition, the intensive efforts in attempting to crystallize many DNA fragments from several laboratories have resulted in a considerable amount of data related to the crystallization conditions for DNA molecules. Various factors such as the types of metal ion, precipitant, buffer and pH all play important roles in obtaining suitable crystals. We have also analyzed the packings of DNA molecules in the crystal lattice and found that they can be arranged into four different general categories. Those four types of packing interactions are: (1) base-base stacking plus intermolecular hydrogen bonds such as in the crystals of Z-DNA, daunomycin/DNA complex, triostin A/DNA complex, etc.; (2) base pair/A-DNA minor groove stacking, as in several DNA oligomer crystals in the A-DNA conformation; (3) guanine-guanine pairing in the minor groove of B-DNA dodecamers; (4) miscellaneous hydrogen bonding and stacking interactions. Many of those intermolecular interactions are examined in details and their possible biological relevance is discussed.

  11. [The use of oligonucleotide aptamers in cancer therapy].


    Odrzywolski, Adrian; Waśko, Adam


    Aptamers are a new class of molecules which originated in the 1990s. They are usually RNA or DNA oligonucleotides, the length of which ranges between 20 and 80 nt. They are produced using the SELEX method that allows one to obtain aptamers that bind to virtually any molecule of interest, providing a high specificity. Aptamers are an alternative to antibodies because on the one hand, their sensitivity is at a similar or sometimes even higher level, while on the other hand they do not show immunogenicity, and may be synthesized in vitro. To date, a broad range of different applications of aptamers has been described: as components of biosensors, or use in various laboratory techniques, such as microarrays or chromatography. One of the most important is the use of aptamers in medicine, especially in the fight against cancer. They can be used both for diagnosis and for the eradication of cancers - particularly through the delivery of drugs. Currently, most transport-related research is devoted to the delivery of chemotherapeutic drugs, such as doxorubicin. This was used in research on liver cancer cells, prostate, and acute lymphoblastic leukemia blast cells. Another possibility is to use aptamers to deliver siRNAs. In this way inhibition of the quality control process of the mRNA in tumor cells is possible. An aptamer complex with the drug allows for direct delivery of the active substance in a particular cell type, substantially eliminating the non-specific effect of the drug. PMID:27180958

  12. High-throughput genotyping using horizontal polyacrylamide gels with wells arranged for microplate array diagonal gel electrophoresis (MADGE).


    Day, I N; Humphries, S E; Richards, S; Norton, D; Reid, M


    Genotyping (typing of genetic variation) typically involves PCR followed by an allele-specific oligonucleotide-binding assay, restriction enzyme digest or direct check of the outcome of a PCR designed to distinguish genotype. Electrophoresis can resolve "bound" from "free" oligonucleotide, as well as resolve PCR fragments and digests, but it is traditionally regarded as cumbersome and laborious in comparison with solution assays. Here we describe simple horizontal polyacrylamide gels which can receive a 96-well array of samples directly, which can be stacked in tanks and which are bound to a robust support of glass. The line of electrophoresis is on a 71.6 degree diagonal relative to the columns of the array (microplate array diagonal gel electrophoresis [MADGE]). Several thousand reactions can conveniently be analyzed in a shoebox-sized apparatus in a couple of hours. High resolution is achieved in the range of 20-1000 bp, information processing is simplified and automation is possible. PMID:8588924

  13. 2-O-[2-(Methylthio)ethyl]-Modified Oligonucleotide: An Analog of 2-O-[2-(Methoxy)ethyl]-Modified Oligonucleotide with Improved Protein Binding Properties and High Binding Affinity to Target RNA

    SciTech Connect

    Prakash, T.P.; Manoharan, M.; Fraser, A.S.; Kawasaki, A.M.; Lesnik, E.; Sioufi, N.; Leeds, J.M.; Teplova, M.; Egli, M.


    A novel 2'-modification, 2'-O-[2-(methylthio)ethyl] or 2'-O-MTE, has been incorporated into oligonucleotides and evaluated for properties relevant to antisense activity. The results were compared with the previously characterized 2'-O-[2-(methoxy)ethyl] 2'-O-MOE modification. As expected, the 2'-O-MTE modified oligonucleotides exhibited improved binding to human serum albumin compared to the 2'-O-MOE modified oligonucleotides. The 2'-O-MTE oligonucleotides maintained high binding affinity to target RNA. Nuclease digestion of 2'-O-MTE oligonucleotides showed that they have limited resistance to exonuclease degradation. We analyzed the crystal structure of a decamer DNA duplex containing the 2'-O-MTE modifcation. Analysis of the crystal structure provides insight into the improved RNA binding affinity, protein binding affinity and limited resistance of 2'-O-MTE modified oligonucleotides to exonuclease degradation.

  14. Inhibition of transcription by platinated triplex-forming oligonucleotides.


    Graham, Mindy K; Miller, Paul S


    Platinated triplex-forming oligonucleotides (TFOs) consisting of 2'-methoxythymidine and 2'-methoxy-5-methylcytidine and an N-7 platinated deoxyguanosine ((Pt)G) at the 5'-((Pt)G-TFO), 3'-(TFO-G(Pt)), or 3'- and 5'-((Pt)G-TFO-G(Pt)) ends of the TFO form mono-((Pt)G-TFO and TFO-G(Pt)) and interstrand ((Pt)G-TFO-G(Pt)) cross-links with target DNA as a result of reaction of the (Pt)G with guanines adjacent to the homopurine TFO binding site in the target. The extent of cross-linking is greatest when the (Pt)G is located on the 3' end of the TFO and the target guanine is on the same strand as the TFO binding site. Multiple, contiguous deoxyguanosines in the TFO binding site or a cytosine adjacent to the G(Pt) of the TFO significantly reduce cross-linking. DNA reporter plasmids in which platinated TFOs were cross-linked at a site in the transcribed region between a CMV promoter and a luciferase reporter gene were transfected into Chinese hamster ovary cells, and luciferase expression was compared with that for the corresponding non-cross-linked plasmid. Luciferase expression was inhibited 95 % when TFO-G(Pt) was bound and cross-linked to the transcribed strand, demonstrating that the cross-linked TFO was able to block transcription elongation. Further inhibition (99 %) was observed in nucleotide excision repair (NER) deficient cells, suggesting that NER may repair this lesion. The 3'-G(Pt) group of TFO-G(Pt) protects the TFO from degradation by exonucleases found in mammalian serum. Taken together, these results suggest that platinated TFOs of the type TFO-G(Pt) may find applications as agents for suppressing DNA transcription and consequently inhibiting gene expression in mammalian cells. PMID:22965663

  15. Application of heteronuclear couplings to conformational analysis of oligonucleotides

    SciTech Connect

    Zhu, G.; Live, D.; Bax, A.


    The value of vicinal coupling constants extracted from NMR spectra in deducing torsion angles for conformational analysis is well recognized. Due to the abundance of protons, their couplings have been mostly widely used. In many instances, couplings between protons and other nuclei may be a valuable complement to proton-proton couplings or, in some instances, may be the only coupling available to characterize the torsion angle about a bond. Recently, heteronuclear couplings have been used to great benefit in studies of isotopically enriched proteins, and this general approach has been extended to peptides at natural abundance. The possibility of using this approach to study oligonucleotides is also attractive but has not as yet been widely exploited. With the development of strategies for labeling such molecules, particularly RNAs, this may become an important component in conformational analysis. For DNA, labeling is less accessible, but sufficient quantities of unlabeled material are readily available for measuring these couplings at natural abundance. We chose several DNA systems to explore the usefulness of heteronuclear couplings in addressing the sugar conformation and the glycosidic torsion angle. Intensities of cross peaks in long-range HMQC experiments can be related to the couplings. Crosspeaks involving H1{prime} and C1{prime} atoms have been emphasized because of the superior shift dispersion at these positions between sugar protons and carbon atoms. Results will be shown for the self-complementary Dickerson duplex dodecamer sequence d(CGCGAATTCGCG) and for d(GGTCGG), which dimerizes to form a G-tetrad structure incorporating both syn and anti base orientations. The couplings provide a clear discrimination between presence of C3{prime}-endo and C2{prime}-endo conformations of the sugars and syn and anti bases arrangements.

  16. Correction of a Cystic Fibrosis Splicing Mutation by Antisense Oligonucleotides.


    Igreja, Susana; Clarke, Luka A; Botelho, Hugo M; Marques, Luís; Amaral, Margarida D


    Cystic fibrosis (CF), the most common life-threatening genetic disease in Caucasians, is caused by ∼2,000 different mutations in the CF transmembrane conductance regulator (CFTR) gene. A significant fraction of these (∼13%) affect pre-mRNA splicing for which novel therapies have been somewhat neglected. We have previously described the effect of the CFTR splicing mutation c.2657+5G>A in IVS16, showing that it originates transcripts lacking exon 16 as well as wild-type transcripts. Here, we tested an RNA-based antisense oligonucleotide (AON) strategy to correct the aberrant splicing caused by this mutation. Two AONs (AON1/2) complementary to the pre-mRNA IVS16 mutant region were designed and their effect on splicing was assessed at the RNA and protein levels, on intracellular protein localization and function. To this end, we used the 2657+5G>A mutant CFTR minigene stably expressed in HEK293 Flp-In cells that express a single copy of the transgene. RNA data from AON1-treated mutant cells show that exon 16 inclusion was almost completely restored (to 95%), also resulting in increased levels of correctly localized CFTR protein at the plasma membrane (PM) and with increased function. A novel two-color CFTR splicing reporter minigene developed here allowed the quantitative monitoring of splicing by automated microscopy localization of CFTR at the PM. The AON strategy is thus a promising therapeutic approach for the specific correction of alternative splicing. PMID:26553470

  17. Oligonucleotide facilitators may inhibit or activate a hammerhead ribozyme.

    PubMed Central

    Jankowsky, E; Schwenzer, B


    Facilitators are oligonucleotides capable of affecting hammerhead ribozyme activity by interacting with the substrate at the termini of the ribozyme. Facilitator effects were determined in vitro using a system consisting of a ribozyme with 7 nucleotides in every stem sequence and two substrates with inverted facilitator binding sequences. The effects of 9mer and 12mer RNA as well as DNA facilitators which bind either adjacent to the 3'- or 5'-end of the ribozyme were investigated. A kinetic model was developed which allows determination of the apparent dissociation constant of the ribozyme-substrate complex from single turnover reactions. We observed a decreased dissociation constant of the ribozyme-substrate complex due to facilitator addition corresponding to an additional stabilization energy of delta delta G=-1.7 kcal/mol with 3'-end facilitators. The cleavage rate constant was increased by 3'-end facilitators and decreased by 5'-end facilitators. Values for Km were slightly lowered by all facilitators and kcat was increased by 3'-end facilitators and decreased by 5'-end facilitators in our system. Generally the facilitator effects increased with the length of the facilitators and RNA provided greater effects than DNA of the same sequence. Results suggest facilitator influences on several steps of the hammerhead reaction, substrate association, cleavage and dissociation of products. Moreover, these effects are dependent in different manners on ribozyme and substrate concentration. This leads to the conclusion that there is a concentration dependence whether activation or inhibition is caused by facilitators. Conclusions are drawn with regard to the design of hammerhead ribozyme facilitator systems. PMID:8602353

  18. A novel dysferlin mutant pseudoexon bypassed with antisense oligonucleotides

    PubMed Central

    Dominov, Janice A; Uyan, Özgün; Sapp, Peter C; McKenna-Yasek, Diane; Nallamilli, Babi R R; Hegde, Madhuri; Brown, Robert H


    Objective Mutations in dysferlin (DYSF), a Ca2+-sensitive ferlin family protein important for membrane repair, vesicle trafficking, and T-tubule function, cause Miyoshi myopathy, limb-girdle muscular dystrophy type 2B, and distal myopathy. More than 330 pathogenic DYSF mutations have been identified within exons or near exon–intron junctions. In ~17% of patients who lack normal DYSF, only a single disease-causing mutation has been identified. We studied one family with one known mutant allele to identify both the second underlying genetic defect and potential therapeutic approaches. Methods We sequenced the full DYSF cDNA and investigated antisense oligonucleotides (AONs) as a tool to modify splicing of the mRNA transcripts in order to process out mutant sequences. Results We identified a novel pseudoexon between exons 44 and 45, (pseudoexon 44.1, PE44.1), which inserts an additional 177 nucleotides into the mRNA and 59 amino acids within the conserved C2F domain of the DYSF protein. Two unrelated dysferlinopathy patients were also found to carry this mutation. Using AONs targeting PE44.1, we blocked the abnormal splicing event, yielding normal, full-length DYSF mRNA, and increased DYSF protein expression. Interpretation This is the first report of a deep intronic mutation in DYSF that alters mRNA splicing to include a mutant peptide fragment within a key DYSF domain. We report that AON-mediated exon-skipping restores production of normal, full-length DYSF in patients’ cells in vitro, offering hope that this approach will be therapeutic in this genetic context, and providing a foundation for AON therapeutics targeting other pathogenic DYSF alleles. PMID:25493284

  19. Effect of non-specific species competition from total RNA on the static mode hybridization response of nanomechanical assays of oligonucleotides.


    Mishra, Rohit; Hegner, Martin


    We investigate here the nanomechanical response of microcantilever sensors in real-time for detecting a range of ultra-low concentrations of oligonucleotides in a complex background of total cellular RNA extracts from cell lines without labeling or amplification. Cantilever sensor arrays were functionalized with probe single stranded DNA (ssDNA) and reference ssDNA to obtain a differential signal. They were then exposed to complementary target ssDNA strands that were spiked in a fragmented total cellular RNA background in biologically relevant concentrations so as to provide clinically significant analysis. We present a model for prediction of the sensor behavior in competitive backgrounds with parameters that are indicators of the change in nanomechanical response with variation in the target and background concentration. For nanomechanical assays to compete with current technologies it is essential to comprehend such responses with eventual impact on areas like understanding non-coding RNA pharmacokinetics, nucleic acid biomarker assays and miRNA quantification for disease monitoring and diagnosis to mention a few. Additionally, we also achieved a femtomolar sensitivity limit for online oligonucleotide detection in a non-competitive environment with these sensors. PMID:24807191

  20. Effect of non-specific species competition from total RNA on the static mode hybridization response of nanomechanical assays of oligonucleotides

    NASA Astrophysics Data System (ADS)

    Mishra, Rohit; Hegner, Martin


    We investigate here the nanomechanical response of microcantilever sensors in real-time for detecting a range of ultra-low concentrations of oligonucleotides in a complex background of total cellular RNA extracts from cell lines without labeling or amplification. Cantilever sensor arrays were functionalized with probe single stranded DNA (ssDNA) and reference ssDNA to obtain a differential signal. They were then exposed to complementary target ssDNA strands that were spiked in a fragmented total cellular RNA background in biologically relevant concentrations so as to provide clinically significant analysis. We present a model for prediction of the sensor behavior in competitive backgrounds with parameters that are indicators of the change in nanomechanical response with variation in the target and background concentration. For nanomechanical assays to compete with current technologies it is essential to comprehend such responses with eventual impact on areas like understanding non-coding RNA pharmacokinetics, nucleic acid biomarker assays and miRNA quantification for disease monitoring and diagnosis to mention a few. Additionally, we also achieved a femtomolar sensitivity limit for online oligonucleotide detection in a non-competitive environment with these sensors.

  1. Oligonucleotide delivery with cell surface binding and cell penetrating Peptide amphiphile nanospheres.


    Mumcuoglu, Didem; Sardan, Melis; Tekinay, Turgay; Guler, Mustafa O; Tekinay, Ayse B


    A drug delivery system designed specifically for oligonucleotide therapeutics can ameliorate the problems associated with the in vivo delivery of these molecules. The internalization of free oligonucleotides is challenging, and cytotoxicity is the main obstacle for current transfection vehicles. To develop nontoxic delivery vehicles for efficient transfection of oligonucleotides, we designed a self-assembling peptide amphiphile (PA) nanosphere delivery system decorated with cell penetrating peptides (CPPs) containing multiple arginine residues (R4 and R8), and a cell surface binding peptide (KRSR), and report the efficiency of this system in delivering G-3129, a Bcl-2 antisense oligonucleotide (AON). PA/AON (peptide amphiphile/antisense oligonucleotide) complexes were characterized with regards to their size and secondary structure, and their cellular internalization efficiencies were evaluated. The effect of the number of arginine residues on the cellular internalization was investigated by both flow cytometry and confocal imaging, and the results revealed that uptake efficiency improved as the number of arginines in the sequence increased. The combined effect of cell penetration and surface binding property on the cellular internalization and its uptake mechanism was also evaluated by mixing R8-PA and KRSR-PA. R8 and R8/KRSR decorated PAs were found to drastically increase the internalization of AONs compared to nonbioactive PA control. Overall, the KRSR-decorated self-assembled PA nanospheres were demonstrated to be noncytotoxic delivery vectors with high transfection rates and may serve as a promising delivery system for AONs. PMID:25828697

  2. Combined in vitro transcription and reverse transcription to amplify and label complex synthetic oligonucleotide probe libraries

    PubMed Central

    Murgha, Yusuf; Beliveau, Brian; Semrau, Kassandra; Schwartz, Donald; Wu, Chao-ting; Gulari, Erdogan; Rouillard, Jean-Marie


    Oligonucleotide microarrays allow the production of complex custom oligonucleotide libraries for nucleic acid detection–based applications such as fluorescence in situ hybridization (FISH). We have developed a PCR-free method to make single-stranded DNA (ssDNA) fluorescent probes through an intermediate RNA library. A double-stranded oligonucleotide library is amplified by transcription to create an RNA library. Next, dye- or hapten-conjugate primers are used to reverse transcribe the RNA to produce a dye-labeled cDNA library. Finally the RNA is hydrolyzed under alkaline conditions to obtain the single-stranded fluorescent probes library. Starting from unique oligonucleotide library constructs, we present two methods to produce single-stranded probe libraries. The two methods differ in the type of reverse transcription (RT) primer, the incorporation of fluorescent dye, and the purification of fluorescent probes. The first method employs dye-labeled reverse transcription primers to produce multiple differentially single-labeled probe subsets from one microarray library. The fluorescent probes are purified from excess primers by oligonucleotide-bead capture. The second method uses an RNA:DNA chimeric primer and amino-modified nucleotides to produce amino-allyl probes. The excess primers and RNA are hydrolyzed under alkaline conditions, followed by probe purification and labeling with amino-reactive dyes. The fluorescent probes created by the combination of transcription and reverse transcription can be used for FISH and to detect any RNA and DNA targets via hybridization. PMID:26054766

  3. Oligonucleotide-induced alternative splicing of serotonin 2C receptor reduces food intake.


    Zhang, Zhaiyi; Shen, Manli; Gresch, Paul J; Ghamari-Langroudi, Masoud; Rabchevsky, Alexander G; Emeson, Ronald B; Stamm, Stefan


    The serotonin 2C receptor regulates food uptake, and its activity is regulated by alternative pre-mRNA splicing. Alternative exon skipping is predicted to generate a truncated receptor protein isoform, whose existence was confirmed with a new antiserum. The truncated receptor sequesters the full-length receptor in intracellular membranes. We developed an oligonucleotide that promotes exon inclusion, which increases the ratio of the full-length to truncated receptor protein. Decreasing the amount of truncated receptor results in the accumulation of full-length, constitutively active receptor at the cell surface. After injection into the third ventricle of mice, the oligonucleotide accumulates in the arcuate nucleus, where it changes alternative splicing of the serotonin 2C receptor and increases pro-opiomelanocortin expression. Oligonucleotide injection reduced food intake in both wild-type and ob/ob mice. Unexpectedly, the oligonucleotide crossed the blood-brain barrier and its systemic delivery reduced food intake in wild-type mice. The physiological effect of the oligonucleotide suggests that a truncated splice variant regulates the activity of the serotonin 2C receptor, indicating that therapies aimed to change pre-mRNA processing could be useful to treat hyperphagia, characteristic for disorders like Prader-Willi syndrome. PMID:27406820

  4. Sequence specific inhibition of human type II phospholipase A2 enzyme activity by phosphorothioate oligonucleotides.

    PubMed Central

    Bennett, C F; Chiang, M Y; Wilson-Lingardo, L; Wyatt, J R


    Phosphorothioate oligonucleotides were identified which directly inhibited human type II phospholipase A2 (PLA2) enzyme activity in a sequence specific manner. The minimum pharmacophore common to all oligonucleotides which inhibited PLA2 enzyme activity consisted of two sets of three or more consecutive guanosine residues in a row. These oligonucleotides appear to form G quartets resulting in the formation of oligonucleotide aggregates. Additionally, a phosphorothioate backbone was required to be effective inhibitors of type II PLA2. The activity of one oligodeoxynucleotide, IP 3196 (5'-GGGTGGGTATAGAAGGGCTCC-3') has been characterized in more detail. IP 3196 inhibited PLA2 enzyme activity when the substrate was presented in the form of a phospholipid bilayer but not when presented in the form of a mixed micelle with anionic detergents. Human type II PLA2 was 50-fold more sensitive to inhibition by IP 3196 than venom and pancreatic type I enzymes. These data demonstrate that phosphorothioate oligonucleotides can specifically inhibit human type II PLA2 enzyme activity in a sequence specific manner. PMID:8065936

  5. Liposome-encapsulated polyethylenimine/oligonucleotide polyplexes prepared by reverse-phase evaporation technique.


    Ko, Young Tag; Bickel, Ulrich


    Liposome-encapsulated polyplex system represents a promising delivery system for oligonucleotide-based therapeutics such as siRNA and asODN. Here, we report a novel method to prepare liposome-encapsulated cationic polymer/oligonucleotide polyplexes based on the reverse-phase evaporation following organic extraction of the polyplexes. The polyplexes of polyethylenimine and oligonucleotide were first formed in aqueous buffer at an N/P ratio of 6. The overall positively charged polyplexes were then mixed with the anionic phospholipids in overall organic media. The overall organic environment and electrostatic interaction between anionic phospholipids and positively charged polyplexes resulted in inverted micelle-like particles with the polyplexes in the core. After phase separation, the hydrophobic particles were recovered in organic phase. Reverse-phase evaporation of the organic solvent in the presence of hydrophilic polymer-grafted lipids resulted in a stable aqueous dispersion of hydrophilic lipid-coated particles with the polyplex in the core. Transmission electron microscopy visualization revealed spherical structures with heavily stained polyplex cores surrounded by lightly stained lipid coats. The lipid-coated polyplex particles showed colloidal stability, complete protection of the loaded oligonucleotide molecules from enzymatic degradation, and high loading efficiency of more than 80%. Thus, this technique represents an alternative method to prepare lipid-coated polyplex particles as a delivery system of oligonucleotide therapeutics. PMID:22328240

  6. Modified nucleotides in T1 RNase oligonucleotides of 18S ribosomal RNA of the Novikoff hepatoma.


    Choi, Y C; Busch, H


    The primary structure of 18S rRNA of the Novikoff hepatoma cells was investigated. Regardless of whether the primary sequence of 18S rRNA is finally determined by RNA sequencing methods or DNA sequencing methods, it is important to identify numbers and types of the modified nucleotides and accordingly the present study was designed to localize the modified regions in T1 RNase derived oligonucleotide. Modified nucleotides found in 66 different oligonucleotide sequences included 2 m62A, 1 m6A, 1 m7G, 1m1cap3psi, 7 Cm, 13 Am, 9 Gm, 11 Um, and 38 psi residues. A number of these modified nucleotides are now placed in defined sequences of T1 RNase oligonucleotides which are now being searched for in larger fragments derived from partial T1 RNase digests of 18S rRNA. Improved homochromatography fingerprinting (Choi et al. (1976) Cancer Res. 36, 4301) of T1 RNase derived oligonucleotides provided a distinctive pattern for 18S rRNA of Novikoff hepatoma ascites cells. The 116 spots obtained by homochromatography contain 176 oligonucleotide sequences. PMID:209819

  7. Surface modification of plasmonic nanostructured materials with thiolated oligonucleotides in 10 seconds using selective microwave heating.


    Abel, Biebele; Aslan, Kadir


    This study demonstrates the proof-of-principle of rapid surface modification of plasmonic nanostructured materials with oligonucleotides using low power microwave heating. Due to their interesting optical and electronic properties, silver nanoparticle films (SNFs, 2 nm thick) deposited onto glass slides were used as the model plasmonic nanostructured materials. Rapid surface modification of SNFs with oligonucleotides was carried out using two strategies (1) Strategy 1: for ss-oligonucleotides, surface hybridization and (2) Strategy 2: for ds-oligonucleotides, solution hybridization), where the samples were exposed to 10, 15, 30 and 60 seconds microwave heating. To assess the efficacy of our new rapid surface modification technique, identical experiments carried out without the microwave heating (i.e., conventional method), which requires 24 hours for the completion of the identical steps. It was found that SNFs can be modified with ss- and ds-oligonucleotides in 10 seconds, which typically requires several hours of incubation time for the chemisorption of thiol groups on to the planar metal surface using conventional techniques. PMID:23645933

  8. Oligonucleotide directed misfolding of RNA inhibits Candida albicans group I intron splicing

    PubMed Central

    Childs, Jessica L.; Disney, Matthew D.; Turner, Douglas H.


    RNA is becoming an important therapeutic target. Many potential RNA targets require secondary or tertiary structure for function. Examples include ribosomal RNAs, RNase P RNAs, mRNAs with untranslated regions that regulate translation, and group I and group II introns. Here, a method is described to inhibit RNA function by exploiting the propensity of RNA to adopt multiple folded states that are of similar free energy. This method, called oligonucleotide directed misfolding of RNA (ODMiR), uses short oligonucleotides to stabilize inactive structures. The ODMiR method is demonstrated with the group I intron from Candida albicans, a human pathogen. The oligonucleotides, L(TACCTTTC) and TLCTLACLGALCGLGCLC, with L denoting a locked nucleic acid residue, inhibit 50% of group I intron splicing in a transcription mixture at about 150 and 30 nM oligonucleotide concentration, respectively. Both oligonucleotides induce misfolds as determined by native gel electrophoresis and diethyl pyrocarbonate modification. The ODMiR approach provides a potential therapeutic strategy applicable to RNAs with secondary or tertiary structures required for function. PMID:12169671

  9. Delivery of oligonucleotides into mammalian cells by anionic peptides: comparison between monomeric and dimeric peptides.

    PubMed Central

    Freulon, I; Roche, A C; Monsigny, M; Mayer, R


    The use of antisense oligonucleotides as putative therapeutic agents is limited by their poor delivery into the cytosol and/or the nucleus because they are not able to efficiently cross lipid bilayers. To circumvent this pitfall, anionic amphipathic peptides derived from the influenza virus fusogenic peptide have been used to destabilize membranes in an acidic environment. In this paper, we compare the ability of a monomeric and a dimeric peptide to introduce oligonucleotides into the cytosol and nuclei of several types of cultured cells. Cells incubated at pH 6.2 or at a slightly lower pH in the presence of the monomeric peptide but not the dimeric peptide were efficiently permeabilized. The location of fluorescent derivatives of peptides and of oligonucleotides was assessed by confocal microscopy. Both the peptides and oligonucleotides remained entrapped in vesicular compartments at neutral pH; at acidic pH, oligonucleotides in the presence of the monomeric peptide were mainly in the nucleus, while in the presence of the dimeric peptide they co-localized with the peptide into vesicles. The data are interpreted on the basis of the spectroscopic behaviour of monomeric and dimeric peptides in relation to the environmental pH. PMID:11237872

  10. Novel Efficient Cell-Penetrating, Peptide-Mediated Strategy for Enhancing Telomerase Inhibitor Oligonucleotides.


    Muñoz-Alarcón, Andrés; Eriksson, Jonas; Langel, Ülo


    At present, there are several therapeutic approaches for targeting telomerase in tumors. One in particular, currently undergoing clinical trials, is based on synthetic lipid-modified oligonucleotide antagonists aimed at inhibiting the ribonucleoprotein subunit of human telomerase. However, while enabling efficient uptake, the lipid modifications reduce the potency of the therapeutic oligonucleotides compared to nonmodified oligonucleotides. Moreover, lipid modification may increase oligonucleotide accumulation in the liver causing undesirable hepatotoxicity. Noncovalent complexation strategies for cell-penetrating peptide (CPP)-mediated delivery present an option to circumvent the need for potency-reducing modifications, while allowing for a highly efficient uptake, and could significantly improve the efficiency of telomerase-targeting cancer therapeutics. Delivery of a nonlipidated locked nucleic acid/2'-O-methyl mixmer significantly inhibits the telomerase activity in treated HeLa cells. The inhibitory effect was further improved through addition of a CPP. Furthermore, calculated IC50-values for the oligonucleotide delivered by CPPs into HeLa cells are more than 20 times lower than telomerase inhibitor Imetelstat, currently undergoing clinical trials. These results emphasize the potential of CPP-mediated delivery of future pharmaceuticals and provide means by which to enhance an already promising therapeutic strategy for cancer treatment. PMID:26479411

  11. Achieving successful delivery of oligonucleotides--From physico-chemical characterization to in vivo evaluation.


    Scomparin, Anna; Polyak, Dina; Krivitsky, Adva; Satchi-Fainaro, Ronit


    RNA interference is one of the most promising fields in modern medicine to treat several diseases, ranging from cancer to cardiac diseases, passing through viral infections and metabolic pathologies. Since the discovery of the potential therapeutic properties of non-self oligonucleotides, it was clear that it is important to develop delivery systems that are able to increase plasma stability and bestow membrane-crossing abilities to the oligonucleotides in order to reach their cytoplasmic targets. Polymer therapeutics, among other systems, are widely investigated as delivery systems for therapeutic agents, such as oligonucleotides. Physico-chemical characterization of the supramolecular polyplexes obtained upon charge interaction or covalent conjugation between the polymeric carrier and the oligonucleotides is critical. Appropriate characterization is fundamental in order to predict and understand the in vivo silencing efficacy and to avoid undesired side effects and toxicity profile. Shedding light on the physico-chemical and in vitro requirements of a polyplex leads to an efficient in vivo delivery system for RNAi therapeutics. In this review, we will present the most common techniques for characterization of obtained polymer/oligonucleotide polyplexes and an up-to-date state of the art in vivo preclinical and clinical studies. This is the first review to deal with the difficulties in appropriate characterization of small interfering RNA (siRNA) or microRNA (miRNA) polyplexes and conjugates which limit the clinical translation of this promising technology. PMID:25916823

  12. High-quality gene assembly directly from unpurified mixtures of microarray-synthesized oligonucleotides

    PubMed Central

    Borovkov, Alex Y.; Loskutov, Andrey V.; Robida, Mark D.; Day, Kristen M.; Cano, Jose A.; Le Olson, Tien; Patel, Hetal; Brown, Kevin; Hunter, Preston D.; Sykes, Kathryn F.


    To meet the growing demand for synthetic genes more robust, scalable and inexpensive gene assembly technologies must be developed. Here, we present a protocol for high-quality gene assembly directly from low-cost marginal-quality microarray-synthesized oligonucleotides. Significantly, we eliminated the time- and money-consuming oligonucleotide purification steps through the use of hybridization-based selection embedded in the assembly process. The protocol was tested on mixtures of up to 2000 oligonucleotides eluted directly from microarrays obtained from three different chip manufacturers. These mixtures containing <5% perfect oligos, and were used directly for assembly of 27 test genes of different sizes. Gene quality was assessed by sequencing, and their activity was tested in coupled in vitro transcription/translation reactions. Genes assembled from the microarray-eluted material using the new protocol matched the quality of the genes assembled from >95% pure column-synthesized oligonucleotides by the standard protocol. Both averaged only 2.7 errors/kb, and genes assembled from microarray-eluted material without clonal selection produced only 30% less protein than sequence-confirmed clones. This report represents the first demonstration of cost-efficient gene assembly from microarray-synthesized oligonucleotides. The overall cost of assembly by this method approaches 5¢ per base, making gene synthesis more affordable than traditional cloning. PMID:20693531

  13. A novel, one-step amplification and oligonucleotide ligation procedure for multiplex genetic typing

    SciTech Connect

    Eggerding, F.A.


    A new technique, coupled amplification and oligonucleotide ligation (CAL), has been developed for simultaneous multiplex amplification and genotyping of DNA. CAL is a biphasic method which combines in one assay DNA amplification by the polymerase chain reaction (PCR) with DNA genotyping by the oligonucleotide ligation assay (OLA). By virtue of a difference in the melting temperatures of PCR primer-target DNA and OLA probe-target DNA hybrids, the method allows preferential amplification of DNA during stage I and oligonucleotide ligation during stage II of the reaction. In stage I target DNA is amplified using high-melting primers in a two-step PCR cycle that employs a 72{degrees}C anneal-elongation step. In stage II genotyping of PCR products by competitive oligonucleotide ligation with oligonucleotide probes located between PCR primers is accomplished by several cycles of denaturation at 94{degrees}C followed by anneal-ligation at 55{degrees}C. Ligation products are fluorochrome-labeled at their 3{prime}-ends and analyzed electrophoretically on a fluorescent DNA sequencer. The CAL procedure has been used for multiplex detection of 30 cystic fibrosis mutations and for analysis of ras gene point mutations. Because mutation detection occurs concurrently with target amplification, the technique is rapid, highly sensitive and specific, easily automatable, and requires minimal sample processing.

  14. Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

    PubMed Central

    Chernonosov, Alexander A.; Koval, Vladimir V.; Knorre, Dmitrii G.; Chernenko, Alexander A.; Derkacheva, Valentina M.; Lukyanets, Eugenii A.; Fedorova, Olga S.


    Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen 1O2, while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species (.O2−, H2O2, OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O2 and 2-mercaptoethanol or in the presence of H2O2. Under both sensitized and catalyzed conditions, the nucleotides G13–G15 were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer. PMID:17497012

  15. Design and Application of an Easy to Use Oligonucleotide Mass Calculation Program

    NASA Astrophysics Data System (ADS)

    Yang, Jiong; Leopold, Peter; Helmy, Roy; Parish, Craig; Arvary, Becky; Mao, Bing; Meng, Fanyu


    With the development of new synthesis procedures, an ever increasing number of chemical modifications can now be incorporated into synthetic oligonucleotides, representing new challenges for analytical chemists to efficiently identify and characterize such molecules. While conventional mass spectrometry (MS) has proven to be a powerful tool to study nucleic acids, new and improved methods and software are now needed to address this emerging challenge. In this report, we describe a simple yet powerful program that affords great flexibility in the calculation of theoretical masses for conventional as well as modified oligonucleotide molecules. This easy to use program can accept input oligonucleotide sequences and then calculate the theoretical mass values for full length products, process impurities, potential metabolites, and gas phase fragments. We intentionally designed this software so that modified nucleotide residues can be incorporated into oligonucleotide sequences, and corresponding mass values can be rapidly calculated. To test the utility of this program, two oligonucleotides that contain a large number of chemical modifications were synthesized. We have analyzed these samples using a Q-TOF mass spectrometer and compared the calculated masses to the observed ones. We found that all of the data matched very well with less than 30 ppm mass errors, well within the expectation for our instrument operated in its current mode. These data confirmed the validity of calculations performed with this new software.

  16. Noncoder: a web interface for exon array-based detection of long non-coding RNAs

    PubMed Central

    Gellert, Pascal; Ponomareva, Yuliya; Braun, Thomas; Uchida, Shizuka


    Due to recent technical developments, a high number of long non-coding RNAs (lncRNAs) have been discovered in mammals. Although it has been shown that lncRNAs are regulated differently among tissues and disease statuses, functions of these transcripts are still unknown in most cases. GeneChip Exon 1.0 ST Arrays (exon arrays) from Affymetrix, Inc. have been used widely to profile genome-wide expression changes and alternative splicing of protein-coding genes. Here, we demonstrate that re-annotation of exon array probes can be used to profile expressions of tens of thousands of lncRNAs. With this annotation, a detailed inspection of lncRNAs and their isoforms is possible. To allow for a general usage to the research community, we developed a user-friendly web interface called ‘noncoder’. By uploading CEL files from exon arrays and with a few mouse clicks and parameter settings, exon array data will be normalized and analysed to identify differentially expressed lncRNAs. Noncoder provides the detailed annotation information of lncRNAs and is equipped with unique features to allow for an efficient search for interesting lncRNAs to be studied further. The web interface is available at PMID:23012263

  17. Development of a Method for Profiling Protein Interactions with LNA-Modified Antisense Oligonucleotides Using Protein Microarrays.


    Kakiuchi-Kiyota, Satoko; Whiteley, Lawrence O; Ryan, Anne M; Mathialagan, Nagappan


    Development of locked nucleic acid (LNA) gapmers, antisense oligonucleotides used for efficient inhibition of target RNA expression, is limited by nontarget-mediated hepatotoxicity. Increased binding of hepatocellular proteins to toxic LNA gapmers may be one of the mechanisms contributing to LNA gapmer-induced hepatotoxicity in vivo. In the present study, we investigated the protein binding propensity of nontoxic sequence-1 (NTS-1), toxic sequence-2 (TS-2), and severely highly toxic sequence-3 (HTS-3) LNA gapmers using human protein microarrays. We previously demonstrated by the transcription profiling analysis of liver RNA isolated from mice that TS-2 and HTS-3 gapmers modulate different transcriptional pathways in mice leading to hepatotoxicity. Our protein array profiling demonstrated that a greater number of proteins, including ones associated with hepatotoxicity, hepatic system disorder, and cell functions, were bound by TS-2 and HTS-3 compared with NTS-1. However, the profiles of proteins bound by TS-2 and HTS-3 were similar and did not distinguish proteins contributing to severe in vivo toxicity. These results, together with the previous transcription profiling analysis, indicate that the combination of sequence-dependent transcription modulation and increased protein binding of toxic LNA gapmers contributes to hepatotoxicity. PMID:26643897

  18. Hydrolysis of microporous polyamide-6 membranes as substrate for in situ synthesis of oligonucleotides

    NASA Astrophysics Data System (ADS)

    Tang, Jianxin; He, Nongyue; Nie, Libo; Xiao, Pengfeng; Chen, Hong


    This article provides a novel method of preparing substrate for in situ synthesis of oligonucleotide by hydrolyzing microporous polyamide-6 membranes in a 0.01 mol/l/NaOH/(H 2O-CH 3OH) mixture medium with refluxing about 36 h. Attenuated total reflectance Fourier transform infrared spectroscopy (ATR-FTIR) demonstrated the emergence of amines (NH 2) on the surface. Optimum hydrolyzing conditions were determined through the ultra-violet (UV) spectra. A pH value of 12 and a hydrolysis time of 36 h are the preferred conditions for the modification. The treated membrane can be applied to in situ synthesis of oligonucleotide and, for example, the oligonucleotide probes of 5 '-AAC CAC CAA ACA CAC-3 ' were successfully synthesized on the hydrolyzed membrane. The single step coupling efficiency determined by ultraviolet (UV) spectra is above 98%.

  19. Electron migration in 5-bromouracil-substituted DNA and oligonucleotides in irradiated aqueous solutions

    SciTech Connect

    Zimbrick, J.D.; Beach, C.M.; Fuciarelli, A.G.; Sisk, E.C.


    Results of work by other investigators support the hypothesis that negative charge can migrate in DNA. Charge transfer between nucleotides and electron migration in solid state DNA has been demonstrated, with migration distances as great as 110 bases. Here we report a series of studies on aqueous solutions of DNA and oligonucleotides in which the radiolysis of 5-bromouracil (BU) substituted for thymine is used as a molecular probe to detect and measure the extent of electron migration. In studies using oligonucleotides, BU was substituted for thymine at specific locations in defined base sequences using automated phosphoramidite synthesis techniques. Using these single-stranded oligonucleotides with BU located at the 5 in. end of the sequence, electrons do not appear to migrate more than one base, if any.

  20. Hydration-dependent dynamics of human telomeric oligonucleotides in the picosecond timescale: A neutron scattering study

    SciTech Connect

    Sebastiani, F.; Comez, L.; Sacchetti, F.; Orecchini, A.; Petrillo, C.; Paciaroni, A.; De Francesco, A.; Teixeira, S. C. M.


    The dynamics of the human oligonucleotide AG{sub 3}(T{sub 2}AG{sub 3}){sub 3} has been investigated by incoherent neutron scattering in the sub-nanosecond timescale. A hydration-dependent dynamical activation of thermal fluctuations in weakly hydrated samples was found, similar to that of protein powders. The amplitudes of such thermal fluctuations were evaluated in two different exchanged wave-vector ranges, so as to single out the different contributions from intra- and inter-nucleotide dynamics. The activation energy was calculated from the temperature-dependent characteristic times of the corresponding dynamical processes. The trends of both amplitudes and activation energies support a picture where oligonucleotides possess a larger conformational flexibility than long DNA sequences. This additional flexibility, which likely results from a significant relative chain-end contribution to the average chain dynamics, could be related to the strong structural polymorphism of the investigated oligonucleotides.

  1. Potent triple helix stabilization by 5',3'-modified triplex-forming oligonucleotides.


    Ben Gaied, Nouha; Zhao, Zhengyun; Gerrard, Simon R; Fox, Keith R; Brown, Tom


    Anthraquinone and pyrene analogues attached to the 3' and/or 5' termini of triplex-forming oligonucleotides (TFOs) by various linkers increased the stability of parallel triple helices. The modifications are simple to synthesize and can be introduced during standard solid-phase oligonucleotide synthesis. Potent triplex stability was achieved by using doubly modified TFOs, which in the most favourable cases gave an increase in melting temperature of 30 degrees C over the unmodified counterparts and maintained their selectivity for the correct target duplex. Such TFOs can produce triplexes with melting temperatures of 40 degrees C at pH 7 even though they do not contain any triplex-stabilizing base analogues. These studies have implications for the design of triplex-forming oligonucleotides for use in biology and nanotechnology. PMID:19554592

  2. Dipentafluorophenyl carbonate--a reagent for the synthesis of oligonucleotides and their conjugates.

    PubMed Central

    Efimov, V A; Kalinkina, A L; Chakhmakhcheva, O G


    Dipentafluorophenyl carbonate has been successfully used as condensing agent for the internucleotide bond formation in the synthesis of oligonucleotides via H-phosphonate approach. The mechanism of a nucleotide component activation with this reagent has been investigated with the help of 31P NMR spectroscopy. It was shown that preactivation of deoxynucleoside H-phosphonate with dipentafluorophenyl carbonate has no influence on the efficiency of the synthesis. This reagent is highly reactive, nonhygroscopic and stable on storage at room temperature. The effectiveness of dipentafluorophenyl carbonate in the oligonucleotide chemistry has been demonstrated in the solid-phase synthesis of 10-50-mers on 0.2, 1 and 10 mumol scales. The use of this reagent for the derivatisation of polymer supports as well as for the synthesis of oligonucleotide conjugates with polyethylene glycol and a lipid is described. Images PMID:8265346

  3. Repair of Thalassemic Human β -globin mRNA in Mammalian Cells by Antisense Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Sierakowska, Halina; Sambade, Maria J.; Agrawal, Sudhir; Kole, Ryszard


    In one form of β -thalassemia, a genetic blood disorder, a mutation in intron 2 of the β -globin gene (IVS2-654) causes aberrant splicing of β -globin pre-mRNA and, consequently, β -globin deficiency. Treatment of mammalian cells stably expressing the IVS2-654 human β -globin gene with antisense oligonucleotides targeted at the aberrant splice sites restored correct splicing in a dose-dependent fashion, generating correct human β -globin mRNA and polypeptide. Both products persisted for up to 72 hr posttreatment. The oligonucleotides modified splicing by a true antisense mechanism without overt unspecific effects on cell growth and splicing of other pre-mRNAs. This novel approach in which antisense oligonucleotides are used to restore rather than to down-regulate the activity of the target gene is applicable to other splicing mutants and is of potential clinical interest.

  4. Pinpointing RNA-Protein Cross-Links with Site-Specific Stable Isotope-Labeled Oligonucleotides

    PubMed Central


    High affinity RNA-protein interactions are critical to cellular function, but directly identifying the determinants of binding within these complexes is often difficult. Here, we introduce a stable isotope mass labeling technique to assign specific interacting nucleotides in an oligonucleotide-protein complex by photo-cross-linking. The method relies on generating site-specific oxygen-18-labeled phosphodiester linkages in oligonucleotides, such that covalent peptide-oligonucleotide cross-link sites arising from ultraviolet irradiation can be assigned to specific sequence positions in both RNA and protein simultaneously by mass spectrometry. Using Lin28A and a let-7 pre-element RNA, we demonstrate that mass labeling permits unambiguous identification of the cross-linked sequence positions in the RNA-protein complex. PMID:26583201

  5. Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

    PubMed Central

    Narihiro, Takashi; Sekiguchi, Yuji


    Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

  6. Smart polymeric micelles as nanocarriers for oligonucleotides and siRNA delivery.


    Kataoka, Kazunori; Itaka, Keiji; Nishiyama, Nobuhiro; Yamasaki, Yuichi; Oishi, Motoi; Nagasaki, Yukio


    The development of in vivo delivery systems for oligonucleotides and siRNA is strongly desired to achieve their clinical applications. Recently, polyplex micelles, which are formed through an electrostatic interaction between nucleic acid compounds (DNA and RNA) and poly(ethylene glycol) (PEG)-polycation block copolymers, have received much attention due to their nanometric-scaled size and excellent biocompatibility. Here, three types of newly engineered block copolymers were developed to construct polyplex micelles useful for oligonucleotides and siRNA delivery: (1) PEG-polycation diblock copolymers possessing diamine side-chain with distinctive pKa for siRNA encapsulation into polyplex micelles with high endosomal escaping ability, (2) Lactosylated PEG-(oligonucleotide or siRNA) conjugate through acid-labile beta-thiopropionate linkage to construct pH-sensitive PIC micelles, and (3) PEG-poly(methacrylic acid) block copolymer for the construction of organic/inorganic hybrid nanoparticles encapsulating siRNA. PMID:17150611

  7. Immobilization of DNA in polyacrylamide gel for the manufacture of DNA and DNA-oligonucleotide microchips.

    SciTech Connect

    Proudnikov, D.; Timofeev, E.; Mirzabekov, A.; Center for Mechanistic Biology and Biotechnology; Engelhardt Inst. of Molecular Biology


    Activated DNA was immobilized in aldehyde-containing polyacrylamide gel for use in manufacturing the MAGIChip (microarrays of gel-immobilized compounds on a chip). First, abasic sites were generated in DNA by partial acidic depurination. Amino groups were then introduced into the abasic sites by reaction with ethylenediamine and reduction of the aldimine bonds formed. It was found that DNA could be fragmented at the site of amino group incorporation or preserved mostly unfragmented. In similar reactions, both amino-DNA and amino-oligonucleotides were attached through their amines to polyacrylamide gel derivatized with aldehyde groups. Single- and double-stranded DNA of 40 to 972 nucleotides or base pairs were immobilized on the gel pads to manufacture a DNA microchip. The microchip was hybridized with fluorescently labeled DNA-specific oligonucleotide probes. This procedure for immobilization of amino compounds was used to manufacture MAGIChips containing both DNA and oligonucleotides.

  8. Detecting novel genes with sparse arrays

    PubMed Central

    Haiminen, Niina; Smit, Bart; Rautio, Jari; Vitikainen, Marika; Wiebe, Marilyn; Martinez, Diego; Chee, Christine; Kunkel, Joe; Sanchez, Charles; Nelson, Mary Anne; Pakula, Tiina; Saloheimo, Markku; Penttilä, Merja; Kivioja, Teemu


    Species-specific genes play an important role in defining the phenotype of an organism. However, current gene prediction methods can only efficiently find genes that share features such as sequence similarity or general sequence characteristics with previously known genes. Novel sequencing methods and tiling arrays can be used to find genes without prior information and they have demonstrated that novel genes can still be found from extensively studied model organisms. Unfortunately, these methods are expensive and thus are not easily applicable, e.g., to finding genes that are expressed only in very specific conditions. We demonstrate a method for finding novel genes with sparse arrays, applying it on the 33.9 Mb genome of the filamentous fungus Trichoderma reesei. Our computational method does not require normalisations between arrays and it takes into account the multiple-testing problem typical for analysis of microarray data. In contrast to tiling arrays, that use overlapping probes, only one 25mer microarray oligonucleotide probe was used for every 100 b. Thus, only relatively little space on a microarray slide was required to cover the intergenic regions of a genome. The analysis was done as a by-product of a conventional microarray experiment with no additional costs. We found at least 23 good candidates for novel transcripts that could code for proteins and all of which were expressed at high levels. Candidate genes were found to neighbour ire1 and cre1 and many other regulatory genes. Our simple, low-cost method can easily be applied to finding novel species-specific genes without prior knowledge of their sequence properties. PMID:20691772

  9. The EAS-1000 array

    SciTech Connect

    Khristiansen, G.B.; Fomin, IU.A.; Chasnikov, I.IA.; Ivanenko, V.M.; Efimov, N.N. )


    The requirements for a newly constructed EAS array are summarized, and the EAS-1000 array now under construction is described. The array is depicted, and its accuracy in finding EAS parameters is shown. The expected statistics in observing EAS of different energies are presented for the most important scientific problems the array is supposed to solve.

  10. Bolaamphiphile-based nanocomplex delivery of phosphorothioate gapmer antisense oligonucleotides as a treatment for Clostridium difficile.


    Hegarty, John P; Krzeminski, Jacek; Sharma, Arun K; Guzman-Villanueva, Diana; Weissig, Volkmar; Stewart, David B


    Despite being a conceptually appealing alternative to conventional antibiotics, a major challenge toward the successful implementation of antisense treatments for bacterial infections is the development of efficient oligonucleotide delivery systems. Cationic vesicles (bolasomes) composed of dequalinium chloride ("DQAsomes") have been used to deliver plasmid DNA across the cardiolipin-rich inner membrane of mitochondria. As cardiolipin is also a component of many bacterial membranes, we investigated the application of cationic bolasomes to bacteria as an oligonucleotide delivery system. Antisense sequences designed in silico to target the expression of essential genes of the bacterial pathogen, Clostridium difficile, were synthesized as 2'-O-methyl phosphorothioate gapmer antisense oligonucleotides (ASO). These antisense gapmers were quantitatively assessed for their ability to block mRNA translation using luciferase reporter and C. difficile protein expression plasmid constructs in a coupled transcription-translation system. Cationic bolaamphiphile compounds (dequalinium derivatives) of varying alkyl chain length were synthesized and bolasomes were prepared via probe sonication of an aqueous suspension. Bolasomes were characterized by particle size distribution, zeta potential, and binding capacities for anionic oligonucleotide. Bolasomes and antisense gapmers were combined to form antisense nanocomplexes. Anaerobic C. difficile log phase cultures were treated with serial doses of gapmer nanocomplexes or equivalent amounts of empty bolasomes for 24 hours. Antisense gapmers for four gene targets achieved nanomolar minimum inhibitory concentrations for C. difficile, with the lowest values observed for oligonucleotides targeting polymerase genes rpoB and dnaE. No inhibition of bacterial growth was observed from treatments at matched dosages of scrambled gapmer nanocomplexes or plain, oligonucleotide-free bolasomes compared to untreated control cultures. We describe

  11. Bolaamphiphile-based nanocomplex delivery of phosphorothioate gapmer antisense oligonucleotides as a treatment for Clostridium difficile

    PubMed Central

    Hegarty, John P; Krzeminski, Jacek; Sharma, Arun K; Guzman-Villanueva, Diana; Weissig, Volkmar; Stewart, David B


    Despite being a conceptually appealing alternative to conventional antibiotics, a major challenge toward the successful implementation of antisense treatments for bacterial infections is the development of efficient oligonucleotide delivery systems. Cationic vesicles (bolasomes) composed of dequalinium chloride (“DQAsomes”) have been used to deliver plasmid DNA across the cardiolipin-rich inner membrane of mitochondria. As cardiolipin is also a component of many bacterial membranes, we investigated the application of cationic bolasomes to bacteria as an oligonucleotide delivery system. Antisense sequences designed in silico to target the expression of essential genes of the bacterial pathogen, Clostridium difficile, were synthesized as 2′-O-methyl phosphorothioate gapmer antisense oligonucleotides (ASO). These antisense gapmers were quantitatively assessed for their ability to block mRNA translation using luciferase reporter and C. difficile protein expression plasmid constructs in a coupled transcription–translation system. Cationic bolaamphiphile compounds (dequalinium derivatives) of varying alkyl chain length were synthesized and bolasomes were prepared via probe sonication of an aqueous suspension. Bolasomes were characterized by particle size distribution, zeta potential, and binding capacities for anionic oligonucleotide. Bolasomes and antisense gapmers were combined to form antisense nanocomplexes. Anaerobic C. difficile log phase cultures were treated with serial doses of gapmer nanocomplexes or equivalent amounts of empty bolasomes for 24 hours. Antisense gapmers for four gene targets achieved nanomolar minimum inhibitory concentrations for C. difficile, with the lowest values observed for oligonucleotides targeting polymerase genes rpoB and dnaE. No inhibition of bacterial growth was observed from treatments at matched dosages of scrambled gapmer nanocomplexes or plain, oligonucleotide-free bolasomes compared to untreated control cultures. We

  12. Toll-like receptor 9 mediates CpG oligonucleotide-induced cellular invasion.


    Ilvesaro, Joanna M; Merrell, Melinda A; Li, Li; Wakchoure, Savita; Graves, David; Brooks, Sonja; Rahko, Eeva; Jukkola-Vuorinen, Arja; Vuopala, Katri S; Harris, Kevin W; Selander, Katri S


    Toll-like receptor 9 (TLR9) belongs to the innate immune system and recognizes microbial and vertebrate DNA. We showed previously that treatment with the TLR9-agonistic ODN M362 (a CpG sequence containing oligonucleotide) induces matrix metalloproteinase-13-mediated invasion in TLR9-expressing human cancer cell lines. Here, we further characterized the role of the TLR9 pathway in this process. We show that CpG oligonucleotides induce invasion in macrophages from wild-type C57/B6 and MyD88 knockout mice and in human MDA-MB-231 breast cancer cells lacking MyD88 expression. This effect was significantly inhibited in macrophages from TLR9 knockout mice and in human MDA-MB-231 breast cancer cells stably expressing TLR9 small interfering RNA or dominant-negative tumor necrosis factor receptor-associated factor 6 (TRAF6). Sequence modifications to the CpG oligonucleotides that targeted the stem loop and other secondary structures were shown to influence the invasion-inducing effect in MDA-MB-231 cells. In contrast, methylation of the cytosine residues of the parent CpG oligonucleotide did not affect the TLR9-mediated invasion compared with the unmethylated parent CpG oligonucleotide. Finally, expression of TLR9 was studied in clinical breast cancer samples and normal breast epithelium with immunohistochemistry. TLR9 staining localized in epithelial cells in both cancer and normal samples. The mean TLR9 staining intensity was significantly increased in the breast cancer cells compared with normal breast epithelial cells. In conclusion, our results suggest that TLR9 expression is increased in breast cancer and CpG oligonucleotide-induced cellular invasion is mediated via TLR9 and TRAF6, independent of MyD88. Further, our findings suggest that the structure and/or stability of DNA may influence the induction of TLR9-mediated invasion in breast cancer. PMID:18922969

  13. Oxalyl-CPG: a labile support for synthesis of sensitive oligonucleotide derivatives.

    PubMed Central

    Alul, R H; Singman, C N; Zhang, G R; Letsinger, R L


    A procedure is described for linking nucleosides covalently to controlled pore glass or cross-linked polystyrene supports by means of an oxalyl anchor. Though stable to triethylamine and diisopropylamine, the nucleoside-oxalyl link can be cleaved within a few minutes at room temperature with ammonium hydroxide in methanol. This new anchor can be used in automated synthesis of conventional oligonucleotides. The primary value, however, is that it enables one to employ solid support methodology to synthesize a variety of base-sensitive oligonucleotide derivatives, as illustrated here by synthesis of oligomers with base protecting groups intact and with methyl phosphotriester groups at the internucleoside links. PMID:2027761

  14. Sequence selective naked-eye detection of DNA harnessing extension of oligonucleotide-modified nucleotides.


    Verga, Daniela; Welter, Moritz; Marx, Andreas


    DNA polymerases can efficiently and sequence selectively incorporate oligonucleotide (ODN)-modified nucleotides and the incorporated oligonucleotide strand can be employed as primer in rolling circle amplification (RCA). The effective amplification of the DNA primer by Φ29 DNA polymerase allows the sequence-selective hybridisation of the amplified strand with a G-quadruplex DNA sequence that has horse radish peroxidase-like activity. Based on these findings we develop a system that allows DNA detection with single-base resolution by naked eye. PMID:26774580

  15. The synthesis of oligonucleotides containing a primary amino group at the 5'-terminus.

    PubMed Central

    Connolly, B A


    Oligonucleotides containing a primary amino group at their 5'-termini have been prepared and further derivatised with amino specific probes. The sequence required is prepared using standard solid phase phosphoramidite techniques and an extra round of synthesis is then performed with N-monomethoxytrityl-0-methoxydiisopropylaminophosphinyl 3-aminopropan(1)ol. After cleavage from the resin, removal of the phosphate and base protecting groups and purification gives a monomethoxytrityl-NH(CH2)3PO4-oligomer. The monomethoxytrityl group can be removed with acetic acid to give the desired amino containing oligomer. The amino group can be further derivatised with amino specific probes yielding fluorescent or biotinylated oligonucleotide products. PMID:3562247

  16. Fluorescent triplex-forming DNA oligonucleotides labeled with a thiazole orange dimer unit

    PubMed Central

    Ikeda, Shuji; Yanagisawa, Hiroyuki; Yuki, Mizue; Okamoto, Akimitsu


    Fluorescent probes for the detection of a double-stranded DNA were prepared by labeling a triplex-forming DNA oligonucleotide with a thiazole orange (TO) dimer unit. They belong to ECHO (exciton-controlled hybridization-sensitive fluorescent oligonucleotide) probes which we have previously reported. The excitonic interaction between the two TO molecules was expected to effectively suppress the background fluorescence of the probes. The applicability of the ECHO probes for the detection of double-stranded DNA was confirmed by examining the thermal stability and photophysical and kinetic properties of the DNA triplexes formed by the ECHO probes. PMID:23445822

  17. Immobilization of DNA via oligonucleotides containing an aldehyde or carboxylic acid group at the 5' terminus.

    PubMed Central

    Kremsky, J N; Wooters, J L; Dougherty, J P; Meyers, R E; Collins, M; Brown, E L


    A general method for the immobilization of DNA through its 5'-end has been developed. A synthetic oligonucleotide, modified at its 5'-end with an aldehyde or carboxylic acid, was attached to latex microspheres containing hydrazide residues. Using T4 polynucleotide ligase and an oligonucleotide splint, a single stranded 98mer was efficiently joined to the immobilized synthetic fragment. After impregnation of the latex microspheres with the fluorescent dye, Nile Red and attachment of an aldehyde 16mer, 5 X 10(5) bead-DNA conjugates could be detected with a conventional fluorimeter. Images PMID:3562241

  18. Large scale, liquid phase synthesis of oligonucleotides by the phosphoramidite approach.

    PubMed Central

    Bonora, G M; Biancotto, G; Maffini, M; Scremin, C L


    A new method for the liquid phase synthesis of oligonucleotides is described which makes use of polyethylene glycol (PEG) as soluble support and phosphoramidite derivatives as synthons. The new synthetic protocol was applied to a quite large scale production (about 100 mumoles) of such compounds up to the 20mer level. This solution method, called HELP High Efficiency Liquid Phase) Plus, appears effective in terms of speed and coupling yield and can be evaluated for the production of large amount of oligonucleotides. PMID:8464706

  19. Oligonucleotide-based label-free detection with optical microresonators: strategies and challenges.


    Toren, Pelin; Ozgur, Erol; Bayindir, Mehmet


    This review targets diversified oligonucleotide-based biodetection techniques, focusing on the use of microresonators of whispering gallery mode (WGM) type as optical biosensors mostly integrated with lab-on-a-chip systems. On-chip and microfluidics combined devices along with optical microresonators provide rapid, robust, reproducible and multiplexed biodetection abilities in considerably small volumes. We present a detailed overview of the studies conducted so far, including biodetection of various oligonucleotide biomarkers as well as deoxyribonucleic acids (DNAs), ribonucleic acids (RNAs) and proteins. We particularly advert to chemical surface modifications for specific and selective biosensing. PMID:27306702

  20. Customized oligonucleotide microchips that convert multiple genetic information to simple patterns, are portable and reusable


    Mirzabekov, Andrei; Guschin, Dmitry Y.; Chik, Valentine; Drobyshev, Aleksei; Fotin, Alexander; Yershov, Gennadiy; Lysov, Yuri


    This invention relates to using customized oligonucleotide microchips as biosensors for the detection and identification of nucleic acids specific for different genes, organisms and/or individuals in the environment, in food and in biological samples. The microchips are designed to convert multiple bits of genetic information into simpler patterns of signals that are interpreted as a unit. Because of an improved method of hybridizing oligonucleotides from samples to microchips, microchips are reusable and transportable. For field study, portable laser or bar code scanners are suitable.

  1. Solar array drive system

    NASA Technical Reports Server (NTRS)

    Berkopec, F. D.; Sturman, J. C.; Stanhouse, R. W.


    A solar array drive system consisting of a solar array drive mechanism and the corresponding solar array drive electronics is being developed. The principal feature of the solar array drive mechanism is its bidirectional capability which enables its use in mechanical redundancy. The solar array drive system is of a widely applicable design. This configuration will be tested to determine its acceptability for generic mission sets. Foremost of the testing to be performed is the testing for extended duration.

  2. Integrated infrared array technology

    NASA Technical Reports Server (NTRS)

    Goebel, J. H.; Mccreight, C. R.


    An overview of integrated infrared (IR) array technology is presented. Although the array pixel formats are smaller, and the readout noise of IR arrays is larger, than the corresponding values achieved with optical charge-coupled-device silicon technology, substantial progress is being made in IR technology. Both existing IR arrays and those being developed are described. Examples of astronomical images are given which illustrate the potential of integrated IR arrays for scientific investigations.

  3. Approach to the synthesis of natural and modified oligonucleotides by the phosphotriester method using O-nucleophilic intramolecular catalysis.


    Efimov, Vladimir A; Molchanova, Natalia S; Chakhmakhcheva, Oksana G


    An approach to the solid phase synthesis of natural and modified oligonucleotides using phosphotriester technique has been developed. Particularly, this method allows the synthesis of ribo- and deoxyribo-oligonucleotides containing various 2'-modified mononucleotides as well as stereodefined nucleotide phosphorothioate analogues. PMID:18058542

  4. A two-dimensional DNA array: the three-layer logpile.


    Malo, Jonathan; Mitchell, James C; Turberfield, Andrew J


    We describe the three-layer logpile (3LL), a two-dimensional DNA array which self-assembles from four synthetic oligonucleotides via a four-armed Holliday junction motif. It consists of three layers of helices, each running at 60 degrees to the others. DNA arrays can be used as periodic templates to create, for example, synthetic protein crystals: this array is designed to maximize structural order by ensuring that helices run continuously, without bending, through the structure. UV absorbance measurements show a rate-dependent hysteresis associated with the assembly of the 3LL. Negative-stain transmission electron microscopy (TEM) of 3LL samples shows that the arrays form extensive sheets (approximately microm(2)) and a process of iterative correlation mapping and averaging of small subsets of digitized TEM micrographs yields an averaged projection image that is consistent with a computer-generated model of the crystal. PMID:19722538

  5. Design of a tobacco exon array with application to investigate the differential cadmium accumulation property in two tobacco varieties

    PubMed Central


    Background For decades the tobacco plant has served as a model organism in plant biology to answer fundamental biological questions in the areas of plant development, physiology, and genetics. Due to the lack of sufficient coverage of genomic sequences, however, none of the expressed sequence tag (EST)-based chips developed to date cover gene expression from the whole genome. The availability of Tobacco Genome Initiative (TGI) sequences provides a useful resource to build a whole genome exon array, even if the assembled sequences are highly fragmented. Here, the design of a Tobacco Exon Array is reported and an application to improve the understanding of genes regulated by cadmium (Cd) in tobacco is described. Results From the analysis and annotation of the 1,271,256 Nicotiana tabacum fasta and quality files from methyl filtered genomic survey sequences (GSS) obtained from the TGI and ~56,000 ESTs available in public databases, an exon array with 272,342 probesets was designed (four probes per exon) and tested on two selected tobacco varieties. Two tobacco varieties out of 45 accumulating low and high cadmium in leaf were identified based on the GGE biplot analysis, which is analysis of the genotype main effect (G) plus analysis of the genotype by environment interaction (GE) of eight field trials (four fields over two years) showing reproducibility across the trials. The selected varieties were grown under greenhouse conditions in two different soils and subjected to exon array analyses using root and leaf tissues to understand the genetic make-up of the Cd accumulation. Conclusions An Affymetrix Exon Array was developed to cover a large (~90%) proportion of the tobacco gene space. The Tobacco Exon Array will be available for research use through Affymetrix array catalogue. As a proof of the exon array usability, we have demonstrated that the Tobacco Exon Array is a valuable tool for studying Cd accumulation in tobacco leaves. Data from field and greenhouse

  6. Quantitative Oligonucleotide Microarray Fingerprinting of Salmonella enterica isolates

    SciTech Connect

    Willse, Alan R.; Straub, Tim M.; Wunschel, Sharon C.; Small, Jack A.; Call, Douglas R.; Daly, Don S.; Chandler, Darrell P.


    We report on a genome-independent microbial fingerprinting method using nucleic acid microarrays for microbial forensics and epidemiology applications. We demonstrate that the microarray method provides high-resolution differentiation between closely related microorganisms using Salmonella enterica strains. In replicate trials we used a simple 192-probe nonamer array to construct a fingerprint library of 25 closely related Salmonella isolates. Controlling false discovery rate for multiple testing at alpha =.05, at least 295 of 300 pairs of S. enterica isolate fingerprints were found to be statistically distinct using a modified Hotelling Tsquared test. Although we find most pairs of Salmonella fingerprints to be distinct, forensic applications will also require a protocol for library construction and reliable microbial classification against a fingerprint library. We outline additional steps required to produce a protocol for library construction and reliable classification of unknown organisms.

  7. The illusion of specific capture: surface and solution studies of suboptimal oligonucleotide hybridization

    PubMed Central


    Background Hybridization based assays and capture systems depend on the specificity of hybridization between a probe and its intended target. A common guideline in the construction of DNA microarrays, for instance, is that avoiding complementary stretches of more than 15 nucleic acids in a 50 or 60-mer probe will eliminate sequence specific cross-hybridization reactions. Here we present a study of the behavior of partially matched oligonucleotide pairs with complementary stretches starting well below this threshold complementarity length – in silico, in solution, and at the microarray surface. The modeled behavior of pairs of oligonucleotide probes and their targets suggests that even a complementary stretch of sequence 12 nt in length would give rise to specific cross-hybridization. We designed a set of binding partners to a 50-mer oligonucleotide containing complementary stretches from 6 nt to 21 nt in length. Results Solution melting experiments demonstrate that stable partial duplexes can form when only 12 bp of complementary sequence are present; surface hybridization experiments confirm that a signal close in magnitude to full-strength signal can be obtained from hybridization of a 12 bp duplex within a 50mer oligonucleotide. Conclusions Microarray and other molecular capture strategies that rely on a 15 nt lower complementarity bound for eliminating specific cross-hybridization may not be sufficiently conservative. PMID:23445545

  8. A competitive enzyme hybridization assay for plasma determination of phosphodiester and phosphorothioate antisense oligonucleotides.

    PubMed Central

    Deverre, J R; Boutet, V; Boquet, D; Ezan, E; Grassi, J; Grognet, J M


    An enzyme competitive hybridization assay was developed and validated for determination of mouse plasma concentrations of a 15mer antisense phosphodiester oligodeoxyribonucleotide and of two phosphorothioate analogs. Assays were performed in 96-well microtiter plates. The phosphodiester sense sequence was covalently bound to the microwells. The 5'-biotinylated antisense sequence was used as tracer. The principle of the assay involves competitive hybridization of tracer and antisense nucleotide to the solid phase-immobilized sense oligonucleotide. Solid phase- bound tracer oligonucleotide was assayed after reaction with a streptavidin-acetylcholinesterase conjugate, using the colorimetric method of Ellman. As in competitive enzyme immunoassays, coloration was inversely related to the amount of analyte initially present in the sample. The limit of quantification was 900 pM for phosphodiester antisense oligonucleotide using a 100 microl volume of plasma without extraction. Cross-reactivity was negligible after a four base deletion in either the 3'or 5'position. The assay was simple and sensitive, suitable for in vitro screening of oligonucleotide hybridization potency in biological fluids and for measuring the plasma pharmacokinetics of phosphorothioate and phosphodiester sequences. PMID:9278477

  9. Understanding oligonucleotide-mediated inhibition of gene expression in Xenopus laevis oocytes

    PubMed Central

    Bailey, Cheryl; Weeks, Daniel L.


    Triplex-forming oligonucleotides (TFOs) modified with N,N-diethylethylenediamine can inhibit the expression of a reporter plasmid in Xenopus oocytes if the triplex is preformed prior to injection while unmodified oligonucleotides cannot. Here we show that merely forming a triplex in a reporter plasmid does not disrupt transcription, but when TFOs are targeted to sites within the transcribed region of a reporter gene then gene activity is inhibited. TFO-based inhibition did not lead to large scale degradation or mutation of the reporter plasmid, but dramatically lowered mRNA levels. Finally, we investigated the accessibility of a triplex target site on a reporter plasmid after injection into nuclei. We found that the site used for our previous studies was inaccessible to restriction endonuclease after injection into nuclei. This observation may explain why inhibition was dependent on forming the triplex before injection into oocytes. Based on the assumption that oligonucleotide association, like restriction enzyme access, was excluded by nucleosome formation, additional target sites were inserted so that all sites could not simultaneously be associated with the octamer core of a nucleosome. With multiple target sites prior association of the plasmid with nuclear proteins does not prevent oligonucleotide-mediated inhibition of gene activity. PMID:10666457

  10. Antisense phosphorothioate oligonucleotides: selective killing of the intracellular parasite Leishmania amazonensis.

    PubMed Central

    Ramazeilles, C; Mishra, R K; Moreau, S; Pascolo, E; Toulmé, J J


    We targeted the mini-exon sequence, present at the 5' end of every mRNA of the protozoan parasite Leishmania amazonensis, by phosphorothioate oligonucleotides. A complementary 16-mer (16PS) was able to kill amastigotes--the intracellular stage of the parasite--in murine macrophages in culture. After 24 hr of incubation with 10 microM 16PS, about 30% infected macrophages were cured. The oligomer 16PS acted through antisense hybridization in a sequence-dependent way; no effect on parasites was observed with noncomplementary phosphorothioate oligonucleotides. The antisense oligonucleotide 16PS was a selective killer of the protozoans without any detrimental effect to the host macrophage. Using 16PS linked to a palmitate chain, which enabled it to complex with low density lipoproteins, improved the leishmanicidal efficiency on intracellular amastigotes, probably due to increased endocytosis. Phosphorothioate oligonucleotides complementary to the intron part of the mini-exon pre-RNA were also effective, suggesting that antisense oligomers could prevent trans-splicing in these parasites. Images PMID:8058724

  11. A triple-helix forming oligonucleotide targeting genomic DNA fails to induce mutation.


    Reshat, Reshat; Priestley, Catherine C; Gooderham, Nigel J


    Purine tracts in duplex DNA can bind oligonucleotide strands in a sequence specific manner to form triple-helix structures. Triple-helix forming oligonucleotides (TFOs) targeting supFG1 constructs have previously been shown to be mutagenic raising safety concerns for oligonucleotide-based pharmaceuticals. We have engineered a TFO, TFO27, to target the genomic Hypoxanthine-guanine phosphoribosyltransferase (HPRT) locus to define the mutagenic potential of such structures at genomic DNA. We report that TFO27 was resistant to nuclease degradation and readily binds to its target motif in a cell free system. Contrary to previous studies using the supFG1 reporter construct, TFO27 failed to induce mutation within the genomic HPRT locus. We suggest that it is possible that previous reports of triplex-mediated mutation using the supFG1 reporter construct could be confounded by DNA quadruplex formation. Although the present study indicates that a TFO targeting a genomic locus lacks mutagenic activity, it is unclear if this finding can be generalised to all TFOs and their targets. For the present, we suggest that it is prudent to avoid large purine stretches in oligonucleotide pharmaceutical design to minimise concern regarding off-target genotoxicity. PMID:22914677

  12. Cellular Internalization of Therapeutic Oligonucleotides by Peptide Amphiphile Nanofibers and Nanospheres.


    Mumcuoglu, Didem; Sardan Ekiz, Melis; Gunay, Gokhan; Tekinay, Turgay; Tekinay, Ayse B; Guler, Mustafa O


    Oligonucleotides are promising drug candidates due to the exceptionally high specificity they exhibit toward their target DNA and RNA sequences. However, their poor pharmacokinetic and pharmacodynamic properties, in conjunction with problems associated with their internalization by cells, necessitates their delivery through specialized carrier systems for efficient therapy. Here, we investigate the effects of carrier morphology on the cellular internalization mechanisms of oligonucleotides by using self-assembled fibrous or spherical peptide nanostructures. Size and geometry were both found to be important parameters for the oligonucleotide internalization process; direct penetration was determined to be the major mechanism for the internalization of nanosphere carriers, whereas nanofibers were internalized by clathrin- and dynamin-dependent endocytosis pathways. We further showed that glucose conjugation to carrier nanosystems improved cellular internalization in cancer cells due to the enhanced glucose metabolism associated with oncogenesis, and the internalization of the glucose-conjugated peptide/oligonucleotide complexes was found to be dependent on glucose transporters present on the surface of the cell membrane. PMID:27097153

  13. Oligonucleotide microarray expression profiling of contrasting invasive phenotypes in colorectal cancer.


    Thorn, Christopher C; Williams, Deborah; Freeman, Thomas C


    This chapter refers to the application of laser-capture microdissection with oligonucleotide microarray analysis. The protocol described has been successfully used to identify differential transcript expression between contrasting colorectal cancer invasive phenotypes. Tissue processing, RNA extraction, quality control, amplification, fluorescent labelling, purification, hybridisation, and elements of data analysis are covered. PMID:21761306

  14. Poly(propylacrylic acid) enhances cationic lipid mediated delivery of antisense oligonucleotides

    PubMed Central

    Lee, Li Kim; Williams, Charity L.; Devore, David; Roth, Charles M.


    The use of antisense oligodeoxynucleotides (ODNs) to inhibit the expression of specific mRNA targets represents a powerful technology for control of gene expression. Cationic lipids and polymers are frequently used to improve the delivery of ODNs to cells, but the resulting complexes often aggregate, bind to serum components, and are trafficked poorly within cells. We show that the addition of a synthetic, pH-sensitive, membrane-disrupting polyanion, poly(propylacrylic acid) (PPAA), improves the in vitro efficiency of the cationic lipid, DOTAP, with regard to oligonucleotide delivery and antisense activity. In characterization studies, ODN complexation with DOTAP/ODN was maintained even when substantial amounts of PPAA were added. The formulation also exhibited partial protection of phosphodiester oligonucleotides against enzymatic digestion. In Chinese hamster ovary (CHO) cells, incorporation of PPAA in DOTAP/ODN complexes improved two- to threefold the cellular uptake of fluorescently tagged oligonucleotides. DOTAP/ODN complexes containing PPAA also maintained high levels of uptake into cells upon exposure to serum. Addition of PPAA to DOTAP/ODN complexes enhanced the antisense activity (using GFP as the target) over a range of PPAA concentrations in both serum-free, and to a lesser extent, serum-containing media. Thus, PPAA is a useful adjunct that improves the lipid-mediated delivery of oligonucleotides. PMID:16677032

  15. TmPrime: fast, flexible oligonucleotide design software for gene synthesis

    PubMed Central

    Bode, Marcus; Khor, Samuel; Ye, Hongye; Li, Mo-Huang; Ying, Jackie Y.


    Herein we present TmPrime, a computer program to design oligonucleotide sets for gene assembly by both ligase chain reaction (LCR) and polymerase chain reaction (PCR). TmPrime offers much flexibility with no constraints on the gene and oligonucleotide lengths. The program divides the long input DNA sequence based on the input desired melting temperature, and dynamically optimizes the length of oligonucleotides to achieve homologous melting temperatures. The output reports the melting temperatures, oligonucleotide sequences and potential formation of secondary structures. Our program also provides functions on sequence pooling to separate long genes into smaller pieces for multi-pool assembly and codon optimization for expression. The software has been successfully used in the design and synthesis of green fluorescent protein fragment (GFPuv) (760 bp), human protein kinase B-2 (PKB2) (1446 bp) and the promoter of human calcium-binding protein A4 (S100A4) (752 bp) using real-time PCR assembly with LCGreen I, which offers a novel approach to compare the efficiency of gene synthesis. The purity of assembled products is successfully estimated with the use of melting curve analysis, which would potentially eliminate the necessity for agarose gel electrophoresis. This program is freely available at PMID:19515937

  16. The prebiotic synthesis of deoxythymidine oligonucleotides. II - Comparison of condensing agents

    NASA Technical Reports Server (NTRS)

    Odom, D. G.; Brady, J. T.


    A reaction which oligomerizes nucleotides under possible prebiotic conditions has been characterized. Nucleoside monophosphate in the presence of cyanamide at acid pH condenses to form dithymidine pyrophosphate and phosphodiester bonded compounds. Imidazole compounds and activated precursors such as nucleoside triphosphate are not necessary for this oligomerization reaction which produces primarily cyclic oligonucleotides.

  17. Comparison of small molecules and oligonucleotides that target a toxic, non-coding RNA.


    Costales, Matthew G; Rzuczek, Suzanne G; Disney, Matthew D


    Potential RNA targets for chemical probes and therapeutic modalities are pervasive in the transcriptome. Oligonucleotide-based therapeutics are commonly used to target RNA sequence. Small molecules are emerging as a modality to target RNA structures selectively, but their development is still in its infancy. In this work, we compare the activity of oligonucleotides and several classes of small molecules that target the non-coding r(CCUG) repeat expansion (r(CCUG)(exp)) that causes myotonic dystrophy type 2 (DM2), an incurable disease that is the second-most common cause of adult onset muscular dystrophy. Small molecule types investigated include monomers, dimers, and multivalent compounds synthesized on-site by using RNA-templated click chemistry. Oligonucleotides investigated include phosphorothioates that cleave their target and vivo-morpholinos that modulate target RNA activity via binding. We show that compounds assembled on-site that recognize structure have the highest potencies amongst small molecules and are similar in potency to a vivo-morpholino modified oligonucleotide that targets sequence. These studies are likely to impact the design of therapeutic modalities targeting other repeats expansions that cause fragile X syndrome and amyotrophic lateral sclerosis, for example. PMID:27117425

  18. A facile inhibitor screening of SARS coronavirus N protein using nanoparticle-based RNA oligonucleotide

    PubMed Central

    Roh, Changhyun


    Hundreds of million people worldwide have been infected with severe acute respiratory syndrome (SARS), and the rate of global death from SARS has remarkably increased. Hence, the development of efficient drug treatments for the biological effects of SARS is highly needed. We have previously shown that quantum dots (QDs)-conjugated RNA oligonucleotide is sensitive to the specific recognition of the SARS-associated coronavirus (SARS-CoV) nucleocapsid (N) protein. In this study, we found that a designed biochip could analyze inhibitors of the SARS-CoV N protein using nanoparticle-based RNA oligonucleotide. Among the polyphenolic compounds examined, (−)-catechin gallate and (−)-gallocatechin gallate demonstrated a remarkable inhibition activity on SARS-CoV N protein. (−)-catechin gallate and (−)-gallocatechin gallate attenuated the binding affinity in a concentrated manner as evidenced by QDs-conjugated RNA oligonucleotide on a designed biochip. At a concentration of 0.05 μg mL−1, (−)-catechin gallate and (−)-gallocatechin gallate showed more than 40% inhibition activity on a nanoparticle-based RNA oligonucleotide biochip system. PMID:22619553

  19. Cell penetrating peptide delivery of splice directing oligonucleotides as a treatment for Duchenne muscular dystrophy.


    Betts, Corinne A; Wood, Matthew J A


    Duchenne muscular dystrophy is a severe, X-linked muscle wasting disorder caused by the absence of an integral structural protein called dystrophin. This is caused by mutations or deletions in the dystrophin gene which disrupt the reading frame, thereby halting the production of a functional protein. A number of potential therapies have been investigated for the treatment of this disease including utrophin upregulation, 'stop-codon read through' aminoglycosides and adeno-associated virus gene replacement as well as stem cell therapy. However, the most promising treatment to date is the use of antisense oligonucleotides which cause exon skipping by binding to a specific mRNA sequence, skipping the desired exon, thereby restoring the reading frame and producing a truncated yet functional protein. The results from recent 2'OMePS and morpholino clinical trials have renewed hope for Duchenne patients; however in vivo studies in a mouse model, mdx, have revealed low systemic distribution and poor delivery of oligonucleotides to affected tissues such as the brain and heart. However a variety of cell penetrating peptides directly conjugated to antisense oligonucleotides have been shown to enhance delivery in Duchenne model systems with improved systemic distribution and greater efficacy compared to 'naked' antisense oligonucleotides. These cell penetrating peptides, combined with an optimised dose and dosing regimen, as well as thorough toxicity profile have the potential to be developed into a promising treatment which may be progressed to clinical trial. PMID:23140454

  20. Efficient large-scale preparation and purification of short single-stranded RNA oligonucleotides.


    Zlobina, Maria; Sedo, Ondrej; Chou, Ming-Yuan; Slepankova, Lucia; Lukavsky, Peter J


    Sequence-specific RNA recognition by RNA-binding proteins plays a crucial role in the post-translational regulation of gene expression. Biophysical and biochemical studies help to unravel the principles of sequence-specific RNA recognition, but the methods used require large amounts of single-stranded RNA (ssRNA). Here we present a fast and robust method for large-scale preparation and purification of short ssRNA oligonucleotides for biochemical, biophysical, and structural studies. We designed an efficiently folding, self-cleaving hammerhead (HH) ribozyme to prepare ssRNA oligonucleotides. Hammerhead ribozyme RNAs self-cleave with over 95% efficiency during in vitro transcription as a function of magnesium concentration to produce high yields of the desired ssRNA products. The resulting ssRNAs can be purified from crude transcription reactions by denaturing anion-exchange chromatography and then desalted by weak anion-exchange chromatography using volatile ammonium bicarbonate buffer solutions. The ssRNA oligonucleotides produced this way are homogenous, as judged by mass spectrometry (MS), and are suitable for biochemical and biophysical studies. Moreover, for high-resolution NMR structure determination of RNA-protein complexes, our protocol enables efficient preparation of ssRNA oligonucleotides with various isotope-labeling schemes which are not commercially available. PMID:26842352

  1. Selection of optimal oligonucleotide probes for microarrays using multiple criteria, global alignment and parameter estimation

    PubMed Central

    Li, Xingyuan; He, Zhili; Zhou, Jizhong


    The oligonucleotide specificity for microarray hybridization can be predicted by its sequence identity to non-targets, continuous stretch to non-targets, and/or binding free energy to non-targets. Most currently available programs only use one or two of these criteria, which may choose ‘false’ specific oligonucleotides or miss ‘true’ optimal probes in a considerable proportion. We have developed a software tool, called CommOligo using new algorithms and all three criteria for selection of optimal oligonucleotide probes. A series of filters, including sequence identity, free energy, continuous stretch, GC content, self-annealing, distance to the 3′-untranslated region (3′-UTR) and melting temperature (Tm), are used to check each possible oligonucleotide. A sequence identity is calculated based on gapped global alignments. A traversal algorithm is used to generate alignments for free energy calculation. The optimal Tm interval is determined based on probe candidates that have passed all other filters. Final probes are picked using a combination of user-configurable piece-wise linear functions and an iterative process. The thresholds for identity, stretch and free energy filters are automatically determined from experimental data by an accessory software tool, CommOligo_PE (CommOligo Parameter Estimator). The program was used to design probes for both whole-genome and highly homologous sequence data. CommOligo and CommOligo_PE are freely available to academic users upon request. PMID:16246912

  2. Oligonucleotide and amplification fingerprinting of wild species and cultivars of banana (Musa spp.).


    Kaemmer, D; Afza, R; Weising, K; Kahl, G; Novak, F J


    DNA oligonucleotide and amplification fingerprinting have been successfully used to detect genetic polymorphisms in 15 representative species and cultivars of the genus Musa, comprising AA, AAA, AAAA, AAB, ABB, and BB genotypes. In-gel-hybridization of Hinf I-digested genomic banana DNA to the 32P-labeled synthetic oligonucleotides (GATA)4, (GTG)5, and (CA)8 revealed considerable polymorphisms between Musa species and cultivars. The fingerprint patterns proved to be somatically stable and did not show differences between individual plants of 'Grand Nain' (AAA genotype). Dendrograms based on oligonucleotide fingerprint band sharing data proved to be consistent with most of the known features of the history of banana and plantain cultivation and evolution, respectively. DNA samples from the same banana species and cultivars were also amplified by PCR using single or pairwise combinations of short oligonucleotide primers. Amplification products were separated on agarose or polyacrylamide gels and visualized by ethidium bromide or silver staining, respectively. Polymorphic patterns were obtained with some but not all primers. By using the CCCTCTGCGG primer in simplex and/or duplex PCR, the induced mutant 'GN60A' was clearly recognized from its original variety 'Grand Nain'. Both fingerprint techniques allowed the detection of bands characteristic for the A and B genome. This DNA fingerprinting technology has potential application in several areas of Musa improvement. PMID:1369000

  3. Investigating Synthetic Oligonucleotide Targeting of Mir31 in Duchenne Muscular Dystrophy.


    Hildyard, John Cw; Wells, Dominic J


    Exon-skipping via synthetic antisense oligonucleotides represents one of the most promising potential therapies for Duchenne muscular dystrophy (DMD), yet this approach is highly sequence-specific and thus each oligonucleotide is of benefit to only a subset of patients. The discovery that dystrophin mRNA is subject to translational suppression by the microRNA miR31, and that miR31 is elevated in the muscle of DMD patients, raises the possibility that the same oligonucleotide chemistries employed for exon skipping could be directed toward relieving this translational block. This approach would act synergistically with exon skipping where possible, but by targeting the 3'UTR it would further be of benefit to the many DMD patients who express low levels of in-frame transcript. We here present investigations into the feasibility of combining exon skipping with several different strategies for miR31-modulation, using both in vitro models and the mdx mouse (the classical animal model of DMD), and monitoring effects on dystrophin at the transcriptional and translational level. We show that despite promising results from our cell culture model, our in vivo data failed to demonstrate similarly reproducible enhancement of dystrophin translation, suggesting that miR31-modulation may not be practical under current oligonucleotide approaches. Possible explanations for this disappointing outcome are discussed, along with suggestions for future investigations. PMID:27525173

  4. Generation and screening of an oligonucleotide-encoded synthetic peptide library.

    PubMed Central

    Needels, M C; Jones, D G; Tate, E H; Heinkel, G L; Kochersperger, L M; Dower, W J; Barrett, R W; Gallop, M A


    We have prepared a library of approximately 10(6) different peptide sequences on small, spherical (10-microns diameter) beads by the combinatorial chemical coupling of both L- and D-amino acid building blocks. To each bead is covalently attached many copies of a single peptide sequence and, additionally, copies of a unique single-stranded oligonucleotide that codes for that peptide sequence. The oligonucleotide tags are synthesized through a parallel combinatorial procedure that effectively records the process by which the encoded peptide sequence is assembled. The collection of beads was screened for binding to a fluorescently labeled anti-peptide antibody using a fluorescence-activated cell sorting instrument. Those beads to which the antibody bound tightly were isolated by fluorescence-activated sorting, and the oligonucleotide identifiers attached to individual sorted beads were amplified by the PCR. Sequences of the amplified DNAs were determined to reveal the identity of peptide sequences that bound to the antibody with high affinity. By combining the capacity for information storage in an oligonucleotide code with the tremendous level of amplification possible through the PCR, we have devised a means for specifying the identity of each member of a vast library of molecules synthesized from both natural and unnatural chemical building blocks. In addition, we have shown that the use of flow cytometry instrumentation permits facile isolation of individual beads that bear high-affinity ligands for biological receptors. Images Fig. 2 PMID:7504279

  5. Tumor cell-targeted delivery of nanoconjugated oligonucleotides in composite spheroids.


    Carver, Kyle; Ming, Xin; Juliano, Rudy L


    Standard tissue culture has often been a poor model for predicting the efficacy of anti-cancer agents including oligonucleotides. In contrast to the simplicity of monolayer tissue cultures, a tumor mass includes tightly packed tumor cells, tortuous blood vessels, high levels of extracellular matrix, and stromal cells that support the tumor. These complexities pose a challenge for delivering therapeutic agents throughout the tumor, with many drugs limited to cells proximal to the vasculature. Multicellular tumor spheroids are superior to traditional monolayer cell culture for the assessment of cancer drug delivery, since they possess many of the characteristics of metastatic tumor foci. However, homogeneous spheroids comprised solely of tumor cells do not account for some of the key aspects of metastatic tumors, particularly the interaction with host cells such as fibroblasts. Further, homogeneous culture does not allow for the assessment of targeted delivery to tumor versus host cells. Here we have evaluated delivery of targeted and untargeted oligonucleotide nanoconjugates and of oligonucleotide polyplexes in both homogeneous and composite tumor spheroids. We find that inclusion of fibroblasts in the spheroids reduces delivery efficacy of the polyplexes. In contrast, targeted multivalent RGD-oligonucleotide nanoconjugates were able to effectively discriminate between melanoma cells and fibroblasts, thus providing tumor-selective uptake and pharmacological effects. PMID:25238564

  6. Investigating Synthetic Oligonucleotide Targeting of Mir31 in Duchenne Muscular Dystrophy

    PubMed Central

    Hildyard, John CW; Wells, Dominic J


    Exon-skipping via synthetic antisense oligonucleotides represents one of the most promising potential therapies for Duchenne muscular dystrophy (DMD), yet this approach is highly sequence-specific and thus each oligonucleotide is of benefit to only a subset of patients. The discovery that dystrophin mRNA is subject to translational suppression by the microRNA miR31, and that miR31 is elevated in the muscle of DMD patients, raises the possibility that the same oligonucleotide chemistries employed for exon skipping could be directed toward relieving this translational block. This approach would act synergistically with exon skipping where possible, but by targeting the 3’UTR it would further be of benefit to the many DMD patients who express low levels of in-frame transcript. We here present investigations into the feasibility of combining exon skipping with several different strategies for miR31-modulation, using both in vitro models and the mdx mouse (the classical animal model of DMD), and monitoring effects on dystrophin at the transcriptional and translational level. We show that despite promising results from our cell culture model, our in vivo data failed to demonstrate similarly reproducible enhancement of dystrophin translation, suggesting that miR31-modulation may not be practical under current oligonucleotide approaches. Possible explanations for this disappointing outcome are discussed, along with suggestions for future investigations. PMID:27525173

  7. A multicenter, cross-platform clinical validation study of cancer cytogenomic arrays.


    Li, Marilyn M; Monzon, Federico A; Biegel, Jaclyn A; Jobanputra, Vaidehi; Laffin, Jennifer J; Levy, Brynn; Leon, Annette; Miron, Patricia; Rossi, Michael R; Toruner, Gokce; Alvarez, Karla; Doho, Gregory; Dougherty, Margaret J; Hu, Xiaofeng; Kash, Shera; Streck, Deanna; Znoyko, Iya; Hagenkord, Jill M; Wolff, Daynna J


    Cytogenomic microarray analysis (CMA) offers high resolution, genome-wide copy number information and is widely used in clinical laboratories for diagnosis of constitutional abnormalities. The Cancer Genomics Consortium (CGC) conducted a multiplatform, multicenter clinical validation project to compare the reliability and inter- and intralaboratory reproducibility of this technology for clinical oncology applications. Four specimen types were processed on three different microarray platforms-from Affymetrix, Agilent, and Illumina. Each microarray platform was employed at two independent test sites. The results were compared in a blinded manner with current standard methods, including karyotype, FISH, or morphology. Twenty-nine chronic lymphocytic leukemia blood, 34 myelodysplastic syndrome bone marrow, and 30 fresh frozen renal epithelial tumor samples were assessed by all six laboratories. Thirty formalin fixed paraffin embedded renal tumor samples were analyzed at the Affymetrix and Agilent test sites only. All study samples were initial diagnostic samples. Array data were analyzed at each participating site and were submitted to caArray for central analysis. Laboratory interpretive results were submitted to the central analysis team for comparison with the standard-of-care assays and for calculation of intraplatform reproducibility and cross-platform concordance. The results demonstrated that the three microarray platforms 1) detect clinically actionable genomic changes in cancer compatible to standard-of-care methods; 2) further define cytogenetic aberrations; 3) identify submicroscopic alterations and loss of heterozygosity (LOH); and 4) yield consistent results within and between laboratories. Based on this study, the CGC concludes that CMA is a sensitive and reliable technique for copy number and LOH assessment that may be used for clinical oncology genomic analysis. PMID:26454669

  8. Development and characterization of a microheater array device for real-time DNA mutation detection

    NASA Astrophysics Data System (ADS)

    Williams, Layne; Okandan, Murat; Chagovetz, Alex; Blair, Steve


    DNA analysis, specifically single nucleotide polymorphism (SNP) detection, is becoming increasingly important in rapid diagnostics and disease detection. Temperature is often controlled to help speed reaction rates and perform melting of hybridized oligonucleotides. The difference in melting temperatures, Tm, between wild-type and SNP sequences, respectively, to a given probe oligonucleotide, is indicative of the specificity of the reaction. We have characterized Tm's in solution and on a solid substrate of three sequences from known mutations associated with Cystic Fibrosis. Taking advantage of Tm differences, a microheater array device was designed to enable individual temperature control of up to 18 specific hybridization events. The device was fabricated at Sandia National Laboratories using surface micromachining techniques. The microheaters have been characterized using an IR camera at Sandia and show individual temperature control with minimal thermal cross talk. Development of the device as a real-time DNA detection platform, including surface chemistry and associated microfluidics, is described.

  9. Development and characterization of a microheater array device for real-time DNA mutation detection

    NASA Astrophysics Data System (ADS)

    Williams, Layne; Okandan, Murat; Chagovetz, Alex; Blair, Steve


    DNA analysis, specifically single nucleotide polymorphism (SNP) detection, is becoming increasingly important in rapid diagnostics and disease detection. Temperature is often controlled to help speed reaction rates and perform melting of hybridized oligonucleotides. The difference in melting temperatures, Tm, between wild-type and SNP sequences, respectively, to a given probe oligonucleotide, is indicative of the specificity of the reaction. We have characterized Tm's in solution and on a solid substrate of three sequences from known mutations associated with Cystic Fibrosis. Taking advantage of Tm differences, a microheater array device was designed to enable individual temperature control of up to 18 specific hybridization events. The device was fabricated at Sandia National Laboratories using surface micromachining techniques. The microheaters have been characterized using an IR camera at Sandia and show individual temperature control with minimal thermal cross talk. Development of the device as a real-time DNA detection platform, including surface chemistry and associated microfluidics, is described.

  10. Detection of Genes Involved in Biodegradation and Biotransformation in Microbial Communities by Using 50-Mer Oligonucleotide Microarrays

    PubMed Central

    Rhee, Sung-Keun; Liu, Xueduan; Wu, Liyou; Chong, Song C.; Wan, Xiufeng; Zhou, Jizhong


    To effectively monitor biodegrading populations, a comprehensive 50-mer-based oligonucleotide microarray was developed based on most of the 2,402 known genes and pathways involved in biodegradation and metal resistance. This array contained 1,662 unique and group-specific probes with <85% similarity to their nontarget sequences. Based on artificial probes, our results showed that under hybridization conditions of 50°C and 50% formamide, the 50-mer microarray hybridization can differentiate sequences having <88% similarity. Specificity tests with representative pure cultures indicated that the designed probes on the arrays appeared to be specific to their corresponding target genes. The detection limit was ∼5 to 10 ng of genomic DNA in the absence of background DNA and 50 to 100 ng of pure-culture genomic DNA in the presence of background DNA or 1.3 × 107 cells in the presence of background RNA. Strong linear relationships between the signal intensity and the target DNA and RNA were observed (r2 = 0.95 to 0.99). Application of this type of microarray to analyze naphthalene-amended enrichment and soil microcosms demonstrated that microflora changed differently depending on the incubation conditions. While the naphthalene-degrading genes from Rhodococcus-type microorganisms were dominant in naphthalene-degrading enrichments, the genes involved in naphthalene (and polyaromatic hydrocarbon and nitrotoluene) degradation from gram-negative microorganisms, such as Ralstonia, Comamonas, and Burkholderia, were most abundant in the soil microcosms. In contrast to general conceptions, naphthalene-degrading genes from Pseudomonas were not detected, although Pseudomonas is widely known as a model microorganism for studying naphthalene degradation. The real-time PCR analysis with four representative genes showed that the microarray-based quantification was very consistent with real-time PCR (r2 = 0.74). In addition, application of the arrays to both polyaromatic

  11. Sugar radicals formed by photo-excitation of guanine cation radical in oligonucleotides

    PubMed Central

    Adhikary, Amitava; Collins, Sean; Khanduri, Deepti; Sevilla, Michael D.


    This work presents evidence that photo-excitation of guanine cation radical (G•+) in dGpdG and DNA-oligonucleotides: TGT, TGGT, TGGGT, TTGTT, TTGGTT, TTGGTTGGTT, AGA and AGGGA in frozen glassy aqueous solutions at low temperatures leads to hole transfer to the sugar phosphate backbone and results in high yields of deoxyribose radicals. In this series of oligonucleotides we find that, G•+ on photo-excitation, at 143 K leads to the formation of predominantly C5′• and C1′• with small amounts of C3′•. Photo-conversion yields of G•+ to sugar radicals in oligonucleotides decreased as the overall chain length increased. However, for high molecular weight dsDNA (salmon testes) in frozen aqueous solutions substantial conversion of G•+ to C1′• (only) sugar radical is still found (ca. 50%). Within the cohort of sugar radicals formed we find a relative increase in the formation of C1′• with length of the oligonucleotide along with decreases in C3′• and C5′• For dsDNA in frozen solutions, only the formation of C1′• is found via photo-excitation of G•+ without a significant temperature dependence (77 K to 180 K). Long wavelength visible light (>540 nm) is observed to be about as effective as light under 540 nm for photoconversion of G•+ to sugar radicals for short oligonucleotides but gradually loses effectiveness with chain length. This wavelength dependence is attributed to base-to-base hole transfer for wavelengths >540 nm. Base-to-sugar hole transfer is suggested to dominate under 540 nm. These results may have implications for a number of investigations of hole transfer through DNA in which DNA-holes are subjected to continuous visible illumination. PMID:17547448

  12. Development, Characterization and Experimental Validation of a Cultivated Sunflower (Helianthus annuus L.) Gene Expression Oligonucleotide Microarray

    PubMed Central

    Fernandez, Paula; Soria, Marcelo; Blesa, David; DiRienzo, Julio; Moschen, Sebastian; Rivarola, Maximo; Clavijo, Bernardo Jose; Gonzalez, Sergio; Peluffo, Lucila; Príncipi, Dario; Dosio, Guillermo; Aguirrezabal, Luis; García-García, Francisco; Conesa, Ana; Hopp, Esteban; Dopazo, Joaquín; Heinz, Ruth Amelia; Paniego, Norma


    Oligonucleotide-based microarrays with accurate gene coverage represent a key strategy for transcriptional studies in orphan species such as sunflower, H. annuus L., which lacks full genome sequences. The goal of this study was the development and functional annotation of a comprehensive sunflower unigene collection and the design and validation of a custom sunflower oligonucleotide-based microarray. A large scale EST (>130,000 ESTs) curation, assembly and sequence annotation was performed using Blast2GO ( The EST assembly comprises 41,013 putative transcripts (12,924 contigs and 28,089 singletons). The resulting Sunflower Unigen Resource (SUR version 1.0) was used to design an oligonucleotide-based Agilent microarray for cultivated sunflower. This microarray includes a total of 42,326 features: 1,417 Agilent controls, 74 control probes for sunflower replicated 10 times (740 controls) and 40,169 different non-control probes. Microarray performance was validated using a model experiment examining the induction of senescence by water deficit. Pre-processing and differential expression analysis of Agilent microarrays was performed using the Bioconductor limma package. The analyses based on p-values calculated by eBayes (p<0.01) allowed the detection of 558 differentially expressed genes between water stress and control conditions; from these, ten genes were further validated by qPCR. Over-represented ontologies were identified using FatiScan in the Babelomics suite. This work generated a curated and trustable sunflower unigene collection, and a custom, validated sunflower oligonucleotide-based microarray using Agilent technology. Both the curated unigene collection and the validated oligonucleotide microarray provide key resources for sunflower genome analysis, transcriptional studies, and molecular breeding for crop improvement. PMID:23110046

  13. Coupling Strategies for the Synthesis of Peptide-Oligonucleotide Conjugates for Patterned Synthetic Biomineralization

    PubMed Central

    Carter, Joshua D.; LaBean, Thomas H.


    This work describes preparation strategies for peptide-oligonucleotide conjugates that combine the self-assembling behavior of DNA oligonucleotides with the molecular recognition capabilities of peptides. The syntheses include a solution-phase fragment coupling reaction and a solid-phase fragment coupling strategy where the oligonucleotide has been immobilized on DEAE Sepharose. The yield of four coupling reagents is evaluated, two reagents in water, EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride) and DMTMM (4-(4,6-dimethoxy[1,3,5]triazin-2-yl)-4-methyl-morpholinium chloride), and two in dimethylformamide (DMF), PyBOP ((Benzotriazol-1-yloxy) tripyrrolidinophosphonium hexafluorophosphate) and HBTU (O-benzotriazole-N,N,N′,N′-tetramethyluronium hexafluorophosphate), while the oligonucleotide fragment is either in solution or immobilized on DEAE. These coupling strategies rely on an unprotected 5′ amino linker on the oligonucleotide reacting with the peptide C-terminus. The peptide, selected from a combinatorial library for its gold-binding behavior, was 12 amino acids long with an N-terminus acetyl cap. Formation of the conjugates was confirmed by gel electrophoresis and mass spectrometry while molecular recognition functionality of the peptide portion was verified using atomic force microscopy. Solution-phase yields were superior to their solid-phase counterparts. EDC resulted in the highest yield for both solution-phase (95%) and solid-phase strategies (24%), while the DMF-based reagents, PyBOP and HBTU, resulted in low yields with reduced recovery. All recoverable conjugates demonstrated gold nanoparticle templating capability. PMID:22007290

  14. Coupling strategies for the synthesis of Peptide-oligonucleotide conjugates for patterned synthetic biomineralization.


    Carter, Joshua D; Labean, Thomas H


    This work describes preparation strategies for peptide-oligonucleotide conjugates that combine the self-assembling behavior of DNA oligonucleotides with the molecular recognition capabilities of peptides. The syntheses include a solution-phase fragment coupling reaction and a solid-phase fragment coupling strategy where the oligonucleotide has been immobilized on DEAE Sepharose. The yield of four coupling reagents is evaluated, two reagents in water, EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride) and DMTMM (4-(4,6-dimethoxy[1,3,5]triazin-2-yl)-4-methyl-morpholinium chloride), and two in dimethylformamide (DMF), PyBOP ((Benzotriazol-1-yloxy) tripyrrolidinophosphonium hexafluorophosphate) and HBTU (O-benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate), while the oligonucleotide fragment is either in solution or immobilized on DEAE. These coupling strategies rely on an unprotected 5' amino linker on the oligonucleotide reacting with the peptide C-terminus. The peptide, selected from a combinatorial library for its gold-binding behavior, was 12 amino acids long with an N-terminus acetyl cap. Formation of the conjugates was confirmed by gel electrophoresis and mass spectrometry while molecular recognition functionality of the peptide portion was verified using atomic force microscopy. Solution-phase yields were superior to their solid-phase counterparts. EDC resulted in the highest yield for both solution-phase (95%) and solid-phase strategies (24%), while the DMF-based reagents, PyBOP and HBTU, resulted in low yields with reduced recovery. All recoverable conjugates demonstrated gold nanoparticle templating capability. PMID:22007290

  15. Development, characterization and experimental validation of a cultivated sunflower (Helianthus annuus L.) gene expression oligonucleotide microarray.


    Fernandez, Paula; Soria, Marcelo; Blesa, David; DiRienzo, Julio; Moschen, Sebastian; Rivarola, Maximo; Clavijo, Bernardo Jose; Gonzalez, Sergio; Peluffo, Lucila; Príncipi, Dario; Dosio, Guillermo; Aguirrezabal, Luis; García-García, Francisco; Conesa, Ana; Hopp, Esteban; Dopazo, Joaquín; Heinz, Ruth Amelia; Paniego, Norma


    Oligonucleotide-based microarrays with accurate gene coverage represent a key strategy for transcriptional studies in orphan species such as sunflower, H. annuus L., which lacks full genome sequences. The goal of this study was the development and functional annotation of a comprehensive sunflower unigene collection and the design and validation of a custom sunflower oligonucleotide-based microarray. A large scale EST (>130,000 ESTs) curation, assembly and sequence annotation was performed using Blast2GO ( The EST assembly comprises 41,013 putative transcripts (12,924 contigs and 28,089 singletons). The resulting Sunflower Unigen Resource (SUR version 1.0) was used to design an oligonucleotide-based Agilent microarray for cultivated sunflower. This microarray includes a total of 42,326 features: 1,417 Agilent controls, 74 control probes for sunflower replicated 10 times (740 controls) and 40,169 different non-control probes. Microarray performance was validated using a model experiment examining the induction of senescence by water deficit. Pre-processing and differential expression analysis of Agilent microarrays was performed using the Bioconductor limma package. The analyses based on p-values calculated by eBayes (p<0.01) allowed the detection of 558 differentially expressed genes between water stress and control conditions; from these, ten genes were further validated by qPCR. Over-represented ontologies were identified using FatiScan in the Babelomics suite. This work generated a curated and trustable sunflower unigene collection, and a custom, validated sunflower oligonucleotide-based microarray using Agilent technology. Both the curated unigene collection and the validated oligonucleotide microarray provide key resources for sunflower genome analysis, transcriptional studies, and molecular breeding for crop improvement. PMID:23110046

  16. Generating a synthetic genome by whole genome assembly: φX174 bacteriophage from synthetic oligonucleotides

    PubMed Central

    Smith, Hamilton O.; Hutchison, Clyde A.; Pfannkoch, Cynthia; Venter, J. Craig


    We have improved upon the methodology and dramatically shortened the time required for accurate assembly of 5- to 6-kb segments of DNA from synthetic oligonucleotides. As a test of this methodology, we have established conditions for the rapid (14-day) assembly of the complete infectious genome of bacteriophage φX174 (5,386 bp) from a single pool of chemically synthesized oligonucleotides. The procedure involves three key steps: (i) gel purification of pooled oligonucleotides to reduce contamination with molecules of incorrect chain length, (ii) ligation of the oligonucleotides under stringent annealing conditions (55°C) to select against annealing of molecules with incorrect sequences, and (iii) assembly of ligation products into full-length genomes by polymerase cycling assembly, a nonexponential reaction in which each terminal oligonucleotide can be extended only once to produce a full-length molecule. We observed a discrete band of full-length assemblies upon gel analysis of the polymerase cycling assembly product, without any PCR amplification. PCR amplification was then used to obtain larger amounts of pure full-length genomes for circularization and infectivity measurements. The synthetic DNA had a lower infectivity than natural DNA, indicating approximately one lethal error per 500 bp. However, fully infectious φX174 virions were recovered after electroporation into Escherichia coli. Sequence analysis of several infectious isolates verified the accuracy of these synthetic genomes. One such isolate had exactly the intended sequence. We propose to assemble larger genomes by joining separately assembled 5- to 6-kb segments; ≈60 such segments would be required for a minimal cellular genome. PMID:14657399

  17. Drop drying on surfaces determines chemical reactivity - the specific case of immobilization of oligonucleotides on microarrays

    PubMed Central


    Background Drop drying is a key factor in a wide range of technical applications, including spotted microarrays. The applied nL liquid volume provides specific reaction conditions for the immobilization of probe molecules to a chemically modified surface. Results We investigated the influence of nL and μL liquid drop volumes on the process of probe immobilization and compare the results obtained to the situation in liquid solution. In our data, we observe a strong relationship between drop drying effects on immobilization and surface chemistry. In this work, we present results on the immobilization of dye labeled 20mer oligonucleotides with and without an activating 5′-aminoheptyl linker onto a 2D epoxysilane and a 3D NHS activated hydrogel surface. Conclusions Our experiments identified two basic processes determining immobilization. First, the rate of drop drying that depends on the drop volume and the ambient relative humidity. Oligonucleotides in a dried spot react unspecifically with the surface and long reaction times are needed. 3D hydrogel surfaces allow for immobilization in a liquid environment under diffusive conditions. Here, oligonucleotide immobilization is much faster and a specific reaction with the reactive linker group is observed. Second, the effect of increasing probe concentration as a result of drop drying. On a 3D hydrogel, the increasing concentration of probe molecules in nL spotting volumes accelerates immobilization dramatically. In case of μL volumes, immobilization depends on whether the drop is allowed to dry completely. At non-drying conditions, very limited immobilization is observed due to the low oligonucleotide concentration used in microarray spotting solutions. The results of our study provide a general guideline for microarray assay development. They allow for the initial definition and further optimization of reaction conditions for the immobilization of oligonucleotides and other probe molecule classes to different

  18. Human Leukocyte Antigen Typing Using a Knowledge Base Coupled with a High-Throughput Oligonucleotide Probe Array Analysis

    PubMed Central

    Zhang, Guang Lan; Keskin, Derin B.; Lin, Hsin-Nan; Lin, Hong Huang; DeLuca, David S.; Leppanen, Scott; Milford, Edgar L.; Reinherz, Ellis L.; Brusic, Vladimir


    Human leukocyte antigens (HLA) are important biomarkers because multiple diseases, drug toxicity, and vaccine responses reveal strong HLA associations. Current clinical HLA typing is an elimination process requiring serial testing. We present an alternative in situ synthesized DNA-based microarray method that contains hundreds of thousands of probes representing a complete overlapping set covering 1,610 clinically relevant HLA class I alleles accompanied by computational tools for assigning HLA type to 4-digit resolution. Our proof-of-concept experiment included 21 blood samples, 18 cell lines, and multiple controls. The method is accurate, robust, and amenable to automation. Typing errors were restricted to homozygous samples or those with very closely related alleles from the same locus, but readily resolved by targeted DNA sequencing validation of flagged samples. High-throughput HLA typing technologies that are effective, yet inexpensive, can be used to analyze the world’s populations, benefiting both global public health and personalized health care. PMID:25505899

  19. Detection of food-borne pathogens with DNA arrays on disk.


    Arnandis-Chover, T; Morais, S; Tortajada-Genaro, L A; Puchades, R; Maquieira, Á; Berganza, J; Olabarria, G


    A DNA oligonucleotide array for duplex pathogen detection on a DVD platform is developed. The assay involves hybridization of PCR products and optical detection using compact disc technology. Different DNA array constructions for attachment of synthetic oligonucleotides on to DVD surface are evaluated, finding that streptavidin-biotin coupling method yielded the highest sensitivity in combination with enzymatic signal amplification. Issues of importance for the DNA array construction such immobilized probes design, PCR product labeling strategy and composition of the hybridization buffer were addressed. The methodology was proved scoring single nucleotide polymorphisms with high selectivity. The assay capability was also demonstrated by the identification of two pathogenic microorganisms in powder milk samples. In fifty minutes, the DVD-array system identifies Salmonella spp. and Cronobacter spp. (previously named Enterobacter sakazakii) precise and simultaneously with a sensitivity of 10(0) and 10(2) cfu/mL, respectively, in infant milk. Results were in good agreement with those obtained by quantitative real-time PCR. PMID:23158341

  20. Carbon Nanotube Nanoelectrode Array as an Electronic Chip for Ultrasensitive Label-free DNA Detection

    NASA Technical Reports Server (NTRS)

    Li, Jun; Koehne, Jessica; Chen, Hua; Cassell, Alan; Ng, Hou Tee; Fan, Wendy; Ye, Qi; Han, Jie; Meyyappan, M.


    A reliable nanoelectrode array based on vertically aligned multi-walled carbon nanotubes (MWNTs) embedded in SiO2 is used for ultrasensitive DNA detection. Characteristic nanoelectrode behavior is observed using low-density MWNT arrays for measuring both bulk and surface immobilized redox species such as K4Fe(CN)6 and ferrocene derivatives. The open-end of MWNTs are found to present similar properties as graphite edge-plane electrodes with wide potential window, flexible chemical functionalities, and good biocompatibility. BRCA1 related oligonucleotide probes with 18 bp are selectively functionalized at the open ends of the nanotube array and specifically hybridized with oligonucleotide targets incorporated with a polyG tag. The guanine groups are employed as the signal moieties in the electrochemical measurements. R(bpy)(sup 2+, sub 3) mediator is used to further amplify the guanine oxidation signal. The hybridization of sub-attomoles of DNA targets is detected electrochemically by combining the MWNT nanoelectrode array with the R(bpy)(sup 2+, sub 3) amplification mechanism. This technique was employed for direct electrochemical detection of label-free PCR amplicon from a healthy donor through specific hybridization with the BRCA1 probe. The detection limit is estimated to be less than 1000 DNA molecules since abundant guanine bases in the PCR amplicon provides a large signal. This system provides a general platform for rapid molecular diagnostics in applications requiring ultrahigh sensitivity, high-degree of miniaturization, and simple sample preparation, and low-cost operation.

  1. The Dynamics of Compound, Transcript, and Protein Effects After Treatment With 2OMePS Antisense Oligonucleotides in mdx Mice

    PubMed Central

    Verhaart, Ingrid E C; van Vliet-van den Dool, Laura; Sipkens, Jessica A; de Kimpe, Sjef J; Kolfschoten, Ingrid G M; van Deutekom, Judith C T; Liefaard, Lia; Ridings, Jim E; Hood, Steve R; Aartsma-Rus, Annemieke


    Antisense-mediated exon skipping is currently in clinical development for Duchenne muscular dystrophy (DMD) to amend the consequences of the underlying genetic defect and restore dystrophin expression. Due to turnover of compound, transcript, and protein, chronic treatment with effector molecules (antisense oligonucleotides) will be required. To investigate the dynamics and persistence of antisense 2′-O-methyl phosphorothioate oligonucleotides, exon skipping, and dystrophin expression after dosing was concluded, mdx mice were treated subcutaneously for 8 weeks with 100 mg/kg oligonucleotides twice weekly. Thereafter, mice were sacrificed at different time points after the final injection (36 hours–24 weeks). Oligonucleotide half-life was longer in heart (~65 days) compared with that in skeletal muscle, liver, and kidney (~35 days). Exon skipping half-lives varied between 33 and 53 days, whereas dystrophin protein showed a long half-life (>100 days). Oligonucleotide and exon-skipping levels peaked in the first week and declined thereafter. By contrast, dystrophin expression peaked after 3–8 weeks and then slowly declined, remaining detectable after 24 weeks. Concordance between levels of oligonucleotides, exon skipping, and proteins was observed, except in heart, wherein high oligonucleotide levels but low exon skipping and dystrophin expression were seen. Overall, these results enhance our understanding of the pharmacokinetics and pharmacodynamics of 2′-O-methyl phosphorothioate oligos used for the treatment of DMD. PMID:24549299

  2. Simple Method To Prepare Oligonucleotide-Conjugated Antibodies and Its Application in Multiplex Protein Detection in Single Cells.


    Gong, Haibiao; Holcomb, Ilona; Ooi, Aik; Wang, Xiaohui; Majonis, Daniel; Unger, Marc A; Ramakrishnan, Ramesh


    The diversity of nucleic acid sequences enables genomics studies in a highly multiplexed format. Since multiplex protein detection is still a challenge, it would be useful to use genomics tools for this purpose. This can be accomplished by conjugating specific oligonucleotides to antibodies. Upon binding of the oligonucleotide-conjugated antibodies to their targets, the protein levels can be converted to oligonucleotide levels. In this report we describe a simple method for preparing oligonucleotide-conjugated antibodies and discuss this method's application in oligonucleotide extension reaction (OER) for multiplex protein detection. Conjugation is based on strain-promoted alkyne-azide cycloaddition (the Cu-free click reaction), in which the antibody is activated with a dibenzocyclooctyne (DBCO) moiety and subsequently linked covalently with an azide-modified oligonucleotide. In the functional test, the reaction conditions and purification processes were optimized to achieve maximum yield and best performance. The OER assay employs a pair of antibody binders (two antibodies, each conjugated with its own oligonucleotide) developed for each protein target. The two oligonucleotides contain unique six-base complementary regions at their 3' prime ends to allow annealing and extension by DNA synthesis enzymes to form a DNA template. Following preamplification, the DNA template is detected by qPCR. Distinct oligonucleotide sequences are assigned to different antibody binders to enable multiplex protein detection. When tested using recombinant proteins, some antibody binders, such as those specific to CSTB, MET, EpCAM, and CASP3, had dynamic ranges of 5-6 logs. The antibody binders were also used in a multiplexed format in OER assays, and the binders successfully detected their protein targets in cell lysates, and in single cells in combination with the C1 system. This click reaction-based antibody conjugation procedure is cost-effective, needs minimal hands-on time, and

  3. A functional genomics tool for the Pacific bluefin tuna: Development of a 44K oligonucleotide microarray from whole-genome sequencing data for global transcriptome analysis.


    Yasuike, Motoshige; Fujiwara, Atushi; Nakamura, Yoji; Iwasaki, Yuki; Nishiki, Issei; Sugaya, Takuma; Shimizu, Akio; Sano, Motohiko; Kobayashi, Takanori; Ototake, Mitsuru


    Bluefin tunas are one of the most important fishery resources worldwide. Because of high market values, bluefin tuna farming has been rapidly growing during recent years. At present, the most common form of the tuna farming is based on the stocking of wild-caught fish. Therefore, concerns have been raised about the negative impact of the tuna farming on wild stocks. Recently, the Pacific bluefin tuna (PBT), Thunnus orientalis, has succeeded in completing the reproduction cycle under aquaculture conditions, but production bottlenecks remain to be solved because of very little biological information on bluefin tunas. Functional genomics approaches promise to rapidly increase our knowledge on biological processes in the bluefin tuna. Here, we describe the development of the first 44K PBT oligonucleotide microarray (oligo-array), based on whole-genome shotgun (WGS) sequencing and large-scale expressed sequence tags (ESTs) data. In addition, we also introduce an initial 44K PBT oligo-array experiment using in vitro grown peripheral blood leukocytes (PBLs) stimulated with immunostimulants such as lipopolysaccharide (LPS: a cell wall component of Gram-negative bacteria) or polyinosinic:polycytidylic acid (poly I:C: a synthetic mimic of viral infection). This pilot 44K PBT oligo-array analysis successfully addressed distinct immune processes between LPS- and poly I:C- stimulated PBLs. Thus, we expect that this oligo-array will provide an excellent opportunity to analyze global gene expression profiles for a better understanding of diseases and stress, as well as for reproduction, development and influence of nutrition on tuna aquaculture production. PMID:26477480

  4. A statistical learning approach to the modeling of chromatographic retention of oligonucleotides incorporating sequence and secondary structure data

    PubMed Central

    Sturm, Marc; Quinten, Sascha; Huber, Christian G.; Kohlbacher, Oliver


    We propose a new model for predicting the retention time of oligonucleotides. The model is based on ν support vector regression using features derived from base sequence and predicted secondary structure of oligonucleotides. Because of the secondary structure information, the model is applicable even at relatively low temperatures where the secondary structure is not suppressed by thermal denaturing. This makes the prediction of oligonucleotide retention time for arbitrary temperatures possible, provided that the target temperature lies within the temperature range of the training data. We describe different possibilities of feature calculation from base sequence and secondary structure, present the results and compare our model to existing models. PMID:17567619

  5. Thermophotovoltaic Array Optimization

    SciTech Connect

    SBurger; E Brown; K Rahner; L Danielson; J Openlander; J Vell; D Siganporia


    A systematic approach to thermophotovoltaic (TPV) array design and fabrication was used to optimize the performance of a 192-cell TPV array. The systematic approach began with cell selection criteria that ranked cells and then matched cell characteristics to maximize power output. Following cell selection, optimization continued with an array packaging design and fabrication techniques that introduced negligible electrical interconnect resistance and minimal parasitic losses while maintaining original cell electrical performance. This paper describes the cell selection and packaging aspects of array optimization as applied to fabrication of a 192-cell array.

  6. Synthesis, thermal stability and reactivity towards 9-aminoellipticine of double-stranded oligonucleotides containing a true abasic site.

    PubMed Central

    Bertrand, J R; Vasseur, J J; Rayner, B; Imbach, J L; Paoletti, J; Paoletti, C; Malvy, C


    A 13 mers abasic oligonucleotide was synthetized. It was therefore possible to compare thermal stability and reactivity of duplex oligonucleotides either with an apurinic/apyrimidinic site or without any lesion. An important decrease in the melting temperature appeared for duplexes with an abasic site. The chemical reaction of these modified oligonucleotides with the intercalating agent 9-aminoellipticine was studied by gel electrophoresis and by fluorescence. The formation of a Schiff base between 9-aminoellipticine and abasic sites was rapid and complete with duplexes at 11 degrees C. Schiff base related fluorescence and beta-elimination cleavage were more important with the apyrimidinic sites than with the apurinic ones. When compared to previous results obtained with the model d(TprpT) some unexpected behaviours appeared with longer and duplex oligonucleotides. For instance only partial beta-elimination cleavage was observed. It is likely that stacking parameters in the double helix play a great role in the studied reaction. Images PMID:2602153

  7. Conversion of adenine to 5-amino-4-pyrimidinylimidazole caused by acetyl capping during solid phase oligonucleotide synthesis.


    Rodriguez, Andrew A; Cedillo, Isaiah; McPherson, Andrew K


    The acetyl capping reaction used throughout solid phase oligonucleotide synthesis is meant to minimize n-1 deletionmer impurities by terminating sequences that fail to couple to a phosphoramidite. However, the reaction is also responsible for the formation of a number of impurities. One capping-related impurity has an additional mass of 98amu from the parent oligonucleotide. The n+98 amu impurity was found to result from modification of an adenine nucleobase. The structure of the impurity was determined by preparation of an oligonucleotide enriched in n+98 amu, enzymatic digestion to individual nucleosides, isolation of the pure nucleoside+98 amu species, crystallization, and X-ray crystallographic analysis. The n+98 amu impurity is an oligonucleotide in which one adenine residue has been converted to 5-amino-4-pyrimidinylimidazole. The mechanism of formation of the impurity was investigated, and a mechanism is proposed. PMID:27353533

  8. Crystallization of a member of the recFOR DNA repair pathway, RecO, with and without bound oligonucleotide

    SciTech Connect

    Aono, Shelly; Hartsch, Thomas; Schulze-Gahmen, Ursula


    RecFOR proteins are important for DNA repair by homologous recombination in bacteria. The RecO protein from Thermus thermophilus was cloned, purified and characterized for its binding to oligonucleotides. The protein was crystallized alone and in complex with a 14-mer oligonucleotide. Both crystal forms grow under different crystallization conditions in the same space group, P3121 or P3221, with almost identical unit cell parameters. Complete data sets were collected to 2.8 Angstrom and 2.5 Angstrom for RecO alone and the RecO-oligonucleotide complex, respectively. Visual comparison of the diffraction patterns between the two crystal forms and calculation of an Rmerge of 33.9 percent on F indicate that one of the crystal forms is indeed a complex of RecO with bound oligonucleotide.

  9. Disulfide-tethered solid supports for synthesis of photoluminescent oligonucleotide conjugates: hydrolytic stability and labeling on the support.


    Salo, H; Guzaev, A; Lönnberg, H


    Several new disulfide-tethered solid supports (S1-S5) were synthesized, and their resistance against ammonolysis was tested. Among these supports, only the one bearing an N-[15-[(4, 4'-dimethoxytrityl)oxy]-12,13-dithiapentadecanoyl] linker (S4b) tolerated ammonolysis and exhibited properties compatible with the oligonucleotide synthesis by phosphoramidite strategy. The applicability of this disulfide linker structure in postsynthetic oligonucleotide labeling on the support was demonstrated by introduction of two photoluminescent lanthanide chelates or two dansyl groups to the N4-(6-aminohexyl) amino-modified cytosine residues at the 5' end of the oligonucleotide sequence. Subsequent release of the resulting conjugates as their 3'-phosphates was achieved by reductive cleavage of the disulfide bond and precipitation of the conjugate from the solution with ethanol. The fluorescently tagged oligomer obtained showed hybridization properties similar to those of oligonucleotides labeled in solution. PMID:9576811

  10. Superconducting Bolometer Array Architectures

    NASA Technical Reports Server (NTRS)

    Benford, Dominic; Chervenak, Jay; Irwin, Kent; Moseley, S. Harvey; Shafer, Rick; Staguhn, Johannes; Wollack, Ed; Oegerle, William (Technical Monitor)


    The next generation of far-infrared and submillimeter instruments require large arrays of detectors containing thousands of elements. These arrays will necessarily be multiplexed, and superconducting bolometer arrays are the most promising present prospect for these detectors. We discuss our current research into superconducting bolometer array technologies, which has recently resulted in the first multiplexed detections of submillimeter light and the first multiplexed astronomical observations. Prototype arrays containing 512 pixels are in production using the Pop-Up Detector (PUD) architecture, which can be extended easily to 1000 pixel arrays. Planar arrays of close-packed bolometers are being developed for the GBT (Green Bank Telescope) and for future space missions. For certain applications, such as a slewed far-infrared sky survey, feedhorncoupling of a large sparsely-filled array of bolometers is desirable, and is being developed using photolithographic feedhorn arrays. Individual detectors have achieved a Noise Equivalent Power (NEP) of -10(exp 17) W/square root of Hz at 300mK, but several orders of magnitude improvement are required and can be reached with existing technology. The testing of such ultralow-background detectors will prove difficult, as this requires optical loading of below IfW. Antenna-coupled bolometer designs have advantages for large format array designs at low powers due to their mode selectivity.

  11. Evaluating bacterial activity from cell-specific ribosomal RNA content measured with oligonucleotide probes

    SciTech Connect

    Kemp, P.F.; Lee, S.; LaRoche, J.


    We describe a procedure for measuring the cell-specific quantity of ribosomal RNA (rRNA) and DNA in order to evaluate the frequency distribution of activity among cells. The procedure is inherently quantitative, does not require sample incubation and potentially can be taxon-specific. Fluorescently-labelled oligonucleotide probes are hybridized to the complementary 16S rRNA sequences in preserved, intact cells. The resulting cell fluorescence is proportional to cellular rRNA content and can be measured with a microscope-mounted photometer system, by image analysis, or by flow cytometry. Similarly, DNA content is measured as fluorescence of cells stained with the DNA specific fluorochrome DAPI. These are either prepared as separate samples for purposes of enumeration and DNA measurements, or are dual-labelled cells which are also hybridized with oligonucleotide probes.

  12. Evaluating bacterial activity from cell-specific ribosomal RNA content measured with oligonucleotide probes

    SciTech Connect

    Kemp, P.F.; Lee, S.; LaRoche, J.


    We describe a procedure for measuring the cell-specific quantity of ribosomal RNA (rRNA) and DNA in order to evaluate the frequency distribution of activity among cells. The procedure is inherently quantitative, does not require sample incubation and potentially can be taxon-specific. Fluorescently-labelled oligonucleotide probes are hybridized to the complementary 16S rRNA sequences in preserved, intact cells. The resulting cell fluorescence is proportional to cellular rRNA content and can be measured with a microscope-mounted photometer system, by image analysis, or by flow cytometry. Similarly, DNA content is measured as fluorescence of cells stained with the DNA specific fluorochrome DAPI. These are either prepared as separate samples for purposes of enumeration and DNA measurements, or are dual-labelled cells which are also hybridized with oligonucleotide probes.

  13. Efficient Targeting of Fatty-Acid Modified Oligonucleotides to Live Cell Membranes through Stepwise Assembly

    PubMed Central


    Lipid modifications provide efficient targeting of oligonucleotides to live cell membranes in a range of applications. Targeting efficiency is a function of the rate of lipid DNA insertion into the cell surface and its persistence over time. Here we show that increasing lipid hydrophobicity increases membrane persistence, but decreases the rate of membrane insertion due to the formation of nonproductive aggregates in solution. To ameliorate this effect, we split the net hydrophobicity of the membrane anchor between two complementary oligonucleotides. When prehybridized in solution, doubly anchored molecules also aggregate due to their elevated hydrophobicity. However, when added sequentially to cells, aggregation does not occur so membrane insertion is efficient. Hybridization between the two strands locks the complexes at the cell surface by increasing net hydrophobicity, increasing their total concentration and lifetime, and dramatically improving their utility in a variety of biomedical applications. PMID:25325667

  14. Chimeric bifunctional oligonucleotides as a novel tool to invade telomerase assembly

    PubMed Central

    Azhibek, Dulat; Zvereva, Maria; Zatsepin, Timofei; Rubtsova, Maria; Dontsova, Olga


    Telomerase is a key participant in the telomere length maintaining system in eukaryotic cells. Telomerase RNA and protein reverse transcriptase subunits are essential for the appearance of active telomerase in vitro. Telomerase is active in many cancer types and is a potential target for anticancer drug development. Here we report a new approach for impairing telomerase function at the stage of human telomerase assembly. The approach is based on the application of chimeric bifunctional oligonucleotides that contain two oligonucleotide parts complementary to the functional domains of telomerase RNA connected with non-nucleotide linkers in different orientations (5′-3′, 5′-5′ or 3′-3′). Such chimeras inhibited telomerase in vitro in the nM range, but were effective in vivo in sub-nM concentrations, predominantly due to their effect on telomerase assembly and dimerization. PMID:25081209

  15. Preparation of Intrastrand {G}O(6) -Alkylene-O(6) {G} Cross-Linked Oligonucleotides.


    O'Flaherty, Derek K; Wilds, Christopher J


    This unit describes the preparation O(6) -2'-deoxyguanosine-butylene-O(6) -2'-deoxyguanosine dimer phosphoramidites and precursors for incorporation of site-specific intrastrand cross-links (IaCL) into DNA oligonucleotides. Protected 2'-deoxyguanosine dimers are produced using the Mitsunobu reaction. IaCL DNA containing the intradimer phosphodiester are first chemically phosphorylated, followed by a ring-closing reaction using the condensing reagent 1-(2-mesitylenesulfonyl)-3-nitro-1H-1,2,4-triazole. Phosphoramidites are incorporated into oligonucleotides by solid-phase synthesis and standard deprotection and cleavage protocols are employed. This approach allows for the preparation of IaCL DNA substrates in amounts and purity amenable for biophysical characterization, and biochemical studies as substrates to investigate DNA repair and bypass pathways. © 2016 by John Wiley & Sons, Inc. PMID:27584704

  16. Providing Oligonucleotides with Steric Selectivity by Brush-Polymer-Assisted Compaction.


    Lu, Xueguang; Tran, Thanh-Huyen; Jia, Fei; Tan, Xuyu; Davis, Sage; Krishnan, Swathi; Amiji, Mansoor M; Zhang, Ke


    Difficult biopharmaceutical characteristics of oligonucleotides, such as poor enzymatic stability, rapid clearance by reticuloendothelial organs, immunostimulation, and coagulopathies, limit their application as therapeutics. Many of these side effects are initiated via sequence-specific or nonsequence-specific interactions with proteins. Herein, we report a novel form of brush-polymer/DNA conjugate that provides the DNA with nanoscale steric selectivity: Hybridization kinetics with complementary DNA remains nearly unaffected, but interactions with proteins are significantly retarded. The relative lengths of the brush side chain and the DNA strand are found to play a critical role in the degree of selectivity. Being able to evade protein adhesion also improves in vivo biodistribution, thus making these molecular nanostructures promising materials for oligonucleotide-based therapies. PMID:26378378

  17. Site-Specific Oligonucleotide Binding Represses Transcription of the Human c-myc Gene in vitro

    NASA Astrophysics Data System (ADS)

    Cooney, Michael; Czernuszewicz, Graznya; Postel, Edith H.; Flint, S. Jane; Hogan, Michael E.


    A 27-base-long DNA oligonucleotide was designed that binds to duplex DNA at a single site within the 5' end of the human c-myc gene, 115 base pairs upstream from the transcription origin P1. On the basis of the physical properties of its bound complex, it was concluded that the oligonucleotide forms a colinear triplex with the duplex binding site. By means of an in vitro assay system, it was possible to show a correlation between triplex formation at -115 base pairs and repression of c-myc transcription. The possibility is discussed that triplex formation (site-specific RNA binding to a DNA duplex) could serve as the basis for an alternative program of gene control in vivo.

  18. A new approach to the synthesis of the 5'-deoxy-5'-methylphosphonate linked thymidine oligonucleotide analogues.

    PubMed Central

    Szabó, T; Kers, A; Stawinski, J


    A new synthetic method for the preparation of the 5'-deoxy-5'-methylphosphonate linked thymidine oligonucleotides (5'-methylenephosphonate analogues) was developed. The method is based on the use of a phosphonate protecting group, 4-methoxy-1-oxido-2-picolyl, enabling intramolecular nucleophilic catalysis which together with the condensing agent, 2,4,6-triisopropylbenzenesulfonyl chloride, secures fast and efficient formation of the 5'-methylenephosphonate internucleosidic bonds. The produced protected oligomers were treated with thiophenol and triethylamine to remove the phosphonate protecting groups, cleaved from the solid support using concentrated aqueous ammonia, and purified by HPLC. Several thymidine oligonucleotide analogues with the chain length of up to 20 nucleotidic units, in which all internal 5'-oxygen atoms have been replaced by methylene groups directly bound to phosphorus, were synthesised using this methodology. PMID:7731801

  19. Human papilloma virus strain detection utilising custom-designed oligonucleotide microarrays.


    Ayers, Duncan; Platt, Mark; Javad, Farzad; Day, Philip J R


    Within the past 15 years, the utilisation of microarray technology for the detection of specific pathogen strains has increased rapidly. Presently, it is possible to simply purchase a pre-manufactured "off the shelf " oligonucleotide microarray bearing a wide variety of known signature DNA sequences previously identified in the organism being studied. Consequently, a hybridisation analysis may be used to pinpoint which strain/s is present in any given clinical sample. However, there exists a problem if the study necessitates the identification of novel sequences which are not represented in commercially available microarray chips. Ideally, such investigations require an in situ oligonucleotide microarray platform with the capacity to synthesise microarrays bearing probe sequences designed solely by the researcher. This chapter will focus on the employment of the Combimatrix® B3 CustomArray™ for the synthesis of reusable, bespoke microarrays for the purpose of discerning multiple Human Papilloma Virus strains. PMID:20938834

  20. Production of complex nucleic acid libraries using highly parallel in situ oligonucleotide synthesis.


    Cleary, Michele A; Kilian, Kristopher; Wang, Yanqun; Bradshaw, Jeff; Cavet, Guy; Ge, Wei; Kulkarni, Amit; Paddison, Patrick J; Chang, Kenneth; Sheth, Nihar; Leproust, Eric; Coffey, Ernest M; Burchard, Julja; McCombie, W Richard; Linsley, Peter; Hannon, Gregory J


    Generation of complex libraries of defined nucleic acid sequences can greatly aid the functional analysis of protein and gene function. Previously, such studies relied either on individually synthesized oligonucleotides or on cellular nucleic acids as the starting material. As each method has disadvantages, we have developed a rapid and cost-effective alternative for construction of small-fragment DNA libraries of defined sequences. This approach uses in situ microarray DNA synthesis for generation of complex oligonucleotide populations. These populations can be recovered and either used directly or immortalized by cloning. From a single microarray, a library containing thousands of unique sequences can be generated. As an example of the potential applications of this technology, we have tested the approach for the production of plasmids encoding short hairpin RNAs (shRNAs) targeting numerous human and mouse genes. We achieved high-fidelity clone retrieval with a uniform representation of intended library sequences. PMID:15782200

  1. Antibacterial Activity of DNA-Stabilized Silver Nanoclusters Tuned by Oligonucleotide Sequence.


    Javani, Siamak; Lorca, Romina; Latorre, Alfonso; Flors, Cristina; Cortajarena, Aitziber L; Somoza, Álvaro


    Silver nanoclusters (AgNCs) stabilized by DNA are promising materials with tunable fluorescent properties, which have been employed in a plethora of sensing systems. In this report, we explore their antimicrobial properties in Gram-positive and Gram-negative bacteria. After testing 9 oligonucleotides with different sequence and length, we found that the antibacterial activity depends on the sequence of the oligonucleotide employed. The sequences tested yielded fluorescent AgNCs, which can be grouped in blue, yellow, and red emitters. Interestingly, blue emitters yielded poor antibacterial activity, whereas yellow and red emitters afforded an activity similar to silver nitrate. Furthermore, structural studies using circular dichroism indicate the formation of complexes with different stability and structure, which might be one of the factors that modulate their activity. Finally, we prepared a trimeric structure containing the sequence that afforded the best antimicrobial activity, which inhibited the growth of Gram-positive and negative bacteria in the submicromolar range. PMID:27058628

  2. Recognition and sensing of low-epitope targets via ternary complexes with oligonucleotides and synthetic receptors

    NASA Astrophysics Data System (ADS)

    Yang, Kyung-Ae; Barbu, Mihaela; Halim, Marlin; Pallavi, Payal; Kim, Benjamin; Kolpashchikov, Dmitry M.; Pecic, Stevan; Taylor, Steven; Worgall, Tilla S.; Stojanovic, Milan N.


    Oligonucleotide-based receptors or aptamers can interact with small molecules, but the ability to achieve high-affinity and specificity of these interactions depends strongly on functional groups or epitopes displayed by the binding targets. Some classes of targets are particularly challenging: for example, monosaccharides have scarce functionalities and no aptamers have been reported to recognize, let alone distinguish from each other, glucose and other hexoses. Here we report aptamers that differentiate low-epitope targets such as glucose, fructose or galactose by forming ternary complexes with high-epitope organic receptors for monosaccharides. In a follow-up example, we expand this method to isolate high-affinity oligonucleotides against aromatic amino acids complexed in situ with a nonspecific organometallic receptor. The method is general and enables broad clinical use of aptamers for the detection of small molecules in mix-and-measure assays, as demonstrated by monitoring postprandial waves of phenylalanine in human subjects.

  3. Electronic Switch Arrays for Managing Microbattery Arrays

    NASA Technical Reports Server (NTRS)

    Mojarradi, Mohammad; Alahmad, Mahmoud; Sukumar, Vinesh; Zghoul, Fadi; Buck, Kevin; Hess, Herbert; Li, Harry; Cox, David


    Integrated circuits have been invented for managing the charging and discharging of such advanced miniature energy-storage devices as planar arrays of microscopic energy-storage elements [typically, microscopic electrochemical cells (microbatteries) or microcapacitors]. The architecture of these circuits enables implementation of the following energy-management options: dynamic configuration of the elements of an array into a series or parallel combination of banks (subarrarys), each array comprising a series of parallel combination of elements; direct addressing of individual banks for charging/or discharging; and, disconnection of defective elements and corresponding reconfiguration of the rest of the array to utilize the remaining functional elements to obtain the desited voltage and current performance. An integrated circuit according to the invention consists partly of a planar array of field-effect transistors that function as switches for routing electric power among the energy-storage elements, the power source, and the load. To connect the energy-storage elements to the power source for charging, a specific subset of switches is closed; to connect the energy-storage elements to the load for discharging, a different specific set of switches is closed. Also included in the integrated circuit is circuitry for monitoring and controlling charging and discharging. The control and monitoring circuitry, the switching transistors, and interconnecting metal lines are laid out on the integrated-circuit chip in a pattern that registers with the array of energy-storage elements. There is a design option to either (1) fabricate the energy-storage elements in the corresponding locations on, and as an integral part of, this integrated circuit; or (2) following a flip-chip approach, fabricate the array of energy-storage elements on a separate integrated-circuit chip and then align and bond the two chips together.

  4. Inhibition of certain strains of HIV-1 by cell surface polyanions in the form of cholesterol-labeled oligonucleotides

    SciTech Connect

    Ahn, Kwang-Soo; Ou, Wu; Silver, Jonathan . E-mail:


    Cholesterol-labeled oligonucleotides were found several years ago to inhibit HIV-1 in tissue culture at nanomolar concentrations. We present evidence that this is mainly due to an electrostatic interaction between polyanionic oligonucleotide concentrated at the cell surface and a positively charged region in the V3 loop of the HIV-1 envelope protein. When added to tissue culture, cholesterol-labeled oligonucleotides became concentrated at the plasma membrane and potently inhibited virus entry and cell fusion mediated by the envelope protein of some X4 strains of HIV-1, but had little effect on fusion mediated by R5 strains of HIV-1, amphotropic MLV envelope protein, or VSV-G protein. Noncholesterol-labeled oligonucleotides did not bind to the cell surface or inhibit fusion. The pattern of susceptibility to cholesterol-labeled oligonucleotides among HIV-1 strains was the same as reported for nonmembrane-associating polyanions such as dextran sulfate, but the cholesterol-labeled oligonucleotides were effective at lower concentrations. Substitution of a basic 33 amino acid V3 loop sequence from the envelope protein of a resistant strain into a susceptible strain made the envelope protein resistant to inhibition. Inhibition by cholesterol-labeled oligonucleotides was abrogated by the polycation DEAE-dextran. Cholesterol-labeled oligonucleotides bound to nonraft regions of the plasma membrane and did not inhibit HIV virus binding to cells. Many infectious agents first associate with target cells via relatively nonspecific charge interactions; our data suggest that molecules that combine a membrane-targeting motif with multiple negative charges might be useful to modify these interactions.

  5. Triple helix formation with purine-rich phosphorothioate-containing oligonucleotides covalently linked to an acridine derivative.

    PubMed Central

    Lacoste, J; François, J C; Hélène, C


    Purine-rich (GA)- and (GT)-containing oligophosphorothioates were investigated for their triplex-forming potential on a 23 bp DNA duplex target. In our system, GA-containing oligophosphorothioates (23mer GA-PS) were capable of triplex formation with binding affinities lower than (GA)-containing oligophosphodiesters (23mer GA-PO). The orientation of the third strand 23mers GA-PS and GA-PO was antiparallel to the purine strand of the duplex DNA target. In contrast, (GT)-containing oligophosphorothioates (23mer GT-PS) did not support triplex formation in either orientation, whereas the 23mer GT-PO oligophosphodiester demonstrated triplex formation in the antiparallel orientation. GA-PS oligonucleotides, in contrast to GT-PS oligonucleotides, were capable of self-association, but these self-associated structures exhibited lower stabilities than those formed with GA-PO oligonucleotides, suggesting that homoduplex formation (previously described for the 23mer GA-PO sequence by Noonberg et al.) could not fully account for the decrease in triplex stability when phosphorothioate linkages were used. The 23mer GA-PS oligonucleotide was covalently linked via its 5'-end to an acridine derivative (23mer Acr-GA-PS). In the presence of potassium cations, this conjugate demonstrated triplex formation with higher binding affinity than the unmodified 23mer GA-PS oligonucleotide and even than the 23mer GA-PO oligonucleotide. A (GA)-containing oligophosphodiester with two phosphorothioate linkages at both the 5'- and 3'-ends exhibited similar binding affinity to duplex DNA compared with the unmodified GA-PO oligophosphodiester. This capped oligonucleotide was more resistant to nucleases than the GA-PO oligomer and thus represents a good alternative for ex vivo applications of (GA)-containing, triplex-forming oligonucleotides, allowing a higher binding affinity for its duplex target without rapid cellular degradation. PMID:9115367

  6. Nonenzymatic template-directed synthesis on hairpin oligonucleotides. III - Incorporation of adenosine and uridine residues

    NASA Technical Reports Server (NTRS)

    Wu, Taifeng; Orgel, Leslie E.


    Nonenzymatic template-directed incorporation of adenosine and uridine residues into template sequences was obtained using nucleoside-5-prime phosphoro (2-methyl)imidazolides as substrates and hairpin oligonucleotides as templates. The reactions are regiospecific, producing mainly 3-prime-5-prime phosphodiester bonds. Limited synthesis of CA and AC sequences was observed along with some synthesis of the AA sequences on templates containing TG and GT sequences, along wilth some synthesis of the AA sequences on templates containing TT sequences.

  7. High-frequency genome editing using ssDNA oligonucleotides with zinc-finger nucleases

    PubMed Central

    Chen, Fuqiang; Pruett-Miller, Shondra M; Huang, Yuping; Gjoka, Monika; Duda, Katarzyna; Taunton, Jack; Collingwood, Trevor N; Frodin, Morten; Davis, Gregory D


    Zinc-finger nucleases (ZFNs) have enabled highly efficient gene targeting in multiple cell types and organisms. Here we describe methods for using simple ssDNA oligonucleotides in tandem with ZFNs to efficiently produce human cell lines with three distinct genetic outcomes: (i) targeted point mutation, (ii) targeted genomic deletion of up to 100 kb and (iii) targeted insertion of small genetic elements concomitant with large genomic deletions. PMID:21765410

  8. Simulation and visualization of flow pattern in microarrays for liquid phase oligonucleotide and peptide synthesis.


    O-Charoen, Sirimon; Srivannavit, Onnop; Gulari, Erdogan


    Microfluidic microarrays have been developed for economical and rapid parallel synthesis of oligonucleotide and peptide libraries. For a synthesis system to be reproducible and uniform, it is crucial to have a uniform reagent delivery throughout the system. Computational fluid dynamics (CFD) is used to model and simulate the microfluidic microarrays to study geometrical effects on flow patterns. By proper design geometry, flow uniformity could be obtained in every microreactor in the microarrays. PMID:17480053


    PubMed Central

    O-Charoen, Sirimon; Srivannavit, Onnop; Gulari, Erdogan


    Microfluidic microarrays have been developed for economical and rapid parallel synthesis of oligonucleotide and peptide libraries. For a synthesis system to be reproducible and uniform, it is crucial to have a uniform reagent delivery throughout the system. Computational fluid dynamics (CFD) is used to model and simulate the microfluidic microarrays to study geometrical effects on flow patterns. By proper design geometry, flow uniformity could be obtained in every microreactor in the microarrays. PMID:17480053

  10. Modular construction of plasmids through ligation-free assembly of vector components with oligonucleotide linkers.


    Vroom, Jonathan A; Wang, Clifford L


    We have developed a modular method of plasmid construction that can join multiple DNA components in a single reaction. A nicking enzyme is used to create 5' and 3' overhangs on PCR-generated DNA components. Without the use of ligase or restriction enzymes, components are joined using oligonucleotide linkers that recognize the overhangs. By specifying the sequences of the linkers, desired components can be assembled in any combination and order to generate different plasmid vectors. PMID:18533903

  11. [The simultaneous synthesis of peptides and oligonucleotides on kaolinite with the participation of aminoacyladenylates].


    Egofarova, R Kh; Vasil'eva, N V; Moiseeva, L N; Otroshchenko, V A; Pavlovskaia, T E


    A simultaneous synthesis of peptides (2-5 residues) and oligonucleotides (3-9 residues) has been carried out on caolinite matrix using amino acids and aminoacyladenylates as substrates. The rate of oligomer synthesis on mineral surface is higher than that in solution. The mechanism of synthesis has been described. The data has been discussed in connection with abiogenesis of two major types of biopolymers, proteins and nucleic acids. PMID:2347997

  12. Ultrasound-targeted antisense oligonucleotide attenuates ischemia/reperfusion-induced myocardial tumor necrosis factor-alpha.


    Erikson, John M; Freeman, Gregory L; Chandrasekar, Bysani


    Ultrasound contrast agents are now emerging as effective vehicles for delivering therapeutic agents to target tissues. In the present study, we used ultrasound-targeted, contrast-bound antisense oligonucleotides to inhibit the expression of tumor necrosis factor-alpha (TNF-alpha), a proinflammatory cytokine with negative inotropic effects. We compared the efficacy of left ventricular vs. intravenous administration and determined the optimal time for delivery. WKY rats were treated with perfluorocarbon-exposed sonicated dextrose albumin (PESDA) microspheres incubated with 100 microg of antisense oligonucleotide directed against TNF-alpha. Contrast was infused into either the superior vena cava or the left ventricular cavity along with simultaneous application of ultrasound. Twenty-four hours later, the animals underwent 15 min of ischemia and 2 h reperfusion. Control animals underwent sham operation only, ischemia/reperfusion only, or received PESDA only. A second group received treatment just prior to, or immediately after the onset of ischemia. At the end of the experimental period, hearts were removed and analyzed for TNF-alpha by northern and western blotting. While no TNF-alpha expression was detected in sham-operated animals, robust expression of TNF-alpha mRNA and protein was seen in controls treated with ultrasound and PESDA alone. In contrast, intravenous or left ventricular administration of antisense oligonucleotides significantly inhibited ischemia/reperfusion-induced TNF-alpha expression. Direct delivery into the left ventricular cavity was more effective than intravenous administration, and delivery just prior to ischemia was most effective in attenuating TNF-alpha expression. Furthermore, attenuation of TNF-alpha expression also significantly inhibited other post-ischemic inflammatory mediators including IL-1beta and intercellular adhesion molecule-1 (ICAM-1). Thus, ultrasound-targeted antisense oligonucleotides can effectively attenuate post

  13. Rapid Identification of the Genus Fonsecaea by PCR with Specific Oligonucleotide Primers

    PubMed Central

    Abliz, Paride; Fukushima, Kazutaka; Takizawa, Kayoko; Nieda, Norikazu; Miyaji, Makoto; Nishimura, Kazuko


    An oligonucleotide primer set based on internal transcribed spacer regions of ribosomal DNA for PCR which gives the amplicon for only the DNA from Fonsecaea species was designed. This set yielded an amplicon with 333 bp for all strains of Fonsecaea pedrosoi and Fonsecaea compacta examined but no amplicons for related dematiaceous fungi and pathogenic yeasts. PCR using this primer set was considered to be a useful method for the rapid identification of the genus Fonsecaea. PMID:12574304

  14. Generation of a C-3'-thymidinyl radical in single-stranded oligonucleotides under anaerobic conditions.


    Bryant-Friedrich, Amanda C


    [reaction: see text] A C-3'-thymidinyl radical has been photochemically generated site-specifically in DNA oligonucleotides. A nucleoside H-phosphonate bearing a C-3' acetyl group was incorporated into DNA oligomers using a hand-coupling technique. When nucleotides containing the modified monomer were photolyzed (> or =320 nm) in the presence of a hydrogen atom donor, reduction products were detected by RP-HPLC and MALDI-ToF MS analysis. PMID:15228271

  15. Designing linear systolic arrays

    SciTech Connect

    Kumar, V.K.P.; Tsai, Y.C. . Dept. of Electrical Engineering)


    The authors develop a simple mapping technique to design linear systolic arrays. The basic idea of the technique is to map the computations of a certain class of two-dimensional systolic arrays onto one-dimensional arrays. Using this technique, systolic algorithms are derived for problems such as matrix multiplication and transitive closure on linearly connected arrays of PEs with constant I/O bandwidth. Compared to known designs in the literature, the technique leads to modular systolic arrays with constant hardware in each PE, few control lines, lexicographic data input/output, and improved delay time. The unidirectional flow of control and data in this design assures implementation of the linear array in the known fault models of wafer scale integration.

  16. Reconfigurable mosaic annular arrays.


    Thomenius, Kai E; Wodnicki, Robert; Cogan, Scott D; Fisher, Rayette A; Burdick, Bill; Smith, L Scott; Khuri-Yakub, Pierre; Lin, Der-Song; Zhuang, Xuefeng; Bonitz, Barry; Davies, Todd; Thomas, Glen; Woychik, Charles


    Mosaic annular arrays (MAA) based on reconfigurable array (RA) transducer electronics assemblies are presented as a potential solution for future highly integrated ultrasonic transducer subsystems. Advantages of MAAs include excellent beam quality and depth of field resulting from superior elevational focus compared with 1-D electronically scanned arrays, as well as potentially reduced cost, size, and power consumption resulting from the use of a limited number of beamforming channels for processing a large number of subelements. Specific design tradeoffs for these highly integrated arrays are discussed in terms of array specifications for center frequency, element pitch, and electronic switch-on resistance. Large-area RAs essentially function as RC delay lines. Efficient architectures which take into account RC delay effects are presented. Architectures for integration of the transducer and electronics layers of large-area array implementations are reviewed. PMID:24960699

  17. Carbon nanotube nanoelectrode arrays


    Ren, Zhifeng; Lin, Yuehe; Yantasee, Wassana; Liu, Guodong; Lu, Fang; Tu, Yi


    The present invention relates to microelectode arrays (MEAs), and more particularly to carbon nanotube nanoelectrode arrays (CNT-NEAs) for chemical and biological sensing, and methods of use. A nanoelectrode array includes a carbon nanotube material comprising an array of substantially linear carbon nanotubes each having a proximal end and a distal end, the proximal end of the carbon nanotubes are attached to a catalyst substrate material so as to form the array with a pre-determined site density, wherein the carbon nanotubes are aligned with respect to one another within the array; an electrically insulating layer on the surface of the carbon nanotube material, whereby the distal end of the carbon nanotubes extend beyond the electrically insulating layer; a second adhesive electrically insulating layer on the surface of the electrically insulating layer, whereby the distal end of the carbon nanotubes extend beyond the second adhesive electrically insulating layer; and a metal wire attached to the catalyst substrate material.

  18. Solar array automation limitations

    NASA Technical Reports Server (NTRS)

    Trumble, Terry M.


    Significant progress in the automation of the spacecraft electrical power systems has been made within the past few years. This is especially important with the development of the space station and the increasing demand on the electrical power systems for future satellites. The key element of the spacecraft power system, the solar arrays which supply the power, will have to grow to supply many tens of kilowatts of power within the next twenty years. This growth will be accompanied by the problems associated with large distributed power systems. The growth of the arrays, the on-array management problems and potential solutions to array degradation or failure are discussed. Multilowatt arrays for unmanned spacecraft with comments on the implications of array degradation for manned spacecraft are discussed.

  19. Identification and classification of Oxalobacter formigenes strains by using oligonucleotide probes and primers.

    PubMed Central

    Sidhu, H; Allison, M; Peck, A B


    Genomic DNAs of various strains of Oxalobacter formigenes were subjected to restriction endonuclease fragment length polymorphism- and PCR-based amplification analyses with DNA probes and primers complementary to sequences within either the oxc gene, encoding oxalyl coenzyme A (oxalyl-CoA) decarboxylase, or the frc gene, encoding formyl-CoA transferase. Oligonucleotide probes based on nonconserved sequences of oxc or frc were able to divide O. formigenes strains into at least two groups, consistent with the current separation of O. formigenes strains into groups I and II on the basis of 16S rRNA sequence similarities and lipid content. In contrast, an oligonucleotide probe based on the conserved 5' end of oxc appeared to bind all group I and the majority of group II strains. PCR amplification of the oxc gene showed even greater sensitivity in detecting O. formigenes and provided support for further division of the strains into subgroups. In addition, these oligonucleotides failed to hybridize to or amplify PCR products from whole fecal DNA isolated from fresh stool samples from an individual not colonized with O. formigenes, indicating unique specificity. Thus, these DNA analyses permit both detection as well as classification of O. formigenes strains. PMID:9003594

  20. Rapid, high-resolution in situ hybridization histochemistry with radioiodinated synthetic oligonucleotides

    SciTech Connect

    Lewis, M.E.; Arentzen, R.; Baldino, F. Jr.


    In situ hybridization histochemistry is a valuable technique for localizing specific messenger RNA (mRNA) and detecting changes in gene expression. Generally, the mRNA of interest has been detected by probes obtained from cloned DNA and labelled to high specific activity by nick translation. Such probes have a number of disadvantages which can be circumvented by the use of short synthetic oligonucleotides designed to be complementary to a known mRNA sequence. We report here that synthetic oligonucleotides complementary to part of the mRNA coding for rat arginine-vasopressin (AVP) can be labelled to high specific activity with (/sup 125/I), using either the primer extension method with the Klenow fragment of DNA polymerase I or the 3'-tailing method with terminal deoxynucleotidyl transferase. Both AVP probes hybridized well to the magnocellular neurons of the hypothalamic paraventricular and supraoptic nuclei. A strong autoradiographic signal was present by 2 days, with grains largely confined to the perikaryon. These results compare favorably to those obtained with (/sup 32/P)- or (/sup 3/H)-labelled probes. Given the ease of the 3'-tailing method, (/sup 125/I)-labelled oligonucleotides appear to be especially useful probes for in situ hybridization histochemistry.

  1. Photocleavable Peptide-Oligonucleotide Conjugates for Protein Kinase Assays by MALDI-TOF MS†

    PubMed Central

    Zhou, Guangchang; Khan, Faraz; Dai, Qing; Sylvester, Juliesta E.; Kron, Stephen J.


    Robust methods for highly parallel, quantitative analysis of cellular protein tyrosine kinase activities may provide tools critically needed to decipher oncogenic signaling, discover new targeted drugs, diagnose cancer and monitor patients. Here, we describe proof-of-principle for a novel protein kinase assay with potential to answer these challenges. MALDI-TOF mass spectrometry provides an ideal tool for label-free multiplexed analysis of peptide phosphorylation, but is poorly matched to homogeneous assays and complex samples. Thus, we conjugated a common oligonucleotide tag to multiple peptide substrates, offering efficient capture from solution-phase kinase reactions by annealing to the complementary sequence tethered to PEG-passivated superparamagnetic microparticles. To enable reversible conjugation, we developed a novel bifunctional cross-linker allowing simple and efficient preparation of photocleavable peptide-oligonucleotide conjugates. After washing away contaminants and photorelease, MALDI-TOF analysis yielded relative phosphorylation of each peptide with high sensitivity and specificity. Validating the hybridization-mediated multiplexed kinase assay, when three peptide substrate-oligonucleotide conjugates were mixed with the tyrosine kinase c-Abl and ATP, we readily observed their differential phosphorylation yet measured a common IC50 for the Abl kinase inhibitor imatinib. This new assay enables analysis of protein kinase activities in a multiplexed format amenable to screening inhibitors against multiple kinases in parallel, an important capability for drug discovery and predictive diagnostics. PMID:22772337

  2. Synthesis of a duplex oligonucleotide containing a nitrogen mustard interstrand DNA-DNA cross-link.


    Ojwang, J O; Grueneberg, D A; Loechler, E L


    Many cancer chemotherapeutic agents react with DNA and give adducts that block DNA replication, which is thought to result in cytotoxicity, especially in rapidly proliferating cells such as cancer cells. One class of these agents is bifunctionally reactive (e.g., the nitrogen mustards) and forms DNA-DNA cross-links. It is unknown whether inter- or intrastrand cross-links are more effective at blocking DNA replication. To evaluate this, a DNA shuttle vector is being constructed with an interstrand cross-link at a unique site. In the first step of this project, a duplex oligonucleotide containing an interstrand cross-link is isolated by denaturing polyacrylamide gel electrophoresis from the reaction of nitrogen mustard with two partially complementary oligodeoxynucleotides. The purified oligonucleotide product is characterized and shown to be cross-linked in a 5'-GAC-3' 3'-CTG-5' sequence by a nitrogen mustard moiety that is bound at the N(7)-position of the guanines in the opposing strands; the glycosylic bonds of these guanine adducts are stabilized in their corresponding imidazole ring-opened form. Nitrogen mustard is shown to react with a variety of oligonucleotides and, based upon these results, its preferred targets for interstrand cross-linking are 5'-GXC-3' sequences, where X can be any of the four deoxyribonucleotide bases. PMID:2819709

  3. Targeting DNA with triplex-forming oligonucleotides to modify gene sequence.


    Simon, Philippe; Cannata, Fabio; Concordet, Jean-Paul; Giovannangeli, Carine


    Molecules that interact with DNA in a sequence-specific manner are attractive tools for manipulating gene sequence and expression. For example, triplex-forming oligonucleotides (TFOs), which bind to oligopyrimidine.oligopurine sequences via Hoogsteen hydrogen bonds, have been used to inhibit gene expression at the DNA level as well as to induce targeted mutagenesis in model systems. Recent advances in using oligonucleotides and analogs to target DNA in a sequence-specific manner will be discussed. In particular, chemical modification of TFOs has been used to improve binding to chromosomal target sequences in living cells. Various oligonucleotide analogs have also been found to expand the range of sequences amenable to manipulation, including so-called "Zorro" locked nucleic acids (LNAs) and pseudo-complementary peptide nucleic acids (pcPNAs). Finally, we will examine the potential of TFOs for directing targeted gene sequence modification and propose that synthetic nucleases, based on conjugation of sequence-specific DNA ligands to DNA damaging molecules, are a promising alternative to protein-based endonucleases for targeted gene sequence modification. PMID:18460344

  4. Lattice model of oligonucleotide hybridization in solution. II. Specificity and cooperativity

    NASA Astrophysics Data System (ADS)

    Araque, J. C.; Robert, M. A.


    Because oligonucleotides are short sequences of nucleic acid bases, their association in solution with complementary strands (hybridization) is often seen to conform to a simple two-state model. However, experimental evidence suggests that, despite their short length, oligonucleotides may hybridize through multiple states involving intermediates. We investigate whether these apparently contradictory scenarios are possible by imposing different levels of sequence specificity on a lattice model of oligonucleotides in solution, which we introduced in Part I [J. C. Araque et al., J. Chem. Phys. 134, 165103 (2011)]. We find that both multiple-intermediate (weakly cooperative) and two-state (strongly cooperative) transitions are possible and that these are directly linked to the level of sequence specificity. Sequences with low specificity hybridize (base-by-base) by way of multiple stable intermediates with increasing number of paired bases. Such intermediate states are weakly cooperative because the energetic gain from adding an additional base pair is outweighed by the conformational entropy loss. Instead, sequences with high specificity hybridize through multiple metastable intermediates which easily bridge the configurational and energetic gaps between single- and double-stranded states. These metastable intermediates interconvert with minimal loss of conformational entropy leading to a strongly cooperative hybridization. The possibility of both scenarios, multiple- and two-states, is therefore encoded in the specificity of the sequence which in turn defines the level of cooperativity.

  5. Oligonucleotide-based systems: DNA, microRNAs, DNA/RNA aptamers.


    Jolly, Pawan; Estrela, Pedro; Ladomery, Michael


    There are an increasing number of applications that have been developed for oligonucleotide-based biosensing systems in genetics and biomedicine. Oligonucleotide-based biosensors are those where the probe to capture the analyte is a strand of deoxyribonucleic acid (DNA), ribonucleic acid (RNA) or a synthetic analogue of naturally occurring nucleic acids. This review will shed light on various types of nucleic acids such as DNA and RNA (particularly microRNAs), their role and their application in biosensing. It will also cover DNA/RNA aptamers, which can be used as bioreceptors for a wide range of targets such as proteins, small molecules, bacteria and even cells. It will also highlight how the invention of synthetic oligonucleotides such as peptide nucleic acid (PNA) or locked nucleic acid (LNA) has pushed the limits of molecular biology and biosensor development to new perspectives. These technologies are very promising albeit still in need of development in order to bridge the gap between the laboratory-based status and the reality of biomedical applications. PMID:27365033

  6. In vivo tumor growth inhibition and biodistribution studies of locked nucleic acid (LNA) antisense oligonucleotides

    PubMed Central

    Fluiter, Kees; ten Asbroek, Anneloor L. M. A.; de Wissel, Marit B.; Jakobs, Marja E.; Wissenbach, Margit; Olsson, Håkan; Olsen, Otto; Oerum, Henrik; Baas, Frank


    Locked nucleic acids (LNA) are novel high-affinity DNA analogs that can be used as genotype-specific drugs. The LNA oligonucleotides (LNA PO ODNs) are very stable in vitro and in vivo without the need for a phosphorothiolated backbone. In this study we tested the biological fate and the efficacy in tumor growth inhibition of antisense oligonucleotides directed against the gene of the large subunit of RNA polymerase II (POLR2A) that are completely synthesized as LNA containing diester backbones. These full LNA oligonucleotides strongly reduce POLR2A protein levels. Full LNA PO ODNs appeared to be very stable compounds when injected into the circulation of mice. Full LNA PO ODNs were continuously administered for 14 days to tumor-bearing nude mice. Tumor growth was inhibited sequence specifically at dosages from 1 mg/kg/day. LNA PO ODNs appeared to be non-toxic at dosages <5 mg/kg/day. Biodistribution studies showed the kidneys to have the highest uptake of LNA PO ODNs and urinary secretion as the major route of clearance. This report shows that LNA PO ODNs are potent genotype-specific drugs that can inhibit tumor growth in vivo. PMID:12560491

  7. Pressure-Mediated Oligonucleotide Transfection of Rat and Human Cardiovascular Tissues

    NASA Astrophysics Data System (ADS)

    Mann, Michael J.; Gibbons, Gary H.; Hutchinson, Howard; Poston, Robert S.; Hoyt, E. Grant; Robbins, Robert C.; Dzau, Victor J.


    The application of gene therapy to human disease is currently restricted by the relatively low efficiency and potential hazards of methods of oligonucleotide or gene delivery. Antisense or transcription factor decoy oligonucleotides have been shown to be effective at altering gene expression in cell culture expreriments, but their in vivo application is limited by the efficiency of cellular delivery, the intracellular stability of the compounds, and their duration of activity. We report herein the development of a highly efficient method for naked oligodeoxynucleotide (ODN) transfection into cardiovascular tissues by using controlled, nondistending pressure without the use of viral vectors, lipid formulations, or exposure to other adjunctive, potentially hazardous substances. In this study, we have documented the ability of ex vivo, pressure-mediated transfection to achieve nuclear localization of fluorescent (FITC)-labeled ODN in approximately 90% and 50% of cells in intact human saphenous vein and rat myocardium, respectively. We have further documented that pressure-mediated delivery of antisense ODN can functionally inhibited target gene expression in both of these tissues in a sequence-specific manner at the mRNA and protein levels. This oligonucleotide transfection system may represent a safe means of achieving the intraoperative genetic engineering of failure-resistant human bypass grafts and may provide an avenue for the genetic manipulation of cardiac allograft rejection, allograft vasculopathy, or other transplant diseases.

  8. Methicillin-Resistant Bacteria Inhabiting Surface Waters Monitored by mecA-Targeted Oligonucleotide Probes.


    Seyedmonir, Elnaz; Yilmaz, Fadime; Icgen, Bulent


    Part of a 20-60 kb staphylococcal chromosome cassette called mecA encodes low-affinity penicillin-binding protein PBP2a and causes methicillin resistance. Among all methicillin-resistant bacteria, methicillin-resistant Staphylococcus aureus is a major pathogen and main concern worldwide. Although the origin of the mecA is not very well-defined, mecA homologues are also ubiquitous in methicillin-resistant non-staphylococcal bacteria. Due to the dissemination of methicillin resistance through the transmission of mecA gene among staphylococcal and non-staphylococcal bacteria inhabiting surface waters, there is a need to monitor mecA gene in these waters for public health safety. Therefore, this study aimed at monitoring mecA harboring bacteria inhabiting surface waters by using fluorescently labelled mecA-targeted oligonucleotide probes. Under the hybridization conditions of 55 % formamide and 0.020 M NaCl at 46°C, the oligonucleotide probe used in the study showed high hybridization stringency to the mecA gene targeted. The strong linear relationships observed between the signal intensity and the target gene were used to assess the population dynamics of mecA harboring isolates over a 2-year-period. The results indicated that mecA-targeted oligonucleotide probes can be effectively used for in situ monitoring of methicillin resistant isolates inhabiting surface waters. PMID:27156085

  9. Electron stimulated desorption of anions from native and brominated single stranded oligonucleotide trimers

    SciTech Connect

    Polska, Katarzyna; Rak, Janusz; Bass, Andrew D.; Cloutier, Pierre; Sanche, Leon


    We measured the low energy electron stimulated desorption (ESD) of anions from thin films of native (TXT) and bromine monosubstituted (TBrXT) oligonucleotide trimers deposited on a gold surface (T = thymidine, X = T, deoxycytidine (C), deoxyadenosine (A) or deoxyguanosine (G), Br = bromine). The desorption of H{sup -}, CH{sub 3}{sup -}/NH{sup -}, O{sup -}/NH{sub 2}{sup -}, OH{sup -}, CN{sup -}, and Br{sup -} was induced by 0 to 20 eV electrons. Dissociative electron attachment, below 12 eV, and dipolar dissociation, above 12 eV, are responsible for the formation of these anions. The comparison of the results obtained for the native and brominated trimers suggests that the main pathways of TBrXT degradation correspond to the release of the hydride and bromide anions. Significantly, the presence of bromine in oligonucleotide trimers blocks the electron-induced degradation of nuclobases as evidenced by a dramatic decrease in CN{sup -} desorption. An increase in the yields of OH{sup -} is also observed. The debromination yield of particular oligonucleotides diminishes in the following order: BrdU > BrdA > BrdG > BrdC. Based on these results, 5-bromo-2{sup '}-deoxyuridine appears to be the best radiosensitizer among the studied bromonucleosides.

  10. Targeting gene expression in the preimplantation mouse embryo using morpholino antisense oligonucleotides.


    Siddall, Laura S; Barcroft, Lisa C; Watson, Andrew J


    Morpholino antisense oligonucleotides act by blocking translation of their target gene products and are effective tools for down-regulating gene expression. The current study was conducted to define treatment conditions for the use of morpholino oligonucleotides (MOs) in mammalian preimplantation embryos, and to employ MOs to target genes and study gene function in the early embryo. For the first time, ethoxylated polyethylenimine (EPEI), Lipofectin or Lysolecithin delivery agents were employed in combination with a fluorescent control MO and an alpha-catenin specific MO, to down-regulate gene expression during murine preimplantation development. Experiments applied to both two- and eight-cell stage murine preimplantation embryos contrasted the efficacy of MO concentrations of 1, 2, 5, 10, and 20 microM and treatment delivery times of 3, 6, 24, and 48 hr. Continuous treatment of two-cell embryos with Lipofectin and 20 microM alpha-catenin MO for 48 hr resulted in a significant (P < 0.05) reduction in development to the blastocyst stage and was accompanied by a marked reduction in alpha-catenin protein. These results indicate that morpholino antisense oligonucleotides are effective tools for down-regulating gene expression during mammalian preimplantation development. PMID:12412042

  11. Targeting the r(CGG) Repeats That Cause FXTAS with Modularly Assembled Small Molecules and Oligonucleotides

    PubMed Central


    We designed small molecules that bind the structure of the RNA that causes fragile X-associated tremor ataxia syndrome (FXTAS), an incurable neuromuscular disease. FXTAS is caused by an expanded r(CGG) repeat (r(CGG)exp) that inactivates a protein regulator of alternative pre-mRNA splicing. Our designed compounds modulate r(CGG)exp toxicity in cellular models of FXTAS, and pull-down experiments confirm that they bind r(CGG)expin vivo. Importantly, compound binding does not affect translation of the downstream open reading frame (ORF). We compared molecular recognition properties of our optimal compound to oligonucleotides. Studies show that r(CGG)exp’s self-structure is a significant energetic barrier for oligonucleotide binding. A fully modified 2′-OMethyl phosphorothioate is incapable of completely reversing an FXTAS-associated splicing defect and inhibits translation of the downstream ORF, which could have deleterious effects. Taken together, these studies suggest that a small molecule that recognizes structure may be more well suited for targeting highly structured RNAs that require strand invasion by a complementary oligonucleotide. PMID:24506227

  12. Targeting the r(CGG) repeats that cause FXTAS with modularly assembled small molecules and oligonucleotides.


    Tran, Tuan; Childs-Disney, Jessica L; Liu, Biao; Guan, Lirui; Rzuczek, Suzanne; Disney, Matthew D


    We designed small molecules that bind the structure of the RNA that causes fragile X-associated tremor ataxia syndrome (FXTAS), an incurable neuromuscular disease. FXTAS is caused by an expanded r(CGG) repeat (r(CGG)(exp)) that inactivates a protein regulator of alternative pre-mRNA splicing. Our designed compounds modulate r(CGG)(exp) toxicity in cellular models of FXTAS, and pull-down experiments confirm that they bind r(CGG)(exp) in vivo. Importantly, compound binding does not affect translation of the downstream open reading frame (ORF). We compared molecular recognition properties of our optimal compound to oligonucleotides. Studies show that r(CGG)(exp)'s self-structure is a significant energetic barrier for oligonucleotide binding. A fully modified 2'-OMethyl phosphorothioate is incapable of completely reversing an FXTAS-associated splicing defect and inhibits translation of the downstream ORF, which could have deleterious effects. Taken together, these studies suggest that a small molecule that recognizes structure may be more well suited for targeting highly structured RNAs that require strand invasion by a complementary oligonucleotide. PMID:24506227

  13. Evaluation of Therapeutic Oligonucleotides for Familial Amyloid Polyneuropathy in Patient-Derived Hepatocyte-Like Cells.


    Niemietz, Christoph J; Sauer, Vanessa; Stella, Jacqueline; Fleischhauer, Lutz; Chandhok, Gursimran; Guttmann, Sarah; Avsar, Yesim; Guo, Shuling; Ackermann, Elizabeth J; Gollob, Jared; Monia, Brett P; Zibert, Andree; Schmidt, Hartmut H-J


    Familial amyloid polyneuropathy (FAP) is caused by mutations of the transthyretin (TTR) gene, predominantly expressed in the liver. Two compounds that knockdown TTR, comprising a small interfering RNA (siRNA; ALN-TTR-02) and an antisense oligonucleotide (ASO; IONIS-TTRRx), are currently being evaluated in clinical trials. Since primary hepatocytes from FAP patients are rarely available for molecular analysis and commercial tissue culture cells or animal models lack the patient-specific genetic background, this study uses primary cells derived from urine of FAP patients. Urine-derived cells were reprogrammed to induced pluripotent stem cells (iPSCs) with high efficiency. Hepatocyte-like cells (HLCs) showing typical hepatic marker expression were obtained from iPSCs of the FAP patients. TTR mRNA expression of FAP HLCs almost reached levels measured in human hepatocytes. To assess TTR knockdown, siTTR1 and TTR-ASO were introduced to HLCs. A significant downregulation (>80%) of TTR mRNA was induced in the HLCs by both oligonucleotides. TTR protein present in the cell culture supernatant of HLCs was similarly downregulated. Gene expression of other hepatic markers was not affected by the therapeutic oligonucleotides. Our data indicate that urine cells (UCs) after reprogramming and hepatic differentiation represent excellent primary human target cells to assess the efficacy and specificity of novel compounds. PMID:27584576

  14. Enzymatic assay for deoxyribonucleoside triphosphates using synthetic oligonucleotides as template primers

    SciTech Connect

    Sherman, P.A.; Fyfe, J.A. )


    The enzymatic assay for deoxyribonucleoside triphosphates has been improved by using synthetic oligonucleotides of a carefully defined sequence as template primers for DNA polymerase. High backgrounds, which limit the sensitivity of the assay when calf thymus DNA or alternating copolymers are used as template primers, were eliminated with these oligonucleotide template primers. Sensitivity was further increased by designing the template primer to incorporate multiple labeled deoxyribonucleotides per limiting unlabeled deoxyribonucleotide. Each of several DNA polymerases exhibited unique reaction characteristics with the oligonucleotide template primers, which was attributed to the differing exonuclease activities associated with these various enzymes. Assay optimization therefore included matching the polymerase with the template primer to obtain the lowest background reaction and highest sensitivity. This modified assay is particularly well suited for keeping cell sample size to a minimum in experimental protocols which generate large numbers of data points or require careful timing of sampling. With this technique, we measured the levels of all four deoxyribonucleoside triphosphates in extracts from as few as 2 x 10(4) cultured cells.

  15. Oligonucleotides labeled with single fluorophores as sensors for deoxynucleotide triphosphate binding by DNA polymerases.


    Nikiforov, Theo T


    Oligonucleotides labeled with a single fluorophore (fluorescein or tetramethylrhodamine) have been used previously as fluorogenic substrates for a number of DNA modifying enzymes. Here, it is shown that such molecules can be used as fluorogenic probes to detect the template-dependent binding of deoxynucleotide triphosphates by DNA polymerases. Two polymerases were used in this work: the Klenow fragment of the Escherichia coli DNA polymerase I and the Bacillus stearothermophilus polymerase, Bst. When complexes of these polymerases with dye-labeled hairpin-type oligonucleotides were mixed with various deoxynucleotide triphosphates in the presence of Sr²⁺ as the divalent metal cation, the formation of ternary DNA-polymerase-dNTP complexes was detected by concentration-dependent changes in the fluorescence intensities of the dyes. Fluorescein- and tetramethylrhodamine-labeled probes of identical sequences responded differently to the two polymerases. With Bst polymerase, the fluorescence intensities of all probes increased with the next correct dNTP; with Klenow polymerase, tetramethylrhodamine-labeled probes increased their fluorescence, but the intensity of fluorescein-labeled probes decreased on formation of ternary complexes with the correct incoming nucleotides. The use of Sr²⁺ as the divalent metal ion allowed the formation of catalytically inactive ternary complexes and obviated the need for using 2',3'-dideoxy-terminated oligonucleotides as would have been needed in the case of Mg²⁺ as the metal ion. PMID:24096197

  16. Bisulfite oligonucleotide-capture sequencing for targeted base- and strand-specific absolute 5-methylcytosine quantitation.


    Masser, Dustin R; Stanford, David R; Hadad, Niran; Giles, Cory B; Wren, Jonathan D; Sonntag, William E; Richardson, Arlan; Freeman, Willard M


    Epigenetic regulation through DNA methylation (5mC) plays an important role in development, aging, and a variety of diseases. Genome-wide studies of base- and strand-specific 5mC are limited by the extensive sequencing required. Targeting bisulfite sequencing to specific genomic regions through sequence capture with complimentary oligonucleotide probes retains the advantages of bisulfite sequencing while focusing sequencing reads on regions of interest, enables analysis of more samples by decreasing the amount of sequence required per sample, and provides base- and strand-specific absolute quantitation of CG and non-CG methylation levels. As an example, an oligonucleotide capture set to interrogate 5mC levels in all rat RefSeq gene promoter regions (18,814) and CG islands, shores, and shelves (18,411) was generated. Validation using whole-genome methylation standards and biological samples demonstrates enrichment of the targeted regions and accurate base-specific quantitation of CG and non-CG methylation for both forward and reverse genomic strands. A total of 170 Mb of the rat genome is covered including 6.6 million CGs and over 67 million non-CG sites, while reducing the amount of sequencing required by ~85 % as compared to existing whole-genome sequencing methods. This oligonucleotide capture targeting approach and quantitative validation workflow can also be applied to any genome of interest. PMID:27091453

  17. Selective Detection of Peptide-Oligonucleotide Heteroconjugates Utilizing Capillary HPLC-ICPMS

    NASA Astrophysics Data System (ADS)

    Catron, Brittany; Caruso, Joseph A.; Limbach, Patrick A.


    A method for the selective detection and quantification of peptide:oligonucleotide heteroconjugates, such as those generated by protein:nucleic acid cross-links, using capillary reversed-phase high performance liquid chromatography (cap-RPHPLC) coupled with inductively coupled plasma mass spectrometry detection (ICPMS) is described. The selective detection of phosphorus as 31P+, the only natural isotope, in peptide-oligonucleotide heteroconjugates is enabled by the elemental detection capabilities of the ICPMS. Mobile phase conditions that allow separation of heteroconjugates while maintaining ICPMS compatibility were investigated. We found that trifluoroacetic acid (TFA) mobile phases, used in conventional peptide separations, and hexafluoroisopropanol/triethylamine (HFIP/TEA) mobile phases, used in conventional oligonucleotide separations, both are compatible with ICPMS and enable heteroconjugate separation. The TFA-based separations yielded limits of detection (LOD) of ~40 ppb phosphorus, which is nearly seven times lower than the LOD for HFIP/TEA-based separations. Using the TFA mobile phase, 1-2 pmol of a model heteroconjugate were routinely separated and detected by this optimized capLC-ICPMS method.

  18. Electron stimulated desorption of anions from native and brominated single stranded oligonucleotide trimers

    NASA Astrophysics Data System (ADS)

    Polska, Katarzyna; Rak, Janusz; Bass, Andrew D.; Cloutier, Pierre; Sanche, Léon


    We measured the low energy electron stimulated desorption (ESD) of anions from thin films of native (TXT) and bromine monosubstituted (TBrXT) oligonucleotide trimers deposited on a gold surface (T = thymidine, X = T, deoxycytidine (C), deoxyadenosine (A) or deoxyguanosine (G), Br = bromine). The desorption of H-, CH3-/NH-, O-/NH2-, OH-, CN-, and Br- was induced by 0 to 20 eV electrons. Dissociative electron attachment, below 12 eV, and dipolar dissociation, above 12 eV, are responsible for the formation of these anions. The comparison of the results obtained for the native and brominated trimers suggests that the main pathways of TBrXT degradation correspond to the release of the hydride and bromide anions. Significantly, the presence of bromine in oligonucleotide trimers blocks the electron-induced degradation of nuclobases as evidenced by a dramatic decrease in CN- desorption. An increase in the yields of OH- is also observed. The debromination yield of particular oligonucleotides diminishes in the following order: BrdU > BrdA > BrdG > BrdC. Based on these results, 5-bromo-2'-deoxyuridine appears to be the best radiosensitizer among the studied bromonucleosides.

  19. Ultrasensitive Detection of Ebola Virus Oligonucleotide Based on Upconversion Nanoprobe/Nanoporous Membrane System.


    Tsang, Ming-Kiu; Ye, WeiWei; Wang, Guojing; Li, Jingming; Yang, Mo; Hao, Jianhua


    Ebola outbreaks are currently of great concern, and therefore, development of effective diagnosis methods is urgently needed. The key for lethal virus detection is high sensitivity, since early-stage detection of virus may increase the probability of survival. Here, we propose a luminescence scheme of assay consisting of BaGdF5:Yb/Er upconversion nanoparticles (UCNPs) conjugated with oligonucleotide probe and gold nanoparticles (AuNPs) linked with target Ebola virus oligonucleotide. As a proof of concept, a homogeneous assay was fabricated and tested, yielding a detection limit at picomolar level. The luminescence resonance energy transfer is ascribed to the spectral overlapping of upconversion luminescence and the absorption characteristics of AuNPs. Moreover, we anchored the UCNPs and AuNPs on a nanoporous alumina (NAAO) membrane to form a heterogeneous assay. Importantly, the detection limit was greatly improved, exhibiting a remarkable value at the femtomolar level. The enhancement is attributed to the increased light-matter interaction throughout the nanopore walls of the NAAO membrane. The specificity test suggested that the nanoprobes were specific to Ebola virus oligonucleotides. The strategy combining UCNPs, AuNPs, and NAAO membrane provides new insight into low-cost, rapid, and ultrasensitive detection of different diseases. Furthermore, we explored the feasibility of clinical application by using inactivated Ebola virus samples. The detection results showed great potential of our heterogeneous design for practical application. PMID:26720408

  20. Detection of Glucose with Atomic Absorption Spectroscopy by Using Oligonucleotide Functionalized Gold Nanoparticle.


    Zhang, Hong; Yan, Honglian; Ling, Liansheng


    A novel method for the detection of glucose was established with atomic absorption spectroscopy by using the label of gold nanoparticle (AuNP). Silver-coated glass assembled with oligonucleotide 5'-SH-T12-AGA CAA GAG AGG-3' (Oligo 1) was acted as separation probe, oligonucleotide 5'-CAA CAG AGA ACG-T12-SH-3' modified gold nanoparticle (AuNP-Oligo 2) was acted as signal-reporting probe. Oligonucleotide 5'-CGT TCT CTG TTG CCT CTC TTG TCT-3' (Oligo 3) could hybridize with Oligo 1 on the surface of silver-coated glass and AuNP-Oligo 2, and free AuNP-Oligo 2 could be removed by rinsing with buffer. Hence the concentration of Oligo 3 was transformed into the concentration of gold element. In addition, Oligo 3 could be cleaved into DNA fragments by glucose, glucose oxidase and Fe(2+)-EDTA through Fenton reaction. Thereby the concentration of glucose could be transformed to the absorbance of gold element. Under the optimum conditions, the integrated absorbance decreased proportionally to the concentration of glucose over the range from 50.0 μM to 1.0 mM with a detection limit of 40.0 μM. Moreover, satisfactory result was obtained when the assay was used to determinate glucose in human serum. PMID:27427698

  1. Vesicles tethered to microbubbles by hybridized DNA oligonucleotides: Flow cytometry analysis of this new drug delivery vehicle design

    PubMed Central

    Lozano, Monica M.; Starkel, Cambrie D.; Longo, Marjorie L.


    Hybridization of complementary lipid-linked DNA oligonucleotides was used to tether small unilamellar vesicles (SUVs) to the lipid monolayer shells of air-microbubbles, a new attachment design for a drug delivery vehicle to be used in tandem with ultrasound imaging. Flow cytometry was used and a novel analysis was developed, based upon light scattering and fluorescence intensity, to quantify the fraction of microbubbles of chosen size-ranges with oligonucleotide-tethered fluorescently labeled SUVs. Fluorescence microscopy was used to verify that our methodology results in successful high-density SUV tethering to a similar fraction of the microbubbles when compared to the flow cytometry statistics. The fraction of successful tetherings increased with the concentration of the complementary lipid-linked oligonucleotide as expected and decreased with the time that microbubbles were incubated with SUVs, which was not expected. Also unexpected, a large fraction of microbubbles had only background fluorescence levels while a much smaller fraction (at most one-eighth, for the shortest incubation and highest concentration of lipid-linked oligonucleotide) had oligonucleotide-tethered fluorescently labeled SUVs and, according to our fluorescence microscopy, that small fraction was densely covered with SUVs. Ejection of the lipid-linked oligonucleotide during high surface pressure compression of the monolayer shells of actively shrinking microbubbles subjected to the Laplace overpressure is speculated as a qualitatively explanation for the statistics. PMID:20229988

  2. In vivo transcription of a progesterone-responsive gene is specifically inhibited by a triplex-forming oligonucleotide.

    PubMed Central

    Ing, N H; Beekman, J M; Kessler, D J; Murphy, M; Jayaraman, K; Zendegui, J G; Hogan, M E; O'Malley, B W; Tsai, M J


    Oligonucleotides provide novel reagents for inhibition of gene expression because of their high affinity binding to specific nucleotide sequences. We describe a 38 base, single-stranded DNA that forms a triple helix or 'triplex' on progesterone response elements of a target gene. This triplex-forming oligonucleotide binds with a Kd = 100 nM at 37 degrees C and physiological pH, and blocks binding of progesterone receptors to the target. Furthermore, it completely inhibited progesterone receptor-dependent transcription in vitro. To approach in vivo conditions, triplex-forming oligonucleotides were tested in cell transfection studies. The derivation of the oligonucleotides with cholesterol enhanced their cellular uptake and nuclear concentration by at least four-fold. The cholesterol-derivatized triplex-forming oligonucleotide specifically inhibited transcription of the PRE-containing reporter gene in cells when applied to the medium at micromolar concentrations. This is the first demonstration of steroid-responsive gene inhibition by triplex formation and joins the growing body of evidence indicating that oligonucleotides have therapeutic potential. Images PMID:8332487

  3. Discovery and Development of the G-rich Oligonucleotide AS1411 as a Novel Treatment for Cancer

    PubMed Central

    Bates, Paula J.; Laber, Damian A.; Miller, Donald M.; Thomas, Shelia D.; Trent, John O.


    Certain guanine-rich (G-rich) DNA and RNA molecules can associate intermolecularly or intramolecularly to form four stranded or “quadruplex” structures, which have unusual biophysical and biological properties. Several synthetic G-rich quadruplex-forming oligodeoxynucleotides have recently been investigated as therapeutic agents for various human diseases. We refer to these biologically active G-rich oligonucleotides as aptamers because their activities arise from binding to protein targets via shape-specific recognition (analogous to antibody-antigen binding). As therapeutic agents, the G-rich aptamers may have some advantages over monoclonal antibodies and other oligonucleotide-based approaches. For example, quadruplex oligonucleotides are non-immunogenic, heat stable and they have increased resistance to serum nucleases and enhanced cellular uptake compared to unstructured sequences. In this review, we describe the characteristics and activities of G-rich oligonucleotides. We also give a personal perspective on the discovery and development of AS1411, an antiproliferative G-rich phosphodiester oligonucleotide that is currently being tested as an anticancer agent in Phase II clinical trials. This molecule functions as an aptamer to nucleolin, a multifunctional protein that is highly expressed by cancer cells, both intracellularly and on the cell surface. Thus, the serendipitous discovery of the G-rich oligonucleotides also led to the identification of nucleolin as a new molecular target for cancer therapy. PMID:19454272

  4. A facile and sensitive electrochemiluminescence biosensor for Hg2+ analysis based on a dual-function oligonucleotide probe.


    Huang, Rong-Fu; Liu, Hui-Xin; Gai, Qi-Qi; Liu, Gai-Juan; Wei, Zheng


    In this study, a sensitive electrochemiluminescent (ECL) biosensor for the detection of Hg(2+) was easily prepared by self-assembling mercury-specific oligonucleotide on the surface of gold nanoparticles (AuNPs) modified indium tin oxide (ITO) electrode. A conformation change of the oligonucleotide from linear chain to hairpin occurs upon the binding of Hg(2+) through thymine-Hg(2+)-thymine coordination. The dual-function oligonucleotide serves as the probe to Hg(2+) but also a carrier of signal-generating molecules, [Ru(bpy)2(dppz)](BF4)2. It was estimated that one oligonucleotide was able to load with eight ECL signal molecules; a ratio of four or five oligonucleotides per gold nanoparticle was obtained basing on the calculation with surface density. Without tedious multiple-labeling procedures and special modification of oligonucleotide probe for signal transduction/amplification, a detection limit of 5.1 pM Hg(2+) was outstanding from the interference of other ten metal ions. Results of spiked water samples were in good agreement with that obtained by atomic fluorescent spectrometry. PMID:25909339

  5. Oligonucleotide and Parylene Surface Coating of Polystyrene and ePTFE for Improved Endothelial Cell Attachment and Hemocompatibility

    PubMed Central

    Schleicher, Martina; Hansmann, Jan; Elkin, Bentsian; Kluger, Petra J.; Liebscher, Simone; Huber, Agnes J. T.; Fritze, Olaf; Schille, Christine; Müller, Michaela; Schenke-Layland, Katja; Seifert, Martina; Walles, Heike; Wendel, Hans-Peter; Stock, Ulrich A.


    In vivo self-endothelialization by endothelial cell adhesion on cardiovascular implants is highly desirable. DNA-oligonucleotides are an intriguing coating material with nonimmunogenic characteristics and the feasibility of easy and rapid chemical fabrication. The objective of this study was the creation of cell adhesive DNA-oligonucleotide coatings on vascular implant surfaces. DNA-oligonucleotides immobilized by adsorption on parylene (poly(monoaminomethyl-para-xylene)) coated polystyrene and ePTFE were resistant to high shear stress (9.5 N/m2) and human blood serum for up to 96 h. Adhesion of murine endothelial progenitor cells, HUVECs and endothelial cells from human adult saphenous veins as well as viability over a period of 14 days of HUVECs on oligonucleotide coated samples under dynamic culture conditions was significantly enhanced (P < 0.05). Oligonucleotide-coated surfaces revealed low thrombogenicity and excellent hemocompatibility after incubation with human blood. These properties suggest the suitability of immobilization of DNA-oligonucleotides for biofunctionalization of blood vessel substitutes for improved in vivo endothelialization. PMID:22481939

  6. Pacific Array (Transportable Broadband Ocean Floor Array)

    NASA Astrophysics Data System (ADS)

    Kawakatsu, Hitoshi; Ekstrom, Goran; Evans, Rob; Forsyth, Don; Gaherty, Jim; Kennett, Brian; Montagner, Jean-Paul; Utada, Hisashi


    Based on recent developments on broadband ocean bottom seismometry, we propose a next generation large-scale array experiment in the ocean. Recent advances in ocean bottom broadband seismometry1, together with advances in the seismic analysis methodology, have enabled us to resolve the regional 1-D structure of the entire lithosphere/asthenosphere system, including seismic anisotropy (azimuthal, and hopefully radial), with deployments of ~15 broadband ocean bottom seismometers (BBOBSs). Having ~15 BBOBSs as an array unit for a 2-year deployment, and repeating such deployments in a leap-frog way or concurrently (an array of arrays) for a decade or so would enable us to cover a large portion of the Pacific basin. Such efforts, not only by giving regional constraints on the 1-D structure beneath Pacific ocean, but also by sharing waveform data for global scale waveform tomography, would drastically increase our knowledge of how plate tectonics works on this planet, as well as how it worked for the past 150 million years. International collaborations is essential: if three countries/institutions participate this endeavor together, Pacific Array may be accomplished within five-or-so years.

  7. Microstrip monpulse dipole array

    NASA Astrophysics Data System (ADS)

    Miccioli, W.; Toth, J.; Sa, N.; Lewis, M.


    The development of a microstrip radiating aperture utilizing multiple microstrip dipole radiators fed by a resonant feed configuration is described. This array combines an efficient capacitively coupled radiator feeding mechanism with a planar power divider configuration to achieve an extremely thin, lightweight antenna aperture. Linear array dipole matching theory and radiator bandwidth improvement techniques are also described. A quadrant based microstrip monopulse antenna was constructed. Experimental data from this array, its subassemblies and individual components are presented and compared to analytical predictions.

  8. Distributed array radar

    NASA Astrophysics Data System (ADS)

    Heimiller, R. C.; Belyea, J. E.; Tomlinson, P. G.


    Distributed array radar (DAR) is a concept for efficiently accomplishing surveillance and tracking using coherently internetted mini-radars. They form a long baseline, very thinned array and are capable of very accurate location of targets. This paper describes the DAR concept. Factors involving two-way effective gain patterns for deterministic and random DAR arrays are analyzed and discussed. An analysis of factors affecting signal-to-noise ratio is presented and key technical and performance issues are briefly summarized.

  9. Telescope Array Experiment

    NASA Astrophysics Data System (ADS)

    Kawai, H.; Yoshida, S.; Yoshii, H.; Tanaka, K.; Cohen, F.; Fukushima, M.; Hayashida, N.; Hiyama, K.; Ikeda, D.; Kido, E.; Kondo, Y.; Nonaka, T.; Ohnishi, M.; Ohoka, H.; Ozawa, S.; Sagawa, H.; Sakurai, N.; Shibata, T.; Shimodaira, H.; Takeda, M.; Taketa, A.; Takita, M.; Tokuno, H.; Torii, R.; Udo, S.; Yamakawa, Y.; Fujii, H.; Matsuda, T.; Tanaka, M.; Yamaoka, H.; Hibino, K.; Benno, T.; Doura, K.; Chikawa, M.; Nakamura, T.; Teshima, M.; Kadota, K.; Uchihori, Y.; Hayashi, K.; Hayashi, Y.; Kawakami, S.; Matsuyama, T.; Minamino, M.; Ogio, S.; Ohshima, A.; Okuda, T.; Shimizu, N.; Tanaka, H.; Bergman, D. R.; Hughes, G.; Stratton, S.; Thomson, G. B.; Endo, A.; Inoue, N.; Kawana, S.; Wada, Y.; Kasahara, K.; Azuma, R.; Iguchi, T.; Kakimoto, F.; Machida, S.; Misumi, K.; Murano, Y.; Tameda, Y.; Tsunesada, Y.; Chiba, J.; Miyata, K.; Abu-Zayyad, T.; Belz, J. W.; Cady, R.; Cao, Z.; Huentemeyer, P.; Jui, C. C. H.; Martens, K.; Matthews, J. N.; Mostofa, M.; Smith, J. D.; Sokolsky, P.; Springer, R. W.; Thomas, J. R.; Thomas, S. B.; Wiencke, L. R.; Doyle, T.; Taylor, M. J.; Wickwar, V. B.; Wilkerson, T. D.; Hashimoto, K.; Honda, K.; Ikuta, K.; Ishii, T.; Kanbe, T.; Tomida, T.


    The TA observatory is a hybrid detector system consisting of both a surface detector array as well as a set of fluorescence detectors. The observatory will measure the energy spectrum, anisotropy and composition of ultra-high energy cosmic rays. The surface detectors are being deployed and the array should be complete by the end of February, 2007. We will soon be collecting hybrid data at the Telecope Array.

  10. Electrically reconfigurable logic array

    NASA Technical Reports Server (NTRS)

    Agarwal, R. K.


    To compose the complicated systems using algorithmically specialized logic circuits or processors, one solution is to perform relational computations such as union, division and intersection directly on hardware. These relations can be pipelined efficiently on a network of processors having an array configuration. These processors can be designed and implemented with a few simple cells. In order to determine the state-of-the-art in Electrically Reconfigurable Logic Array (ERLA), a survey of the available programmable logic array (PLA) and the logic circuit elements used in such arrays was conducted. Based on this survey some recommendations are made for ERLA devices.

  11. Integrated avalanche photodiode arrays


    Harmon, Eric S.


    The present disclosure includes devices for detecting photons, including avalanche photon detectors, arrays of such detectors, and circuits including such arrays. In some aspects, the detectors and arrays include a virtual beveled edge mesa structure surrounded by resistive material damaged by ion implantation and having side wall profiles that taper inwardly towards the top of the mesa structures, or towards the direction from which the ion implantation occurred. Other aspects are directed to masking and multiple implantation and/or annealing steps. Furthermore, methods for fabricating and using such devices, circuits and arrays are disclosed.

  12. Array-CGH Analysis Suggests Genetic Heterogeneity in Rhombencephalosynapsis

    PubMed Central

    Démurger, F.; Pasquier, L.; Dubourg, C.; Dupé, V.; Gicquel, I.; Evain, C.; Ratié, L.; Jaillard, S.; Beri, M.; Leheup, B.; Lespinasse, J.; Martin-Coignard, D.; Mercier, S.; Quelin, C.; Loget, P.; Marcorelles, P.; Laquerrière, A.; Bendavid, C.; Odent, S.; David, V.


    Rhombencephalosynapsis is an uncommon, but increasingly recognized, cerebellar malformation defined as vermian agenesis with fusion of the hemispheres. The embryologic and genetic mechanisms involved are still unknown, and to date, no animal models are available. In the present study, we used Agilent oligonucleotide arrays in a large series of 57 affected patients to detect candidate genes. Four different unbalanced rearrangements were detected: a 16p11.2 deletion, a 14q12q21.2 deletion, an unbalanced translocation t(2p;10q), and a 16p13.11 microdeletion containing 2 candidate genes. These genes were further investigated by sequencing and in situ hybridization. This first microarray screening of a rhombencephalosynapsis series suggests that there may be heterogeneous genetic causes. PMID:24167461

  13. Solar array stepping to minimize array excitation

    NASA Technical Reports Server (NTRS)

    Bhat, Mahabaleshwar K. P. (Inventor); Liu, Tung Y. (Inventor); Plescia, Carl T. (Inventor)


    Mechanical oscillations of a mechanism containing a stepper motor, such as a solar-array powered spacecraft, are reduced and minimized by the execution of step movements in pairs of steps, the period between steps being equal to one-half of the period of torsional oscillation of the mechanism. Each pair of steps is repeated at needed intervals to maintain desired continuous movement of the portion of elements to be moved, such as the solar array of a spacecraft. In order to account for uncertainty as well as slow change in the period of torsional oscillation, a command unit may be provided for varying the interval between steps in a pair.

  14. Focal plane array with modular pixel array components for scalability

    SciTech Connect

    Kay, Randolph R; Campbell, David V; Shinde, Subhash L; Rienstra, Jeffrey L; Serkland, Darwin K; Holmes, Michael L


    A modular, scalable focal plane array is provided as an array of integrated circuit dice, wherein each die includes a given amount of modular pixel array circuitry. The array of dice effectively multiplies the amount of modular pixel array circuitry to produce a larger pixel array without increasing die size. Desired pixel pitch across the enlarged pixel array is preserved by forming die stacks with each pixel array circuitry die stacked on a separate die that contains the corresponding signal processing circuitry. Techniques for die stack interconnections and die stack placement are implemented to ensure that the desired pixel pitch is preserved across the enlarged pixel array.

  15. ISS Solar Array Management

    NASA Technical Reports Server (NTRS)

    Williams, James P.; Martin, Keith D.; Thomas, Justin R.; Caro, Samuel


    The International Space Station (ISS) Solar Array Management (SAM) software toolset provides the capabilities necessary to operate a spacecraft with complex solar array constraints. It monitors spacecraft telemetry and provides interpretations of solar array constraint data in an intuitive manner. The toolset provides extensive situational awareness to ensure mission success by analyzing power generation needs, array motion constraints, and structural loading situations. The software suite consists of several components including samCS (constraint set selector), samShadyTimers (array shadowing timers), samWin (visualization GUI), samLock (array motion constraint computation), and samJet (attitude control system configuration selector). It provides high availability and uptime for extended and continuous mission support. It is able to support two-degrees-of-freedom (DOF) array positioning and supports up to ten simultaneous constraints with intuitive 1D and 2D decision support visualizations of constraint data. Display synchronization is enabled across a networked control center and multiple methods for constraint data interpolation are supported. Use of this software toolset increases flight safety, reduces mission support effort, optimizes solar array operation for achieving mission goals, and has run for weeks at a time without issues. The SAM toolset is currently used in ISS real-time mission operations.

  16. Array for detecting microbes


    Andersen, Gary L.; DeSantis, Todd D.


    The present embodiments relate to an array system for detecting and identifying biomolecules and organisms. More specifically, the present embodiments relate to an array system comprising a microarray configured to simultaneously detect a plurality of organisms in a sample at a high confidence level.

  17. A new diagnostic workflow for patients with mental retardation and/or multiple congenital abnormalities: test arrays first

    PubMed Central

    Gijsbers, Antoinet CJ; Lew, Janet YK; Bosch, Cathy AJ; Schuurs-Hoeijmakers, Janneke HM; van Haeringen, Arie; den Hollander, Nicolette S; Kant, Sarina G; Bijlsma, Emilia K; Breuning, Martijn H; Bakker, Egbert; Ruivenkamp, Claudia AL


    High-density single-nucleotide polymorphism (SNP) genotyping technology enables extensive genotyping as well as the detection of increasingly smaller chromosomal aberrations. In this study, we assess molecular karyotyping as first-round analysis of patients with mental retardation and/or multiple congenital abnormalities (MR/MCA). We used different commercially available SNP array platforms, the Affymetrix GeneChip 262K NspI, the Genechip 238K StyI, the Illumina HumanHap 300 and HumanCNV 370 BeadChip, to detect copy number variants (CNVs) in 318 patients with unexplained MR/MCA. We found abnormalities in 22.6% of the patients, including six CNVs that overlap known microdeletion/duplication syndromes, eight CNVs that overlap recently described syndromes, 63 potentially pathogenic CNVs (in 52 patients), four large segments of homozygosity and two mosaic trisomies for an entire chromosome. This study shows that high-density SNP array analysis reveals a much higher diagnostic yield as that of conventional karyotyping. SNP arrays have the potential to detect CNVs, mosaics, uniparental disomies and loss of heterozygosity in one experiment. We, therefore, propose a novel diagnostic approach to all MR/MCA patients by first analyzing every patient with an SNP array instead of conventional karyotyping. PMID:19436329

  18. Micromachined electrode array


    Okandan, Murat; Wessendorf, Kurt O.


    An electrode array is disclosed which has applications for neural stimulation and sensing. The electrode array, in certain embodiments, can include a plurality of electrodes each of which is flexibly attached to a common substrate using a plurality of springs to allow the electrodes to move independently. In other embodiments of the electrode array, the electrodes can be fixed to the substrate. The electrode array can be formed from a combination of bulk and surface micromachining, and can include electrode tips having an electroplated metal (e.g. platinum, iridium, gold or titanium) or a metal oxide (e.g. iridium oxide) for biocompatibility. The electrode array can be used to form a part of a neural prosthesis, and is particularly well adapted for use in an implantable retinal prosthesis.

  19. Microbial sensor cell arrays.


    Melamed, Sahar; Elad, Tal; Belkin, Shimshon


    Motivated by the advantages endowed by high-throughput analysis, researchers have succeeded in incorporating multiple reporter cells into a single platform; the technology now allows the simultaneous scrutiny of a large collection of sensor strains. We review current aspects in cell array technology with emphasis on microbial sensor arrays. We consider various techniques for patterning live cells on solid surfaces, describe different array-based applications and devices, and highlight recent efforts for live cell storage. We review mathematical approaches for deciphering the data emanating from bioreporter collections, and discuss the future of single cell arrays. Innovative technologies for cell patterning, preservation and interpretation are continuously being developed; when they all mature, cell arrays may become an efficient analytical tool, in a scope resembling that of DNA microarray biochips. PMID:22176747

  20. Photovoltaic array loss mechanisms

    NASA Technical Reports Server (NTRS)

    Gonzalez, Charles


    Loss mechanisms which come into play when solar cell modules are mounted in arrays are identified. Losses can occur either from a reduction in the array electrical performance or with nonoptimal extraction of power from the array. Electrical performance degradation is caused by electrical mismatch, transmission losses from cell surface soiling and steep angle of reflectance, and electrical losses from field wiring resistance and the voltage drop across blocking diodes. The second type of loss, concerned with the operating points of the array, can involve nonoptimal load impedance and limiting the operating envelope of the array to specific ranges of voltage and current. Each of the loss mechanisms are discussed and average energy losses expected from soiling, steep reflectance angles and circuit losses are calculated.