Sample records for aflatoxin b1 afb

  1. Error-prone replication bypass of the primary aflatoxin B1 DNA adduct, AFB1-N7-Gua.


    Lin, Ying-Chih; Li, Liang; Makarova, Alena V; Burgers, Peter M; Stone, Michael P; Lloyd, R Stephen


    Hepatocellular carcinomas (HCCs) are the third leading cause of cancer deaths worldwide. The highest rates of early onset HCCs occur in geographical regions with high aflatoxin B1 (AFB1) exposure, concomitant with hepatitis B infection. Although the carcinogenic basis of AFB1 has been ascribed to its mutagenic effects, the mutagenic property of the primary AFB1-DNA adduct, AFB1-N7-Gua, in mammalian cells has not been studied extensively. Taking advantage of the ability to create vectors containing a site-specific DNA adduct, the mutagenic potential was determined in primate cells. This adduct was highly mutagenic following replication in COS-7 cells, with a mutation frequency of 45%. The spectrum of mutations was predominantly G to T base substitutions, a result that is consistent with previous mutation data derived from aflatoxin-associated HCCs. To assess which DNA polymerases (pol) might contribute to the mutational outcome, in vitro replication studies were performed. Unexpectedly, replicative pol δ and the error-prone translesion synthesis pol ζ were able to accurately bypass AFB1-N7-Gua. In contrast, replication bypass using pol κ was shown to occur with low fidelity and could account for the commonly detected G to T transversions. PMID:24838242

  2. Carcinogenic effects of aflatoxin B1 among wheat handlers

    PubMed Central

    Saad-Hussein, Amal; Taha, Mona M; Beshir, Safia; Shahy, Eman M; Shaheen, Weam; Elhamshary, Mohamed


    Background: Epidemiological studies have demonstrated that serum aflatoxin B1 (AFB1) is a hepatocarcinogenic mycotoxin and contributor to the high rate of hepatocellular carcinoma (HCC). The prevalence of liver cancer in Egypt is particularly worrisome. In a registry-based analysis of occupational risk for HCC, significant excesses were observed especially for grain mill workers. Objective: The aim of this study was to assess the hepatic carcinogenicity of AFB1 in wheat handlers. Methods: Serum AFB1/albumin (AFB1/Alb), alpha-fetoprotein (AFP), alpha-l-fucosidase (AFU), and arginase were estimated in exposed wheat handlers including millers and bakers. The control group was composed of non-occupationally exposed workers. Results: AFB1/Alb and AFU were significantly higher among workers employed as bakers compared to mill workers and controls. Mill workers had higher levels of AFB1/Alb than the controls. AFB1/Alb, AFP, and AFU were all significantly higher and arginase was significantly lower among HCC cases compared to the other groups. There was a significant correlation between AFU and AFB1/Alb in bakers and between AFP and AFB1/Alb in HCC cases. Arginase was inversely correlated with AFB1/Alb in HCC cases. AFB1/Alb was significantly correlated with the duration of exposure in bakers. Conclusion: Wheat handlers exposed to Aspergillus flavus have a high risk of elevated serum AFB1/Alb levels and AFU. PMID:25000109

  3. Vaccination of Lactating Dairy Cows for the Prevention of Aflatoxin B1 Carry Over in Milk

    PubMed Central

    Polonelli, Luciano; Giovati, Laura; Magliani, Walter; Conti, Stefania; Sforza, Stefano; Calabretta, Alessandro; Casoli, Claudio; Ronzi, Paola; Grilli, Ester; Gallo, Antonio; Masoero, Francesco; Piva, Gianfranco


    The potential of anaflatoxin B1 (AnAFB1) conjugated to keyhole limpet hemocyanin (KLH) as a vaccine (AnAFB1-KLH) in controlling the carry over of the aflatoxin B1 (AFB1) metabolite aflatoxin M1 (AFM1) in cow milk is reported. AFB1 is the most carcinogenic compound in food and foodstuffs amongst aflatoxins (AFs). AnAFB1 is AFB1 chemically modified as AFB1-1(O-carboxymethyl) oxime. In comparison to AFB1, AnAFB1 has proven to be non-toxic in vitro to human hepatocarcinoma cells and non mutagenic to Salmonella typhimurium strains. AnAFB1-KLH was used for immunization of cows proving to induce a long lasting titer of anti-AFB1 IgG antibodies (Abs) which were cross reactive with AFB1, AFG1, and AFG2. The elicited anti-AFB1 Abs were able to hinder the secretion of AFM1 into the milk of cows continuously fed with AFB1. Vaccination of lactating animals with conjugated AnAFB1 may represent a solution to the public hazard constituted by milk and cheese contaminated with AFs. PMID:22053212

  4. Uncommon occurrence ratios of aflatoxin B1, B 2, G 1, and G 2 in maize and groundnuts from Malawi.


    Matumba, Limbikani; Sulyok, Michael; Njoroge, Samuel M C; Njumbe Ediage, Emmanuel; Van Poucke, Christof; De Saeger, Sarah; Krska, Rudolf


    We report an unusual aflatoxin profile in maize and groundnuts from Malawi, with aflatoxin G1 found routinely at equal or even higher levels than aflatoxin B1. Aflatoxin B1 (AFB1) ratio in a contaminated sample is generally greater than 50% of total aflatoxin (sum of aflatoxin B1, B2, G1, and G2). In Malawi, the aflatoxin occurrence ratios were determined by examining LC-MS/MS and HPLC fluorescence detection (FLD) data of 156 naturally contaminated raw maize and 80 groundnut samples collected in 2011 and 2012. Results showed that natural aflatoxin occurrence ratio differed. In 47% of the samples, the concentration of AFG1 was higher than that of AFB1. The mean concentration percentages of AFB1/AFB2/AFG1/AFG2 in reference to total aflatoxins were found to be 47:5:43:5%, respectively. The AFG1 and AFB1 50/50 trend was observed in maize and groundnuts and was consistent for samples collected in both years. If the AFB1 measurement was used to check compliance of total aflatoxin regulatory limit set at 10, 20, 100, and 200 μg/kg with an assumption that AFB1≥50% of the total aflatoxin content, 8, 13, 24, and 26% false negative rates would have occurred respectively. It is therefore important for legislation to consider total aflatoxins rather than AFB1 alone. PMID:25194830

  5. Electrochemical Immunosensor Based on Polythionine/Gold Nanoparticles for the Determination of Aflatoxin B1

    PubMed Central

    Owino, Joseph H.O.; Arotiba, Omotayo A.; Hendricks, Nicolette; Songa, Everlyne A.; Jahed, Nazeem; Waryo, Tesfaye T.; Ngece, Rachel F.; Baker, Priscilla G.L.; Iwuoha, Emmanuel I.


    An aflatoxin B1 (AFB1) electrochemical immunosensor was developed by the immobilisation of aflatoxin B1-bovine serum albumin (AFB1-BSA) conjugate on a polythionine (PTH)/gold nanoparticles (AuNP)-modified glassy carbon electrode (GCE). The surface of the AFB1-BSA conjugate was covered with horseradish peroxidase (HRP), in order to prevent non-specific binding of the immunosensors with ions in the test solution. The AFB1 immunosensor exhibited a quasi-reversible electrochemistry as indicated by a cyclic voltammetric (CV) peak separation (ΔEp) value of 62 mV. The experimental procedure for the detection of AFB1 involved the setting up of a competition between free AFB1 and the immobilised AFB1-BSA conjugate for the binding sites of free anti-aflatoxin B1 (anti-AFB1) antibody. The immunosensor's differential pulse voltammetry (DPV) responses (peak currents) decreased as the concentration of free AFB1 increased within a dynamic linear range (DLR) of 0.6 - 2.4 ng/mL AFB1 and a limit of detection (LOD) of 0.07 ng/mL AFB1. This immunosensing procedure eliminates the need for enzyme-labeled secondary antibodies normally used in conventional ELISA–based immunosensors.

  6. Effects of Aflatoxin B1 and Fumonisin B1 on Blood Biochemical Parameters in Broilers

    PubMed Central

    Tessari, Eliana N. C.; Kobashigawa, Estela; Cardoso, Ana Lúcia S. P.; Ledoux, David R.; Rottinghaus, George E.; Oliveira, Carlos A. F.


    The individual and combined effects of dietary aflatoxin B1 (AFB1) and fumonisin B1 (FB1) on liver pathology, serum levels of aspartate amino-transferase (AST) and plasma total protein (TP) of broilers were evaluated from 8 to 41 days of age. Dietary treatments included a 3 × 3 factorial arrangement with three levels of AFB1 (0, 50 and 200 μg AFB1/kg), and three levels of FB1 (0, 50 and 200 mg FB1/kg). At 33 days post feeding, with the exception of birds fed 50 mg FB1 only, concentrations of AST were higher (p < 0.05) in all other treatment groups when compared with controls. Plasma TP was lower (p < 0.05) at six days post feeding in groups fed 200 μg AFB1/kg alone or in combination with FB1. At day 33 days post feeding, with the exception of birds fed the highest combination of AFB1 and FB1 which had higher plasma TP than control birds, plasma TP of birds fed other dietary treatments were similar to controls. Broilers receiving the highest levels of AFB1 and FB1 had bile duct proliferation and trabecular disorder in liver samples. AFB1 singly or in combination with FB at the levels studied, caused liver damage and an increase in serum levels of AST. PMID:22069595

  7. Effects of aflatoxin B(1) and fumonisin B(1) on blood biochemical parameters in broilers.


    Tessari, Eliana N C; Kobashigawa, Estela; Cardoso, Ana Lúcia S P; Ledoux, David R; Rottinghaus, George E; Oliveira, Carlos A F


    The individual and combined effects of dietary aflatoxin B(1 )(AFB(1)) and fumonisin B(1) (FB(1)) on liver pathology, serum levels of aspartate amino-transferase (AST) and plasma total protein (TP) of broilers were evaluated from 8 to 41 days of age. Dietary treatments included a 3 × 3 factorial arrangement with three levels of AFB(1 )(0, 50 and 200 μg AFB(1)/kg), and three levels of FB(1 )(0, 50 and 200 mg FB(1)/kg). At 33 days post feeding, with the exception of birds fed 50 mg FB(1 )only, concentrations of AST were higher (p < 0.05) in all other treatment groups when compared with controls. Plasma TP was lower (p < 0.05) at six days post feeding in groups fed 200 μg AFB(1)/kg alone or in combination with FB(1). At day 33 days post feeding, with the exception of birds fed the highest combination of AFB(1 )and FB(1 )which had higher plasma TP than control birds(, )plasma TP of birds fed other dietary treatments were similar to controls. Broilers receiving the highest levels of AFB(1) and FB(1) had bile duct proliferation and trabecular disorder in liver samples. AFB(1) singly or in combination with FB at the levels studied, caused liver damage and an increase in serum levels of AST. PMID:22069595

  8. Low cost quantitative digital imaging as an alternative to qualitative in vivo bioassays for analysis of active aflatoxin B1

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aflatoxin B1 (AFB1) producing fungi contaminate food and feed and are a major health concern. To minimize the sources and incidence of AFB1 illness there is a need to develop affordable, sensitive mobile devices for detection of active AFB1. In the present study we used a low cost fluorescence detec...

  9. Effects of prolonged oral administration of aflatoxin B1 and fumonisin B1 in broiler chickens.


    Del Bianchi, M; Oliveira, C A F; Albuquerque, R; Guerra, J L; Correa, B


    The effects of prolonged oral administration of aflatoxin B1 (AFB1) and fumonisin B1 (FB1) mycotoxins were evaluated in broiler chickens from 21 to 42 d of age. A total of 192 birds were housed in experimental batteries and assigned to 32 cages, 6 birds per cage. The following treatments were applied: 1) 0 mycotoxins (control), 2) 10 mg of FB1, 3) 50 microg of AFB1, 4) 50 microg of AFB1 + 10 mg of FB1, 5) 350 microg of AFB1, 6) 350 microg of AFB1 + 10 mg of FB1, 7) 2,450 microg of AFB1, 8) 2,450 microg of AFB1 + 10 mg of FB1/kg of feed. Each treatment consisted of 4 replicates of 6 birds each. At the end of the trial, blood samples from 12 birds per treatment were collected, and the birds were necropsied. Compared with controls, the percentage of heterophils was lower (P < 0.05) in birds from groups receiving 50 microg of AFB1/kg + 10 mg of FB1/ kg and 2450 microg of AFB1/kg alone or in combination with FB1. A higher percentage of lymphocytes (P < 0.05) was observed in birds fed 50 microg of AFB1/kg + 10 mg of FB1/ kg, 350 microg of AFB1/kg, and 2,450 microg of AFB1/kg. A decrease in plasma albumin was observed only in birds fed 2,450 microg of AFB1/kg + 10 mg of FB1/kg. The liver of AFB1-treated birds had focal areas of necrosis and inflammatory infiltrates. In birds fed rations containing only 10 mg of FB1/kg, bile duct hyperplasia with fibrosis and a mononuclear infiltrate accompanied by trabecular derangement were observed. In contrast, in treatments in which FB1 was administered in combination, hepatic vacuolar degeneration was observed, and renal tissue presented corpuscles with increased cellular agglomeration, characterizing glomerulonephritis, and a clearly visible tubular epithelium with areas of degeneration and necrosis. The FB1 residues were detected in liver and in excreta of all FB1-treated groups, at levels that ranged from 0.013 to 0.051 mg/kg and from 1.19 to 2.79 mg/kg, respectively. Results indicated that FB1 and AFB1, singly or in combination

  10. Fungal degradation of aflatoxin B1.


    Shantha, T


    A number of fungal cultures were screened to select an organism suitable to be used in the detoxification of aflatoxin B1. They were co-cultured in Czapek-Dox-Casamino acid medium with aflatoxin B1 producing Aspergillus flavus. Several fungal cultures were found to prevent synthesis of aflatoxin B1 in liquid culture medium. Among these Phoma sp., Mucor sp., Trichoderma harzianum, Trichoderma sp. 639, Rhizopus sp. 663, Rhizopus sp. 710, Rhizopus sp. 668, Alternaria sp. and some strains belonging to the Sporotrichum group (ADA IV B14(a), ADA SF VI BF (9), strain 720) could inhibit aflatoxin synthesis by > or =90%. A few fungi, namely ADA IV B1, ADA F1, ADA F8, also belonging to the Sporotrichum group, were less efficient than the Phoma sp. The Cladosporium sp. and A. terreus sp. were by far the least efficient, registering <10% inhibition. The cultures which prevent aflatoxin biosynthesis are also capable of degrading the preformed toxin. Among these, Phoma sp. was the most efficient destroying about 99% of aflatoxin B1. The cell free extract of Phoma sp. destroyed nearly 50 microg aflatoxin B1 100 ml(-1) culture medium (90% of the added toxin), and this was more effective than its own culture filtrate over 5 days incubation at 28+/-2 degrees C. The degradation was gradual: 35% at 24 h, 58% at 48 h, 65% at 72 h, 85% at 96 h and 90% at 120 h. The possibility of a heat stable enzymatic activity in the cell free extract of Phoma is proposed. PMID:10945479

  11. Aflatoxin B1 is toxic to porcine oocyte maturation.


    Liu, Jun; Wang, Qiao-Chu; Han, Jun; Xiong, Bo; Sun, Shao-Chen


    As a toxic secondary metabolite of Aspergillus species, Aflatoxin B1 (AFB1) is a major food and feed contaminant in tropical and sub-tropical regions with high temperature and humidity. It has been reported to be toxic to the female reproductive system in laboratory and domestic animals. In the present study, the influence of acute exposure to AFB1 (10 and 50 μM, 44h) on porcine oocyte maturation and its possible mechanism were investigated. The maturation rates of oocytes decreased significantly in the presence of 50 μM of AFB1. Cell cycle analysis showed that most oocytes were arrested at germinal vesicle breakdown or meosis I stage. However, actin assembly, spindle structure and chromosome alignment were not disrupted after exposure to 50 μM AFB1. Further study showed that DNA methylation levels increased in treated oocytes (50 μM). Histone methylation levels were also analysed after treatment (50 μM): H3K27me3 and H3K4me2 levels decreased, whereas H3K9me3 level increased, indicating that epigenetic modification was affected. AFB1 treatment (50 μM) also induced oxidative stress and further led to autophagy, as shown by accumulation of reactive oxygen species, up-regulated LC3 protein expression and increased mRNA levels of ATG3, ATG5 and ATG7. Annexin V-FITC staining assay revealed that AFB1 treatment (50 μM) resulted in oocyte early apoptosis, which was confirmed by increased Bak, Bax, Bcl-xl mRNA levels. Collectively, our results suggest that AFB1 disrupts porcine oocyte maturation through changing epigenetic modifications as well as inducing oxidative stress, excessive autophagy and apoptosis. PMID:25778688

  12. Aflatoxin B1 binding by dairy strains of lactic acid bacteria and bifidobacteria.


    Peltonen, K; el-Nezami, H; Haskard, C; Ahokas, J; Salminen, S


    Various food commodities including dairy products may be contaminated with aflatoxins, which, even in small quantities, have detrimental effects on human and animal health. Several microorganisms have been reported to bind or degrade aflatoxins in foods and feeds. This study assessed the binding of aflatoxin B1 (AFB1) from contaminated solution by 20 strains of lactic acid bacteria and bifidobacteria. The selected strains are used in the food industry and comprised 12 Lactobacillus, five Bifidobacterium, and three Lactococcus strains. Bacteria and AFB1 were incubated (24 h, +37 degrees C) and the amount of unbound AFB1 was quantitated by HPLC. Between 5.6 and 59.7% AFB1 was bound from solution by these strains. Two Lactobacillus amylovorus strains and one Lactobacillus rhamnosus strain removed more than 50% AFB1 and were selected for further study. Bacterial binding of AFB1 by these strains was rapid, and more than 50% AFB1 was bound throughout a 72-h incubation period. Binding was reversible, and AFB1 was released by repeated aqueous washes. These findings further support the ability of specific strains of lactic acid bacteria to bind selected dietary contaminants. PMID:11699445


    EPA Science Inventory

    DNA binding and adduct formation of aflatoxin B1 (AFB1) was studied in cultured bladder and tracheobronchial explants from human, monkey, dog, hamster and rat. Explants were exposed to (3H)AFB1 (1 micrometer final concentration) in PFHR-4 medium (pH 7.4) without serum for 24 h, a...

  14. Aflatoxin B1, zearalenone and deoxynivalenol in feed ingredients and complete feed from central China.


    Liu, Jie; Sun, Lvhui; Zhang, Jiacai; Guo, Jiao; Chen, Lei; Qi, Desheng; Zhang, Niya


    Between 2012 and 2014, 2528 feed ingredient and complete feed samples were collected from central China. Numbers of 2083, 255 and 190 samples were analysed for aflatoxin B1 (AFB1), zearalenone (ZEN) and deoxynivalenol (DON), respectively, by high-performance liquid chromatography in combination with UV or fluorescence detection. The incidence rates of AFB1, ZEN and DON contamination of feed ingredients and complete feeds were 33.9%, 90.2% and 77.4%, respectively. The percentage of positive samples for AFB1 ranged from 13.1% to 97.1%. Cottonseed meal presented the most serious contamination by AFB1. ZEN and DON contamination levels of feeds ranged from 50% to 100%, indicating serious contamination over the studied 3-year period. This study demonstrates that AFB1, ZEN and DON contamination of feeds in central China is serious and differs over the years. Feeds are mostly contaminated with ZEN, followed by DON and AFB1. PMID:26771914

  15. Non-linear relationships between aflatoxin B1 levels and the biological response of monkey kidney vero cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aflatoxin (AF)-producing fungi contaminate food and feed during preharvest, storage and processing periods. Once consumed, AF accumulates in tissues, causing illnesses in animals and humans. At least 20 different types of AFs have been identified, and of these, aflatoxin B1 (AFB1) is the most ubiqui...

  16. Low levels of aflatoxin B1, ricin and milk enhance recombinant protein production in mammalian cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Changing the optimal tissue culture medium by adding low levels of environmental stress such as 1 µM of the fungal toxin aflatoxin B1 (AFB1), 1 ng of the castor bean protein toxin ricin in transduced mammalian cells or 1% reconstituted milk enhances transcription and increases production of the foll...

  17. Feasibility of detecting Aflatoxin B1 in single maize kernels using hyperspectral imaging

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The feasibility of detecting Aflatoxin B1 (AFB1) in single maize kernel inoculated with Aspergillus flavus conidia in the field, as well as its spatial distribution in the kernels, was assessed using near-infrared hyperspectral imaging (HSI) technique. Firstly, an image mask was applied to a pixel-b...

  18. Aflatoxin B1 binding capacity of autochthonous strains of lactic acid bacteria.


    Fazeli, Mohammad R; Hajimohammadali, M; Moshkani, Azamossadat; Samadi, Nasrin; Jamalifar, Hossein; Khoshayand, Mohammad R; Vaghari, Elham; Pouragahi, Samieh


    Some foods are prone to contamination with aflatoxins, with detrimental effect on human health. Lactic acid bacteria have been reported to bind aflatoxins and remove them from foods and feeds. Reduction of aflatoxin B1 (AFB1) from the liquid media by the autochthonous lactic acid bacteria (Lactobacillus casei, Lactobacillus plantarum, and Lactobacillus fermentum) isolated from traditional Iranian sourdough and dairy products is reported in the current study. The effect of incubation time on the binding capacity of the strains to AFB1 was also investigated. Duplicates of individual bacteria with population equivalent to 2 X 10(10) CFU/ml were incubated in the presence of AFB1 at 37 degrees C for a period of 72 h, and the amounts of unbound AFB1 were quantitated by reverse-phase high-performance liquid chromatography. All the strains were capable of removal of AFB1, and the reduction of AFB1 ranged from 25 to 61% throughout the incubation period. Removal of AFB1 was a rapid process, with approximately 61 and 56% of the toxin taken instantly by L. fermentum and L. plantarum, respectively. Binding was of a reversible nature, and some of the bound AFB1 was released into the media by the repeated centrifugation and resuspension of the cell pellets. The stability of the bacteria-toxin complex was strain dependent, and L. casei was a stronger binder of AFB1 compared with the other bacteria. No toxin release was observed after 24 h. These findings tend to suggest that certain novel probiotic bacteria with high aflatoxin binding capacity could be selected for detoxification of foods. PMID:19205485

  19. Clay-based affinity probes for selective cleanup and determination of aflatoxin B1 using nanostructured montmorillonite on quartz.


    Huebner, Henry J; Phillips, Timothy D


    A study was conducted to investigate the selective cleanup and determination of aflatoxin B1 (AfB1) from contaminated media. Composite adsorbents were formulated from calcium montmorillonite clay, which possesses a high affinity and enthalpy of adsorption for AfB1. Nanostructuring techniques were used to construct various formulations of the clay-based composite media. In AfB1 adsorption studies with prototypical affinity columns, these composites offered narrowly defined, reproducible capacity ranges. Composite recoveries of AfB1 from spiked grains exhibited linear trends that correlated well with the range of spike levels. Composite columns provided lower recoveries of AfB1 from naturally contaminated corn than did immunoaffinity columns; however, recoveries were consistent and purified extracts were free of interfering compounds, as determined by liquid chromatography with fluorescence detection. PMID:12852572

  20. Occupational Exposure to Aflatoxin B1 in a Portuguese Poultry Slaughterhouse.


    Viegas, Susana; Veiga, Luísa; Almeida, Ana; dos Santos, Mateus; Carolino, Elisabete; Viegas, Carla


    Aflatoxin B1 (AFB1) is a secondary metabolite produced by the fungi Aspergillus flavus and is the most potent hepatocarcinogen known in mammals and has been classified by the International Agency of Research on Cancer as Group 1 carcinogen. Although dietary exposure to AFB1 has been extensively documented, there are still few studies dedicated to the problem of occupational exposure. Considering recent findings regarding AFB1 occupational exposure in poultry production, it was considered relevant to clarify if there is also exposure in poultry slaughterhouses. Occupational exposure assessment to AFB1 was done with a biomarker of internal dose that measures AFB1 in the serum by enzyme-linked immunosorbent assay. Thirty workers from a slaughterhouse were enrolled in this study. A control group (n = 30) was also considered in order to know AFB1 background levels for Portuguese population. Fourteen workers (47.0%) showed detectable levels of AFB1 with values from 1.06 to 4.03ng ml(-1), with a mean value of 1.73ng ml(-1). No AFB1 was detected in serum of individuals used as controls. Despite uncertainties regarding the exposure route that is contributing more to exposure (inhalation or dermal) is possible to state that exposure to AFB1 is occurring in the slaughterhouse studied. It seems that reducing AFB1 contamination in poultry production can have a positive result in this occupational setting. PMID:26568583

  1. Potential for aflatoxin B1 and B2 production by Aspergillus flavus strains isolated from rice samples

    PubMed Central

    Lai, Xianwen; Zhang, He; Liu, Ruicen; Liu, Chenglan


    In this study, we investigated the potential for aflatoxin B1 (AFB1) and B2 (AFB2) production in rice grain by 127 strains of Aspergillus flavus isolated from rice grains collected from China. These strains were inoculated onto rice grains and incubated at 28 °C for 21 days. AFB1 and AFB2 were extracted and quantified by high-performance liquid chromatography coupled with fluorescence detection. Among the tested strains, 37% produced AFB1 and AFB2 with levels ranging from 175 to 124 101 μg kg−1 for AFB1 and from not detected to 10 329 μg kg−1 for AFB2. The mean yields of these isolates were 5884 μg kg−1 for AFB1 and 1968 μg kg−1 for AFB2. Overall, most of the aflatoxigenic strains produced higher levels of AFB1 than AFB2 in rice. The obtained information is useful for assessing the risk of aflatoxin contamination in rice samples. PMID:25737649

  2. Protective Roles of Sodium Selenite against Aflatoxin B1-Induced Apoptosis of Jejunum in Broilers

    PubMed Central

    Peng, Xi; Zhang, Shengqiang; Fang, Jing; Cui, Hengmin; Zuo, Zhicai; Deng, Junliang


    The effects of aflatoxin B1 (AFB1) exposure and sodium selenite supplementation on cell apoptosis of jejunum in broilers were studied. A total of 240 one-day-old male AA broilers were randomly assigned four dietary treatments containing 0 mg/kg of AFB1 (control), 0.3 mg/kg AFB1 (AFB1), 0.4 mg/kg supplement Se (+ Se) and 0.3 mg/kg AFB1 + 0.4 mg/kg supplement Se (AFB1 + Se), respectively. Compared with the control broilers, the number of apoptotic cells, the expression of Bax and Caspase-3 mRNA were significantly increased, while the expression of Bcl-2 mRNA and the Bcl-2/Bax ratio were significantly decreased in AFB1 broilers. The number of apoptotic cells and the expression of Caspase-3 mRNA in AFB1 + Se broilers were significantly higher than those in the control broilers, but significantly lower than those in AFB1 broilers. There were no significant changes in the expression of Bax mRNA between AFB1 + Se and control broilers; the expression of Bcl-2 mRNA and the Bcl-2/Bax ratio in AFB1 + Se broilers were significantly lower than those in the control broilers, but significantly higher than those in AFB1 broilers. In conclusion, 0.3 mg/kg AFB1 in the diet can increase cell apoptosis, decrease Bcl-2 mRNA expression, and increase of Bax and Caspase-3 mRNA expression in broiler’s jejunum. However, supplementation of dietary sodium selenite at the concentration of 0.4 mg/kg Se may ameliorate AFB1-induced apoptosis by increasing Bcl-2 mRNA expression, and decreasing Bax and Caspase-3 mRNA expression. PMID:25526081

  3. Effect of γ-radiation on the production of aflatoxin B1 by Aspergillus parasiticus in raisins (Vitis vinifera L.)

    NASA Astrophysics Data System (ADS)

    Kanapitsas, Alexandros; Batrinou, Anthimia; Aravantinos, Athanasios; Markaki, Panagiota


    Aflatoxin B1 (AFB1) mostly produced by Aspergillus flavus and Aspergillus parasiticus, is an extremely toxic and carcinogenic metabolite. The effect of gamma irradiation at dose of 10 kGy on the production of aflatoxin B1 (AFB1) inoculated by Aspergillus parasiticus in raisins (Vitis vinifera L.) and on AFB1 in contaminated samples, was investigated. Values of the amount of aflatoxin B1 produced on the 12th day of incubation, after irradiation, showed that gamma radiation exposure at 10 kGy decreased AFB1 production at 65% compared with the non-irradiated sample, on the same day. The application of 10 kGy gamma radiation directly on 100 ng of AFB1 which were spiked in raisins resulted in ~29% reduction of AFB1. According to the risk assessment analysis the Provisional Maximum Tolerable Daily Intake (PMTDI) of 1.0 ng AFB1 kg-1bw, indicates that consumers are less exposed to AFB1 from the irradiated raisins.

  4. Magnetic Bead-Based Colorimetric Immunoassay for Aflatoxin B1 Using Gold Nanoparticles

    PubMed Central

    Wang, Xu; Niessner, Reinhard; Knopp, Dietmar


    A competitive colorimetric immunoassay for the detection of aflatoxin B1 (AFB) has been established using biofunctionalized magnetic beads (MBs) and gold nanoparticles (GNPs). Aflatoxin B1-bovine serum albumin conjugates (AFB-BSA) modified MBs were employed as capture probe, which could specifically bind with GNP-labeled anti-AFB antibodies through immunoreaction, while such specific binding was competitively inhibited by the addition of AFB. After magnetic separation, the supernatant solution containing unbound GNPs was directly tested by UV-Vis spectroscopy. The absorption intensity was directly proportional to the AFB concentration. The influence of GNP size, incubation time and pH was investigated in detail. After optimization, the developed method could detect AFB in a linear range from 20 to 800 ng/L, with the limit of detection at 12 ng/L. The recoveries for spiked maize samples ranged from 92.8% to 122.0%. The proposed immunoassay provides a promising approach for simple, rapid, specific and cost-effective detection of toxins in the field of food safety. PMID:25405511

  5. Degradation of Aflatoxin B1 during the Fermentation of Alcoholic Beverages

    PubMed Central

    Inoue, Tomonori; Nagatomi, Yasushi; Uyama, Atsuo; Mochizuki, Naoki


    Aflatoxin B1 (AFB1) is a contaminant of grain and fruit and has one of the highest levels of carcinogenicity of any natural toxin. AFB1 and the fungi that produce it can also contaminate the raw materials used for beer and wine manufacture, such as corn and grapes. Therefore, brewers must ensure strict monitoring to reduce the risk of contamination. In this study, the fate of AFB1 during the fermentation process was investigated using laboratory-scale bottom and top beer fermentation and wine fermentation. During fermentation, cool wort beer samples and wine must samples were artificially spiked with AFB1 and the levels of AFB1 remaining after fermentation were analyzed. AFB1 levels were unchanged during both types of fermentation used for beer but were reduced to 30% of their initial concentration in wine. Differential analysis of the spiked and unspiked wine samples showed that the degradation compound was AFB2a, a hydrated derivative of AFB1. Thus, the results showed that the risk of AFB1 carryover was still present for both types of beer fermentation but was reduced in the case of wine fermentation because of hydration. PMID:23812408

  6. Degradation of aflatoxin B1 during the fermentation of alcoholic beverages.


    Inoue, Tomonori; Nagatomi, Yasushi; Uyama, Atsuo; Mochizuki, Naoki


    Aflatoxin B1 (AFB1) is a contaminant of grain and fruit and has one of the highest levels of carcinogenicity of any natural toxin. AFB1 and the fungi that produce it can also contaminate the raw materials used for beer and wine manufacture, such as corn and grapes. Therefore, brewers must ensure strict monitoring to reduce the risk of contamination. In this study, the fate of AFB1 during the fermentation process was investigated using laboratory-scale bottom and top beer fermentation and wine fermentation. During fermentation, cool wort beer samples and wine must samples were artificially spiked with AFB1 and the levels of AFB1 remaining after fermentation were analyzed. AFB1 levels were unchanged during both types of fermentation used for beer but were reduced to 30% of their initial concentration in wine. Differential analysis of the spiked and unspiked wine samples showed that the degradation compound was AFB2a, a hydrated derivative of AFB1. Thus, the results showed that the risk of AFB1 carryover was still present for both types of beer fermentation but was reduced in the case of wine fermentation because of hydration. PMID:23812408

  7. The mitochondrial and death receptor pathways involved in the thymocytes apoptosis induced by aflatoxin B1.


    Peng, Xi; Yu, Zhengqiang; Liang, Na; Chi, Xiaofeng; Li, Xiaochong; Jiang, Min; Fang, Jing; Cui, Hengmin; Lai, Weimin; Zhou, Yi; Zhou, Shan


    Aflatoxin B1 (AFB1) is a potent immunosuppressive agent in endotherms, which can be related to the up-regulated apoptosis of immune organs. In this study, we investigated the roles of the mitochondrial, death receptor, and endoplasmic reticulum pathways in Aflatoxin B1 induced thymocytes apoptosis. Chickens were fed an aflatoxin B1 containing diet (0.6 mg/kg AFB1) for 3 weeks. Our results showed that (1) AFB1 diet induced the decrease of T-cell subsets, morphological changes, and excessive apoptosis of thymus. (2) The excessive apoptosis involved the mitochondrial pathway (up-regulation of Bax, Bak, cytC and down-regulation of Bcl-2 and Bcl-xL) and death receptor pathway (up-regulation of FasL, Fas and FADD). (3) Oxidative stress, an apoptosis inducer, was confirmed in the thymus. In conclusion, this is the first study to demonstrate that mitochondrial and death receptor pathways involved in AFB1 induced thymocytes apoptosis in broilers. PMID:26933817

  8. The mitochondrial and death receptor pathways involved in the thymocytes apoptosis induced by aflatoxin B1

    PubMed Central

    Chi, Xiaofeng; Li, Xiaochong; Jiang, Min; Fang, Jing; Cui, Hengmin; Lai, Weimin; Zhou, Yi; Zhou, Shan


    Aflatoxin B1 (AFB1) is a potent immunosuppressive agent in endotherms, which can be related to the up-regulated apoptosis of immune organs. In this study, we investigated the roles of the mitochondrial, death receptor, and endoplasmic reticulum pathways in Aflatoxin B1 induced thymocytes apoptosis. Chickens were fed an aflatoxin B1 containing diet (0.6 mg/kg AFB1) for 3 weeks. Our results showed that (1) AFB1 diet induced the decrease of T-cell subsets, morphological changes, and excessive apoptosis of thymus. (2) The excessive apoptosis involved the mitochondrial pathway (up-regulation of Bax, Bak, cytC and down-regulation of Bcl-2 and Bcl-xL) and death receptor pathway (up-regulation of FasL, Fas and FADD). (3) Oxidative stress, an apoptosis inducer, was confirmed in the thymus. In conclusion, this is the first study to demonstrate that mitochondrial and death receptor pathways involved in AFB1 induced thymocytes apoptosis in broilers. PMID:26933817

  9. Effect of climate change on Aspergillus flavus and aflatoxin B1 production

    PubMed Central

    Medina, Angel; Rodriguez, Alicia; Magan, Naresh


    This review considers the available information on the potential impact of key environmental factors and their interactions on the molecular ecology, growth and aflatoxin production by Aspergillus flavus in vitro and in maize grain. The recent studies which have been carried out to examine the impact of water activity × temperature on aflatoxin biosynthesis and phenotypic aflatoxin production are examined. These have shown that there is a direct relationship between the relative expression of key regulatory and structural genes under different environmental conditions which correlate directly with aflatoxin B1 production. A model has been developed to integrate the relative expression of 10 biosynthetic genes in the pathway, growth and aflatoxin B1 (AFB1) production which was validated under elevated temperature and water stress conditions. The effect of interacting conditions of aw × temperature × elevated CO2 (2 × and 3 × existing levels) are detailed for the first time. This suggests that while such interacting environmental conditions have little effect on growth they do have a significant impact on aflatoxin biosynthetic gene expression (structural aflD and regulatory aflR genes) and can significantly stimulate the production of AFB1. While the individual factors alone have an impact, it is the combined effect of these three abiotic factors which have an impact on mycotoxin production. This approach provides data which is necessary to help predict the real impacts of climate change on mycotoxigenic fungi. PMID:25101060

  10. Prevention of Aflatoxin B1-Induced DNA Breaks by β-D-Glucan

    PubMed Central

    Madrigal-Bujaidar, Eduardo; Morales-González, José Antonio; Sánchez-Gutiérrez, Manuel; Izquierdo-Vega, Jeannett A.; Reyes-Arellano, Alicia; Álvarez-González, Isela; Pérez-Pasten, Ricardo; Madrigal-Santillán, Eduardo


    Aflatoxins are a group of naturally-occurring carcinogens that are known to contaminate different human and animal foodstuffs. Aflatoxin B1 (AFB1) is the most genotoxic hepatocarcinogenic compound of all of the aflatoxins. In this report, we explore the capacity of β-d-glucan (Glu) to reduce the DNA damage induced by AFB1 in mouse hepatocytes. For this purpose, we applied the comet assay to groups of animals that were first administered Glu in three doses (100, 400 and 700 mg/kg bw, respectively) and, 20 min later, 1.0 mg/kg of AFB1. Liver cells were obtained at 4, 10 and 16 h after the chemical administration and examined. The results showed no protection of the damage induced by AFB1 with the low dose of the polysaccharide, but they did reveal antigenotoxic activity exerted by the two high doses. In addition, we induced a co-crystallization between both compounds, determined their fusion points and analyzed the molecules by UV spectroscopy. The data suggested the formation of a supramolecular complex between AFB1 and β-d-glucan. PMID:26110504

  11. Aflatoxin B1 Induced Compositional Changes in Gut Microbial Communities of Male F344 Rats.


    Wang, Jincheng; Tang, Lili; Glenn, Travis C; Wang, Jia-Sheng


    Aflatoxins are a group of potent foodborne toxicants naturally occurring in maize and groundnuts. Differential species-specific sensitivity to aflatoxins has been documented but cannot be fully explained by the differences in metabolism of these toxicants among animal species. Commensal microbial communities (microbiota) are critical to human and animal health, but few studies have assessed interactions between xenobiotic toxins and those microbiota, and its potential effects to humans and animals. Here, an exploratory dosing experiment was conducted to explore effects of Aflatoxin B1 (AFB1) on the gut microbiota in a commonly used rat model. Male F344 rats were randomly divided into groups and treated with different concentrations of AFB1. Microbial communities in fecal samples were assessed using 16S rRNA sequence analysis. We found that samples from the control group had a phylogenetically diverse community, and that increasing AFB1 doses decreased this diversity but increased evenness of community composition. In addition, the gut microbiota from different samples was clustered according to their dosing regimens. There is no community shift at the phylum level but some lactic acid bacteria were significantly depleted by AFB1. These findings suggested that AFB1 could modify the gut microbiota in a dose-dependent manner. PMID:26612839

  12. Dietary modulation of the biotransformation and genotoxicity of aflatoxin B(1).


    Gross-Steinmeyer, Kerstin; Eaton, David L


    Diet and its various components are consistently identified as among the most important 'risk factors' for cancer worldwide, yet great uncertainty remains regarding the relative contribution of nutritive (e.g., vitamins, calories) vs. non-nutritive (e.g., phytochemicals, fiber, contaminants) factors in both cancer induction and cancer prevention. Among the most potent known human dietary carcinogens is the mycotoxin, aflatoxin B(1) (AFB). AFB and related aflatoxins are produced as secondary metabolites by the molds Aspergillus flavus and Aspergillus parasiticus that commonly infect poorly stored foods including peanuts, pistachios, corn, and rice. AFB is a potent hepatocarcinogenic agent in numerous animal species, and has been implicated in the etiology of human hepatocellular carcinoma. Recent research has shown that many diet-derived factors have great potential to influence AFB biotransformation, and some efficiently protect from AFB-induced genotoxicity. One key mode of action for reducing AFB-induced carcinogenesis in experimental animals was shown to be the induction of detoxification enzymes such as certain glutathione-S-transferases that are regulated through the Keap1-Nrf2-ARE signaling pathway. Although initial studies utilized the dithiolthione drug, oltipraz, as a prototypical inducer of antioxidant response, dietary components such as suforaphane (SFN) are also effective inducers of this pathway in rodent models. However, human GSTs in general do not appear to be extensively induced by SFN, and GSTM1 - the only human GST with measurable catalytic activity toward aflatoxin B(1)-8,9-epoxide (AFBO; the genotoxic metabolite of AFB), does not appear to be induced by SFN, at least in human hepatocytes, even though its expression in human liver cells does appear to offer considerable protection against AFB-DNA damage. Although induction of detoxification pathways has served as the primary mechanistic focus of chemoprevention studies, protective effects of

  13. Vaccination of Heifers with Anaflatoxin Improves the Reduction of Aflatoxin B1 Carry Over in Milk of Lactating Dairy Cows

    PubMed Central

    Giovati, Laura; Gallo, Antonio; Masoero, Francesco; Cerioli, Carla; Ciociola, Tecla; Conti, Stefania; Magliani, Walter; Polonelli, Luciano


    It was previously reported that injection of anaflatoxin B1 (AnAFB1) conjugated to keyhole limpet hemocyanin (KLH), together with Freund's adjuvant, was effective in inducing in cows a long lasting titer of anti-aflatoxin B1 (AFB1) antibodies (Abs), cross-reacting with other aflatoxins, which were able to hinder, proportionally to their titer, the secretion of aflatoxin M1 (AFM1) into the milk of cows continuously fed with AFB1. According to anti-AFB1 Ab titer, 50% of the vaccinated cows were recognized as high responder animals. In an attempt to prepare a more effective formulation for vaccination of cows, it was compared the immunogenicity, in Holstein Friesian heifers, of AnAFB1 covalently conjugated to KLH or to recombinant diphtheria toxin (CRM197) molecules, and injected together with various adjuvants. This study demonstrated that injection of AnAFB1 conjugated to KLH and mixed with complete (priming) and incomplete Freund's adjuvant (boosters), as in the previous schedule of immunization, was the most effective regimen for inducing Ab responses against AFB1, although pre-calving administration could increase the effectiveness of vaccination, resulting in 100% high responder animals. After one booster dose at the beginning of the milk production cycle, anti-AFB1 Ab titers were comparable to those recorded at the end of the immunization schedule, and proved to be effective in reducing significantly AFB1 carry over, as AFM1, from feed to milk. Pre-calving vaccination of dairy heifers with conjugated AnAFB1, adjuvated with complete and incomplete Freund's adjuvant, may represent the most effective tool for preventing the public health hazard constituted by milk and cheese contaminated with aflatoxins. PMID:24714096

  14. Vaccination of heifers with anaflatoxin improves the reduction of aflatoxin b1 carry over in milk of lactating dairy cows.


    Giovati, Laura; Gallo, Antonio; Masoero, Francesco; Cerioli, Carla; Ciociola, Tecla; Conti, Stefania; Magliani, Walter; Polonelli, Luciano


    It was previously reported that injection of anaflatoxin B1 (AnAFB1) conjugated to keyhole limpet hemocyanin (KLH), together with Freund's adjuvant, was effective in inducing in cows a long lasting titer of anti-aflatoxin B1 (AFB1) antibodies (Abs), cross-reacting with other aflatoxins, which were able to hinder, proportionally to their titer, the secretion of aflatoxin M1 (AFM1) into the milk of cows continuously fed with AFB1. According to anti-AFB1 Ab titer, 50% of the vaccinated cows were recognized as high responder animals. In an attempt to prepare a more effective formulation for vaccination of cows, it was compared the immunogenicity, in Holstein Friesian heifers, of AnAFB1 covalently conjugated to KLH or to recombinant diphtheria toxin (CRM197) molecules, and injected together with various adjuvants. This study demonstrated that injection of AnAFB1 conjugated to KLH and mixed with complete (priming) and incomplete Freund's adjuvant (boosters), as in the previous schedule of immunization, was the most effective regimen for inducing Ab responses against AFB1, although pre-calving administration could increase the effectiveness of vaccination, resulting in 100% high responder animals. After one booster dose at the beginning of the milk production cycle, anti-AFB1 Ab titers were comparable to those recorded at the end of the immunization schedule, and proved to be effective in reducing significantly AFB1 carry over, as AFM1, from feed to milk. Pre-calving vaccination of dairy heifers with conjugated AnAFB1, adjuvated with complete and incomplete Freund's adjuvant, may represent the most effective tool for preventing the public health hazard constituted by milk and cheese contaminated with aflatoxins. PMID:24714096

  15. An aptamer-based dipstick assay for the rapid and simple detection of aflatoxin B1.


    Shim, Won-Bo; Kim, Min Jin; Mun, Hyoyoung; Kim, Min-Gon


    A rapid and simple dipstick assay based on an aptamer has been developed for the determination of aflatoxin B1 (AFB1). The dipstick assay format was based on a competitive reaction of the biotin-modified aptamer specific to AFB1 between target and cy5-modified DNA probes. Streptavidin and anti-cy5 antibody as capture reagents were immobilized at test and control lines on a membrane of the dipstick assay. After optimization, the limit of detection for the dipstick assay was 0.1 ng/ml AFB1 in buffer. The method was confirmed to be specific to AFB1, and the entire process of the assay can be completed within 30 min. Aqueous methanol (20%) provided a good extraction efficiency, and the matrix influence from corn extracts was successfully reduced through 2-fold dilution. The results of AFB1 analysis for corn samples spiked with known concentration of AFB1 by the dipstick assay and ELISA showed good agreement. The cut-off value of the dipstick assay for corn samples was 0.3 ng/g AFB1. Therefore, the dipstick assay is first reported and considered as a rapid, simple, on-site and inexpensive screening tool for AFB1 determination in grains as well as a corn. PMID:25032679

  16. A novel strain of Cellulosimicrobium funkei can biologically detoxify aflatoxin B1 in ducklings

    PubMed Central

    Sun, Lv-Hui; Zhang, Ni-Ya; Sun, Ran-Ran; Gao, Xin; Gu, Changqin; Krumm, Christopher Steven; Qi, De-Sheng


    Two experiments were conducted to screen microorganisms with aflatoxin B1 (AFB1) removal potential from soils and to evaluate their ability in reducing the toxic effects of AFB1 in ducklings. In experiment 1, we screened 11 isolates that showed the AFB1 biodegradation ability, and the one exhibited the highest AFB1 removal ability (97%) was characterized and identified as Cellulosimicrobium funkei (C. funkei). In experiment 2, 80 day-old Cherry Valley ducklings were divided into four groups with four replicates of five birds each and were used in a 2 by 2 factorial trial design, in which the main factors included administration of AFB1 versus solvent and C. funkei versus solvent for 2 weeks. The AFB1 treatment significantly decreased the body weight gain, feed intake and impaired feed conversion ratio. AFB1 also decreased serum albumin and total protein concentration, while it increased activities of alanine aminotransferase and aspartate aminotransferase and liver damage in the ducklings. Supplementation of C. funkei alleviated the adverse effects of AFB1 on growth performance, and provided protective effects on the serum biochemical indicators, and decreased hepatic injury in the ducklings. Conclusively, our results suggest that the novel isolated C. funkei strain could be used to mitigate the negative effects of aflatoxicosis in ducklings. PMID:25616109

  17. Aflatoxin B1 in sesame seeds and sesame products from the Greek market.


    Kollia, Eleni; Tsourouflis, Kyriakos; Markaki, Panagiota


    Aflatoxin B1 (AFB1) is considered as the most potent liver carcinogen for humans. A method for determination in sesame seeds was developed. AFB1 was extracted by methanol-water, cleaned by immunoaffinity columns and determined by high-performance liquid chromatography with fluorescence detection. The recovery factor and the limit of detection (LOD) of AFB1 in sesame seeds were 111.5% and 0.02 ng g(-1), respectively. Thirty samples of sesame products were examined for the presence of AFB1. After analysis, 77.6% of samples were found to be contaminated. Eight samples exceeded the European Union (EU) limit (2 µg AFB1 kg(-1)). In 15 samples, AFB1 was below the EU limit. Seven samples remained below the LOD. The most contaminated (14.49 ng AFB1 g(-1)) sample was unpeeled packaged sesame seeds. In all samples, aflatoxigenic Aspergilli fungi as well as the risk for AFB1 presence in sesame seed was investigated. PMID:27088795

  18. Response of the Hepatic Transcriptome to Aflatoxin B1 in Domestic Turkey (Meleagris gallopavo)

    PubMed Central

    Monson, Melissa S.; Settlage, Robert E.; McMahon, Kevin W.; Mendoza, Kristelle M.; Rawal, Sumit; El-Nezami, Hani S.; Coulombe, Roger A.; Reed, Kent M.


    Dietary exposure to aflatoxin B1 (AFB1) is detrimental to avian health and leads to major economic losses for the poultry industry. AFB1 is especially hepatotoxic in domestic turkeys (Meleagris gallopavo), since these birds are unable to detoxify AFB1 by glutathione-conjugation. The impacts of AFB1 on the turkey hepatic transcriptome and the potential protection from pretreatment with a Lactobacillus-based probiotic mixture were investigated through RNA-sequencing. Animals were divided into four treatment groups and RNA was subsequently recovered from liver samples. Four pooled RNA-seq libraries were sequenced to produce over 322 M reads totaling 13.8 Gb of sequence. Approximately 170,000 predicted transcripts were de novo assembled, of which 803 had significant differential expression in at least one pair-wise comparison between treatment groups. Functional analysis linked many of the transcripts significantly affected by AFB1 exposure to cancer, apoptosis, the cell cycle or lipid regulation. Most notable were transcripts from the genes encoding E3 ubiquitin-protein ligase Mdm2, osteopontin, S-adenosylmethionine synthase isoform type-2, and lipoprotein lipase. Expression was modulated by the probiotics, but treatment did not completely mitigate the effects of AFB1. Genes identified through transcriptome analysis provide candidates for further study of AFB1 toxicity and targets for efforts to improve the health of domestic turkeys exposed to AFB1. PMID:24979717

  19. Biosensor-based screening method for the detection of aflatoxins B1-G1.


    Cuccioloni, Massimiliano; Mozzicafreddo, Matteo; Barocci, Simone; Ciuti, Francesca; Pecorelli, Ivan; Eleuteri, Anna Maria; Spina, Michele; Fioretti, Evandro; Angeletti, Mauro


    Aflatoxins are extremely toxic metabolites from Aspergillus species that can adulterate a wide range of human foodstuff. Herein, we propose a novel assay designed as an analytical test for aflatoxin B1 and G1 (AFB1 and AFG1, respectively) that could represent an alternative screening technique for this class of mycotoxins. The approach for the determination of these toxins is based on surface plasmon resonance using neutrophil porcine elastase as a "bait" for these aflatoxins. The selection and optimization of the analytical procedure involved a preliminary investigation on the type of inhibition by AFB1: the level of the protease inhibition exerted by AFB1 depended upon the incubation time and the concentration of the binding partners, showing the competitiveness and the reversibility of the inhibition. A posteriori, the nature of the interaction granted a rapid analysis, a single detection test requiring only a few minutes. For the development of the assay, the experimental conditions were evaluated and optimized with both calibration solution and aflatoxin-spiked samples. To apply this method to aflatoxin-contaminated maize, a rapid solid-phase extraction treatment was developed. The proposed assay for AFB1 and AFG1 was validated by comparison with both a chromatographic reference method and a standard enzyme linked immunosorbent assay procedure. This enzyme-based biosensor represents a new approach for the detection of aflatoxins based on the reversible interaction between a blocked macromolecule and a soluble ligand, having the major advantages in the relative rapidity, the reusability of the capturing surface, and low cost per single test. PMID:19551989

  20. Effect of 8-oxoguanine glycosylase deficiency on aflatoxin B1 tumourigenicity in mice

    PubMed Central

    Mulder, Jeanne E.; Turner, Patricia V.; Massey, Thomas E.


    The mycotoxin aflatoxin B1 (AFB1) may initiate cancer by causing oxidatively damaged DNA, specifically by causing 8-oxo-7,8-dihydro-2’-deoxyguanosine (8-oxodG) lesions. Base excision repair removes these lesions, with 8-oxoguanine glycosylase (OGG1) being the rate-limiting enzyme. The aim of this study was to determine the effect of ogg1 deficiency on AFB1-induced oxidatively damaged DNA and tumourigenesis. Female wild-type, heterozygous and homozygous ogg1 null mice were given a single dose of 50mg/kg AFB1 or 40 µl dimethyl sulfoxide (DMSO) ip. Neither ogg1 genotype nor AFB1 treatment affected levels of oxidised guanine in lung or liver 2h post-treatment. AFB1-treated ogg1 null mice showed exacerbated weight loss and mortality relative to DMSO-treated ogg1 null mice, but AFB1 treatment did not significantly increase lung or liver tumour incidence compared with controls, regardless of ogg1 genotype. Suspect lung masses from three of the AFB1-treated mice were adenomas, and masses from two of the mice were osteosarcomas. No osteosarcomas were observed in DMSO-treated mice. All liver masses from AFB1-treated mice were adenomas, and one also contained a hepatocellular carcinoma. In DNA from the lung tumours, the K-ras mutation pattern was inconsistent with initiation by AFB1. In conclusion, ogg1 status did not have a significant effect on AFB1-induced oxidatively damaged DNA or tumourigenesis, but deletion of one or both alleles of ogg1 did increase susceptibility to other aspects of AFB1 toxicity. PMID:25583175

  1. Inhibition of ebselen on aflatoxin B(1)-induced hepatocarcinogenesis in Fischer 344 rats.


    Yang, C F; Liu, J; Wasser, S; Shen, H M; Tan, C E; Ong, C N


    Aflatoxin B(1) (AFB(1)), a potent hepatocarcinogen, enhances ROS formation and causes oxidative DNA damage, which may play a role in its carcinogenicity. We have demonstrated recently that ebselen, an organic selenium compound, protects against the cytotoxicity of AFB(1) through its antioxidant capability. The present study was designed to investigate the effect of ebselen on AFB(1)-induced hepatocarcinogenesis in an animal model. Fischer 344 rats were first treated with either deionized water or ebselen (5 mg/kg, 5 days/week) via gavage for 4 weeks, then given AFB(1) (0.4 mg/kg, gavage, once a week) or AFB(1) plus ebselen (5 mg/kg, 5 days/week) for another 24 weeks. The results showed that the hepatocarcinogenicity of AFB(1) in rats was significantly reduced by ebselen treatment as indicated by a decrease in: (i) serum gamma-glutamyl transpeptidase activity; (ii) expression of mRNAs of liver alpha-fetoprotein and the placental form of glutathione S-transferase (GST-P); and (iii) the area and mean density of staining of liver GST-P foci. Ebselen treatment significantly reduced the formation of hepatic AFB(1)-DNA adducts and 8-hydroxydeoxyguanosine caused by AFB(1) exposure. These findings suggest that ebselen can inhibit the carcinogenicity of AFB(1). In addition to the reduction of AFB(1)-DNA adduct formation, the protective effect of ebselen against AFB(1)-induced oxidative DNA damage may also, at least in part, contribute to its anticarcinogenic property. PMID:11133813

  2. A novel method for determination of aflatoxin B1 mediated by FCLA + BSA

    NASA Astrophysics Data System (ADS)

    Chen, WenLi; Xing, Da


    As a chemiluminescence (CL) probe, 3,7-dihydro-6-{4-{2-(N"-(5-fluoresceinyl) thioureido)ethoxy}phenyl}-2-met -hylimi-dazo{1,2-a}pyrazin-3-one dosium salt (FCLA) can sensitively and specifically react with singlet oxygen (1O2 ) and superoxide(O2""). BSA (Bovine Serum Albumin) can enlarge the CL intensity of FCLA to 860%. This report presents a novel method for determination of Aflatoxin B1 (AfB1) mediated by FCLA+BSA. The concentration of AFB1 showed an obvious positive correlation with the CL intensity mediated by FCLA+BSA. This method could measure accurately ng/ml of AfB1 concentration. At the same time, the fluorescence spectrum of FCLA+BSA and FCLA+BSA+AfB1 were measured respectively, which showed that the fluorescence intensity of FCLA+BSA+AfB1 was higher than FCLA+BSA. Comparing the peak value of FCLA, FCLA+BSA and FCLA+BSA+AfB1 had a 6nm Einstein shift (red shift). The study suggested that CL method mediated by FCLA+BSA might be applicable to the determination of AfB1 concentration.

  3. Aflatoxin B1 in eggs and chicken livers by dispersive liquid-liquid microextraction and HPLC.


    Amirkhizi, Behzad; Arefhosseini, Seyed Rafie; Ansarin, Masoud; Nemati, Mahboob


    A rapid, low-cost and simple technique has been developed for the determination of aflatoxin B1 (AFB1) in eggs and livers using high-performance liquid chromatography (HPLC) with UV detection. In this study, the presence of AFB1 was investigated in 150 eggs and 50 chicken livers from the local market of Tabriz, Iran. AFB1 was extracted with a mixture of acetonitrile:water (80:20) and cleaned up by dispersive liquid-liquid microextraction which is a very economical, fast and sensitive method. AFB1 was quantified by HPLC-UV without need for any complex derivatisation in samples to enhance the detection. The results showed that 72% of the liver and 58% of the egg samples were contaminated with AFB1 ranging from 0.30 to 16.36 µg kg (̶1). limit of detection and limit of quantification for AFB1 were 0.08 and 0.28 µg kg (̶ 1), respectively. The proposed method is suitable for fast analysing of AFB1 in egg and liver samples. PMID:26160230

  4. Response of the hepatic transcriptome to aflatoxin B1 in ducklings.


    Zhang, Ni-Ya; Qi, Ming; Gao, Xin; Zhao, Ling; Liu, Jie; Gu, Chang-Qin; Song, Wen-Jing; Krumm, Christopher Steven; Sun, Lv-Hui; Qi, De-Sheng


    This study was conducted to determine the effects of aflatoxin B1 (AFB1) on the hepatic transcriptome in ducklings through RNA-sequencing (RNA-Seq). Twenty four, 1-day-old ducklings were divided into 4 treatment groups. Each group received an oral dose of AFB1 at 0, 10, 20, 40 μg/kg BW per day for 2 weeks. Administration of 20 and 40 μg/kg BW of AFB1 significantly decreased body weight, feed intake, serum total protein and albumin, while increasing serum aspartate aminotransferase and alanine aminotransferase activities, and hepatic histopathological lesions. Furthermore, RNA was extracted from the liver of ducklings administrated 0 and 40 μg/kg BW of AFB1. Two RNA-Seq libraries were created from pooled samples and produced over 149 M reads, totaling 14.9 Gb of sequence. Approximately 96,953 predicted transcripts were assembled, 749 of which had significant differential expressions (≥ 2-fold) between the control and AFB1 treatment. GO and KEGG pathway analysis results showed that many genes involved in phase I metabolism, phase II detoxification, oxidation-reduction process, carcinogenesis, apoptosis and cell cycle, and fatty acid metabolism were affected by AFB1 exposure. Conclusion, this study determined the hepatic transcriptome responded to AFB1 exposure, and provide candidate genes can be targeted to prevent and/or reduce aflatoxicosis in ducklings. PMID:26763128

  5. Exposure to aflatoxin B1 in Thailand by consumption of brown and color rice.


    Panrapee, Iamtaweejaroen; Phakpoom, Kooprasertying; Thanapoom, Maneeboon; Nampeung, Anukul; Warapa, Mahakarnchanakul


    This study assessed the aflatoxin B1 (AFB1) intake of the Thai population through consumption of contaminated brown and color rice. A total of 240 rice samples from two harvesting periods were collected in June/July 2012 (period I) and in December 2012/January 2013 (period II) and analyzed for AFB1 by HPLC with fluorescence detection (limit of detection (LOD) = 0.093 ng/g). Exposure assessment was based on AFB1 levels in rice and food intake data for rice according to Thai National Consumption. Frequency and levels of AFB1 were higher in period I (59%, aflatoxin of 20 μg kg(-1), but 12 out of 240 rice samples exceeded the European Union maximum level for AFB1 of 2 μg kg(-1). The data showed that the quality and safety of Thai rice largely comply with the requirement for both exports and domestic consumption. According to the Thai National Consumption data, the estimated AFB1 intake via rice consumption in period I and period II was 0.80 and 0.12 μg kg(-1) bw day(-1), respectively. The potential risk for cancer, based on the recommendation of the JECFA, was estimated to be 0.011 person/year/100,000 people at a mean consumption. Although the risk via consumption of Thai rice seems to be low, the maximum levels of AFB1 in this staple food suggest that careful monitoring and surveillance of AFB1 contamination in rice is essential to ensure the safety of rice. PMID:26686516

  6. Absence of the Aflatoxin Biosynthesis Gene, norA, allows accumulation of deoxyaflatoxin B1 in Aspergillus flavus cultures

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Conversion of O-methylsterigmatocystin (OMST) to aflatoxin B1 (AFB1), a highly toxic and carcinogenic fungal metabolite of some Aspergillus species, begins with its oxidation catalyzed by the cytochrome P450 monooxygenase, OrdA (AflQ). The complexity of the subsequent oxidation, hydration, ring-ope...

  7. Chemopreventive effect of cactus Opuntia ficus indica on oxidative stress and genotoxicity of aflatoxin B1

    PubMed Central


    Background Aflatoxin B1 (AFB1) is potent hepatotoxic and hepatocarcinogenic agent. In aflatoxicosis, oxidative stress is a common mechanism contributing to initiation and progression of hepatic damage. The aim of this work was to evaluate the hepatoprotective effect of cactus cladode extract (CCE) on aflatoxin B1-induced liver damage in mice by measuring malondialdehyde (MDA) level, the protein carbonyls generation and the heat shock proteins Hsp 70 and Hsp 27 expressions in liver. We also looked for an eventual protective effect against AFB1-induced genotoxicity as determined by chromosome aberrations test, SOS Chromotest and DNA fragmentation assay. We further evaluated the modulation of p53, bax and bcl2 protein expressions in liver. Methods Adult, healthy balbC (20-25 g) male mice were pre-treated by intraperitonial administration of CCE (50 mg/Kg.b.w) for 2 weeks. Control animals were treated 3 days a week for 4 weeks by intraperitonial administration of 250 μg/Kg.b.w AFB1. Animals treated by AFB1 and CCE were divided into two groups: the first group was administrated CCE 2 hours before each treatment with AFB1 3 days a week for 4 weeks. The second group was administrated without pre-treatment with CCE but this extract was administrated 24 hours after each treatment with AFB1 3 days a week for 4 weeks. Results Our results clearly showed that AFB1 induced significant alterations in oxidative stress markers. In addition, it has a genotoxic potential and it increased the expression of pro apoptotic proteins p53 and bax and decreased the expression of bcl2. The treatment of CCE before or after treatment with AFB1, showed (i) a total reduction of AFB1 induced oxidative damage markers, (ii) an anti-genotoxic effect resulting in an efficient prevention of chromosomal aberrations and DNA fragmentation compared to the group treated with AFB1 alone (iii) restriction of the effect of AFB1 by differential modulation of the expression of p53 which decreased as well as its

  8. Study of Protective Effect of Date and Nigella Sativa on Aflatoxin B1 Toxicity

    PubMed Central

    Al-Ghasham, Abdalla; Ata, Hesham Saad; El-Deep, Said; Meki, Abdel-Raheim; Shehada, Salah


    Background: Many medicinal plants and their purified constituents have been shown beneficial therapeutic potentials. Seeds of Nigella sativa, a dicotyledon of the Ranunculaceae family, have been utilized for thousands of years as a spice and food preservative. Methods: the toxic effect of aflatoxin-B1 (AFB1) and the possible cytoprotective effect of Nigella sativa (NS) oil and aqueous extract of date were studied on 40 male rats. The animals were divided into 4 groups (10 rats each) and treated daily for two weeks. Group 1 received normal saline as controls. Group 2 treated via intraperitoneal (IP) route with AFB1 (50μg/kg BW). Group 3 treated with AFB1 and NS oil via IP. Group 4 treated with AFB1 and received orally aqueous extract of date (15mg/15ml). The liver and kidneys of each animal were histological examined and biochemical evaluation of the liver and kidney functions was performed. Results: Group 2 showed severe degenerative and necrotic changes in the liver and kidney. The plasma levels of alanine transaminase (ALT), aspartate transaminase (AST), creatinine and urea in AFB1 group were significantly higher than the control group. Livers and kidneys of rats, treated with AFB1 and NS showed less histopathological changes in comparison with the AFB1 treated group. Livers and kidneys of rats treated with AFB1 and date group showed only mild histopathological changes in comparison with AFB1 treated group. These histopathological changes seen in animals treated with AFB1 and dates were associated with a significant reduction in levels of ALT, AST, creatinine and urea. Likewise, histopathological changes in the AFB1 and NS group were associated with significant reduction in the levels of beforementioned indices. Moreover, AFB1 and date group showed significant improvement in liver function comparing with AFB1 and NS group. Conclusion: our study revealed that treatment with AFB1 induced histopathological changes in the tissues of liver and kidney associated with

  9. Effects of aflatoxin B1 and fumonisin B1 on body weight, antibody titres and histology of broiler chicks.


    Tessari, E N C; Oliveira, C A F; Cardoso, A L S P; Ledoux, D R; Rottinghaus, G E


    1. Our objective was to evaluate the toxic effects of aflatoxin B1 (AFB1) and fumonisin B1 (FB1), administered singly or in combination to broilers. 2. Feeds were prepared with concentrations equal to 0, 50 and 200 microg AFB1/kg, and/or 0, 50 and 200 mg FB1/kg, and offered to broiler chicks from 8 to 41 d of age. The experimental design was totally randomised, in a 3 x 3 factorial arrangement with 9 treatments and 12 birds per treatment. Animals were vaccinated against Newcastle disease on d 14 of life and killed at 41 d. 3. Compared with controls, all mycotoxin-treated groups at 41 d had lower body weight and weight gain, and higher relative heart weight. The relative weight of the liver increased only in birds fed diets containing 200 mg FB1, singly or in combination with AFB1. 4. At 35 d, all groups receiving mycotoxin-treated rations had reduced geometrical mean antibody titres, with birds from groups fed combinations of AFB1 and FB1/kg having even lower values, when compared to the other groups. 5. Histological changes were observed only in liver from birds fed mycotoxin-contaminated rations, and in kidneys of birds fed the diet containing 200 microg AFB1 and 200 mg FB1/kg. Main alterations included vacuolar degeneration and cell proliferation of bile ducts in the liver, and hydropic degeneration in renal tubules in the kidneys. 6. We concluded that AFB1 and FB1 in combination have primarily additive effects on body weight, liver structure and immunological response of broilers at the concentrations used. PMID:16787861

  10. Aflatoxin B1 degradation by liquid cultures and lysates of three bacterial strains.


    Adebo, Oluwafemi Ayodeji; Njobeh, Patrick Berka; Sidu, Sibusiso; Tlou, Matsobane Godfrey; Mavumengwana, Vuyo


    Aflatoxin contamination remains a daunting issue to address in food safety. In spite of the efforts geared towards prevention and elimination of this toxin, it still persists in agricultural commodities. This has necessitated the search for other measures such as microbial degradation to combat this hazard. In this study, we investigated the biodegradation of aflatoxin B1 (AFB1), using lysates of three bacterial strains (Pseudomonas anguilliseptica VGF1, Pseudomonas fluorescens and Staphylococcus sp. VGF2) isolated from a gold mine aquifer. The bacterial cells were intermittently lysed in the presence and absence of protease inhibitors to obtain protease free lysates, subsequently incubated with AFB1 for 3, 6, 12, 24, and 48h to investigate whether any possible AFB1 degradation occurred using high performance liquid chromatography (HPLC) for detection. Results obtained revealed that after 6h of incubation, protease inhibited lysates of Staphylococcus sp. VGF2 demonstrated the highest degradation capacity of 100%, whereas P. anguilliseptica VGF1 and P. fluorescens lysates degraded AFB1 by 66.5 and 63%, respectively. After further incubation to 12h, no residual AFB1 was detected for all the lysates. Lower degrading ability was however observed for liquid cultures and uninhibited lysates. Data on cytotoxicity studies against human lymphocytes showed that the degraded products were less toxic than the parent AFB1. From this study, it can thus be deduced that the mechanism of degradation by these bacterial lysates is enzymatic. This study shows the efficacy of crude bacterial lysates for detoxifying AFB1 indicating potential for application in the food and feed industry. PMID:27294556

  11. In vitro studies on chemoprotective effect of borax against aflatoxin B1-induced genetic damage in human lymphocytes.


    Turkez, Hasan; Geyikoğlu, Fatime; Dirican, Ebubekir; Tatar, Abdulgani


    A common dietary contaminant, aflatoxin B1 (AFB1), has been shown to be a potent mutagen and carcinogen in humans and many animal species. Since the eradication of AFB1 contamination in agricultural products has been rare, the use of natural or synthetic free radical scavengers could be a potential chemopreventive strategy. Boron compounds like borax (BX) and boric acid are the major components of industry and their antioxidant role has recently been reported. In the present report, we evaluated the capability of BX to inhibit the rate of micronucleus (MN) and sister chromatid exchange (SCE) formations induced by AFB1. There were significant increases (P < 0.05) in both SCE and MN frequencies of cultures treated with AFB1 (3.12 ppm) as compared to controls. However, co-application of BX (1, 2 and 5 ppm) and AFB1 resulted in decreases of SCE and MN rates as compared to the group treated with AFB1 alone. Borax gave 30-50 % protection against AFB1 induced SCEs and MNs. In conclusion, the support of borax was especially useful in aflatoxin-toxicated blood tissue. Thus, the risk on target tissues of AFB1 could be reduced and ensured early recovery from its toxicity. PMID:22526492

  12. Effects of milk thistle seed against aflatoxin B1 in broiler model

    PubMed Central

    Amiridumari, Halimeh; Sarir, Hadi; Afzali, Nazar; FaniMakki, Omid


    Background: Consumption of aflatoxin B1 (AFB1) contaminated products can pose a risk of development of various diseases in human and animals due to radical production. The scope of this work is to evaluate the efficacy of milk thistle seed (MTS), as a radical scavenger, on serum biochemistry, lipid profile and liver enzymes against AFB1 in broiler chickens contaminated with AFB1. Materials and Methods: The effect of nine experimental treatments (3 × 3 factorial design) was assessed using 216 one-d-old Ross 308 male broiler chicks in a randomized complete design with four replicates of six birds for each dietary treatments: Control (T1), 250 ppb AFB1 (T2), 500 ppb AFB1 (T3), 0.5% MTS (T4), 0.5% MTS Plus 250 ppb AFB1 (T5), 0.5% MTS Plus 500 ppb AFB1 (T6), 1.0% MTS (T7), 1.0% MTS Plus 250 ppb AFB1 (T8), and 1.0% MTS Plus 500 ppb AFB1 (T9). The individual and combined effects of dietary AFB1 and MTS on serum biochemistry factors (Glucose, Calcium, Phosphorus, Iron, Creatinine, and Uric acid), lipid profile (Triglyceride, Cholesterol, Low density lipoprotein (LDL), and High density lipoprotein (HDL)) and liver enzymes aspartate amino-transferase and alanine amino-transaminase (ALT) in broilers were evaluated at 21 days of age. Also, statistical packages Macros-1.002 (2010) were used to perform the above analysis on computer. Results: Consumption of 500 ppb AFB1 in to the diet significantly decreased HDL (58.13 ± 2.65), Calcium (7.11 ± 0.13), and Glucose (197.1 ± 7.42) compared to the control group (85.12 ± 1.95, 9.45 ± 0.17 and 223.1 ± 6.61, respectively), (P < 0.05). In contrast, it significantly increased creatinine (2.25 ± 0.011) and AST (244.51 ± 4.91). Using MTS together with AFB1 significantly reduced the effect of AFB1 on the above parameters. Conclusion: MTS can provide protection against the negative effects of AFB1 on broiler chicks. PMID:24381623

  13. In Vitro Efficacy of Myxococcus fulvus ANSM068 to Biotransform Aflatoxin B1

    PubMed Central

    Guan, Shu; Zhao, Lihong; Ma, Qiugang; Zhou, Ting; Wang, Ning; Hu, Xinxu; Ji, Cheng


    Aflatoxin B1 (AFB1) is commonly found in cereals and animal feeds and causes a significant threat to the food industry and animal production. Several microbial isolates with high AFB1 transformation ability have been identified in our previous studies. The aim of this research was to characterize one of those isolates, Myxococcus fulvus ANSM068, and to explore its biotransformation mechanism. The bacterial isolate of M. fulvus ANSM068, isolated from deer feces, was able to transform AFB1 by 80.7% in liquid VY/2 medium after incubation at 30 °C for 72 h. The supernatant of the bacterial culture was more effective in transforming AFB1 as compared to the cells alone and the cell extract. The transformation activity was significantly reduced and eradicated after the culture supernatant was treated with proteinase K, proteinase K plus SDS and heating. Culture conditions, including nitrogen source, initial pH and incubation temperature were evaluated for an optimal AFB1 transformation. Liquid chromatography mass spectrometry (LCMS) analyses showed that AFB1 was transformed to a structurally different compound. Infrared analysis (IR) indicated that the lactone ring on the AFB1 molecule was modified by the culture supernatant. Chromatographies on DEAE-Ion exchange and Sephadex-Molecular sieve and SDS-PAGE electrophoresis were used to determine active components from the culture supernatant, indicating that enzyme(s) were responsible for the AFB1 biotransformation. This is the first report on AFB1 transformation by a strain of myxobacteria through enzymatic reaction(s). PMID:21152320

  14. Hepatic Transcriptome Responses of Domesticated and Wild Turkey Embryos to Aflatoxin B1

    PubMed Central

    Monson, Melissa S.; Cardona, Carol J.; Coulombe, Roger A.; Reed, Kent M.


    The mycotoxin, aflatoxin B1 (AFB1) is a hepatotoxic, immunotoxic, and mutagenic contaminant of food and animal feeds. In poultry, AFB1 can be maternally transferred to embryonated eggs, affecting development, viability and performance after hatch. Domesticated turkeys (Meleagris gallopavo) are especially sensitive to aflatoxicosis, while Eastern wild turkeys (M. g. silvestris) are likely more resistant. In ovo exposure provided a controlled AFB1 challenge and comparison of domesticated and wild turkeys. Gene expression responses to AFB1 in the embryonic hepatic transcriptome were examined using RNA-sequencing (RNA-seq). Eggs were injected with AFB1 (1 μg) or sham control and dissected for liver tissue after 1 day or 5 days of exposure. Libraries from domesticated turkey (n = 24) and wild turkey (n = 15) produced 89.2 Gb of sequence. Approximately 670 M reads were mapped to a turkey gene set. Differential expression analysis identified 1535 significant genes with |log2 fold change| ≥ 1.0 in at least one pair-wise comparison. AFB1 effects were dependent on exposure time and turkey type, occurred more rapidly in domesticated turkeys, and led to notable up-regulation in cell cycle regulators, NRF2-mediated response genes and coagulation factors. Further investigation of NRF2-response genes may identify targets to improve poultry resistance. PMID:26751476

  15. Effects of Nutrients in Substrates of Different Grains on Aflatoxin B1 Production by Aspergillus flavus

    PubMed Central

    Liu, Jie; Sun, Lvhui; Zhang, Niya; Zhang, Jiacai; Guo, Jiao; Li, Chong; Rajput, Shahid Ali; Qi, Desheng


    The current study was to better understand the potential factors affecting aflatoxin B1 (AFB1) accumulation varies between different grains. The nutrient composition and contents of defatted substrates were determined; additionally, according to the nutrient content of the substrates, the effects of starch, soluble sugars, amino acids, and trace elements on AFB1 production and mycelial growth in Czapek-Dox medium were examined. These results verified that removal of lipids from ground substrates significantly reduced the substrate's potential for AFB1 production by Aspergillus flavus. Maltose, glucose, sucrose, arginine, glutamic acid, aspartic acid, and zinc significantly induced AFB1 production up to 1.7- to 26.6-fold. And stachyose more significantly promoted A. flavus growth than the other nutrients. Thus, this study demonstrated that, combined with the nutrients content of grains, in addition to lipids, sucrose, stachyose, glutamic acid, and zinc might play key roles in various grains that are differentially infected by A. flavus. Particularly, two new nutrients (arginine and stachyose) of the grains we found significantly stimulate AFB1 production and A. flavus growth, respectively. The results provide new concepts for antifungal methods to protect food and animal feed from AFB1 contamination. PMID:27294129

  16. Determination of Aflatoxin B1 Levels in Organic Spices and Herbs

    PubMed Central

    Tosun, Halil; Arslan, Recep


    Organically produced spices and herbs were analyzed for determination of aflatoxin B1 (AFB1) by ELISA using immunoaffinity column. For this purpose 93 organic spices and 37 organic herbs were randomly selected from organic markets and organic shops in Turkey. AFB1 was detected in 58 organic spice and 32 organic herb samples. Among organic spice samples, the maximum value was detected in cinnamon sample (53 μg/kg). AFB1 was not detected in thyme samples. AFB1 levels of 41 organic spice samples were above the EU regulatory limit (5 μg/kg). Among organic herb samples the highest concentration of AFB1 (52.5 μg/kg) was detected in a rosehip sample. AFB1 levels of 21 organic herb samples were above the regulatory limits of the European Union. These results showed that more stringent measures must be taken for the prevention of mold contamination in the production of organic spices and herbs. PMID:23766719

  17. Effects of Nutrients in Substrates of Different Grains on Aflatoxin B1 Production by Aspergillus flavus.


    Liu, Jie; Sun, Lvhui; Zhang, Niya; Zhang, Jiacai; Guo, Jiao; Li, Chong; Rajput, Shahid Ali; Qi, Desheng


    The current study was to better understand the potential factors affecting aflatoxin B1 (AFB1) accumulation varies between different grains. The nutrient composition and contents of defatted substrates were determined; additionally, according to the nutrient content of the substrates, the effects of starch, soluble sugars, amino acids, and trace elements on AFB1 production and mycelial growth in Czapek-Dox medium were examined. These results verified that removal of lipids from ground substrates significantly reduced the substrate's potential for AFB1 production by Aspergillus flavus. Maltose, glucose, sucrose, arginine, glutamic acid, aspartic acid, and zinc significantly induced AFB1 production up to 1.7- to 26.6-fold. And stachyose more significantly promoted A. flavus growth than the other nutrients. Thus, this study demonstrated that, combined with the nutrients content of grains, in addition to lipids, sucrose, stachyose, glutamic acid, and zinc might play key roles in various grains that are differentially infected by A. flavus. Particularly, two new nutrients (arginine and stachyose) of the grains we found significantly stimulate AFB1 production and A. flavus growth, respectively. The results provide new concepts for antifungal methods to protect food and animal feed from AFB1 contamination. PMID:27294129

  18. Prenatal exposure to aflatoxin B1: developmental, behavioral, and reproductive alterations in male rats

    NASA Astrophysics Data System (ADS)

    Supriya, Ch.; Reddy, P. Sreenivasula


    Previous studies have shown that aflatoxin B1 (AfB1) inhibits androgen biosynthesis as a result of its ability to form a high-affinity complex with the steroidogenic acute regulatory protein. The results of the present study demonstrate the postnatal effects of in utero exposure to AfB1 in the rat. Pregnant Wistar rats were given 10, 20, or 50 μg AfB1/kg body weight daily from gestation day (GD) 12 to GD 19. At parturition, newborns were observed for clinical signs and survival. All animals were born alive and initially appeared to be active. Male pups from control and AfB1-exposed animals were weaned and maintained up to postnatal day (PD) 100. Litter size, birth weight, sex ratio, survival rate, and crown-rump length of the pups were significantly decreased in AfB1-exposed rats when compared to controls. Elapsed time (days) for testes to descend into the scrotal sac was significantly delayed in experimental pups when compared to control pups. Behavioral observations such as cliff avoidance, negative geotaxis, surface rightening activity, ascending wire mesh, open field behavior, and exploratory and locomotory activities were significantly impaired in experimental pups. Body weights and the indices of testis, cauda epididymis, prostate, seminal vesicles, and liver were significantly reduced on PD 100 in male rats exposed to AfB1 during embryonic development when compared with controls. Significant reduction in the testicular daily sperm production, epididymal sperm count, and number of viable, motile, and hypo-osmotic tail coiled sperm was observed in experimental rats. The levels of serum testosterone and activity levels of testicular hydroxysteroid dehydrogenases were significantly decreased in a dose-dependent manner with a significant increase in the serum follicle-stimulating hormone and luteinizing hormone in experimental rats. Deterioration in the testicular and cauda epididymal architecture was observed in experimental rats. The results of fertility

  19. Prenatal exposure to aflatoxin B1: developmental, behavioral, and reproductive alterations in male rats.


    Supriya, Ch; Reddy, P Sreenivasula


    Previous studies have shown that aflatoxin B1 (AfB1) inhibits androgen biosynthesis as a result of its ability to form a high-affinity complex with the steroidogenic acute regulatory protein. The results of the present study demonstrate the postnatal effects of in utero exposure to AfB1 in the rat. Pregnant Wistar rats were given 10, 20, or 50 μg AfB1/kg body weight daily from gestation day (GD) 12 to GD 19. At parturition, newborns were observed for clinical signs and survival. All animals were born alive and initially appeared to be active. Male pups from control and AfB1-exposed animals were weaned and maintained up to postnatal day (PD) 100. Litter size, birth weight, sex ratio, survival rate, and crown-rump length of the pups were significantly decreased in AfB1-exposed rats when compared to controls. Elapsed time (days) for testes to descend into the scrotal sac was significantly delayed in experimental pups when compared to control pups. Behavioral observations such as cliff avoidance, negative geotaxis, surface rightening activity, ascending wire mesh, open field behavior, and exploratory and locomotory activities were significantly impaired in experimental pups. Body weights and the indices of testis, cauda epididymis, prostate, seminal vesicles, and liver were significantly reduced on PD 100 in male rats exposed to AfB1 during embryonic development when compared with controls. Significant reduction in the testicular daily sperm production, epididymal sperm count, and number of viable, motile, and hypo-osmotic tail coiled sperm was observed in experimental rats. The levels of serum testosterone and activity levels of testicular hydroxysteroid dehydrogenases were significantly decreased in a dose-dependent manner with a significant increase in the serum follicle-stimulating hormone and luteinizing hormone in experimental rats. Deterioration in the testicular and cauda epididymal architecture was observed in experimental rats. The results of fertility

  20. The effect of aflatoxin-B1 on red drum (Sciaenops ocellatus) and assessment of dietary supplementation of NovaSil for the prevention of aflatoxicosis.


    Zychowski, Katherine E; Hoffmann, Aline Rodrigues; Ly, Hoai J; Pohlenz, Camilo; Buentello, Alejandro; Romoser, Amelia; Gatlin, Delbert M; Phillips, Timothy D


    Aflatoxin B1 (AFB1) is a potent carcinogen that causes growth stunting, immunosuppression and liver cancer in multiple species. The recent trend of replacing fishmeal with plant-based proteins in fish feed has amplified the AFB1 exposure risk in farm-raised fish. NovaSil (NS), a calcium montmorillonite clay, has previously been shown to reduce AFB1 bioavailability safely and efficaciously in several mammalian species. This study was designed to: (1) evaluate AFB1 impact on cultured red drum, Sciaenops ocellatus, over the course of seven weeks; and (2) assess NS supplementation as a strategy to prevent aflatoxicosis. Fish were fed diets containing 0, 0.1, 0.25, 0.5, 1, 2, 3, or 5 ppm AFB1. Two additional treatment groups were fed either 5 ppm AFB1 + 1% NS or 5 ppm AFB1 + 2% NS. Aflatoxin B1 negatively impacted red drum weight gain, survival, feed efficiency, serum lysozyme concentration, hepatosomatic index (HSI), whole-body lipid levels, liver histopathological scoring, as well as trypsin inhibition. NovaSil inclusion in AFB1-contaminated diets improved weight gain, feed efficiency, serum lysozyme concentration, muscle somatic index, and intraperitoneal fat ratios compared to AFB1-treated fish. Although not significant, NS reduced AFB1-induced histopathological changes in the liver and decreased Proliferating Cell Nuclear Antigen (PCNA) staining. Importantly, NS supplementation improved overall health of AFB1-exposed red drum. PMID:24064717

  1. Zinc inhibits aflatoxin B1-induced cytotoxicity and genotoxicity in human hepatocytes (HepG2 cells).


    Yang, Xuan; Lv, Yangjun; Huang, Kunlun; Luo, Yunbo; Xu, Wentao


    Aflatoxin B1 (AFB1) has strong carcinogenicity. Consumption of AFB1-contaminated agricultural products and the occurrence of hepatocellular carcinoma have received widespread attention. The aim of this paper was to investigate whether zinc supplementation could inhibit AFB1-induced cytotoxicity and genotoxicity in HepG2 cells and the mechanism of this inhibition. Our data suggest that zinc sources can relieve a certain degree of AFB1-induced cytotoxicity and genotoxicity by protecting against apoptotic body formation and DNA strand breaks, affecting S phase cell cycle arrest, reducing 8-OHdG formation, inhibiting global DNA hypomethylation and regulating gene expression in antioxidation, zinc-association and apoptosis processes. Consequently, zinc stabilizes the integrity of DNA and improves cell survival. These data provides new insights into the protective role of zinc in alleviating AFB1-induced cytotoxicity and mediating epigenetic changes in hepatocytes, demonstrating that zinc sources have detoxification properties in mycotoxin-induced toxicity. PMID:27017951

  2. Occurrence of aflatoxin B1 in natural products.


    Prado, Guilherme; Altoé, Aline F; Gomes, Tatiana C B; Leal, Alexandre S; Morais, Vanessa A D; Oliveira, Marize S; Ferreira, Marli B; Gomes, Mateus B; Paschoal, Fabiano N; von S Souza, Rafael; Silva, Daniela A; Cruz Madeira, Jovita E G


    The media claims for the consumption of natural resource-based food have gradually increased in both developing and developed countries. The interest in the safety of these products is partially due to the possible presence of toxigenic fungi acting as mycotoxin producers, such as aflatoxins produced during the secondary metabolism of Aspergillus flavus, A. parasiticus and A. nomius. Aflatoxins, mainly aflatoxin B1, are directly associated with liver cancer in human beings. This paper is aimed at evaluating the presence of aflatoxin B1 in a few vegetable drugs, dried plant extracts and industrialized products traded in 2010 in the city of Belo Horizonte, State of Minas Gerais, Brazil. The method used for the quantification of aflatoxin B1 was based on extraction through acetone:water (85:15), immunoaffinity column purification followed by separation and detection in high efficiency liquid chromatography. Under the conditions of analysis, the Limits of Detection and Quantification were 0.6 µg kg(-1) and 1.0 µg kg(-1) respectively. The complete sets of analyses were carried out in duplicate. Aflatoxin B1 was noticed in a single sample (< 1.0 µg kg(-1)). The results revealed low aflatoxin B1 contamination in the products under analysis. However, it is required to establish a broad monitoring program in order to obtain additional data and check up on the actual extension of contamination. PMID:24031973

  3. Occurrence of aflatoxin B1 in natural products

    PubMed Central

    Prado, Guilherme; Altoé, Aline F.; Gomes, Tatiana C. B.; Leal, Alexandre S.; Morais, Vanessa A. D.; Oliveira, Marize S.; Ferreira, Marli B.; Gomes, Mateus B.; Paschoal, Fabiano N.; von S. Souza, Rafael; Silva, Daniela A.; Cruz Madeira, Jovita E. G.


    The media claims for the consumption of natural resource-based food have gradually increased in both developing and developed countries. The interest in the safety of these products is partially due to the possible presence of toxigenic fungi acting as mycotoxin producers, such as aflatoxins produced during the secondary metabolism of Aspergillus flavus, A. parasiticus and A. nomius. Aflatoxins, mainly aflatoxin B1, are directly associated with liver cancer in human beings. This paper is aimed at evaluating the presence of aflatoxin B1 in a few vegetable drugs, dried plant extracts and industrialized products traded in 2010 in the city of Belo Horizonte, State of Minas Gerais, Brazil. The method used for the quantification of aflatoxin B1 was based on extraction through acetone:water (85:15), immunoaffinity column purification followed by separation and detection in high efficiency liquid chromatography. Under the conditions of analysis, the Limits of Detection and Quantification were 0.6 µg kg-1 and 1.0 µg kg-1 respectively. The complete sets of analyses were carried out in duplicate. Aflatoxin B1 was noticed in a single sample (< 1.0 µg kg-1). The results revealed low aflatoxin B1 contamination in the products under analysis. However, it is required to establish a broad monitoring program in order to obtain additional data and check up on the actual extension of contamination. PMID:24031973

  4. Low cost quantitative digital imaging as an alternative to qualitative in vivo bioassays for analysis of active aflatoxin B1.


    Rasooly, Reuven; Do, Paula M; Hernlem, Bradley J


    Aflatoxin B1 (AFB1) producing fungi contaminate food and feed and are a major health concern. To minimize the sources and incidence of AFB1 illness there is a need to develop affordable, sensitive mobile devices for detection of active AFB1. In the present study we used a low cost fluorescence detector and describe two quantitative assays for detection of detoxified and active AFB1 demonstrating that AFB1 concentration can be measured as intensity of fluorescence. When the assay plate containing increasing concentrations of AFB1 is illuminated with a 366 nm ultraviolet lamp, AFB1 molecules absorb photons and emit blue light with peak wavelength of 432 nm. The fluorescence intensity increased in dose dependent manner. However, this method cannot distinguish between active AFB1 which poses a threat to health, and the detoxified AFB1 which exhibits no toxicity. To measure the toxin activity, we used a cell based assay that makes quantification more robust and is capable of detecting multiple samples simultaneously. It is an alternative to the qualitative duckling bioassay which is the "gold-standard" assay currently being used for quantitative analysis of active AFB1. AFB1 was incubated with transduced Vero cells expressing the green fluorescence protein (GFP) gene. After excitation with blue light at 475 nm, cells emitted green light with emission peak at 509 nm. The result shows that AFB1 inhibits protein expression in a concentration dependent manner resulting in proportionately less GFP fluorescence in cells exposed to AFB1. The result also indicates strong positive linear relationship with R(2)=0.90 between the low cost CCD camera and a fluorometer, which costs 100 times more than a CCD camera. This new analytical method for measuring active AFB1 is low in cost and combined with in vitro assay, is quantitative. It also does not require the use of animals and may be useful especially for laboratories in regions with limited resources. PMID:26874107

  5. Supercritical Fluid Extraction of Aflatoxin B 1 from Soil

    EPA Science Inventory

    This research describes the development of a Supercritical Fluid Extraction (SFE) method to recover aflatoxin B1 from fortified soil. The effects of temperature, pressure, modifier (identity and percentage), and extraction type were assessed. Using the optimized SFE conditions, ...

  6. Aflatoxin B1-induced hepatocellular carcinoma in developing countries: Geographical distribution, mechanism of action and prevention

    PubMed Central



    Hepatocellular carcinoma (HCC) is the most well-known primary liver malignancy worldwide. Its incidence is rising at alarming rates and has become a public concern globally. It is more frequent in developing countries than in industrialized countries with respect to geographical variation, ethnic disparities and socioeconomic status. Dietary exposure to aflatoxins is among the major HCC risk factors. Aflatoxin B1, which is a genotoxic hepatocarcinogen, which presumptively causes cancer by inducing DNA adducts leading to genetic changes in target liver cells. AFB1 is metabolized by cytochrome-P450 enzymes to the reactive intermediate AFB1-8, 9 epoxide (AFBO) which binds to liver cell DNA, resulting in DNA adducts. DNA adducts interact with the guanine bases of liver cell DNA and cause a mutational effect in the P53 tumor suppressor gene at the codon 249 hotspot in exon 7, which may lead to HCC. Approximately 4.5 billion of the world’s population is exposed to aflatoxin-contaminated food, particularly in low-income countries. Prevention involves treating crops that are susceptible to fungal contamination, appropriate handling of foodstuffs and the use of chemopreventive intervention. Moreover, an integrated network collaboration of different sectors, including public health, agricultural departments and mass media, is required to ensure effective food regulation systems so as to minimize the contamination of food by aflatoxins. PMID:23599745

  7. Sequential dietary exposure to aflatoxin B1 and fumonisin B1 in F344 rats increases liver preneoplastic changes indicative of a synergistic interaction.


    Qian, Guoqing; Tang, Lili; Lin, Shuhan; Xue, Kathy S; Mitchell, Nicole J; Su, Jianjia; Gelderblom, Wentzel C; Riley, Ronald T; Phillips, Timothy D; Wang, Jia-Sheng


    Dietary co-exposure to aflatoxin B1 (AFB1) and fumonisin B1 (FB1) and their interaction on hepatocellular carcinogenesis is of particular concern in toxicology and public health. In this study we evaluated the liver preneoplastic effects of single and sequential dietary exposure to AFB1 and FB1 in the F344 rat carcinogenesis model. Serum biochemical alterations, liver histopathological changes, and the formation of liver glutathione S transferase positive (GST-P+) foci were the major outcome parameters examined. Compared to the AFB1-only treatment, the FB1-only treatment induced less dysplasia, and more apoptosis and mitoses. Sequential AFB1 and FB1 treatment lead to increased numbers of dysplasia, apoptosis and foci of altered hepatocytes, as compared to either mycotoxin treatment alone. More importantly, sequential exposure to AFB1 and FB1 synergistically increased the numbers of liver GTP-P+ foci by approximately 7.3-and 12.9-fold and increased the mean sizes of GST-P+ foci by 6- and 7.5-fold, respectively, as compared to AFB1- or FB1-only treatment groups. In addition, liver ALT and AST levels were significantly increased after sequential treatment as compared to single treatment groups. The results demonstrate the interactive effect of dietary AFB1 and FB1 in inducing liver GST-P+ foci formation and provide information to model future intervention studies. PMID:27430420

  8. Aspergillus flavus and aflatoxin B1 in flour production.


    Halt, M


    This paper discusses the results of investigations of contamination with aflatoxin-producing fungi and aflatoxin B1 affecting 545 samples of wheat grains, 475 samples of intermediate products of wheat grain being milled to flour (like middlings) and 238 samples of flour. A significant contamination with moulds was detected in analyzed samples. Although Aspergillus (34.87%) and Penicillium (32.37%) dominated, other types were also present, e.g., Cladosporium, Fusarium, Mucor, Alternaria, Rhizopus, Absidia and Trichoderma (listed in order of frequency). The presence of Aspergillus flavus, the known aflatoxin producer, was detected in 9.94% of analyzed samples. Isolates of A. Flavus were capable of producing aflatoxin B1 under favourable conditions. Aflatoxin B1 was found in 76.8% of samples contaminated with A. flavus. The highest contamination with aflatoxin B1 was detected in wheat grain samples (mean value of 16.3 micrograms/kg) and in intermediate products of wheat grain being milled to flour (mean value of 11.13 micrograms/kg). Contamination was lower in flour samples (mean value of 4.13 micrograms/kg). With regard to proposed standards given by the FAO and WHO, under which the content of aflatoxin should not exceed 30 micrograms/kg in food products, only two of 96 samples did not meet these criteria. PMID:7859854

  9. β-1,3-Glucan reverses aflatoxin B1-mediated suppression of immune responses in mice.


    Bakheet, Saleh A; Attia, Sabry M; Alwetaid, Mohammad Y; Ansari, Mushtaq Ahmad; Zoheir, Khairy M A; Nadeem, Ahmed; Al-Shabanah, Othman A; Al-Harbi, Mohammed M; Ahmad, Sheikh Fayaz


    Aflatoxin B1 (AFB1) is immunotoxic to animals and is a suspected immunosuppressant in humans. β-1,3-Glucan (BG) consists of glucose polymers and has a variety of stimulatory effects on the immune system. In this study, we investigated the role of BG on the expression of phenotypic markers and cytokine secretion in mice exposed to AFB1. We treated animals with BG (150mg/kg, p.o., once daily) for 7days beginning at the onset of AFB1 exposure. Exposure of animals to AFB1 alone (1250μg/kg, p.o, once daily) for 7days resulted in a decrease in the percentages of lymphocyte subsets (CD4(+), GITR(+), CD8(+), TCR β(+), CD3(+), Foxp3(+), CD4(+)Foxp3(+), and CD127(+)) as compared to an normal control (NC). However, both BG alone and BG given in conjunction with exposure to AFB1 significantly increased the percentages of these lymphocyte subsets in blood. We also observed that mice exposed to AFB1 showed reduced IL-2, TNF-α, IL-17, and IFN-γ production in the spleen and serum. In contrast, oral administration of BG alone and in conjunction with AFB1 exposure augmented the levels of these cytokines. Moreover, this finding was confirmed through RT-PCR and western blot analysis of mRNA and protein expression in the spleen. Altogether, it can be concluded from these studies that BG enhances the responses of lymphocyte subsets, including cytokine production, even when given following exposure to AFB1 immunotoxin. These data demonstrate that BG carries out its immunomodulating activity by regulating cytokine production. Our findings also provide a direction for development of specific immunomodulating therapy. PMID:26997472

  10. Distinct response of the hepatic transcriptome to Aflatoxin B1 induced hepatocellular carcinogenesis and resistance in rats.


    Shi, Jiejun; He, Jiangtu; Lin, Jing; Sun, Xin; Sun, Fenyong; Ou, Chao; Jiang, Cizhong


    Aflatoxin is a natural potent carcinogen and a major cause of liver cancer. However, the molecular mechanisms of hepatocellular carcinogenesis remain largely unexplored. In this study, we profiled global gene expression in liver tissues of rats that developed hepatocellular carcinoma (HCC) from aflatoxin B1 (AFB1) administration and those that were AFB1-resistant, as well as rats without AFB1 exposure as a control. AFB1 exposure resulted in extensive perturbation in gene expression with different functions in HCC and AFB1 resistance (AR) samples. The differentially expressed genes (DEGs) in HCC sample were enriched for cell proliferation, cell adhesion and vasculature development that largely contribute to carcinogenesis. Anti-apoptosis genes were up-regulated in HCC sample whereas apoptosis-induction genes were up-regulated in AR sample. AFB1 exposure also caused extensive alteration in expression level of lncRNAs. Among all the 4511 annotated lncRNAs, half of them were highly expressed only in HCC sample and up-regulated a group of protein-coding genes with cancer-related functions: apoptosis regulation, DNA repair, and cell cycle. Intriguingly, these genes were down-regulated by lncRNAs highly expressed in AR sample. Collectively, apoptosis is the critical biological process for carcinogenesis in response to AFB1 exposure through changes in expression level of both protein-coding and lncRNA genes. PMID:27545718

  11. Distinct response of the hepatic transcriptome to Aflatoxin B1 induced hepatocellular carcinogenesis and resistance in rats

    PubMed Central

    Shi, Jiejun; He, Jiangtu; Lin, Jing; Sun, Xin; Sun, Fenyong; Ou, Chao; Jiang, Cizhong


    Aflatoxin is a natural potent carcinogen and a major cause of liver cancer. However, the molecular mechanisms of hepatocellular carcinogenesis remain largely unexplored. In this study, we profiled global gene expression in liver tissues of rats that developed hepatocellular carcinoma (HCC) from aflatoxin B1 (AFB1) administration and those that were AFB1-resistant, as well as rats without AFB1 exposure as a control. AFB1 exposure resulted in extensive perturbation in gene expression with different functions in HCC and AFB1 resistance (AR) samples. The differentially expressed genes (DEGs) in HCC sample were enriched for cell proliferation, cell adhesion and vasculature development that largely contribute to carcinogenesis. Anti-apoptosis genes were up-regulated in HCC sample whereas apoptosis-induction genes were up-regulated in AR sample. AFB1 exposure also caused extensive alteration in expression level of lncRNAs. Among all the 4511 annotated lncRNAs, half of them were highly expressed only in HCC sample and up-regulated a group of protein-coding genes with cancer-related functions: apoptosis regulation, DNA repair, and cell cycle. Intriguingly, these genes were down-regulated by lncRNAs highly expressed in AR sample. Collectively, apoptosis is the critical biological process for carcinogenesis in response to AFB1 exposure through changes in expression level of both protein-coding and lncRNA genes. PMID:27545718

  12. Sulforaphane, a cancer chemopreventive agent, induces pathways associated with membrane biosynthesis in response to tissue damage by aflatoxin B1

    PubMed Central

    Techapiesancharoenkij, Nirachara; Fiala, Jeannette L. A.; Navasumrit, Panida; Croy, Robert G.; Wogan, Gerald N.; Groopman, John D.; Ruchirawat, Mathuros; Essigmann, John M.


    Aflatoxin B1 (AFB1) is one of the major risk factors for liver cancer globally. A recent study showed that sulforaphane (SF), a potent inducer of phase II enzymes that occurs naturally in widely consumed vegetables, effectively induces hepatic glutathione S-transferases (GSTs) and reduces levels of hepatic AFB1-DNA adducts in AFB1-exposed Sprague Dawley rats. The present study characterized the effects of SF pre-treatment on global gene expression in the livers of similarly treated male rats. Combined treatment with AFB1 and SF caused reprogramming of a network of genes involved in signal transduction and transcription. Changes in gene regulation were observable 4 h after AFB1 administration in SF-pretreated animals and may reflect regeneration of cells in the wake of AFB1-induced hepatotoxicity. At 24 h after AFB1 administration, significant induction of genes that play roles in cellular lipid metabolism and acetyl-CoA biosynthesis was detected in SF-pretreated AFB1-dosed rats. Induction of this group of genes may indicate a metabolic shift toward glycolysis and fatty acid synthesis to generate and maintain pools of intermediate molecules required for tissue repair, cell growth and compensatory hepatic cell proliferation. Collectively, gene expression data from this study provide insights into molecular mechanisms underlying the protective effects of SF against AFB1 hepatotoxicity and hepatocarcinogenicity, in addition to the chemopreventive activity of this compound as a GST inducer. PMID:25450479

  13. Effect of dietary resveratrol in ameliorating aflatoxin B1-induced changes in broiler birds.


    Sridhar, M; Suganthi, R U; Thammiaha, V


    Consumption of aflatoxin B1 (AFB1) contaminated feed by poultry affects the health of broiler birds causing severe economic losses. The use of phytochemicals is a safe, effective, alternative and practical approach to combat the toxic effect of AF in broilers. Resveratrol, a polyphenol derived from red grapes, berries and peanuts, exerts anti-inflammatory, antioxidant and immunomodulatory effects. Our study was aimed at evaluating the possible protective effects of resveratrol against the adverse effects of AFB1 in broiler birds. A feeding trial of 42 days of duration was undertaken in a completely randomized design with five dietary treatments: G1-AFB1(1.0 ppm); G2-CTR (basal diet alone); G3-AFB1(1.0 ppm)+Resv 0.5%; G4-AFB1(1.0 ppm)+Resv 1%; and G5-Resv 1%. Gain in body weight (BWG) and feed intake (FI) was observed to be highest (p < 0.05) in the AFB1 birds followed by the control group. Feed conversion ratio was lowest in G2-CTR birds and failed to record any significant variation (p > 0.05) between groups as well as within groups. Birds fed resveratrol at both 0.5% and 1.0% levels in combination with AFB1 as well as alone along with basal diet had lower BWG and FI between the fourth and fifth week and also at the fifth week (p < 0.05). No variation (p > 0.05) was obtained in the FCR of AFB1 and resveratrol group of broiler birds. AFB1 feeding significantly increased the activities of aspartate-(AST) and alanine-(ALT) amino transferase, superoxide dismutase (SOD) and catalase (CAT) activities (p < 0.05) but lowered glucose, cholesterol and triglyceride levels in serum. Supplementation of resveratrol helped in increasing the activities of the oxidative enzymes and in improving the plasma total antioxidant capacity (TAOC) and total protein (TP) significantly (p < 0.05) and protein values. The livers of AFB1 group showed degeneration of hepatocytes, bile duct hyperplasia and microgranuloma formation. In resveratrol supplemented birds, the severity and degree of the

  14. Quantifying Aflatoxin B1 in peanut oil using fabricating fluorescence probes based on upconversion nanoparticles.


    Sun, Cuicui; Li, Huanhuan; Koidis, Anastasios; Chen, Quansheng


    Rare earth doped upconversion nanoparticles convert near-infrared excitation light into visible emission light. Compared to organic fluorophores and semiconducting nanoparticles, upconversion nanoparticles (UCNPs) offer high photochemical stability, sharp emission bandwidths, and large anti-Stokes shifts. Along with the significant light penetration depth and the absence of autofluorescence in biological samples under infrared excitation, these UCNPs have attracted more and more attention on toxin detection and biological labelling. Herein, the fluorescence probe based on UCNPs was developed for quantifying Aflatoxin B1 (AFB1) in peanut oil. Based on a specific immunity format, the detection limit for AFB1 under optimal conditions was obtained as low as 0.2ng·ml(-1), and in the effective detection range 0.2 to 100ng·ml(-1), good relationship between fluorescence intensity and AFB1 concentration was achieved under the linear ratios up to 0.90. Moreover, to check the feasibility of these probes on AFB1 measurements in peanut oil, recovery tests have been carried out. A good accuracy rating (93.8%) was obtained in this study. Results showed that the nanoparticles can be successfully applied for sensing AFB1 in peanut oil. PMID:27124091

  15. Quantifying Aflatoxin B1 in peanut oil using fabricating fluorescence probes based on upconversion nanoparticles

    NASA Astrophysics Data System (ADS)

    Sun, Cuicui; Li, Huanhuan; Koidis, Anastasios; Chen, Quansheng


    Rare earth doped upconversion nanoparticles convert near-infrared excitation light into visible emission light. Compared to organic fluorophores and semiconducting nanoparticles, upconversion nanoparticles (UCNPs) offer high photochemical stability, sharp emission bandwidths, and large anti-Stokes shifts. Along with the significant light penetration depth and the absence of autofluorescence in biological samples under infrared excitation, these UCNPs have attracted more and more attention on toxin detection and biological labelling. Herein, the fluorescence probe based on UCNPs was developed for quantifying Aflatoxin B1 (AFB1) in peanut oil. Based on a specific immunity format, the detection limit for AFB1 under optimal conditions was obtained as low as 0.2 ng·ml- 1, and in the effective detection range 0.2 to 100 ng·ml- 1, good relationship between fluorescence intensity and AFB1 concentration was achieved under the linear ratios up to 0.90. Moreover, to check the feasibility of these probes on AFB1 measurements in peanut oil, recovery tests have been carried out. A good accuracy rating (93.8%) was obtained in this study. Results showed that the nanoparticles can be successfully applied for sensing AFB1 in peanut oil.

  16. Affinity improvement by fine tuning of single-chain variable fragment against aflatoxin B1.


    Min, Won-Ki; Na, Kang-In; Yoon, Jung-Hyun; Heo, Yoon-Jee; Lee, Daesang; Kim, Sung-Gun; Seo, Jin-Ho


    Aflatoxin B1 (AFB1) produced in Aspergillus flavus is a major hepatocarcinogen found in foods and feed. For effective immunological detection of AFB1 at low concentrations, the development of high affinity antibody for AFB1 is required. Previously, an affinity-maturated single-chain variable fragment containing 6 mutations (scFv-M37) was isolated from an artificial mutagenic library, which showed a 9-fold higher affinity than its wild type scFv. In this study, the effect of the 6 mutated residues on the affinity improvement was characterized using surface plasmon resonance analysis, which identified a deleterious mutation (VH-A110T) located on a framework region of the scFv-M37. The back mutation of VH-A110T resulted in a 3.2-fold affinity improvement, which was attributed to decrease of dissociation rate constant (kd) in interaction between AFB1 and the back mutant scFv. The biophysical analyses using circular dichroism and gel filtration revealed that the back mutation of VH-A110T caused a subtle conformational change of the scFv toward tighter binding to AFB1. PMID:27173568

  17. Aflatoxin M1 in raw milk and aflatoxin B1 in feed from household cows in Singida, Tanzania.


    Mohammed, Salum; Munissi, Joan J E; Nyandoro, Stephen S


    Aflatoxin M1 (AFM1) contamination in raw milk from household cows fed with sunflower seedcakes or sunflower-based seedcake feeds was determined in 37 milk samples collected randomly from different locations in Singida region, Tanzania. Aflatoxin B1 (AFB1) contamination in sunflower-based seedcake feed was determined in 20 feed samples collected from the same household dairy farmers. The samples were analysed by RP-HPLC using fluorescent detection after immunoaffinity column clean-up. Recoveries were 88.0% and 94.5%, while the limits of detection (LOD) were 0.026 ng mL(-1) and 0.364 ng g(-1) for AFM1 and AFB1, respectively. Of the analysed cow's milk samples, 83.8% (31/37) contained AFM1, with levels ranging from LOD to 2.007 ng mL(-1), exceeding both the European Commission (EC) and Tanzania Food and Drug Authority (TFDA) limit of 0.05 ng mL(-1). Of the contaminated samples, 16.1% exceeded the Codex Alimentarius limit of 0.5 ng mL(-1). AFB1 was present in 65% (13/20) of the feed samples with levels ranging from LOD to 20.47 ng g(-1), 61.53% exceeding the TFDA and EC maximum limits of 5 ng g(-1) for complete dairy animal feed. The observed AFM1 and AFB1 contamination necessitates the need to raise awareness to dairy farmers in Tanzania to safeguard the health of the end-users. PMID:26756100

  18. Associations of serum aflatoxin B1-lysine adduct level with socio-demographic factors and aflatoxins intake from nuts and related nut products in Malaysia.


    Leong, Yin-Hui; Rosma, Ahmad; Latiff, Aishah A; Izzah, A Nurul


    Aflatoxins are one of the major risk factors in the multi-factorial etiology of human hepatocellular carcinoma. Therefore, the information on aflatoxins exposure is very important in the intervention planning in order to reduce the dietary intake of aflatoxins, especially among the children. This study investigated the relationship between aflatoxin B(1) (AFB(1)) lysine adduct levers in serum and socio-demographic factors and dietary intake of aflatoxins from nuts and nut products in Penang, Malaysia. A cross-sectional field study was conducted in five districts of Penang. A survey on socio-demographic characteristics was administered to 364 healthy adults from the three main ethnic groups (Malay, Chinese and Indian). A total of 170 blood samples were successfully collected and tested for the level of AFB(1)-lysine adduct. 97% of the samples contained AFB(1)-lysine adduct above the detection limit of 0.4 pg/mg albumin and ranged from 0.20 to 23.16 pg/mg albumin (mean±standard deviation=7.67±4.54 pg/mg albumin; median=7.12 pg/mg albumin). There was no significant association between AFB(1)-lysine adduct levels with gender, district, education level, household number and occupation when these socio-demographic characteristics were examined according to high or low levels of AFB(1)-lysine. However, participants in the age group of 31-50 years were 3.08 times more likely to have high AFB(1) levels compared to those aged between 18 and 30 years (P=0.026). Significant difference (P=0.000) was found among different ethnic groups. Chinese and Indian participants were 3.05 and 2.35 times more likely to have high AFB(1) levels than Malay. The result of AFB(1)-lysine adduct suggested that Penang adult population is likely to be exposed to AFB(1) but at a level of less than that needed to cause direct acute illness or death. PMID:22230243

  19. Effect of gamma radiation on the inactivation of aflatoxin B1 in food and feed crops

    PubMed Central

    Ghanem, I.; Orfi, M.; Shamma, M.


    Samples of food crops (peanut, peeled pistachio, unpeeled pistachio, rice, and corn) and feed (barley, bran, corn) were autoclave-sterilized, and inoculated with 106 of spore suspension of an isolate of Aspergillus flavus fungus known to produce aflatoxin B1 (AFB1) . Following a 10-day period of incubation at 27 C to allow for fungal growth, food and feed samples were irradiated with gamma radiation at the doses 4, 6, and 10 kGy. Results indicated that degradation of AFB1 was positively correlated with the increase in the applied dose of gamma ray for each tested sample. At a dose of 10 kGy percentages of AFB1 degradation reached highest values at 58.6, 68.8, 84.6, 81.1 and 87.8% for peanuts, peeled pistachios, unpeeled pistachios, corn and rice samples, respectively. In feed samples percentages of AFB1 degradation were 45, 66, and 90% in barley, 47, 75, and 86% in bran, and 31, 72, and 84% in corn for the doses of 4, 6, and 10 kGy, respectively. AFB1 degradation in food samples correlated negatively with oil content in irradiated samples. Thus, in peanuts, which contained the highest oil content, percentage of AFB1 degradation at 10 kGy was not more than 56.6%, whereas, the corresponding value in corn, which contained the lowest oil content, reached as high as 80%. The above results indicate the possibility of using gamma radiation as a means of degradation of AFB1 in food and feed crops to levels lower than the maximum allowed levels. PMID:24031308

  20. Aflatoxin B(1) degradation by Stenotrophomonas maltophilia and other microbes selected using coumarin medium.


    Guan, Shu; Ji, Cheng; Zhou, Ting; Li, Junxia; Ma, Qiugang; Niu, Tiangui


    Aflatoxin B(1) (AFB(1)) is one of the most harmful mycotoxins in animal production and food industry. A safe, effective and environmentally sound detoxification method is needed for controlling this toxin. In this study, 65 samples were screened from various sources with vast microbial populations using a newly developed medium containing coumarin as the sole carbon source. Twenty five single-colony bacterial isolates showing AFB(1) reduction activity in a liquid culture medium were selected from the screen. Isolate 35-3, obtained from tapir feces and identified to be Stenotrophomonas maltophilia, reduced AFB(1) by 82.5% after incubation in the liquid medium at 37 degrees C for 72 h. The culture supernatant of isolate 35-3 was able to degrade AFB(1) effectively, whereas the viable cells and cell extracts were far less effective. Factors influencing AFB(1) degradation by the culture supernatant were investigated. Activity was reduced to 60.8% and 63.5% at 20 degrees C and 30 degrees C, respectively, from 78.7% at 37 degrees C. The highest degradation rate was 84.8% at pH 8 and the lowest was only 14.3% at pH 4.0. Ions Mg(2+) and Cu(2+) were activators for AFB(1) degradation, however ion Zn(2+) was a strong inhibitor. Treatments with proteinase K, proteinase K plus SDS and heating significantly reduced or eradicated the degradation activity of the culture supernatant. The results indicated that the degradation of AFB(1) by S. maltophilia 35-3 was enzymatic and could have a great potential in industrial applications. PMID:19325817

  1. Aflatoxin B1 Degradation by Stenotrophomonas Maltophilia and Other Microbes Selected Using Coumarin Medium#

    PubMed Central

    Guan, Shu; Ji, Cheng; Zhou, Ting; Li, Junxia; Ma, Qiugang; Niu, Tiangui


    Aflatoxin B1 (AFB1) is one of the most harmful mycotoxins in animal production and food industry. A safe, effective and environmentally sound detoxification method is needed for controlling this toxin. In this study, 65 samples were screened from various sources with vast microbial populations using a newly developed medium containing coumarin as the sole carbon source. Twenty five single-colony bacterial isolates showing AFB1 reduction activity in a liquid culture medium were selected from the screen. Isolate 35-3, obtained from tapir feces and identified to be Stenotrophomonas maltophilia, reduced AFB1 by 82.5% after incubation in the liquid medium at 37 °C for 72 h. The culture supernatant of isolate 35-3 was able to degrade AFB1 effectively, whereas the viable cells and cell extracts were far less effective. Factors influencing AFB1 degradation by the culture supernatant were investigated. Activity was reduced to 60.8% and 63.5% at 20 °C and 30 °C, respectively, from 78.7% at 37 °C. The highest degradation rate was 84.8% at pH 8 and the lowest was only 14.3% at pH 4.0. Ions Mg2+ and Cu2+ were activators for AFB1 degradation, however ion Zn2+ was a strong inhibitor. Treatments with proteinase K, proteinase K plus SDS and heating significantly reduced or eradicated the degradation activity of the culture supernatant. The results indicated that the degradation of AFB1 by S. maltophilia 35-3 was enzymatic and could have a great potential in industrial applications. PMID:19325817

  2. Spectral characteristics of fluorescence and circular dichroism of aflatoxin B1 reaction with its anti-idiotypic antibody

    NASA Astrophysics Data System (ADS)

    Liu, Aiping; Yang, Hongxiu; Wang, Xiaohong; Chen, Fusheng


    Aflatoxin B1 (AFB1) is a toxic secondary metabolite and sensitive methods for its analysis have been developed. In our lab, a number of works have been carried out, including exploitation of detection methods and production of anti-idiotypic antibody (Ab2) against Fab fragment of anti-AFB1 antibody (Ab1). In this paper, Ab2 was generated upon the immunization of mice with F(ab')2 fragment, which was specific to AFB1 and obtained by pepsin digestion of Ab1. The characteristics of Ab2 was primarily investigated by indirect competitive enzyme-linked immunosorbent assay (icELISA), which indicated that Ab2, might bear an internal image of antigen AFB1 and was able to combine to F(ab')2 in competition with AFB1, and the concentration of Ab2 to cause 50% inhibition of binding (IC50) was 131.8 μg/mL. In addition, fluorescence and circular dichroism studies were designed to explore the mutual relationship among AFB1, F(ab')2 and Ab2. The fluorescence spectroscopy implied that both AFB1 and Ab2 act as a quencher upon F(ab')2, and the Ab2 could compete with AFB1 when both of Ab2 and AFB1 reacted with F(ab')2. The circular dichroism (CD) spectrum suggested that both the binding of Ab2 and AFB1 on F(ab')2 brought secondary conformation change of F(ab')2, especially in the changes of α helix and β sheet. The research performed would provide unique insight into the comprehension of interaction among AFB1, F(ab')2 and Ab2 as well as offer structural information for substitution researches of toxic antigen like AFB1.

  3. Analysis of aflatoxin b1 in Iranian foods using HPLC and a monolithic column and estimation of its dietary intake.


    Yazdanpanah, Hassan; Zarghi, Afshin; Shafaati, Ali Reza; Foroutan, Seyed Mohsen; Aboul-Fathi, Farshid; Khoddam, Arash; Nazari, Firoozeh; Shaki, Fatemeh


    A high performance liquid chromatographic method was developed for determination of aflatoxin B1 (AFB1) in foods using a monolithic column with sample clean up on an immunoaffinity column. The method was validated for analysis of AFB1 in rice, bread, puffed corn snack, wheat flour and peanut samples. The average recoveries for AFB1 in different foods ranged from 94.4 to 102.5% with the coefficient of variation lower than 10% for all foods. Limit of detection was 0.01 ng/g. A survey of AFB1 was performed on 90 samples collected from Tehran retail market in June 2005. The results showed that none of the bread and wheat flour samples were contaminated with AFB1. The mean AFB1 levels in rice, puffed corn snack and peanut samples were 4.17, 0.11, and 1.97 ng/g, respectively. The level of contamination of 3 samples (one rice sample and two peanuts samples) to AFB1 was found to be higher than 5 ng/g. Although all food samples had mean concentration of AFB1 below the maximum tolerated level in Iran, the mean intake of AFB1 from rice was estimated 3.49 times higher than the guidance value of 1 ng AFB1/Kg body weight/day. Therefore, it is strongly recommended to monitor AFB1 in foods, especially in rice, in Iran. This is the first study on exposure assessment of Iranian population to AFB1. PMID:24250676

  4. Analysis of Aflatoxin B1 in Iranian Foods Using HPLC and a Monolithic Column and Estimation of its Dietary Intake

    PubMed Central

    Yazdanpanah, Hassan; Zarghi, Afshin; Shafaati, Ali Reza; Foroutan, Seyed Mohsen; Aboul-Fathi, Farshid; Khoddam, Arash; Nazari, Firoozeh; Shaki, Fatemeh


    A high performance liquid chromatographic method was developed for determination of aflatoxin B1 (AFB1) in foods using a monolithic column with sample clean up on an immunoaffinity column. The method was validated for analysis of AFB1 in rice, bread, puffed corn snack, wheat flour and peanut samples. The average recoveries for AFB1 in different foods ranged from 94.4 to 102.5% with the coefficient of variation lower than 10% for all foods. Limit of detection was 0.01 ng/g. A survey of AFB1 was performed on 90 samples collected from Tehran retail market in June 2005. The results showed that none of the bread and wheat flour samples were contaminated with AFB1. The mean AFB1 levels in rice, puffed corn snack and peanut samples were 4.17, 0.11, and 1.97 ng/g, respectively. The level of contamination of 3 samples (one rice sample and two peanuts samples) to AFB1 was found to be higher than 5 ng/g. Although all food samples had mean concentration of AFB1 below the maximum tolerated level in Iran, the mean intake of AFB1 from rice was estimated 3.49 times higher than the guidance value of 1 ng AFB1/Kg body weight/day. Therefore, it is strongly recommended to monitor AFB1 in foods, especially in rice, in Iran. This is the first study on exposure assessment of Iranian population to AFB1. PMID:24250676

  5. Effect of Sodium Selenite on Pathological Changes and Renal Functions in Broilers Fed a Diet Containing Aflatoxin B1

    PubMed Central

    Liang, Na; Wang, Fengyuan; Peng, Xi; Fang, Jing; Cui, Hengmin; Chen, Zhengli; Lai, Weimin; Zhou, Yi; Geng, Yi


    To evaluate the renal toxicity of dietary aflatoxin B1 (AFB1) and ameliorating effects of added dietary sodium selenite in broiler, renal histopathological changes, ultrastructural changes, and renal function parameters were monitored at 7, 14, and 21 days of age. Two hundred one-day-old healthy male Avian broilers were divided into four groups, namely control group, AFB1 group (0.3 mg/kg AFB1), +Se group (0.4 mg/kg Se), and AFB1+Se group (0.3 mg/kg AFB1+0.4 mg/kg Se). Compared with that of the control group, the relative weight of kidney was increased in the AFB1 group. There were no significant differences between the AFB1+Se group and the control group. By histopathological observation, the renal epithelia were swelling and necrosis at 7 and 21 days of age. Ultrastructurally, the lipid droplets and expanded endoplasmic reticulum appeared in the plasma of epithelia cells in the AFB1 group. Enlarged mitochondria with degenerated cristae were observed in the +Se group. Compared with the control group, the contents of serum creatinine and serum uric acid in the AFB1 group were increased, while the activity of renal Na+-K+ ATPase was decreased. When 0.4 mg/kg selenium was added into the diet containing 0.3 mg/kg AFB1, there were no obvious histological changes in the AFB1+Se group, and the contents of the serum creatinine and serum uric acid contents and the activity of renal Na+-K+ ATPase were close to those in the control group. In conclusion, sodium selenite exhibited protective effects on AFB1-induced kidney toxicity in broilers. PMID:26371027

  6. Ozonolysis efficiency and safety evaluation of aflatoxin B1 in peanuts.


    Diao, Enjie; Hou, Hanxue; Chen, Bin; Shan, Changpo; Dong, Haizhou


    Ozonolysis efficiency of aflatoxin-contaminated peanuts (ACPs) was investigated, and the safety of ACPs untreated/treated by ozone was evaluated after 28-day intragastrically administration in male and female Wistar rats. 89.40% of aflatoxin B1 (AFB1) in peanuts was decomposed by ozone with a concentration of 50mg/L, flow rate of 5L/min for 60h. After 60h, the ozonolysis efficiency of AFB1 was not further improved. In the subchronic toxicity experiment, all rats did not have unusual changes in behavior, and no signs of intoxication were observed except for several dead rats due to inappropriate gavage or anesthesia. The results of subchronic toxicity indicated that rats fed on ACPs alone had significantly decreased in body weight gain and feed conversion efficiency. Most serum biochemical indexes of rats had apparently changed compared with those in the negative control, and gender difference significantly affected most indexes of subchronic toxicity except for the ratios of organ to body weight and histopathological observation. Rats fed on ACPs treated by ozone showed significant beneficial health effects. All the results suggested that the deleterious effects of AFB1 could be highly reduced by ozone, and ozone itself did not show any toxic effects on animals in this processing. PMID:23395718

  7. Toxic effect of aflatoxin B1 and the role of recovery on the rat cerebral cortex and hippocampus.


    Bahey, Noha Gamal; Abd Elaziz, Hekmat Osman; Gadalla, Kamal Kamal El Sayed


    Aflatoxin B1 (AFB1) is the most toxic and well-known mycotoxin that exists in many food stuff. Exposure to AFB1 has been reported to produce serious biochemical and structural alterations in human and animal organs, however, its effect on the brain is not well studied. Therefore, this study was aimed to investigate the possible histopathological effect of AFB1 and its withdrawal on the cerebral cortex and hippocampus. Fifteen adult female Wistar rats were divided into 3 equal groups: control, AFB1 (15.75 μg/kg/orally, once weekly, for 8 weeks) and recovery groups. Brain sections were processed for hematoxylin and eosin staining as well as for NeuN and GFAP immunostaining. AFB1 administration resulted in several histopathological alterations including; cellular degeneration, dilatation of the blood vessels and significant decrease in the thickness of the frontal cortex and the hippocampal CA1 pyramidal cell layer. In the frontal cortex, there was a significant reduction in the percentage of astrocyte distribution without changes in neuronal numbers. On the other hand, in the hippocampal CA1 region, there was a significant reduction of neuronal number and a significant increase in the percentage of astrocyte distribution. Importantly, AFB1-induced structural alterations were rescued following AFB1 withdrawal. In conclusion, AFB1 induce histological alterations in the rat brain which are potentially reversible upon withdrawal. PMID:26380901

  8. Preparation and characterization of an immunoaffinity column for the selective extraction of aflatoxin B1 in 13 kinds of foodstuffs.


    Xie, Jie; Peng, Tao; He, Jian-Li; Shao, Yu; Fan, Chun-Lin; Chen, Ying; Jiang, Wen-Xiao; Chen, Min; Wang, Qi; Pei, Xing-Yao; Ding, Shuang-Yang; Jiang, Hai-Yang


    A rapid and reliable immunoaffinity column (IAC) clean-up based ultra performance liquid chromatography tandem mass spectrometry (UPLC-MS/MS) method was developed for the determination of aflatoxin B1 (AFB1) in cereals, peanuts, vegetable oils and Chinese traditional food products like sufu and lobster sauce. The immunoaffinity column of AFB1 (AFB1-IAC) was prepared by coupling CNBr-activated Sepharose-4B with the anti-AFB1 monoclonal antibody. The column capacity of IAC was over 260ng/mL gel. Samples were extracted with methanol-water (60:40, v/v) and the extracts were then purified on an AFB1-IAC before UPLC-MS/MS analysis. The average recoveries of AFB1 in spiked samples at levels of 1.0, 5.0 and 10.0μg/kg ranged from 72% to 98%, with the relative standard deviations of 1.2-9.3% (n=6). The limits of qualification ranged from 0.07 to 0.23μg/kg, which were below the MRLs of AFB1 in the matrices evaluated. In this work, the developed method was suitable for the determination of trace AFB1 residues in 13 kinds of foodstuffs. PMID:26160471

  9. Protective Effects of Sodium Selenite against Aflatoxin B1-Induced Oxidative Stress and Apoptosis in Broiler Spleen

    PubMed Central

    Wang, Fengyuan; Shu, Gang; Peng, Xi; Fang, Jing; Chen, Kejie; Cui, Hengmin; Chen, Zhengli; Zuo, Zhicai; Deng, Junliang; Geng, Yi; Lai, Weimin


    The aim of this study was to investigate the possible protective role of sodium selenite on aflatoxin B1-induced oxidative stress and apoptosis in spleen of broilers. Two hundred one-day-old male broilers, divided into five groups, were fed with basal diet (control group), 0.3 mg/kg AFB1 (AFB1 group), 0.3 mg/kg AFB1 + 0.2 mg/kg Se (+Se group I), 0.3 mg/kg AFB1 + 0.4 mg/kg Se (+Se group II) and 0.3 mg/kg AFB1 + 0.6 mg/kg Se (+Se group III), respectively. According to biochemical assays, AFB1 significantly decreased the activities of glutathione peroxidase, total superoxide dismutase, glutathione reductase, catalase and the level of glutathione hormone, while it increased the level of malondialdehyde. Moreover, AFB1 increased the percentage of apoptosis cells by flow cytometry and the occurrence of apoptotic cells by TUNEL assay. Simultaneous supplementation with sodium selenite restored these parameters to be close to those in control group. In conclusion, sodium selenite exhibited protective effects on AFB1-induced splenic toxicity in broilers by inhibiting oxidative stress and excessive apoptosis. PMID:23839060

  10. Base substitution mutations induced by metabolically activated aflatoxin B1.


    Foster, P L; Eisenstadt, E; Miller, J H


    We have determined the base substitutions generated by metabolically activated aflatoxin B1 in the lacI gene of a uvrB- strain of Escherichia coli. By monitoring over 70 different nonsense mutation sites, we show that activated aflatoxin B1 specifically induced GxC leads to TxA transversions. One possible pathway leading to this base change involves depurination at guanine residues. We consider this mechanism of mutagenesis in the light of our other findings that the carcinogens benzo[a]pyrene diol epoxide and N-acetoxyacetylaminofluorene also specifically induce GxC leads to TxA transversions. PMID:6405385

  11. Interactions between hepatitis B virus and aflatoxin B(1): effects on p53 induction in HepaRG cells.


    Lereau, Myriam; Gouas, Doriane; Villar, Stéphanie; Besaratinia, Ahmad; Hautefeuille, Agnès; Berthillon, Pascale; Martel-Planche, Ghislaine; Nogueira da Costa, André; Ortiz-Cuaran, Sandra; Hantz, Olivier; Pfeifer, Gerd P; Hainaut, Pierre; Chemin, Isabelle


    Infection by hepatitis B virus (HBV) and dietary exposure to aflatoxin B(1) (AFB(1)) are the main risk factors for the development of chronic liver disease and hepatocellular carcinoma (HCC). How these factors cooperate is still largely unknown. AFB(1) activation leads to DNA adduction and mutagenesis, with a specific mutation at codon 249 in TP53 (p.R249S). So far, only limited studies have addressed the effects of AFB(1) on HBV replication. We have analysed the effects of both risk factors on p53 induction during HBV infection in HepaRG, a cell line with hepatocyte-like morphology that metabolizes AFB(1) and supports HBV infection. Exposure to AFB(1) up to 5 µM induced a downregulation of HBV replication after 48 h, as measured by a decrease in viral antigens in the culture medium (HBsAg, HBeAg and large envelope protein) and in intracellular levels of HBV transcripts, DNA and HBsAg. Conversely, HBV infection did not significantly modify AFB(1)-DNA adduct formation or repair as assessed by immunodot-blot assay, and the induction of p53 in response to AFB(1) was similar in infected and non-infected HepaRG cells. Overall, our results suggest that AFB(1) exposure decreases HBV replication, whereas DNA damage by AFB(1) and subsequent p53 induction is not affected by the presence of the virus. Thus, in HepaRG cell line, AFB(1) and HBV do not cooperate to increase DNA damage by AFB(1). Further studies on the effects of both factors in a context of chronicity are needed to better understand synergistic effects. PMID:22113009

  12. Intervention of Grape Seed Proanthocyanidin Extract on the Subchronic Immune Injury in Mice Induced by Aflatoxin B1

    PubMed Central

    Long, Miao; Zhang, Yi; Li, Peng; Yang, Shu-Hua; Zhang, Wen-Kui; Han, Jian-Xin; Wang, Yuan; He, Jian-Bin


    The aim was to investigate the prevention of grape seed proanthocyanidin extract (GSPE) on the subchronic immune injury induced by aflatoxin B1 (AFB1) and the possible ameliorating effect of GSPE in mice. The subchronic AFB1-induced immune injury mice model was set up with the continuous administration of 100 μg/kg body weight (BW) AFB1 for six weeks by intragastric administration. Then, intervention with different doses (50 and 100 mg/kg BW) of GSPE was conducted on mice to analyze the changes of body weight, immune organ index, antioxidant capability of spleen, serum immunoglobulin content, and the expression levels of inflammatory cytokines. The prevention of GSPE on the immune injury induced by AFB1 was studied. The GSPE could relieve the AFB1-induced reduction of body weight gain and the atrophy of the immune organ. The malondialdehyde (MDA) level of the spleen in the AFB1 model group significantly increased, but levels of catalase (CAT), glutathione (GSH), glutathione peroxidase (GSH-PX), and superoxide dismutase (SOD) significantly decreased. The GSPE could significantly inhibit the oxidative stress injury of the spleen induced by AFB1. AFB1 exposure could not significantly change the contents of IgA, IgG, or IgM. AFB1 significantly improved the expression of interleukin 1β (IL-1β), IL-6, tumor necrosis factor α (TNF-α), and interferon γ (IFN-γ). Additionally, GSPE could decrease the expression of these four proinflammatory factors to different degrees and inhibit the inflammatory reaction of mice. The results suggest that GSPE alleviates AFB1-induced oxidative stress and significantly improves the immune injury of mice induced by AFB1. PMID:27070584

  13. Hematological parameters and the state of liver cells of rats after oral administration of aflatoxin b1 alone and together with nanodiamonds.


    Mogilnaya, Oa; Puzyr, Ap; Baron, Av; Bondar, Vs


    Hematological parameters and the state of liver cells of rats were examined in vivo after the animals received aflatoxin B1 (AfB1) alone and together with modified nanodiamonds (MND) synthesized by detonation. The rats that had received the MND hydrosol had elevated leukocyte levels, mainly due to higher granulocyte counts and somewhat increased monocyte counts compared to control rats. Hematological parameters of the rats that had received AfB1 alone differed from those of the control rats in another way: total white blood cell counts were significantly lower due to the decreased lymphocyte counts. In rats that had consumed AfB1 with the MND hydrosol, changes in hematological parameters were less pronounced than in rats that had consumed either AfB1 or MND. Electron microscopy showed that hepatocytes of the rats that had received the MND hydrosol or AfB1 with the MND hydrosol contained elevated levels of lipid inclusions and lysosomes. Hyperplasia of the smooth endoplasmic reticulum (EPR) was revealed in liver specimens of the rats that had received AfB1. Results of the study suggest the conclusion about mutual mitigation of the effects of nanoparticles and the mycotoxin on rats blood and liver cells after AfB1 has adsorbed on MND. PMID:20672086

  14. Hematological Parameters and the State of Liver Cells of Rats After Oral Administration of Aflatoxin B1 Alone and Together with Nanodiamonds

    NASA Astrophysics Data System (ADS)

    Mogilnaya, O. A.; Puzyr, A. P.; Baron, A. V.; Bondar, V. S.


    Hematological parameters and the state of liver cells of rats were examined in vivo after the animals received aflatoxin B1 (AfB1) alone and together with modified nanodiamonds (MND) synthesized by detonation. The rats that had received the MND hydrosol had elevated leukocyte levels, mainly due to higher granulocyte counts and somewhat increased monocyte counts compared to control rats. Hematological parameters of the rats that had received AfB1 alone differed from those of the control rats in another way: total white blood cell counts were significantly lower due to the decreased lymphocyte counts. In rats that had consumed AfB1 with the MND hydrosol, changes in hematological parameters were less pronounced than in rats that had consumed either AfB1 or MND. Electron microscopy showed that hepatocytes of the rats that had received the MND hydrosol or AfB1 with the MND hydrosol contained elevated levels of lipid inclusions and lysosomes. Hyperplasia of the smooth endoplasmic reticulum (EPR) was revealed in liver specimens of the rats that had received AfB1. Results of the study suggest the conclusion about mutual mitigation of the effects of nanoparticles and the mycotoxin on rats blood and liver cells after AfB1 has adsorbed on MND.

  15. Lipopolysaccharide augments aflatoxin B(1)-induced liver injury through neutrophil-dependent and -independent mechanisms.


    Barton, C C; Ganey, P E; Roth, R A


    Exposure to small, noninjurious doses of the inflammagen, bacterial endotoxin (lipopolysaccharide, LPS) augments the toxicity of certain hepatotoxicants including aflatoxin B(1) (AFB(1)). Mediators of inflammation, in particular neutrophils (PMNs), are responsible for tissue injury in a variety of animal models. This study was conducted to examine the role of PMNs in the pathogenesis of hepatic injury after AFB(1)/LPS cotreatment. Male, Sprague-Dawley rats (250-350 g) were treated with either 1 mg AFB(1)/kg, ip or its vehicle (0.5% DMSO/saline), and 4 h later with either E. coli LPS (7. 4 x 10(6) EU/kg, iv) or its saline vehicle. Over a course of 6 to 96 h after AFB(1) administration, rats were killed and livers were stained immunohistochemically for PMNs. LPS resulted in an increase in PMN accumulation in the liver that preceded the onset of liver injury. To assess if PMNs contributed to the pathogenesis, an anti-PMN antibody was administered to reduce PMN numbers in blood and liver, and injury was evaluated. Hepatic parenchymal cell injury was evaluated as increased alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities in serum and from histologic examination of liver sections. Biliary tract alterations were evaluated as increased concentration of serum bile acids and activities of gamma-glutamyltransferase (GGT), alkaline phosphatase (ALP), and 5'-nucleotidase (5'-ND) in serum. Neutrophil depletion protected against hepatic parenchymal cell injury caused by AFB(1)/LPS cotreatment but not against markers of biliary tract injury. This suggests that LPS augments AFB(1) hepatotoxicity through two mechanisms: one of which is PMN-dependent, and another that is not. PMID:11053557

  16. In vitro inhibitory effect of aflatoxin B1 on acetylcholinesterase activity in mouse brain.


    Cometa, Maria Francesca; Lorenzini, Paola; Fortuna, Stefano; Volpe, Maria Teresa; Meneguz, Annarita; Palmery, Maura


    Growing concern on the problem of mycotoxins in the alimentary chain underlines the need to investigate the mechanisms explaining the cholinergic effects of aflatoxin B(1) (AFB(1)). We examined the effect of AFB(1), a mycotoxin produced by Aspergillus flavus, on mouse brain acetylcholinesterase (AChE) and specifically on its molecular isoforms (G(1) and G(4)) after in vitro exposure. AFB(1) (from 10(-9) to 10(-4)M), inhibited mouse brain AChE activity (IC(50) = 31.6 x 10(-6)M) and its G(1) and G(4) molecular isoforms in a dose-dependent manner. Michaelis-Menten parameters indicate that the K(m) value increased from 55.2 to 232.2% whereas V(max) decreased by 46.2-75.1%. The direct, the Lineweaver-Burk and the secondary plots indicated a non-competitive-mixed type antagonism, induced when the inhibitor binds to the free enzyme and to the enzyme-substrate complex. AFB(1)-inhibited AChE was partially reactivated by pyridine 2-aldoxime (2-PAM) (10(-4)M) but the AChE-inhibiting time courses of AFB(1) (10(-4)M) and diisopropylfluorophosphate (DFP) (2 x 10(-7)M) differed. Overall these data suggest that AFB(1) non-competitively inhibits mouse brain AChE by blocking access of the substrate to the active site or by inducing a defective conformational change in the enzyme through non-covalent binding interacting with the AChE peripheral binding site, or through both mechanisms. PMID:15590113

  17. Panax ginseng extract modulates oxidative stress, DNA fragmentation and up-regulate gene expression in rats sub chronically treated with aflatoxin B1 and fumonisin B 1.


    Hassan, Aziza M; Abdel-Aziem, Sekena H; El-Nekeety, Aziza A; Abdel-Wahhab, Mosaad A


    Aflatoxins and fumonisins are important food-borne mycotoxins implicated in human health and have cytotoxic effects. The aims of the current study were to evaluate the protective role of Panax ginseng extract (PGE) against the synergistic effect of subchronic administration of aflatoxin B1 (AFB1) and fumonisin B1 (FB1) on DNA and gene expression in rat. Female Sprague-Dawley rats were divided into eight groups (ten rats/group) and treated for 12 weeks including the control group, the group having received AFB1 (80 µg/kg bw), the group having received FB1 (100 µg/kg bw), the group having received AFB1 plus FB1 and the groups having received PGE (20 mg/kg bw) alone or with AFB1 and/or FB1. At the end of experiment, liver and kidney were collected for the determination of DNA fragmentation, lipid peroxidation (LP), glutathione (GSH) contents and alterations in gene expression. The results indicated that these mycotoxins increased DNA fragmentation, LP and decreased GSH content in liver and kidney and down-regulated gene expression of antioxidants enzymes. The combined treatments with AFB1 and/or FB1 plus PGE suppressed DNA fragmentation only in the liver, normalized LP and increased GSH in the liver and kidney as well as up-regulated the expression of GPx, SOD1 and CAT mRNA. It could be concluded that AFB1 and FB1 have synergistic genotoxic effects. PGE induced protective effects against their oxidative stress and genotoxicity through its antioxidant properties. PMID:24748134

  18. Novel regulation of aflatoxin B1 biosynthesis in Aspergillus flavus by piperonal.


    Park, Eun-Sil; Bae, In Kyung; Kim, Ho Jin; Lee, Sung-Eun


    The present study investigated its inhibitory role in aflatoxin (AF) biosynthesis. Treating only AFB1- and B2-producing Aspergillus flavus with piperonal completely inhibited AFB1 production with high sclerotial formation, resulting in 20-fold higher AFG2 production. On the other hand, benzodioxole and eugenol suppressed AFB1 production without AFG formation, while methyleugenol showed potent inhibition of AFB1 production with slight production of AFG1. These results indicate that natural products may change aflatoxin biosynthesis, and highlight a novel regulation of AFG2 production by piperonal. It is the first report for chemical regulation on AFG2 production in non-AFG producing-aspergilli. PMID:26273991

  19. Optical waveguide lightmode spectroscopy technique-based immunosensor development for aflatoxin B1 determination in spice paprika samples.


    Majer-Baranyi, Krisztina; Zalán, Zsolt; Mörtl, Mária; Juracsek, Judit; Szendrő, István; Székács, András; Adányi, Nóra


    Optical waveguide lightmode spectroscopy (OWLS) technique has been applied to label-free detection of aflatoxin B1 in a competitive immunoassay format, with the aim to compare the analytical goodness of the developed OWLS immunosenor with HPLC and enzyme-linked immunosorbent assay (ELISA) methods for the detection of aflatoxin in spice paprika matrix. We have also assessed applicability of the QuEChERS method prior to ELISA measurements, and the results were compared to those obtained by traditional solvent extraction followed by immunoaffinity clean-up. The AFB1 content of sixty commercial spice paprika samples from different countries were measured with the developed and optimized OWLS immunosensor. Comparing the results from the indirect immunosensor to that obtained by HPLC or ELISA provided excellent correlation (with regression coefficients above 0.94) indicating that the competitive OWLS immunosensor has a potential for quick determination of aflatoxin B1 in paprika samples. PMID:27283719

  20. Determination of aflatoxin B1 in pistachio kernels and shells.


    Scholten, J M; Spanjer, M C


    A method was developed for accurate measurement of aflatoxin B1 in the edible portion of pistachio nuts. Twenty-nine samples of kernels with and without their shells were slurried with a Mega Ultra Turrax. A subsample of the homogenate was extracted with water-methanol, defatted with petroleum ether, purified with a silica solid-phase extraction column, and redissolved in methanol. After separation on an octadecyl column and postcolumn reaction with on-line electrochemically generated bromine, the aflatoxin B1 derivative was detected fluorometrically. The shells contained less than 1% of the aflatoxin B1 found in the edible kernel, and they accounted for 41.7-46.8% of the weight of the whole pistachio. These observations indicate it is possible to analyze an entire sample, up to 25 kg, as a whole and still be able to judge whether it meets the legal tolerance limit of 5 micrograms aflatoxin B1/kg edible part, as set by the Dutch Food Act. PMID:8946714

  1. Inhibitory Effects of Silver Nanoparticles on Growth and Aflatoxin B1 Production by Aspergillus Parasiticus

    PubMed Central

    Mousavi, Seyyed Amin Ayatollahi; Pourtalebi, Somayyeh


    Background: Aflatoxins (AFs) are secondary hazardous fungal metabolites that are produced by strains of some Aspergillus species on food and feedstuffs. Aflatoxin B1 (AFB1) is one of the most important AF with high toxicity. Prevention of AF production and their elimination from food products is a matter of importance for many researchers in the last decades. Nanomaterials applications in medical science have been widely studied in the recent years. Most of existing researches seek the effect of nanoparticles on bacteria, fungi, and viruses. The aim of this study was to determine the effects of silver nanoparticles (AgNPs) on growth and AFB1 production of AF-producing Aspergillus parasiticus. Methods: A parasiticus was inoculated (106 conidia per ml of medium) to potato dextrose broth (PDB) medium and then AgNPs was added and incubated with shaking at 130 rpm and 28°C for 7 days. AF was assayed by high performance liquid chromatography (HPLC). Microbiological assay (MBA) on microplates contained potato dextrose broth (PDB) medium (4 days at 28°C) at different concentrations of AgNPs (60, 80, 100, 120, 140, 160, 180 and 200 μg/ml) was measured. Results: The results demonstrated that a minimum inhibition concentration (MIC) equal to 180 μg/ml was determined for AgNPs against A. parasiticus. The AgNPs effectively inhibited AFB1 production at a concentration of 90 μg/ml. Conclusion: The results obtained in this study show AgNPs at concentrations lower than the MIC drastically inhibited production of AFB1 by A. parasiticus in culture medium. The AgNPs may be useful to control AF contamination of susceptible crops in the field. PMID:26538778

  2. Effect of oral supplementation of Lactobacillus reuteri in reduction of intestinal absorption of aflatoxin B(1) in rats.


    Hernandez-Mendoza, Adrián; González-Córdova, Aarón Fernando; Vallejo-Cordoba, Belinda; Garcia, Hugo Sergio


    The goals of this work were to assess the ability of Lactobacillus reuteri to bind aflatoxin B(1) in the intestinal tract and determine its effect on intestinal absorption of the toxin dispensed in either single or multiple doses in a murine model. Male Wistar rats were used, and two experiments were conducted after bacteria were implanted. Experiment one involved a single-oral dose of toxin, and the subsequent flow cytometric analysis of bacteria isolated from the small intestine and treated with specific FITC-labeled AFB(1) antibodies. The second experiment was carried out supplying the toxin in 7 oral sub-doses, and the later quantification of AFB(1)-Lys adducts in blood samples by ELISA assay. The results demonstrated that L. reuteri was able to bind AFB(1) in the intestinal tract, mostly in the duodenum. Furthermore, the AFB(1)-Lys adducts were present at significantly lower levels in those animals receiving AFB(1) plus bacteria than in those receiving only AFB(1). Our findings confirm that probiotic bacteria could act as biological barriers in normal intestinal conditions thereby reducing the bioavailability of AFB(1) ingested orally in a single or multiple doses, thus avoiding its toxic effects. PMID:21298677

  3. Aflatoxin B1-induced Hprt mutations in splenic lymphocytes of Fischer 344 rats. Results of an intermittent feeding trial.


    Morris, S M; Aidoo, A; Chen, J J; Chou, M W; Casciano, D A


    In a previous study, we found an increase in the mutant frequency at the Hypoxanthine phosphoribosyl transferase (Hprt) locus in the splenic lymphocytes of Fischer 344 rats acutely exposed to aflatoxin B1 (AFB1). Because an acute exposure may not reflect the exposure pattern of individuals whose diet may contain AFB1-contaminated foodstuffs, we sought to determine if the feeding regimen affected the induction of Hprt mutations in the rat splenic lymphocyte. Thus, Fischer 344 rats were fed either (A) a control diet, (B) various doses of AFB1 for three four-week periods interspersed with two four-week periods of the control diet, or (C) continuously fed 1.6 ppm of AFB1. Not only was a significant increase in the mutant frequency detected in the lymphocytes of rats fed a dose as low as 0. 01 ppm of AFB1, but the increase in the mutant frequency at the end of the 20-week experimental period was consistent with an accumulation of damage induced by AFB1. These results indicate that the rat lymphocyte/Hprt assay is useful for detecting chronic low level exposures. Further, these data suggest that an intermittent, low-level exposure to AFB1 may present a human health risk. PMID:10029671

  4. A simple aptamer-based fluorescent assay for the detection of Aflatoxin B1 in infant rice cereal.


    Chen, Lu; Wen, Fang; Li, Ming; Guo, Xiaodong; Li, Songli; Zheng, Nan; Wang, Jiaqi


    A fluorescent assay for the rapid, sensitive and specific detection of Aflatoxin B1 (AFB1) was developed in this study. Initially, a DNA/DNA duplex was formed between a fluorescein-labeled AFB1 aptamer and its partially complementary DNA strand containing a quencher moiety, resulting in fluorescence quenching due to the close proximity of fluorophore and quencher. Upon the addition of AFB1, an aptamer/AFB1 complex was generated to release the quencher-modified DNA strand, thus recovered the fluorescence of fluorescein and enabled quantitative detection for AFB1 by monitoring fluorescence enhancement. Under optimized conditions, this assay exhibited a linear response to AFB1 in the range of 5-100ng/mL with a detection limit down to 1.6ng/mL. Trials of this assay in infant rice cereal with satisfactory recovery in the range of 93.0%-106.8%, demonstrate that the new assay could be a potential sensing platform for AFB1 determination in food. PMID:27542489

  5. Effect of the inclusion of adsorbents on aflatoxin B1 quantification in animal feedstuffs.


    Gallo, A; Masoero, F; Bertuzzi, T; Piva, G; Pietri, A


    The extraction efficiency of aflatoxin B1 (AFB1) in cattle feed containing nine adsorbents (ADSs) was investigated using two organic/aqueous solvents composed of methanol/water (80/20 v/v; MeOH) and acetone/water (85/15 v/v; AC). Samples were obtained including a highly AFB1-contaminated (HC) and a low-level AFB(1)-contaminated (LC) feedstuff (15.33 and 7.57 microg kg(-1), respectively), nine ADSs (four clay minerals; one yeast cell wall-based product; one activated carbon and three commercial ADS products) at two different levels of inclusion (10 and 20 g kg(-1)). After solvent extraction and immunoaffinity column clean-up, all samples were analysed for AFB1 by high-performance liquid chromatography (HPLC) with fluorescence detection. For each contamination level (HC and LC), the data obtained were analysed using a factorial arrangement in a completely randomized design. Means were compared with the correspondent controls using the Dunnett's test. No statistical difference was found in AFB1 levels of feedstuffs not containing ADSs when extracted with AC or MeOH, even if numerically higher values were obtained with AC. A dose-dependent effect (p < 0.01) of ADSs inclusion was observed on AFB1 recoveries that were lower when the higher ADS level (20 g kg(-1)) was included in the HC and LC feedstuffs. Higher AFB(1) recoveries were obtained using AC compared with MeOH, both in HC (75.0% versus 12.0%, respectively) and in LC (84.0% versus 22.8%, respectively) ADSs containing feedstuffs. However, when the activated carbon and the sodium bentonite were included in feeds, lower AFB1 concentrations with respect to control values (p < 0.001 and <0.05, respectively) were obtained also using AC. The data obtained in this study indicate that routine use of the MeOH solvent for AFB1 analysis of unknown feedstuffs, can produce misleading results if they contain an ADS. PMID:19750400

  6. Immunotoxicity of aflatoxin B1: Impairment of the cell-mediated response to vaccine antigen and modulation of cytokine expression

    SciTech Connect

    Meissonnier, Guylaine M.; Pinton, Philippe; Laffitte, Joelle; Cossalter, Anne-Marie; Gong, Yun Yun; Wild, Christopher P.; Bertin, Gerard; Galtier, Pierre; Oswald, Isabelle P.


    Aflatoxin B1 (AFB1), a mycotoxin produced by Aspergillus flavus or A. parasiticus, is a frequent contaminant of food and feed. This toxin is hepatotoxic and immunotoxic. The present study analyzed in pigs the influence of AFB1 on humoral and cellular responses, and investigated whether the immunomodulation observed is produced through interference with cytokine expression. For 28 days, pigs were fed a control diet or a diet contaminated with 385, 867 or 1807 {mu}g pure AFB1/kg feed. At days 4 and 15, pigs were vaccinated with ovalbumin. AFB1 exposure, confirmed by an observed dose-response in blood aflatoxin-albumin adduct, had no major effect on humoral immunity as measured by plasma concentrations of total IgA, IgG and IgM and of anti-ovalbumin IgG. Toxin exposure did not impair the mitogenic response of lymphocytes but delayed and decreased their specific proliferation in response to the vaccine antigen, suggesting impaired lymphocyte activation in pigs exposed to AFB1. The expression level of pro-inflammatory (TNF-{alpha}, IL-1{beta}, IL-6, IFN-{gamma}) and regulatory (IL-10) cytokines was assessed by real-time PCR in spleen. A significant up-regulation of all 5 cytokines was observed in spleen from pigs exposed to the highest dose of AFB1. In pigs exposed to the medium dose, IL-6 expression was increased and a trend towards increased IFN-{gamma} and IL-10 was observed. In addition we demonstrate that IL-6 impaired in vitro the antigenic- but not the mitogenic-induced proliferation of lymphocytes from control pigs vaccinated with ovalbumin. These results indicate that AFB1 dietary exposure decreases cell-mediated immunity while inducing an inflammatory response. These impairments in the immune response could participate in failure of vaccination protocols and increased susceptibility to infections described in pigs exposed to AFB1.

  7. The effect of NovaSil dietary supplementation on the growth and health performance of Nile tilapia (Oreochromis niloticus) fed aflatoxin-B1 contaminated feed

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The objective of this study was to evaluate the ability of NovaSil (NS) clay to sorb and mitigate the toxic effects of aflatoxin B1 (AFB1) in Nile tilapia (Oreochromis niloticus). Growth performance, specific innate immunological function, intestinal microbial community, and histology were evaluate...

  8. Portable visual quantitative detection of aflatoxin B1 using a target-responsive hydrogel and a distance-readout microfluidic chip.


    Ma, Yanli; Mao, Yu; Huang, Di; He, Zhe; Yan, Jinmao; Tian, Tian; Shi, Yuanzhi; Song, Yanling; Li, Xingrui; Zhu, Zhi; Zhou, Leiji; Yang, Chaoyong James


    Aflatoxin B1 (AFB1), as the secondary metabolite of molds, is the most predominant and toxic mycotoxin that seriously threatens the health of humans and animals. In this work, an AFB1-responsive hydrogel was synthesized for highly sensitive and portable detection of AFB1. The AFB1-responsive hydrogel was prepared using an AFB1 aptamer and its two short complementary DNA strands as cross-linkers. For visual detection of AFB1, the hydrogel is preloaded with gold nanoparticles (AuNPs). Upon introduction of AFB1, the AFB1 aptamer binds with AFB1, leading to the disruption of the hydrogel and release of the AuNPs with a distinct color change of the supernatant from colorless to red. In order to lower the detection limit and extend the method to quantitative analysis, a distance-readout volumetric bar chart chip (V-chip) was combined with an AFB1-responsive hydrogel preloaded with platinum nanoparticles (PtNPs). In the presence of AFB1, the hydrogel collapses and releases PtNPs which can catalyze the decomposition of H2O2 to generate O2. The increasing gas pressure moves a red ink bar in the V-chip and provides a quantitative relationship between the distance and the concentration of AFB1. The method was applied for detection of AFB1 in beer, with a detection limit of 1.77 nM (0.55 ppb) where an immunoaffinity column (IAC) of AFB1 was used to cleanup and pre-concentrate the sample, which satisfies the testing requirement of 2.0 ppb set by the European Union. The combination of an AFB1-responsive hydrogel with a distance-based readout V-chip offers a user-friendly POCT device, which has great potential for rapid, portable, selective, and quantitative detection of AFB1 in real samples to ensure food safety and avoid subsequent economic losses. PMID:27302553

  9. Non-Linear Relationships between Aflatoxin B1 Levels and the Biological Response of Monkey Kidney Vero Cells

    PubMed Central

    Rasooly, Reuven; Hernlem, Bradley; He, Xiaohua; Friedman, Mendel


    Aflatoxin-producing fungi contaminate food and feed during pre-harvest, storage and processing periods. Once consumed, aflatoxins (AFs) accumulate in tissues, causing illnesses in animals and humans. Most human exposure to AF seems to be a result of consumption of contaminated plant and animal products. The policy of blending and dilution of grain containing higher levels of aflatoxins with uncontaminated grains for use in animal feed implicitly assumes that the deleterious effects of low levels of the toxins are linearly correlated to concentration. This assumption may not be justified, since it involves extrapolation of these nontoxic levels in feed, which are not of further concern. To develop a better understanding of the significance of low dose effects, in the present study, we developed quantitative methods for the detection of biologically active aflatoxin B1 (AFB1) in Vero cells by two independent assays: the green fluorescent protein (GFP) assay, as a measure of protein synthesis by the cells, and the microculture tetrazolium (MTT) assay, as a measure of cell viability. The results demonstrate a non-linear dose-response relationship at the cellular level. AFB1 at low concentrations has an opposite biological effect to higher doses that inhibit protein synthesis. Additional studies showed that heat does not affect the stability of AFB1 in milk and that the Vero cell model can be used to determine the presence of bioactive AFB1 in spiked beef, lamb and turkey meat. The implication of the results for the cumulative effects of low amounts of AFB1 in numerous foods is discussed. PMID:23949006

  10. Association between aflatoxin B1 occupational airway exposure and risk of hepatocellular carcinoma: a case-control study.


    Lai, Hao; Mo, Xianwei; Yang, Yang; He, Ke; Xiao, Jun; Liu, Chao; Chen, Jiansi; Lin, Yuan


    The aim of this study was to determine the airway exposure of sugar and papermaking factory workers to aflatoxin B1 (AFB1) and to explore the potential association between AFB1 airway exposure and the risk of hepatocellular carcinoma (HCC) in a case-control study. Dust samples were collected from the sugarcane bagasse warehouse, and presser and paper production workshops. Blood samples were collected from 181 workshop employees and 203 controls who worked outside the workshop. AFB1 albumin adducts were detected using a double antibody sandwich enzyme-linked immunosorbent assay (ELISA). To explore the association between AFB1 airway exposure and the risk of HCC, the medical records of 68 HCC patients who worked in a sugar and papermaking factory between January 1994 and December 2013 were analyzed. A questionnaire was used to collect information from 150 healthy controls who worked for the same company and lived near the factory. AFB1 was detected in the dust samples, but could not be detected in any of the rice samples. An analysis of serum samples revealed serum AFB1 albumin adducts in 102 (56.35 %) of the study participants. However, in the control group, only 12 (5.9 %) individuals had detectable levels of AFB1 albumin adducts. Those with airway exposure to Aspergillus flavus-contaminated dust had an elevated risk of HCC compared to those without exposure (odds ratio, 5.24; 95 % confidence interval, 2.77-9.88; P = 0.00). The findings of this study indicate that occupational AFB1 airway exposure might be associated with the risk of AFB1-related HCC among the population that was used in this study. Intervention programs aimed at reducing exposure to inhalational AFB1 are needed urgently. Additional suitably designed, multicenter, prospective studies using large samples are needed to further confirm the results. PMID:24961349

  11. Ability of Lactobacillus plantarum MON03 to mitigate aflatoxins (B1 and M1) immunotoxicities in mice.


    Jebali, Rania; Abbès, Samir; Salah-Abbès, Jalila Ben; Younes, Ridha Ben; Haous, Zohra; Oueslati, Ridha


    Aflatoxin B1 (AFB1) and M1 (AFM1) are mycotoxins produced by numerous Aspergillus species in pre- or post-harvest cereals and milk. AFB1 and AFM1 display a potent economic loss in livestock and also cause severe immunological problems. The aims of this study were to: evaluate a new AFB1 and AFM1-binding/degrading micro-organism for biological detoxification; examine its ability to degrade AFB1 and AFM1 in liquid medium; and evaluate its potential for in vivo preventative effects against AFB1- and AFM1-induced immunomodulation in mice. Lactobacillus plantarum MON03 (LP) isolated from Tunisian artisanal butter was found to display significant binding ability to AFB1 and AFM1 in PBS (i.e. 82% and 89%, respectively) within 24 h of incubation and able to tolerate gastric acidity, have strongly hydrophilic cells surface properties, and adhere efficacy to Caco-3 cells in vitro. The in vivo study was conducted using Balb/c mice that received by oral gavage vehicle (control), LP only (2 × 10(9) CFU/L, ~2 g/kg BW), AFB1 or AFM1 alone (0.25 and 0.27 mg/kg, respectively), or AFB1 + LP or AFM1 + LP daily for 15 days. Compared to in control mice, treatments with AFB1 and AFM1 led to significantly decreased body weight gains, histopathological changes, and decrements in all hematologic and immune parameters assessed. Co-treatment with LP strongly reduced the adverse effects of each mycotoxin. In fact, the mice receiving AFB1 + LP or AFM1 + LP co-treatment displayed no significant differences in the assayed parameters as compared to the control mice. By itself, the bacteria alone had no adverse effects in the mice. From these data, it is concluded that the tested bacteria could be beneficial in biotechnology detoxification of contaminated food and feed for humans and animals. PMID:25441623

  12. Temporary modulation of responses to common vaccines and serum cation status in broilers during exposure to low doses of aflatoxin B1.


    Yunus, A W; Böhm, J


    The purpose of this study was to observe the effects of low doses of aflatoxin B1 (AFB1) on responses to common vaccines and levels of serum cations in broilers. Male broilers at 7 d of age were fed control (no AFB1), a 75 µg of AFB1/kg (75 ppb of AFB1) diet, or a 750 µg of AFB1/kg (750 ppb of AFB1) diet. The 750 ppb of AFB1 diet resulted in a temporary increase in ELISA titers against Newcastle disease virus (P = 0.014) and infectious bursal disease virus (P = 0.005) during wk 2 and 4 of exposure, respectively, compared with the control diet. Conversely, lower (P ≤ 0.01) serum protein concentrations were found in broilers under the 750 ppb AFB1 diet during wk 2 and 4. During wk 2 of exposure, lower serum levels of potassium were noted in birds under both the 75 (P = 0.037) and 750 ppb (P = 0.000) AFB1 diets compared with those under the control diet. During wk 5, higher serum magnesium (P = 0.004), and sodium (P = 0.000) under the 750 ppb AFB1 diet were found compared with the control diet. These data indicate that low dietary levels of AFB1 can temporarily increase or decrease the studied serological variables in broilers depending upon the stage of exposure. PMID:24135593

  13. Supercritical fluid extraction of aflatoxin B(1) from soil.


    Starr, James M; Selim, Mustafa I


    This research describes the development of a supercritical fluid extraction (SFE) method to recover aflatoxin B(1) from fortified soil. The effects of temperature, pressure, modifier (identity and percentage), and extraction type were assessed. Using the optimized SFE conditions, the mean recovery from air dried soil was 72%. The variables associated with changes in recovery of aflatoxin were co-solvents, static extraction, and temperature. Acetonitrile-2% acetic acid, used both in-cell and on-line, provided the most efficient recovery. The results indicate that desorption from the soil was the limiting factor in recovery and that the static phase was more important than the dynamic. PMID:18814879

  14. Rapid screening of aflatoxin B1 in beer by fluorescence polarization immunoassay.


    Beloglazova, N V; Eremin, S A


    This manuscript describes the development of a sensitive, fast and easily-performed fluorescence polarization immunoassay (FPIA) for the mycotoxin aflatoxin B1 (AFB1) in various beer samples, both lager and dark. The highest sensitivity was determined for six poly- and monoclonal antibodies selective towards aflatoxins. The sample pretreatment design was emphasized since beer samples are characterized by extremely diverse matrices. Herein, the choice of sorbent for effective removal of matrix interferences prior to analysis was crucial. The samples were diluted with a borate buffer solution containing 1% PEG 6000 and passed through the clean-up column packed with NH2-derivated silica. This sample pretreatment technique was perfectly suitable for the FPIA of lager beer samples, but for dark beer and ale it did not suffice. An artificial matrix was constructed to plot a calibration curve and quantify the results of the latter samples. The developed immunoassay was characterized by a limit of detection of 1 ng mL(-1). Apparent recovery values of 89-114% for lager and 80-125% for dark beer were established. The FPIA data for AFB1 was characterized by elevated linear regression coefficients, 0.9953 for spiked lager and 0.9895 for dark beer samples respectively. PMID:26003708

  15. Leaky Gut and Mycotoxins: Aflatoxin B1 Does Not Increase Gut Permeability in Broiler Chickens.


    Galarza-Seeber, Rosario; Latorre, Juan D; Bielke, Lisa R; Kuttappan, Vivek A; Wolfenden, Amanda D; Hernandez-Velasco, Xochitl; Merino-Guzman, Ruben; Vicente, Jose L; Donoghue, Annie; Cross, David; Hargis, Billy M; Tellez, Guillermo


    Previous studies conducted in our laboratory have demonstrated that intestinal barrier function can be adversely affected by diet ingredients or feed restriction, resulting in increased intestinal inflammation-associated permeability. Two experiments were conducted in broilers to evaluate the effect of three concentrations of Aflatoxin B1 (AFB1; 2, 1.5, or 1 ppm) on gastrointestinal leakage and liver bacterial translocation (BT). In experiment 1, 240 day-of-hatch male broilers were allocated in two groups, each group had six replicates of 20 chickens (n = 120/group): Control feed or feed + 2 ppm AFB1. In experiment 2, 240 day-of-hatch male broilers were allocated in three groups, each group had five replicates of 16 chickens (n = 80/group): Control feed; feed + 1 ppm AFB1; or feed + 1.5 ppm AFB1. In both experiments, chickens were fed starter (days 1-7) and grower diets (days 8-21) ad libitum and performance parameters were evaluated every week. At day 21, all chicks received an oral gavage dose of FITC-d (4.16 mg/kg) 2.5 h before collecting blood samples to evaluate gastrointestinal leakage of FITC-d. In experiment 2, a hematologic analysis was also performed. Liver sections were aseptically collected and cultured using TSA plates to determine BT. Cecal contents were collected to determine total colony-forming units per gram of Gram-negative bacteria, lactic acid bacteria (LAB), or anaerobes by plating on selective media. In experiment 2, liver, spleen, and bursa of Fabricius were removed to determine organ weight ratio, and also intestinal samples were obtained for morphometric analysis. Performance parameters, organ weight ratio, and morphometric measurements were significantly different between Control and AFB1 groups in both experiments. Gut leakage of FITC-d was not affected by the three concentrations of AFB1 evaluated (P > 0.05). Interestingly, a significant reduction in BT was observed in chickens that received 2 and 1

  16. Leaky Gut and Mycotoxins: Aflatoxin B1 Does Not Increase Gut Permeability in Broiler Chickens

    PubMed Central

    Galarza-Seeber, Rosario; Latorre, Juan D.; Bielke, Lisa R.; Kuttappan, Vivek A.; Wolfenden, Amanda D.; Hernandez-Velasco, Xochitl; Merino-Guzman, Ruben; Vicente, Jose L.; Donoghue, Annie; Cross, David; Hargis, Billy M.; Tellez, Guillermo


    Previous studies conducted in our laboratory have demonstrated that intestinal barrier function can be adversely affected by diet ingredients or feed restriction, resulting in increased intestinal inflammation-associated permeability. Two experiments were conducted in broilers to evaluate the effect of three concentrations of Aflatoxin B1 (AFB1; 2, 1.5, or 1 ppm) on gastrointestinal leakage and liver bacterial translocation (BT). In experiment 1, 240 day-of-hatch male broilers were allocated in two groups, each group had six replicates of 20 chickens (n = 120/group): Control feed or feed + 2 ppm AFB1. In experiment 2, 240 day-of-hatch male broilers were allocated in three groups, each group had five replicates of 16 chickens (n = 80/group): Control feed; feed + 1 ppm AFB1; or feed + 1.5 ppm AFB1. In both experiments, chickens were fed starter (days 1–7) and grower diets (days 8–21) ad libitum and performance parameters were evaluated every week. At day 21, all chicks received an oral gavage dose of FITC-d (4.16 mg/kg) 2.5 h before collecting blood samples to evaluate gastrointestinal leakage of FITC-d. In experiment 2, a hematologic analysis was also performed. Liver sections were aseptically collected and cultured using TSA plates to determine BT. Cecal contents were collected to determine total colony-forming units per gram of Gram-negative bacteria, lactic acid bacteria (LAB), or anaerobes by plating on selective media. In experiment 2, liver, spleen, and bursa of Fabricius were removed to determine organ weight ratio, and also intestinal samples were obtained for morphometric analysis. Performance parameters, organ weight ratio, and morphometric measurements were significantly different between Control and AFB1 groups in both experiments. Gut leakage of FITC-d was not affected by the three concentrations of AFB1 evaluated (P > 0.05). Interestingly, a significant reduction in BT was observed in chickens that received 2 and

  17. Magnetic bead-based fluorescence immunoassay for aflatoxin B1 in food using biofunctionalized rhodamine B-doped silica nanoparticles.


    Tang, Dianping; Yu, Yongliang; Niessner, Reinhard; Miró, Manuel; Knopp, Dietmar


    A simple and sensitive fluorescence immunoassay for the detection of aflatoxin B(1) (AFB(1), as a model compound) in food was developed using AFB(1)-bovine serum albumin conjugate (AFB(1)-BSA)-functionalized magnetic beads as immunosensing probes. The recognition elements were prepared by doping of rhodamine B (RB) fluorophore into silica nanoparticles followed by immobilization of monoclonal anti-AFB(1) antibodies on the silica shell. Based on a competitive-type immunoassay format, the assay was performed both in low-binding polypropylene 96-well microtiter plates (MTPs) and in an automated sequential injection (SI) format. Similar detection limit (LOD) of 0.2 ng mL(-1)vs. 0.1 ng mL(-1) but narrower dynamic working linear range of 0.5-7 ng mL(-1)vs. 0.5-30 ng mL(-1) was obtained toward AFB(1) standards with the flow setup compared to the MTP format. Intra-batch assay precision was substantially improved (≤5.3% vs.≤8.7%) by resorting to the SI manifold. The proposed method features unbiased identification of negative (blank) and positive samples. No significant differences at the 95% confidence level were encountered in the analysis of naturally contaminated peanut samples between the proposed immunoassay and liquid chromatography for determination of AFB(1). PMID:20820489

  18. Quality Evaluation of Five Commercial Enzyme Linked Immunosorbent Assay Kits for Detecting Aflatoxin B1 in Feedstuffs

    PubMed Central

    Sun, Dan-dan; Gu, Xu; Li, Jun-guo; Yao, Ting; Dong, Ying-chao


    The objective of this study was to evaluate the quality of five commercial enzyme linked immunosorbent assay (ELISA) kits (A, B, C, D, and E) from different suppliers for detecting aflatoxin B1 (AFB1). AFB1-free corn samples supplemented with different levels of AFB1 (5, 10, and 20 μg/kg) were used as positive controls and 6 replicates of each control sample were tested to evaluate the accuracy and precision of these kits. In addition, we also evaluated the performance of these ELISA kits for AFB1 in 30 feed samples, including corn, distillers dried grains with soluble, wheat samples, soybean meal, and poultry feed, which were verified by high performance liquid chromatography. Results showed that the coefficients of variation ranged from 1.18% to 16.22% in intra-plate and 2.85% to 18.04% in inter-plate for the determination of AFB1. The half maximal inhibitory concentration for five kits ranged from 3.72 to 7.22 μg/kg. The quantitation limits of AFB1 were all under the legal limit in China but somewhat inconsistent with kit instructions. Although the recovery rate of four of the five kits were either less than 90% or more than 110%, all these values were acceptable in practice. Two kits had high false positive rates (C and E). In conclusion, our results revealed that the qualities of five tested ELISA kits were significantly different. PMID:25924961

  19. Simple and sensitive detection of aflatoxin B1 within five minute using a non-conventional competitive immunosensing mode.


    Lin, Youxiu; Zhou, Qian; Lin, Yuping; Tang, Dianyong; Chen, Guonan; Tang, Dianping


    A novel competitive-type immunosensing strategy based on target-induced displacement reaction with antibody-functionalized mesoporous carbon (MSC) nanoparticles was designed for sensitive and rapid electrochemical detection of aflatoxin B1 (AFB1, used as a model) on the Nafion-functionalized sensing interface. Electroactive thionine molecules were initially decorated to the mesoporous carbon, and polyclonal anti-AFB1 antibody was then covalently conjugated to the nanostructures. The immunosensor was simply prepared via the electrostatic interaction between negatively charged Nafion film and positively charged anti-AFB1 antibody accompanying the nanostructures. The electrochemical signal originated from the carried thionine to mesoporous carbon. Upon target AFB1 introduction, the analyte reacted with the labeled anti-AFB1 antibody on the MSC based on specific antigen-antibody reaction and induced the dissociation of thionine-MSN nanostructures from the sensing interface, thus decreasing the cathodic current of the carried thionine molecules. Under optimal conditions, the immunosensor exhibited good electrochemical responses for determination of target AFB1 at a concentration as low as 3.0 pg mL(-1) (3.0 ppt). Importantly, the non-conventional sensing system provides a promising immunosensing strategy for rapid screening of small molecules because of its simplicity, low cost and sensitivity without the needs of sample separation and washing step. PMID:26208172

  20. Interaction of aflatoxin B1 and fumonisin B1 in mice causes immunotoxicity and oxidative stress: Possible protective role using lactic acid bacteria.


    Abbès, Samir; Ben Salah-Abbès, Jalila; Jebali, Rania; Younes, Ridha Ben; Oueslati, Ridha


    Aflatoxins (AF) are important foodborne mycotoxins implicated in human health and have immunocytotoxic effects. The aims of this study were to evaluate a new aflatoxin B1 (AFB1) and fumonisin B1 (FB1)-binding/degrading micro-organism for biological detoxification, to examine its ability to degrade AFB1 and FB1 in liquid medium, and to evaluate its potential in vivo protective role against any combined effects from AFB1 and FB1 on host splenocyte caspase-3 activity (reflecting DNA damage/cell death) and mRNA levels of select inflammation-regulating cytokines. Balb/c mice were divided into groups (10/group) and treated daily for 2 weeks by oral gavage with AFB1 (80 µg/kg BW), FB1 (100 µg/kg), AFB1 + FB1, or lactic acid bacteria (Lactobacillus paracasei BEJ01, 2 × 10(9) CFU/L, ∼2 mg/kg) - alone or in combination with the AFB1 and/or FB1. After the exposures, spleens were collected for measures of caspase-3 activity, lipid peroxidation (LP), and glutathione (GSH) content, expression of anti-oxidation protective enzymes (GPx and SOD), and mRNA levels of inflammation-regulating cytokines (e.g. IL-10, IL-4, IFNγ, TNFα). Thymii were also removed for analysis of apoptosis. The results indicated that, in the spleen, exposure to the mycotoxins led to increased caspase-3 activity, LP, and IL-10 and IL-4 mRNA levels, but decreased GSH content and down-regulated expression of GPx and SOD, and of IFNγ and TNFα mRNA. Co-treatment using Lactic Acid Bacteria (LAB) with AFB1 or FB1 suppressed levels of DNA fragmentation, normalized splenic LP and increased GSH levels, up-regulated expression of GPx and SOD, and normalized mRNA levels of the analyzed cytokines. It is concluded that AFB1 and FB1 might have combinational (synergistic moreso than additive) toxic effects in situ. Further, it can be seen that use of LAB induced protective effects against the oxidative stress and (immuno)toxicity of these agents in part through adhesion (and so likely diminished

  1. Monoclonal antibody-quantum dots CdTe conjugate-based fluoroimmunoassay for the determination of aflatoxin B1 in peanuts.


    Zhang, Zhaowei; Li, Yuanyuan; Li, Peiwu; Zhang, Qi; Zhang, Wen; Hu, Xiaofeng; Ding, Xiaoxia


    A fluoroimmunoassay towards aflatoxin B1 (AFB1) was presented using quantum dots as the fluorescent label. The CdTe QDs were successfully linked to the monoclonal antibody against AFB1. Based on the conjugated complexes, a novel direct competitive fluorescence-linked immunosorbent assay (cFLISA) was developed for AFB1 detection. The 50% inhibition value (IC50) of the cFLISA was 0.149ng/mL in peanuts matrix. The method performance included the limit of detection (LOD) of 0.016ng/mL and considerable recoveries of 85-117% at three fortification levels (0.075, 0.15, and 0.3ng/g) from spiked AFB1 blank peanuts samples, along with coefficients of variation (CVs) below 10%. The cFLISA provided an alternative of rapid and sensitive detection for AFB1 and, moreover provided great potential for multiplexed mycotoxins determination simultaneously. PMID:24176348

  2. Structural Elucidation and Toxicity Assessment of Degraded Products of Aflatoxin B1 and B2 by Aqueous Extracts of Trachyspermum ammi

    PubMed Central

    Iram, Wajiha; Anjum, Tehmina; Iqbal, Mazhar; Ghaffar, Abdul; Abbas, Mateen


    In this study aqueous extract of seeds and leaves of Trachyspermum ammi were evaluated for their ability to detoxify aflatoxin B1 and B2 (AFB1; 100 μg L−1 and AFB2; 50 μg L−1) by in vitro and in vivo assays. Results indicated that T. ammi seeds extract was found to be significant (P < 0.05) in degrading AFB1 and AFB2 i.e., 92.8 and 91.9% respectively. However, T. ammi leaves extract proved to be less efficient in degrading these aflatoxins, under optimized conditions i.e., pH 8, temperature 30°C and incubation period of 72 h. The structural elucidation of degraded toxin products by LCMS/MS analysis showed that eight degraded products of AFB1 and AFB2 were formed. MS/MS spectra showed that most of the products were formed by the removal of double bond in the terminal furan ring and modification of lactone group indicating less toxicity as compared to parent compounds. Brine shrimps bioassay further confirmed the low toxicity of degraded products, showing that T. ammi seeds extract can be used as an effective tool for the detoxification of aflatoxins. PMID:27064492

  3. Structural Elucidation and Toxicity Assessment of Degraded Products of Aflatoxin B1 and B2 by Aqueous Extracts of Trachyspermum ammi.


    Iram, Wajiha; Anjum, Tehmina; Iqbal, Mazhar; Ghaffar, Abdul; Abbas, Mateen


    In this study aqueous extract of seeds and leaves of Trachyspermum ammi were evaluated for their ability to detoxify aflatoxin B1 and B2 (AFB1; 100 μg L(-1) and AFB2; 50 μg L(-1)) by in vitro and in vivo assays. Results indicated that T. ammi seeds extract was found to be significant (P < 0.05) in degrading AFB1 and AFB2 i.e., 92.8 and 91.9% respectively. However, T. ammi leaves extract proved to be less efficient in degrading these aflatoxins, under optimized conditions i.e., pH 8, temperature 30°C and incubation period of 72 h. The structural elucidation of degraded toxin products by LCMS/MS analysis showed that eight degraded products of AFB1 and AFB2 were formed. MS/MS spectra showed that most of the products were formed by the removal of double bond in the terminal furan ring and modification of lactone group indicating less toxicity as compared to parent compounds. Brine shrimps bioassay further confirmed the low toxicity of degraded products, showing that T. ammi seeds extract can be used as an effective tool for the detoxification of aflatoxins. PMID:27064492

  4. Regulation of aflatoxin B1-metabolizing aldehyde reductase and glutathione S-transferase by chemoprotectors.

    PubMed Central

    McLellan, L I; Judah, D J; Neal, G E; Hayes, J D


    Ingestion of aflatoxin B1 (AFB1) represents a major risk factor in the aetiology of human hepatocellular carcinoma. In the rat, the harmful effects of AFB1 can be prevented by the administration of certain drugs which induce hepatic detoxification enzymes. We have previously shown that treatment of rats with the chemoprotector ethoxyquin (EQ) results in a marked increase in expression of the Alpha-class glutathione S-transferase (GST) Yc2 subunit which has high activity towards AFB1-8,9-epoxide [Hayes, Judah, McLellan, Kerr, Peacock and Neal (1991) Biochem. J. 279, 385-398]. To allow an assessment of whether the increased expression of GST Yc2 represents a general adaptive resistance mechanism to chemical stress, that is invoked by both chemoprotectors and carcinogens, we have examined the effects of EQ, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), phenobarbital (PB), AFB1, 3-methylcholanthrene (3-MC) and clofibrate on the AFB1-glutathione-conjugating activity and the GST subunit levels in rat liver. In addition, the effect of these drugs on the hepatic levels of an aldehyde reductase (AFB1-AR) that metabolizes the cytotoxic dialdehydic form of AFB1 has been studied as this enzyme also appears to be important in chemoprotection. Administration of the antioxidants EQ, BHA or BHT, as well as PB, led to a marked increase in levels of the GST Yc2 subunit in rat liver, and this increase coincided with a substantial rise in the GST activity towards AFB1-8,9-epoxide; neither AFB1, 3-MC nor clofibrate caused induction of Yc2 or any of the GST subunits examined. Among the xenobiotics studied, EQ was found to be the most effective inducing agent for the Yc2 subunit as well as Yc1, Yb1 and Yf. However, PB was equally as effective as EQ in increasing levels of the Ya-type subunits, although it was not found to be as potent an inducer of the other GST subunits, including Yc2. In addition to induction of GST, EQ caused a substantial increase in the hepatic

  5. Interactive effects of dietary protein concentration and aflatoxin B1 on performance, nutrient digestibility, and gut health in broiler chicks.


    Chen, X; Naehrer, K; Applegate, T J


    A 20-day trial was conducted to determine the impact of aflatoxin B1 (AFB1) and dietary protein concentration on performance, nutrient digestibility, and gut health in broiler chicks. The 6 dietary treatments were arranged in a 2 × 3 factorial with 3 crude protein (CP) concentrations (16, 22, and 26%) with or without 1.5 mg/kg AFB1 Each diet was fed to 6 replicate cages (6 chicks per cage) from zero to 20 d of age. Endogenous N and amino acid loss were estimated from birds fed a N-free diet with or without 1.5 mg/kg AFB1 A significant interaction between AFB1 and CP concentration was observed for growth performance, where reduction of BW gain, feed intake, gain:feed ratio, and breast muscle weight by AFB1 were most profound in birds fed the 16%-CP diet, and were completely eliminated when birds were fed the 26%-CP diet (AFB1 by CP interaction; P ≤ 0.023). Similarly, AFB1 reduced serum albumin, total protein, and globulin concentrations in birds fed 16 and 22% CP diets, but not in those fed the 26%-CP (AFB1 by CP interaction; P ≤ 0.071). Gut permeability was increased in birds fed AFB1-contamiated diets as measured by serum lactulose/rhamnose ratio (main effect; P = 0.04). Additionally, AFB1 tended to increase endogenous N loss (P = 0.09), and significantly reduced apparent ileal digestible energy and standardized ileal N and amino acid digestibility in birds fed the 16%-CP diet, while birds fed higher dietary CP were not affected (AFB1 by CP interaction; P ≤ 0.01). Further, AFB1 increased the translation initiation factor 4E-binding protein (4EBP1), claudin1, and multiple jejunal amino acid transporters expression (main effect; P ≤ 0.04). Results from this study indicate that a 1.5 mg AFB1/kg diet significantly impairs growth, major serum biochemistry measures, gut barrier, endogenous loss, and energy and amino acid digestibility. Aflatoxicosis can be augmented by low dietary CP, while higher dietary CP completely eliminated the impairment of

  6. Challenging Role of Dietary Aflatoxin B1 Exposure and Hepatitis B Infection on Risk of Hepatocellular Carcinoma

    PubMed Central

    Kucukcakan, Basak; Hayrulai-Musliu, Zehra


    Aflatoxins (AFT) are poisonous substances which are classified in Group 1 carcinogenic agents to humans by International Agency for Research on Cancer (IARC). AFT can occur naturally in food commodities (maize, corn, rice) as a result of fungal contamination in hot and humid environments. In the food, toxin contamination can remain during manufacturing and long after fungi have stopped being biologically active. Aflatoxin B1 (AFB1) is the most dominant and potent agent from all AFT. In developing countries, high exposure to AFB1 can cause chronic toxicity and usually increases the incidence of Hepatocellular Carcinoma (HCC). However, in these regions hepatitis B is the most common risk factor for HCC cases. Many researches were aimed to enlighten the mechanism and the role of two etiological agents on risk of HCC, but the obtained data was conflicting with each other. It was uncertain that the indicators/biomarkers might be the contribution of the carcinogenic status of the patient; and, the biomarker samples from the subject may only reflect the recent effects of the toxin exposure after consumption of AFB1 contaminated commodities. The studies were facing with the errors of methods which were un-fit to enlighten the possible interaction between Hepatitis B and AFB1 on contribution to HCC. It was pivotal to understand the effect of each risk factor in order to prevent and improve public health in poor and undeveloped regions. Although some of the studies evaluate AFB1 alone as a considerable factor on HCC risk, according to this review it was concluded vice versa. This study was aimed to clarify the main etiological agent of HCC where AFB1 and HBV are endangering public health. In additionally, the purpose was to enlighten the possible synergistic effect between these two factors among HCC pathogenesis. Hence forth, appropriate and right applications could be conducted in undeveloped countries in order to protect public health. PMID:27275251

  7. In vitro ability of beer fermentation residue and yeast-based products to bind aflatoxin B1.


    Bovo, Fernanda; Franco, Larissa Tuanny; Rosim, Roice Eliana; Barbalho, Ricardo; de Oliveira, Carlos Augusto Fernandes


    This study aimed to verify the in vitro ability of beer fermentation residue (BFR) containing Saccharomyces cerevisiae cells and five commercial products that differed in the viability and integrity of S. cerevisiae cells to remove aflatoxin B1 (AFB1) from a citrate-phosphate buffer solution (CPBS). BFR was collected at a microbrewery and prepared by drying and milling. The commercial yeast-based products were as follows: inactive intact yeast cells from beer alcoholic fermentation, inactive intact yeast cells from sugarcane alcoholic fermentation, hydrolyzed yeast cells, yeast cell walls and active yeast cells. Adsorption assays were performed in CPBS spiked with 1.0 μg AFB1/mL at pH 3.0 and 6.0 for a contact time of 60 min at room temperature. Analysis of AFB1 in the samples was performed by high performance liquid chromatography. AFB1 adsorption by the products ranged from 45.5% to 69.4% at pH 3.0 and from 24.0% to 63.8% at pH 6.0. The higher percentages (p < 0.05) of AFB1 binding at both pH values were achieved with products containing hydrolyzed yeast cells or yeast cell walls rather than intact cells. The AFB1 binding percentages of BFR were 55.0 ± 5.0% at pH 3.0 and 49.2 ± 4.5% at pH 6.0, which was not significantly different (p > 0.05) from commercial products containing inactive intact yeast cells. The results of this trial indicate that the yeast-based products tested, especially the BFR, have potential applications in animal feeds as a suitable biological method for reducing the adverse effects of aflatoxins. PMID:26273277

  8. Removal of aflatoxin B1 and inhibition of Aspergillus flavus growth by the use of Lactobacillus plantarum on olives.


    Kachouri, Faten; Ksontini, Hamida; Hamdi, Moktar


    Olives can be contaminated with a wide variety of molds (Aspergillus and/or Penicillium) that can be occurring naturally on fresh and processed olives and could support mycotoxin production. The aim of this work was to investigate aflatoxin B1 (AFB1) production by fungi and its bioaccumulation in olives during storage and to study the impact of the application of Lactobacillus plantarum on the inhibition of mold development and production of AFB1. Two different treatments were applied: (i) olives with natural microflora and (ii) olives inoculated with Aspergillus flavus after elimination of natural microflora. AFB1 has been extracted from olives and quantitated by high-performance liquid chromatography using a fluorescence detector. Results showed the absence of this metabolite in the olives for the season 2008 to 2009. In 2009 to 2010, AFB1 was detected at the level of 11 μg/kg. The application of L. plantarum during the storage of olives favors the reduction of the level of AFB1 to 5.9 μg/kg correlated with a decrease in the amount of molds (86.3%). The images obtained by environmental scanning electron microscopy showed that L. plantarum was able to adhere to the olive surface and probably produce a biofilm that inhibits the multiplication of yeast and fungi by oxygen competition. Results showed an increase of antioxidant activity and amount of total phenolic compounds of olives, respectively, by 24 and 8.6%. In many olives contaminated with A. flavus, AFB1 was present at an initial level of 5.15 μg/kg and increased to 6.55 μg/kg after 8 days of storage. The biological detoxification of AFB1 in olives by L. plantarum is confirmed by the reduction of the level of AFB1 to 2.12 μg/kg on day 0 and its absence after 4 days of storage. PMID:25285494

  9. Protective Efficacy of Alpha-lipoic Acid against AflatoxinB1-induced Oxidative Damage in the Liver

    PubMed Central

    Li, Y.; Ma, Q. G.; Zhao, L. H.; Guo, Y. Q.; Duan, G. X.; Zhang, J. Y.; Ji, C.


    Alpha-lipoic acid (α-LA) is not only involved in energy metabolism, but is also a powerful antioxidant that can protect against hepatic oxidative stress induced by some drugs, toxins, or under various physiological and pathophysiological conditions. Here, we investigated the effect of α-LA against liver oxidative damage in broilers exposed to aflatoxin B1 (AFB1). Birds were randomly divided into four groups and assigned different diets: basal diet, 300 mg/kg α-LA supplementation in basal diet, diet containing 74 μg/kg AFB1, and 300 mg/kg α-LA supplementation in diet containing 74 μg/kg AFB1, for 3 weeks. The results revealed that the addition of 300 mg/kg α-LA protected against the liver function damage of broilers induced by chronic low dose of AFB1 as estimated by a significant (p<0.05) change in levels of plasma total protein, albumin, alkaline phosphatase and the activities of liver glutamic-oxalacetic transaminase and glutamic-pyruvic transaminase. The histopathological analysis also showed that liver tissues were injured in the AFB1 diet, but this effect was alleviated by the addition of 300 mg/kg α-LA. Additionally, AFB1 induced a profound elevation of oxidative stress in birds, as indicated by an increase in malondialdehyde level, a decrease in glutathione peroxidase activity and a depletion of the glutathione content in the liver. All of these negative effects were inhibited by treatment with α-LA. Our results suggest that the inhibition of AFB1-induced excess production of lipid peroxides and the maintenance of intracellular antioxidant status may play important roles in the protective effects of α-LA against AFB1-induced oxidative damage in the liver. PMID:25050030

  10. Purified form of cytochrome P-450 from rainbow trout with high activity toward conversion of aflatoxin B1 to aflatoxin B1-2,3-epoxide.


    Williams, D E; Buhler, D R


    Aflatoxin B1, the most potent hepatic chemical carcinogen known, is activated to the putative product aflatoxin B1-2,3-epoxide via a cytochrome P-450-dependent reaction. Mt. Shasta rainbow trout is the most sensitive species known to the hepatocarcinogenic effects of aflatoxin B1. We have previously isolated and purified a minor form of cytochrome P-450 from this strain of rainbow trout, with a lambda max in the carbon monoxide-reduced difference spectrum of 449.5 nm and a molecular weight of 54,000. In this study, we have compared in a reconstituted system this trout P-450 to trout cytochrome P-448 and rat cytochrome P-450 and P-448 for metabolism and activation of aflatoxin B1. Trout cytochrome P-450 had much higher activity towards aflatoxin B1 and a greater degree of regioselectivity in the formation of aflatoxin B1-2,3-dihydroxy-2,3-dihydrodiol and was much more efficient in producing aflatoxin B1 covalent adducts with DNA. The existence of such a form of cytochrome P-450 in Mt. Shasta rainbow trout may be responsible for the acute sensitivity of this strain to the carcinogenic effects of aflatoxin B1. PMID:6411332

  11. Carry-over of aflatoxin B1 to aflatoxin M1 in high yielding Israeli cows in mid- and late-lactation.


    Britzi, Malka; Friedman, Shmulik; Miron, Joshua; Solomon, Ran; Cuneah, Olga; Shimshoni, Jakob A; Soback, Stefan; Ashkenazi, Rina; Armer, Sima; Shlosberg, Alan


    The potent hepatotoxin and carcinogen aflatoxin B1 (AFB1) is a common mycotoxin contaminant of grains used in animal feeds. Aflatoxin M1 (AFM1) is the major metabolite of AFB1 in mammals, being partially excreted into milk, and is a possible human carcinogen. The maximum permitted concentration of AFM1 in cows' milk is 0.05 μg/kg in Israel and the European Union. Since milk yield and the carry-over of AFB1 in the feed to AFM1 in the milk are highly correlated, it was considered important to determine the AFM1 carry-over in Israeli-Holstein dairy cows, distinguished by world record high milk production. Twelve such cows were used to determine AFM1 carry-over following daily oral administration of feed containing ~86 μg AFB1 for 7 days. The mean carry-over rate at steady-state (Days 3-7) was 5.8% and 2.5% in mid-lactation and late-lactation groups, respectively. The carry-over appears to increase exponentially with milk yield and could be described by the equation: carry-over% = 0.5154 e(0.0521 × milk yield), with r(2) = 0.6224. If these data truly reflect the carry-over in the national Israeli dairy herd, the maximum level of AFB1 in feed should not exceed 1.4 μg/kg, a value 3.6 times lower than the maximum residue level currently applied in Israel. PMID:23325299

  12. Tetramethyl-6-carboxyrhodamine quenching-based aptasensing platform for aflatoxin B1: Analytical performance comparison of two aptamers.


    Goud, K Yugender; Sharma, Atul; Hayat, Akhtar; Catanante, Gaëlle; Gobi, K Vengatajalabathy; Gurban, Ana Maria; Marty, Jean Louis


    In this study, a simple TAMRA (tetramethyl-6-carboxyrhodamine) quenching-based aptasensing platform was designed for the detection of aflatoxin B1 (AFB1). Here, we compared the analytical performance of two aptamer sequences: seqA and seqB. The AFB1 detection was based on the interactions of FAM (carboxyfluorescein)-labeled aptamer with TAMRA-labeled DNA complementary strand in the presence and absence of target analyte. Under optimized experimental conditions, TAMRA-labeled strand quenched the fluorescence response of FAM-labeled aptamer due to the noncovalent interaction between the two DNA strands. The binding of AFB1 induced the complex formation and weakened the interaction between FAM-labeled aptamer and TAMRA-labeled complementary strand, resulting in the fluorescence recovery. By using this principle concept, an assay was constructed for the detection of AFB1. The method exhibited good sensitivity, good selectivity with a limit of detection of 0.2 ng ml(-1), and a wide linear range from 0.25 to 32 ng ml(-1). For real sample application, the aptasensors were tested in beer and wine samples, with good recovery rates obtained for AFB1 detection. PMID:27251432

  13. Molecular Mechanisms of Lipoic Acid Protection against Aflatoxin B1-Induced Liver Oxidative Damage and Inflammatory Responses in Broilers

    PubMed Central

    Ma, Qiugang; Li, Yan; Fan, Yu; Zhao, Lihong; Wei, Hua; Ji, Cheng; Zhang, Jianyun


    Alpha-lipoic acid (α-LA) was evaluated in this study for its molecular mechanisms against liver oxidative damage and inflammatory responses induced by aflatoxin B1 (AFB1). Birds were randomly allocated into four groups with different diets for three weeks: a basal diet, a 300 mg/kg α-LA supplementation in a basal diet, a diet containing 74 μg/kg AFB1, and 300 mg/kg α-LA supplementation in a diet containing 74 μg/kg AFB1. In the AFB1 group, the expression of GSH-PX mRNA was down-regulated (p < 0.05), and the levels of lipid peroxide and nitric oxide were increased (p < 0.05) in the chicken livers compared to those of the control group. Additionally, the mRNA level of the pro-inflammatory factor interleukin-6 was up-regulated significantly (p < 0.05), the protein expressions of both the nuclear factor kappa B (NF-κB) p65 and the inducible nitric oxide synthase were enhanced significantly (p < 0.05) in the AFB1 group. All of these negative effects were inhibited by α-LA. These results indicate that α-LA may be effective in preventing hepatic oxidative stress, down-regulating the expression of hepatic pro-inflammatory cytokines, as well as inhibiting NF-κB expression. PMID:26694462

  14. Highly sensitive SERS-based immunoassay of aflatoxin B1 using silica-encapsulated hollow gold nanoparticles.


    Ko, Juhui; Lee, Chankil; Choo, Jaebum


    Aflatoxin B1 (AFB1) is a well-known carcinogenic contaminant in foods. It is classified as an extremely hazardous compound because of its potential toxicity to the human nervous system. AFB1 has also been extensively used as a biochemical marker to evaluate the degree of food spoilage. In this study, a novel surface-enhanced Raman scattering (SERS)-based immunoassay platform using silica-encapsulated hollow gold nanoparticles (SEHGNs) and magnetic beads was developed for highly sensitive detection of AFB1. SEHGNs were used as highly stable SERS-encoding nano tags, and magnetic beads were used as supporting substrates for the high-density loading of immunocomplexes. Quantitative analysis of AFB1 was performed by monitoring the intensity change of the characteristic peaks of Raman reporter molecules. The limit of detection (LOD) of AFB1, determined by this SERS-based immunoassay, was determined to be 0.1 ng/mL. This method has some advantages over other analytical methods with respect to rapid analysis (less than 30 min), good selectivity, and reproducibility. The proposed method is expected to be a new analytical tool for the trace analysis of various mycotoxins. PMID:25462866

  15. Modulation of the spleen transcriptome in domestic turkey (Meleagris gallopavo) in response to aflatoxin B1 and probiotics.


    Monson, Melissa S; Settlage, Robert E; Mendoza, Kristelle M; Rawal, Sumit; El-Nezami, Hani S; Coulombe, Roger A; Reed, Kent M


    Poultry are highly susceptible to the immunotoxic effects of the food-borne mycotoxin aflatoxin B1 (AFB1). Exposure impairs cell-mediated and humoral immunity, limits vaccine efficacy, and increases the incidence of costly secondary infections. We investigated the molecular mechanisms of AFB1 immunotoxicity and the ability of a Lactobacillus-based probiotic to protect against aflatoxicosis in the domestic turkey (Meleagris gallopavo). The spleen transcriptome was examined by RNA sequencing (RNA-seq) of 12 individuals representing four treatment groups. Sequences (6.9 Gb) were de novo assembled to produce over 270,000 predicted transcripts and transcript fragments. Differential expression analysis identified 982 transcripts with statistical significance in at least one comparison between treatment groups. Transcripts with known immune functions comprised 27.6 % of significant expression changes in the AFB1-exposed group. Short exposure to AFB1 suppressed innate immune transcripts, especially from antimicrobial genes, but increased the expression of transcripts from E3 ubiquitin-protein ligase CBL-B and multiple interleukin-2 response genes. Up-regulation of transcripts from lymphotactin, granzyme A, and perforin 1 could indicate either increased cytotoxic potential or activation-induced cell death in the spleen during aflatoxicosis. Supplementation with probiotics was found to ameliorate AFB1-induced expression changes for multiple transcripts from antimicrobial and IL-2-response genes. However, probiotics had an overall suppressive effect on immune-related transcripts. PMID:25597949

  16. Polymorphisms in the precursor microRNAs and aflatoxin B1-related hepatocellular carcinoma.


    Long, Xi-Dai; Huang, Xiao-Ying; Yao, Jin-Guang; Liao, Pinhu; Tang, Yu-Jin; Ma, Yun; Xia, Qiang


    The altered expression of some microRNAs (miRNAs) is observed in hepatocellular carcinoma (HCC); however, the genetic polymorphisms in the precursor miRNAs (pre-miRNAs) in aflatoxin B1 (AFB1)-related HCC have not yet been investigated. A hospital-based case-control study, including 1,706 HCC cases and 2,270 controls without any liver diseases or tumors, was conducted in a high AFB1 exposure area of China to assess the relationship between 48 polymorphisms in the pre-miRNAs and AFB1-related HCC risk and prognosis. Among 48 polymorphisms, only rs28599926 (in the miRNA 1268a) affected HCC risk. Compared with the homozygote of rs28599926C alleles (rs28599926-CC), the genotypes of rs28599926 T alleles (namely rs28599926-CT or -TT) increased HCC risk (odds ratio [OR]: 1.63 and 5.52, 95% confidence interval [CI]: 1.40-1.90 and 4.27-7.14, respectively). Significant interactive effects between risk genotypes and AFB1 exposure status were also observed in the joint effects analysis. This polymorphism was associated not only with larger tumor size, higher portal vein tumor risk, and tumor dedifferentiation, but also with higher AFB1 adducts levels and increasing the mutation risk of TP53 gene. Furthermore, rs28599926 modified the tumor recurrence-free survival (hazard ratio [HR]: 2.86, 95% CI: 2.36-3.43) and overall survival (HR: 2.12, 95% CI: 1.86-2.41) of cases. Additionally, one target of miR-1268a was show to be the ADAMTS4 mRNA and rs28599926 polymorphism might modify ADAMTS4 expression. These findings indicate that polymorphisms in the pre-miRNAs may be risk and prognostic biomarkers of AFB1-related HCC, and rs28599926 in miR-1268a is such a potential candidate. © 2015 Wiley Periodicals, Inc. PMID:26152337

  17. Determination of the aflatoxin AFB1 from corn by direct analysis in real time-mass spectrometry (DART-MS).


    Busman, Mark; Liu, Jihong; Zhong, Hongjian; Bobell, John R; Maragos, Chris M


    Direct analysis in real time (DART) ionisation coupled to a high-resolution mass spectrometer (MS) was used for screening of aflatoxins from a variety of surfaces and the rapid quantitative analysis of a common form of aflatoxin, AFB1, extracted from corn. Sample preparation procedure and instrument parameter settings were optimised to obtain sensitive and accurate determination of aflatoxin AFB1. 84:16 acetonitrile water extracts of corn were analysed by DART-MS. The lowest calibration level (LCL) for aflatoxin AFB1 was 4 μg kg⁻¹. Quantitative analysis was performed with the use of matrix-matched standards employing the ¹³C-labelled internal standard for AFB1. DART-MS of spiked corn extracts gave linear response in the range 4-1000 μg kg⁻¹. Good recoveries (94-110%) and repeatabilities (RSD = 0.7-6.9%) were obtained at spiking levels of 20 and 100 μg kg⁻¹ with the use of an isotope dilution technique. Trueness of data obtained for AFB1 in maize by DART-MS was demonstrated by analysis of corn certified reference materials. PMID:24588621

  18. Inactivation of aflatoxin B1 by using the synergistic effect of hydrogen peroxide and gamma radiation.

    PubMed Central

    Patel, U D; Govindarajan, P; Dave, P J


    Inactivation of aflatoxin B1 was studied by using gamma radiation and hydrogen peroxide. A 100-krad dose of gamma radiation was sufficient to inactivate 50 micrograms of aflatoxin B1 in the presence of 5% hydrogen peroxide, and 400 krad was required for total degradation of 100 micrograms of aflatoxin in the same system. Degradation of aflatoxin B1 was confirmed by high-pressure liquid chromatographic and thin-layer chromatographic analysis. Ames microsomal mutagenicity test showed loss of aflatoxin activity. This method of detoxification also reduces the toxin levels effectively in artificially contaminated groundnuts. Images PMID:2497710

  19. An attempt to model the probability of growth and aflatoxin B1 production of Aspergillus flavus under non-isothermal conditions in pistachio nuts.


    Aldars-García, Laila; Ramos, Antonio J; Sanchis, Vicente; Marín, Sonia


    Human exposure to aflatoxins in foods is of great concern. The aim of this work was to use predictive mycology as a strategy to mitigate the aflatoxin burden in pistachio nuts postharvest. The probability of growth and aflatoxin B1 (AFB1) production of aflatoxigenic Aspergillus flavus, isolated from pistachio nuts, under static and non-isothermal conditions was studied. Four theoretical temperature scenarios, including temperature levels observed in pistachio nuts during shipping and storage, were used. Two types of inoculum were included: a cocktail of 25 A. flavus isolates and a single isolate inoculum. Initial water activity was adjusted to 0.87. Logistic models, with temperature and time as explanatory variables, were fitted to the probability of growth and AFB1 production under a constant temperature. Subsequently, they were used to predict probabilities under non-isothermal scenarios, with levels of concordance from 90 to 100% in most of the cases. Furthermore, the presence of AFB1 in pistachio nuts could be correctly predicted in 70-81 % of the cases from a growth model developed in pistachio nuts, and in 67-81% of the cases from an AFB1 model developed in pistachio agar. The information obtained in the present work could be used by producers and processors to predict the time for AFB1 production by A. flavus on pistachio nuts during transport and storage. PMID:26187836

  20. Application of lactic acid bacteria in removing heavy metals and aflatoxin B1 from contaminated water.


    Elsanhoty, Rafaat M; Al-Turki, I A; Ramadan, Mohamed Fawzy


    In this study selected lactic acid bacteria (LAB, Lactobacillus acidophilus, Lactobacillus rhamnosus, Lactobacillus plantrium and Streptococcus thermophiles) and probiotic bacteria (Bifidobacterium angulatum) were tested for their ability in removing heavy metals (HM) including cadmium (Cd), lead (Pb) and arsenic (As) as well as aflatoxin B1 (AFB1) from contaminated water. The biosorption parameters (pH, bacterial concentration, contact time and temperature) of removal using individual as well as mixed LAB and probiotic bacteria were studied. Removal of HM and AFB1 depended on the strain, wherein the process was strongly pH-dependent with high removal ability at a pH close to neutral. The increase in bacterial concentration enhanced the removal of Cd, Pb and As. Also, increasing of contact time and temperature increased the ability of LAB to remove HM. The effect of contact time on Cd removal was slightly different when freshly cultured cells were used. The removal of Cd, Pb and As decreased with the increase in the initial metal concentration. The most effective HM removers were Lactobacillus acidophilus and Bifidobacterium angulatum. The system was found to be adequate for concentrations of HM under investigation. At the end of the operation, the concentration of HM reached the level allowed by the World Health Organization regulations. PMID:27508367

  1. Aflatoxin B1 induced hepatic neoplasia in Great Lakes coho salmon

    SciTech Connect

    Black, J.J.; Maccubbin, A.E.; Myers, H.K.; Zeigel, R.F.


    There is considerable interest in the development of fish models for carcinogen bioassays and the study of chemically induced cancer in wild fish species. Among salmonid species, rainbow trout have mainly been used for carcinogenesis research, in part due to the role played by this species in the discovery of the carcinogenic action of aflatoxin B1 (AFB1). Recently, apparatus and methodology for microinjection of salmonid fish embryos with chemical carcinogens has been described. Because eggs produced by Pacific salmon are relatively much larger than those of rainbow trout, they would provide an attractive subject for embryo microinjection. The Great Lakes are annually stocked with large numbers of coho salmon. It has been recommended to use coho salmon as an indicator for monitoring ecosystem health in the Great Lakes, because stockings throughout health in the Great Lakes, because stockings throughout the Great Lakes are from a common genetic strain and in the lake environment they have a defined food source and life cycle. These considerations led the authors to test coho salmon for their sensitivity to the potent hepatocarcinogen, AFB1. The present report describes in preliminary form, the results of these experiments.

  2. Rapid and label-free detection of ochratoxin A and aflatoxin B1 using an optical portable instrument.


    Arduini, Fabiana; Neagu, Daniela; Pagliarini, Valeria; Scognamiglio, Viviana; Leonardis, Maria Antonietta; Gatto, Emanuela; Amine, Aziz; Palleschi, Giuseppe; Moscone, Danila


    In this study, we report a novel assay for the combined on site detection of aflatoxin B1 (AFB1) and ochratoxin A (OTA), through a colorimetric biosensing system for AFB1 and a fluorimetric detection for OTA, exploiting the capability of the portable fibre optic spectrometer to perform both analyses. AFB1 was detected using the acetylcholinesterase (AChE) enzyme that is inhibited by this toxin, and the degree of inhibition was quantified by the Ellman's spectrophotometric method, obtaining a detection limit of 10 µg L(-1). OTA quantification was performed by monitoring its intrinsic fluorescence in methanol, reaching a detection limit of 0.1 µg L(-1). In order to successfully apply the analytical tool in the food analysis, immunoaffinity columns were used. Clean-up and quantification of both AFB1 and OTA in millet samples was obtained by HPLC-dedicated AflaOchra-Test HPLC™ (Vicam™) and Afla-OtaCLEAN™ (LC-Tech) immunoaffinity columns, followed by absorption/fluorescence detection. Millet samples which were fortified with both OTA (50 µg kg(-1)) and AFB1 (20 µg kg(-1)), gave recovery values of 100 ± 6% for OTA, and 110 ± 10% for AFB1, using AflaOchra-Test HPLC™. Single OTA clean-up and quantification in wine samples was obtained, using an OchraTest immunoaffinity column (Vicam™), reaching a detection limit of 0.3 µg L(-1) and recovery values between 80% and 120%. These results demonstrated the possibility of employing a single clean-up and a cost-effective, and easy to use analytical system for both AFB1 and OTA detection at µg kg(-1) (ppb) level. Furthermore, in the case of positive samples, they could be analysed further, using standard chromatographic procedures, without any additional clean-up step, since the same extraction procedure of standard method is proposed in our method. PMID:26838428

  3. Cytochrome P450 2A13 enhances the sensitivity of human bronchial epithelial cells to aflatoxin B1-induced DNA damage

    SciTech Connect

    Yang, Xuejiao; Zhang, Zhan; Wang, Xichen; Wang, Yun; Zhang, Xiaoming; Lu, Huiyuan; Wang, Shou-Lin


    Cytochrome P450 2A13 (CYP2A13) mainly expresses in human respiratory system and mediates the metabolic activation of aflatoxin B1 (AFB1). Our previous study suggested that CYP2A13 could increase the cytotoxic and apoptotic effects of AFB1 in immortalized human bronchial epithelial cells (BEAS-2B). However, the role of CYP2A13 in AFB1-induced DNA damage is unclear. Using BEAS-2B cells that stably express CYP2A13 (B-2A13), CYP1A2 (B-1A2), and CYP2A6 (B-2A6), we compared their effects in AFB1-induced DNA adducts, DNA damage, and cell cycle changes. BEAS-2B cells that were transfected with vector (B-vector) were used as a control. The results showed that AFB1 (5–80 nM) dose- and time-dependently induced DNA damage in B-2A13 cells. AFB1 at 10 and 80 nM significantly augmented this effect in B-2A13 and B-1A2 cells, respectively. B-2A6 cells showed no obvious DNA damage, similar to B-vector cells and the vehicle control. Similarly, compared with B-vector, B-1A2 or B-2A6 cells, B-2A13 cells showed more sensitivity in AFB1-induced γH2AX expression, DNA adduct 8-hydroxy-deoxyguanosine formation, and S-phase cell-cycle arrest. Furthermore, AFB1 activated the proteins related to DNA damage responses, such as ATM, ATR, Chk2, p53, BRCA1, and H2AX, rather than the proteins related to DNA repair. These effects could be almost completely inhibited by 100 μM nicotine (a substrate of CYP2A13) or 1 μM 8-methoxypsoralen (8-MOP; an inhibitor of CYP enzyme). Collectively, these findings suggest that CYP2A13 plays an important role in low-concentration AFB1-induced DNA damage, possibly linking environmental airborne AFB1 to genetic injury in human respiratory system. - Highlights: • CYP2A13 plays a critical role in low concentration of AFB1-induced DNA damage. • B-2A13 cells were more sensitive to AFB1 than B-1A2 cells and B-2A6 cells. • AFB1 dose- and time-dependently induced DNA damage in B-2A13 cells • AFB1-induced DNA adducts and damage can be inhibited by nicotine and 8

  4. Effect of Aflatoxin B1 on Growth of Bovine Mammary Epithelial Cells in 3D and Monolayer Culture System

    PubMed Central

    Forouharmehr, Ali; Harkinezhad, Taher; Qasemi-Panahi, Babak


    Purpose: Many studies have been showed transfer of aflatoxins, toxins produced by Aspergillus flvaus and Aspergillus parasiticus fungi, into milk. These toxins are transferred into the milk through digestive system by eating contaminated food. Due to the toxicity of these materials, it seems that it has side effects on the growth of mammary cells. Therefore, the present work aimed to investigate possible toxic effects of aflatoxin B1 (AFB1) on bovine mammary epithelial cells in monolayer and three-dimensional cultures. Methods: Specimens of the mammary tissue of bovine were sized out in size 2×2 cm in slaughterhouse. After disinfection and washing in sterile PBS, primary cell culture was performed by enzymatic digestion of tissue with collagenase. When proper numbers of cells were achieved in monolayer culture, cells were seeded in a 24-well culture plate for three-dimensional (3D) culture in Matrigel matrix. After 21 days of 3D culture and reaching the required number of cells, the concentrations of 15, 25 and 35 µL of AFB1 were added to the culture in quadruplicate and incubated for 8 hours. Cellular cytotoxicity was examined using standard colorimetric assay and finally, any change in the morphology of the cells was studied by microscopic technique. Results: Microscopic investigations showed necrosis of the AFB1-exposed cells compared to the control cells. Also, bovine mammary epithelial cells were significantly affected by AFB1 in dose and time dependent manner in cell viability assays. Conclusion: According to the results, it seems that AFB1 can induce cytotoxicity and necrosis in bovine mammary epithelial cells. PMID:24312827

  5. Rapid immunoenzyme assay of aflatoxin B1 using magnetic nanoparticles.


    Urusov, Alexandr E; Petrakova, Alina V; Vozniak, Maxim V; Zherdev, Anatoly V; Dzantiev, Boris B


    The main limitations of microplate-based enzyme immunoassays are the prolonged incubations necessary to facilitate heterogeneous interactions, the complex matrix and poorly soluble antigens, and the significant sample dilutions often required because of the presence of organic extractants. This study presents the use of antibody immobilization on the surface of magnetic particles to overcome these limitations in the detection of the mycotoxin, aflatoxin B1. Features of the proposed system are a high degree of nanoparticle dispersion and methodologically simple immobilization of the antibodies by adsorption. Reactions between the immobilized antibodies with native and labeled antigens are conducted in solution, thereby reducing the interaction period to 5 min without impairing the analytical outcome. Adsorption of immunoglobulins on the surface of magnetic nanoparticles increases their stability in aqueous-organic media, thus minimizing the degree of sample dilution required. Testing barley and maize extracts demonstrated a limit of aflatoxin B1 detection equal to 20 pg/mL and total assay duration of 20 min. Using this method, only the 3-fold dilution of the initial methanol/water (60/40) extraction mixture in the microplate wells is necessary. The proposed pseudo-homogeneous approach could be applied toward immunodetection of a wide range of compounds. PMID:25412219

  6. Comparative study of in vitro prooxidative properties and genotoxicity induced by aflatoxin B1 and its laccase-mediated detoxification products.


    Zeinvand-Lorestani, Hamed; Sabzevari, Omid; Setayesh, Neda; Amini, Mohsen; Nili-Ahmadabadi, Amir; Faramarzi, Mohammad Ali


    In this paper, the enzymatic detoxification of aflatoxin B1 (AFB1) by laccase was studied, and the prooxidant properties and mutagenicity of the detoxification products were compared with those of AFB1. The optimal enzymatic reaction occurred in 0.1M of citrate buffer containing 20% DMSO at 35 °C, a pH of 4.5, and a laccase activity of 30 U mL(-1). After 2 d, sixty-seven percent of the toxic substrate was removed. The prooxidative properties of the detoxified products (27% versus 86%) and the mutagenicity were significantly decreased in comparison with the parent toxin. Unlike AFB1, which promoted metabolism-dependent genetic mutations by base-pair substitution, the detoxified products did not induce genotoxicity. Comparison of the Km values for AFB1 and riboflavin, a valuable food nutrient, indicated that laccase showed greater affinity for the toxin than for riboflavin. PMID:25876029

  7. Hepatitis B virus infection contributes to oxidative stress in a population exposed to aflatoxin B1 and high-risk for hepatocellular carcinoma

    PubMed Central

    Liu, Zhi-Ming; Li, Le-Qun; Peng, Min-Hao; Liu, Tang-Wei; Qin, Zhong; Guo, Ya; Xiao, Kai-Yin; Ye, Xin-Ping; Mo, Xin-Shao; Qin, Xue; Li, Shan; Yan, Lu-Nan; Shen, Han-Ming; Wang, LianWen; Wang, Qiao; Wang, Kai-bo; Liang, Ren-xiang; Wei, Zong-liang; Ong, Choon Nam; Santella, Regina M.; Peng, Tao


    Biomarkers of Hepatitis B Virus (HBV) infection, aflatoxin B1 (AFB1) exposure and oxidative stress were detected in 71 hepatocellular carcinoma (HCC) patients and 694 controls from southern China. Plasma level of AFB1-Albumin-Adducts (AAA) and protein carbonyl content (PCC) were significantly higher in the 71 HCC cases than in any age/gender matched HBV sero-status groups (P<0.001). HCC patients positive for the p53-249 G-T mutation had a marginally higher level of PCC than those negative for the mutation (p=0.077). HBV infection had a prominent influence on the association between AFB1 exposure and oxidative stress biomarkers in the controls. Our study indicates a significant contribution from HBV infection to oxidative stress in a population with AFB1 exposure which might substantially increase risk for HCC in this region. PMID:18280645

  8. Mass spectrometric identification and toxicity assessment of degraded products of aflatoxin B1 and B2 by Corymbia citriodora aqueous extracts

    PubMed Central

    Iram, Wajiha; Anjum, Tehmina; Iqbal, Mazhar; Ghaffar, Abdul; Abbas, Mateen


    This study explores the detoxification potential of Corymbia citriodora plant extracts against aflatoxin B1 and B2 (AFB1; 100 μg L−1 and AFB2; 50 μg L−1) in In vitro and In vivo assays. Detoxification was qualitatively and quantitatively analyzed by TLC and HPLC, respectively. The study was carried out by using different parameters of optimal temperature, pH and incubation time period. Results indicated that C. citriodora leaf extract(s) more effectively degrade AFB1 and AFB2 i.e. 95.21% and 92.95% respectively than C. citriodora branch extract, under optimized conditions. The structural elucidation of degraded toxin products was done by LCMS/MS analysis. Ten degraded products of AFB1 and AFB2 and their fragmentation pathways were proposed based on molecular formulas and MS/MS spectra. Toxicity of these degraded products was significantly reduced as compared to that of parent compounds because of the removal of double bond in the terminal furan ring. The biological toxicity of degraded toxin was further analyzed by brine shrimps bioassay, which showed that only 17.5% mortality in larvae was recorded as compared to untreated toxin where 92.5% mortality was observed after 96hr of incubation. Therefore, our finding suggests that C. citriodora leaf extract can be used as an effective tool for the detoxification of aflatoxins. PMID:26423838

  9. Aflatoxin B1 Detection Using a Highly-Sensitive Molecularly-Imprinted Electrochemical Sensor Based on an Electropolymerized Metal Organic Framework.


    Jiang, Mengjuan; Braiek, Mohamed; Florea, Anca; Chrouda, Amani; Farre, Carole; Bonhomme, Anne; Bessueille, Francois; Vocanson, Francis; Zhang, Aidong; Jaffrezic-Renault, Nicole


    A sensitive electrochemical molecularly-imprinted sensor was developed for the detection of aflatoxin B1 (AFB1), by electropolymerization of p-aminothiophenol-functionalized gold nanoparticles in the presence of AFB1 as a template molecule. The extraction of the template leads to the formation of cavities that are able to specifically recognize and bind AFB1 through π-π interactions between AFB1 molecules and aniline moities. The performance of the developed sensor for the detection of AFB1 was investigated by linear sweep voltammetry using a hexacyanoferrate/hexacyanoferrite solution as a redox probe, the electron transfer rate increasing when the concentration of AFB1 increases, due to a p-doping effect. The molecularly-imprinted sensor exhibits a broad linear range, between 3.2 fM and 3.2 µM, and a quantification limit of 3 fM. Compared to the non-imprinted sensor, the imprinting factor was found to be 10. Selectivity studies were also performed towards the binding of other aflatoxins and ochratoxin A, proving good selectivity. PMID:26371042

  10. Aflatoxin B1 Detection Using a Highly-Sensitive Molecularly-Imprinted Electrochemical Sensor Based on an Electropolymerized Metal Organic Framework

    PubMed Central

    Jiang, Mengjuan; Braiek, Mohamed; Florea, Anca; Chrouda, Amani; Farre, Carole; Bonhomme, Anne; Bessueille, Francois; Vocanson, Francis; Zhang, Aidong; Jaffrezic-Renault, Nicole


    A sensitive electrochemical molecularly-imprinted sensor was developed for the detection of aflatoxin B1 (AFB1), by electropolymerization of p-aminothiophenol-functionalized gold nanoparticles in the presence of AFB1 as a template molecule. The extraction of the template leads to the formation of cavities that are able to specifically recognize and bind AFB1 through π-π interactions between AFB1 molecules and aniline moities. The performance of the developed sensor for the detection of AFB1 was investigated by linear sweep voltammetry using a hexacyanoferrate/hexacyanoferrite solution as a redox probe, the electron transfer rate increasing when the concentration of AFB1 increases, due to a p-doping effect. The molecularly-imprinted sensor exhibits a broad linear range, between 3.2 fM and 3.2 µM, and a quantification limit of 3 fM. Compared to the non-imprinted sensor, the imprinting factor was found to be 10. Selectivity studies were also performed towards the binding of other aflatoxins and ochratoxin A, proving good selectivity. PMID:26371042

  11. Size-dependent modulation of graphene oxide-aptamer interactions for an amplified fluorescence-based detection of aflatoxin B1 with a tunable dynamic range.


    Zhang, JingJing; Li, Zengmei; Zhao, Shancang; Lu, Yi


    Aflatoxin B1 (AFB1) is a common toxin found in many foods. While AFB1 sensors have been reported, few studies have shown amplified detection with tunable dynamic ranges. We herein report a simple and highly sensitive amplified aptamer-based fluorescent sensor for AFB1, which relies on the ability of nano-graphene oxide (GO) to protect aptamers from nuclease cleavage for amplified detection and on the nanometer size effect of GO to tune the dynamic range and sensitivity. The assay was performed by simply mixing the carboxyl-X-rhodamine (ROX)-labeled AFB1 aptamer, the GO, the nuclease, and the AFB1 samples. Modulating the size of the GO nanosheet resulted in three dynamic ranges, i.e., 12.5 to 312.5 ng mL(-1), 1.0 to 100 ng mL(-1), and 5.0 to 50 ng mL(-1), with corresponding limits of detection of 10.0 ng mL(-1), 0.35 ng mL(-1) and 15.0 ng mL(-1), respectively. The sensor was highly selective against other aflatoxins and common molecules in foods, and its performance was verified in corn samples spiked with known concentration of AFB1. PMID:27137348

  12. Mass spectrometric identification and toxicity assessment of degraded products of aflatoxin B1 and B2 by Corymbia citriodora aqueous extracts.


    Iram, Wajiha; Anjum, Tehmina; Iqbal, Mazhar; Ghaffar, Abdul; Abbas, Mateen


    This study explores the detoxification potential of Corymbia citriodora plant extracts against aflatoxin B1 and B2 (AFB1; 100 μg L(-1) and AFB2; 50 μg L(-1)) in In vitro and In vivo assays. Detoxification was qualitatively and quantitatively analyzed by TLC and HPLC, respectively. The study was carried out by using different parameters of optimal temperature, pH and incubation time period. Results indicated that C. citriodora leaf extract(s) more effectively degrade AFB1 and AFB2 i.e. 95.21% and 92.95% respectively than C. citriodora branch extract, under optimized conditions. The structural elucidation of degraded toxin products was done by LCMS/MS analysis. Ten degraded products of AFB1 and AFB2 and their fragmentation pathways were proposed based on molecular formulas and MS/MS spectra. Toxicity of these degraded products was significantly reduced as compared to that of parent compounds because of the removal of double bond in the terminal furan ring. The biological toxicity of degraded toxin was further analyzed by brine shrimps bioassay, which showed that only 17.5% mortality in larvae was recorded as compared to untreated toxin where 92.5% mortality was observed after 96hr of incubation. Therefore, our finding suggests that C. citriodora leaf extract can be used as an effective tool for the detoxification of aflatoxins. PMID:26423838

  13. Biosynthetic relationship among aflatoxins B1, B2, M1, and M2.

    PubMed Central

    Dutton, M F; Ehrlich, K; Bennett, J W


    Aflatoxins are a family of toxic, acetate-derived decaketides that arise biosynthetically through polyhydroxyanthraquinone intermediates. Most studies have assumed that aflatoxin B1 is the biosynthetic precursor of the other aflatoxins. We used a strain of Aspergillus flavus which accumulates aflatoxin B2 to investigate the later stages of aflatoxin biosynthesis. This strain produced aflatoxins B2 and M2 but no detectable aflatoxin B1 when grown over 12 days in a low-salt, defined growth medium containing asparagine. Addition of dichlorvos to this growth medium inhibited aflatoxin production with concomitant accumulation of versiconal hemiacetal acetate. When mycelial pellets were grown for 24, 48, and 72 h in growth medium and then transferred to a replacement medium, only aflatoxin B2 and M2 were recovered after 96 h of incubation. Addition of sterigmatocystin to the replacement medium led to the recovery of higher levels of aflatoxins B2 and M2 than were detected in control cultures, as well as to the formation of aflatoxins B1 and M1 and O-methylsterigmatocystin. These results support the hypothesis that aflatoxins B1 and B2 can arise independently via a branched pathway. PMID:3925881

  14. Product identification and safety evaluation of aflatoxin B1 decontaminated by electrolyzed oxidizing water.


    Xiong, Ke; Liu, Hai jie; Li, Li te


    In this study with aflatoxin-contaminated peanuts, the effectiveness of electrolyzed oxidizing water (EOW) in the decontamination of aflatoxin B(1) was investigated. The aflatoxin B(1) content was markedly reduced upon treatment with EOW, particularly with neutral electrolyzed oxidizing water (NEW). The conversion product of EOW treatment was isolated and identified as 8-chloro-9-hydroxy aflatoxin B(1) (compound 1), which is an amphiphilic molecule, in contrast to fat-soluble aflatoxin B(1). A mutagenic response study revealed that the number of revertants per plate after treatment of bacterial strains TA-97, TA-98, TA-100, and TA-102 with NEW was within the standard value range. The HepG2 cell viability assay yielded an IC(50) value of compound 1 approximately 150 mM. This study indicates that EOW had the ability to decontaminate aflatoxin B(1), and the conversion product, compound 1, did not exhibit mutagenic activity or cytotoxic effects. PMID:22950859

  15. Development of the custom polymeric materials specific for aflatoxin B1 and ochratoxin A for application with the ToxiQuant T1 sensor tool.


    Piletska, Elena; Karim, Kal; Coker, Raymond; Piletsky, Sergey


    Two polymers were computationally designed with affinity to two of the most abundant mycotoxins aflatoxin B1 (AFB1) and ochratoxin A (OTA) for application in the ToxiQuant T1 System. The principle of quantification of AFB1 and OTA using the ToxiQuant T1 instrument comprised of a fluorimetric analysis of mycotoxins adsorbed on the polymer upon exposure to UV light. High affinity of the developed resins allowed the adsorption of both toxins as discrete bands on the top of the cartridge with detection limit as low as 1ng quantity of mycotoxins. PMID:20015499

  16. Transfer of aflatoxin B1 from feed to milk and from milk to curd and whey in dairy sheep fed artificially contaminated concentrates.


    Battacone, G; Nudda, A; Palomba, M; Pascale, M; Nicolussi, P; Pulina, G


    An experiment was carried out using dairy ewes to study the transfer of aflatoxin B1 (AFB1) from feed to milk and from milk to cheese. The effects of AFB1 on liver function and hematological parameters were also investigated. Fifteen ewes were assigned to treatments in replicated 3 x 3 Latin squares. The experimental groups received 32, 64, or 128 microg/d of pure AFB1 for 7 d followed by 5 d of clearance. On the sixth day of the first period, the total daily milk produced by each ewe was collected separately and processed into cheese. The results indicate that the level of AFB1 used did not adversely affect animal health and milk production traits. The aflatoxin M1 (AFM1) concentrations in milk approached a steady-state condition in all treated groups between 2 and 7 d after the start of treatment. The mean AFM1 concentrations of treated groups in steady-state condition (184.4, 324.7, and 596.9 ng/kg in ewes fed 32, 64, or 128 microg of AFB1, respectively) were significantly affected by the AFB1 doses. The AFM1 concentration was linearly related to the AFB1 intake/kg of BW. The carry-over values of AFB1 from feed into AFM1 in milk (0.26 to 0.33%) were not influenced by the AFB1 doses. The AFM1 concentrations in curd and whey were linearly related to the AFM1 concentrations in the unprocessed milk. PMID:16107394

  17. Glutathione-S-transferase A3 knockout mice are sensitive to acute cytotoxic and genotoxic effects of aflatoxin B1

    SciTech Connect

    Ilic, Zoran; Crawford, Dana; Egner, Patricia A.; Sell, Stewart


    Aflatoxin B1 (AFB1) is a major risk factor for hepatocellular carcinoma (HCC) in humans. However, mice, a major animal model for the study of AFB1 carcinogenesis, are resistant, due to high constitutive expression, in the mouse liver, of glutathione S-transferase A3 subunit (mGSTA3) that is lacking in humans. Our objective was to establish that a mouse model for AFB1 toxicity could be used to study mechanisms of toxicity that are relevant for human disease, i.e., an mGSTA3 knockout (KO) mouse that responds to toxicants such as AFB1 in a manner similar to humans. Exons 3-6 of the mGSTA3 were replaced with a neomycin cassette by homologous recombination. Southern blotting, RT-PCR, Western blotting, and measurement of AFB1-N{sup 7}-DNA adduct formation were used to evaluate the mGSTA3 KO mice. The KO mice have deletion of exons 3-6 of the mGSTA3 gene, as expected, as well as a lack of mGSTA3 expression at the mRNA and protein levels. Three hours after injection of 5 mg/kg AFB1, mGSTA3 KO mice have more than 100-fold more AFB1-N{sup 7}-DNA adducts in their livers than do similarly treated wild-type (WT) mice. In addition, the mGSTA3 KO mice die of massive hepatic necrosis, at AFB1 doses that have minimal toxic effects in WT mice. We conclude that mGSTA3 KO mice are sensitive to the acute cytotoxic and genotoxic effects of AFB1, confirming the crucial role of GSTA3 subunit in protection of normal mice against AFB1 toxicity. We propose the mGSTA3 KO mouse as a useful model with which to study the interplay of risk factors leading to HCC development in humans, as well as for testing of additional possible functions of mGSTA3.

  18. Genome-Wide and Differential Proteomic Analysis of Hepatitis B Virus and Aflatoxin B1 Related Hepatocellular Carcinoma in Guangxi, China

    PubMed Central

    Chen, Zhao-Hong; Bai, Tao; Xiang, Bang-De; Qin, Xiao; Xiao, Kai-Yin; Peng, Min-Hao; Liu, Zhi-Ming; Liu, Tang-Wei; Qin, Xue; Li, Shan; Han, Ze-Guang; Mo, Zeng-Nan; Santella, Regina M.; Winkler, Cheryl A.; O’Brien, Stephen J.; Peng, Tao


    Both hepatitis B virus (HBV) and aflatoxin B1 (AFB1) exposure can cause liver damage as well as increase the probability of hepatocellular carcinoma (HCC). To investigate the underlying genetic changes that may influence development of HCC associated with HBV infection and AFB1 exposure, HCC patients were subdivided into 4 groups depending upon HBV and AFB1 exposure status: (HBV(+)/AFB1(+), HBV(+)/AFB1(-), HBV(-)/AFB1(+), HBV(-)/AFB1(-)). Genetic abnormalities and protein expression profiles were analyzed by array-based comparative genomic hybridization and isobaric tagging for quantitation. A total of 573 chromosomal aberrations (CNAs) including 184 increased and 389 decreased were detected in our study population. Twenty-five recurrently altered regions (RARs; chromosomal alterations observed in ≥10 patients) in chromosomes were identified. Loss of 4q13.3-q35.2, 13q12.1-q21.2 and gain of 7q11.2-q35 were observed with a higher frequency in the HBV(+)/AFB1(+), HBV(+)/AFB1(-) and HBV(-)/AFB1(+) groups compared to the HBV(-)/AFB(-) group. Loss of 8p12-p23.2 was associated with high TNM stage tumors (P = 0.038) and was an unfavorable prognostic factor for tumor-free survival (P =0.045). A total of 133 differentially expressed proteins were identified in iTRAQ proteomics analysis, 69 (51.8%) of which mapped within identified RARs. The most common biological processes affected by HBV and AFB1 status in HCC tumorigenesis were detoxification and drug metabolism pathways, antigen processing and anti-apoptosis pathways. Expression of AKR1B10 was increased significantly in the HBV(+)/AFB1(+) and HBV(-)/AFB1(+) groups. A significant correlation between the expression of AKR1B10 mRNA and protein levels as well as AKR1B10 copy number was observered, which suggest that AKR1B10 may play a role in AFB1-related hepatocarcinogenesis. In summary, a number of genetic and gene expression alterations were found to be associated with HBV and AFB1- related HCC. The possible synergistic

  19. Stimulation of Sister Chromatid Exchanges and Mutation by Aflatoxin B1-DNA Adducts in Saccharomyces cerevisiae Requires MEC1 (ATR), RAD53, and DUN1

    PubMed Central

    Fasullo, Michael; Sun, Mingzeng; Egner, Patricia


    The hepatocarcinogen aflatoxin B1 (AFB1) is a potent recombinagen but weak mutagen in the yeast Saccharomyces cerevisiae. AFB1 exposure induces DNA damage-inducible genes, such as RAD51 and those encoding ribonucleotide reductase (RNR), through a MEC1 (ATR homolog)-dependent pathway. Previous studies have indicated that MEC1 is required for both AFB1-associated recombination and mutation, and suggested that AFB1-DNA adducts are common substrates for recombination and mutagenesis. However, little is known about the downstream effectors of MEC1 required for genotoxic events associated with AFB1 exposure. Here we show that AFB1 exposure increases frequencies of RAD51-dependent unequal sister chromatid exchange (SCE) and activates Rad53 (CHK2). We found that MEC1, RAD53, and DUN1 are required for both AFB1-associated mutation and SCE. Deletion of SML1, which encodes an inhibitor of RNR, did not suppress the DUN1-dependent requirement for AFB1-associated genetic events, indicating that higher dNTP levels could not suppress the dun1 phenotype. We identified AFB1-DNA adducts and show that approximately the same number of adducts are obtained in both wild type and rad53 mutants. Since DUN1 is not required for UV-associated mutation and recombination, these studies define a distinct role for DUN1 in AFB1-associated mutagenesis and recombination. We speculate that AFB1-associated DNA adducts stall DNA replication, a consequence of which can either be mutation or recombination. PMID:18228255

  20. Modulation of aflatoxin B1-mediated genotoxicity in primary cultures of human hepatocytes by diindolylmethane, curcumin, and xanthohumols.


    Gross-Steinmeyer, Kerstin; Stapleton, Patricia L; Tracy, Julia H; Bammler, Theo K; Strom, Stephen C; Buhler, Donald R; Eaton, David L


    This study employed cultured human primary hepatocytes to investigate the ability of the putative chemopreventive phytochemicals curcumin (CUR), 3,3'-diindolylmethane (DIM), isoxanthohumol (IXN), or 8-prenylnaringenin (8PN) to reduce DNA adduct formation of the hepatocarcinogen aflatoxin B1 (AFB). Following 48 h of pretreatment, DIM and 8PN significantly increased AFB-DNA adduct levels, whereas CUR and IXN had no effect. DIM greatly enhanced the transcriptional expression of cytochrome P450 (CYP) 1A1 and CYP1A2 mRNA. Glutathione S-transferase mRNAs were not increased by any of the treatments. In vitro enzyme activity assays demonstrated that 8PN and DIM, but not CUR or IXN, inhibited human CYP1A1, CYP1A2, and CYP3A4 activities. To distinguish between treatment effects on transcription versus direct effects on enzyme activity for DIM, we evaluated the effects of pretreatment alone (transcriptional activation) versus cotreatment alone (enzyme inhibition). The results demonstrated that effects on gene expression, but not catalytic activity, are responsible for the observed effects of DIM on AFB-DNA adduct formation. The increase in AFB-DNA damage following DIM treatment may be explained through its substantial induction of CYP1A2 and/or its downregulation of GSTM1, both of which were significant. The increase in DNA damage by DIM raises potential safety risks for dietary supplements of DIM and its precursor indole-3-carbinol. PMID:19770484

  1. An enzyme-free catalytic DNA circuit for amplified detection of aflatoxin B1 using gold nanoparticles as colorimetric indicators.


    Chen, Junhua; Wen, Junlin; Zhuang, Li; Zhou, Shungui


    An enzyme-free biosensor for the amplified detection of aflatoxin B1 has been constructed based on a catalytic DNA circuit. Three biotinylated hairpin DNA probes (H1, H2, and H3) were designed as the assembly components to construct the sensing system (triplex H1-H2-H3 product). Cascaded signal amplification capability was obtained through toehold-mediated strand displacement reactions to open the hairpins and recycle the trigger DNA. By the use of streptavidin-functionalized gold nanoparticles as the signal indicators, the colorimetric readout can be observed by the naked eye. In the presence of a target, the individual nanoparticles (red) aggregate into a cross-linked network of nanoparticles (blue) via biotin-streptavidin coupling. The colorimetric assay is ultrasensitive, enabling the visual detection of trace levels of aflatoxin B1 (AFB1) as low as 10 pM without instrumentation. The calculated limit of detection (LOD) is 2 pM in terms of 3 times standard deviation over the blank response. The sensor is robust and works even when challenged with complex sample matrices such as rice samples. Our sensing platform is simple and convenient in operation, requiring only the mixing of several solutions at room temperature to achieve visible and intuitive results, and holds great promise for the point-of-use monitoring of AFB1 in environmental and food samples. PMID:27119550

  2. Generation of a New Model Rat: Nrf2 Knockout Rats Are Sensitive to Aflatoxin B1 Toxicity.


    Taguchi, Keiko; Takaku, Misaki; Egner, Patricia A; Morita, Masanobu; Kaneko, Takehito; Mashimo, Tomoji; Kensler, Thomas W; Yamamoto, Masayuki



  3. Synergistic effect of black tea and curcumin in improving the hepatotoxicity induced by aflatoxin B1 in rats.


    Alm-Eldeen, Abeer A; Mona, Mohamed H; Shati, Ali A; El-Mekkawy, Haitham I


    Aflatoxin B1 (AFB1) is a toxic compound commonly found as a contaminant in human food. It is carcinogenic due its potential in inducing the oxidative stress and distortion of the most antioxidant enzymes. Since black tea possesses strong antioxidant activity, it protects cells and tissues against oxidative stress. Curcumin (CMN), a naturally occurring agent, has a combination of biological and pharmacological properties that include antioxidant activity. Therefore, the present study was carried out to investigate the possible role of separate and mixed supplementation of black tea extract and CMN in the hepatotoxicity induced by AFB1 in rats. A total of 48: adult male Sprague Dawley rats were randomly divided into eight groups with six rats in each group. Group 1 (normal control) includes rats that received no treatment. Groups 2, 3, and 4 (positive control) include rats that received olive oil, black tea extract, and CMN, respectively. Group 5 includes rats that received AFB1 at a dose of 750 μg/kg body weight (b.w.) dissolved in olive oil. Groups 6, 7, and 8 include rats that received AFB1 along with 2% black tea extract, CMN at a dose of 200 mg/kg b.w., and both black tea extract and CMN at the same previous doses, respectively. After 90 days, biochemical and histopathological examination was carried out for the blood samples and liver tissues. A significant decrease in the antioxidant enzymes and a significant increase in the lipid peroxidation and hydrogen peroxide in the rats treated with AFB1 were observed. Moreover, there were dramatic changes in the liver function biomarkers, lipid profile, and liver architecture. Supplementation of black tea extract or CMN showed an efficient role in repairing the distortion of the biochemical and histological changes induced by AFB1 in liver. This improvement was more pronounced when both CMN and black tea were used together. PMID:23796760

  4. Estimated exposure to zearalenone, ochratoxin A and aflatoxin B1 through the consume of bakery products and pasta considering effects of food processing.


    Bol, Emilli Keller; Araujo, Letícia; Veras, Flávio Fonseca; Welke, Juliane Elisa


    The objective of this research was to estimate the processing effect on mycotoxins levels and the exposure to zearalenone (ZEA), ochratoxin (OTA) and aflatoxin B1 (AFB1) through the consumption of pasta and bakery products. The higher reduction percentage of mycotoxins was observed in cake production (95, 90 and 70% for ZEA, OTA and AFB1, respectively). Bread and biscuit showed similar reduction in mycotoxins levels (89 and 90% for ZEA; 80 and 85% for OTA; 36 and 40% for AFB1, respectively). The lower reduction in the levels of mycotoxins has been observed for pasta (75, 65 and 10% for ZEA, OTA and AFB1, respectively). The consumption of these products could represent 12.6% of the maximum tolerable daily intake of ZEA and 30.5% of the tolerable weekly intake of OTA. The margin of exposure value related to the exposure to AFB1 was 24.6. The exposure to ZEA and OTA through the consumption of bakery products and pasta would not represent risk for consumer health, (although conjugated forms were not determined). However, the exposure to AFB1 represents a risk (even without considering the AFB1-conjugated forms). PMID:26807886

  5. Effects of 3 sequestering agents on milk aflatoxin M1 concentration and the performance and immune status of dairy cows fed diets artificially contaminated with aflatoxin B1.


    Ogunade, I M; Arriola, K G; Jiang, Y; Driver, J P; Staples, C R; Adesogan, A T


    This study examined whether adding 3 mycotoxin-sequestering agents to diets contaminated with aflatoxin B1 (AFB1) would reduce milk aflatoxin M1 (AFM1) concentration, and improve the performance and alter immune status of dairy cows. Fifteen lactating dairy cows were used in an experiment with an incomplete crossover design including four 28-d periods. Treatments included a control diet (C), a toxin diet (T; 1,725µg of AFB1/head per day; 75µg/kg), and diets containing the toxin and 20g/head per day of a proprietary mixture of Saccharomyces cerevisiae fermentation product containing a low (SEQ1) or high (SEQ2) dose of a chlorophyll-based additive, or a low dose of the chlorophyll-based additive and sodium bentonite clay (SEQ3). Sequestering agents were top-dressed on the total mixed ration (TMR) daily in each period, and AFB1 was dosed orally in gelatin capsules before the TMR was fed on d 21 to 25. Milk was sampled twice daily on d 20 to 28 and plasma was sampled on d 20 and 25. Sequestering agents did not affect milk AFM1 concentration during the toxin-dosing period. However, after AFB1 was withdrawn, the sequestering agents reduced the time required (24 vs. 48h) to reduce the milk AFM1 concentration below the Food and Drug Administration action level of 0.5µg/kg. Feeding T instead of C tended to reduce milk and fat-corrected milk yields, but feeding SEQ1 prevented these effects. Red blood cell count and hemoglobin concentration were reduced by feeding T instead of C, but not by feeding SEQ1, SEQ2, or SEQ3. The mean fluorescence intensity of antibody staining for 2 leukocyte adhesion molecules, L-selectin (CD62L) and β-integrin (CD18), tended to be greatest when SEQ1 and SEQ3 were fed. Plasma acid-soluble protein concentration was decreased by feeding SEQ1, SEQ2, and SEQ3 instead of T. Sequestering agents had no effect on milk AFM1 concentration, but they reduced the time required to reduce milk AFM1 concentration to a safe level after withdrawal of AFB1 from

  6. Fractionation of radioactivity in the milk of goats administered UC-aflatoxin B1

    SciTech Connect

    Goto, T.; Hsieh, D.P.


    A detailed fractionation of radioactivity in the milk of goats administered UC-aflatoxin B1 at low doses was performed. The milk collected in the first 24 h following dosing contained radioactivity equivalent to 0.45-1.1% of the dose given. The radioactivity in each sample was partitioned into 4 fractions: ether, protein, dichloromethane, and water-alcohol. Over 80% of the radioactivity was detected in the dichloromethane fraction, of which over 95% was attributable to aflatoxin M1. No aflatoxin B1 or other known aflatoxin metabolites were detected in any fraction. The results indicate that the major metabolite of aflatoxin B1 in goat milk is aflatoxin M1 and that other metabolites, including conjugates, are of minor significance.

  7. Removal of aflatoxin B1-DNA adducts and in vitro transformation in mouse embryo fibroblasts C3H/10T1 1/2

    SciTech Connect

    Amstad, P.A.; Wang, T.V.; Cerutti, P.A.


    The mechanism of in vitro transformation of the mouse embryo fibroblast C3H/10T 1/2 clone 8 by aflatoxin B1 (AFB1) was studied in confluent holding (CH) experiments. Confluent cultures of C3H/10T 1/2 cells were treated with AFB1 for 16 hours, and the DNA adduct composition and concentration were determined by chromatographic procedures after 0, 8, 16, and 40 hours of CH when the cells were replated at low density for the expression of their colony-forming ability and the formation of transformed foci. Total adduct concentration and the concentration of the major primary adduct 2,3-dihydro-2-(N7-guanyl)-3-hydroxyaflatoxin B1 (AFB1-N7-Gua) decreased continuously during CH due to spontaneous decomposition and probably also due to enzymatic repair processes. In contrast, the more chemically stable secondary product 2,3-dihydro-2-(N5-formyl-2',5',6'-triamino-4'-oxo-N5-pyrimidyl)-3-hydroxyaflatoxin B1 (AFB1-triamino-Py) accumulated in the DNA and reached its maximum concentration after 16 hours of CH. While the loss of total AFB1-DNA adducts during CH was reflected in recovery of viability, the potential to form transformed foci reached a maximum after 16 hours of CH and then decreased with continued CH below the initial value. Therefore, no simple relationship exists between the concentration of the total adducts AFB1-N7-Gua and AFB1-triamino-Py at the time of release from CH and the potential to form transformed foci. However, DNA lesions or abnormal DNA configurations formed during CH as a consequence of the cellular processing of AFB1-DNA adducts may play a role in the transformation process.

  8. Biotransformation of aflatoxin B1 and aflatoxin G1 in peanut meal by anaerobic solid fermentation of Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus.


    Chen, Yujie; Kong, Qing; Chi, Chen; Shan, Shihua; Guan, Bin


    The purpose of this study was to explore the ability of anaerobic solid fermentation of Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus to biotransform aflatoxins in peanut meal. The pH of the peanut meal was adjusted above 10, and then heated for 10 min at 100 °C, 115 °C and 121 °C. The S. thermophilus and L. delbrueckii subsp. bulgaricus were precultured together in MRS broth for 48 h at 37 °C. The heated peanut meal was mixed with precultured MRS broth containing 7.0×10(8) CFU/mL of S. thermophilus and 3.0×10(3) CFU/mL of L. delbrueckii subsp. bulgaricus with the ratio of 1 to 1 (weight to volume) and incubated in anaerobic jars at 37 °C for 3 days. The aflatoxin content in the peanut meal samples was determined by HPLC. The results showed that the peanut meal contained mainly aflatoxin B1 (AFB1) (10.5±0.64 μg/kg) and aflatoxin G1 (AFG1) (18.7±0.55 μg/kg). When heat treatment was combined with anaerobic solid fermentation, the biotransformation rate of aflatoxins in peanut meal could attain 100%. The cytotoxicity of fermented peanut meal to L929 mouse connective tissue fibroblast cells was determined by MTT assay and no significant toxicity was observed in the fermented peanut meal. Furthermore, heat treatment and anaerobic solid fermentation did not change the amino acid concentrations and profile in peanut meal. PMID:26143229

  9. Structural Analysis and Biological Toxicity of Aflatoxins B1 and B2 Degradation Products Following Detoxification by Ocimum basilicum and Cassia fistula Aqueous Extracts.


    Iram, Wajiha; Anjum, Tehmina; Iqbal, Mazhar; Ghaffar, Abdul; Abbas, Mateen; Khan, Abdul Muqeet


    This study showed the comparison between Ocimum basilicum and Cassia fistula (leaves and branch) aqueous extracts for their ability to detoxify of aflatoxins B1 and B2 (AFB1; 100 μg L(-1) and AFB2; 50 μg L(-1)) by In Vitro assays and decontamination studies. Results indicated that O. basilicum leaves extract was found to be highly significant (P < 0.05) in degrading AFB1 and AFB2, i.e., 90.4 and 88.6%, respectively. However, O. basilicum branch, C. fistula leaves and branch extracts proved to be less efficient in degrading these aflatoxins, under optimized conditions, i.e., pH 8, temperature 30°C and incubation period of 72 h. Moreover the antifungal activity of these plants extracts were also tested. The findings depicted that O. basilicum leaves extract showed maximum growth inhibition of aflatoxigenic isolates, i.e., 82-87% as compared to other tested plants extracts. The structural elucidation of degraded toxin products by LCMS/MS analysis showed that nine degraded products of AFB1 and AFB2 were formed. MS/MS spectra showed that most of the products were formed by the removal of double bond in the terminal furan ring and modification of lactone group indicating less toxicity as compared to parent compounds. Brine shrimps bioassay further confirmed the low toxicity of degraded products, showing that O. basilicum leaves extract can be used as an effective tool for the detoxification of aflatoxins. PMID:27471501

  10. Structural Analysis and Biological Toxicity of Aflatoxins B1 and B2 Degradation Products Following Detoxification by Ocimum basilicum and Cassia fistula Aqueous Extracts

    PubMed Central

    Iram, Wajiha; Anjum, Tehmina; Iqbal, Mazhar; Ghaffar, Abdul; Abbas, Mateen; Khan, Abdul Muqeet


    This study showed the comparison between Ocimum basilicum and Cassia fistula (leaves and branch) aqueous extracts for their ability to detoxify of aflatoxins B1 and B2 (AFB1; 100 μg L-1 and AFB2; 50 μg L-1) by In Vitro assays and decontamination studies. Results indicated that O. basilicum leaves extract was found to be highly significant (P < 0.05) in degrading AFB1 and AFB2, i.e., 90.4 and 88.6%, respectively. However, O. basilicum branch, C. fistula leaves and branch extracts proved to be less efficient in degrading these aflatoxins, under optimized conditions, i.e., pH 8, temperature 30°C and incubation period of 72 h. Moreover the antifungal activity of these plants extracts were also tested. The findings depicted that O. basilicum leaves extract showed maximum growth inhibition of aflatoxigenic isolates, i.e., 82–87% as compared to other tested plants extracts. The structural elucidation of degraded toxin products by LCMS/MS analysis showed that nine degraded products of AFB1 and AFB2 were formed. MS/MS spectra showed that most of the products were formed by the removal of double bond in the terminal furan ring and modification of lactone group indicating less toxicity as compared to parent compounds. Brine shrimps bioassay further confirmed the low toxicity of degraded products, showing that O. basilicum leaves extract can be used as an effective tool for the detoxification of aflatoxins. PMID:27471501

  11. Organophilic treatments of bentonite increase the adsorption of aflatoxin B1 and protect stem cells against cellular damage.


    Nones, Janaína; Nones, Jader; Poli, Anicleto; Trentin, Andrea Gonçalves; Riella, Humberto Gracher; Kuhnen, Nivaldo Cabral


    Bentonite clays exhibit high adsorptive capacity for contaminants, including aflatoxin B1 (AFB1), a mycotoxin responsible for causing severe toxicity in several species including pigs, poultry and man. Organophilic treatments is known to increase the adsorption capacity of bentonites, and the primary aim of this study was to evaluate the ability of Brazilian bentonite and two organic salts - benzalkonium chloride (BAC) and cetyltrimethylammonium bromide (CTAB) to adsorb AFB1. For this end, 2(2) factorial designs were used in order to analyze if BAC or CTAB was able to increase AFB1 adsorption when submitted in different temperature and concentration. Both BAC and CTAB treatment (at 30°C and 2% of salt concentration) were found to increase the adsorption of AFB1 significantly compared with untreated bentonite. After organophilic bentonite treatments with BAC or CTAB, a vibration of CH stretch (2850 and 2920cm(-1)) were detected. A frequency of the SiO stretch (1020 and 1090cm(-1)) was changed by intercalation of organic cation. Furthermore, the interlayer spacing of bentonite increases to 1.23nm (d001 reflection at 2θ=7.16) and 1.22 (d001 reflection at 2θ=7.22) after the addition of BAC and CTAB, respectively. Another aim of the study was to observe the effects of these two bentonite salts in neural crest stem cell cultures. The two materials that were created by organophilic treatments were not found to be toxic to stem cells. Furthermore the results indicate that the two materials tested may protect the neural crest stem cells against damage caused by AFB1. PMID:27281241

  12. In vitro and in vivo temperature modulation of hepatic metabolism and DNA adduction of aflatoxin B1 in rainbow trout.


    Carpenter, H M; Zhang, Q; el Zahr, C; Selivonchick, D P; Brock, D E; Curtis, L R


    Alterations in membrane lipid composition during temperature acclimation of poikilotherms is hypothesized to compensate for direct effects of temperature on membrane fluidity. Temperature also influences disposition and actions of some xenobiotics. This suggests the potential for complex interactions between temperature and metabolism of chemical carcinogens. Whole livers and hepatic microsomes from rainbow trout acclimated at 18 degrees C have more saturated fatty acids and less mono- and polyunsaturated fatty acids than those from fish acclimated at 10 degrees C. Such changes are consistent with a role for membrane lipid fluidity in temperature compensation. When 10 and 18 degrees C acclimated fish are ip injected with 0.4 mg/kg [3H]aflatoxin B1 (AFB1) at their respective acclimation temperatures, hepatic disposition of AFB1, DNA adduction, and biliary metabolites are similar. An acute shift of 18 degrees C acclimated trout to 14 degrees C reduces [3H]AFB-DNA adduct formation, while [3H]AFB1 adduction after acute shift of 10 degrees C acclimated fish to 14 degrees C is no different than in non-shifted fish. Hepatic microsomes isolated from 10 or 18 degrees C acclimated trout, incubated with 10 microM [3H]AFB1 and calf thymus DNA between 6 and 22 degrees C exhibit no differences in the "break points" of Arrhenius plots (16 degrees C in both groups). There is, however, more in vitro DNA adduction of [3H]AFB1 by microsomes from 18 degrees C acclimated fish, a difference abolished by 0.5 mM alpha-naphthoflavone (ANF). These results suggest that temperature acclimation of trout differentially modifies activities of cytochrome P-450 isozymes. When assayed at respective acclimation temperatures, hepatic cytosol from 18 degrees C fish produces more aflatoxicol, a detoxication product of AFB1, than cytosol from 10 degree C fish. Therefore, this soluble enzyme does not exhibit ideal temperature compensation. Such temperature-induced differences in microsomal cytochrome P

  13. Determination of aflatoxin B1 in cereals by homogeneous liquid-liquid extraction coupled to high performance liquid chromatography-fluorescence detection.


    Sheijooni-Fumani, Neda; Hassan, Jalal; Yousefi, Seyed R


    A simple and rapid method based on homogeneous liquid-liquid extraction coupled to HPLC with fluorescence detection was developed for the determination of aflatoxin B1 (AFB1) in the rice and grain samples after post-column derivatization. The proposed method eliminated the use of immunoaffinity columns for clean-up in the determination of AFB1. The parameters affecting recovery and preconcentration such as type and volume of organic solvent, volume ratio of water/methanol, concentration of phase separator reagent and extraction time were optimized. Under the optimized conditions, the calibration graph was linear in the concentration range of 0.01-1.0 ng/g with the detection limit of 0.003 ng/g. This method was successfully applied for the analysis of AFB1 in different cereal samples. PMID:21491592

  14. An in vitro study of alkaline phosphatase sensitivity to mixture of aflatoxin B1 and fumonisin B1 in the hepatopancreas of coastal lagoon wild and farmed shrimp Litopenaeus vannamei.


    Pérez-Acosta, Jesús A; Burgos-Hernandez, Armando; Velázquez-Contreras, Carlos A; Márquez-Ríos, Enrique; Torres-Arreola, Wilfrido; Arvizu-Flores, Aldo A; Ezquerra-Brauer, J Marina


    This study aimed to establish the combined effect of aflatoxin B1 (AFB1) and fumonisin B1 (FB1) on wild Litopenaeus vannamei hepatopancreas alkaline phosphatase (AP) activity compared with that of farmed shrimp. AP activity in hepatopancreas extract was confirmed by several specific inhibitor assays. AP activity of wild shrimp was higher than that of farmed shrimp (p < 0.05). However, AP activity from both wild and farmed shrimp was inhibited when incubated with AFB1 and FB1. The greatest inhibition occurred when AP was incubated with a mixture of AFB1 and FB1. The IC50 for AFB1 on AP activity of wild and farmed shrimp hepatopancreases was 0.790 and 0.398 μg/mL, respectively. The IC50 of FB1 was 0.87 μg/mL for wild shrimp and 0.69 μg/mL for farmed shrimp. These results suggest that, at the mycotoxins concentrations used in the study, AP from farmed L. vannamei was sensitive to the presence of both mycotoxins; however, AP is more sensitive to the combination of AFB1 + FB1 suggesting a possible synergistic or potentiating inhibitory effect. PMID:27040818

  15. Metabolomics of the Bio-Degradation Process of Aflatoxin B1 by Actinomycetes at an Initial pH of 6.0

    PubMed Central

    Eshelli, Manal; Harvey, Linda; Edrada-Ebel, RuAngelie; McNeil, Brian


    Contamination of food and feed by Aflatoxin B1 (AFB1) is a cause of serious economic and health problems. Different processes have been used to degrade AFB1. In this study, biological degradation of AFB1 was carried out using three Actinomycete species, Rhodococcus erythropolis ATCC 4277, Streptomyces lividans TK 24, and S. aureofaciens ATCC 10762, in liquid cultures. Biodegradation of AFB1 was optimised under a range of temperatures from 25 to 40 °C and pH values of 4.0 to 8.0. An initial concentration of 20 µg/mL of AFB1 was used in this study. The amount of AFB1 remaining was measured against time by thin layer chromatography (TLC) and high-performance liquid chromatography (HPLC), coupled with UV and mass spectrometry (LC-MS). All species were able to degrade the AFB1, and no significant difference was found between them. AFB1 remained in the liquid culture for R. erythropolis, S. lividans and S. aureofaciens were 0.81 µg/mL, 2.41 µg/mL and 2.78 µg/mL respectively, at the end of the first 24 h. Degradation occurred at all incubation temperatures and the pH with the optimal conditions for R. erythropolis was achieved at 30 °C and pH 6, whereas for S. lividans and S. aureofaciens the optimum conditions for degradation were 30 °C and pH 5. Analysis of the degradative route indicated that each microorganism has a different way of degrading AFB1. The metabolites produced by R. erythropolis were significantly different from the other two microorganisms. Products of degradation were identified through metabolomic studies by utilizing high-resolution mass spectral data. Mass spectrometric analysis indicated that the degradation of AFB1 was associated with the appearance of a range of lower molecular weight compounds. The pathway of degradation or chemical alteration of AFB1 was followed by means of high resolution Fourier transform mass spectrometry (HR-FTMS) analysis as well as through the MS2 fragmentation to unravel the degradative pathway for AFB1. AFB1 bio

  16. The ultrastructural features of aflatoxin B1-induced lesions in the rat liver.

    PubMed Central

    Pritchard, D. J.; Butler, W. H.


    Hepatocellular carcinoma was induced in rats by administering aflatoxin B1 (AFB1) for 6 weeks. Malignant tumours were preceded by foci and nodules of altered hepatocytes. The ultrastructural characteristics of the nodular lesions have been studied and compared with those of the hepatocellular carcinoma cells. Alterations in the endoplasmic reticulum, junctional complexes and nuclei were common to both the basophilic and eosinophilic nodular cells and the carcinoma cells. These most likely represent hyperplastic changes rather than malignant alterations. The eosinophilic nodules were distinguished from other lesions by the abundance of concentric, membranous whorls in the cytoplasm of nodular cells. These cytoplasmic structures were also present in some hepatocellular carcinoma cells. The observations provided further evidence suggesting that the eosinophilic nodule, rather than the basophilic nodule, may play a role in the development of malignancy in the rat liver. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 Fig. 7 Fig. 8 Fig. 9 Fig. 10 Fig. 11 Fig. 12 PMID:3146339

  17. Efficiency of hydrated sodium calcium aluminosilicate to ameliorate the adverse effects of graded levels of aflatoxin B1 in broiler chicks.


    Chen, X; Horn, N; Applegate, T J


    The objective of this study was to evaluate the efficiency of a hydrated sodium calcium aluminosilicate (HSCAS) adsorbent to ameliorate the adverse effects of 0.5 to 2 mg of aflatoxin B1 (AFB1)/kg in broiler chicks. The study consisted of 8 dietary treatments, including 4 concentrations of AFB1 (0, 0.5, 1, and 2 mg/kg) with or without HSCAS (0.5%) fed to 8 replicate cages per diet (6 males chicks per cage) from 0 to 21 d of age. Cumulative feed intake, BW gain (P < 0.0001), and G:F (P = 0.004) of birds fed the 2 mg of AFB1/kg of diet were significantly lower in comparison with birds fed 0 to 1 mg of AFB1/kg. Relative liver weight was increased in the 2 mg of AFB1/kg group (P < 0.0001). Dietary HSCAS improved cumulative BW gain (main effect P = 0.06), particularly from 14 to 21 d of age (P = 0.037). Dietary HSCAS also reversed the increase in relative liver weight for birds fed AFB1 (P = 0.019). Dietary AFB1 negatively affected major serum parameters (albumin, total protein, globulin, phosphorus, glucose, alkaline phosphatase, and creatine phosphokinase), whereas supplementation with HSCAS partially alleviated the affected serum biochemistry. In addition, serum complement activity and liver gene expression were negatively affected by 2 mg of AFB1/kg. The HSCAS supplement increased the liver expression of catalase and superoxide dismutase (P < 0.05). Results from this study indicate that dietary supplementation with HSCAS can effectively improve BW gain and partially ameliorate aflatoxicosis for broiler chicks fed AFB1-contaminated feeds. PMID:24894529

  18. Suppression of aflatoxin B1- or methyl methanesulfonate-induced chromosome aberrations in rat bone marrow cells after treatment with S-methyl methanethiosulfonate.


    Ito, Y; Nakamura, Y; Nakamura, Y


    The suppressive effect of S-methyl methanethiosulfonate (MMTS) on aflatoxin B1 (AFB1)- or methyl methanesulfonate (MMS)-induced chromosome aberrations (CA) in rat bone marrow cells was studied. MMTS significantly suppressed CA induced by both AFB1 (an indirect-acting carcinogen) and MMS (a direct-acting carcinogen). Suppression was observed at all periods (6, 12, 18, 24 and 48 h) after AFB1 or MMS treatment and in all doses of AFB1 (5, 10 and 20 mg/kg) or MMS (50, 75 and 100 mg/kg) investigated. AFB1-induced CA was potently suppressed by MMTS given between 2 h before and 6 h after the AFB1 injection. The suppression of AFB1-induced CA by MMTS paralleled the dose of MMTS when MMTS was given in a dose range of 1-20 mg/kg body weight. MMS-induced CA was potently suppressed by MMTS given between 2 h before and 2 h after the MMS injection. The suppressive effect of MMTS on MMS-induced CA paralleled the dose of MMTS when MMTS was given in a dose range of 1-15 mg/kg body weight. Diphenyl disulfide, which modifies -SH groups in proteins like MMTS, also significantly suppressed both AFB1- and MMS-induced CA. Although other mechanisms are not excluded, the suppression of carcinogen-induced CA by MMTS may result from the ability of MMTS to modify -SH groups in proteins. The juices of cabbage and onion, which contain considerable amounts of MMTS and S-methyl-L-cysteinesulfoxide (the precursor of MMTS), also significantly suppressed AFB1- or MMS-induced CA. These results suggest that MMTS is a possible chemopreventive agent against cancer. PMID:9393623

  19. A SERS-active sensor based on heterogeneous gold nanostar core-silver nanoparticle satellite assemblies for ultrasensitive detection of aflatoxinB1

    NASA Astrophysics Data System (ADS)

    Li, Aike; Tang, Lijuan; Song, Dan; Song, Shanshan; Ma, Wei; Xu, Liguang; Kuang, Hua; Wu, Xiaoling; Liu, Liqiang; Chen, Xin; Xu, Chuanlai


    A surface-enhanced Raman scattering (SERS) sensor based on gold nanostar (Au NS) core-silver nanoparticle (Ag NP) satellites was fabricated for the first time to detect aflatoxinB1 (AFB1). We constructed the SERS sensor using AFB1 aptamer (DNA1)-modified Ag satellites and a complementary sequence (DNA2)-modified Au NS core. The Raman label (ATP) was modified on the surface of Ag satellites. The SERS signal was enhanced when the satellite NP was attached to the Au core NS. The AFB1 aptamer on the surface of Ag satellites would bind to the targets when AFB1 was present in the system, Ag satellites were then removed and the SERS signal decreased. This SERS sensor showed superior specificity for AFB1 and the linear detection range was from 1 to 1000 pg mL-1 with the limit of detection (LOD) of 0.48 pg mL-1. The excellent recovery experiment using peanut milk demonstrated that the sensor could be applied in food and environmental detection.A surface-enhanced Raman scattering (SERS) sensor based on gold nanostar (Au NS) core-silver nanoparticle (Ag NP) satellites was fabricated for the first time to detect aflatoxinB1 (AFB1). We constructed the SERS sensor using AFB1 aptamer (DNA1)-modified Ag satellites and a complementary sequence (DNA2)-modified Au NS core. The Raman label (ATP) was modified on the surface of Ag satellites. The SERS signal was enhanced when the satellite NP was attached to the Au core NS. The AFB1 aptamer on the surface of Ag satellites would bind to the targets when AFB1 was present in the system, Ag satellites were then removed and the SERS signal decreased. This SERS sensor showed superior specificity for AFB1 and the linear detection range was from 1 to 1000 pg mL-1 with the limit of detection (LOD) of 0.48 pg mL-1. The excellent recovery experiment using peanut milk demonstrated that the sensor could be applied in food and environmental detection. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr08372a

  20. An ethoxyquin-inducible aldehyde reductase from rat liver that metabolizes aflatoxin B1 defines a subfamily of aldo-keto reductases.

    PubMed Central

    Ellis, E M; Judah, D J; Neal, G E; Hayes, J D


    Protection of liver against the toxic and carcinogenic effects of aflatoxin B1 (AFB1) can be achieved through the induction of detoxification enzymes by chemoprotectors such as the phenolic antioxidant ethoxyquin. We have cloned and sequenced a cDNA encoding an aldehyde reductase (AFB1-AR), which is expressed in rat liver in response to dietary ethoxyquin. Expression of the cDNA in Escherichia coli and purification of the recombinant enzyme reveals that the protein exhibits aldehyde reductase activity and is capable of converting the protein-binding dialdehyde form of AFB1-dihydrodiol to the nonbinding dialcohol metabolite. We show that the mRNA encoding this enzyme is markedly elevated in the liver of rats fed an ethoxyquin-containing diet, correlating with acquisition of resistance to AFB1. AFB1-AR represents the only carcinogen-metabolizing aldehyde reductase identified to date that is induced by a chemoprotector. Alignment of the amino acid sequence of AFB1-AR with other known and putative aldehyde reductases shows that it defines a subfamily within the aldo-keto reductase superfamily. Images Fig. 2 Fig. 3 Fig. 4 PMID:8234296

  1. Hetero-enzyme-based two-round signal amplification strategy for trace detection of aflatoxin B1 using an electrochemical aptasensor.


    Zheng, Wanli; Teng, Jun; Cheng, Lin; Ye, Yingwang; Pan, Daodong; Wu, Jingjing; Xue, Feng; Liu, Guodong; Chen, Wei


    An electrochemical aptasensor for trace detection of aflatoxin B1 (AFB1) was developed by using an aptamer as the recognition unit while adopting the telomerase and EXO III based two-round signal amplification strategy as the signal enhancement units. The telomerase amplification was used to elongate the ssDNA probes on the surface of gold nanoparticles, by which the signal response range of the signal-off model electrochemical aptasensor could be correspondingly enlarged. Then, the EXO III amplification was used to hydrolyze the 3'-end of the dsDNA after the recognition of target AFB1, which caused the release of bounded AFB1 into the sensing system, where it participated in the next recognition-sensing cycle. With this two-round signal amplified electrochemical aptasensor, target AFB1 was successfully measured at trace concentrations with excellent detection limit of 0.6*10(-4)ppt and satisfied specificity due to the excellent affinity of the aptamer against AFB1. Based on this designed two-round signal amplification strategy, both the sensing range and detection limit were greatly improved. This proposed ultrasensitive electrochemical aptasensor method was also validated by comparison with the classic instrumental methods. Importantly, this hetero-enzyme based two-round signal amplified electrochemical aptasensor offers a great promising protocol for ultrasensitive detection of AFB1 and other mycotoxins by replacing the core recognition sequence of the aptamer. PMID:26896792

  2. Alleviation of aflatoxin B1-induced oxidative stress in HepG2 cells by volatile extract from Allii Fistulosi Bulbus.


    Lee, Joon-Kyoung; Choi, Eun Hye; Lee, Kwang-Geun; Chun, Hyang Sook


    The volatile extract from Allii Fistulosi Bulbus (VEAF) was isolated by steam distillation under reduced pressure, followed by continuous liquid-liquid extraction, and its effects on aflatoxin B1 (AFB1)-induced oxidative stress were investigated in human hepatoma cells (HepG2). The main constituents of the VEAF, identified by gas chromatography/mass spectrometry, were 2-octyl-5-methyl-3(2H)-furanone, 2-hexyl-5-methyl-3(2H)-furanone, 2,5-dimethylthiophene, 3,5-diethyl-1,2,4-trithiolane and 3,4-dimethyl-2,5-dihydro-thiophene-2-one. VEAF significantly inhibited the formation of intracellular reactive oxygen species caused by AFB1 in a dose-dependent manner, concomitant with a significant decrease in the AFB1-induced cytotoxicity. VEAF pretreatment significantly reduced the levels of thiobarbituric acid reactive substances, an indicator of lipid peroxidation, whereas increased the level of reduced glutathione. The level of 8-hydroxy-2'-deoxyguanosine, a DNA oxidative stress marker, was also decreased by 49-59% with pretreatment of VEAF. With respect to the activity of AFB1 metabolizing enzymes, VEAF significantly increased the activity of glutathione S-transferase, and significantly decreased the cytochrome (CYP) P450 3A4 activity, but had a little effect on the CYP1As. These results suggest that VEAF may be selectively effective in alleviating the AFB1-induced oxidative stress, and lead to cytoprotection against AFB1 exposure. PMID:15970298

  3. Comparative Hepatotoxicity of Aflatoxin B1 among Workers Exposed to Different Organic Dust with Emphasis on Polymorphism Role of Glutathione S-Transferase Gene

    PubMed Central

    Saad-Hussein, Amal; Shahy, Eman M.; Shaheen, Weam; Taha, Mona M.; Mahdy-Abdallah, Heba; Ibrahim, Khadiga S.; Hafez, Salwa F.; Fadl, Nevein N.; El-Shamy, Karima A.


    AIM: The study aimed to investigate effects of organic dust exposure from different sources on aflatoxin B1-albumin adducts (AFB1/Alb), and role of glutathione S-transferase (GST) gene polymorphism in hepatotoxicity of (AFB1) among exposed workers. MATERIAL AND METHODS: Liver enzymes, AFB1/Alb, and GST polymorphism were estimated in 132 wheat flour dust and 87 woods sawmill workers, and 156 controls. RESULTS: Results revealed that AFB1/Alb and liver enzymes were significantly elevated in exposed workers compared to controls, and were significantly higher in sawmill workers compared to flour workers. AFB1/Alb in flour and sawmill workers with GSTT1 and GSTM1&GSTT1 null genotypes were significantly higher than controls, and in sawmill workers with GSTM1&GSTT1 null than flour workers. Liver enzymes (ALT and AST) in sawmill workers were significantly higher than flour workers and controls in all GST polymorphism; except in GSTT1 polymorphism, where these enzymes were significantly higher in the two exposed groups than controls. CONCLUSIONS: In conclusion, organic dust exposure may cause elevation in AFB1/Alb and liver enzymes of exposed workers, and GST gene polymorphism plays an important role in susceptibility to hepatic parenchymal cell injury; except in workers with GSTT1&GSTM1 null genotype, gene susceptibility seemed to have little role and the main role was for environmental exposures. PMID:27335608

  4. A novel electrochemical immunosensor for highly sensitive detection of aflatoxin B1 in corn using single-walled carbon nanotubes/chitosan.


    Zhang, Xian; Li, Chao-Rui; Wang, Wei-Cheng; Xue, Jian; Huang, Ya-Ling; Yang, Xian-Xian; Tan, Bin; Zhou, Xi-Peng; Shao, Chuang; Ding, Shi-Jia; Qiu, Jing-Fu


    A sensitive electrochemical immunosensor for aflatoxin B1 (AFB1) detection based on single-walled carbon nanotubes/chitosan was presented. The immunosensor was based on an indirect competitive binding to a fixed amount of anti-AFB1 between free AFB1 and AFB1-bovine serum albumin, which conjugate immobilized on covalently functionalized nanotubes/chitosan laid on the glass carbon electrode. Then, the anti-mouse immunoglobulin G secondary antibody labeled with alkaline phosphatase was bound to the electrode surface through reacting with primary antibody. Finally, alkaline phosphatase catalyzes the hydrolysis of the substrate α-naphthyl phosphate, which produced electrochemical signal. Compared with conventional methods, the established immunosensor was more sensitive and simple. Under optimal conditions, this method could quantitatively detect AFB1 from 0.01 to 100 ng mL(-1) with a detection limit of 3.5 pg mL(-1). Moreover, the immunosensor was successfully applied to assay AFB1 in corn powder, which showed good correlation with the results obtained from high performance liquid chromatography. PMID:26304338

  5. Boric acid: a potential chemoprotective agent against aflatoxin b1 toxicity in human blood

    PubMed Central

    Geyikoglu, Fatime


    Aflatoxin B1 is the most potent pulmonary and hepatic carcinogen. Since the eradication of Aflatoxin B1 contamination in agricultural products has been difficult, the use of natural or synthetic free radical scavengers could be a potential chemopreventive strategy. Boric acid is the major component of industry and its antioxidant role has recently been reported. The present study assessed, for the first time, the effectiveness of boric acid following exposure to Aflatoxin B1 on human whole blood cultures. The biochemical characterizations of glutathione and some enzymes have been carried out in erythrocytes. Alterations in malondialdehyde level were determined as an index of oxidative stress. The sister-chromatid exchange and micronucleus tests were performed to assess DNA damages in lymphocytes. Aflatoxin B1 treatment significantly reduced the activities of antioxidants by increasing malondialdehyde level (30.53 and 51.43%) of blood, whereas, the boric acid led to an increased resistance of DNA to oxidative damage induced by Aflatoxin B1 in comparison with control values (P < 0.05). In conclusion, the support of boric acid was especially useful in Aflatoxin-toxicated blood. Thus the risk on tissue targeting of Aflatoxin B1 could be reduced ensuring early recovery from its toxicity. PMID:20431944

  6. Effect of sample size in the evaluation of "in-field" sampling plans for aflatoxin B(1) determination in corn.


    Brera, Carlo; De Santis, Barbara; Prantera, Elisabetta; Debegnach, Francesca; Pannunzi, Elena; Fasano, Floriana; Berdini, Clara; Slate, Andrew B; Miraglia, Marina; Whitaker, Thomas B


    Use of proper sampling methods throughout the agri-food chain is crucial when it comes to effectively detecting contaminants in foods and feeds. The objective of the study was to estimate the performance of sampling plan designs to determine aflatoxin B(1) (AFB(1)) contamination in corn fields. A total of 840 ears were selected from a corn field suspected of being contaminated with aflatoxin. The mean and variance among the aflatoxin values for each ear were 10.6 mug/kg and 2233.3, respectively. The variability and confidence intervals associated with sample means of a given size could be predicted using an equation associated with the normal distribution. Sample sizes of 248 and 674 ears would be required to estimate the true field concentration of 10.6 mug/kg within +/-50 and +/-30%, respectively. Using the distribution information from the study, operating characteristic curves were developed to show the performance of various sampling plan designs. PMID:20608734

  7. Aspergillus flavus Aflatoxin Occurrence and Expression of Aflatoxin Biosynthesis Genes in Soil

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The carcinogen, aflatoxin B1 (AFB1) produced by Aspergillus flavus, is a major food safety concern in crops. However, information on AFB1 occurrence in soil and crop residue is scarce. A series of experiments investigated the occurrence of AFB1 in soil and corn residues, and ascertained the ecology ...

  8. [Determination of aflatoxin B1, B2, G1, G2 in armeniacae semen amarum by high-performance liquid chromatography-tandem mass spectrometry].


    Zheng, Run-Sheng; Xu, Hui; Wang, Wen-Li; Zhan, Ruo-Ting; Chen, Wei-Wen


    A simple, rapid and cost-effective high-performance liquid chromatography-tandem mass spectrometry (LC-MS/ MS) method was established for simultaneous determination of aflatoxins (AFB1, AFB2, AFG1, AFG2) in Armeniacae Semen Amarum and the application was performance in 11 samples collected from different markets, medical stores and hospitals. The sample was extracted with 84% acetonitrile/water and 250 microL extraction was directly injected into a LC-MS/MS system without further purification procedure after being redissolved with methanol. The LC separation was performed on a C18 column with a linear gradient elution program of 4 mmol x L(-1) NH4 Ac-0.1% formic acid solution and menthol as the mobile phase. Selected reaction monitoring (SRM) was used for selective determination of the four aflatoxins on a triple quadruple mass spectrometer, which was operated in positive ionization modes. All the four aflatoxins showed a good linear relationship with r > 0.999 0, the average recoveries were between 87.88% and 102.9% and the matrix effect was ranged from 90.71% to 99.30% in low, intermediate and high levels. Furthermore, the higher recovery was obtained by the method reported in this study, comparing to the cleanup procedure with the Mycosep 226 purification column. Eleven samples collected were detected and the contamination levels of the AFB1 were between 1.590-2.340 microg x kg(-1) and the AF (B1 + B2 + G1 + G2) was ranged from 2.340 to 3.340 microg x kg(-1). In summary, the developed method was suitable to detect and screen AFB1, AFB2, AFG1, AFG2 in Armeniacae Semen Amarum. PMID:24490568

  9. Aflatoxin B1 induced upregulation of protein arginine methyltransferase 5 in human cell lines.


    Ghufran, Md Sajid; Ghosh, Krishna; Kanade, Santosh R


    The exposure of naturally occurring mycotoxins affects human health and play a vital role in cancer initiation and progression. Aflatoxin B1 is a difuranocoumarin mycotoxin, classified as a group I carcinogen. The present study was conducted to assess the effect of aflatoxin B1 on epigenetic regulatory proteins. The protein arginine methyltransferase 5 expression was induced upon aflatoxin B1 treatment in a dose and time dependent manner. Further global arginine methylation was also increased in the same manner. This is the first report showing the induction of epigenetic regulatory protein, protein arginine methyltransferase 5 upon aflatoxin B1 treatment. Further study is required to establish the detailed pathway of PRMT5 induction. PMID:27242039

  10. Simultaneous determination of aflatoxin B1 and M1 in milk, fresh milk and milk powder by LC-MS/MS utilising online turbulent flow chromatography.


    Fan, Sufang; Li, Qiang; Sun, Lei; Du, Yanshan; Xia, Jing; Zhang, Yan


    A novel, fully automated method based on dual-column switching using online turbulent flow chromatography followed by LC-MS/MS was developed for the determination of aflatoxin B1 and M1 in milk, fresh milk and milk powder samples. After ultrasound-assisted extraction, samples were directly injected into the chromatographic system and the analytes were concentrated on the clean-up loading column. Through purge switch, analytes were transferred to the analytical column for subsequent detection by mass spectrometry. Different types of TurboFlow(TM) columns, transfer flow rates and transfer times were optimised. Method limits of detection obtained for AFB1 and AFM1 were 0.05 μg kg(-1), and limits of quantification were 0.1 μg kg(-1). Recoveries of aflatoxin B1 and M1 were in range of 81.1-102.1% for all samples. Matrix effects of aflatoxin B1 and M1 were in range of 63.1-94.3%. The developed method was successfully used for the analysis of aflatoxin B1 and M1 in real samples. PMID:25952817

  11. cDNA cloning, expression and activity of a second human aflatoxin B1-metabolizing member of the aldo-keto reductase superfamily, AKR7A3.


    Knight, L P; Primiano, T; Groopman, J D; Kensler, T W; Sutter, T R


    The aflatoxin B1 (AFB1) aldehyde metabolite of AFB1 may contribute to the cytotoxicity of this hepatocarcinogen via protein adduction. Aflatoxin B1 aldehyde reductases, specifically the NADPH-dependent aldo-keto reductases of rat (AKR7A1) and human (AKR7A2), are known to metabolize the AFB1 dihydrodiol by forming AFB1 dialcohol. Using a rat AKR7A1 cDNA, we isolated and characterized a distinct aldo-keto reductase (AKR7A3) from an adult human liver cDNA library. The deduced amino acid sequence of AKR7A3 shares 80 and 88% identity with rat AKR7A1 and human AKR7A2, respectively. Recombinant rat AKR7A1 and human AKR7A3 were expressed and purified from Escherichia coli as hexa-histidine tagged fusion proteins. These proteins catalyzed the reduction of several model carbonyl-containing substrates. The NADPH-dependent formation of AFB1 dialcohol by recombinant human AKR7A3 was confirmed by liquid chromatography coupled to electrospray ionization mass spectrometry. Rabbit polyclonal antibodies produced using recombinant rat AKR7A1 protein were shown to detect nanogram amounts of rat and human AKR7A protein. The amount of AKR7A-related protein in hepatic cytosols of 1, 2-dithiole-3-thione-treated rats was 18-fold greater than in cytosols from untreated animals. These antibodies detected AKR7A-related protein in normal human liver samples ranging from 0.3 to 0.8 microg/mg cytosolic protein. Northern blot analysis showed varying levels of expression of AKR7A RNA in human liver and in several extrahepatic tissues, with relatively high levels in the stomach, pancreas, kidney and liver. Based on the kinetic parameters determined using recombinant human AKR7A3 and AFB1 dihydrodiol at pH 7.4, the catalytic efficiency of this reaction (k2/K, per M/s) equals or exceeds those reported for other enzymes, for example cytochrome P450s and glutathione S-transferases, known to metabolize AFB1 in vivo. These findings indicate that, depending on the extent of AFB1 dihydrodiol formation, AKR

  12. An enzyme-free catalytic DNA circuit for amplified detection of aflatoxin B1 using gold nanoparticles as colorimetric indicators

    NASA Astrophysics Data System (ADS)

    Chen, Junhua; Wen, Junlin; Zhuang, Li; Zhou, Shungui


    An enzyme-free biosensor for the amplified detection of aflatoxin B1 has been constructed based on a catalytic DNA circuit. Three biotinylated hairpin DNA probes (H1, H2, and H3) were designed as the assembly components to construct the sensing system (triplex H1-H2-H3 product). Cascaded signal amplification capability was obtained through toehold-mediated strand displacement reactions to open the hairpins and recycle the trigger DNA. By the use of streptavidin-functionalized gold nanoparticles as the signal indicators, the colorimetric readout can be observed by the naked eye. In the presence of a target, the individual nanoparticles (red) aggregate into a cross-linked network of nanoparticles (blue) via biotin-streptavidin coupling. The colorimetric assay is ultrasensitive, enabling the visual detection of trace levels of aflatoxin B1 (AFB1) as low as 10 pM without instrumentation. The calculated limit of detection (LOD) is 2 pM in terms of 3 times standard deviation over the blank response. The sensor is robust and works even when challenged with complex sample matrices such as rice samples. Our sensing platform is simple and convenient in operation, requiring only the mixing of several solutions at room temperature to achieve visible and intuitive results, and holds great promise for the point-of-use monitoring of AFB1 in environmental and food samples.An enzyme-free biosensor for the amplified detection of aflatoxin B1 has been constructed based on a catalytic DNA circuit. Three biotinylated hairpin DNA probes (H1, H2, and H3) were designed as the assembly components to construct the sensing system (triplex H1-H2-H3 product). Cascaded signal amplification capability was obtained through toehold-mediated strand displacement reactions to open the hairpins and recycle the trigger DNA. By the use of streptavidin-functionalized gold nanoparticles as the signal indicators, the colorimetric readout can be observed by the naked eye. In the presence of a target, the

  13. Developmental exposure of aflatoxin B1 reversibly affects hippocampal neurogenesis targeting late-stage neural progenitor cells through suppression of cholinergic signaling in rats.


    Tanaka, Takeshi; Mizukami, Sayaka; Hasegawa-Baba, Yasuko; Onda, Nobuhiko; Sugita-Konishi, Yoshiko; Yoshida, Toshinori; Shibutani, Makoto


    To elucidate the maternal exposure effects of aflatoxin B1 (AFB1) and its metabolite aflatoxin M1, which is transferred into milk, on postnatal hippocampal neurogenesis, pregnant Sprague-Dawley rats were provided a diet containing AFB1 at 0, 0.1, 0.3, or 1.0 ppm from gestational day 6 to day 21 after delivery on weaning. Offspring were maintained through postnatal day (PND) 77 without AFB1 exposure. Following exposure to 1.0 ppm AFB1, offspring showed no apparent systemic toxicity at weaning, whereas dams showed increased liver weight and DNA repair gene upregulation in the liver. In the hippocampal dentate gyrus of male PND 21 offspring, the number of doublecortin(+) progenitor cells were decreased, which was associated with decreased proliferative cell population in the subgranular zone at ≥ 0.3 ppm, although T-box brain 2(+) cells, tubulin beta III(+) cells, gamma-H2A histone family, member X(+) cells, and cyclin-dependent kinase inhibitor 1A(+) cells did not fluctuate in number. AFB1 exposure examined at 1.0 ppm also resulted in transcript downregulation of the cholinergic receptor subunit Chrna7 and dopaminergic receptor Drd2 in the dentate gyrus, although there was no change in transcript levels of DNA repair genes. In the hippocampal dentate hilus, interneurons expressing CHRNA7 or phosphorylated tropomyosin receptor kinase B (TRKB) decreased at ≥ 0.3 ppm. On PND 77, there were no changes in neurogenesis-related parameters. These results suggested that maternal AFB1 exposure reversibly affects hippocampal neurogenesis targeting type-3 progenitor cells. This mechanism likely involves suppression of cholinergic signals on hilar GABAergic interneurons and brain-derived neurotrophic factor-TRKB signaling from granule cells. The no-observed-adverse-effect level for offspring neurogenesis was determined to be 0.1 ppm (7.1-13.6 mg/kg body weight/day). PMID:26260870

  14. Effects of Aflatoxin B1 on T-Cell Subsets and mRNA Expression of Cytokines in the Intestine of Broilers

    PubMed Central

    Jiang, Min; Peng, Xi; Fang, Jing; Cui, Hengmin; Yu, Zhengqiang; Chen, Zhengli


    This study was conducted to investigate the effects of aflatoxin B1 (AFB1) on T-cell subsets and mRNA expression of cytokines in the small intestine of broilers. One hundred and fifty-six one-day-old healthy Cobb broilers were randomly divided into control group (0 mg/kg AFB1) and AFB1 group (0.6 mg/kg AFB1) with three replicates per group and 26 birds per replicate for 21 days, respectively. At 7, 14, and 21 days of age, the duodenum, jejunum and ileum were sampled for analyzing T cell subsets (CD3+, CD3+CD4+ and CD3+CD8+) by flow cytometry as well as IL-2, IL-4, IL-6, IL-10, IL-17, IFN-γ and TNF-α mRNA expression by qRT-PCR. The percentages of T-cells in the intra-epithelial lymphocytes (IELs) and lamina propria lymphocytes (LPLs) of duodenum, jejunum and ileum in the AFB1 group showed a decreased tendency in comparison to the control group. The mRNA expression of cytokines in the three intestinal segments in the AFB1 group presented a general decline compared with the control groups. Our data demonstrated that 0.6 mg/kg AFB1 in the broilers diet could reduce the percentages of T-cell subsets and the expression level of cytokine mRNA in the small intestine, implying that the immune function of the intestinal mucosa might be affected. The reduction of cytokines mRNA expression may be closely associated with the decreased proportions of T cells subsets induced by AFB1. PMID:25826527

  15. Metabolism and DNA binding of aflatoxicol and aflatoxin B1 in vivo and in isolated hepatocytes from rainbow trout (Salmo gairdneri).


    Loveland, P M; Wilcox, J S; Pawlowski, N E; Bailey, G S


    The purpose of this study was to compare the metabolism and DNA binding of aflatoxicol (AFL) with that of aflatoxin B1 (AFB1) in vivo and in isolated hepatocytes from Mt Shasta strain rainbow trout (Salmo gairdneri). Maximum total binding of [3H]AFL to liver DNA from trout exposed by intraperitoneal injection was 38-47% of that of [3H]AFB1 over a 1-7 day period. The average AFL/AFB1 DNA binding ratio in 1-h incubations with isolated hepatocytes was 0.67 +/- 0.36 (n = 13). In freshly isolated hepatocytes, substantial interconversion between AFB1 and AFL via reductase and dehydrogenase enzymes was observed. Total in vivo excretion of conjugates in bile over 4 days was greater for [3H]AFL substrate than for [3H]AFB1. To determine if AFL binding was due to direct activation or to prior metabolism to AFB1 followed by activation, AFL with a tritium atom on the carbon containing the cyclopentenol function [1-3H]AFL, was synthesized and incubated with hepatocytes. Binding of [1-3H]AFL was 3% that of [3H]AFB1 and represents only direct binding of the intact cyclopentenol epoxide molecule before transformation to AFB1 and consequent loss of 3H. H.p.l.c. analysis of DNA hydrolyzed after incubation with [1-3H]AFL resulted primarily in production of non-radioactive 8,9-dihydro-8-(N7-guanyl)-9-hydroxyaflatoxin B1 (AFB1-N7-guanine). A radioactive peak estimated to be 1% as abundant as the AFB1-N7-guanine was also observed. The overall binding of generally labeled [3H]AFL to trout liver DNA in vivo and in freshly prepared hepatocytes correlates well with available tumor incidence and mutagenicity data. Conclusions from these findings are that direct interaction of AFL-8,9-epoxide with DNA is of relatively minor quantitative importance in rainbow trout hepatocytes and that the major adduct results from conversion of AFL to AFB1 prior to epoxide formation. PMID:3111740

  16. Effects of temperature, water activity and incubation time on fungal growth and aflatoxin B1 production by toxinogenic Aspergillus flavus isolates on sorghum seeds.


    Lahouar, Amani; Marin, Sonia; Crespo-Sempere, Ana; Saïd, Salem; Sanchis, Vicente


    Sorghum, which is consumed in Tunisia as human food, suffers from severe colonization by several toxigenic fungi and contamination by mycotoxins. The Tunisian climate is characterized by high temperature and humidity that stimulates mold proliferation and mycotoxin accumulation in foodstuffs. This study investigated the effects of temperature (15, 25 and 37°C), water activity (aw, between 0.85 and 0.99) and incubation time (7, 14, 21 and 28 d) on fungal growth and aflatoxin B1 (AFB1) production by three Aspergillus flavus isolates (8, 10 and 14) inoculated on sorghum grains. The Baranyi model was applied to identify the limits of growth and mycotoxin production. Maximum diameter growth rates were observed at 0.99 a(w) at 37°C for two of the isolates. The minimum aw needed for mycelial growth was 0.91 at 25 and 37°C. At 15°C, only isolate 8 grew at 0.99 a(w). Aflatoxin B1 accumulation could be avoided by storing sorghum at low water activity levels (≤0.91 a(w)). Aflatoxin production was not observed at 15°C. This is the first work on the effects of water activity and temperature on A. flavus growth and AFB1 production by A. flavus isolates on sorghum grains. PMID:26920121

  17. Performance improvement of the one-dot lateral flow immunoassay for aflatoxin B1 by using a smartphone-based reading system.


    Lee, Sangdae; Kim, Giyoung; Moon, Jihea


    This study was conducted to develop a simple, rapid, and accurate lateral flow immunoassay (LFIA) detection method for point-of-care diagnosis. The one-dot LFIA for aflatoxin B1 (AFB1) was based on the modified competitive binding format using competition between AFB1 and colloidal gold-AFB1-BSA conjugate for antibody binding sites in the test zone. A Smartphone-based reading system consisting of a Samsung Galaxy S2 Smartphone, a LFIA reader, and a Smartphone application for the image acquisition and data analysis. The detection limit of one-dot LFIA for AFB1 is 5 μg/kg. This method provided semi-quantitative analysis of AFB1 samples in the range of 5 to 1,000 μg/kg. Using combination of the one-dot LFIA and the Smartphone-based reading system, it is possible to conduct a more fast and accurate point-of-care diagnosis. PMID:23598499

  18. A SERS-active sensor based on heterogeneous gold nanostar core-silver nanoparticle satellite assemblies for ultrasensitive detection of aflatoxinB1.


    Li, Aike; Tang, Lijuan; Song, Dan; Song, Shanshan; Ma, Wei; Xu, Liguang; Kuang, Hua; Wu, Xiaoling; Liu, Liqiang; Chen, Xin; Xu, Chuanlai


    A surface-enhanced Raman scattering (SERS) sensor based on gold nanostar (Au NS) core-silver nanoparticle (Ag NP) satellites was fabricated for the first time to detect aflatoxinB1 (AFB1). We constructed the SERS sensor using AFB1 aptamer (DNA1)-modified Ag satellites and a complementary sequence (DNA2)-modified Au NS core. The Raman label (ATP) was modified on the surface of Ag satellites. The SERS signal was enhanced when the satellite NP was attached to the Au core NS. The AFB1 aptamer on the surface of Ag satellites would bind to the targets when AFB1 was present in the system, Ag satellites were then removed and the SERS signal decreased. This SERS sensor showed superior specificity for AFB1 and the linear detection range was from 1 to 1000 pg mL(-1) with the limit of detection (LOD) of 0.48 pg mL(-1). The excellent recovery experiment using peanut milk demonstrated that the sensor could be applied in food and environmental detection. PMID:26732202

  19. Performance Improvement of the One-Dot Lateral Flow Immunoassay for Aflatoxin B1 by Using a Smartphone-Based Reading System

    PubMed Central

    Lee, Sangdae; Kim, Giyoung; Moon, Jihea


    This study was conducted to develop a simple, rapid, and accurate lateral flow immunoassay (LFIA) detection method for point-of-care diagnosis. The one-dot LFIA for aflatoxin B1 (AFB1) was based on the modified competitive binding format using competition between AFB1 and colloidal gold-AFB1-BSA conjugate for antibody binding sites in the test zone. A Smartphone-based reading system consisting of a Samsung Galaxy S2 Smartphone, a LFIA reader, and a Smartphone application for the image acquisition and data analysis. The detection limit of one-dot LFIA for AFB1 is 5 μg/kg. This method provided semi-quantitative analysis of AFB1 samples in the range of 5 to 1,000 μg/kg. Using combination of the one-dot LFIA and the Smartphone-based reading system, it is possible to conduct a more fast and accurate point-of-care diagnosis. PMID:23598499

  20. The mycotoxin aflatoxin B1 stimulates Epstein-Barr virus-induced B-cell transformation in in vitro and in vivo experimental models.


    Accardi, Rosita; Gruffat, Henri; Sirand, Cécilia; Fusil, Floriane; Gheit, Tarik; Hernandez-Vargas, Hector; Le Calvez-Kelm, Florence; Traverse-Glehen, Alexandra; Cosset, François-Loïc; Manet, Evelyne; Wild, Christopher P; Tommasino, Massimo


    Although Epstein-Barr virus (EBV) infection is widely distributed, certain EBV-driven malignancies are geographically restricted. EBV-associated Burkitt's lymphoma (eBL) is endemic in children living in sub-Saharan Africa. This population is heavily exposed to food contaminated with the mycotoxin aflatoxin B1 (AFB1). Here, we show that exposure to AFB1 in in vitro and in vivo models induces activation of the EBV lytic cycle and increases EBV load, two events that are associated with an increased risk of eBL in vivo. AFB1 treatment leads to the alteration of cellular gene expression, with consequent activations of signaling pathways, e.g. PI3K, that in turn mediate reactivation of the EBV life cycle. Finally, we show that AFB1 triggers EBV-driven cellular transformation both in primary human B cells and in a humanized animal model. In summary, our data provide evidence for a role of AFB1 as a cofactor in EBV-mediated carcinogenesis. PMID:26424750

  1. Phytic Acid Exposure Alters AflatoxinB1-induced Reproductive and Oxidative Toxicity in Albino Rats (Rattus norvegicus)

    PubMed Central

    Abu El-Saad, Abdelaziz S.


    The increased use of feed in Egypt's aquaculture and animal industries raises concerns about the possible presence of mycotoxins in feedstuffs. The use of alternative medicine, such as botanicals and nutritional supplements, has become popular with inflammatory cases. The present study aimed to testify the role played by phytic acid (IP6) in enhancing the reproductive and oxidative toxicity induced in aflatoxinB1 (AFB1) treated white male albino rats (Rattus norvegicus) throughout treatment and withdrawal periods. One hundred and twenty white male albino rats were grouped into four groups. Group 1, was injected with 300 μg kg−1 body wt of AFB1 once every 3 days for 15 days and left uninjected for another 15 days to study the withdrawal effect. Group 2, was injected with 300 μg kg−1 body wt of AFB1 once every 3 days for 15 days and treated simultaneously with IP6 daily for another 15 days. Group 3, was treated daily with IP6 (40 mg kg−1 body wt) for 15 days and with no treatment for other 15 days. Group 4, injected with equivalent volume of sterile phosphate buffer saline solution as a control group. Sera were taken at the experimental intervals and assayed for testosterone hormone, follicular-stimulating hormone (FSH) and luteinizing hormone (LH) to determine the toxicological impact of AFB1 and the possibility of amelioration by phytic acid on the reproductive performance of the studied animal. The effects of AFB1 treatment on the absolute and relative weight of testis as well as its histopathologic effect on the testis and the possibility of amelioration by IP6 treatment were evaluated. The activities of enzymatic and non-enzymatic anti-oxidants, in addition to lipid peroxidation were measured in the testis’ homogenate of AFB1-treated rats. A decrease in sex hormone levels, an increase in testicular lipid peroxidation product levels and a significant decrease in testicular glutathione content, catalase and total peroxidase and superoxide dismutase

  2. Toxicity of increasing aflatoxin B1 concentrations from contaminated corn with or without clay adsorbent supplementation in ducklings.


    Wan, X L; Yang, Z B; Yang, W R; Jiang, S Z; Zhang, G G; Johnston, S L; Chi, F


    A total of 1,280 1-d-old ducks were used in a study to investigate the effects of increasing aflatoxin B1 (AFB1) concentrations from naturally contaminated corn on young ducklings, and the effectiveness of a clay adsorbent (CA) to protect against those effects. Ducks were randomly allotted to 8 treatments (TRT) in a 4 × 2 factorial arrangement with 4 levels of AFB1 (0, 25, 50, and 100 μg/kg) and 2 levels of CA (0 and 0.1%) with 8 pens per TRT and 20 ducks per pen. All ducks were allowed ad libitum access to feed and water during the 21-d experiment. The ADG, ADFI, feed conversion rate, mortality, bill color, and CV of BW of each replicate were measured at the end of the study. Blood and tissue samples from 8 ducks per TRT were obtained on d 21 of the experiment to determine the serum immunoglobulin and protein concentrations, relative organ weights, and intestinal morphology. Average daily gain and relative weights of the liver, spleen, thymus, and bursa of Fabricius decreased linearly (P < 0.05) as dietary AFB1 increased. Serum proteins and intestinal villi heights and villus/crypt ratio followed the same pattern. Bill decolorization ratio, CV of BW, and mortality increased linearly (P < 0.05) as dietary AFB1 increased. Adding 0.1% CA to the diet improved (P < 0.05) the relative weights of the small intestine, spleen, and thymus, and the villus height and villus/crypt ratio of the duodenum and jejunum, as well as the serum IgG and IgM concentrations. Adding CA also reduced (P < 0.05) bill decolorization ratio, CV of BW, mortality, and serum IgA concentration. Therefore, duck performance was negatively affected by increasing AFB1 concentrations in diets. But the addition of 0.1% CA can protect against the detrimental effects caused by AFB1-contaminated corn in diets for ducks. PMID:23571334

  3. Identification of early target genes of aflatoxin B1 in human hepatocytes, inter-individual variability and comparison with other genotoxic compounds

    SciTech Connect

    Josse, Rozenn; Dumont, Julie; Fautrel, Alain; Robin, Marie-Anne; Guillouzo, André


    Gene expression profiling has recently emerged as a promising approach to identify early target genes and discriminate genotoxic carcinogens from non-genotoxic carcinogens and non-carcinogens. However, early gene changes induced by genotoxic compounds in human liver remain largely unknown. Primary human hepatocytes and differentiated HepaRG cells were exposed to aflatoxin B1 (AFB1) that induces DNA damage following enzyme-mediated bioactivation. Gene expression profile changes induced by a 24 h exposure of these hepatocyte models to 0.05 and 0.25 μM AFB1 were analyzed by using oligonucleotide pangenomic microarrays. The main altered signaling pathway was the p53 pathway and related functions such as cell cycle, apoptosis and DNA repair. Direct involvement of the p53 protein in response to AFB1 was verified by using siRNA directed against p53. Among the 83 well-annotated genes commonly modulated in two pools of three human hepatocyte populations and HepaRG cells, several genes were identified as altered by AFB1 for the first time. In addition, a subset of 10 AFB1-altered genes, selected upon basis of their function or tumor suppressor role, was tested in four human hepatocyte populations and in response to other chemicals. Although they exhibited large variable inter-donor fold-changes, several of these genes, particularly FHIT, BCAS3 and SMYD3, were found to be altered by various direct and other indirect genotoxic compounds and unaffected by non-genotoxic compounds. Overall, this comprehensive analysis of early gene expression changes induced by AFB1 in human hepatocytes identified a gene subset that included several genes representing potential biomarkers of genotoxic compounds. -- Highlights: ► Gene expression profile changes induced by aflatoxin B1 in human hepatocytes. ► AFB1 modulates various genes including tumor suppressor genes and proto-oncogenes. ► Important inter-individual variations in the response to AFB1. ► Some genes also altered by other

  4. Inhibition by the bioflavonoid ternatin of aflatoxin B1-induced lipid peroxidation in rat liver.


    Souza, M F; Tomé, A R; Rao, V S


    Aflatoxin B1, a metabolite of Aspergillus flavus is a potent hepatotoxic and hepatocarcinogenic mycotoxin. Lipid peroxidation and oxidative DNA damage are the principal manifestations of aflatoxin B1-induced toxicity which could be mitigated by antioxidants. Many plant constituents, e.g. flavonoids, lignans and spice principles (capsaicin, curcumin, eugenol, etc.) have been reported to prevent liver damage associated with lipid peroxidation. In this study we investigated ternatin, a tetramethoxyflavone isolated from Egletes viscosa, for possible protection against liver injury induced by aflatoxin B1 in rats. Seventy two hours after a single intraperitoneal dose of aflatoxin B1 (1 mg kg(-1)), the concentration of malondialdehyde, the product of lipid peroxidation in liver homogenates, and serum levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were significantly elevated (P<0.001). Subcutaneous ternatin (25 mg kg(-1)) pretreatment greatly reduced aflatoxin B1-induced increases in the levels of serum enzymes (ALT from 5071+/-763 to 293+/-66 international units L(-1) and AST from 4241+/-471 to 449+/-108 international units L(-1)) and elevated malondialdehyde levels (from 11.37+/-1.27 to 0.79+/-0.22 nmol (mg wet tissue)(-1)) in a manner similar to oral vitamin E (300 mg kg(-1)), a standard antioxidant. Further, histological changes induced by aflatoxin B1 such as hepatocellular necrosis and bile-duct proliferation were markedly inhibited in animals pretreated with ternatin or vitamin E. These data provide evidence that ternatin inhibits lipid peroxidation and affords protection against liver damage induced by aflatoxin B1. Ternatin might, therefore, be a suitable candidate for the chemoprevention of aflatoxicosis associated liver cancer. PMID:10217309

  5. Single corn kernel aflatoxin B1 extraction and analysis method

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aflatoxins are highly carcinogenic compounds produced by the fungus Aspergillus flavus. Aspergillus flavus is a phytopathogenic fungus that commonly infects crops such as cotton, peanuts, and maize. The goal was to design an effective sample preparation method and analysis for the extraction of afla...

  6. Multi-component immunochromatographic assay for simultaneous detection of aflatoxin B1, ochratoxin A and zearalenone in agro-food.


    Li, Xin; Li, Peiwu; Zhang, Qi; Li, Ran; Zhang, Wen; Zhang, Zhaowei; Ding, Xiaoxia; Tang, Xiaoqian


    Mycotoxins are highly toxic contaminants and have induced health threat to human and animals. Aflatoxin B1 (AFB1), ochratoxin A (OTA) and zearalenone (ZEA) commonly occur in food and feed. A multi-component immunochromatographic assay (ICA) was developed for rapid and simultaneous determination of these three mycotoxins in agro-food. The strategy was performed based on the competitive immunoreactions between antibody-colloidal gold nanoparticle conjugate probes and mycotoxins or mycotixin antigens. Each monoclonal antibody specially recognize its corresponding mycotoxin and antigen, and there was no cross reactivity in the assay. Three mycotixin antigens were immobilized as three test lines in the nitrocellulose membrane reaction zone, which enable the simultaneous detection in one single test. The visible ICA results were obtained in 20 min. The visual detection limits of this strip test for the AFB1, OTA and ZEA were 0.25 ng/mL, 0.5 ng/mL and 1 ng/mL, respectively. The assay was evaluated using spiked and naturally contaminated peanuts, maize and rice samples. The results were in accordance with those obtained using enzyme-linked immunosorbent assay. In summary, this developed ICA could provide an effective and rapid approach for onsite detection of multi-mycotoxin in agro-food samples without any expensive instrument. PMID:23807236

  7. Rapid pretreatment and detection of trace aflatoxin B1 in traditional soybean sauce.


    Xie, Fang; Lai, WeiHua; Saini, Jasdeep; Shan, Shan; Cui, Xi; Liu, DaoFeng


    Soybean sauce, a traditional fermented food in China, has different levels of aflatoxin B1 pollution. Two kinds of direct and indirect immunomagnetic bead methods for the pretreatment of aflatoxin B1 were evaluated in this work. A method was established to detect aflatoxin B1 in soybean sauce using an immunomagnetic bead system for pretreatment and ELISA for quantification. The pretreatment method of immunomagnetic beads performed better compared with the conventional extraction and immunoaffinity column method. ELISA exhibited a good linear relationship at an aflatoxin B1 concentration of 0.05-0.3μg/kg (r(2)=0.9842). The average recoveries across spike levels varied from 0.5 to 7μg/kg were 83.6-104% with a relative standard deviation between 4.2% and 11.7%. With the advantages of rapid detection, easy operation, simple equipment, sensitivity, accuracy, and high recovery; this method can be well applied in the trace determination of aflatoxin B1 in soybean sauce samples. PMID:24360425

  8. Role of Oxidative Stress in Sclerotial Differentiation and Aflatoxin B1 Biosynthesis in Aspergillus flavus

    PubMed Central

    Grintzalis, Konstantinos; Vernardis, Spyros I.; Klapa, Maria I.


    We show here that oxidative stress is involved in both sclerotial differentiation (SD) and aflatoxin B1 biosynthesis in Aspergillus flavus. Specifically, we observed that (i) oxidative stress regulates SD, as implied by its inhibition by antioxidant modulators of reactive oxygen species and thiol redox state, and that (ii) aflatoxin B1 biosynthesis and SD are comodulated by oxidative stress. However, aflatoxin B1 biosynthesis is inhibited by lower stress levels compared to SD, as shown by comparison to undifferentiated A. flavus. These same oxidative stress levels also characterize a mutant A. flavus strain, lacking the global regulatory gene veA. This mutant is unable to produce sclerotia and aflatoxin B1. (iii) Further, we show that hydrogen peroxide is the main modulator of A. flavus SD, as shown by its inhibition by both an irreversible inhibitor of catalase activity and a mimetic of superoxide dismutase activity. On the other hand, aflatoxin B1 biosynthesis is controlled by a wider array of oxidative stress factors, such as lipid hydroperoxide, superoxide, and hydroxyl and thiyl radicals. PMID:25002424

  9. The aflatoxin B1 isolating potential of two lactic acid bacteria

    PubMed Central

    Hamidi, Adel; Mirnejad, Reza; Yahaghi, Emad; Behnod, Vahid; Mirhosseini, Ali; Amani, Sajad; Sattari, Sara; Darian, Ebrahim Khodaverdi


    Objective To determine lactic acid bacteria's capability to enhance the process of binding and isolating aflatoxin B1 and to utilize such lactic acid bacteria as a food supplement or probiotic products for preventing absorption of aflatoxin B1 in human and animal bodies. Methods In the present research, the bacteria were isolated from five different sources. For surveying the capability of the bacteria in isolating aflatoxin B1, ELISA method was implemented, and for identifying the resultant strains through 16S rRNA sequencing method, universal primers were applied. Results Among the strains which were isolated, two strains of Lactobacillus pentosus and Lactobacillus beveris exhibited the capability of absorbing and isolating aflatoxin B1 by respectively absorbing and discharging 17.4% and 34.7% of the aforementioned toxin existing in the experiment solution. Conclusions Strains of Lactobacillus pentosus and Lactobacillus beveris were isolated from human feces and local milk samples, respectively. And both strains has the ability to isolate or bind with aflatoxin B1. PMID:23998015

  10. Natural occurrence of moulds and aflatoxin B1 in melon seeds from markets in Nigeria.


    Bankole, S A; Ogunsanwo, B M; Mabekoje, O O


    Shelled melon seeds (Colocynthis citrullus L.) were purchased from markets in randomly selected villages and towns in three states in each of the rain forest (Ogun, Oyo and Osun) and Northern guinea savanna (Kaduna, Niger and Bauchi) zones of Nigeria. The seed samples were analysed for incidence of visibly diseased seeds, moisture content, moulds and aflatoxin B1 contamination. The incidence of diseased seeds ranged from 6.4% to 50.4% in the forest, and 4.3% to 34.3% in the savanna, and the moisture content was 5.6% to 12.6% and 4.5% to 10.3%, respectively. Mould evaluation revealed that Aspergillus was the most frequent genus, followed by Penicillium, Botryodiplodia, Cladosporium and Rhizopus in decreasing sequential order. Aspergillus flavus had the highest individual count in melon seed from both zones. Aflatoxin B1 was detected at levels above 5 microg/kg in 32.2% of samples, while only 3.5% of the samples contained the toxin above the 20 microg/kg Nigerian tolerance level in food. The percentage of samples contaminated with aflatoxin B1 was statistically comparable for the pooled data of villages and towns. The median level of aflatoxin B1 was less than 5 microg/kg in the seed samples, while the mean aflatoxin B1 levels was 14.1 microg/kg in the forest and 13.0 microg/kg in the savanna samples. PMID:15207382

  11. The efficacy of bamboo charcoal in comparison with smectite to reduce the detrimental effect of aflatoxin B1 on in vitro rumen fermentation of a hay-rich feed mixture.


    Jiang, Ya-Hui; Wang, Ping; Yang, Hong-Jian; Chen, Ying


    Two commercial materials, a bamboo charcoal (BC) and a smectite clay (SC), were assessed in vitro with aflatoxin B1 (AFB1) in an equilibrium adsorption test. The adsorption capacity and proportion adsorbed (0.381 μg/mg, 0.955) for BC were greater than for SC (0.372 μg/mg, 0.931). The effects of in vitro ruminal fermentation of hay-rich feed incubated with 1.0 μg/mL AFB1 for 0-10 g/L doses of BC and SC were measured at 39 °C for 72 h. The BC and SC binders increased AFB1 loss at dosages ≥1.0 g/L (p < 0.0001). Average AFB1 loss (p < 0.0001) was greater for SC (0.904) than BC (0.881). Both SC and SC addition increased in vitro dry matter loss, and the average dry matter losses were similar. Asymptotic gas volume and volatile fatty acid production were greater for BC than for SC (p < 0.0001). Thus, BC may be as effective as SC in removing aflatoxin B1's detrimental effects on rumen degradability and fermentation under the occurrence of microbial aflatoxin degradation. PMID:25014194

  12. The Efficacy of Bamboo Charcoal in Comparison with Smectite to Reduce the Detrimental Effect of Aflatoxin B1 on In Vitro Rumen Fermentation of a Hay-Rich Feed Mixture

    PubMed Central

    Jiang, Ya-Hui; Wang, Ping; Yang, Hong-Jian; Chen, Ying


    Two commercial materials, a bamboo charcoal (BC) and a smectite clay (SC), were assessed in vitro with aflatoxin B1 (AFB1) in an equilibrium adsorption test. The adsorption capacity and proportion adsorbed (0.381 μg/mg, 0.955) for BC were greater than for SC (0.372 μg/mg, 0.931). The effects of in vitro ruminal fermentation of hay-rich feed incubated with 1.0 μg/mL AFB1 for 0–10 g/L doses of BC and SC were measured at 39 °C for 72 h. The BC and SC binders increased AFB1 loss at dosages ≥1.0 g/L (p < 0.0001). Average AFB1 loss (p < 0.0001) was greater for SC (0.904) than BC (0.881). Both SC and SC addition increased in vitro dry matter loss, and the average dry matter losses were similar. Asymptotic gas volume and volatile fatty acid production were greater for BC than for SC (p < 0.0001). Thus, BC may be as effective as SC in removing aflatoxin B1’s detrimental effects on rumen degradability and fermentation under the occurrence of microbial aflatoxin degradation. PMID:25014194

  13. Biodegradation of aflatoxin B1 in contaminated rice straw by Pleurotus ostreatus MTCC 142 and Pleurotus ostreatus GHBBF10 in the presence of metal salts and surfactants.


    Das, Arijit; Bhattacharya, Sourav; Palaniswamy, Muthusamy; Angayarkanni, Jayaraman


    Aflatoxin B1 (AFB1) is a highly toxic fungal metabolite having carcinogenic, mutagenic and teratogenic effects on human and animal health. Accidental feeding of aflatoxin-contaminated rice straw may be detrimental for ruminant livestock and can lead to transmission of this toxin or its metabolites into the milk of dairy cattle. White-rot basidiomycetous fungus Pleurotus ostreatus produces ligninolytic enzymes like laccase and manganese peroxidase (MnP). These extracellular enzymes have been reported to degrade many environmentally hazardous compounds. The present study examines the ability of P. ostreatus strains to degrade AFB1 in rice straw in the presence of metal salts and surfactants. Laccase and MnP activities were determined spectrophotometrically. The efficiency of AFB1 degradation was evaluated by high performance liquid chromatography. Highest degradation was recorded for both P. ostreatus MTCC 142 (89.14 %) and P. ostreatus GHBBF10 (91.76 %) at 0.5 µg mL(-1) initial concentration of AFB1. Enhanced degradation was noted for P. ostreatus MTCC 142 in the presence of Cu(2+) and Triton X-100, at toxin concentration of 5 µg mL(-1). P. ostreatus GHBBF10 showed highest degradation in the presence of Zn(2+) and Tween 80. Liquid chromatography-mass spectrometric analysis revealed the formation of hydrated, decarbonylated and O-dealkylated products. The present findings suggested that supplementation of AFB1-contaminated rice straw by certain metal salts and surfactants can improve the enzymatic degradation of this mycotoxin by P. ostreatus strains. PMID:24770873

  14. Influence of temperature cycling on the production of aflatoxins B1 and G1 by Aspergillus parasiticus.

    PubMed Central

    Lin, Y C; Ayres, J C; Koehler, P E


    The effect of temperature cycling on the relative productions of aflatoxins B1 and G1 by Aspergillus parasiticus NRRL 2999 was studied. The cycling of temperature between 33 and 15 degrees C favored aflatoxin B1 accumulation, whereas cycling between 35 and 15 degrees C favored aflatoxin G1 production. Cultures subjected to temperature cycling between 33 and 25 degrees C at various time intervals changed the relative productions of aflatoxins B1 and G1 drastically. Results obtained with temperature cycling and yeast extract-sucrose medium with ethoxyquin to decrease aflatoxin G1 production suggest that the enzyme system responsible for the conversion of aflatoxin B1 to G1 might be more efficient at 25 degrees C than at 33 degrees C. The possible explanation of the effect of both constant and cycling temperatures on the relative accumulations of aflatoxins B1 and G2 might be through the control of the above enzyme system. The study also showed that greater than 57% of aflatoxin B1, greater than 47% of aflatoxin G1, and greater than 50% of total aflatoxins (B1 plus G1) were in the mycelium by day 10 under both constant and cyclic temperature conditions. PMID:6781404

  15. Growth, serum biochemistry, complement activity, and liver gene expression responses of Pekin ducklings to graded levels of cultured aflatoxin B1.


    Chen, X; Horn, N; Cotter, P F; Applegate, T J


    A 14-d study was conducted to evaluate the effects of cultured aflatoxin B1 (AFB1) on performance, serum biochemistry, serum natural antibody and complement activity, and hepatic gene expression parameters in Pekin ducklings. A total of 144 male Pekin ducklings were weighed, tagged, and randomly allotted to 4 dietary treatments containing 4 concentrations of AFB1 (0, 0.11, 0.14, and 0.21 mg/kg) from 0 to 14 d of age (6 cages per diet; 6 ducklings per cage). Compared with the control group, there was a 10.9, 31.7, and 47.4% (P < 0.05) decrease in cumulative BW gain with 0.11, 0.14, and 0.21 mg of AFB1/kg of diet, respectively, but feed efficiency was not affected. Increasing concentrations of AFB1 reduced cumulative BW gain and feed intake both linearly and quadratically, and regression equations were developed with r(2) ≥0.73. Feeding 0.11 to 0.21 mg of AFB1/kg reduced serum glucose, creatinine, albumin, total protein, globulin, Ca, P, and creatine phosphokinase linearly, whereas serum urea N, Cl, alkaline phosphatase, and aspartate amino transferase concentrations increased linearly with increasing AFB1 (P < 0.05). Additionally, 0.11 to 0.21 mg of AFB1/kg diets impaired classical and alternative complement pathways in the duckling serum when tested by lysis of rabbit, human type O, and horse erythrocytes, and decreased rabbit and horse agglutinins (P < 0.05). Liver peroxisome proliferator activated receptor α (PPARα) expression was linearly downregulated by AFB1 (P < 0.01). Results from this study indicate that for every 0.10 mg/kg increase in dietary AFB1, cumulative feed intake and BW gain decrease approximately 230 and 169 g per duckling from hatch to 14 d; and that AFB1 at very low concentrations can significantly impair liver function and gene expression, and innate immune dynamics in Pekin ducklings. PMID:24902705

  16. Determination of aflatoxins B1, B2, G1, and G2 in olive oil, peanut oil, and sesame oil.


    Bao, Lei; Trucksess, Mary W; White, Kevin D


    Edible oils are consumed directly, and used as ingredients in food, soaps, and skin products. However, oils such as olive oil, peanut oil, and sesame oil could be contaminated with aflatoxins, which are detrimental to human and animal health. A method using immunoaffinity column cleanup with RPLC separation and fluorescence detection (FLD) for determination of aflatoxins (AF) B1, B2, G1, and G2 in olive oil, peanut oil, and sesame oil was developed and validated. Test samples were extracted with methanol-water (55 + 45, v/v). After shaking and centrifuging, the lower layer was filtered, diluted with water, and filtered through glass microfiber filter paper. The filtrate was then passed through an immunoaffinity column, and the toxins were eluted with methanol. The toxins were then subjected to RPLC/FLD analysis after postcolumn UV photochemical derivatization. The accuracy and repeatability characteristics of the method were determined. Recoveries of AFB1 spiked at levels from 1.0 to 10.0 microg/kg in olive oil, peanut oil, and sesame oil ranged from 82.9 to 98.6%. RSDs ranged from 0.6 to 8.9%. HorRat values were < 0.2 for all of the matrixes tested. Recoveries of AF spiked at levels from 2.0 to 20.0 microg/kg ranged from 87.7 to 102.2%. RSDs ranged from 1.3 to 12.6%. HorRat values were < 0.4 for all of the matrixes tested. LC/MS/MS with multiple-reaction monitoring was used to confirm the identities of aflatoxins in a naturally contaminated peanut oil. PMID:20629398

  17. Survey of Deoxynivalenol and Aflatoxin B1 in Instant Noodles and Bread Consumed in Thailand by Using Liquid Chromatography-Tandem Mass Spectrometry.


    Pralatnet, Sasithorn; Poapolathep, Saranya; Giorgi, Mario; Imsilp, Kanjana; Kumagai, Susumu; Poapolathep, Amnart


    One hundred wheat product samples (50 instant noodle samples and 50 bread samples) were collected from supermarkets in Bangkok, Thailand. Deoxynivalenol (DON) and aflatoxin B1 (AFB1) contamination in these products was analyzed using a validated liquid chromatography-tandem mass spectrometry method. The limit of quantification values of DON and AFB1 in the instant noodles and bread were 2 and 1 ng g(-1), respectively. The survey found that DON was quantifiable in 40% of collected samples, in 2% of noodles (0.089 μg g(-1)), and in 78% of breads (0.004 to 0.331 μg g(-1)). AFB1 was below the limit of quantification of the method in all of the tested samples. The results suggest that the risk of DON exposure via noodles and breads is very low in urban areas of Thailand. No risk can be attributable to AFB1 exposure in the same food matrices, but further studies with a larger sample size are needed to confirm these data. PMID:27357050

  18. Inhibition of the Aspergillus flavus Growth and Aflatoxin B1 Contamination on Pistachio Nut by Fengycin and Surfactin-Producing Bacillus subtilis UTBSP1

    PubMed Central

    Farzaneh, Mohsen; Shi, Zhi-Qi; Ahmadzadeh, Masoud; Hu, Liang-Bin; Ghassempour, Alireza


    In this study, the treatment of pistachio nuts by Bacillus subtilis UTBSP1, a promising isolate to degrade aflatoxin B1 (AFB1), caused to reduce the growth of Aspergillus flavus R5 and AFB1 content on pistachio nuts. Fluorescence probes revealed that the cell free supernatant fluid from UTBSP1 affects spore viability considerably. Using high-performance liquid chromatographic (HPLC) method, 10 fractions were separated and collected from methanol extract of cell free supernatant fluid. Two fractions showed inhibition zones against A. flavus. Mass spectrometric analysis of the both antifungal fractions revealed a high similarity between these anti-A. flavus compounds and cyclic-lipopeptides of surfactin, and fengycin families. Coproduction of surfactin and fengycin acted in a synergistic manner and consequently caused a strong antifungal activity against A. flavus R5. There was a positive significant correlation between the reduction of A. flavus growth and the reduction of AFB1 contamination on pistachio nut by UTBSP1. The results indicated that fengycin and surfactin-producing B. subtilis UTBSP1 can potentially reduce A. flavus growth and AFB1 content in pistachio nut. PMID:27298596

  19. Inhibition of the Aspergillus flavus Growth and Aflatoxin B1 Contamination on Pistachio Nut by Fengycin and Surfactin-Producing Bacillus subtilis UTBSP1.


    Farzaneh, Mohsen; Shi, Zhi-Qi; Ahmadzadeh, Masoud; Hu, Liang-Bin; Ghassempour, Alireza


    In this study, the treatment of pistachio nuts by Bacillus subtilis UTBSP1, a promising isolate to degrade aflatoxin B1 (AFB1), caused to reduce the growth of Aspergillus flavus R5 and AFB1 content on pistachio nuts. Fluorescence probes revealed that the cell free supernatant fluid from UTBSP1 affects spore viability considerably. Using high-performance liquid chromatographic (HPLC) method, 10 fractions were separated and collected from methanol extract of cell free supernatant fluid. Two fractions showed inhibition zones against A. flavus. Mass spectrometric analysis of the both antifungal fractions revealed a high similarity between these anti-A. flavus compounds and cyclic-lipopeptides of surfactin, and fengycin families. Coproduction of surfactin and fengycin acted in a synergistic manner and consequently caused a strong antifungal activity against A. flavus R5. There was a positive significant correlation between the reduction of A. flavus growth and the reduction of AFB1 contamination on pistachio nut by UTBSP1. The results indicated that fengycin and surfactin-producing B. subtilis UTBSP1 can potentially reduce A. flavus growth and AFB1 content in pistachio nut. PMID:27298596

  20. Comparison of S9 mix and hepatocytes as external metabolizing systems in mammalian cell cultures: cytogenetic effects of 7,12-dimethylbenzanthracene and aflatoxin B1

    SciTech Connect

    Madle, E.; Tiedemann, G.; Madle, S.; Oett, A.; Kaufmann, G.


    Two external metabolizing systems, S9 mix from Aroclor-induced rat livers and freshly isolated hepatocytes, were used for activation in cultures of human lymphocytes and V79 cells. 7, 12-dimethylbenzanthracene (DMBA) and aflatoxin B1 (AFB1) were employed as indirectly acting reference mutagens. Mutagenic effects were measured by induction of sister chromatid exchange (SCE). With DMBA, SCE-inducing effects were found to be quite similar after activation by S9 mix and activation by hepatocytes. In contrast with AFB1, S9 activation led to a stronger SCE induction than hepatocyte activation in both target cells. The induction of chromosomal aberrations by AFB1 after activation by the two metabolizing systems was also analyzed in V79 cells. This experiment again revealed that AFB1 was more efficiently activated by S9 mix than by hepatocytes. The experiments have shown that the suitability of hepatocytes as an activation system is not restricted to microbial or eukaryotic point mutation assays, but that hepatocyte metabolism can also be successfully included in cytogenetic tests with short- and long-term cultures of mammalian target cells.

  1. Correlation between mixed-function oxidase enzyme induction and aflatoxin B1-induced unscheduled DNA synthesis in the chick embryo, in vivo.


    Hamilton, J W; Bloom, S E


    The unscheduled DNA synthesis (UDS) technique has been adapted for use in the chick embryo, in vivo, to determine the relationship between induction of the mixed-function oxidase (MFO) enzyme system and genetic damage from an indirect-acting mutagen-carcinogen. Embryos were injected at 6 days of incubation (DI) with either phenobarbital (PB), a specific inducer of P-450-associated enzyme activities, or 3,4,3',4'-tetrachlorobiphenyl (TCB), a specific inducer of P1-450-associated enzyme activities. Aflatoxin B1 (AFB1) was injected 24 hr later (7 DI), followed by a 5-hr continuous 3H-thymidine exposure. The livers were removed, prepared for autoradiography, and hepatocytes were scored for an increase in grains/nucleus, indicative of UDS. Aflatoxin B1 caused a dose-related increase in UDS in all control and induction groups. Phenobarbital-induced embryos had an increased UDS response while TCB-induced embryos had a decreased UDS response, relative to noninduced embryos, for each dosage of AFB1. This suggests that the genotoxicity of an indirect-acting mutagen-carcinogen can be either increased or decreased, in vivo, depending on the inducer used. The chick embryo provides an excellent system for studying the effect of MFO induction on the genotoxicity of promutagen-carcinogens in a developing system. PMID:6420149

  2. Involvement of cytochrome P450, glutathione S-transferase, and epoxide hydrolase in the metabolism of aflatoxin B1 and relevance to risk of human liver cancer.

    PubMed Central

    Guengerich, F P; Johnson, W W; Ueng, Y F; Yamazaki, H; Shimada, T


    In recent years there has been considerable interest in the effect of variations in activities of xenobiotic-metabolizing enzymes on cancer incidence. This interest has accelerated with the development of methods for analyzing genetic polymorphisms. However, progress in epidemiology has been slow and the contributions of polymorphisms to risks from individual chemicals and mixtures are often controversial. A series of studies is presented to show the complexities encountered with a single chemical, aflatoxin B1 (AFB1). AFB1 is oxidized by human cytochrome P450 enzymes to several products. Only one of these, the 8,9-exo-epoxide, appears to be mutagenic and the others are detoxication products. P450 3A4, which can both activate and detoxicate AFB1, is found in the liver and the small intestine. In the small intestine, the first contact after oral exposure, epoxidation would not lead to liver cancer. The (nonenzymatic) half-life of the epoxide has been determined to be approximately 1 sec at 23 degrees C and neutral pH. Although the half-life is short, AFB1-8,9-exo-epoxide does react with DNA and glutathione S-transferase. Levels of these conjugates have been measured and combined with the rate of hydrolysis in a kinetic model to predict constants for binding of the epoxide with DNA and glutathione S-transferase. A role for epoxide hydrolase in alteration of AFB1 hepatocarcinogenesis has been proposed, although experimental evidence is lacking. Some inhibition of microsome-generated genotoxicity was observed with rat epoxide hydrolase; further information on the extent of contribution of this enzyme to AFB1 metabolism is not yet available. PMID:8781383

  3. Conversion of 11-hydroxy-O-methylsterigmatocystin to aflatoxin G1 in Aspergillus parasiticus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In aflatoxin biosynthesis, aflatoxins G1 (AFG1) and B1 (AFB1) are independently produced from a common precursor, O-methylsterigmatocystin (OMST). Recently, 11-hydroxy-O-methylsterigmatocystin (HOMST) was identified as a later precursor involved in the conversion of OMST to AFB1. However, the invo...

  4. Near-infrared hyperspectral imaging for detecting Aflatoxin B1 of maize kernels

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The feasibility of detecting the Aflatoxin B1 in maize kernels inoculated with Aspergillus flavus conidia in the field was assessed using near-infrared hyperspectral imaging technique. After pixel-level calibration, wavelength dependent offset, the masking method was adopted to reduce the noise and ...

  5. Study of interactions between DNA and aflatoxin B1 using electrochemical and fluorescence methods.


    Banitaba, Mohammad Hossein; Davarani, Saied Saeed Hosseiny; Mehdinia, Ali


    In this study, a carbon paste electrode modified with N-butylpyridinium hexafluorophosphate (BPPF(6)) ionic liquid and DNA was introduced as an electrochemical biosensor to study the interaction between DNA and aflatoxin B1 molecules. For this purpose, variations in oxidation peak current of guanine in various concentrations of aflatoxin B1 were measured by using the differential pulse voltammetry (DPV) method. According to this study, the binding constant of DNA-aflatoxin B1 was found to be 3.5×10(6)M(-1). This modified electrode was also used for determination of low concentrations of aflatoxin B1 by using differential pulse voltammetry. A linear dynamic range from 8.00×10(-8) to 5.91×10(-7)M and a limit of detection of 2.00×10(-8)M resulted from DPV measurements. To confirm our results, a fluorescence study was also performed. It resulted in a binding constant of 2.8×10(6)M(-1), which is in good agreement with that obtained from electrochemical study. PMID:21238426

  6. [Growth and bioluminescence of luminous bacteria under the action of aflatoxin B1 before and after its treatment with nanodiamonds].


    Mogil'naia, O A; Puzyr', A P; Bondar', V S


    The effect of aflatoxin B1 on growth and luminescence of marine luminous bacteria P. phosphoreum and recombinant E. coli Z905 cells was investigated. The bidirectional effect of aflatoxin B1 on the studied bacterial species was detected--an inhibition of luminescence in P. phosphoreum and its stimulation in E. coli. It was shown that aflatoxin B1 influences the cell luminescence in the freshly grown cultures and bacteria restored after lyophilization. It was detected that the effect of aflatoxin B1 was graded after interaction with the modified nanodiamond (MND) of detonation synthesis. After mycotoxin's treatment with MND, it does not cause significant changes in bacterial luminescence. The possibilities for the use of P. phosphoreum and E. coli bacteria in the bioluminescent monitoring of aflatoxin B1 and the use of MND for mycotoxin deactivation are discussed. PMID:20198915

  7. Effects of chlorophyll and chlorophyllin on low-dose aflatoxin B1 pharmacokinetics in human volunteers: A pilot study

    SciTech Connect

    Jubert, C; Mata, J; Bench, G; Dashwood, R; Pereira, C; Tracewell, W; Turteltaub, K; Williams, D; Bailey, G


    Chlorophyll (Chla) and chlorophyllin (CHL) were shown previously to reduce carcinogen bioavailability, biomarker damage, and tumorigenicity in trout and rats. These findings were partially extended to humans (Proc Natl Acad Sci USA 98, 14601-14606 (2001)), where CHL reduced excretion of aflatoxin B{sub 1} (AFB{sub 1})-DNA repair products in Chinese unavoidably exposed to dietary AFB{sub 1}. However, neither AFB{sub 1} pharmacokinetics nor Chla effects were examined. We conducted a small unblinded crossover study to establish AFB{sub 1} pharmacokinetic parameters in human volunteers, and to explore possible effects of CHL or Chla co-treatment on those parameters. For protocol 1, fasted subjects received an IRB-approved dose of 14C-AFB{sub 1} (30 ng, 5 nCi) by capsule with 100 ml water, followed by normal eating and drinking after hr 2. Blood and cumulative urine samples were collected over 72 hr, and {sup 14}C-AFB{sub 1} equivalents were determined by Accelerator Mass Spectrometry. Protocols 2 and 3 were similar except capsules also contained 150 mg of purified Chla, or CHL, respectively. All protocols were repeated 3 times for each of three volunteers. The study revealed rapid human AFB{sub 1} uptake (plasma ka 5.05 {+-} 1.10 hr-1, Tmax 1.0 hr) and urinary elimination (95% complete by 24 hr) kinetics. Chla and CHL treatment each significantly impeded AFB{sub 1} absorption and reduced Cmax and AUC's (plasma and urine) in one or more subjects. These initial results provide AFB{sub 1} pharmacokinetic parameters previously unavailable for humans, and suggest that Chla or CHL co-consumption may limit the bioavailability of ingested aflatoxin in humans, as they do in animal models.

  8. Acute toxicity of aflatoxin B1 and rubratoxin B in dogs.


    Hayes, A W; Williams, W L


    The effect of ip administrated aflatoxin B1 and rubratoxin B, singly and in combination, on dogs was determined by serum tests, by observations of clinical signs and survival times, and by evaluation of gross and microscopic lesions. The dog is sensitive to the toxic effects of both mycotoxins. Glutamic-oxaloacetic transaminase, lactic dehydrogenase and alkaline phosphatase activities and survival time varied in relation to dose and to the mycotoxin(s) administered. All three plasma enzymes were elevated regardless of dose with the combination of aflatoxin B1/rubratoxin B at 24 hr after dosing, except LDH, which was within the normal range but only at the lowest dose level. Several serum constituents including BUN, cholesterol, uric acid, and total bilirubin were elevated, whereas serum glucose was depressed in dogs treated with the multiple-toxin regimen; these changes were not seen in dogs given only aflatoxin B1 but were characteristic in rubratoxin-treated animals. In general, gross findings at necropsy were similar in all dogs regardless of the dose regimen. A striking similarity existed in the histologic changes observed between lesions experimentally induced by the mycotoxin combination and those lesions reported for dogs fed toxic feed in laboratory studies or in natural cases of hepatitis X. Of particular similarity were the severe kidney lesions observed in dogs exposed to the mycotoxin combination and kidney lesions reported in natural outbreaks of hepatitis X. There can be little doubt of an association between hepatitis X and aflatoxin B1, although it is apparent that the disease probably involves more than a single toxic factor. Our results suggest that hepatitis X in dogs includes aflatoxin B1 as a primary etiological factor but that rubratoxin B also may be involved. PMID:581496

  9. Human health implications from co-exposure to aflatoxins and fumonisins in maize-based foods in Latin America: Guatemala as a case study

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Co-occurence of fumonisin B1 (FB1) and aflatoxin B1 (AFB1) in maize has been demonstrated in many surveys. Combined-exposure to FB1 and AFB1 was of concern to the Joint FAO/WHO Expert Committee on Food Additives because of the known genotoxicity of AFB1 and the ability of FB1 to induce regenerative...

  10. Identification of O-methylsterigmatocystin as an aflatoxin B1 and G1 precursor in Aspergillus parasiticus.

    PubMed Central

    Bhatnagar, D; McCormick, S P; Lee, L S; Hill, R A


    An isolate of Aspergillus parasiticus CP461 (SRRC 2043) produced no detectable aflatoxins, but accumulated O-methylsterigmatocystin (OMST). When sterigmatocystin (ST) was fed to this isolate in a low-sugar medium, there was an increase in the accumulation of OMST, without aflatoxin synthesis. When radiolabeled [14C]OMST was fed to resting mycelia of a non-aflatoxin-, non-ST-, and non-OMST-producing mutant of A. parasiticus AVN-1 (SRRC 163), 14C-labeled aflatoxins B1 and G1 were produced; 10 nmol of OMST produced 7.8 nmol of B1 and 1.0 nmol of G1, while 10 nmol of ST produced 6.4 nmol of B1 and 0.6 nmol of G1. A time course study of aflatoxin synthesis in ST feeding experiments with AVN-1 revealed that OMST is synthesized by the mold during the onset of aflatoxin synthesis. The total amount of aflatoxins recovered from OMST feeding experiments was higher than from experiments in which ST was fed to the resting mycelia. These results suggest that OMST is a true metabolite in the aflatoxin biosynthetic pathway between sterigmatocystin and aflatoxins B1 and G1 and is not a shunt metabolite, as thought previously. PMID:3111363

  11. Ameliorative Effects of Tinospora Cordifolia Root Extract on Histopathological and Biochemical Changes Induced by Aflatoxin-B1 in Mice Kidney

    PubMed Central

    Gupta, Rekha; Sharma, Veena


    The present study was planned to investigate the ability of the Tinospora cordifolia to scavenge free radicals generated during aflatoxicosis. A total no. of 48 male Swiss albino mice (30 ± 5 g) were exposed to Aflatoxin B1(AFB1) (2 μg/30 g b.wt, orally) either individually or in combination with T. cordifolia (50, 100, 200 mg/kg, orally) once daily for 25 days. AFB1 exposure led to significant rise in thiobarbituric acid reactive substances (TBARS) and fall in superoxide dismutase (SOD), catalase (CAT), reduced glutathione (GSH), glutathione-S-transferase (GST), glutathione peroxidase (GPx), glutathione reductase (GR), ascorbic acid, and protein content. T. cordifolia was found to show protective effect by lowering down the content of TBARS and enhancing the GSH, ascorbic acid, protein, and the activities of antioxidant enzymes viz., SOD, CAT, glutathione peroxidase, GST, and GR in kidney. Histopathological analysis of kidney samples also confirmed the protective values and antioxidant activity of ethanolic extract of herb. T. cordifolia showed protection against aflatoxin-induced nephrotoxicity due to the presence of alkaloids such as a choline, tinosporin, isocolumbin, palmatine, tetrahydropalmatine, and magnoflorine. PMID:21976812

  12. Comparative Measurement of In Vitro Paraquat and Aflatoxin B1 Cytotoxicity Using Three Different Cytotoxicity Assays in Pheochromocytoma Cells (PC-12).


    Mohammadi-Bardbori, Afshin; Nejati, Majid; Esmaeili, Jamileh; Ghafari, Homanaz; Ghazi-Khansari, Mahmoud


    ABSTRACT Among the herbicides and mycotoxins, paraquat (PQ) and aflatoxin B1 (AFB1) are highly cytotoxic. In this study the toxicity of PQ and AFB1 in the cultured cell were determined using MTT [3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide], JG-B (Janus green B), and NR (neutral red) assay by multiwell scanning spectophotometry. JG-B was used not only for the vital staining of mitochondria but also for viability assay and was compared to MTT and NR assay. Various concentrations of paraquat (0.1 mM to 100 mM) and AFB1 (0.001 nM to 10 nM) on the PC-12 cells were investigated. The 50% lethal concentration of toxins (LC50) were determined for PQ (7.70 +/- 2.50, 3.67 +/- 1.53, 4.85 +/- 2.44) and AFB1 (0.16 +/- 0.01, 0.13 +/- 0.04, 0.14 +/- 0.02) as determined by these methods (JG-B, NR, and MTT, respectively). A significant correlation was found among the JG-B and MTT using PQ (r(2) = 0.99, p < 0.05) and significant correlation was also found among the three methods (r(2) = 0.95, 0.93, and 0.92, p < 0.05) using AFB1. No significant correlation was found between JG-B and MTT with NR (r(2) = 0.34 and 0.35, p < 0.05, respectively) using PQ. These results suggest that both methods (MTT assay and JG-B assay) are reliable and are comparable for determining the cytotoxicity. It is concluded that the JG-B assay may be preferable to MTT assay methods because of its simplicity, low cost, sensitivity, and objectivity; in addition, this method takes little time to be done. PMID:20020925

  13. Effect of p53 Arg72Pro polymorphism on the induction of micronucleus by aflatoxin B1 in in vitro in human blood lymphocytes.


    Bayram, Süleyman; Rencüzoğulları, Eyyüp; Almas, Abdullah Muttalip; Genç, Ahmet


    Aflatoxin B1 (AFB1) is a class 1 carcinogen produced by Aspergillus flavus and Aspergillus parasiticus that can contaminate a variety of food substances, the liver being its target organ. A common p53 Arg72Pro polymorphism resulting in the substitution of an arginine amino acid by proline amino acid in the transactivating domain has been demonstrated to affect p53 function. The aim of this study is to investigate association between p53 Arg72Pro polymorphism and the frequencies of spontaneous and AFB1-induced DNA damage in peripheral blood lymphocytes from 100 healthy individuals in Turkish population. In vitro cytokinesis-blocked micronucleus (CBMN) assay was used to detect the spontaneous and AFB1-induced DNA damage whereas, genotyping of p53 Arg72Pro polymorphism was carried out by using a polymerase chain reaction restriction fragment length polymorphism assay. During 68 h incubation time, lymphocytes treated with AFB1 (1.56 μg/mL) and S9 mix for a total of 3 h (48-51 h). Treatment of the lymphocytes with AFB1significantly increased the overall frequencies of micronucleus (MN) when compared to untreated cultures (1.23 ± 0.05 versus 0.55 ± 0.02; p < 0.001). Moreover, genotype analysis revealed a statistically significant association between Pro/Pro genotype of p53 Arg72Pro polymorphism and increased frequencies of MN both spontaneous and AFB1-induced cultures when compared Arg/Arg genotype (0.69 ± 0.19 versus 0.46 ± 0.13, p < 0.001; 1.59 ± 0.65 versus 1.01 ± 0.41 p < 0.001; respectively). Our data indicate that p53 Arg72Pro polymorphism plays a significant role in human sensitivity to the genotoxic effects of AFB1. Further investigations in larger sample size and with different ethnic origins as well as including more functional single nucleotide polymorphisms might lead to the identification of novel genetic factors responsible for susceptibility to human carcinogens such as AFB1. PMID:26738694

  14. Aflatoxin B1 contamination in maize in Europe increases due to climate change

    NASA Astrophysics Data System (ADS)

    Battilani, P.; Toscano, P.; van der Fels-Klerx, H. J.; Moretti, A.; Camardo Leggieri, M.; Brera, C.; Rortais, A.; Goumperis, T.; Robinson, T.


    Climate change has been reported as a driver for emerging food and feed safety issues worldwide and its expected impact on the presence of mycotoxins in food and feed is of great concern. Aflatoxins have the highest acute and chronic toxicity of all mycotoxins; hence, the maximal concentration in agricultural food and feed products and their commodities is regulated worldwide. The possible change in patterns of aflatoxin occurrence in crops due to climate change is a matter of concern that may require anticipatory actions. The aim of this study was to predict aflatoxin contamination in maize and wheat crops, within the next 100 years, under a +2 °C and +5 °C climate change scenario, applying a modelling approach. Europe was virtually covered by a net, 50 × 50 km grids, identifying 2254 meshes with a central point each. Climate data were generated for each point, linked to predictive models and predictions were run consequently. Aflatoxin B1 is predicted to become a food safety issue in maize in Europe, especially in the +2 °C scenario, the most probable scenario of climate change expected for the next years. These results represent a supporting tool to reinforce aflatoxin management and to prevent human and animal exposure.

  15. Aflatoxin B1 contamination in maize in Europe increases due to climate change.


    Battilani, P; Toscano, P; Van der Fels-Klerx, H J; Moretti, A; Camardo Leggieri, M; Brera, C; Rortais, A; Goumperis, T; Robinson, T


    Climate change has been reported as a driver for emerging food and feed safety issues worldwide and its expected impact on the presence of mycotoxins in food and feed is of great concern. Aflatoxins have the highest acute and chronic toxicity of all mycotoxins; hence, the maximal concentration in agricultural food and feed products and their commodities is regulated worldwide. The possible change in patterns of aflatoxin occurrence in crops due to climate change is a matter of concern that may require anticipatory actions. The aim of this study was to predict aflatoxin contamination in maize and wheat crops, within the next 100 years, under a +2 °C and +5 °C climate change scenario, applying a modelling approach. Europe was virtually covered by a net, 50 × 50 km grids, identifying 2254 meshes with a central point each. Climate data were generated for each point, linked to predictive models and predictions were run consequently. Aflatoxin B1 is predicted to become a food safety issue in maize in Europe, especially in the +2 °C scenario, the most probable scenario of climate change expected for the next years. These results represent a supporting tool to reinforce aflatoxin management and to prevent human and animal exposure. PMID:27066906

  16. Aflatoxin B1 contamination in maize in Europe increases due to climate change

    PubMed Central

    Battilani, P.; Toscano, P.; Van der Fels-Klerx, H. J.; Moretti, A.; Camardo Leggieri, M.; Brera, C.; Rortais, A.; Goumperis, T.; Robinson, T.


    Climate change has been reported as a driver for emerging food and feed safety issues worldwide and its expected impact on the presence of mycotoxins in food and feed is of great concern. Aflatoxins have the highest acute and chronic toxicity of all mycotoxins; hence, the maximal concentration in agricultural food and feed products and their commodities is regulated worldwide. The possible change in patterns of aflatoxin occurrence in crops due to climate change is a matter of concern that may require anticipatory actions. The aim of this study was to predict aflatoxin contamination in maize and wheat crops, within the next 100 years, under a +2 °C and +5 °C climate change scenario, applying a modelling approach. Europe was virtually covered by a net, 50 × 50 km grids, identifying 2254 meshes with a central point each. Climate data were generated for each point, linked to predictive models and predictions were run consequently. Aflatoxin B1 is predicted to become a food safety issue in maize in Europe, especially in the +2 °C scenario, the most probable scenario of climate change expected for the next years. These results represent a supporting tool to reinforce aflatoxin management and to prevent human and animal exposure. PMID:27066906

  17. Assessment of aflatoxin B1 in livestock feed and feed ingredients by high-performance thin layer chromatography

    PubMed Central

    Kotinagu, Korrapati; Mohanamba, T.; Kumari, L. Rathna


    Aim: Detection of aflatoxin B1 in Livestock compound Feed and feed ingredients by high-performance thin layer chromatography (HPTLC). Materials and Methods: Chromatography was performed on HPTLC silica gel 60 F 254, aluminum sheets by CAMAG automatic TLC sampler 4, with mobile phase condition chloroform:acetone:water (28:4:0.06). Extraction of aflatoxin B1 from samples was done as per AOAC method and screening and quantification done by HPTLC Scanner 4 under wavelength 366 nm. Results: A total of 97 livestock feed (48) and feed ingredients (49) samples received from different livestock farms and farmers were analyzed for aflatoxin B1of which 29 samples were contaminated, constituting 30%. Out of 48 livestock compound feed samples, aflatoxin B1 could be detected in 16 samples representing 33%, whereas in livestock feed ingredients out of 49 samples, 13 found positive for aflatoxin B1 representing 24.5%. Conclusion: HPTLC assures good recovery, precision, and linearity in the quantitative determination of aflatoxin B1 extracted from Livestock compound feed and feed ingredients. As more number of feed and feed ingredients are contaminated with aflatoxin B1 which causes deleterious effects in both animal and human beings, so there is a need for identifying the source of contamination, executing control measures, enabling better risk assessment techniques, and providing economic benefits. PMID:27047050

  18. Label-free immunosensor based on one-step electrodeposition of chitosan-gold nanoparticles biocompatible film on Au microelectrode for determination of aflatoxin B1 in maize.


    Ma, Haihua; Sun, Jizhou; Zhang, Yuan; Bian, Chao; Xia, Shanhong; Zhen, Tong


    Gold nanoparticles (AuNPs) embedded in chitosan (CHI) film, well-dispersed and smaller in size (about 10 nm), were fabricated by one-step electrodeposion on Au microelectrode in solution containing chitosan and chloride trihydrate. The nano-structure CHI-AuNPs composite film offers abundant amine groups, good conductivity, excellent biocompatibility and stability for antibody immobilization. The combination of aflatoxin B1 (AFB1) with immobilized antibody introduces a barrier to electron transfer, resulting in current decreasement. The morphologies and characterizations of modified microelectrodes were investigated by scanning electron microscope (SEM), cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS) and Fourier transform infrared spectroscopy (FT-IR). The proposed non-enzyme and label-free immunosensor exhibited high sensitive amperometric response to AFB1 concentration in two linear ranges of 0.1 to 1 ng mL(-1) and 1 to 30 ng mL(-1), with the detection limit of 0.06 ng mL(-1) (S/N=3). The immunoassay was also applied for analysis of maize samples spiked with AFB1. Considering the sample extraction procedure, the linear range and limit of detection were assessed to be 1.6-16 ng mL(-1) and 0.19 ng mL(-1) respectively. The simple method showed good fabrication controllability and reproducibility for immunosensor design. PMID:26851579

  19. Toxic effects of aflatoxin B1 on embryonic development of zebrafish (Danio rerio): potential activity of piceatannol encapsulated chitosan/poly (lactic acid) nanoparticles.


    Dhanapal, Jeevitha; Ravindrran, Malathy Balaraman; Baskar, Santhosh K


    The aim was to analyse the efficacy of piceatannol (PIC) loaded chitosan (CS)/poly(lactic acid)(PLA) nanoparticles (CS/PLA-PIC NPs) in zebra fish embryos exposed to aflatoxin B1 (AFB1). FTIR confirmed the chemical interaction between the polymers and drug. SEM showed the size of CS/PLA-PIC NPs approximately 87 to 200nm, compared to CS-PLA NPs of 150nm size. The size was further affirmed as 127nm (CS-PLA NPs) and 147nm (CS/PLA-PIC NPs) by zetasizer depiction. CS/PLA-PIC NPs have not illustrated toxicity at high concentrations when tested in zebrafish embryos. AFB1 wielded their toxic effects on the survival, spontaneous movement, hatching and heart rate and development of embryos were observed in both time and dose-dependent manner at 4μM. Our results suggested that the addition of CS/PLA-PIC NPs increases the survival, heart rate and hatching in time dependent manner at the dosage of 20μg/ml. These hopeful results may prompt the advancement of drug encapsulated polymeric nanoparticles which may have the potential role in improving the AFB1 induced toxicity in humans as well. PMID:25322988

  20. Phlomis mauritanica extracts reduce the xanthine oxidase activity, scavenge the superoxide anions, and inhibit the aflatoxin B1-, sodium azide-, and 4-nitrophenyldiamine-induced mutagenicity in bacteria.


    Limem, Ilef; Bouhlel, Ines; Bouchemi, Meriem; Kilani, Soumaya; Boubaker, Jihed; Ben-Sghaier, Mohamed; Skandrani, Ines; Behouri, Wissem; Neffati, Aicha; Ghedira, Kamel; Chekir-Ghedira, Leila


    Four extracts were prepared from the leaves of Phlomis mauritanica: lyophilized infusion, total oligomer flavonoids, methanol, and ethyl acetate extracts. The antimutagenic properties of these extracts were investigated by assessing the inhibition of the mutagenic effects of direct-acting mutagens such as sodium azide and 4-nitrophenylenediamine and indirect-acting mutagens like aflatoxin B1 (AFB1) using the Ames assay. The four extracts prepared from P. mauritanica strongly inhibit the mutagenicity induced by AFB1 in both Salmonella typhimurium TA 100 and TA 98 assay systems. Lyophilized infusion and methanol extracts at the dose of 250 microg per plate reduced AFB1 mutagenicity by 93% and 91%, respectively, in S. typhymurium strain TA 100. We examined also the antioxidant effect of these extracts by the enzymatic xanthine/xanthine oxidase assay. Result indicated that total oligomer flavonoids and ethyl acetate and methanol extracts were potent inhibitors of xanthine oxidase activity. In contrast, lyophilized infusion, total oligomer flavonoids, and methanol extracts exhibited a high degree of superoxide anion scavenging. Our findings emphasize the potential of P. mauritanica extracts to prevent mutations and oxidant effects. Furthermore, the results presented here could be an additional argument to support the use of this species as a medicinal and dietary plant. PMID:20406134

  1. Determination of aflatoxin B1 in tiger nut-based soft drinks.


    Arranz, I; Stroka, J; Neugebauer, M


    An analytical method for the determination of aflatoxin B1 in a tiger nut-based soft drinks named 'horchata' is described. The method is based on an immunoaffinity clean-up, followed by HPLC separation and fluorescence detection after electrochemical post-column derivatization. The detection limit (S/N = 3) and the quantification limit (S/N = 10) were 0.02 and 0.06 microg kg(-1), respectively. The mean recovery at a level of 2 microg l(-1) was 88% (n = 6) and the coefficient of variation was 9%. The method was applied to conduct a small market survey for a beverage named 'horchata' that is frequently consumed by parts of the population in Southern Europe. Twenty-two samples from Spanish and Belgian supermarkets were analysed. As a result, only one sample was found to contain aflatoxin B1 at the limit of quantitation of the method. PMID:16517532

  2. Inhibition effects of Chinese cabbage powder on aflatoxin B1-induced liver cancer.


    Wang, Tuoyi; Li, Chunyan; Liu, Yang; Li, Tiezhu; Zhang, Jie; Sun, Yonghai


    In this study, 0.25 μg/ml aflatoxin B1 was used to establish a liver cancer model for assessing the potential anticancer ability of Chinese cabbage powder, which is a complex water-soluble extract from Chinese cabbage by spray-drying at an outlet temperature of 130 °C. We found at least 11 potential anticancer substances in Chinese cabbage powder. A 90-d animal experiment demonstrated that 10% of Chinese cabbage powder in drinking water could improve the plasma micronutrient status, inhibit the formation of aflatoxin B1-DNA adducts in liver cells, and effectively reduce the incidence of liver tumor induced by aflatoxin B1 from 6.67% to 0%. The dose effect experiment revealed that 10% may be the minimal effective dose to prevent the occurrence of early liver tumors. This study will help elucidate the basis of epidemiological observations of dietary cancer prevention in humans, as well as explore related mechanisms. PMID:25976785

  3. Identification of AFB1-interacting proteins and interactions between RPSA and AFB1.


    Zhuang, Zhenhong; Huang, Yaling; Yang, Yanling; Wang, Shihua


    A method using immobilized affinity chromatography (IAC) was developed to screen for aflatoxin B1 (AFB1)-binding proteins. AFB1 and bovine serum albumin (BSA) coupled protein (BSA-AFB1) was prepared using 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride. The resulting coupled compound was immobilized onto PVDF transfer membranes, which were then incubated with total protein from mouse liver. AFB1-binding proteins were eluted, after non-specific washing, by specific elution, and the eluted proteins were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Two candidate AFB1-binding proteins were identified by liquid chromatography-tandem mass spectrometry as the 40S ribosomal protein SA (RPSA) and a putative uncharacterized protein. RPSA and AFB1 interactions were further analyzed by ELISA in vitro and laser confocal immunofluorescence analysis in vivo. The results from ELISA and immunofluorescence showed that RPSA efficiently bound AFB1 in vitro and in vivo. This study's conclusion laid the foundation for further exploration of the role of AFB1-binding proteins in AFB1 toxicology towards hepatocytes and the entry pathway of AFB1 into hepatocytes. PMID:26372695

  4. Assessment of isorhamnetin 3-O-neohesperidoside from Acacia salicina: protective effects toward oxidation damage and genotoxicity induced by aflatoxin B1 and nifuroxazide.


    Bouhlel, Ines; Limem, Ilef; Skandrani, Ines; Nefatti, Aicha; Ghedira, Kamel; Dijoux-Franca, Marie-Genevieve; Leila, Chekir-Ghedira


    Antioxidant activity of isorhamnetin 3-O-neohesperidoside, isolated from the leaves of Acacia salicina, was determined by the ability of this compound to inhibit xanthine oxidase activity and to scavenge the free radical 2,2'-azino-bis (3-ethylbenzthiazoline-6-sulfonic acid) (ABTS(.-)) diammonium salt. Antigenotoxic activity was assessed using the SOS chromotest assay. This compound has the ability to scavenge the ABTS(.+) radical by a hydrogen donating mechanism. We also envisaged the study of the antioxidant effect of this compound by the enzymatic xanthine/xanthine oxidase (X/XOD) assay. Results indicated that isorhamnetin 3-O-neohesperidoside was a potent inhibitor of xanthine oxidase and superoxide anion scavengers. Moreover, this compound induced an inhibitory activity against nifuroxazide and aflatoxine B1 (AFB1) induced genotoxicity. Taken together, these observations provide evidence that isorhamnetin 3-O-neohesperidoside isolated from the leaves of A. salicina is able to protect cells against the consequences of oxidative stress. PMID:20809543

  5. A Theoretical Study of 8-Chloro-9-Hydroxy-Aflatoxin B1, the Conversion Product of Aflatoxin B1 by Neutral Electrolyzed Water

    PubMed Central

    Escobedo-González, René; Méndez-Albores, Abraham; Villarreal-Barajas, Tania; Aceves-Hernández, Juan Manuel; Miranda-Ruvalcaba, René; Nicolás-Vázquez, Inés


    Theoretical studies of 8-chloro-9-hydroxy-aflatoxin B1 (2) were carried out by Density Functional Theory (DFT). This molecule is the reaction product of the treatment of aflatoxin B1 (1) with hypochlorous acid, from neutral electrolyzed water. Determination of the structural, electronic and spectroscopic properties of the reaction product allowed its theoretical characterization. In order to elucidate the formation process of 2, two reaction pathways were evaluated—the first one considering only ionic species (Cl+ and OH−) and the second one taking into account the entire hypochlorous acid molecule (HOCl). Both pathways were studied theoretically in gas and solution phases. In the first suggested pathway, the reaction involves the addition of chlorenium ion to 1 forming a non-classic carbocation assisted by anchimeric effect of the nearest aromatic system, and then a nucleophilic attack to the intermediate by the hydroxide ion. In the second studied pathway, as a first step, the attack of the double bond from the furanic moiety of 1 to the hypochlorous acid is considered, accomplishing the same non-classical carbocation, and again in the second step, a nucleophilic attack by the hydroxide ion. In order to validate both reaction pathways, the atomic charges, the highest occupied molecular orbital and the lowest unoccupied molecular orbital were obtained for both substrate and product. The corresponding data imply that the C9 atom is the more suitable site of the substrate to interact with the hydroxide ion. It was demonstrated by theoretical calculations that a vicinal and anti chlorohydrin is produced in the terminal furan ring. Data of the studied compound indicate an important reduction in the cytotoxic and genotoxic potential of the target molecule, as demonstrated previously by our research group using different in vitro assays. PMID:27455324

  6. Aflatoxin B1 metabolism to aflatoxicol and derivatives lethal to Bacillus subtilis GSY 1057 by rainbow trout (Salmo gairdneri) liver.


    Schoenhard, G L; Lee, D J; Howell, S E; Pawlowski, N E; Libbey, L M; Sinnhuber, R O


    Aflatoxicol, R0, was isolated from Mt. Shasta strain rainbow trout (Salmo gairdneri), and liver homogenates were incubated with aflatoxin B1. Its identity was confirmed by mass, infrared, and ultraviolet spectrometry. The structure was identical to one of the diastereomers prepared by chemical reduction of aflatoxin B1. Aflatoxicol was apparently formed by a reduced nicotinamide adenine dinucleotide phosphate-dependent soluble enzyme of the 105,000 x g supernatant from rainbow trout. Aflatoxicol was not lethal in phosphate buffer to Bacillus subtilis GSY 1057 (metB4, hisA1, uvr-1) nor were aflatoxins B1, Q1, and B2. In the presence of reduced nicotinamide adenine dinucleotide phosphate and trout liver microsomes, aflatoxicol reduced the viability of B. subtilis. Aflatoxin B2, which lacks the vinyl ether present in the other compounds, could not be activated. The product of aflatoxin B1 activation by trout liver microsomes was sought after incubation of 14C-labeled aflatoxin B1. The radioactivity was found in unaltered aflatoxin B1 and in three extremely polar metabolites. The quantity of the new metabolites and the level of microbial lethality was reduced by addition of cytosine and cysteine to the incubation medium. The vinyl ether configuration was a structural requirement for activation, and this finding and the nature of the enzymatic reaction were consistent with the hypothesis that the compounds were metabolized to highly reactive and unstable electrophilic products which bound to nucleophiles such as cytosine and were lethal to B. subtilis. The formation of aflatoxicol as the major product of trout liver metabolism is of great significance considering that it could be activated to a lethal compound and that rainbow trout are one of the most sensitive species to aflatoxin B1-induced carcinoma. PMID:5190

  7. Protection of salvia miltiorrhiza against aflatoxin-B1-induced hepatocarcinogenesis in Fischer 344 rats dual mechanisms involved.


    Liu, J; Yang, C F; Wasser, S; Shen, H M; Tan, C E; Ong, C N


    Extract of Salvia Miltiorrhiza (SM) has been widely used in traditional Chinese medicine for treating liver diseases. Recent experimental evidence indicates that it has anti-tumor potential. In this study, the effect of SM on alfatoxin B1 (AFB1)-induced hepatocarcinogenesis was investigated in male Fischer 344 rats. AFB1 (40 microg/100 g body wt, by gavage) was administered once a week for 24 weeks. In SM treatment group, rats were given SM (0.25g/100g body wt, 5 days/week by gavage) for a total of 28 weeks, including 4 weeks before and 24 weeks during AFB1 exposure. Results showed that the elevation of serum alanine aminotransferase and aspartate aminotransferase activities due to AFB1 dosing was almost completely abolished by the treatment of SM, indicating that SM could prevent AFB1-induced liver cell injury. It was further observed that SM substantially reduced glutathione S-transferase placenta form (GST-P) positive foci formation and GST-P mRNA expression caused by AFB1, which clearly suggests that SM is effective in preventing AFB1-induced hepatocarcinogenesis. Furthermore, the inhibition on AFB1 hepatocarcinigenesis was associated with a corresponding decrease in AFB1-DNA adducts formation as well as AFB1-induced oxidative DNA damage (8-hydroxydeoxyguanosine) in rat liver. Our results also indicate that the protective effect of SM might be mediated through dual mechanisms: (i) the enhancement of AFB1 detoxification pathway, especially the induction of GST-Yc2 mRNA expression, and (ii) the antioxidant property of SM. PMID:11441922

  8. Determination and chemometric evaluation of total aflatoxin, aflatoxin B1, ochratoxin A and heavy metals content in corn flours from Turkey.


    Algül, Işıl; Kara, Derya


    Concentrations of the total aflatoxin, aflatoxin B1, aflatoxin B2, aflatoxin G1, aflatoxin G2, ochratoxin A, lead, cadmium, mercury, arsenic, copper, zinc and chromium in corn flour samples were determined. Eighteen corn flour samples that were obtained from different cities and villages in Turkey and 3 corn flour samples obtained from the UK. Determination of the different toxins was carried out using HPLC instrumentation after pre-separation using immunoaffinity columns that work through a mechanism of solid-phase extraction. An ICP-MS instrument was used for the heavy metal determinations. The results obtained from HPLC and ICP-MS analyses of the corn flour samples showed that these samples contain detectable levels of most of the analytes but the mercury was at undetectable levels. A very strong statistical relationship was observed between Cr and total Aflatoxin and Aflatoxin B1; whereas Ochratoxin A was related to Cu and Zn concentrations using correlation analyses and principal component analyses. PMID:24679753

  9. Co-occurence of aflatoxins and fumonisins in maize: guatemala as a case study

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aflatoxin B1 (AFB1) and fumonisin B1 (FB1) are found in maize. AFB1 is a genotoxic carcinogen (IARC Group 1) and FB1 a liver cancer promoter in rodents and trout (IARC Group 2B). Therefore, the possibility of co-exposure is a health concern, most notably in areas where maize serves as a dietary st...

  10. Rapid On-Site Sensing Aflatoxin B1 in Food and Feed via a Chromatographic Time-Resolved Fluoroimmunoassay

    PubMed Central

    Wang, Du; Zhang, Qi; Li, Peiwu; Ding, Xiaoxia


    Aflatoxin B1 poses grave threats to food and feed safety due to its strong carcinogenesis and toxicity, thus requiring ultrasensitive rapid on-site determination. Herein, a portable immunosensor based on chromatographic time-resolved fluoroimmunoassay was developed for sensitive and on-site determination of aflatoxin B1 in food and feed samples. Chromatographic time-resolved fluoroimmunoassay offered a magnified positive signal and low signal-to-noise ratio in time-resolved mode due to the absence of noise interference caused by excitation light sources. Compared with the immunosensing performance in previous studies, this platform demonstrated a wider dynamic range of 0.2-60 μg/kg, lower limit of detection from 0.06 to 0.12 µg/kg, and considerable recovery from 80.5% to 116.7% for different food and feed sample matrices. It was found to be little cross-reactivity with other aflatoxins (B2, G1, G2, and M1). In the case of determination of aflatoxin B1 in peanuts, corn, soy sauce, vegetable oil, and mouse feed, excellent agreement was found when compared with aflatoxin B1 determination via the conversational high-performance liquid chromatography method. The chromatographic time-resolved fluoroimmunoassay affords a powerful alternative for rapid on-site determination of aflatoxin B1 and holds a promise for food safety in consideration of practical food safety and environmental monitoring. PMID:25874803

  11. Rapid on-site sensing aflatoxin B1 in food and feed via a chromatographic time-resolved fluoroimmunoassay.


    Zhang, Zhaowei; Tang, Xiaoqian; Wang, Du; Zhang, Qi; Li, Peiwu; Ding, Xiaoxia


    Aflatoxin B1 poses grave threats to food and feed safety due to its strong carcinogenesis and toxicity, thus requiring ultrasensitive rapid on-site determination. Herein, a portable immunosensor based on chromatographic time-resolved fluoroimmunoassay was developed for sensitive and on-site determination of aflatoxin B1 in food and feed samples. Chromatographic time-resolved fluoroimmunoassay offered a magnified positive signal and low signal-to-noise ratio in time-resolved mode due to the absence of noise interference caused by excitation light sources. Compared with the immunosensing performance in previous studies, this platform demonstrated a wider dynamic range of 0.2-60 μg/kg, lower limit of detection from 0.06 to 0.12 µg/kg, and considerable recovery from 80.5% to 116.7% for different food and feed sample matrices. It was found to be little cross-reactivity with other aflatoxins (B2, G1, G2, and M1). In the case of determination of aflatoxin B1 in peanuts, corn, soy sauce, vegetable oil, and mouse feed, excellent agreement was found when compared with aflatoxin B1 determination via the conversational high-performance liquid chromatography method. The chromatographic time-resolved fluoroimmunoassay affords a powerful alternative for rapid on-site determination of aflatoxin B1 and holds a promise for food safety in consideration of practical food safety and environmental monitoring. PMID:25874803

  12. Aflatoxins in pozol, a nixtamalized, maize-based food.


    Méndez-Albores, J A; Arámbula-Villa, G; Preciado-Ortíz, R E; Moreno-Martínez, E


    To determine whether pozol, a nixtamalized maize-based food was contaminated with aflatoxins, samples of non-fermented pozol were collected during the period November 2002 to April 2003 from local markets at Comitan in Chiapas, Mexico. The samples were analyzed for the presence of aflatoxins. Nineteen out of one hundred and eleven samples were contaminated with aflatoxin B2 (AFB2) and traces of aflatoxin B1 (AFB1). The percentage of samples contaminated with AFB2 in pozol prepared with white maize was 5.4%. Pozol mixed with toasted cacao paste had a contamination rate of 41.5%. No aflatoxins were detected in pozol prepared with yellow maize. It was found that only 1 of 19 contaminated samples had aflatoxin concentrations above 20 ppb. PMID:15193807

  13. DNA Sequence Modulates Geometrical Isomerism of the trans-8,9-Dihydro-8-(2,6-diamino-4-oxo-3,4-dihydropyrimid-5-yl-formamido)-9-hydroxy Aflatoxin B1 Adduct

    PubMed Central


    Aflatoxin B1 (AFB1), a mycotoxin produced by Aspergillus flavus, is oxidized by cytochrome P450 enzymes to aflatoxin B1-8,9-epoxide, which alkylates DNA at N7-dG. Under basic conditions, this N7-dG adduct rearranges to yield the trans-8,9-dihydro-8-(2,6-diamino-4-oxo-3,4-dihydropyrimid-5-yl-formamido)-9-hydroxy aflatoxin B1 (AFB1–FAPY) adduct. The AFB1–FAPY adduct exhibits geometrical isomerism involving the formamide moiety. NMR analyses of duplex oligodeoxynucleotides containing the 5′-XA-3′, 5′-XC-3′, 5′-XT-3′, and 5′-XY-3′ sequences (X = AFB1–FAPY; Y = 7-deaza-dG) demonstrate that the equilibrium between E and Z isomers is controlled by major groove hydrogen bonding interactions. Structural analysis of the adduct in the 5′-XA-3′ sequence indicates the preference of the E isomer of the formamide group, attributed to formation of a hydrogen bond between the formyl oxygen and the N6 exocyclic amino group of the 3′-neighbor adenine. While the 5′-XA-3′ sequence exhibits the E isomer, the 5′-XC-3′ sequence exhibits a 7:3 E:Z ratio at equilibrium at 283 K. The E isomer is favored by a hydrogen bond between the formyl oxygen and the N4-dC exocyclic amino group of the 3′-neighbor cytosine. The 5′-XT-3′ and 5′-XY-3′ sequences cannot form such a hydrogen bond between the formyl oxygen and the 3′-neighbor T or Y, respectively, and in these sequence contexts the Z isomer is favored. Additional equilibria between α and β anomers and the potential to exhibit atropisomers about the C5–N5 bond do not depend upon sequence. In each of the four DNA sequences, the AFB1–FAPY adduct maintains the β deoxyribose configuration. Each of these four sequences feature the atropisomer of the AFB1 moiety that is intercalated above the 5′-face of the damaged guanine. This enforces the Ra axial conformation for the C5–N5 bond. PMID:25587868

  14. A fabricated electro-spun sensor based on Lake Red C pigments doped into PAN (polyacrylonitrile) nano-fibers for electrochemical detection of Aflatoxin B1 in poultry feed and serum samples.


    Babakhanian, Arash; Momeneh, Tahereh; Aberoomand-azar, Parviz; Kaki, Samineh; Torki, Mehran; Hossein Kiaie, Seyed; Sadeghi, Ehsan; Dabirian, Farzad


    The aim of this work was to fabricate a novel nano-fiber modified electrode, involving Lake Red C (LRC) pigments doped into electrospun polyacrylonitrile (PAN) fibrous films. Cyclic voltammetry (CV), scanning electron microscopy (SEM), electrochemical impedance spectroscopy (EIS) and differential pulse voltammetry (DPV) techniques were used for electrochemical and morphological characterization of the composite fibers. This sensor responds to Aflatoxin B1 (AFB1) over the concentration range of 40-120 nM with high accuracy and precision in analysis. The modified electrode exhibited an excellent electrocatalytic ability (α = 0.42, log K(s) = 4.21 s(-1), and Γ = 1.49 × 10(-5) mmol cm(-2)) for reduction of AFB1 at the optimum pH of 6 and working potential of -0.75 V (vs. SCE). The common substances accompanying AFB1 had no serious interferences on the response of the modified electrode to AFB1. The modified electrode indicated reproducible behavior and a high level stability during the experiments, making it particularly suitable for the analytical determination of AFB1 in poultry feed and serum samples. PMID:26460282

  15. Alpha-class glutathione S-transferases in wild turkeys (Meleagris gallopavo): characterization and role in resistance to the carcinogenic mycotoxin aflatoxin B1.


    Kim, Ji Eun; Bunderson, Brett R; Croasdell, Amanda; Reed, Kent M; Coulombe, Roger A


    Domestic turkeys (Meleagris gallopavo) are one of the most susceptible animals known to the toxic effects of the mycotoxin aflatoxin B1 (AFB1), a potent human hepatocarcinogen, and universal maize contaminant. We have demonstrated that such susceptibility is associated with the inability of hepatic glutathione S-transferases (GSTs) to detoxify the reactive electrophilic metabolite exo-AFB1-8,9-epoxide (AFBO). Unlike their domestic counterparts, wild turkeys, which are relatively AFB1-resistant, possess hepatic GST-mediated AFBO conjugating activity. Here, we characterized the molecular and functional properties of hepatic alpha-class GSTs (GSTAs) from wild and domestic turkeys to shed light on the differences in resistance between these closely related strains. Six alpha-class GST genes (GSTA) amplified from wild turkeys (Eastern and Rio Grande subspecies), heritage breed turkeys (Royal Palm) and modern domestic (Nicholas strain) turkeys were sequenced, and catalytic activities of heterologously-expressed recombinant enzymes determined. Alpha-class identity was affirmed by conserved GST domains and four signature motifs. All GSTAs contained single nucleotide polymorphisms (SNPs) in their coding regions: GSTA1.1 (5 SNPs), GSTA1.2 (7), GSTA1.3 (3), GSTA2 (3), GSTA3 (1) and GSTA4 (2). E. coli-expressed GSTAs possessed varying activities toward GST substrates 1-chloro-2,4-dinitrobenzene (CDNB), 1,2-dichloro-4-nitrobenzene (DCNB), ethacrynic acid (ECA), cumene hydroperoxide (CHP). As predicted by their relative resistance, livers from domestic turkeys lacked detectable GST-mediated AFBO detoxification activity, whereas those from wild and heritage birds possessed this critical activity, suggesting that intensive breeding and selection resulted in loss of AFB1-protective alleles during domestication. Our observation that recombinant tGSTAs detoxify AFBO, whereas their hepatic forms do not, implies that the hepatic forms of these enzymes are down-regulated, silenced, or

  16. Transformation of adsorbed aflatoxin B1 on smectite at elevated temperatures

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aflatoxins cause liver damage and suppress immunity. Smectites can be used to reduce the bioavailability of aflatoxins through adsorption. To further reduce the toxicity of aflatoxins and to eliminate the treatments of aflatoxin-loaded smectites, degrading the adsorbed aflatoxin to nontoxic or less ...

  17. Effects of a Calcium Bentonite Clay in Diets Containing Aflatoxin when Measuring Liver Residues of Aflatoxin B1 in Starter Broiler Chicks

    PubMed Central

    Fowler, Justin; Li, Wei; Bailey, Christopher


    Research has shown success using clay-based binders to adsorb aflatoxin in animal feeds; however, no adsorbent has been approved for the prevention or treatment of aflatoxicosis. In this study, growth and relative organ weights were evaluated along with a residue analysis for aflatoxin B1 in liver tissue collected from broiler chickens consuming dietary aflatoxin (0, 600, 1200, and 1800 µg/kg) both with and without 0.2% of a calcium bentonite clay additive (TX4). After one week, only the combined measure of a broiler productivity index was significantly affected by 1800 µg/kg aflatoxin. However, once birds had consumed treatment diets for two weeks, body weights and relative kidney weights were affected by the lowest concentration. Then, during the third week, body weights, feed conversion, and the productivity index were affected by the 600 µg/kg level. Results also showed that 0.2% TX4 was effective at reducing the accumulation of aflatoxin B1 residues in the liver and improving livability in birds fed aflatoxin. The time required to clear all residues from the liver was less than one week. With evidence that the liver’s ability to process aflatoxin becomes relatively efficient within three weeks, this would imply that an alternative strategy for handling aflatoxin contamination in feed could be to allow a short, punctuated exposure to a higher level, so long as that exposure is followed by at least a week of a withdrawal period on a clean diet free of aflatoxin. PMID:26343723

  18. New Insights into the Conversion of Versicolorin A in the Biosynthesis of Aflatoxin B1.


    Conradt, David; Schätzle, Michael A; Haas, Julian; Townsend, Craig A; Müller, Michael


    A crucial and enigmatic step in the complex biosynthesis of aflatoxin B1 is the oxidative rearrangement of versicolorin A to demethylsterigmatocystin. This step is thought to proceed by an oxidation-reduction-oxidation sequence, in which the NADPH-dependent oxidoreductase AflM catalyzes the enclosed reduction step. AflM from Aspergillus parasiticus, after heterologous production in E. coli and purification, however, catalyzed the reduction of the hydroquinoid form of the starting compound versicolorin A (25% conversion) to a so far unknown product of aflatoxin biosynthesis. The asymmetric reduction of emodin hydroquinone to (R)-3,8,9,10-tetrahydroxy-6-methyl-3,4-dihydroanthracen-1(2H)-one (up to 82% for AflM) has also been observed in previous studies using MdpC from Aspergillus nidulans (monodictyphenone biosynthetic gene cluster). The first (nonenzymatic) reduction of emodin to emodin hydroquinone, for example with sodium dithionite, is obligatory for the enzymatic reduction by AflM or MdpC. These results imply an unprecedented role of AflM in the complex enzymatic network of aflatoxin biosynthesis. PMID:26266881

  19. Calcium montmorillonite clay reduces AFB1 and FB1 biomarkers in rats exposed to single and co-exposures of aflatoxin and fumonisin

    PubMed Central

    Mitchell, Nicole J.; Xue, Kathy S.; Lin, Shuhan; Marroquin-Cardona, Alicia; Brown, Kristal A.; Elmore, Sarah E.; Tang, Lili; Romoser, Amelia; Gelderblom, Wentzel C. A.; Wang, Jia-Sheng; Phillips, Timothy D.


    Aflatoxins (AFs) and fumonisins (FBs) can co-contaminate foodstuffs and have been associated with hepatocellular and esophageal carcinomas in humans at high risk for exposure. One strategy to reduce exposure (and toxicity) from contaminated foodstuffs is the dietary inclusion of a montmorillonite clay (UPSN) that binds AFs and FBs in the GI tract. In this study, the binding capacity of UPSN was evaluated for AFB1, FB1 and a combination thereof in Fischer-344 rats. Rats were pre-treated with different dietary levels of UPSN (0.25 or 2%) for 1 week. Rats were gavaged with a single dose of either 0.125 mg AFB1 or 25 mg FB1/kg b.w. and a combination thereof in the presence and absence of an aqueous solution of UPSN. The kinetics of mycotoxin excretion were monitored by analyzing serum AFB1-albumin, urinary AF (AFM1), and FB1 biomarkers over a period of 72 hr. UPSN decreased AFM1 excretion by 88-97%, indicating highly effective binding. FB1 excretion was reduced, to a lesser extent, ranging between 45 to 85%. When in combination, both AFB1 and FB1 binding occurred, but capacity was decreased by almost half. In the absence of UPSN, the combined AFB1 and FB1 treatment decreased the urinary biomarkers by 67 and 45% respectively, but increased levels of AFB1-albumin, presumably by modulating its cytochrome metabolism. UPSN significantly reduced bioavailability of both AFB1 and FB1 when in combination; suggesting that it can be utilized to reduce levels below their respective thresholds for affecting adverse biological effects. PMID:24193864

  20. Affinity maturation of single-chain variable fragment specific for aflatoxin B(1) using yeast surface display.


    Min, Won-Ki; Kim, Sung-Gun; Seo, Jin-Ho


    As aflatoxin B1 is one of the most toxic mycotoxins, it is important to detect and to quantify aflatoxin B1 accurately by immunological methods. To enhance aflatoxin B1-binding affinity of the single-chain variable fragment, yeast surface display technique combined with fluorescence-activated cell sorting was applied. A randomly mutated scFv library was subjected to 4 rounds of fluorescence-activated cell sorting, resulting in isolation of 5 scFv variants showing an affinity improvement compared to the parental wild type scFv. The best scFv with a 9-fold improvement in affinity for aflatoxin B1 exhibited similar specificity to the monoclonal antibody. Most of the mutations in scFv-M37 were located outside of the canonical antigen-contact loops, suggesting that its affinity improvement might be driven by an allosteric effect inducing scFv-M37 to form a more favorable binding pocket for aflatoxin B1 than the wild type scFv. PMID:26041237

  1. Mathematic Modeling for Optimum Conditions on Aflatoxin B1 Degradation by the Aerobic Bacterium Rhodococcus erythropolis

    PubMed Central

    Kong, Qing; Zhai, Cuiping; Guan, Bin; Li, Chunjuan; Shan, Shihua; Yu, Jiujiang


    Response surface methodology was employed to optimize the degradation conditions of AFB1 by Rhodococcus erythropolis in liquid culture. The most important factors that influence the degradation, as identified by a two-level Plackett-Burman design with six variables, were temperature, pH, liquid volume, inoculum size, agitation speed and incubation time. Central composite design (CCD) and response surface analysis were used to further investigate the interactions between these variables and to optimize the degradation efficiency of R. erythropolis based on a second-order model. The results demonstrated that the optimal parameters were: temperature, 23.2 °C; pH, 7.17; liquid volume, 24.6 mL in 100-mL flask; inoculum size, 10%; agitation speed, 180 rpm; and incubation time, 81.9 h. Under these conditions, the degradation efficiency of R. erythropolis could reach 95.8% in liquid culture, which was increased by about three times as compared to non-optimized conditions. The result by mathematic modeling has great potential for aflatoxin removal in industrial fermentation such as in food processing and ethanol production. PMID:23202311

  2. Potential natural exposure of Mississippi sandhill cranes to aflatoxin B1.


    Couvillion, C E; Jackson, J R; Ingram, R P; Bennett, L W; McCoy, C P


    A survey was conducted to determine if carcinogenic mycotoxins were present in foods consumed by Mississippi sandhill cranes (Grus canadensis pulla). Samples of field corn (Zea mays) (n = 111) and chufa (Cyperus esculentus) (n = 20), obtained in 1987, 1988 and 1989 on the Mississippi Sandhill Crane National Wildlife Refuge (MSCNWR) and nearby private lands were analyzed for aflatoxin B1(AB1), ochratoxin A and sterigmatocystin using thin layer chromatography. Chufa samples were negative for all three mycotoxins. Aflatoxin B1 was found in corn at concentrations from 5 to 5,000 ppb; the other mycotoxins were not found in corn. Contaminated corn was found in 72% of all corn fields, but the proportion of contaminated fields was 57 to 100% for the 3-yr period. Contamination with AB1 was greatest in corn obtained from the ground post-harvest. Overall, 32% of corn samples from the ground had levels greater than or equal to 200 ppb with a mean of 427 ppb (range = 5 to 5,000 ppb) in contaminated fields. In 1989, mean AB1 concentration in corn on the ground was 5 to 1138 ppb for individual fields. The concentration of AB1 was less than or equal to 200 ppb in all corn samples from upright stalks. The study demonstrated that AB1 is available to sandhill cranes and at levels that may pose a serious health threat. PMID:1758031

  3. Simultaneous analysis of aflatoxins B1, B2, G1, G2, M1 and ochratoxin A in breast milk by high-performance liquid chromatography/fluorescence after liquid-liquid extraction with low temperature purification (LLE-LTP).


    Andrade, Patricia Diniz; Gomes da Silva, Julyane Laine; Caldas, Eloisa Dutra


    The aims of this study were to optimize and validate a methodology for the simultaneous analysis of aflatoxins B1, B2, G1, G2, M1 (AFB1, AFB2, AFG1, AFG2, AFM1) and ochratoxin A (OTA) in breast milk, and to analyze these mycotoxins in samples obtained from human milk banks in the Federal District, Brazil. The optimized analytical method was based on liquid-liquid extraction with low temperature purification (3.25mL of acidified acetonitrile+0.75mL of ethyl acetate), followed by analysis by high-performance liquid chromatography with fluorescence detector (HPLC/FLD) and a photochemical post-column reactor. Limits of quantification (LOQ) ranged from 0.005 to 0.03ng/mL, recoveries from 73 to 99.5%, and relative standard deviations (RSD) from 1.8 to 17.3%. The LLE-LTP extraction method was shown to be simple and cost-effective, since no columns were needed for clean-up. Only 2 of the 224 breast milk samples analyzed were positive for the mycotoxins, both samples containing AFB2 at the LOQ level (0.005ng/mL). The identity of the mycotoxin detected was confirmed by liquid chromatography coupled with tandem mass spectrometry (LC-MS/MS). This result indicates that infants who are fed with breast milk from the milk banks are not at risk from aflatoxin and ochratoxin exposure. PMID:23871563

  4. Novel B melatonin-loaded chitosan microcapsules: in vitro characterization and antiapoptosis efficacy for aflatoxin B1-induced apoptosis in rat liver.


    El-Gibaly, I; Meki, A M A; Abdel-Ghaffar, S K


    The aim of this study was to prepare buoyant (B) melatonin (MT)-loaded chitosan microcapsules having favourable sustained release characteristics (in simulated gastric fluid (SGF), pH 1.2) in comparison with non-buoyant (NB) chitosan particles. The new buoyant microcapsules were prepared by the ionotropic gelation method using sodium lauryl sulfate (NaLS) for coagulation. The microcapsule characteristics were affected by the initial drug and NaLS concentrations, as well as the presence of sodium dioctyl sulfosuccinate (DOS) or pectin with NaLS in the external phase. In general, spherical microcapsules with 36.90-56.23% encapsulation efficiencies, hollow core and satisfactory release properties were produced. The best sustained release profiles (t(50%): 5h) with near zero-order kinetics were observed with the higher theoretical payload microcapsules prepared with both NaLS and DOS in a 1:2 ratio. In vivo studies were also carried out to exploit the protective effect of the MT-loaded NaLS-DOS microcapsules against aflatoxin B1 (AFB1)-induced toxicity (liver apoptosis) in male rats. The results implied that apoptotic rate was significantly reduced when MT or its microcapsules formulation was co-administered with AFB1. The levels of the oxidative stress indices (malondialdehyde (MDA), a lipid peroxidation product and nitric oxide (NO)) in liver tissues were significantly reduced, while the levels of the hepatic antioxidants (glutathione (GSH) and zinc (Zn), as well as the enzyme activities of glutathione reductase (GR), glutathione peroxidase (GSPx) and glutathione-S-transferase (GST)) which act as antiapoptosis were significantly increased as compared to AFB1 group (without MT). MT microcapsules appeared more effective in reduction of apoptotic rate than free MT as indicated by the decline of caspase-3 activities (an apoptotic marker) and confirmed by histopathology. PMID:12818806

  5. Incidence and Level of Aflatoxins Contamination in Medicinal Plants in Korea

    PubMed Central

    Lee, Sung Deuk; Yu, In Sil; Jung, Kweon


    During 2011~2013, a total of 729 samples for 19 types of medicinal plant were collected from Seoulyekryungsi in Seoul, Korea, and investigated for the presence of aflatoxins. The samples were analyzed using immunoaffinity column cleanup and high-performance liquid chromatography coupled to a fluorescence detector after post-column derivatization. Aflatoxins were found in 124 out of the 729 analyzed samples: 65 containing aflatoxin B1 (AFB1), 24 with aflatoxin B2 (AFB2), 15 with aflatoxin G1 (AFG1), and 20 samples with aflatoxin G2 (AFG2). The ranges for positive samples were 0.1~404.7 µg/kg for AFB1, 0.1~10.0 µg/kg for AFB2, 0.1~635.3 µg/kg for AFG1, 0.1~182.5 µg/kg for AFG2, and 0.1~1,043.9 µg/kg for total aflatoxins. Most of the medicinal plant samples (721, 98.9%) were below legal limits, but 8 samples exceeded the legal limits of 10 and 15 µg/kg established by the Korean standard for AFB1 and total aflatoxins (the sum of AFB1, AFB2, AFG1 and AFG2), respectively. PMID:25606005

  6. Experimental induction of liver fibrosis in young guinea pigs by combined application of copper sulphate and aflatoxin B1.


    Seffner, W; Schiller, F; Lippold, U; Dieter, H H; Hoffmann, A


    Aflatoxin B1 alone (0.05 mg resp. 0.037 mg/kg/d), copper alone (6.6 mg/kg/d or 200 mg/l drinking water) or a combination of both was administered orally for 6 months to young guinea pigs from the first/second day of life. In the copper group there were no pathomorphological changes. For the aflatoxin B1 group, liver damage was established. In the combined group, liver injury was more frequent and more severe compared to the aflatoxin B1 group and biliary copper excretion was diminished compared with the copper group. Histologically, only the livers of this group exhibited degeneration, atrophy and steatosis of liver cells, inflammatory processes and a more or less prominent fibrosis. For childhood cirrhosis (ICC and ICT) a combined etiology--a liver damaging agent plus elevated alimentary copper--is a plausible hypothesis. PMID:9334826

  7. Fabrication of a novel nanocomposite based on sol-gel process for hollow fiber-solid phase microextraction of aflatoxins: B1 and B2, in cereals combined with high performane liquid chromatography-diode array detection.


    Es'haghi, Zarrin; Sorayaei, Hoda; Samadi, Fateme; Masrournia, Mahboubeh; Bakherad, Zohreh


    The new pre-concentration technique, hollow fiber-solid phase microextraction based on carbon nanotube reinforced sol-gel and liquid chromatography-photodiode array detection was applied to determination of aflatoxins B(1), B(2) (AFB(1), AFB(2)) in rice, peanut and wheat samples. This research provides an overview of trends related to synthesis of solid phase microextraction (SPME) sorbnents that improves the assay of aflatoxins as the semi-polar compounds in several real samples. It mainly includes summary and a list of the results for a simple carbon nanotube reinforced sol-gel in-fiber device. This device was used for extraction, pre-concentration and determination of aflatoxins B1, B2 in real samples. In this technique carbon nanotube reinforced sol was prepared by the sol-gel method via the reaction of phenyl trimethoxysilane (PTMS) with a basic catalyst (tris hydroxymethyl aminomethan). The influences of microextraction parameters such as pH, ageing time, carbon nanotube contents, desorption conditions, desorption solvent and agitation speed were investigated. Optimal HPLC conditions were: C(18) reversed phase column for separation, water-acetonitril-methanol (35:10:55) as the mobile phase and maximum wavelength for detection was 370 nm. The method was evaluated statistically and under optimized conditions, the detection limits for the analytes were 0.074 and 0.061 ng/mL for B1 and B2 respectively. Limit of quantification for B1 and B2 was 0.1 ng/mL too (n=7). The precisions were in the range of 2.829-2.976% (n=3), and linear ranges were within 0.1 and 400 ng/mL. The method was successfully applied to the analysis of cereals (peanut, wheat, rice) with the relative recoveries from 47.43% to 106.83%. PMID:21925977

  8. Expression of V(H)-linker-V(L) orientation-dependent single-chain Fv antibody fragment derived from hybridoma 2E6 against aflatoxin B1 in Escherichia coli.


    Liu, Aiping; Ye, Yang; Chen, Weifeng; Wang, Xiaohong; Chen, Fusheng


    Aflatoxin B1 (AFB1) is a toxic secondary metabolic product, which threatens human and animal health. Antibody is a key factor for immunoassay against toxic stuff like AFB1, and single-chain Fv antibody fragment (scFv) has become a popular format of genetically engineered antibody. In this study, four hybridoma cell lines against AFB1 were obtained, and then scFvs 2E6 derived from hybridoma cell line 2E6 were constructed in different V(H)/V(L) orientations. Subsequently, scFvs 2E6 were expressed in E. coli BL21(DE3) mainly in the form of inclusion body. SDS-PAGE, Western blot and ELISA were employed to characterize scFvs 2E6. The results revealed that the yield of inclusion body of scFvs 2E6 in either V(H)/V(L) orientation was similar; however, only the scFv in V(H)-linker-V(L) orientation showed anti-AFB1 bioactivity after refolding. The present study underscores the importance of choosing optimal V(H)/V(L) orientation for scFv construction, and scFv may be favorable for immunoassays in food industry. PMID:25540048

  9. Quantitative determination of aflatoxin B1 concentration in acetonitrile by chemometric methods using terahertz spectroscopy.


    Ge, Hongyi; Jiang, Yuying; Lian, Feiyu; Zhang, Yuan; Xia, Shanhong


    Aflatoxins contaminate and colonize agricultural products, such as grain, and thereby potentially cause human liver carcinoma. Detection via conventional methods has proven to be time-consuming and complex. In this paper, the terahertz (THz) spectra of aflatoxin B1 in acetonitrile solutions with concentration ranges of 1-50μg/ml and 1-50μg/l are obtained and analyzed for the frequency range of 0.4-1.6THz. Linear and nonlinear regression models are constructed to relate the absorption spectra and the concentrations of 160 samples using the partial least squares (PLS), principal component regression (PCR), support vector machine (SVM), and PCA-SVM methods. Our results indicate that PLS and PCR models are more accurate for the concentration range of 1-50μg/ml, whereas SVM and PCA-SVM are more accurate for the concentration range of 1-50μg/l. Furthermore, ten unknown concentration samples extracted from mildewed maize are analyzed quantitatively using these methods. PMID:27173565

  10. Acute and subchronic toxicity of aflatoxin B1 to rohu, Labeo rohita (Hamilton).


    Sahoo, P K; Mukherjee, S C; Nayak, S K; Dey, S


    Pathological alterations in various organs of rohu (L. rohita) fingerlings following acute (0, 7.50, 11.25 and 13.75 mg/kg body weight) and subchronic (0, 1.25 and 2.50 mg/kg body weight) single i.p. aflatoxin B1 exposure for 10 and 90 days, respectively, were investigated. Mortality (dose-dependent) was marked only during acute toxicosis. The changes observed in various organs were dose and time dependent. The acute dose groups revealed toxic changes viz., necrotic and vascular changes in liver and gill lamellae; meningitis, congestion in brain, degeneration and inflammatory reaction in heart along with degenerative to necrotic changes in kidney tubules and sloughing of the intestinal mucosa. During subchronic exposure to this toxin, preneoplastic lesions in liver along with changes in spleen, intestine, gill and pancreas were recorded. With low doses of aflatoxin, the fish did not reveal any mortality or external signs other than catchexia and increased pigmentation on scales. In composite culture practice of Indian major carps, this could be of economic significance. PMID:11510129

  11. Exposure to aflatoxin B1 in late gestation alters protein kinase C and apoptotic protein expression in murine placenta.


    Wang, Yanfei; Tan, Wenjuan; Wang, C C; Leung, Lai K


    Mycotoxins are chemicals with diverse toxicities that are produced by fungi. Aflatoxin B1 is commonly found in plant food, and is generally regarded as one of the most toxic mycotoxins. In the present study, pregnant ICR mice were given p.o. daily doses of aflatoxin B1 at 0, 0.05, 0.5, 5mg/kg for 4days (from E13.5 to E16.5). Compared to the control group, time of delivery was shortened and low birth weight was induced in mice treated with 0.5 and 5mg aflatoxin B1/kg, respectively. Placental tissue isolated from pregnant mice at E17.5 showed that the mRNA expression of crh was increased in aflatoxin-treated groups. This upregulation might signify premature delivery. Further analysis indicated that Pkc proteins were activated and Bcl-2 was reduced in the placental tissue of the aflatoxin-treated groups. Reduction of the anti-apoptotic proteins, on the other hand, might affect the morphorgenesis and maintenance of the placenta. PMID:26968497

  12. Urinary 15-F2t-isoprostane, aflatoxin B1 exposure and hepatitis B virus infection and hepatocellular carcinoma in Taiwan

    PubMed Central

    Wu, Hui-Chen; Wang, Qiao; Yang, Hwai-I; Ahsan, Habibul; Tsai, Wei-Yann; Wang, Li-Yu; Chen, Shu-Yuan; Chen, Chien-Jen; Santella, Regina M.


    To evaluate the role of oxidative stress and aflatoxin exposure on risk of hepatocellular carcinoma (HCC), a case–control study nested within a large community-based cohort was conducted in Taiwan. Baseline urine samples, collected from a total of 74 incident HCC cases and 290 matched controls, were used to determine by enzyme-linked immunosorbent assays the level of urinary 15-F2t-isoprostane (15-F2t-IsoP), a biomarker of lipid peroxidation. These samples had been previously analyzed for urinary aflatoxin B1 (AFB1) metabolites and 8-oxo-7,8-dihydro-2′-deoxyguanosine (8-oxodG). Pearson partial correlation coefficient analysis showed that urinary AFB1 metabolites and 8-oxodG were significantly associated with the level of urinary 15-F2t-IsoP. After adjustment for potential confounding factors in a conditional logistic regression model, urinary 15-F2t-IsoP was significantly associated with risk of HCC [above versus below the mean odds ratio (OR) = 2.53, 95% confidence interval (CI) = 1.30–4.93]. Moreover, when compared with subjects in the lowest tertile of 15-F2t-IsoP, there was a trend of increasing risk of HCC (Ptrend = 0.0008), with adjusted ORs (95% CIs) of 3.87 (1.32–11.38) and 6.27 (2.17–18.13) for the second and third tertile, respectively. In addition, the combination of urinary 15-F2t-IsoP above the mean and chronic hepatitis B virus (HBV) infection resulted in an OR of 19.01 (95% CI = 6.67–54.17) compared with those with low urinary 15-F2t-IsoP and without HBV infection. These results suggest that elevated levels of urinary 15-F2t-IsoP may be related to increasing level of aflatoxin exposure and are associated with an increased risk of HCC. PMID:18310087

  13. Risk Assessment on Dietary Exposure to Aflatoxin B1 in Post-Harvest Peanuts in the Yangtze River Ecological Region

    PubMed Central

    Ding, Xiaoxia; Wu, Linxia; Li, Peiwu; Zhang, Zhaowei; Zhou, Haiyan; Bai, Yizhen; Chen, Xiaomei; Jiang, Jun


    Based on the 2983 peanut samples from 122 counties in six provinces of China’s Yangtze River ecological region collected between 2009–2014, along with the dietary consumption data in Chinese resident nutrition and health survey reports from 2002 and 2004, dietary aflatoxin exposure and percentiles in the corresponding statistics were calculated by non-parametric probability assessment, Monte Carlo simulation and bootstrap sampling methods. Average climatic conditions in the Yangtze River ecological region were calculated based on the data from 118 weather stations via the Thiessen polygon method. The survey results found that the aflatoxin contamination of peanuts was significantly high in 2013. The determination coefficient (R2) of multiple regression reflected by the aflatoxin B1 content with average precipitation and mean temperature in different periods showed that climatic conditions one month before harvest had the strongest impact on aflatoxin B1 contamination, and that Hunan and Jiangxi provinces were greatly influenced. The simulated mean aflatoxin B1 intake from peanuts at the mean peanut consumption level was 0.777–0.790 and 0.343–0.349 ng/(kg·d) for children aged 2–6 and standard adults respectively. Moreover, the evaluated cancer risks were 0.024 and 0.011/(100,000 persons·year) respectively, generally less than China’s current liver cancer incidence of 24.6 cases/(100,000 persons·year). In general, the dietary risk caused by peanut production and harvest was low. Further studies would focus on the impacts of peanut circulation and storage on aflatoxin B1 contamination risk assessment in order to protect peanut consumers’ safety and boost international trade. PMID:26501322

  14. Aflatoxins B1, B2, G1, and G2 contamination in ground red peppers commercialized in Sanliurfa, Turkey.


    Karaaslan, Mehmet; Arslanğray, Yusuf


    Aflatoxins (AFs) are hepatogenic, teratogenic, imunosuppressive, and carcinogenic fungal metabolites found in feeds, nuts, wine-grapes, spices, and other grain crops. Humans are exposed to AFs via consumption of mycotoxin-contaminated foods. This study aimed to determine the prevalence of AF contamination in powdered red peppers sold in Sanliurfa. A total of 42 samples were randomly collected from retail shops, supermarkets, open bazaars, and apiaries and examined for the occurrence and levels of AFB1, AFB2, AFG1, and AFG2 toxins. AFs were determined by using an HPLC system after pre-separation utilizing immunoaffinity columns. AFs levels were below 2.5 μg/kg in 16 samples, between 2.5 and 10 μg/kg in 13 samples while 13 samples had AFs higher than the tolerable limit (10 μg/kg) according to the regulations of Turkish Food Codex and European Commission. The occurrence of AF fractions during powdered red pepper processing steps was also evaluated. According to the results obtained in this study, it was found that the highest AF accumulations in powdered red peppers start during perspiration and final drying of the products processed on soil contacted surfaces while there was no limit exceeding aflatoxin contamination in the samples produced on concrete surfaces. PMID:25773893

  15. Aflatoxin B1 in Affecting Broiler’s Performance, Immunity, and Gastrointestinal Tract: A Review of History and Contemporary Issues

    PubMed Central

    Yunus, Agha W.; Razzazi-Fazeli, E.; Bohm, Josef


    Aflatoxin B1 is a common contaminant of poultry feeds in tropical and subtropical climates. Research during the last five decades has well established the negative effects of the mycotoxin on health of poultry. However, the last ten years of relevant data have accentuated the potential of low levels of aflatoxin B1 to deteriorate broiler performance. In this regard, any attempt to establish a dose-effect relationship between aflatoxin B1 level and broiler performance is also complicated due to differences in types of broilers and length of exposure to the mycotoxin in different studies. Contrary to the prevalent notion regarding literature saturation with respect to aflatoxicosis of chicken, many areas of aflatoxicosis still need to be explored. Literature regarding effects of the mycotoxin on the gastrointestinal tract in this regard is particular scanty and non-conclusive. In addition to these issues, the metabolism of aflatoxin B1 and recently proposed hypotheses regarding biphasic effects of the mycotoxin in broilers are briefly discussed. PMID:22069726

  16. Comparison of nixtamalization and extrusion processes for a reduction in aflatoxin content.


    Elias-Orozco, R; Castellanos-Nava, A; Gaytán-Martínez, M; Figueroa-Cárdenas, J D; Loarca-Piña, G


    Traditional nixtamalization and an extrusion method for making the dough (masa) for corn tortillas that requires using lime and hydrogen peroxide were evaluated for the detoxification of aflatoxins. The traditional nixtamalization process reduced levels of aflatoxin B(1) (AFB(1)) by 94%, aflatoxin M(1) (AFM(1)) by 90% and aflatoxin B(1)-8,9-dihydrodiol (AFB(1)-dihydrodiol) by 93%. The extrusion process reduced levels of AFB(1) by 46%, AFM(1) by 20% and AFB(1)-dihydrodiol by 53%. Extrusion treatments with 0, 0.3 and 0.5% lime reduced AFB(1) levels by 46, 74 and 85%, respectively. The inactivation of AFB(1), AFM(1) and AFB(1)-dihydrodiol in the extrusion process using lime together with hydrogen peroxide showed higher elimination of AFB(1) than treatments with lime or hydrogen peroxide alone. The extrusion process with 0.3% lime and 1.5% hydrogen peroxide was the most effective process to detoxify aflatoxins in corn tortillas, but a high level of those reagents negatively affected the taste and aroma of the corn tortilla as compared with tortillas elaborated by the traditional nixtamalization process. PMID:12396399

  17. A comparison of the effects of aflatoxin B1 on the livers of rats and duck hepatitis B virus-infected and noninfected ducks.


    Seawright, A A; Snowden, R T; Olubuyide, I O; Riley, J; Judah, D J; Neal, G E


    A need exists for an appropriate animal model for the involvement of both hepatitis B virus infection and ingestion of aflatoxins in the etiology of liver cancer. Duck hepatitis B virus-infected ducks, on the basis of hepatoma development in the wild in China, appear to offer this possibility. The duck has been reexamined as a model system, and key metabolic processes have been assayed in comparison with the rat model for hepatocarcinogenesis. Aflatoxin B1 was found to be more actively metabolized by hepatic microsomes isolated from Pekin ducks in vitro to the aflatoxin B1-8,9-epoxide than corresponding fractions from the rat, and in vivo, higher levels of aflatoxin B1-guanine adduct were formed in hepatic DNA than in the livers of the aflatoxin B1-sensitive F344 rat. Repair of this DNA lesion in the duck and the subsequent formation of the ring-opened aflatoxin B1-FAPy adduct paralleled that in the rat. No effect of duck hepatitis B virus infection was found on any of these biochemical processes. The formation of hepatic lesions was also studied, and lesions were compared with those seen in the aflatoxin B1-treated rat. Histological analysis of necropsy specimens from ducks, 20 mo after the ducks received doses of aflatoxin B1 (25 and 50 micrograms/kg body wt), showed almost complete regression of the early acute lesions, with no evidence of neoplasia. Male F344 rats treated with aflatoxin B1 150 micrograms/kg 5 days/wk for 4 wk had extensive bile duct hyperplasia at the end of the treatment period and 100% incidence of hepatocellular carcinoma after 52 wk. The possible basis for the relative sensitivity of ducks and rats to the carcinogenic action of aflatoxin B1 is discussed. PMID:8325610

  18. New analytical techniques for mycotoxins in complex organic matrices. [Aflatoxins B1, B2, G1, and G2

    SciTech Connect

    Bicking, M.K.L.


    Air samples are collected for analysis from the Ames Solid Waste Recovery System. The high level of airborne fungi within the processing area is of concern due to the possible presence of toxic mycotoxins, and carcinogenic fungal metabolites. An analytical method has been developed to determine the concentration of aflatoxins B1, B2, G1, and G2 in the air of the plant which produces Refuse Derived Fuel (RDF). After extraction with methanol, some components in the matrix are precipitated by dissolving the sample in 30% acetonitrile/chloroform. An aliquot of this solution is injected onto a Styragel column where the sample components undergo simultaneous size exclusion and reverse phase partitioning. Additional studies have provided a more thorough understanding of solvent related non-exclusion effects on size exclusion gels. The Styragel column appears to have a useable lifetime of more than six months. After elution from Styragel, the sample is diverted to a second column containing Florisil which has been modified with oxalic acid and deactivated with water. Aflatoxins are eluted with 5% water/acetone. After removal of this solvent, the sample is dissolved in 150 of a spotting solvent and the entire sample applied to a thin layer chromatography (TLC) plate using a unique sample applicator developed here. The aflatoxins on the TLC plate are analyzed by laser fluorescence. A detection limit of 10 pg is possible for aflatoxin standards using a nitrogen laser as the excitation source. Sample concentrations are determined by comparing with an internal standard, a specially synthesized aflatoxin derivative. In two separate RDF samples, aflatoxin B1 was found at levels of 6.5 and 17.0 ppB. The analytical method has also proven useful in the analysis of contaminated corn and peanut meal samples. 42 figures, 8 tables.

  19. Aflatoxin B1 in peanut meal reference materials: intercomparisons of methods.


    Van Egmond, H P; Wagstaffe, P J


    The Community Bureau of Reference (BCR) is preparing a series of animal feed reference materials to provide a basis for analytical quality assurance for aflatoxin B1 analysis, a problem of particular importance in view of Community legislation. Before reference values can be assigned to the reference materials the major errors in the underlying measurements must be identified and reduced. This paper presents the results of two intercomparison exercises involving some 20 European laboratories who applied a wide variety of analytical methods. It is shown that the major source of error and discrepancy is connected with incomplete extraction and/or losses during clean-up and that, provided correction for recovery/background interference is made, many methods can achieve acceptable accuracy. Sources of error and their control are discussed, and essential details of the methods used are presented. It is concluded that analytical QA is more important than the use of standardized methods when a high degree of accuracy and comparability are required. PMID:2498137

  20. Immunoaffinity column cleanup with liquid chromatography for determination of aflatoxin B1 in corn samples: interlaboratory study.


    Brera, Carlo; Debegnach, Francesca; Minardi, Valentina; Pannunzi, Elena; De Santis, Barbara; Miraglia, Marina


    An interlaboratory study was conducted to evaluate the effectiveness of an immunoaffinity column cleanup liquid chromatography (LC) method for the determination of aflatoxin B1 levels in corn samples, enforced by European Union legislation. A test portion was extracted with methanol-water (80 + 20); the extract was filtered, diluted with phosphate-buffered saline solution, filtered on a microfiber glass filter, and applied to an immunoaffinity column. The column was washed with deionized water to remove interfering compounds, and the purified aflatoxin B1 was eluted with methanol. Aflatoxin B1 was separated and determined by reversed-phase LC with fluorescence detection after either pre- or postcolumn derivatization. Precolumn derivatization was achieved by generating the trifluoroacetic acid derivative, used by 8 laboratories. The postcolumn derivatization was achieved either with pyridinium hydrobromide perbromide, used by 16 laboratories, or with an electrochemical cell by the addition of bromide to the mobile phase, used by 5 laboratories. The derivatization techniques used were not significantly different when compared by the Student's t-test; the method was statistically evaluated for all the laboratories. Five corn sample materials, both spiked and naturally contaminated, were sent to 29 laboratories (22 Italian and 7 European). Test portions were spiked with aflatoxin B1 at levels of 2.00 and 5.00 ng/g. The mean values for recovery were 82% for the low level and 84% for the high contamination level. Based on results for spiked samples (blind pairs at 2 levels) as well as naturally contaminated samples (blind pairs at 3 levels), the values for relative standard deviation for repeatability (RSDr) ranged from 9.9 to 28.7%. The values for relative standard deviation for reproducibility (RSDR) ranged from 18.6 to 36.8%. The method demonstrated acceptable within- and between-laboratory precision for this matrix, as evidenced by the HorRat values. PMID:17580628

  1. Time-Resolved Fluorescent Immunochromatography of Aflatoxin B1 in Soybean Sauce: A Rapid and Sensitive Quantitative Analysis

    PubMed Central

    Wang, Du; Zhang, Zhaowei; Li, Peiwu; Zhang, Qi; Zhang, Wen


    Rapid and quantitative sensing of aflatoxin B1 with high sensitivity and specificity has drawn increased attention of studies investigating soybean sauce. A sensitive and rapid quantitative immunochromatographic sensing method was developed for the detection of aflatoxin B1 based on time-resolved fluorescence. It combines the advantages of time-resolved fluorescent sensing and immunochromatography. The dynamic range of a competitive and portable immunoassay was 0.3–10.0 µg·kg−1, with a limit of detection (LOD) of 0.1 µg·kg−1 and recoveries of 87.2%–114.3%, within 10 min. The results showed good correlation (R2 > 0.99) between time-resolved fluorescent immunochromatographic strip test and high performance liquid chromatography (HPLC). Soybean sauce samples analyzed using time-resolved fluorescent immunochromatographic strip test revealed that 64.2% of samples contained aflatoxin B1 at levels ranging from 0.31 to 12.5 µg·kg−1. The strip test is a rapid, sensitive, quantitative, and cost-effective on-site screening technique in food safety analysis. PMID:27428975

  2. Time-Resolved Fluorescent Immunochromatography of Aflatoxin B1 in Soybean Sauce: A Rapid and Sensitive Quantitative Analysis.


    Wang, Du; Zhang, Zhaowei; Li, Peiwu; Zhang, Qi; Zhang, Wen


    Rapid and quantitative sensing of aflatoxin B1 with high sensitivity and specificity has drawn increased attention of studies investigating soybean sauce. A sensitive and rapid quantitative immunochromatographic sensing method was developed for the detection of aflatoxin B1 based on time-resolved fluorescence. It combines the advantages of time-resolved fluorescent sensing and immunochromatography. The dynamic range of a competitive and portable immunoassay was 0.3-10.0 µg·kg(-1), with a limit of detection (LOD) of 0.1 µg·kg(-1) and recoveries of 87.2%-114.3%, within 10 min. The results showed good correlation (R² > 0.99) between time-resolved fluorescent immunochromatographic strip test and high performance liquid chromatography (HPLC). Soybean sauce samples analyzed using time-resolved fluorescent immunochromatographic strip test revealed that 64.2% of samples contained aflatoxin B1 at levels ranging from 0.31 to 12.5 µg·kg(-1). The strip test is a rapid, sensitive, quantitative, and cost-effective on-site screening technique in food safety analysis. PMID:27428975

  3. Improved method for confirmation of identity of aflatoxins B1 and M1 in dairy products and animal tissue extracts.


    van Egmond, H P; Stubblefield, R D


    A method is described for confirming the identity of aflatoxins B1 and M1 in dairy products and liver extracts on a thin layer plate. Extracts and standards containing aflatoxins B1 and M1 are spotted on 10 x 10 cm plates, which are developed 2-dimensionally in mixtures of isopropanol-acetone-chloroform. After the first development, trifluoroacetic acid-hexane (1 + 4) is sprayed on that part of the plate containing the separated extract components and the underdeveloped standard spots of B1 and M1, and the plate is heated 6-8 min at 75 degrees C. Then the plate is developed in a second direction, and the reaction products of B1 and M1 with trifluoroacetic acid from the extract are compared with the same derivatives of the respective standards. The method has been used successfully on extracts of milk, cheese, and liver containing 0.1 ng B1 or M1/g and can be completed in 35-45 min. PMID:6782069

  4. Aflatoxin


    ... aflatoxin may be found in the following foods: Peanuts and peanut butter Tree nuts such as pecans Corn Wheat ... the FDA tests foods that may contain aflatoxin. Peanuts and peanut butter are some of the most ...

  5. Aflatoxins

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aflatoxins are toxic and carcinogenic secondary metabolites produced primarily by the filamentous fungi, Aspergillus flavus and Aspergillus parasiticus. Aflatoxin biosynthesis is a quite complex process involving many intermediates and enzymes, regulated at multi-levels. Scientists from biochemist...

  6. Curcumin nanoparticles loaded hydrogels protects against aflatoxin B1-induced genotoxicity in rat liver.


    Abdel-Wahhab, Mosaad A; Salman, Asmaa S; Ibrahim, Mohamed I M; El-Kady, Ahmed A; Abdel-Aziem, Sekena H; Hassan, Nabila S; Waly, Ahmed I


    The current study aimed to evaluate the protective role of curcumin nanoparticles loaded hydrogels (Cur-NPs-Hgs) against AFB1-induced genotoxicity in rat liver. Animals were divided into 7 treatment groups and treated orally for 3 weeks as follow: the control group, the group treated with Hgs alone (0.5 ml/rat), the groups treated with low or high dose of Cur-NPs-Hgs (100 or 200 mg/kg b.w), the group treated with AFB1 (0.125 mg/kg b.w) and the groups treated with AFB1 plus the low or high dose of Cur-NPs-Hgs. Blood ant liver samples were collected for different biochemical, genetical, histological and histochemical analysis. The results revealed that the prepared Cur-NPs have nearly spherical shape with average size of 140 ± 20 nm and negative zeta potential value of 30.7 ± 2.57 mV. The in vivo results showed that treatment with AFB1 decreased the body weight accompanied biochemical, genotoxicity and histological disturbances. The combined treatment with AFB1 and Cur-Nps-Hgs at the two tested doses succeeded to induce a significant protection against AFB1. It could be concluded that Cur-NPs-Hgs is a promise candidate to protect against AFB1-induce liver damage in the high incidence area. Moreover, Hgs are excellent candidates as drug delivery system. PMID:27288928

  7. Determination of aflatoxins B1, B2, G1, and G2 in olive oil, peanut oil, and sesame oil using immunoaffinity column cleanup, postcolumn derivatization, and liquid chromatography/fluorescence detection: collaborative study.


    Bao, Lei; Liang, Chengzhu; Trucksess, Mary W; Xu, Yanli; Lv, Ning; Wu, Zhenxing; Jing, Ping; Fry, Fred S


    The accuracy, repeatability, and reproducibility characteristics of a method using immunoaffinity column (IAC) cleanup with postcolumn derivatization and LC with a fluorescence detector (FLD) for determination of aflatoxins (AFs; sum of AFs B1, B2, G1, and G2) in olive oil, peanut oil, and sesame oil have been established in a collaborative study involving 15 laboratories from six countries. Blind duplicate samples of blank, spiked at levels ranging from 0.25 to 20.0 microg/kg for AF, were analyzed. A naturally contaminated peanut oil sample was also included. Test samples were extracted with methanol-water (55 + 45, v/v). After shaking and centrifuging, the lower layer was filtered, diluted with water, and filtered through glass microfiber filter paper. The filtrate was then passed through an IAC, and the toxins were eluted with methanol. The toxins were then subjected to RPLC-FLD analysis after postcolumn derivatization. Average recoveries of AFs from olive oil, peanut oil, and sesame oil ranged from 84 to 92% (at spiking levels ranging from 2.0 to 20.0 microg/kg); of AFB1 from 86 to 93% (at spiking levels ranging from 1.0 to 10.0 microg/kg); of AFB2 from 89 to 95% (at spiking levels ranging from 0.25 to 2.5 microg/kg); of AFG1 from 85 to 97% (at spiking levels ranging from 0.5 to 5.0 microg/kg); and of AFG2 from 76 to 85% (at spiking levels ranging from 0.25 to 2.5 microg/kg). RSDs for within-laboratory repeatability (RSD(r)) ranged from 3.4 to 10.2% for AF, from 3.5 to 10.9% for AFB1, from 3.2 to 9.5% for AFB2, from 6.5 to 14.9% for AFG1, and from 4.8 to 14.2% for AFG2. RSDs for between-laboratory reproducibility (RSDR) ranged from 6.1 to 14.5% for AF, from 7.5 to 15.4% for AFB1, from 7.1 to 14.6% for AFB2, from 10.8 to 18.1% for AFG1, and from 7.6 to 23.7% for AFG2. Horwitz ratio values were < or = 2 for the analytes in the three matrixes. PMID:23451385

  8. Effects of maternal exposure to aflatoxin B1 during pregnancy on fertility output of dams and developmental, behavioral and reproductive consequences in female offspring using a rat model.


    Supriya, Ch; Akhila, B; Pratap Reddy, K; Girish, B P; Sreenivasula Reddy, P


    A suboptimal in utero environment can have detrimental effects on the pregnancy and long-term adverse "programing" effects on the offspring. Aflatoxin B1 is one of the potent reproductive toxicants and currently detected in both milk and tissues. This article focuses on the effects of prenatal exposure to graded doses of aflatoxin B1 on the pregnancy outcomes of dams and postnatal developments of the female offspring, since these issues have ethological relevance in both animals and humans. Pregnant Wistar rats were injected intramuscularly with vehicle or aflatoxin B1 (10, 20, 50 or 100 μg/kg body weight/day) on days 12-19 of gestation. At parturition, newborns were observed for clinical signs of toxicity and survival. The female offspring were examined through a battery of tests in order to evaluate their developmental, behavioral and reproductive end points. All animals were born alive. The litter size of the aflatoxin B1 treated rats was comparable to the controls. However, the birth weight of the pups in the experimental group was significantly lower when compared to controls. Significant and persistent lags in cliff avoidance, negative geotaxis, surface rightening activity and ascending wire mesh, with a delay in elapsed time for vaginal opening were detected in the female progeny exposed to aflatoxin B1 during embryonic development. The locomotor activity and exploratory behavior in experimental females were significantly decreased than that of controls. Embryonic exposure to aflatoxin B1 also resulted in prolonged stress response, irregular estrus and suppressed fertility output in the progeny at their adulthood. These results indicate that in utero exposure to aflatoxin B1 severely compromised postnatal development of neonatal rats and caused irregular estrus that was accompanied by suppressed fertility output. PMID:26956420

  9. Aflatoxin metabolism in humans: detection of metabolites and nucleic acid adducts in urine by affinity chromatography

    SciTech Connect

    Groopman, J.D.; Donahue, P.R.; Zhu, J.Q.; Chen, J.S.; Wogan, G.N.


    A high-affinity IgM monoclonal antibody specific for aflatoxins was covalently bound to Sepharose 4B and used as a preparative column to isolate aflatoxin derivatives from the urine of people and experimental animals who had been exposed to the carcinogen environmentally or under laboratory conditions. Aflatoxin levels were quantified by radioimmunoassay and high-performance liquid chromatography after elution from the affinity column. In studies on rats injected with ( UC)aflatoxin B1, the authors identified the major aflatoxin-DNA adduct, 2,3-dihydro-2-(N7-guanyl)-3-hydroxy-aflatoxin B1 (AFB1-N7-Gua), and the oxidative metabolites M1 and P1 as the major aflatoxin species present in the urine. When this methodology was applied to human urine samples obtained from people from the Guangxi Province of China exposed to aflatoxin B1 through dietary contamination, the aflatoxin metabolites detected were also AFB1-N7-Gua and aflatoxins M1 and P1. Therefore, affinity chromatography using a monoclonal antibody represents a useful and rapid technique with which to isolate this carcinogen and its metabolites in biochemical epidemiology and for subsequent quantitative measurements, providing exposure information that can be used for risk assessment.

  10. Molecular cloning and heterologous expression of a cDNA encoding a mouse glutathione S-transferase Yc subunit possessing high catalytic activity for aflatoxin B1-8,9-epoxide.

    PubMed Central

    Hayes, J D; Judah, D J; Neal, G E; Nguyen, T


    Resistance to the carcinogenic effects of aflatoxin B1 (AFB1) in the mouse is due to the constitutive expression of an Alpha-class glutathione S-transferase (GST), YcYc, with high detoxification activity towards AFB1-8,9-epoxide. A cDNA clone (pmusGST Yc) for a murine GST Yc polypeptide has been isolated. Sequencing has shown the cDNA insert of pmusGST Yc to be 922 bp in length, with an open reading frame of 663 bp that encodes a polypeptide of M(r) 25358. The primary structure of the murine GST Yc subunit predicted by pmusGST Yc is in complete agreement with the partial amino acid sequence of the aflatoxin-metabolizing mouse liver GST described previously [McLellan, Kerr, Cronshaw & Hayes (1991) Biochem. J. 276, 461-469]. A plasmid, termed pKK-musGST Yc, which permits the expression of the murine Yc subunit in Escherichia coli, has been constructed. The murine GST expressed in E. coli was purified and found to be catalytically active towards several GST substrates, including AFB1-8,9-epoxide. This enzyme was also found to possess electrophoretic and immunochemical properties closely similar to those of the GST Yc subunit from mouse liver. However, the GST synthesized in E. coli and the constitutive mouse liver Alpha-class GST exhibited small differences in their chromatographic behaviour during reverse-phase h.p.l.c. Automated Edman degradation revealed alanine to be the N-terminal amino acid in the GST Yc subunit expressed in E. coli, whereas the enzyme in mouse liver possesses a blocked N-terminus. Although sequencing showed that the purified Yc subunit from E. coli lacked the initiator methionine, the amino acid sequence obtained over the first eleven N-terminal residues agreed with that predicted from the cDNA clone, pmusGST Yc. Comparison of the deduced amino acid sequence of the mouse Yc polypeptide with the primary structures of the rat Alpha-class GST enzymes revealed that it is more closely related to the ethoxyquin-induced rat liver Yc2 subunit than to

  11. Chronic aflatoxin exposure in children living in Bhaktapur, Nepal: Extension of the MAL-ED study

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fumonisin B1 (FB1) and aflatoxin B1 (AFB1) are toxic chemicals produced by molds. The molds that produce these two toxic chemicals are commonly found in corn and their co-occurence in corn has been demonstrated in many surveys. This study was conducted because it is suspected that exposure to eith...

  12. Survey of aflatoxins in watermelon seeds from Iran using immunoaffinity column cleanup and HPLC with fluorescence detection.


    Feizy, J; Beheshti, H R; Fakoor Janati, S S; Khoshbakht Fahim, N


    This survey was undertaken to determine the levels of aflatoxins in melon seeds. Among 65 samples analyzed by liquid chromatography (LC), the results showed that aflatoxin B1 (AFB1) was the major toxins in melon seeds, detected in 58 samples (89.2% of the total) at an average concentration of 8.5 ng g(-1). The level of AFB1 in 12 samples exceeded the maximum tolerated level for AFB1 in Iranian (5 ng g(-1)) regulations; in other words, 18.5% of samples were unfit for human consumption. PMID:24785721

  13. Reduction of Aflatoxins in Apricot Kernels by Electronic and Manual Color Sorting

    PubMed Central

    Zivoli, Rosanna; Gambacorta, Lucia; Piemontese, Luca; Solfrizzo, Michele


    The efficacy of color sorting on reducing aflatoxin levels in shelled apricot kernels was assessed. Naturally-contaminated kernels were submitted to an electronic optical sorter or blanched, peeled, and manually sorted to visually identify and sort discolored kernels (dark and spotted) from healthy ones. The samples obtained from the two sorting approaches were ground, homogenized, and analysed by HPLC-FLD for their aflatoxin content. A mass balance approach was used to measure the distribution of aflatoxins in the collected fractions. Aflatoxin B1 and B2 were identified and quantitated in all collected fractions at levels ranging from 1.7 to 22,451.5 µg/kg of AFB1 + AFB2, whereas AFG1 and AFG2 were not detected. Excellent results were obtained by manual sorting of peeled kernels since the removal of discolored kernels (2.6%–19.9% of total peeled kernels) removed 97.3%–99.5% of total aflatoxins. The combination of peeling and visual/manual separation of discolored kernels is a feasible strategy to remove 97%–99% of aflatoxins accumulated in naturally-contaminated samples. Electronic optical sorter gave highly variable results since the amount of AFB1 + AFB2 measured in rejected fractions (15%–18% of total kernels) ranged from 13% to 59% of total aflatoxins. An improved immunoaffinity-based HPLC-FLD method having low limits of detection for the four aflatoxins (0.01–0.05 µg/kg) was developed and used to monitor the occurrence of aflatoxins in 47 commercial products containing apricot kernels and/or almonds commercialized in Italy. Low aflatoxin levels were found in 38% of the tested samples and ranged from 0.06 to 1.50 μg/kg for AFB1 and from 0.06 to 1.79 μg/kg for total aflatoxins. PMID:26797635

  14. A multiplex chemiluminescent biosensor for type B-fumonisins and aflatoxin B1 quantitative detection in maize flour.


    Zangheri, Martina; Di Nardo, Fabio; Anfossi, Laura; Giovannoli, Cristina; Baggiani, Claudio; Roda, Aldo; Mirasoli, Mara


    A multiplex chemiluminescent biosensor for simple, rapid and ultrasensitive on-site quantification of aflatoxin B1 and type B-fumonisins in maize samples has been developed. The biosensor integrates a multiplex indirect competitive lateral flow immunoassay (LFIA) based on enzyme-catalyzed chemiluminescence detection and a highly sensitive portable charge-coupled device (CCD) camera, employed in a lensless "contact" imaging configuration. The developed assay requires a simple extraction of the analytes from maize flour samples followed by their detection with a 30 min assay time. The use of chemiluminescence detection allowed accurate and objective analytes quantification, enabling simultaneous detection of type B-fumonisins and aflatoxin B1 down to 6 μg kg(-1) and 1.5 μg kg(-1), respectively, thus fulfilling the standards imposed by the legislation of European Union. Maize flour samples spiked with both analytes were subjected to multiplex analysis obtaining recoveries ranging from 80 to 115% and the coefficient of variation below 20%. Finally, analysis of naturally contaminated maize samples resulted in a good agreement between CL-LFIA and a validated confirmatory HPLC-UV and commercial ELISA kit, obtaining recoveries in the range 88-120%. The proposed CL-LFIA protocol is rapid, inexpensive, easy-to-use, and fit for the purpose of rapid screening of mycotoxins in maize flour. PMID:25374970

  15. Cinnamaldehyde inhibits fungal growth and aflatoxin B1 biosynthesis by modulating the oxidative stress response of Aspergillus flavus.


    Sun, Qi; Shang, Bo; Wang, Ling; Lu, Zhisong; Liu, Yang


    Cinnamaldehyde (CIN) is a promising natural preservative and generally recognized as safe for commodities as well as consumers. In this work, the antifungal effects of CIN on Aspergillus flavus were evaluated both in solid and in liquid culture conditions. Our results indicated that CIN effectively inhibited radial growth, spore production, mycelium formation, and aflatoxin B1 biosynthesis by A. flavus in a dose-dependent manner. At the concentration of 104 mg L(-1), CIN exposure was able to completely inhibit fungal growth as well as aflatoxin B1 production. Furthermore, the inhibitory activities of CIN were closely connected with the treatment period and the tested fungal species. Compared with the control strains, CIN dose dependently changed the morphology and ultrastructure of mycelium in different degree. Especially, the reduction of hydrogen peroxide was considered to follow the destruction of mitochondrial. Meanwhile, CIN significantly cut the levels of lipid peroxidation and reduced glutathione. The activity of total superoxide dismutase was significantly inhibited after CIN treatment at the end of incubation, whereas the activities of catalase and glutathione peroxidase were opposite. These results indicated that the inhibitory effect of CIN could attribute to oxidative stress alleviation possibly induced by modifications of cellular structure as well as redox status. PMID:26585445

  16. Efficacy of Some Essential Oils Against Aspergillus flavus with Special Reference to Lippia alba Oil an Inhibitor of Fungal Proliferation and Aflatoxin B1 Production in Green Gram Seeds during Storage.


    Pandey, Abhay K; Sonker, Nivedita; Singh, Pooja


    During mycofloral analysis of green gram (Vigna radiata (L.) R. Wilczek) seed samples taken from different grocery stores by agar and standard blotter paper methods, 5 fungal species were identified, of which Aspergillus flavus exhibited higher relative frequency (75.20% to 80.60%) and was found to produce aflatoxin B1 . On screening of 11 plant essential oils against this mycotoxigenic fungi, Lippia alba essential oil was found to be most effective and showed absolute inhibition of mycelia growth at 0.28 μL/mL. The oil of L. alba was fungistatic and fungicidal at 0.14 and 0.28 μL/mL, respectively. Oil had broad range of fungitoxicity at its MIC value and was absolutely inhibited the AFB1 production level at 2.0 μL/mL. Chemical analysis of this oil revealed geranial (36.9%) and neral (29.3%) as major components followed by myrcene (18.6%). Application of a dose of 80 μL/0.25 L air of Lippia oil in the storage system significantly inhibited the fungal proliferation and aflatoxin production without affecting the seed germination rate. By the virtue of fungicidal, antiaflatoxigenic nature and potent efficacy in storage food system, L. alba oil can be commercialized as botanical fungicide for the protection of green gram seeds during storage. PMID:26928885

  17. Mycobiota and Aflatoxin B1 in Feed for Farmed Sea Bass (Dicentrarchus labrax)

    PubMed Central

    Almeida, Inês Filipa Martins; Martins, Hermínia Marina Lourdes; Santos, Sara Maria Oliveira; Freitas, Maria Suzana; da Costa, José Manuel Gaspar Nunes; d´Almeida Bernardo, Fernando Manuel


    Thesafety characteristics of feed used in fish and crustacean aquaculture systems are an essential tool to assure the productivity of those animal exploitations. Safety of feed may be affected by different hazards, including biological and chemical groups. The aim of this preliminary study was to evaluate fungi contamination and the presence of aflatoxins in 87 samples of feed for sea bass, collected in Portugal. Molds were found in 35 samples (40.2%) in levels ranging from 1 to 3.3 log10 CFU∙g−1. Six genera of molds were found. Aspergillus flavus was the most frequent, found in all positive samples, with a range from 2 to 3.2 log10 CFU∙g−1. Aspergillus niger was found in 34 samples (39.1%), ranging from 1 to 2.7 log10 CFU∙g−1. Aspergillus glaucus was found in 26 samples (29.9%) with levels between 1 and 2.4 log10 CFU∙g−1. Penicillium spp. and Cladosporium spp. were both found in 25 samples (28.7%). Fusarium spp. was found in 22 samples (25.3%), ranging from 1 to 2.3 log10 CFU∙g−1. All feed samples were screened for aflatoxins using a HPLC technique, with a detection limit of 1.0 μg∙kg−1. All samples were aflatoxin negative. PMID:22069703

  18. Aspergillus flavus aflatoxin occurrence and expression of aflatoxin biosynthesis genes in soil.


    Accinelli, Cesare; Abbas, H K; Zablotowicz, R M; Wilkinson, J R


    The carcinogen aflatoxin B1 (AFB1) produced by Aspergillus flavus is a major food safety concern in crops. However, information on AFB1 occurrence in soil and crop residue is scarce. A series of experiments investigated the occurrence of AFB1 in soil and corn residues and ascertained the ecology of A. flavus in a Dundee silt loam soil. Samples of untilled soil (0-2 cm) and residues were collected in March 2007 from plots previously planted with a corn isoline containing the Bacillus thuringiensis (Bt) endotoxin gene or the parental non-Bt isoline. AFB1 levels were significantly different in various corn residues. The highest AFB1 levels were observed in cobs containing grain, with 145 and 275 ng.g-1 in Bt and non-Bt, respectively (P > or = F = 0.001). Aflatoxin levels averaged 3.3 and 9.6 ng.g-1 in leaves and (or) stalks and cobs without grain, respectively. All soils had AFB1 ranging from 0.6 to 5.5 ng.g-1 with similar levels in plots from Bt and non-Bt corn. Based on cultural methods, soil contained from log10 3.1 to 4.5 A. flavus cfu.g-1 with about 60% of isolates producing aflatoxin. Laboratory experiments demonstrated that AFB1 is rapidly degraded in soil at 28 degrees C (half-life < or = 5 days). The potential of the soil A. flavus to produce aflatoxins was confirmed by molecular methods. Transcription of 5 aflatoxin biosynthesis genes, including aflD, aflG, aflP, aflR, and aflS, were detected by reverse transcription - polymerase chain reaction analysis in soil. Although AFB1 appears to be transient in soils, it is clear that AFB1 is produced in surface soil in the presence of corn residues, as indicated by A. flavus cfu levels, AFB1 detection, and expression of aflatoxin biosynthetic genes. PMID:18449222

  19. Exposure of newborns to aflatoxin M1 and B1 from mothers' breast milk in Ankara, Turkey.


    Gürbay, A; Sabuncuoğlu, S Atasayar; Girgin, G; Sahin, G; Yiğit, S; Yurdakök, M; Tekinalp, G


    Aflatoxins (AFs) are important risks for human health due to their widespread presence in foods and environment. However, contamination risk of breast milk with different pollutants including AFs is high in today's life conditions. Since breast milk is a major nutrient for infants, feeding of infants with safe milk is essential. Therefore, the objective of this study was to determine the levels of AF M(1) and B(1) in breast milk samples collected from 75 mothers in Ankara, Turkey. AF M(1) and B(1) levels were investigated by high performance liquid chromatography (HPLC) with a fluorescence detector following an extraction procedure. The limit of detection was found to be 5 ng/l. Both AFs were detected in diverse degrees in all breast milk samples: The level of AF M(1) were in the ranges of 60.90-299.99 ng/l, and AF B(1) were in the ranges of 94.50-4123.80 ng/l. These results pointed out the exposure of mothers and neonates to AF M(1) and B(1), and the necessity of further research on mycotoxin contamination both in foods and biological fluids as well as protection strategies. PMID:19850097

  20. Aflatoxin


    Although aflatoxins are known to cause cancer in animals, the U.S. Food and Drug Administration (FDA) allows them at low levels in nuts, seeds, and legumes because they are considered "unavoidable ...

  1. Embryotoxicity assay of aflatoxin produced by Aspergillus parasiticus NRRL 2999.


    Celik, I; Oğuz, H; Demet, O; Boydak, M; Dönmez, H H; Sur, E; Nizamlioğlu, F


    1. The embryotoxicity of mixed aflatoxins (AF) and aflatoxin B1 (AFB1) were evaluated by a modified chick embryotoxicity screening test (CHEST). Adverse effects on the early embryonic development of thymus and bursa of Fabricius were also investigated by light microscopy. AF consisted of 83.06% AFB1, 12.98% AFB2, 2.84% AFG1 and 1.12% AFG2. 2. A total of 448 fertilised laying hens' eggs were used. AF and AFB1 were injected into the eggs at doses of 10, 100 and 1000 ng/egg. Embryonic developmental stages were evaluated according to the Hamburger-Hamilton scale (HH-scale). 3. The results showed that AFB1 given at 10 ng/egg had a significantly (P<0.05) greater embryotoxic effect than AF given at a similar dose. The higher doses of both AF and AFB1 caused higher embryonic mortality and also an increase in early deaths. 4. In the groups receiving 100 ng/egg AF and AFB1 an abnormal development was seen, with a protruded central region, corresponding to the area pellucida of the blastoderm. No other developmental abnormality attributable to AF or AFB1 was found. PMID:11128380

  2. Co-exposure to fumonisins and aflatoxins in maize-based foods in central america: guatemala as a case study

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aflatoxin B1 (AFB1) is a human liver carcinogen having a genotoxic mechanism of action. The ceramide synthase inhibitor fumonisin B1 (FB1) is a liver cancer promoter in rats and trout. Both mycotoxins are found in maize so that the possibility of co-exposure is a health concern, especially in Centra...

  3. Crosstalk-eliminated quantitative determination of aflatoxin B1-induced hepatocellular cancer stem cells based on concurrent monitoring of CD133, CD44, and aldehyde dehydrogenase1.


    Ju, Hee; Shim, Yumi; Arumugam, Parthasarathy; Song, Joon Myong


    Cancer stem cells (CSCs), known as tumor initiating cells, have become a critically important issue for cancer therapy. Although much research has demonstrated the induction of hepato cellular carcinoma by aflatoxin B1, the formation of hepatocellular CSCs and their quantitative determination is hardly reported. In this work, it was found that hepatocellular CSCs were produced from HepG2 cells by aflatoxin B1-induced mutation, and their amount was quantitatively determined using crosstalk-eliminated multicolor cellular imaging based on quantum dot (Qdot) nanoprobes and an acousto-optical tunable filter (AOTF). Hepatocellular CSCs were acquired via magnetic bead-based sorting and observed using concurrent detection of three different markers: CD133, CD44, and aldehyde dehydrogenase1 (ALDH1). The DNA mutation of HepG2 cells caused by aflatoxin B1 was quantitatively observed via absorbance spectra of aflatoxin B1-8, 9-epoxide-DNA adducts. The percentages of hepatocellular CSCs formed in the entire HepG2 cells were determined to be 9.77±0.65%, 10.9±1.39%, 11.4±1.32%, and 12.8±0.7%, respectively, at 0 μM, 5 μM, 10 μM, and 20 μM of aflatoxin B1. The results matched well with those obtained utilizing flow cytometry. This study demonstrates that aflatoxin mediated mutation induced the conversion of hepatic cancer cell to hepatic CSCs by using a Qdot based constructed multicolor cellular imaging system. PMID:26739636

  4. Antigenotoxic Studies of Different Substances to Reduce the DNA Damage Induced by Aflatoxin B1 and Ochratoxin A

    PubMed Central

    Madrigal-Santillán, Eduardo; Morales-González, José A.; Vargas-Mendoza, Nancy; Reyes-Ramírez, Patricia; Cruz-Jaime, Sandra; Sumaya-Martínez, Teresa; Pérez-Pastén, Ricardo; Madrigal-Bujaidar, Eduardo


    Mycotoxins are produced mainly by the mycelial structure of filamentous fungi, or more specifically, molds. These secondary metabolites are synthesized during the end of the exponential growth phase and appear to have no biochemical significance in fungal growth and development. The contamination of foods and feeds with mycotoxins is a significant problem for the adverse effects on humans, animals, and crops that result in illnesses and economic losses. The toxic effect of the ingestion of mycotoxins in humans and animals depends on a number of factors including intake levels, duration of exposure, toxin species, mechanisms of action, metabolism, and defense mechanisms. In general, the consumption of contaminated food and feed with mycotoxin induces to neurotoxic, immunosuppressive, teratogenic, mutagenic, and carcinogenic effect in humans and/or animals. The most significant mycotoxins in terms of public health and agronomic perspective include the aflatoxins, ochratoxin A (OTA), trichothecenes, fumonisins, patulin, and the ergot alkaloids. Due to the detrimental effects of these mycotoxins, several strategies have been developed in order to reduce the risk of exposure. These include the degradation, destruction, inactivation or removal of mycotoxins through chemical, physical and biological methods. However, the results obtained with these methods have not been optimal, because they may change the organoleptic characteristics and nutritional values of food. Another alternative strategy to prevent or reduce the toxic effects of mycotoxins is by applying antimutagenic agents. These substances act according to several extra- or intracellular mechanisms, their main goal being to avoid the interaction of mycotoxins with DNA; as a consequence of their action, these agents would inhibit mutagenesis and carcinogenesis. This article reviews the main strategies used to control AFB1 and ochratoxin A and contains an analysis of some antigenotoxic substances that reduce the

  5. Monoclonal IgA Antibodies for Aflatoxin Immunoassays

    PubMed Central

    Ertekin, Özlem; Pirinçci, Şerife Şeyda; Öztürk, Selma


    Antibody based techniques are widely used for the detection of aflatoxins which are potent toxins with a high rate of occurrence in many crops. We developed a murine monoclonal antibody of immunoglobulin A (IgA) isotype with a strong binding affinity to aflatoxin B1 (AFB1), aflatoxin B2 (AFB2), aflatoxin G1 (AFG1), aflatoxin G2 (AFG2) and aflatoxin M1 (AFM1). The antibody was effectively used in immunoaffinity column (IAC) and ELISA kit development. The performance of the IACs was compatible with AOAC performance standards for affinity columns (Test Method: AOAC 991.31). The total binding capacity of the IACs containing our antibody was 111 ng, 70 ng, 114 ng and 73 ng for AFB1, AFB2, and AFG1 andAFG2, respectively. Furthermore, the recovery rates of 5 ng of each AF derivative loaded to the IACs were determined as 104.9%, 82.4%, 85.5% and 70.7% for AFB1, AFB2, AFG1 and AFG2, respectively. As for the ELISA kit developed using non-oriented, purified IgA antibody, we observed a detection range of 2–50 µg/L with 40 min total test time. The monoclonal antibody developed in this research is hitherto the first presentation of quadruple antigen binding IgA monoclonal antibodies in mycotoxin analysis and also the first study of their utilization in ELISA and IACs. IgA antibodies are valuable alternatives for immunoassay development, in terms of both sensitivity and ease of preparation, since they do not require any orientation effort. PMID:27187470

  6. Monoclonal IgA Antibodies for Aflatoxin Immunoassays.


    Ertekin, Özlem; Pirinçci, Şerife Şeyda; Öztürk, Selma


    Antibody based techniques are widely used for the detection of aflatoxins which are potent toxins with a high rate of occurrence in many crops. We developed a murine monoclonal antibody of immunoglobulin A (IgA) isotype with a strong binding affinity to aflatoxin B1 (AFB1), aflatoxin B2 (AFB2), aflatoxin G1 (AFG1), aflatoxin G2 (AFG2) and aflatoxin M1 (AFM1). The antibody was effectively used in immunoaffinity column (IAC) and ELISA kit development. The performance of the IACs was compatible with AOAC performance standards for affinity columns (Test Method: AOAC 991.31). The total binding capacity of the IACs containing our antibody was 111 ng, 70 ng, 114 ng and 73 ng for AFB1, AFB2, and AFG1 andAFG2, respectively. Furthermore, the recovery rates of 5 ng of each AF derivative loaded to the IACs were determined as 104.9%, 82.4%, 85.5% and 70.7% for AFB1, AFB2, AFG1 and AFG2, respectively. As for the ELISA kit developed using non-oriented, purified IgA antibody, we observed a detection range of 2-50 µg/L with 40 min total test time. The monoclonal antibody developed in this research is hitherto the first presentation of quadruple antigen binding IgA monoclonal antibodies in mycotoxin analysis and also the first study of their utilization in ELISA and IACs. IgA antibodies are valuable alternatives for immunoassay development, in terms of both sensitivity and ease of preparation, since they do not require any orientation effort. PMID:27187470

  7. Aflatoxins in various food from Istanbul, Turkey.


    Hacıbekiroğlu, I; Kolak, U


    The present work reports the total aflatoxin and aflatoxin B1 levels in 62 food samples from Istanbul, Turkey. The total aflatoxin content in dried American cucumber, squash, tomato, okra and saffron samples was found to be 1.7 μg/kg. AFB1 levels in five dried vegetables (red bell pepper, American cucumber, squash, tomato and okra), two tea (linden and jasmine flower) and three spice samples (cardamom, galangal and saffron) were 1 μg/kg. Of the tested samples, 76% exceeded legal limits of total aflatoxin. The highest levels were determined in chestnut (232.9 μg/kg), nutmeg (206.1 μg/kg) and sumac (182.5 μg/kg). These findings confirm the existing knowledge that food should be regularly and effectively controlled. PMID:24779934

  8. The furofuran-ring selectivity, hydrogen peroxide-production and low Km value are the three elements for highly effective detoxification of aflatoxin oxidase.


    Wu, Yuan-Zhen; Lu, Fu-Pu; Jiang, Hai-Lan; Tan, Cui-Ping; Yao, Dong-Sheng; Xie, Chun-Fang; Liu, Da-Ling


    AFO (aflatoxin oxidase), an enzyme from Armillariella tabescens previously named aflatoxin detoxifizyme, exhibits oxidative detoxification activity toward aflatoxin B1 and sterigmatocystin. Bioinformatics reveals that AFO is a newly discovered oxidase because AFO does not share any significant similarities with any known oxidase. It is critically important to understand how AFO acts on aflatoxin B1. In this study, in addition to aflatoxin B1 (AFB1) and sterigmatocystin (ST), five other chemicals that have furan or pyran structures were investigated. The results indicated that in addition to AFB1 and ST, AFO is also able to act on versicolorin A, 3,4-dihydro-2H-pyran and furan. These results suggested that 8,9-unsaturated carboncarbon bond of aflatoxin B1 is the potential reactive site for AFO. Further findings indicated that the action of AFO is oxygen-dependent and hydrogen peroxide-producing. The simultaneously produced-hydrogen peroxide possibly plays the essential role in detoxification of AFO. In addition, the extremely low Km value of 0.33 µmol/l for AFO-AFB1 and 0.11 µmol/l for AFO-ST signifies that AFO is highly selective for AFB1 as well as ST. PMID:25533793

  9. Use of Cold Atmospheric Plasma to Detoxify Hazelnuts from Aflatoxins

    PubMed Central

    Siciliano, Ilenia; Spadaro, Davide; Prelle, Ambra; Vallauri, Dario; Cavallero, Maria Chiara; Garibaldi, Angelo; Gullino, Maria Lodovica


    Aflatoxins, produced by Aspergillus flavus and A. parasiticus, can contaminate different foodstuffs, such as nuts. Cold atmospheric pressure plasma has the potential to be used for mycotoxin detoxification. In this study, the operating parameters of cold atmospheric pressure plasma were optimized to reduce the presence of aflatoxins on dehulled hazelnuts. First, the effect of different gases was tested (N2, 0.1% O2 and 1% O2, 21% O2), then power (400, 700, 1000, 1150 W) and exposure time (1, 2, 4, and 12 min) were optimized. In preliminary tests on aflatoxin standard solutions, this method allowed to obtain a complete detoxification using a high power for a few minutes. On hazelnuts, in similar conditions (1000 W, 12 min), a reduction in the concentration of total aflatoxins and AFB1 of over 70% was obtained. Aflatoxins B1 and G1 were more sensitive to plasma treatments compared to aflatoxins B2 and G2, respectively. Under plasma treatment, aflatoxin B1 was more sensitive compared to aflatoxin G1. At the highest power, and for the longest time, the maximum temperature increment was 28.9 °C. Cold atmospheric plasma has the potential to be a promising method for aflatoxin detoxification on food, because it is effective and it could help to maintain the organoleptic characteristics. PMID:27128939

  10. High sensitive and throughput screening of Aflatoxin using MALDI-TOF-TOF-PSD-MS/MS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have achieved sensitive and efficient detection of aflatoxin B1(AFB1) through matrix-assisted laser desorption/ionization time-of-flight-time-of-flight mass spectrometry (MALDI-TOF-TOF) and post-source decay (PSD) tandem mass spectrometry (MS/MS) using an acetic acid – a-cyano-4-hydroxycinnamic a...

  11. Efficacy of sodium bentonite as a detoxifier of broiler feed contaminated with aflatoxin and fumonisin.


    Miazzo, R; Peralta, M F; Magnoli, C; Salvano, M; Ferrero, S; Chiacchiera, S M; Carvalho, E C Q; Rosa, C A R; Dalcero, A


    Sodium bentonite (SB) was evaluated for its ability to reduce the deleterious effects of fumonisin B1 (FB1) and aflatoxin B1 (AFB1) in broiler diets. It was incorporated into the diets (0.3%) containing 2.5 mg/kg AFB1, 200 mg/kg FB1, or a combination of 2.5 mg/kg AFB1 and 200 mg/kg FB1. Aflatoxin B1 significantly diminished body weight gain, whereas FB1 or the combination of FB1 and SB had no effect. Addition of SB in the diets significantly diminished the inhibitory effects of dietary AFB1. Feeding AFB1 alone caused significant increases in the relative weights of most observed organs. Feeding FB1 alone did not alter relative weights of any organs. In the combined diet (AFB1 plus FB1) relative weights of the liver, kidney, gizzard, and spleen were increased. Addition of SB to the diet containing AFB1 diminished the relative weights of liver, kidney, and spleen. Addition of SB to diets containing AFB1 and FB1 only decreased liver weights. In relation to the control, lower serum levels of total protein, albumin, and globulins were observed for all AFB, containing diets without SB addition, whereas all other treatments were not altered. Livers of birds fed diets containing AFB1 and a combination of AFB1 and FB1 were enlarged, yellowish, friable, and had rounded borders. The histopathology of them, stained with hematoxylin and eosin, showed multifocal and varied cytoplasmatic vacuolization with perilobular location. Incorporation of SB reduced the incidence and severity of the hepatic histopathology changes associated with aflatoxicosis. PMID:15685935

  12. [Biological contamination by micromycetes in dried Boletus edulis: research of aflatoxin B1, B2 G1, G2 and ochratoxin A].


    Lorini, C; Rossetti, F; Palazzoni, S; Comodo, N; Bonaccorsi, G


    Aim of this survey is to identify those filamentous fungi which parasite Boletus edulis and its group and check the potential presence of secondary metabolites, specifically aflatoxin B1, total aflatoxins and ochratoxin A, in order to assess the risk to consumers' health. Forty samples of dried Boletus edulis, collected by two food industries which distribute the product in many Italian regions, have been analysed. The sampling plan has been conducted from November 2005 to March 2006, collecting 50 g from each commercial category of dried Boletus edulis available in the factory at the time of sampling. All the samples have been tested by visual macroscopic and stereoscopic assays; for some samples--those referred to commercial category presumably at higher risk--we have performed cultural assays as well, typization of isolated micromycetes, extraction and quantification of aflatoxins and ochratoxin A. Mycotoxin detection has been made by HPLC, using the UNI EN 14123 and UNI EN 14132 standard methods, respectively applied to aflatoxins determination in peanuts, pistachios, figs and paprika and to ochratoxin A in barley and coffee. Non pathogenic micromycetes, common in food products, have been frequently observed in cultural assays, while Aspergillus flavus and Aspergillus niger have been found in some samples. However the concentration of aflatoxins was always under the quantification limit. The survey confirm that, if the cold chain is kept throughout the process and the distribution, Boletus edulis and analogue mycetes are not a favourable substratum for the growth and the development of moulds. PMID:19238880

  13. Immunomagnetic bead-based recovery and real time quantitative PCR (RT iq-PCR) for sensitive quantification of aflatoxin B(1).


    Babu, Dinesh; Muriana, Peter M


    Aflatoxin B(1) is an unavoidable natural mycotoxin that enters the food chain by contamination of food grains and feedstuffs, potentially posing carcinogenic risks to animal and human health. Immuno-PCR methods have the potential to address the need of meeting the regulatory limits by detecting trace levels of toxins present in food and animal feeds. This paper describes a real-time immuno-quantitative PCR (RT-iqPCR) assay for quantification of aflatoxin B(1) suspended in methanol:water solution that can also serve as an extraction solvent. Immuno-PCR approaches were examined including direct vs. indirect sandwich assays using monoclonal vs. polyclonal antibodies. Our best approach was obtained using monoclonal antibodies to capture aflatoxin in solution prior to immobilizing the F(c) portion of the capture antibodies onto to protein G magnetic beads. This was followed by the addition of a polyclonal 'signal antibody' tethered with an oligonucleotide template for a subsequent PCR assay. The RT-iqPCR assay described herein leads to the sensitive detection and quantification of aflatoxin B(1) from 10ppb down to 0.1ppb with high correlation (r(2)=0.97) and efficiency (99.5%). The approach also detected the high-dose 'hook effect' phenomenon (excess antigen) which was overcome by the use of dilution protocols to eliminate false negatives that may occur at levels above quantification limits of the assay. The RT-iqPCR approach discussed here is presented as a model system that could easily be adapted for aflatoxin detection in a variety of food or animal feed samples using a simple methanol:water solution as an extraction solvent. PMID:21596071

  14. Rapid analysis of aflatoxins B1, B2, and ochratoxin A in rice samples using dispersive liquid-liquid microextraction combined with HPLC.


    Lai, Xian-Wen; Sun, Dai-Li; Ruan, Chun-Qiang; Zhang, He; Liu, Cheng-Lan


    A novel, simple, and rapid method is presented for the analysis of aflatoxin B1, aflatoxin B2, and ochratoxin A in rice samples by dispersive liquid-liquid microextraction combined with LC and fluorescence detection. After extraction of the rice samples with a mixture of acetonitrile/water/acetic acid, mycotoxins were rapidly partitioned into a small volume of organic solvent (chloroform) by dispersive liquid-liquid microextraction. The three mycotoxins were simultaneously determined by LC with fluorescence detection after precolumn derivatization for aflatoxin B1 and B2. Parameters affecting both extraction and dispersive liquid-liquid microextraction procedures, including the extraction solvent, the type and volume of extractant, the volume of dispersive solvent, the addition of salt, the pH and the extraction time, were optimized. The optimized protocol provided an enrichment factor of approximately 1.25 and with detection of limits (0.06-0.5 μg/kg) below the maximum levels imposed by current regulations for aflatoxins and ochratoxin A. The mean recovery of three mycotoxins ranged from 82.9-112%, with a RSD less than 7.9% in all cases. The method was successfully applied to measure mycotoxins in commercial rice samples collected from local supermarkets in China. PMID:24243826

  15. Development of a microwave-assisted-extraction-based method for the determination of aflatoxins B1, G1, B2, and G2 in grains and grain products.


    Chen, Si; Zhang, Hong


    This article describes the use of microwave-assisted extraction (MAE) as a pretreatment technique for the determination of aflatoxins B(1), G(1), B(2), and G(2) in grains and grain products. The optimal operation parameters, including extraction solvent, temperature, and time, were identified to be acetonitrile as the extraction solvent at 80 °C with 15 min of MAE. The extracts were cleaned up using solid-phase extraction followed by derivatization with trifluoroacetic acid and were determined by liquid chromatography-fluorescence detection. A Sep-Pak cartridge was chosen over Oasis HLB and Bond Elut cartridges. By the use of aflatoxin M(1) as an internal standard, relative recoveries of the aflatoxins ranged from 90.7 to 105.7 % for corn and from 88.1 to 103.4 % for wheat, with relative standard deviations between 2.5 and 8.7 %. A total of 36 samples from local markets were analyzed, and aflatoxin B(1) was found to be the predominant toxin, with concentrations ranging from 0.42 to 3.41 μg/kg. PMID:23314480

  16. Simultaneous determination of aflatoxin B(1) and ochratoxin A in licorice roots and fritillary bulbs by solid-phase extraction coupled with high-performance liquid chromatography-tandem mass spectrometry.


    Wang, Lizhi; Wang, Zhen; Gao, Weiwei; Chen, Juan; Yang, Meihua; Kuang, Ying; Huang, Linfang; Chen, Shilin


    An effective method was developed for screening licorice roots and fritillary bulbs for contamination by aflatoxin B(1) and ochratoxin A using high-performance liquid chromatography connected to tandem mass spectrometry (HPLC-MS/MS). The samples were pre-concentrated and purified using solid-phase extraction, which provided satisfactory results. The separation was performed on a Waters Xbridge(TM) C18 column with a linear gradient of acetonitrile - water containing 5mM ammonium acetate. The MS spectrum was acquired in positive mode with both single quadrupole (Q1) and multiple reaction monitoring (MRM). The optimised method offered a good linear correlation (r(2)>0.9967), excellent precision (RSD<2.83%) and acceptable recovery (from 92.78 to 105.37%). The limits of detection (LOD) and the limits of quantification (LOQ) were less than 0.024 μg/kg and 0.095 μg/kg, respectively. The validated method was successfully applied to the rapid screening for AFB(1) and OTA in licorice roots and fritillary bulbs. PMID:23411213

  17. Effect of ozone on aflatoxins detoxification and nutritional quality of peanuts.


    Chen, Ran; Ma, Fei; Li, Pei-Wu; Zhang, Wen; Ding, Xiao-Xia; Zhang, Qi; Li, Min; Wang, Yan-Ru; Xu, Bao-Cheng


    Aflatoxins are a group of secondary metabolites produced by Aspergillus flavus and Aspergillus parasiticus with carcinogenicity, teratogenicity, and mutagenicity. Aflatoxins may be found in a wide range of agri-products, especially in grains, oilseeds, corns, and peanuts. In this study, the conditions for detoxifying peanuts by ozonation were optimised. Aflatoxins in peanuts at moisture content of 5% (w/w) were sensitive to ozone and easily degraded when reacted with 6.0mg/l of ozone for 30min at room temperature. The detoxification rates of the total aflatoxins and aflatoxin B1 (AFB1) were 65.8% and 65.9%, respectively. The quality of peanut samples was also evaluated in this research. No significant differences (P>0.05) were found in the polyphenols, resveratrol, acid value (AV), and peroxide value (PV) between treated and untreated samples. The results suggested that ozonation was a promising method for aflatoxin detoxification in peanuts. PMID:24176344

  18. Protective effect of Ocimum sanctum on 3-methylcholanthrene, 7,12-dimethylbenz(a)anthracene and aflatoxin B1 induced skin tumorigenesis in mice

    SciTech Connect

    Rastogi, Shipra; Shukla, Yogeshwer; Paul, Bhola N.; Chowdhuri, D. Kar; Khanna, Subhash K.; Das, Mukul


    A study on the protective effect of alcoholic extract of the leaves of Ocimum sanctum on 3-mthylcholanthrene (MCA), 7,12-dimethylbenzanthracene (DMBA) and aflatoxin B{sub 1} (AFB{sub 1}) induced skin tumorigenesis in a mouse model has been investigated. The study involved pretreatment of mice with the leaf extract prior to either MCA application or tetradecanoyl phorbol acetate (TPA) treatment in a two-stage tumor protocol viz a viz, DMBA/TPA and AFB1/TPA. The results of the present study indicate that the pretreatment with alcoholic extract of the leaves of O. sanctum decreased the number of tumors in MCA, DMBA/TPA and AFB1/TPA treated mice. The skin tumor induced animals pretreated with alcoholic extract led to a decrease in the expression of cutaneous {gamma}-glutamyl transpeptidase (GGT) and glutathione-S-transferase-P (GST-P) protein. The histopathological examination of skin tumors treated with leaf extract showed increased infiltration of polymorphonuclear, mononuclear and lymphocytic cells, decreased ornithine decarboxylase activity with concomitant enhancement of interleukin-1{beta} (IL-1{beta}) and tumor necrosis factor-{alpha} (TNF-{alpha}) in the serum, implying the in vivo antiproliferative and immunomodulatory activity of leaf extract. The decrease in cutaneous phase I enzymes and elevation of phase II enzymes in response to topical application of leaf extract prior to MCA, AFB1, DMBA/TPA and AFB1/TPA treatment indicate the possibility of impairment in reactive metabolite(s) formation and thereby reducing skin carcinogenicity. Furthermore, pretreatment of leaf extract in the carcinogen induced animals resulted in elevation of glutathione levels and decrease in lipid peroxidation along with heat shock protein expression, indicating a scavenging or antioxidant potential of the extract during chemical carcinogenesis. Thus it can be concluded that leaf extract of O. sanctum provides protection against chemical carcinogenesis in one or more of the

  19. Modified Rice Straw as Adsorbent Material to Remove Aflatoxin B1 from Aqueous Media and as a Fiber Source in Fino Bread

    PubMed Central

    Mohamed, Sherif R.; El-Desouky, Tarek A.; Hussein, Ahmed M. S.; Mohamed, Sherif S.; Naguib, Khayria M.


    The aims of the current work are in large part the benefit of rice straw to be used as adsorbent material and natural source of fiber in Fino bread. The rice straw was subjected to high temperature for modification process and the chemical composition was carried out and the native rice straw contained about 41.15% cellulose, 20.46% hemicellulose, and 3.91% lignin while modified rice straw has 42.10, 8.65, and 5.81%, respectively. The alkali number was tested and showed an increase in the alkali consumption due to the modification process. The different concentrations of modified rice straw, aflatoxin B1, and pH were tested for removal of aflatoxin B1 from aqueous media and the maximum best removal was at 5% modified rice straw, 5 ng/mL aflatoxin B1, and pH 7. The modified rice straw was added to Fino bread at a level of 5, 10, and 15% and the chemical, rheological, baking quality, staling, and sensory properties were studied. Modified rice straw induced an increase of the shelf life and the produced Fino bread has a better consistency. PMID:26989411

  20. Modified Rice Straw as Adsorbent Material to Remove Aflatoxin B1 from Aqueous Media and as a Fiber Source in Fino Bread.


    Mohamed, Sherif R; El-Desouky, Tarek A; Hussein, Ahmed M S; Mohamed, Sherif S; Naguib, Khayria M


    The aims of the current work are in large part the benefit of rice straw to be used as adsorbent material and natural source of fiber in Fino bread. The rice straw was subjected to high temperature for modification process and the chemical composition was carried out and the native rice straw contained about 41.15% cellulose, 20.46% hemicellulose, and 3.91% lignin while modified rice straw has 42.10, 8.65, and 5.81%, respectively. The alkali number was tested and showed an increase in the alkali consumption due to the modification process. The different concentrations of modified rice straw, aflatoxin B1, and pH were tested for removal of aflatoxin B1 from aqueous media and the maximum best removal was at 5% modified rice straw, 5 ng/mL aflatoxin B1, and pH 7. The modified rice straw was added to Fino bread at a level of 5, 10, and 15% and the chemical, rheological, baking quality, staling, and sensory properties were studied. Modified rice straw induced an increase of the shelf life and the produced Fino bread has a better consistency. PMID:26989411

  1. The effect of humidity after gamma-irradiation on aflatoxin B-1 production of A. Flavus in ground nutmeg and peanut

    NASA Astrophysics Data System (ADS)

    Hilmy, N.; Chosdu, R.; Matsuyama, A.


    The effect of humidity of 75 up to 97% after irradiation on radiosensitivity and aflatoxin B1 production of Aspergillus flavus isolated from Indonesian nutmeg were examined. Irradiation doses used were 0;0.5;1 and 3 kGy. Mould free ground nutmeg and peanut were used as the growth media, and about 10 8 of spores were used to contaminate each of the media. Aflatoxin productions were measured after having incubated 3 days up to 5 months under humidity of 91 and 97%. Prior to HPLC analysis, aflatoxin was cleaned-up using an immunoaffinity column. The results were: (1) A. flavus indicated no or almost no growth under RH of 85% or less. (2) Under 91-97% RH, growth of mycelium and toxin production were inhibited more or less by irradiation up to 1 kGy, although the effectiveness of irradiation varied with different RH and media during postirradiation incubation. (3) By 3 kGy or more, both mycelium growth and toxin production of the mould were found to be completely inhibited. (4) The production of aflatoxin in nutmeg began after having incubated for 25 and 45 days and in peanut for 3 and 6 days under 97 and 91% RH, respectively.

  2. An ultra-high-performance liquid chromatography-tandem mass spectrometry method for simultaneous determination of aflatoxins B1, B2, G1, G2, M1 and M2 in traditional Chinese medicines.


    Han, Zheng; Zheng, Yunliang; Luan, Lianjun; Cai, Zengxuan; Ren, Yiping; Wu, Yongjiang


    An ultra-high-performance liquid chromatography-tandem mass spectrometry (UHPLC-MS/MS) method for simultaneous determination of aflatoxins B1, B2, G1, G2, M1 and M2 in traditional Chinese medicines (TCMs) was developed. The approach was characterized in details and a special focus was placed on the recovery rates of isolation procedure in different TCM matrices, i.e. rhizomes and roots, seeds, flowers, grasses and leaves. For this purpose, [(13)C(17)]-aflatoxinB1 was employed as the internal standard and a reliable solid phase extraction-based clean-up method was developed. The observed recovery rates of the six aflatoxins ranged from 85.6% to 117.6% in different matrices. Then, the established method was successfully applied to the determination of the six aflatoxins in various TCMs. For 30 commercial samples analyzed, 16 were contaminated with aflatoxins. The mean levels (incidence) of aflatoxins B1, B2, G1 and G2 in positive samples were 1.40 (68.8%), 1.27 (50.0%), 0.50 (43.8%) and 0.94 (43.8%) microg kg(-1), respectively. Interestingly, aflatoxin M1 was detected in two samples with the maximal content of 0.70 microg kg(-1). No sample was contaminated with aflatoxin M2. Meanwhile, a possible association between the contamination levels and the selected herbs was clarified in the present study. PMID:20363399

  3. A cross sectional study of hepatitis B, C, some trace elements, heavy metals, aflatoxin B1 and schistosomiasis in a rural population, Egypt.


    Sayed, Hanan Ali; El Ayyat, Afaf; El Dusoki, Howaida; Zoheiry, Mona; Mohamed, Salwa; Hassan, Mona; El Assaly, Nihal; Awad, Alaa; El Ansary, Mahmoud; Saad, Amal; El Karim, Ahmed Abd


    Chronic liver diseases are disastrous to health. Many factors are associated with their prevalence, hence endemicity. These are mainly infectious, parasitic and toxic. A survey was conducted in a village south to Cairo. Large industries concerned with iron and steel industry, metals smelting, cement manufacturing and electric station were located north to the village. A systematic random sample of houses was selected. All individuals inside the houses were invited to share in the study. Sample size was 84 individuals. Hepatitis markers were done (HBsAg and anti-HCV antibodies). The levels of some heavy metals were assessed; which were lead, mercury, arsenic, aluminum, manganese, nickel, chromium and cadmium. Levels of some trace elements were assessed. These were copper, iron, selenium and zinc. Aflatoxin B1 was assessed in serum. Assessment of schistosomal circulating antigen and antibodies was carried out. Abdominal ultrasonograghy was done to assess liver condition. Univariate logistic regression analysis was done to assess the association between studied variables and HBsAg or anti-HCV sero-positive subjects. The association between studied variables and bilharzial or fatty liver, diagnosed by ultrasonography, were also assessed. The univariate logistic regression analysis revealed odds ratios at the following results. For HBsAg seropositive subjects, aflatoxin B1, lead, chromium and schistosomal antigen and antibodies were higher than negative ones where odds ratios were; 6.2, 1.6, 1.6, 1.6 and 1.7, respectively. None of the variables showed statistically significant difference. For anti-HCV antibodies sero-positive subjects, aflatoxin B1 and chromium had the highest odds ratios among the studied variables, (odds ratios were 2.5 and 2.4, respectively). Bilharzial liver showed higher significant positivity of anti-HCV antibodies and insignificant decreased level of zinc than negative ones (odds ratios were 7.2 and 4.5, respectively). Fatty liver cases showed

  4. Occurrence of aflatoxins in mahua (Madhuca indica Gmel.) seeds: synergistic effect of plant extracts on inhibition of Aspergillus flavus growth and aflatoxin production.


    Sidhu, O P; Chandra, Harish; Behl, H M


    Occurrence of aflatoxin in Madhuca indica Gmel. seeds was determined by competitive ELISA. Eighty percent of mahua seed samples were found to be contaminated with aflatoxin. Total aflatoxin content ranged from 115.35 to 400.54ppb whereas the concentration of AFB(1) was in the range of 86.43 to 382.45ppb. Mahua oil was extracted by cold press expeller and analysed for contamination of aflatoxin in both the oil and cake samples. Total aflatoxin and aflatoxin B(1) were 220.66 and 201.57ppb in oil as compared to that in cake samples where it was 87.55 and 74.35ppb, respectively. Various individual and combined plant extracts were evaluated for their efficacy against growth of Aspergillus flavus and aflatoxin production in vitro. Combination of botanicals were found to be more effective in controlling fungal growth and aflatoxin production than individual extracts. Results of the present study suggests that synergistic effect of plant extracts can be used for control of fungal growth and aflatoxin production. These natural plant products may successfully replace synthetic chemicals and provide an alternative method to protect mahua as well as other agricultural commodities of nutritional significance from toxigenic fungi such as A. flavus and aflatoxin production. PMID:19167450

  5. Purple rice bran extract attenuates the aflatoxin B1-induced initiation stage of hepatocarcinogenesis by alteration of xenobiotic metabolizing enzymes.


    Suwannakul, Nattawan; Punvittayagul, Charatda; Jarukamjorn, Kanokwan; Wongpoomchai, Rawiwan


    Pigmented rice bran has been suggested to be a valuable source of beneficial phytochemicals. We investigated genotoxic and anti-genotoxic effects of purple rice bran extract (PRBE) in rats using a liver micronucleus assay. Purple rice bran was extracted with methanol, obtaining large amounts of phenolic compounds, including anthocyanins and small amounts of gamma-oryzanol. The experimental protocols were divided into two sets. Male rats were divided into three groups. Group 1 was a negative control, while Groups 2 and 3 were fed with 100 and 500 mg/kg bw of PRBE, respectively, for 28 days. PRBE had no effect on micronucleus formation or xenobiotic metabolizing enzymes in rat liver. Experiments concerning the effect of PRBE on AFB1 showed that PRBE significantly lessened the amount of micronucleated hepatocytes in AFB1 treated rats. Furthermore, it modulated metabolic activation of AFB1 metabolism in the liver by suppressing activity and protein expression of CYP1A2, CYP3A and CYP 450 reductase, and enhancing phase II enzymes including GST and UGT. Overall, purple rice bran extract was not genotoxic in rats. It exhibited anti-genotoxicity by modulation some xenobiotic enzymes active in AFB1 metabolism. PMID:25921147

  6. Use of sunlight to partially detoxify groundnut (peanut) cake flour and casein contaminated with aflatoxin B1

    SciTech Connect

    Shantha, T.; Murthy, V.S.


    Sunlight destroyed 83 and 50% of the toxin added to casein and groundnut cake flour, respectively. Equilibrium dialysis revealed that both casein and groundnut protein bind aflatoxin but the toxin bound to casein appeared more photo-labile than that bound to groundnut protein.

  7. Short wave infrared (SW-IR) hyperspectral imaging technique for examination of aflatoxin B_1 on corn kernels

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aflatoxins are toxic metabolites produced by the fungi Aspergillus flavus and Aspergillus parasiticus. They can contaminate a wide range of crops before harvest and during storage. Contaminated grains are associated with economic losses for cultivators as well as potential health hazards to both hum...

  8. Application of dispersive liquid-liquid microextraction for the determination of aflatoxins B1, B2, G1 and G2 in cereal products.


    Campone, Luca; Piccinelli, Anna Lisa; Celano, Rita; Rastrelli, Luca


    The application of dispersive liquid-liquid microextraction (DLLME) technique for the rapid analysis of aflatoxins B(1), B(2), G(1) and G(2) in maize, rice and wheat products has been evaluated. After extraction of aflatoxins from cereal matrices with a mixture of methanol/water 8:2 (v/v), the analytes were rapidly transferred from the extract to another small volume of organic solvent, chloroform, by DLLME. Aflatoxins were determined using high performance liquid chromatography with florescence detection and photochemical post-column derivatization. Parameters affecting both extraction and DLLME procedures, such as extraction solvent, type and volume of DLLME extractant, volume of water and salt effect, were systematically investigated and optimized to achieve the best extraction efficiency. Under the optimal experimental conditions, the whole analytical method provides enrichment factors around 2.5 times and detection limits (0.01-0.17 μg kg(-1)) below the maximum levels imposed by current regulation for aflatoxins in cereals and cereal products intended for direct human consumption. Recoveries (67-92%) and repeatability (RSD<10, n=3), tested in three different cereal matrices, meet the performance criteria required by EC Regulation No. 401/2006 for the determination of the levels of mycotoxins in foodstuffs. The proposed method was successfully applied to the analysis of retail cereal products with quantitative results comparable to the immunoaffinity chromatography (IAC). The main advantages of developed method are the simplicity of operation, the rapidity to achieve a very high sample throughput and low cost. PMID:21636088

  9. Effect of γ irradiation on fungal load and aflatoxins reduction in red chillies

    NASA Astrophysics Data System (ADS)

    Iqbal, Shahzad Zafar; Bhatti, Ijaz Ahmad; Asi, Muhammad Rafique; Zuber, Mohammad; Shahid, Muhammad; Parveen, Ishrat


    Chillies are a very important cash crop of Pakistan. The effects of gamma irradiation on microbial load, aflatoxin B1 (AFB1) and total aflatoxins have been studied in chillies samples, collected from different districts of Punjab, Pakistan. Aflatoxins were analyzed using HPLC equipped with a fluorescence detector. The results revealed that among the Aspergillus species isolated, those belonging to section parasiticus were predominant. Gamma radiations of doses 2, 4 and 6 kGy were employed on fungi and chilli samples. The results have demonstrated that the dose of 6 kGy reduced the fungal load by 5 logs. Furthermore, 6 kGy reduced the level of AFB1 and total AFs in ground and whole chillies by 1-2 logs (α < 0.05).

  10. Sensitive Quantification of Aflatoxin B1 in Animal Feeds, Corn Feed Grain, and Yellow Corn Meal Using Immunomagnetic Bead-Based Recovery and Real-Time Immunoquantitative-PCR

    PubMed Central

    Babu, Dinesh; Muriana, Peter M.


    Aflatoxins are considered unavoidable natural mycotoxins encountered in foods, animal feeds, and feed grains. In this study, we demonstrate the application of our recently developed real-time immunoquantitative PCR (RT iq-PCR) assay for sensitive detection and quantification of aflatoxins in poultry feed, two types of dairy feed (1 and 2), horse feed, whole kernel corn feed grains, and retail yellow ground corn meal. Upon testing methanol/water (60:40) extractions of the above samples using competitive direct enzyme linked immunosorbent assay, the aflatoxin content was found to be <20 μg/kg. The RT iq-PCR assay exhibited high antigen hook effect in samples containing aflatoxin levels higher than the quantification limits (0.1–10 μg/kg), addressed by comparing the quantification results of undiluted and diluted extracts. In testing the reliability of the immuno-PCR assay, samples were spiked with 200 μg/kg of aflatoxin B1, but the recovery of spiked aflatoxin was found to be poor. Considering the significance of determining trace levels of aflatoxins and their serious implications for animal and human health, the RT iq-PCR method described in this study can be useful for quantifying low natural aflatoxin levels in complex matrices of food or animal feed samples without the requirement of extra sample cleanup. PMID:25474493

  11. Temporal Variation and Association of Aflatoxin B1 Albumin-Adduct Levels with Socio-Economic and Food Consumption Factors in HIV Positive Adults

    PubMed Central

    Jolly, Pauline E.; Akinyemiju, Tomi F.; Jha, Megha; Aban, Inmaculada; Gonzalez-Falero, Andrea; Joseph, Dnika


    The association between aflatoxin exposure and alteration in immune responses observed in humans suggest that aflatoxin could suppress the immune system and work synergistically with HIV to increase disease severity and progression to AIDS. No longitudinal study has been conducted to assess exposure to aflatoxin (AF) among HIV positive individuals. We examined temporal variation in AFB1 albumin adducts (AF-ALB) in HIV positive Ghanaians, and assessed the association with socioeconomic and food consumption factors. We collected socioeconomic and food consumption data for 307 HIV positive antiretroviral naive adults and examined AF-ALB levels at recruitment (baseline) and at six (follow-up 1) and 12 (follow-up 2) months post-recruitment, by age, gender, socioeconomic status (SES) and food consumption patterns. Generalized linear models were used to examine the influence of socioeconomic and food consumption factors on changes in AF-ALB levels over the study period, adjusting for other covariates. AF-ALB levels (pg/mg albumin) were lower at baseline (mean AF-ALB: 14.9, SD: 15.9), higher at six months (mean AF-ALB: 23.3, SD: 26.6), and lower at 12 months (mean AF-ALB: 15.3, SD: 15.4). Participants with the lowest SES had the highest AF-ALB levels at baseline and follow up-2 compared with those with higher SES. Participants who bought less than 20% of their food and who stored maize for less than two months had lower AF-ALB levels. In the adjusted models, there was a statistically significant association between follow up time and season (dry or rainy season) on AF-ALB levels over time (p = 0.04). Asymptomatic HIV-positive Ghanaians had high plasma AF-ALB levels that varied according to season, socioeconomic status, and food consumption patterns. Steps need to be taken to ensure the safety and security of the food supply for the population, but in particular for the most vulnerable groups such as HIV positive people. PMID:26633502

  12. Aflatoxins in retail food products in Bursa, Turkey.


    Günsen, Ugur; Büyükyörük, Ilhan


    Aflatoxin B1 (AFB1) in 25 cacao hazelnut cream and 15 dried apricot samples and aflatoxin M1 (AFM1) in 130 cheese samples (35 full fatty Turkish white cheeses, 35 fresh kashars, 25 old kashars, 20 Gravyer cheeses and 15 cream cheeses) randomly collected from traditional retail markets with insufFicient chilling facilities in Bursa, Turkey, were determined by ELISA. Mean AFB1 and AFM1 in the cacao hazelnut cream, dried apricot and cheese were 1,076.5 +/- 194.4 ng/kg, 1,441.3 +/- 331.9 ng/kg and 142.2 +/- 18.7 ng/kg, respectively; 15.45% of the cheese samples exceeded the Turkish AFM1 tolerance limit of 250 ng/kg. PMID:12361114

  13. Prevention of Aflatoxin B₁-Induced DNA Breaks by β-D-Glucan.


    Madrigal-Bujaidar, Eduardo; Morales-González, José Antonio; Sánchez-Gutiérrez, Manuel; Izquierdo-Vega, Jeannett A; Reyes-Arellano, Alicia; Álvarez-González, Isela; Pérez-Pasten, Ricardo; Madrigal-Santillán, Eduardo


    Aflatoxins are a group of naturally-occurring carcinogens that are known to contaminate different human and animal foodstuffs. Aflatoxin B1 (AFB1) is the most genotoxic hepatocarcinogenic compound of all of the aflatoxins. In this report, we explore the capacity of β-D-glucan (Glu) to reduce the DNA damage induced by AFB1 in mouse hepatocytes. For this purpose, we applied the comet assay to groups of animals that were first administered Glu in three doses (100, 400 and 700 mg/kg bw, respectively) and, 20 min later, 1.0 mg/kg of AFB1. Liver cells were obtained at 4, 10 and 16 h after the chemical administration and examined. The results showed no protection of the damage induced by AFB1 with the low dose of the polysaccharide, but they did reveal antigenotoxic activity exerted by the two high doses. In addition, we induced a co-crystallization between both compounds, determined their fusion points and analyzed the molecules by UV spectroscopy. The data suggested the formation of a supramolecular complex between AFB1 and β-D-glucan. PMID:26110504

  14. Aflatoxin Toxicity Reduction in Feed by Enhanced Binding to Surface-Modified Clay Additives

    PubMed Central

    Jaynes, William F.; Zartman, Richard E.


    Animal feeding studies have demonstrated that clay additives, such as bentonites, can bind aflatoxins in ingested feed and reduce or eliminate the toxicity. Bentonite deposits are found throughout the world and mostly consist of expandable smectite minerals, such as montmorillonite. The surfaces of smectite minerals can be treated with organic compounds to create surface-modified clays that more readily bind some contaminants than the untreated clay. Montmorillonites treated with organic cations, such as hexadecyltrimethylammonium (HDTMA) and phenyltrimethylammonium (PTMA), more effectively remove organic contaminants, such as benzene and toluene, from water than untreated clay. Similarly, montmorillonite treated with PTMA (Kd = 24,100) retained more aflatoxin B1 (AfB1) from aqueous corn flour than untreated montmorillonite (Kd = 944). Feed additives that reduced aflatoxin toxicity in animal feeding studies adsorbed more AfB1 from aqueous corn flour than feed additives that were less effective. The organic cations HDTMA and PTMA are considered toxic and would not be suitable for clay additives used in feed or food, but other non-toxic or nutrient compounds can be used to prepare surface-modified clays. Montmorillonite (SWy) treated with choline (Kd = 13,800) and carnitine (Kd = 3960) adsorbed much more AfB1 from aqueous corn flour than the untreated clay (Kd = 944). A choline-treated clay prepared from a reduced-charge, high-charge montmorillonite (Kd = 20,100) adsorbed more AfB1 than the choline-treated high-charge montmorillonite (Kd = 1340) or the untreated montmorillonite (Kd = 293). Surface-modified clay additives prepared using low-charge smectites and nutrient or non-toxic organic compounds might be used to more effectively bind aflatoxins in contaminated feed or food and prevent toxicity. PMID:22069725

  15. Effect of temperature and water activity on gene expression and aflatoxin biosynthesis in Aspergillus flavus on almond medium.


    Gallo, Antonia; Solfrizzo, Michele; Epifani, Filomena; Panzarini, Giuseppe; Perrone, Giancarlo


    Almonds are among the commodities at risk of aflatoxin contamination by Aspergillus flavus. Temperature and water activity are the two key determinants in pre and post-harvest environments influencing both the rate of fungal spoilage and aflatoxin production. Varying the combination of these parameters can completely inhibit or fully activate the biosynthesis of aflatoxin, so it is fundamental to know which combinations can control or be conducive to aflatoxin contamination. Little information is available about the influence of these parameters on aflatoxin production on almonds. The objective of this study was to determine the influence of different combinations of temperature (20 °C, 28 °C, and 37 °C) and water activity (0.90, 0.93, 0.96, 0.99 aw) on growth, aflatoxin B1 (AFB1) production and expression of the two regulatory genes, aflR and aflS, and two structural genes, aflD and aflO, of the aflatoxin biosynthetic cluster in A. flavus grown on an almond medium solidified with agar. Maximum accumulation of fungal biomass and AFB1 production was obtained at 28 °C and 0.96 aw; no fungal growth and AFB1 production were observed at 20 °C at the driest tested conditions (0.90 and 0.93 aw). At 20° and 37 °C AFB1 production was 70-90% lower or completely suppressed, depending on aw. Reverse transcriptase quantitative PCR showed that the two regulatory genes (aflR and aflS) were highly expressed at maximum (28 °C) and minimum (20 °C and 37 °C) AFB1 production. Conversely the two structural genes (aflD and aflO) were highly expressed only at maximum AFB1 production (28 °C and 0.96-0.99 aw). It seems that temperature acts as a key factor influencing aflatoxin production which is strictly correlated to the induction of expression of structural biosynthesis genes (aflD and aflO), but not to that of aflatoxin regulatory genes (aflR and aflS), whose functional products are most likely subordinated to other regulatory processes acting at post-translational level

  16. Activated carbons as potentially useful non-nutritive additives to prevent the effect of fumonisin B1 on sodium bentonite activity against chronic aflatoxicosis.


    Monge, María Del Pilar; Magnoli, Alejandra Paola; Bergesio, Maria Virginia; Tancredi, Nestor; Magnoli, Carina E; Chiacchiera, Stella Maris


    Aflatoxin B1 (AFB1) and fumonisin B1 (FB1) are mycotoxins that often co-occur in feedstuffs. The ingestion of AFB1 causes aflatoxicosis in humans and animals. Sodium bentonite (NaB), a cheap non-nutritive unselective sequestering agent incorporated in animal diets, can effectively prevent aflatoxicosis. Fumonisins are responsible for equine leukoencephalomalacia and porcine pulmonary oedema, and often have subclinical toxic effects in poultries. Fumonisin B1 and aflatoxin B1 are both strongly adsorbed in vitro on sodium bentonite. Co-adsorption studies, carried out with a weight ratio of FB1 to AFB1 that mimics the natural occurrence (200:1), showed that FB1 greatly decreases the in vitro ability of NaB to adsorb AFB1. The ability of two activated carbons to adsorb FB1 was also investigated. Both carbons showed high affinity for FB1. A complex behaviour of the FB1 adsorption isotherms with pH was observed. In vitro results suggest that under natural contamination levels of AFB1 and FB1, a mixture of activated carbon and sodium bentonite might be potentially useful for prevention of sub-acute aflatoxicosis. PMID:27159550

  17. Determination of aflatoxins B1, B2, G1, G2 and ochratoxin A in animal feed by ultra high-performance liquid chromatography-tandem mass spectrometry.


    López Grío, Sergio José; Garrido Frenich, Antonia; Martínez Vidal, José Luis; Romero-González, Roberto


    A rapid and simple method was developed to determine aflatoxins B1, B2, G1, G2 and ochratoxin A in animal feed and pet foods by UHPLC-MS/MS. Because the complexity of the evaluated matrices, the proposed method is based on sonication extraction using an ACN/water mixture (80:20 v/v) followed by a clean-up step utilising C(18) as sorbent. Performance parameters of the method were evaluated, including linearity, trueness, precision and LOQ. Good linearity was found for all mycotoxins, with determination coefficients higher than 0.99 in the range considered, using matrix-matched calibration for quantification purposes. Recoveries ranged from 84 to 113%, with RSD lower than 20%, whereas LOQs were 5 microg/kg for the assayed mycotoxins. Finally, the method was successfully applied to the analysis of 19 real samples, detecting aflatoxin G2 in two samples at 13 and 17 microg/kg respectively, whereas the other mycotoxins were detected at trace levels (

  18. Association of high viral load and abnormal liver function with high aflatoxin B1–albumin adduct levels in HIV-positive Ghanaians: preliminary observations

    PubMed Central

    Jolly, P.E.; Shuaib, F.M.; Jiang, Y.; Preko, P.; Baidoo, J.; Stiles, J.K.; Wang, J.-S.; Phillips, T.D.; Williams, J.H.


    We examined the association between certain clinical factors and aflatoxin B1–albumin adduct (AF-ALB) levels in HIV-positive people. Plasma samples collected from 314 (155 HIV-positive and 159 HIV-negative) people were tested for AF-ALB levels, viral load, CD4+ T-cell count, liver function profile, malaria parasitaemia, and hepatitis B and C virus infections. HIV-positive participants were divided into high and low groups based on their median AF-ALB of 0.93 pmol mg−1 albumin and multivariable logistic and linear regression methods used to assess relationships between clinical conditions and AF-ALB levels. Multivariable logistic regression showed statistically significant increased odds of having higher HIV viral loads (OR=2.84; 95% CI=1.17–7.78) and higher direct bilirubin levels (OR=5.47; 95% CI=1.03–22.85) among HIV-positive participants in the high AF-ALB group. There were also higher levels of total bilirubin and lower levels of albumin in association with high AF-ALB. Thus, aflatoxin exposure may contribute to high viral loads and abnormal liver function in HIV-positive people and so promote disease progression. PMID:21749228

  19. Phytohormone levels in germinating seeds of Zea mays L. exposed to selenium and aflatoxines.


    Ağar, Güleray; Türker, Musa; Battal, Peyami; Emre, Erez M


    Seeds of Zea mays L. were exposed to aflatoxine B1 (AFB1), aflatoxine G1 (AFG1) and selenium (Se) alone and in combination and allowed to germinate. Phytohormone levels of GA-like substances (GAs), trans-Zeatin (t-Z) and Indole-3-acetic acid (IAA) were determined by High Performance Liquid Chromatography (HPLC) when the roots of the germinating seeds reach 1.5-3.0 cm in length. The levels of endogenous hormones decreased in seeds treated with AFB1 and AFG1 compared to control; however an increase was noted in seeds exposed to AFG1 and Se together. AFB1 and Se treatment caused reduced hormone levels in most of the treatments. When plants were exposed to Se alone, the highest levels of GAs, t-Z and IAA were observed in the application of 800 ppm Se. The highest levels of GAs, t-Z and IAA were observed when seeds were treated with 0.2 ppm AFG1 + 8 ppm Se, 0.2 ppm AFG1 + 8 ppm Se and 0.2 ppm AFG1 + 0.08 ppm Se, respectively, whereas the lowest levels of the hormones were observed in 0.2 ppm AFB1 + 8 ppm Se, 0.2 ppm AFB1 + 0.08 ppm Se and 0.1 ppm AFB1, respectively. In conclusion, the levels of phytohormones were reduced by the treatment of AFB1 and AFG1 alone. However Se removed the negative effect of AFB1 on phytohormones, but not AFB1. PMID:16636889

  20. Potential natural exposure of endangered red-crowned crane (Grus japonensis) to mycotoxins aflatoxin B1, deoxynivalenol, zearalenone, T-2 toxin, and ochratoxin A*

    PubMed Central

    Liu, Da-wei; Liu, Hong-yi; Zhang, Hai-bin; Cao, Ming-chang; Sun, Yong; Wu, Wen-da; Lu, Chang-hu


    A survey was conducted to determine whether mycotoxins were present in the foods consumed by red-crowned cranes (Grus japonensis) in the Yancheng Biosphere Reserve, China. Collected in the reserve’s core, buffer, and experimental zones during overwintering periods of 2013 to 2015, a total of 113 food samples were analyzed for aflatoxin B1, deoxynivalenol, zearalenone, T-2 toxin, and ochratoxin A using high performance liquid chromatography (HPLC). The contamination incidences vary among different zones and the mycotoxins levels of different food samples also presented disparity. Average mycotoxin concentration from rice grain was greater than that from other food types. Among mycotoxin-positive samples, 59.3% were simultaneously contaminated with more than one toxin. This study demonstrated for the first time that red-crowned cranes were exposed to mycotoxins in the Yancheng Biosphere Reserve and suggested that artificial wetlands could not be considered good habitats for the birds in this reserve, especially rice fields. PMID:26834016

  1. Potential natural exposure of endangered red-crowned crane (Grus japonensis) to mycotoxins aflatoxin B1, deoxynivalenol, zearalenone, T-2 toxin, and ochratoxin A.


    Liu, Da-wei; Liu, Hong-yi; Zhang, Hai-bin; Cao, Ming-chang; Sun, Yong; Wu, Wen-da; Lu, Chang-hu


    A survey was conducted to determine whether mycotoxins were present in the foods consumed by red-crowned cranes (Grus japonensis) in the Yancheng Biosphere Reserve, China. Collected in the reserve's core, buffer, and experimental zones during overwintering periods of 2013 to 2015, a total of 113 food samples were analyzed for aflatoxin B1, deoxynivalenol, zearalenone, T-2 toxin, and ochratoxin A using high performance liquid chromatography (HPLC). The contamination incidences vary among different zones and the mycotoxins levels of different food samples also presented disparity. Average mycotoxin concentration from rice grain was greater than that from other food types. Among mycotoxin-positive samples, 59.3% were simultaneously contaminated with more than one toxin. This study demonstrated for the first time that red-crowned cranes were exposed to mycotoxins in the Yancheng Biosphere Reserve and suggested that artificial wetlands could not be considered good habitats for the birds in this reserve, especially rice fields. PMID:26834016

  2. Efficacy of adsorbents (bentonite and diatomaceous earth) and turmeric (Curcuma longa) in alleviating the toxic effects of aflatoxin in chicks.


    Dos Anjos, F R; Ledoux, D R; Rottinghaus, G E; Chimonyo, M


    A study was conducted to determine the efficacy of bentonite clay (BC), diatomaceous earth (DE) and turmeric powder (TUM) in alleviating the toxic effects of aflatoxin B1 (AFB1). A total of 250 Ross-308 d-old male broiler chicks were assigned to 10 dietary treatments (5 replicates of 5 chicks) from hatch to d 21. Dietary treatments were: basal diet; basal diet plus AFB1 (2 mg) or BC (0.75%), or DE (0.75%), or TUM (200 mg/kg curcuminoids) and different combinations of AFB1, BC, DE and TUM. Feed intake (FI), body weight gain (BWG) and feed gain (FG) of the birds fed on BC or DE separately were not different from control birds. Birds fed on TUM only had similar FI and FG but lower BWG than control chicks. Aflatoxin B1 reduced FI, BWG and serum concentrations of glucose, albumin, total protein calcium, but increased FG and relative liver and kidney weights. Chicks fed on the combination of AFB1 and BC had similar FI and FG to control chicks. Chicks fed on the combination of DE and AFB1 had lower FI (23.1%) and BWG (28.6%) compared with control chicks. Chicks fed on the combination of TUM and AFB1 also had decreased FI (26.2 %) and BWG (31%) compared with control chicks. Chicks fed on the combination of AFB1, BC and TUM consumed significantly higher amounts of feed compared with chicks fed on only AF, but gained less when compared with control diet chicks. Chicks fed on the combination of AFB1, DE and TUM diet had poorer growth performance than those fed on AFB1 alone. None of the combination diets reduced the severity of liver lesions. PMID:25990012

  3. Simultaneous determination of aflatoxin B(1), B(2), G(1), G(2), ochratoxin A, and sterigmatocystin in traditional Chinese medicines by LC-MS-MS.


    Zheng, Runsheng; Xu, Hui; Wang, Wenli; Zhan, Ruoting; Chen, Weiwen


    In this paper we describe a rapid, simple, and costeffective liquid chromatography–tandem mass spectrometric (LC–MS–MS) method for simultaneous analysis of aflatoxin B1, B2, G1, and G2, ochratoxin A, and sterigmatocystin in 25 traditional Chinese medicines (TCMs). The method is based on single extraction with 84:16 (v/v) acetonitrile–water then analysis of the diluted crude extract without further clean-up. Chromatographic separation was achieved on a C18 column, with a mobile phase gradient prepared from aqueous 4 mmol L−1 ammonium acetate–0.1 % formic acid and methanol. Quantification of the analytes was by selective reaction monitoring (SRM) on a triple-quadrupole mass spectrometer in positive-ionization mode. Special focus was on investigating and reducing matrix effects to improve accuracy. The established method was validated by determination of linearity (r>0.995), sensitivity (limits of quantification 1.6–25.0 ng L−1), apparent recovery (84.8–110.6 %), extraction recovery (83.6–106.1 %), and precision (relative standard deviation ≤9.9 %) for two representative TCMs, Semen Armeniacae Amarae and Radix Pseudostellariae. The applicability of the method to TCMs other than these was further investigated, and 23 other TCMs with acceptable matrix effects (80.2–118.6 %) were screened. The validated method was finally used to assess mycotoxin contamination of 244 samples of 25 TCMs collected from local hospitals and TCM pharmacies. Aflatoxin B1 and ochratoxin A were detected in 5.3 % of the samples. Sterigmatocystin, the most prevalent mycotoxin contaminant, was present in 26.2 % of the samples tested; this has not been reported previously. The results of this work imply greater attention should be devoted to evaluation of the potential hazard caused by sterigmatocystin in TCMs. PMID:24658469

  4. Antioxidant activity and inhibition of aflatoxin B1-, nifuroxazide-, and sodium azide-induced mutagenicity by extracts from Rhamnus alaternus L.


    Ammar, Rebai Ben; Sghaier, Mohamed Ben; Boubaker, Jihed; Bhouri, Wissem; Naffeti, Aicha; Skandrani, Ines; Bouhlel, Ines; Kilani, Soumaya; Ghedira, Kamel; Chekir-Ghedira, Leila


    The effect of extracts obtained from Rhamnus alaternus L. leaves on genotoxicity and SOS response induced by aflatoxin B(1) (10 microg/assay) as well as nifuroxazide (20 microg/assay) was investigated in a bacterial assay system, i.e., the SOS chromotest with Escherichia coli PQ37. The evaluation of the mutagenic and antimutagenic actions of the same extracts against the sodium azide (1.5 microg/plate)-induced mutagenicity was assayed using the Salmonella typhimurium assay system. The R. alaternus tested extracts exhibited no genotoxicity either with or without the external S9 activation mixture. However, all the extracts, particularly aqueous extract (A) and its chloroformic fraction (A(2)) significantly decreased the genotoxicity induced by aflatoxin B(1) and nifuroxazide. Moreover, the different extracts showed no mutagenicity when tested with Salmonella typhimurium strains TA1535 and TA1538 either with or without the S9 mix. Aqueous extract as well as its A(2) fraction exhibited the highest level of protection towards the direct mutagen, sodium azide-induced response in TA1535 strain with mutagenicity inhibition percentages of 83.6% and 91.4%, respectively, at a dose of 250 microg/plate. The results obtained by the Ames test assay confirm those of SOS chromotest. These same active extracts exhibited high xanthine oxidase (XOD) inhibiting with respective IC(50) values of 208 and 137 microg/ml, and superoxide anion-scavenging effects (IC(50) values of 132 and 117 microg/ml) when tested in the XOD enzymatic assay system. Our findings emphasize the potential of R. alaternus to prevent mutations and also its antioxidant effect. PMID:18511029

  5. Common African cooking processes do not affect the aflatoxin binding efficacy of refined calcium montmorillonite clay.


    Elmore, Sarah E; Mitchell, Nicole; Mays, Travis; Brown, Kristal; Marroquin-Cardona, Alicia; Romoser, Amelia; Phillips, Timothy D


    Aflatoxins are common contaminants of staple crops, such as corn and groundnuts, and a significant cause of concern for food safety and public health in developing countries. Aflatoxin B1 (AFB1) has been implicated in the etiology of acute and chronic disease in humans and animals, including growth stunting, liver cancer and death. Cost effective and culturally acceptable intervention strategies for the reduction of dietary AFB1 exposure are of critical need in populations at high risk for aflatoxicosis. Fermented gruels consisting of cornmeal are a common source for such exposure and are consumed by both children and adults in many countries with a history of frequent, high-level aflatoxin exposure. One proposed method to reduce aflatoxins in the diet is to include a selective enterosorbent, Uniform Particle Size NovaSil (UPSN), as a food additive in contaminated foods. For UPSN to be effective in this capacity, it must be stable in complex, acidic mixtures that are often exposed to heat during the process of fermented gruel preparation. Therefore, the objective of the present study was to test the ability of UPSN to sorb aflatoxin while common cooking conditions were applied. The influence of fermentation, heat treatment, acidity, and processing time were investigated with and without UPSN. Analyses were performed using the field-practical Vicam assay with HPLC verification of trends. Our findings demonstrated that UPSN significantly reduced aflatoxin levels (47-100%) in cornmeal, regardless of processing conditions. Upon comparison of each element tested, time appeared to be the primary factor influencing UPSN efficacy. The greatest decreases in AFB1 were reported in samples allowed to incubate (with or without fermentation) for 72 hrs. This data suggests that addition of UPSN to staple corn ingredients likely to contain aflatoxins would be a sustainable approach to reduce exposure. PMID:24311894

  6. Common African cooking processes do not affect the aflatoxin binding efficacy of refined calcium montmorillonite clay

    PubMed Central

    Elmore, Sarah E.; Mitchell, Nicole; Mays, Travis; Brown, Kristal; Marroquin-Cardona, Alicia; Romoser, Amelia; Phillips, Timothy D.


    Aflatoxins are common contaminants of staple crops, such as corn and groundnuts, and a significant cause of concern for food safety and public health in developing countries. Aflatoxin B1 (AFB1) has been implicated in the etiology of acute and chronic disease in humans and animals, including growth stunting, liver cancer and death. Cost effective and culturally acceptable intervention strategies for the reduction of dietary AFB1 exposure are of critical need in populations at high risk for aflatoxicosis. Fermented gruels consisting of cornmeal are a common source for such exposure and are consumed by both children and adults in many countries with a history of frequent, high-level aflatoxin exposure. One proposed method to reduce aflatoxins in the diet is to include a selective enterosorbent, Uniform Particle Size NovaSil (UPSN), as a food additive in contaminated foods. For UPSN to be effective in this capacity, it must be stable in complex, acidic mixtures that are often exposed to heat during the process of fermented gruel preparation. Therefore, the objective of the present study was to test the ability of UPSN to sorb aflatoxin while common cooking conditions were applied. The influence of fermentation, heat treatment, acidity, and processing time were investigated with and without UPSN. Analyses were performed using the field-practical Vicam assay with HPLC verification of trends. Our findings demonstrated that UPSN significantly reduced aflatoxin levels (47-100%) in cornmeal, regardless of processing conditions. Upon comparison of each element tested, time appeared to be the primary factor influencing UPSN efficacy. The greatest decreases in AFB1 were reported in samples allowed to incubate (with or without fermentation) for 72 hrs. This data suggests that addition of UPSN to staple corn ingredients likely to contain aflatoxins would be a sustainable approach to reduce exposure. PMID:24311894

  7. Studies on the biological functions of CPS1 in AFB1 induced hepatocarcinogenesis.


    Yang, Chi; Fu, Rao; Zhuang, Zhenhong; Wang, Shihua


    Carbamyl phosphate synthetase 1 (CPS1) was down-regulated in hepatocellular carcinoma (HCC), as treated by aflatoxin B1 (AFB1), a potent hepatocarcinogenesis mycotoxin. In this study, we firstly confirmed that AFB1 down-regulated the expression of CPS1 in a dose-dependent manner. At the meantime, both siRNA knock down of CPS1 and AFB1 treatment inhibited cell proliferation, and induced cell apoptosis. To further analysis the function of CPS1, the interacting proteins of CPS1 were searched by Co-IP, and three interacting proteins including type II cytoskeletal 1 (KRT1), albumin (ALB), and ubiquitin C (UBC) were found. Both KRT1 and ALB were new interacting proteins for CPS1. Our further study showed that CPS1 was regulating interacted and colocalized with KRT1 and ALB, and the intensity correlation was changed by AFB1. KRT1, ALB and CPS1 were all reported to play an important role in differentiation and tissue specialization. These results may offer an increasing understand that CPS1 might have a function in differentiation. PMID:27425868

  8. Reduction of aflatoxins (B₁, B₂, G₁, and G₂) in soybean-based model systems.


    Lee, Jongin; Her, Jae-Young; Lee, Kwang-Geun


    The effects of chemical, physical, and cooking treatments on the reduction of aflatoxin B1 (AFB1), B2, G1, and G2 in soybean matrix were investigated. A HPLC-FLD with a Kobra cell system was used for the quantitative analysis of aflatoxins (AFs). To decrease the level of AFs during the soaking process, the contaminated soybeans were submerged in organic acid solutions. The reduction rates of AFB1 in 1.0N citric acid, lactic acid, succinic acid, and tartaric acid for 18h were 94.1%, 92.7%, 62.0%, and 95.1%, respectively. In the case of pH and autoclave treatment, the level of AFB1 was significantly decreased during autoclaving process at pH 7.4, 9.0, and 11.1, compared with the non-autoclaved samples (p<0.05). In the case of physical treatment, the heating process at 100 and 150°C for 90min significantly decreased the level of AFB1 by 41.9% and 81.2%, respectively (p<0.05). The reduction rate of AFB1 after cooking was 97.9% for soybean milk and 33.6% for steamed soybeans. PMID:26190599

  9. Conversion of 11-hydroxy-O-methylsterigmatocystin to aflatoxin G1 in Aspergillus parasiticus.


    Zeng, Hongmei; Hatabayashi, Hidemi; Nakagawa, Hiroyuki; Cai, Jingjing; Suzuki, Ryoya; Sakuno, Emi; Tanaka, Toshitsugu; Ito, Yasuhiro; Ehrlich, Kenneth C; Nakajima, Hiromitsu; Yabe, Kimiko


    In aflatoxin biosynthesis, aflatoxins G(1) (AFG(1)) and B(1) (AFB(1)) are independently produced from a common precursor, O-methylsterigmatocystin (OMST). Recently, 11-hydroxy-O-methylsterigmatocystin (HOMST) was suggested to be a later precursor involved in the conversion of OMST to AFB(1), and conversion of HOMST to AFB(1) was catalyzed by OrdA enzyme. However, the involvement of HOMST in AFG(1) formation has not been determined. In this work, HOMST was prepared by incubating OrdA-expressing yeast with OMST. Feeding Aspergillus parasiticus with HOMST allowed production of AFG(1) as well as AFB(1). In cell-free systems, HOMST was converted to AFG(1) when the microsomal fraction, the cytosolic fraction from A. parasiticus, and yeast expressing A. parasiticus OrdA were added. These results demonstrated (1) HOMST is produced from OMST by OrdA, (2) HOMST is a precursor of AFG(1) as well as AFB(1), and (3) three enzymes, OrdA, CypA, and NadA, and possibly other unknown enzymes are involved in conversion of HOMST to AFG(1). PMID:21153813

  10. Aptamer induced assembly of fluorescent nitrogen-doped carbon dots on gold nanoparticles for sensitive detection of AFB1.


    Wang, Bin; Chen, Yanfen; Wu, Yuanya; Weng, Bo; Liu, Yingshuai; Lu, Zhisong; Li, Chang Ming; Yu, Cong


    Novel fluorescent nitrogen-doped carbon dots (N,C-dots) were synthesized and assembled on aptamer modified gold nanoparticles (Aptamer/AuNPs) for the super sensitive detection of aflatoxin B1 (AFB1). Positively charged N,C-dots were synthesized by the hydrothermal treatment of pancreatin. The prepared N,C-dots were assembled on aptamer/AuNPs by electrostatic interactions. The fluorescence of the N,C-dots was efficiently quenched. When AFB1 was added to the assay solution, specific interactions between AFB1 and the aptamer caused release of the N,C-dots. The fluorescence of the N,C-dots recovered and the intensity increase could be used to calculate the amount of AFB1 added. The assay exhibits super-high sensitivity with a detection limit of 5 pg/mL (16 pM) and a wide range of linear response of 5 pg/mL to 2.00 ng/mL. A novel aptasensor is thus successfully constructed, it provides an efficient way for sensitive AFB1 sensing as well as a new technique for aptamer based novel sensor construction. PMID:26584079

  11. Assessment of aflatoxin exposure using serum and urinary biomarkers in São Paulo, Brazil: A pilot study.


    Jager, Alessandra V; Tonin, Fernando G; Baptista, Gabriela Z; Souto, Pollyana C M C; Oliveira, Carlos A F


    The aim of this study was to evaluate the human exposure of individuals from Pirassununga, Brazil, to dietary aflatoxins B1 (AFB1) and M1 (AFM1) by determination of serum AFB1-lysine and urinary aflatoxin biomarkers (AFM1 and AFB1-N(7)-guanine). The participants were recruited among employees from a Campus of the University of São Paulo, which provided food samples from their homes, as well as serum and urine samples four times every three months, from June 2011 until March 2012. The probable daily intake (PDI) of aflatoxin was estimated by using the results from analysis of food products collected by the time of samples collection, and data from a 24-hour dietary recall questionnaire. Analyses of AFB1 and AFM1 in food samples were conducted by high-performance liquid chromatography with fluorescence detection. Biomarkers in serum and urine were determined by tandem mass spectrometry. AFB1 and AFM1 were detected in 38 samples of cereals (28%, N=136) and 31 milk products (36%, N=86), respectively. AFB1-lysine and AFB1-N(7)-guanine and were not detected in serum or urine samples, respectively. However, AFM1 was found in 74 urine samples (65%), at mean levels in the 4 sampling times ranging from 0.37±0.23 to 1.70±2.88pg/mg creatinine. The mean PDI varied among different sampling times, ranging from 0.09±0.09 to 1.35±5.98ng/kg body weight/day. A modest though significant correlation (r=0.45; p=0.03; N=23) was found for the first time in Brazil between the AFM1 concentration in urine and the PDI for total aflatoxins (AFB1+AFM1) in sampling 1 (June 2011). Urinary AFM1 was confirmed as very sensitive for monitoring the human exposure to dietary aflatoxin. Further studies using serum and urinary biomarkers are needed to estimate the aflatoxin exposure of populations in higher risk areas in Brazil. PMID:26740158

  12. Aflatoxin and ochratoxin A contamination of retail foods and intake of these mycotoxins in Japan.


    Kumagai, S; Nakajima, M; Tabata, S; Ishikuro, E; Tanaka, T; Norizuki, H; Itoh, Y; Aoyama, K; Fujita, K; Kai, S; Sato, T; Saito, S; Yoshiike, N; Sugita-Konishi, Y


    A survey was undertaken of aflatoxin B1 (AFB1), B2 (AFB2), G1 (AFG1), G2 (AFG2), ochratoxin A (OTA), and fumonisin B1 (FB1), B2 (FB2) and B3 (FB3) contamination of various retail foods in Japan during 2004-05. The mycotoxins were analysed by high-performance liquid chromatography (HPLC), liquid chromatography/mass spectrometry (LC/MS) or high-performance thin-layer chromatography (HPTLC). Aflatoxins (AFs) were detected in ten of 21 peanut butter and in 22 of 44 bitter chocolate samples; the highest level of AFB1, 2.59 microg kg(-1), was found in peanut butter. Aflatoxin contamination was not observed in corn products (n = 55), corn (n = 110), peanuts (n = 120), buckwheat flour (n = 23), dried buckwheat noodles (n = 59), rice (n = 83) or sesame oil (n = 20). OTA was detected in 120 out of 192 samples of oatmeal, wheat flour, rye, buckwheat flour, raw coffee, roasted coffee, raisin, beer, wine and bitter chocolate, but not in rice or corn products. OTA levels in the positive samples were below 13 microg kg(-1). AFs and OTA intakes through the consumption of foods containing cacao were estimated using the data for mycotoxin contamination in bitter chocolate and those for the consumption of foods containing cacao in Japan. PMID:19238621

  13. The role of aflatoxin-contaminated food materials and HCV in developing hepatocellular carcinoma in Al-Sharkia Governorate, Egypt.


    Hifnawy, M S; Mangoud, Amal M; Eissa, Mostafa H; Nor Edin, Essam; Mostafa, Yousry; Abouel-Magd, Yousry; Sabee, Essam I; Amin, Ibrahem; Ismail, Alla; Morsy, Tosson A; Mahrous, Seham; Afefy, Afefy F; el-Shorbagy, Eman; el-Sadawy, Mohamoud; Ragab, Hosenia; Hassan, Mostafa I; el-Hady, Gaber; Saber, Mohamoud


    Aflatoxins, particularly aflatoxin B1 (AFB1) have been recognized as one of the most potent chemical carcinogen. In Egypt, HCV is prevalent. The progressive nature of HCV-related liver diseases was found to be influenced by other factors. In this paper, the role of aflatoxin contamination in the onset of liver cancer in HCV-infected patients was studied. The quantitative identification of the possible aflatoxins contamination in six urban and eleven rural areas using high performance liquid chromatography technique, revealed that corn, wheat, pea nut, lupine "termis", white rice, cowpea "lobiya", fava bean and brown rice showed the prevalence of AFB1 to be 64.7%, 53%, 53%, 47%, 47%, 41%, 29.4% & 29.4% respectively. A positive correlation was found between aflatoxin and positive HCV-PCR together with liver disease progression to G3S3, the indicative of hepatocellular carcinoma. Such correlation was not fully understood, but the oncogene amplification caused by HCV-infection may be aggravated by the consumption of aflatoxin contaminated raw food materials or their products. PMID:15124754

  14. Immuno-physiological alterations from AFB1 in rats counteracted by treatments with Lactobacillus paracasei BEJ01 and montmorillonite clay mixture.


    Ben Salah-Abbès, Jalila; Jebali, Rania; Sharafi, Hakimeh; Akbari Noghabi, Kambiz; Oueslati, Ridha; Abbès, Samir


    High contamination by aflatoxin B1 (AFB1) has been detected in Beja province (Tunisia) in many dairy products and animal feed, which has resulted in many tons of cereals and cereals being removed from the market, causing economic loss. While removal represents a means of reducing risk, exposures still occur. Studies have increasingly focused on means of AFB1 biodegradation/elimination using lactic acid bacteria and clay mineral. In the study here, Lactobacillus paracasei BEJ01 (LP) and montmorilonite clay (MT) were used to reduce the physio-/immunotoxicologic disorders that could develop in rats that underwent AFB1 exposures for a total of 7 consecutive days. The results indicated that rats treated with AFB1 (80 μg/kg BW) alone had significant decreases in lymphocytes in their blood (including B-lymphocytes, CD3(+), CD4(+), and CD8(+) T-lymphocyte subtypes, and NK cells), immunoglobulins (IgA and IgG) and pro-inflammatory cytokines; these rats also had altered oxidative stress status. In contrast, in rats treated with LP + MT (2 × 10(9) cfu/ml [∼ 2 mg/kg] + 0.5 mg MT/kg BW) for a total of 7 days before, concurrent with or after AFB1 treatment, there was a significant blockade/mitigation of each AFB1-impacted parameter. Moreover, treatment with the mixture at any point in relation to AFB1 treatment expectedly caused enhanced TNFα and IL-1β expression relative to control values; all other parameters were comparable to values noted in control rats. Alone, the mixture had no impact on host parameters. From the results here it may be concluded the the LP + MT mixture was effective in protecting these hosts against AFB1-induced immunologic/physiologic disorders and that LP + MT could prevent and/or mitigate AFB1 toxicities in vivo. PMID:27294391

  15. Production of Group Specific Monoclonal Antibody to Aflatoxins and its Application to Enzyme-linked Immunosorbent Assay.


    Kim, Sung-Hee; Cha, Sang-Ho; Karyn, Bischoff; Park, Sung-Won; Son, Seong-Wan; Kang, Hwan-Goo


    Through the present study, we produced a monoclonal antibody against aflatoxin B1 (AFB1) using AFB1- carboxymethoxylamine BSA conjugates. One clone showing high binding ability was selected and it was applied to develop a direct competitive ELISA system. The epitope densities of AFB1-CMO against BSA and KLH were about 1 : 6 and 1 : 545, respectively. The monoclonal antibody (mAb) from cloned hybridoma cell was the IgG1 subclass with λ-type light chains. The IC50s of the monoclonal antibody developed for AFB1, AFB2, AFG1 and AFG2 were 4.36, 7.22, 6.61 and 29.41 ng/ml, respectively, based on the AFB1-KLH coated ELISA system and 15.28, 26.62, 32.75 and 56.67 ng/ml, respectively, based on the mAb coated ELISA. Cross-relativities of mAb to AFB1 for AFB2, AFG1 and AFG2 were 60.47, 65.97 and 14.83% in the AFB1-KLH coated ELISA, and 59.41, 46.66 and 26.97% in the mAb coated ELISA, respectively. Quantitative calculations for AFB1 from the AFB1-Ab ELISA and AFB1-Ag ELISA ranged from 0.25 to 25 ng/ml (R(2) > 0.99) and from 1 to 100 ng/ml (R(2) > 0.99), respectively. The intra- and inter-assay precision CVs were < 10% in both ELISA assay, representing good reproducibility of developed assay. Recoveries ranged from 79.18 to 91.27%, CVs ranged from 3.21 to 7.97% after spiking AFB1 at concentrations ranging from 5 to 50 ng/ml and following by extraction with 70% methanol solution in the Ab-coated ELISA. In conclusion, we produced a group specific mAb against aflatoxins and developed two direct competitive ELISAs for the detection of AFB1 in feeds based on a monoclonal antibody developed. PMID:24278561

  16. Production of Group Specific Monoclonal Antibody to Aflatoxins and its Application to Enzyme-linked Immunosorbent Assay

    PubMed Central

    Kim, Sung-Hee; Cha, Sang-Ho; Karyn, Bischoff; Park, Sung-Won; Son, Seong-Wan


    Through the present study, we produced a monoclonal antibody against aflatoxin B1 (AFB1) using AFB1- carboxymethoxylamine BSA conjugates. One clone showing high binding ability was selected and it was applied to develop a direct competitive ELISA system. The epitope densities of AFB1-CMO against BSA and KLH were about 1 : 6 and 1 : 545, respectively. The monoclonal antibody (mAb) from cloned hybridoma cell was the IgG1 subclass with λ-type light chains. The IC50s of the monoclonal antibody developed for AFB1, AFB2, AFG1 and AFG2 were 4.36, 7.22, 6.61 and 29.41 ng/ml, respectively, based on the AFB1-KLH coated ELISA system and 15.28, 26.62, 32.75 and 56.67 ng/ml, respectively, based on the mAb coated ELISA. Cross-relativities of mAb to AFB1 for AFB2, AFG1 and AFG2 were 60.47, 65.97 and 14.83% in the AFB1-KLH coated ELISA, and 59.41, 46.66 and 26.97% in the mAb coated ELISA, respectively. Quantitative calculations for AFB1 from the AFB1-Ab ELISA and AFB1-Ag ELISA ranged from 0.25 to 25 ng/ml (R2 > 0.99) and from 1 to 100 ng/ml (R2 > 0.99), respectively. The intra- and inter-assay precision CVs were < 10% in both ELISA assay, representing good reproducibility of developed assay. Recoveries ranged from 79.18 to 91.27%, CVs ranged from 3.21 to 7.97% after spiking AFB1 at concentrations ranging from 5 to 50 ng/ml and following by extraction with 70% methanol solution in the Ab-coated ELISA. In conclusion, we produced a group specific mAb against aflatoxins and developed two direct competitive ELISAs for the detection of AFB1 in feeds based on a monoclonal antibody developed. PMID:24278561

  17. Aflatoxin B₁ and aflatoxins in ground red chilli pepper after drying.


    Özkan, Ali; Bindak, Recep; Erkmen, Osman


    In this study, 180 red chilli pepper (RCP) berry samples were obtained from two different croplands of Gaziantep and Kahramanmaraş (Turkey) in August, September and October. RCP berry samples were dried under sunlight and grinded. Ground red chilli pepper (GRCP) samples were analysed for aflatoxins (AFs, sum of B1, B2, G1 and G2) and AFB1 contamination. According to the results, in 49 of 180 samples, AFB1 and in 37 samples, AFs were higher than legal limits. The lowest amounts of AFs and AFB1 were obtained in August and the highest amounts in October. χ(2) analysis showed that there were no significant differences (p > 0.05) between cities among 3 months according to number of samples with AFs and AFB1 above legal limits. According to the Duncan multiple-range test, there was no significant difference between all months. Strict measures are necessary to produce high-quality GRCP. RCP berry must be treated to reduce moulds before production of GRCP. PMID:26099014

  18. Characterization of the critical amino acids of an Aspergillus parasiticus cytochrome P-450 monooxygenase encoded by ordA that is involved in the biosynthesis of aflatoxins B1, G1, B2, and G2.


    Yu, J; Chang, P K; Ehrlich, K C; Cary, J W; Montalbano, B; Dyer, J M; Bhatnagar, D; Cleveland, T E


    The conversion of O-methylsterigmatocystin (OMST) and dihydro-O-methylsterigmatocystin to aflatoxins B1, G1, B2, and G2 requires a cytochrome P-450 type of oxidoreductase activity. ordA, a gene adjacent to the omtA gene, was identified in the aflatoxin-biosynthetic pathway gene cluster by chromosomal walking in Aspergillus parasiticus. The ordA gene was a homolog of the Aspergillus flavus ord1 gene, which is involved in the conversion of OMST to aflatoxin B1. Complementation of A. parasiticus SRRC 2043, an OMST-accumulating strain, with the ordA gene restored the ability to produce aflatoxins B1, G1, B2, and G2. The ordA gene placed under the control of the GAL1 promoter converted exogenously supplied OMST to aflatoxin B1 in Saccharomyces cerevisiae. In contrast, the ordA gene homolog in A. parasiticus SRRC 2043, ordA1, was not able to carry out the same conversion in the yeast system. Sequence analysis revealed that the ordA1 gene had three point mutations which resulted in three amino acid changes (His-400-->Leu-400, Ala-143-->Ser-143, and Ile-528-->Tyr-528). Site-directed mutagenesis studies showed that the change of His-400 to Leu-400 resulted in a loss of the monooxygenase activity and that Ala-143 played a significant role in the catalytic conversion. In contrast, Ile-528 was not associated with the enzymatic activity. The involvement of the ordA gene in the synthesis of aflatoxins G1, and G2 in A. parasiticus suggests that enzymes required for the formation of aflatoxins G1 and G2 are not present in A. flavus. The results showed that in addition to the conserved heme-binding and redox reaction domains encoded by ordA, other seemingly domain-unrelated amino acid residues are critical for cytochrome P-450 catalytic activity. The ordA gene has been assigned to a new cytochrome P-450 gene family named CYP64 by The Cytochrome P450 Nomenclature Committee. PMID:9835571

  19. Two-dimensional heart-cut LC-LC improves accuracy of exact-matching double isotope dilution mass spectrometry measurements of aflatoxin B1 in cereal-based baby food, maize, and maize-based feed.


    Breidbach, Andreas; Ulberth, Franz


    Aflatoxins, mycotoxins of fungi of the Aspergillus sp., pose a risk to consumer health and are, therefore, regulated by more than 100 countries. To facilitate method development and validation as well as assessment of measurement capabilities, availability of certified reference materials and proficiency testing schemes is important. For these purposes, highly accurate determinations of the aflatoxin content in the materials used are necessary. We describe here the use of two-dimensional heart-cut LC-LC in combination with exact-matching double isotope dilution mass spectrometry to determine the content of aflatoxin B1 in three materials used in a proficiency testing scheme. The serious reduction in ionization suppression afforded by the two-dimensional heart-cut LC-LC had a positive effect on the precision of the measured isotope ratios of the exact-matching double isotope dilution mass spectrometry. This is evidenced by the expanded measurement uncertainty (k=2) of 0.017 μg/kg or 8.9 % relative to a mass fraction of aflatoxin B1 in a cereal-based baby food of 0.197 μg/kg. This value is in perfect agreement with the consensus value of this material from a proficiency test (PT) scheme for National Reference Laboratories executed by the European Reference Laboratory for Mycotoxins. The effort necessary to perform the described methodology precludes its frequent use but for specific applications we see it as a valuable tool. PMID:25015044

  20. Stable expression of rat cytochrome P-450IIB1 cDNA in Chinese hamster cells (V79) and metabolic activation of aflatoxin B1.

    PubMed Central

    Doehmer, J; Dogra, S; Friedberg, T; Monier, S; Adesnik, M; Glatt, H; Oesch, F


    V79 Chinese hamster fibroblasts are widely used for mutagenicity testing but have the serious limitation that they do not express cytochromes P-450, which are needed for the activation of many promutagens to mutagenic metabolites. A full-length cDNA clone encoding the monooxygenase cytochrome P-450IIB1 under control of the simian virus 40 early promoter was constructed and cointroduced with the selection marker neomycin phosphotransferase (conferring resistance to G418) into V79 Chinese hamster cells. G418-resistant cells were selected, established as cell lines, and tested for cytochrome P-450IIB1 expression and enzymatic activity. Two cell lines (SD1 and SD3) were found that stably produce cytochrome P-450IIB1. Although purified cytochromes P-450 possess monooxygenase activity only after reconstitution with cytochrome P-450 reductase and phospholipid, the gene product of the construct exhibited this activity. This implies that the gene product is intracellularly localized in a way that allows access to the required components. If compared with V79 cells, the mutation rate for the hypoxanthine phosphoribosyltransferase (HPRT) locus in SD1 cells is markedly increased when exposed to aflatoxin B1, which is activated by this enzyme. Images PMID:3137560

  1. Lab-on-a-chip based biosensor for the real-time detection of aflatoxin.


    Uludag, Yıldız; Esen, Elif; Kokturk, Guzin; Ozer, Hayrettin; Muhammad, Turghun; Olcer, Zehra; Basegmez, H Imge Oktay; Simsek, Senay; Barut, Serkan; Gok, M Yagmur; Akgun, Mete; Altintas, Zeynep


    Polymers were synthesized and utilized for aflatoxin detection coupled with a novel lab-on-a-chip biosensor: MiSens and high performance liquid chromatography (HPLC). Non-imprinted polymers (NIPs) were preferred to be designed and used due to the toxic nature of aflatoxin template and also to avoid difficult clean-up protocols. Towards an innovative miniaturized automated system, a novel biochip has been designed that consists of 6 working electrodes (1mm diameter) with shared reference and counter electrodes. The aflatoxin detection has been achieved by a competition immunoassay that has been performed using the new biochips and the automated MiSens electrochemical biosensor device. For the assay, aflatoxin antibody has been captured on the Protein A immobilized electrode. Subsequently the sample and the enzyme-aflatoxin conjugate mixture has been injected to the electrode surfaces. The final injection of the enzyme substrate results in an amperometric signal. The sensor assays for aflatoxin B1 (AFB1) in different matrices were also performed using enzyme link immunosorbent assay (ELISA) and HPLC for confirmation. High recovery was successfully achieved in spiked wheat samples using NIP coupled HPLC and NIP coupled MiSens biosensor [2ppb of aflatoxin was determined as 1.86ppb (93% recovery), 1.73ppb (86.5% recovery), 1.96ppb (98% recovery) and 1.88ppb (94.0% recovery) for immunoaffinity column (IAC)-HPLC, NIP-HPLC, Supel™ Tox SPE Cartridges (SUP)-HPLC and NIP-MiSens, respectively]. Aflatoxin detection in fig samples were also investigated with MiSens biosensor and the results were compared with HPLC method. The new biosensor allows real-time and on-site detection of AFB1 in foods with a rapid, sensitive, fully automated and miniaturized system and expected to have an immense economic impact for food industry. PMID:27591628

  2. Determination of Aflatoxins in Peanut Products in the Northeast Region of São Paulo, Brazil

    PubMed Central

    Oliveira, Carlos A. F.; Gonçalves, Natália B.; Rosim, Roice E.; Fernandes, Andrezza M.


    The aim of the present study was to determine aflatoxin levels in peanut products traded in the Northeast region of São Paulo, Brazil. To this end, 240 samples of peanut products traded in the cities of Araras, Leme, Pirassununga and Porto Ferreira were collected from June 2006 to May 2007. The samples were analyzed for aflatoxins (AF) B1, B2, G1 and G2 by high performance liquid chromatography. Results showed 44.2% samples positive for AF at levels of 0.5 to 103.8 μg·kg−1. Nine of the positive samples (3.7% of the analysed samples) had total aflatoxin concentrations (B1+B2+G1+G2) higher than the limit established by Brazilian regulations (20 μg·kg−1). Based on the above data, the probable mean daily intake (PDIM) of aflatoxins from peanut products in the Northeast region of São Paulo was estimated to be 0.23 ng kg b.w. day−1. Although this PDIM value was relatively low, results indicate that aflatoxin contamination of peanut products may be a public health concern in Brazil, when considering the potential exposure of highly susceptible consumers. For example, it should be emphasized that children are potentially exposed to aflatoxins, since they consume large quantities of peanut candies, and these products had the highest number of samples positive for AFB1. PMID:19333440

  3. Effectiveness of pulsed light treatment for degradation and detoxification of aflatoxin B1 and B2 in rough rice and rice bran

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aflatoxins primarily accumulate in the hull and bran layers of rough rice making these by-products of rice milling unsuitable for animal feed or human consumption. Contaminated rough rice is also a potential source of aflatoxin exposure to workers handling the grain during post-harvest storage and p...

  4. Application of magnetic solid phase extraction for separation and determination of aflatoxins B ₁ and B₂ in cereal products by high performance liquid chromatography-fluorescence detection.


    Hashemi, Mahdi; Taherimaslak, Zohreh; Rashidi, Somayeh


    A simple and sensitive method based on the magnetic solid phase extraction with modified magnetic nanoparticles followed by high performance liquid chromatography with fluorescence detection has been developed for extraction and determination of aflatoxins B1 (AFB1) and B2 (AFB2) in cereal products. Magnetic nanoparticle coated with 3-(trimethoxysilyl)-1-propanthiol (TMSPT) and modified with 2-amino-5-mercapto-1,3,4-thiadiazole (AMT) was used as an antibody-free adsorbent. Under the optimal conditions, the calibration curves for AFB1 and AFB2 were linear in the ranges of 0.2-15 μg L(-1) and 0.04-3 μg L(-1), respectively. Detection limit was 0.041 μg L(-1) for AFB1 and 0.013 μg L(-1) for AFB2. The proposed method was successfully applied to the determination of AFB1 and AFB2 in spiked corn and rice samples with an average recovery of 93.5%. The results demonstrated that the developed method is simple, rapid, inexpensive, accurate and remarkably free from interference effects. PMID:24814005

  5. Intervention trial with calcium montmorillonite clay in a south Texas population exposed to aflatoxin.


    Pollock, Brad H; Elmore, Sarah; Romoser, Amelia; Tang, Lili; Kang, Min-Su; Xue, Kathy; Rodriguez, Marisa; Dierschke, Nicole A; Hayes, Holly G; Hansen, H Andrew; Guerra, Fernando; Wang, Jia-Sheng; Phillips, Timothy


    South Texas currently has the highest incidence of hepatocellular carcinoma (HCC) in the United States, a disease that disproportionately affects Latino populations in the region. Aflatoxin B1 (AFB1) is a potent liver carcinogen that has been shown to be present in a variety of foods in the United States, including corn and corn products. Importantly, it is a dietary risk factor contributing to a higher incidence of HCC in populations frequently consuming AFB1-contaminated diets. In a randomised double-blind placebo controlled trial, we evaluated the effects of a 3-month administration of ACCS100 (refined calcium montmorillonite clay) on serum AFB1-lysine adduct (AFB-Lys) level and serum biochemistry in 234 healthy men and women residing in Bexar and Medina counties, Texas. Participants recruited from 2012 to 2014 received either a placebo, 1.5 g or 3 g ACCS100 each day for 3 months, and no treatment during the fourth month. Adverse event rates were similar across treatment groups and no significant differences were observed for serum biochemistry and haematology parameters. Differences in levels of AFB-Lys at 1, 3 and 4 months were compared between placebo and active treatment groups. Although serum AFB-Lys levels were decreased by month 3 for both treatment groups, the low dose was the only treatment that was significant (p = 0.0005). In conclusion, the observed effect in the low-dose treatment group suggests that the use of ACCS100 may be a viable strategy to reduce dietary AFB1 bioavailability during aflatoxin outbreaks and potentially in populations chronically exposed to this carcinogen. PMID:27321368

  6. Exposure to aflatoxin B1 in utero is associated with DNA methylation in white blood cells of infants in The Gambia

    PubMed Central

    Hernandez-Vargas, Hector; Castelino, Jovita; Silver, Matt J; Dominguez-Salas, Paula; Cros, Marie-Pierre; Durand, Geoffroy; Calvez-Kelm, Florence Le; Prentice, Andrew M; Wild, Christopher P; Moore, Sophie E; Hennig, Branwen J; Herceg, Zdenko; Gong, Yun Yun; Routledge, Michael N


    Background: Exposure to environmental toxins during embryonic development may lead to epigenetic changes that influence disease risk in later life. Aflatoxin is a contaminant of staple foods in sub-Saharan Africa, is a known human liver carcinogen and has been associated with stunting in infants. Methods: We have measured aflatoxin exposure in 115 pregnant women in The Gambia and examined the DNA methylation status of white blood cells from their infants at 2–8 months old (mean 3.6 ± 0.9). Aflatoxin exposure in women was assessed using an ELISA method to measure aflatoxin albumin (AF-alb) adducts in plasma taken at 1–16 weeks of pregnancy. Genome-wide DNA methylation of infant white blood cells was measured using the Illumina Infinium HumanMethylation450beadchip. Results: AF-alb levels ranged from 3.9 to 458.4 pg/mg albumin. We found that aflatoxin exposure in the mothers was associated to DNA methylation in their infants for 71 CpG sites (false discovery rate < 0.05), with an average effect size of 1.7% change in methylation. Aflatoxin-associated differential methylation was observed in growth factor genes such as FGF12 and IGF1, and immune-related genes such as CCL28, TLR2 and TGFBI. Moreover, one aflatoxin-associated methylation region (corresponding to the miR-4520b locus) was identified. Conclusions: This study shows that maternal exposure to aflatoxin during the early stages of pregnancy is associated with differential DNA methylation patterns of infants, including in genes related to growth and immune function. This reinforces the need for interventions to reduce aflatoxin exposure, especially during critical periods of fetal and infant development. PMID:25855716

  7. Aflatoxins in selected Thai commodities.


    Tansakul, Natthasit; Limsuwan, Sasithorn; Böhm, Josef; Hollmann, Manfred; Razzazi-Fazeli, Ebrahim


    Aflatoxin (AF) B1, B2, G1 and G2 were determined in 120 samples of selected Thai commodities including unpolished rice, unpolished glutinous rice, chilli powder, whole dried chilli pods and raw peanut. The mean concentrations of the total AFs for analysed samples were 0.16, 25.43, 14.18, 6.62 and 1.43 µg kg(-1) with positive incidences of 4%, 20%, 97%, 37% and 30%, respectively. Quantitative analysis was performed using HPLC equipped with post-column derivatisation and fluorescence detection. Sample clean-up was carried out using immunoaffinity columns for selective enrichment of AFs. The method was validated by using certified reference material, which showed recoveries over 85%. The limit of detections (LODs) and limit of quantifications (LOQs) were in a range between 0.01-0.11 µg kg(-1) and 0.03-0.38 µg kg(-1), respectively. The results clearly demonstrated that AFs were detectable in different matrices. Chilli powder was found to have the highest level of AFs contamination followed by chilli pods, peanut and rice, respectively. However, among the selected commodities, unpolished rice contained only trace levels of AFB1 and AFB2. With regard to the fact that AFs are a natural contaminant in commodities, this report calls to attention the regular monitoring and effective control of food commodities to prevent health hazards. PMID:24779933

  8. Optimization and validation of a HPLC method for simultaneous determination of aflatoxin B1, B2, G1, G2, ochratoxin A and zearalenone using an experimental design.


    Rahmani, Anosheh; Selamat, Jinap; Soleimany, Farhang


    A reversed-phase HPLC optimization strategy is presented for investigating the separation and retention behavior of aflatoxin B1, B2, G1, G2, ochratoxin A and zearalenone, simultaneously. A fractional factorial design (FFD) was used to screen the significance effect of seven independent variables on chromatographic responses. The independent variables used were: (X1) column oven temperature (20-40°C), (X2) flow rate (0.8-1.2 ml/min), (X3) acid concentration in aqueous phase (0-2%), (X4) organic solvent percentage at the beginning (40-50%), and (X5) at the end (50-60%) of the gradient mobile phase, as well as (X6) ratio of methanol/acetonitrile at the beginning (1-4) and (X7) at the end (0-1) of gradient mobile phase. Responses of chromatographic analysis were resolution of mycotoxin peaks and HPLC run time. A central composite design (CCD) using response surface methodology (RSM) was then carried out for optimization of the most significant factors by multiple regression models for response variables. The proposed optimal method using 40°C oven temperature, 1 ml/min flow rate, 0.1% acetic acid concentration in aqueous phase, 41% organic phase (beginning), 60% organic phase (end), 1.92 ratio of methanol to acetonitrile (beginning) and 0.2 ratio (end) for X1-X7, respectively, showed good prediction ability between the experimental data and predictive values throughout the studied parameter space. Finally, the optimized method was validated by measuring the linearity, sensitivity, accuracy and precision parameters, and has been applied successfully to the analysis of spiked cereal samples. PMID:21598138

  9. Effect of selenium supplementation on aflatoxin B₁-induced histopathological lesions and apoptosis in bursa of Fabricius in broilers.


    Chen, Kejie; Fang, Jing; Peng, Xi; Cui, Hengmin; Chen, Jin; Wang, Fengyuan; Chen, Zhengli; Zuo, Zhicai; Deng, Junliang; Lai, Weimin; Zhou, Yi


    To investigate the effects of sodium selenite against aflatoxin B1 (AFB 1), 200 male Avian broilers, divided into five groups, were fed with basal diet (control group), 0.3 mg/kg AFB1 (AFB1 group), 0.3 mg/kg AFB1 + 0.2 mg/kg Se (+Se group I), 0.3 mg/kg AFB1 + 0.4 mg/kg Se (+Se group II) and 0.3 mg/kg AFB1 + 0.6 mg/kg Se (+Se group III), respectively. Compared with the control group, decreased relative weight of bursa of Fabricius and contents of serum immunoglobulin, more vacuoles and debris in the bursal lymphoid follicle, and increased percentage of apoptotic bursal cells were observed in the AFB1 group. Sodium selenite, however, could increase the relative weight of bursa of Fabricius and contents of serum immunoglobulin, and ameliorate histopathological lesions. The percentages of apoptotic bursal cells, through flow cytometry and terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling method, in the three +Se groups were lower than those in the AFB 1 group. Compared with the AFB 1 group, moreover, the mRNA expressions of Bax and Caspase-3 by qRT-PCR in the three +Se groups were decreased, while the expression of Bcl-2 was increased. The results indicate that sodium selenite in diet can protect chicken from AFB 1-induced impairment of humoral immune function by reducing bursal histopathological lesions and percentages of apoptotic bursal cells. PMID:25261862

  10. Potential of essential oils for protection of grains contaminated by aflatoxin produced by Aspergillus flavus

    PubMed Central

    Esper, Renata H.; Gonçalez, Edlayne; Marques, Marcia O. M.; Felicio, Roberto C.; Felicio, Joana D.


    Aflatoxin B1 (AFB1) is a highly toxic and carcinogenic metabolite produced by Aspergillus species on food and agricultural commodities. Inhibitory effects of essential oils of Ageratum conyzoides (mentrasto) and Origanum vulgare (oregano) on the mycelial growth and aflatoxin B1 production by Aspergillus flavus have been studied previously in culture medium. The aim of this study was to evaluate aflatoxin B1 production by Aspergillus flavus in real food systems (corn and soybean) treated with Ageratum conyzoides (mentrasto) and Origanum vulgare (oregano) essential oils. Samples with 60 g of the grains were treated with different volumes of essential oils, 200, 100, 50, and 10 μL for oregano and 50, 30, 15, and 10 μL for mentrasto. Fungal growth was evaluated by disk diffusion method. Aflatoxin B1 production was evaluated inoculating suspensions of A. flavus containing 1.3 × 105 spores/mL in 60 g of grains (corn and soybeans) after adjusting the water activity at 0.94. Aflatoxin was quantified by photodensitometry. Fungal growth and aflatoxin production were inhibited by essential oils, but the mentrasto oil was more effective in soybeans than that of oregano. On the other hand, in corn samples, the oregano essential oil was more effective than that of mentrasto. Chemical compositions of the essential oils were also investigated. The GC/MS oils analysis showed that the main component of mentrasto essential oil is precocene I and of the main component of oregano essential oil is 4-terpineol. The results indicate that both essential oils can become an alternative for the control of aflatoxins in corn and soybeans. PMID:24926289

  11. Development of hyperbranched polymers with non-covalent interactions for extraction and determination of aflatoxins in cereal samples.


    Liu, Xiaoyan; Li, Huihui; Xu, Zhigang; Peng, Jialin; Zhu, Shuqiang; Zhang, Haixia


    A novel approach for assembling homogeneous hyperbranched polymers based on non-covalent interactions with aflatoxins was developed; the polymers were used to evaluate the extraction of aflatoxins B1, B2, G1 and G2 (AFB1, AFB2, AFG1 and AFG2) in simulant solutions. The results showed that the extraction efficiencies of three kinds of synthesized polymers for the investigated analytes were not statistically different; as a consequence, one of the representative polymers (polymer I) was used as the solid-phase extraction (SPE) sorbent to evaluate the influences of various parameters, such as desorption conditions, pH, ionic strength, concentration of methanol in sample solutions, and the mass of the sorbent on the extraction efficiency. In addition, the extraction efficiencies for these aflatoxins were compared between the investigated polymer and the traditional sorbent C18. The results showed that the investigated polymer had superior extraction efficiencies. Subsequently, the proposed polymer for the SPE packing material was employed to enrich and analyze four aflatoxins in the cereal powder samples. The limits of detection (LODs) at a signal-to-noise (S/N) ratio of 3 were in the range of 0.012-0.120 ng g(-1) for four aflatoxins, and the limits of quantification (LOQs) calculated at S/N=10 were from 0.04 to 0.40 ng g(-1) for four aflatoxins. The recoveries of four aflatoxins from cereal powder samples were in the range of 82.7-103% with relative standard deviations (RSDs) lower than 10%. The results demonstrate the suitability of the SPE approach for the analysis of trace aflatoxins in cereal powder samples. PMID:24050668

  12. Simultaneous determination of aflatoxins B1, B2, G1, G2, M1 and M2 in peanuts and their derivative products by ultra-high-performance liquid chromatography-tandem mass spectrometry.


    Huang, Baifen; Han, Zheng; Cai, Zengxuan; Wu, Yongjiang; Ren, Yiping


    A reliable ultra-high-performance liquid chromatography-tandem mass spectrometry (UHPLC-MS/MS) method for simultaneous determination of aflatoxins B1, B2, G1, G2, M1 and M2 in peanuts and their derivative products was developed. The sample was extracted by 84% of acetonitrile aqueous solution and the extract was purified by a reliable solid phase extraction-based clean-up method. Then, the analytes were separated on Acquity UPLC HSS T3 column (100 mm x 2.1 mm, 1.8 microm particle size), and eluted with a mobile phase consisting of (A) water containing 0.1% formic acid and (B) acetonitrile/methanol (50/50, v/v). The separated compounds were detected with a Waters Micromass Quattro Ultima Pt tandem quadrupole mass spectrometer operating in positive electro-spray ionization using multiple reaction monitoring mode. The established method was extensively validated by determining the linearity (R(2) > or = 0.9990), average recovery (74.7-86.8%) and precision (relative standard deviation < or = 10.9%). It was shown to be a suitable method for simultaneous determination of the six aflatoxins in peanuts and their derivative products. Finally, a total of 73 samples randomly collected from different areas in Zhejiang province were screened for aflatoxins with the proposed method. The results showed that 31 samples of peanut butter, 14 samples of fresh peanut and 5 samples of musty peanut were contaminated with aflatoxins. Meanwhile, this was the first report on aflatoxins M1 and M2, which were found in unprocessed peanuts and their derivative products. PMID:20152266

  13. Method Validation for the Quantitative Analysis of Aflatoxins (B1, B2, G1, and G2) and Ochratoxin A in Processed Cereal-Based Foods by HPLC with Fluorescence Detection.


    Gazioğlu, Işil; Kolak, Ufuk


    Modified AOAC 991.31 and AOAC 2000.03 methods for the simultaneous determination of total aflatoxins (AFs), aflatoxin B1, and ochratoxin A (OTA) in processed cereal-based foods by RP-HPLC coupled with fluorescence detection were validated. A KOBRA® Cell derivatization system was used to analyze total AFs. One of the modifications was the extraction procedure of mycotoxins. Both AFs and OTA were extracted with methanol-water (75+25, v/v) and purified with an immunoaffinity column before HPLC analysis. The modified methods were validated by measuring the specificity, selectivity, linearity, sensitivity, accuracy, repeatability, reproducibility, recovery, LOD, and LOQ parameters. The validated methods were successfully applied for the simultaneous determination of mycotoxins in 81 processed cereal-based foods purchased in Turkey. These rapid, sensitive, simple, and validated methods are suitable for the simultaneous determination of AFs and OTA in the processed cereal-based foods. PMID:26268976

  14. Surveys of rice sold in Canada for aflatoxins, ochratoxin A and fumonisins

    PubMed Central

    Bansal, J.; Pantazopoulos, P.; Tam, J.; Cavlovic, P.; Kwong, K.; Turcotte, A.-M.; Lau, B.P.-Y.; Scott, P.M.


    Approximately 200 samples of rice (including white, brown, red, black, basmati and jasmine, as well as wild rice) from several different countries, including the United States, Canada, Pakistan, India and Thailand, were analysed for aflatoxins, ochratoxin A (OTA) and fumonisins by separate liquid Chromatographic methods in two different years. The mean concentrations for aflatoxin B1 (AFB1) were 0.19 and 0.17 ng g−1 with respective positive incidences of 56% and 43% (≥ the limit of detection (LOD) of 0.002 ng g−1). Twenty-three samples analysed in the second year also contained aflatoxin B2 (AFB2) at levels ≥LOD of 0.002 ng g−1 The five most contaminated samples in each year contained 1.44–7.14 ng AFB1 g−1 (year 1) and 1.45–3.48 ng AFB1 g−1 (year 2); they were mostly basmati rice from India and Pakistan and black and red rice from Thailand. The average concentrations of ochratoxin A (OTA) were 0.05 and 0.005 ng g−1 in year 1 and year 2, respectively; incidences of samples containing ≥LOD of 0.05 ng g−1 were 43% and 1%, respectively, in the 2 years. All positive OTA results were confirmed by LC-MS/MS. For fumonisins, concentrations of fumonisin B1 (FB1) averaged 4.5 ng g−1 in 15 positive samples (≥0.7 ng g−1) from year 1 (n = 99); fumonisin B2 (FB2) and fumonisin B3 (FB3) were also present (≥1 ng g−1). In the second year there was only one positive sample (14 ng g−1 FB1) out of 100 analysed. All positive FB1 results were confirmed by LC-MS/MS. PMID:21623501

  15. Validation of a UHPLC-FLD analytical method for the simultaneous quantification of aflatoxin B1 and ochratoxin a in rat plasma, liver and kidney.


    Corcuera, Laura-Ana; Ibáñez-Vea, María; Vettorazzi, Ariane; González-Peñas, Elena; Cerain, Adela López de


    A rapid and simple method for the simultaneous quantification of AFB1 and OTA in rat plasma, liver and kidney by UHPLC-FLD has been successfully validated according to the following criteria: selectivity, stability, linearity, precision, accuracy, recovery, robustness and limits of quantification and detection. The extraction method, calibration curves and chromatographic conditions are common for the three matrices. Plasma and homogenized tissue samples (100 μL) were extracted with acetonitrile:formic acid mixture (99:1) (300 μL). Chromatographic separation was performed with a mixture of water and acetonitrile:methanol (50:50), both acidified with 0.5% of formic acid using a gradient profile. The method avoids the use of immunoaffinity columns and allows reduction of sample and solvent volumes as well as toxic wastes. The detection is based on a photochemical reaction which enhances the AFB1 response without affecting the OTA signal before reaching the fluorescent detector. The mycotoxin recovery for each matrix was very efficient, between 93% and 96% for AFB1 and between 94% and 96% for OTA. For both mycotoxins the LOQs were 2μg/L in plasma and 8μg/kg in liver and kidney. The method has successfully been applied to rat samples after a single oral administration of a mixture of AFB1 and OTA and it could be a useful tool in toxicokinetic and toxicological studies. PMID:21868292

  16. Effects of Lipoic Acid on Immune Function, the Antioxidant Defense System, and Inflammation-Related Genes Expression of Broiler Chickens Fed Aflatoxin Contaminated Diets

    PubMed Central

    Li, Yan; Ma, Qiu-Gang; Zhao, Li-Hong; Wei, Hua; Duan, Guo-Xiang; Zhang, Jian-Yun; Ji, Cheng


    This study was designed to evaluate the effect of low level of Aflatoxin B1 (AFB1) on oxidative stress, immune reaction and inflammation response and the possible ameliorating effects of dietary alpha-lipoic acid (α-LA) in broilers. Birds were randomly allocated into three groups and assigned to receive different diets: basal diet, diet containing 74 μg/kg AFB1, and 300 mg/kg α-LA supplementation in diet containing 74 μg/kg AFB1 for three weeks. The results showed that the serum levels of malondialdehyde, tumor necrosis factor alpha (TNFα) and interferon gamma (IFNγ) in the AFB1-treated group were significantly increased than the control group. In addition, the increased expressions of interleukin 6 (IL6), TNFα and IFNγ were observed in birds exposed to the AFB1-contaminated diet. These degenerative changes were inhibited by α-LA-supplement. The activities of total superoxide dismutase and glutathione peroxidase, the levels of humoral immunity, and the expressions of nuclear factor-κB p65 and heme oxygenase-1, however, were not affected by AFB1. The results suggest that α-LA alleviates AFB1 induced oxidative stress and immune changes and modulates the inflammatory response at least partly through changes in the expression of proinflammatory cytokines of spleen such as IL6 and TNFα in broiler chickens. PMID:24699046

  17. Response of a Mu-class glutathione S-transferase from black tiger shrimp Penaeus monodon to aflatoxin B1 exposure.


    Wang, Yun; Liu, Lihui; Huang, Jianhua; Duan, Yafei; Wang, Jun; Fu, Mingjun; Lin, Heizhao


    Glutathione S-transferases (GSTs) are a family of multifunctional phase II enzymes that are involved in the detoxification of exogenous and endogenous compounds. In this study, a full-length cDNA of Mu-class GST (PmMuGST) was isolated from the hepatopancreas of Penaeus monodon using rapid amplification of cDNA ends method. The full length cDNA of PmMuGST is 867 bp, contains an open read frame of 660 bp, and encodes a polypeptide of 219 amino acids with a molecular mass of 25.61 kDa and pI of 6.15. Sequence analysis indicated that the predicted protein sequence of PmMuGST was very similar to (86 %) that of Litopenaeus vannamei. A conserved domain of GST_N_Mu_like (PSSM: cd03075) and GST_C_family_superfamily_like (PSSM: cl02776) was indentified in PmMuGST. Real time quantitative RT-PCR analysis indicated that PmMuGST was present in all of the tested tissues. PmMuGST transcripts both in the hepatopancreas and in the muscle were significantly induced after 14 days of treatment with a low dosage of AFB1 (50 μg/kg) exposure and were significantly inhibited after 42 and 56 days of a high dosage of AFB1 (1000, 2500 μg/kg AFB1) exposure. Taken together, the Mu-class GST from P. monodon was inducible and was involved in the response to AFB1 exposure. PMID:27386274

  18. Determination of aflatoxins B1, B2, G1, and G2 in olive oil, peanut oil, and sesame oil using immunoaffinity column cleanup, postcolumn derivatization, and liquid chromatography with fluorescence detection: first action 2013.05.


    Bao, Lei; Liang, Chengzhu; Trucksess, Mary W; Xu, Yanli; Lv, Ning; Wu, Zhenxing; Jing, Ping; Fry, Fred S


    A collaborative study of a method for determination of aflatoxins (AFs) B1, B2, G1, and G2 in olive oil, peanut oil, and sesame oil using immunoaffinity column cleanup, postcolumn derivatization, and LC with fluorescence detection, previously published in J. AOAC Int. 95, 1689-1700 (2012), was approved as First Action 2013.05 on March 29, 2013 by the Method-Centric Committee for Aflatoxins in Edible Oils. The method uses methanol for extraction followed by filtration. The extract is applied to an immunoaffinity column with antibodies specific for AFs, which are then eluted from the column with a methanol solution. Determination and quantification occur using RP-LC with fluorescence detection after postcolumn derivatization. The average recovery of AFs in olive, peanut, and sesame oils in spiked samples (levels between 2.0 and 20.0 microg/kg) ranged from 84 to 92%. The recoveries for AFs B1, B2, G1, and G2 were 86-93, 89-95, 85-97, and 76-85%, respectively. Within-laboratory RSD (RSDr) values for AFs ranged from 3.4 to 10.2%. RSDr values forAF B1, B2, G1, and G2 were 3.5-10.9, 3.2-9.5, 6.5-14.9, and 4.8-14.2%, respectively. Between-laboratory RSD (RSDR) values for AFs were 6.1-14.5%. RSD, values for AFs B1, B2, G1, and G2 were 7.5-15.4, 7.1-14.6, 10.8-18.1, and 7.6-23.7%, respectively. Horwitz ratio values were < or =2 for the analytes in the three matrixes. PMID:24282940

  19. [Determination of aflatoxins in cereals and oils by liquid chromatography-triple quadrupole tandem mass spectrometry].


    Wang, Xiupin; Li, Peiwu; Yang, Yang; Zhang, Wen; Zhang, Qi; Fan, Sufang; Yu, Li; Wang, Lin; Chen, Xiaomei; Li, Ying; Jiang, Jun


    The high performance liquid chromatography (HPLC)-triple quadrupole tandem mass spectrometry was applied for the determination of the aflatoxins: B1 (AFB1), B2 (AFB2), G1 (AFG1) and G2 (AFG2), in cereals and oils. The samples were first extracted by ultrasonic method. The optimized conditions of ultrasonic extraction were as follows: temperature of 50 degrees C, extraction time of 3 min, methanol-water (containing 40 g/L NaCl) (80: 20, v/v) solution as the medium and a ratio of sample to solvent of 1 : 3 (g: mL). The extracts were then purified using an immunoaffinity column. The separation was performed on a C18 column with mobile phases of 10 mmol/L ammonium acetate and methanol in gradient elution. The sensitive detection of the four AFT compounds by electrospray ionization mass spectrometry (ESI-MS) was carried out in selected reaction monitoring (SRM) mode with aflatoxin M1 (AFM1) as the internal standard. Under the optimized conditions, the limits of detection of AFB1, AFB2, AFG1 and AFG2 were 0.002, 0.004, 0.004 and 0.012 microg/kg, respectively. The recoveries of aflatoxins in different spiked cereals and oils were in the range from 87% to 111%. The intra-day and inter-day precisions were not more than 6.7% and 5.6%, respectively. In comparison with the external standard method, this method can effectively inhibit the matrix effects, and greatly improve the accuracy. PMID:22032163

  20. Detection of Aspergillus flavus in stored peanuts using real-time PCR and the expression of aflatoxin genes in toxigenic and atoxigenic A. flavus isolates.


    Mahmoud, Mohamed A


    Aspergillus flavus is the main species from section Flavi responsible for aflatoxin accumulation in stored peanuts. Rapid methods to detect A. flavus could help to prevent aflatoxins from entering the food chain. A real-time polymerase chain reaction (RTi-PCR) assay was standardized for rapid, specific, and sensitive detection of A. flavus in stored peanuts. A. flavus was detected in 53.6% and 50% of peanut samples by RTi-PCR and A. flavus and Aspergillus parasiticus agar culture, respectively, with 95% agreement between them. Twenty-two A. flavus isolates were screened using high-performance liquid chromatography for their capacity to produce aflatoxin AFB1 (B1). B1 was produced by >72% of the isolates. Sixteen isolates produced B1 at concentrations ranging from 1.64 to 109.18 μg/mL. Four aflatoxin biosynthetic pathway genes (aflD, aflM, aflP, and aflQ) were evaluated using PCR and reverse-transcription PCR in 22 A. flavus isolates from peanut kernels with the aim of rapidly and accurately differentiating toxigenic and atoxigenic isolates. The PCR amplification of genes did not correlate with aflatoxin production capability. The expression of aflD and aflQ was a good marker for differentiating toxigenic from atoxigenic isolates. PMID:25621617

  1. Acute effects of aflatoxins on guinea pig isolated ileum.


    Luzi, A; Cometa, M F; Palmery, M


    Previous studies on the aflatoxins have focused mainly on their chronic toxic effects. In this study we investigated the acute gastrointestinal effects of four common aflatoxins on isolated guinea pig ileum. AFB(1) (EC(50) 4.6+/-0.4 microM) and AFB(2) (EC(50)17+/-4.4 microM) contracted isolated guinea pig ileum in a dose-dependent manner, whereas AFG(1) and AFG(2) evoked no contractions. Atropine (5.9 nM 11.8 and 23.6 nM) antagonized AFB(1)-induced contractions in a dose-dependent manner. Pretreatment with the nicotinic ganglionic blocker, hexamethonium (up to 55 microM), left AFB(1)-induced contractions unchanged. In contrast, tetrodotoxin (0.3 microM), blocked AFB(1) contractile activity. The two inhibitors of ACh release, morphine (0.3 microM) and clonidine (0.4 microM), antagonized EC(50) AFB(1)-induced contractions, and apamin, a drug that increases neuronal excitability, facilitated the EC(50) AFB(1)-induced contractile effect. The choline uptake blocker, hemicholinium (17.4 microM) markedly reduced AFB(1)-induced contractions. These results suggest that aflatoxins induce their contractile effect indirectly through the cholinergic system by stimulating acetylcholine release from the postganglionic parasympathetic nerve endings. The acute actions of aflatoxins on isolated guinea pig ileum could explain their acute gastrointestinal effects in humans and animals. PMID:12206819

  2. Changes in moisture content, mycoflora and aflatoxin content of rice bran during storage.


    Jayaraman, P; Kalyanasundaram, I


    The changes in moisture content, storage mycoflora and aflatoxin B1 (AFB1) in bran from untreated or raw rice (Rr) and parboiled rice (Pbr) stored in small lots in polyethylene bags were studied at 15-day intervals up to 60 days, using five lots of each type of bran. Deterioration was more rapid with reference to all the three parameters, in Rr bran compared to Pbr bran, the former becoming completely overgrown and caked with fungi by the end of 60 days. Aspergillus flavus was the dominant fungus in Pbr bran, whereas A. candidus and Trichoderma viride were abundant in Rr bran. The frequency of incidence as well as concentration of AFB1 increased with storage time in both types of bran, but the rate of increase as well as overall concentration were much higher in Rr bran. Thus raw rice bran is unsuitable for prolonged storage. PMID:8065431

  3. Antifungal properties and inhibitory effects upon aflatoxin production of Thymus vulgaris L. by Aspergillus flavus Link.


    Kohiyama, Cássia Yumie; Yamamoto Ribeiro, Milene Mayumi; Mossini, Simone Aparecida Galerani; Bando, Erika; Bomfim, Natália da Silva; Nerilo, Samuel Botião; Rocha, Gustavo Henrique Oliveira; Grespan, Renata; Mikcha, Jane Martha Graton; Machinski, Miguel


    The antifungal and antiaflatoxigenic properties of Thymus vulgaris essential oil (TEO) were evaluated upon Aspergillus flavus "in vitro". Suspension containing 10(6) of A. flavus were cultivated with TEO in concentrations ranging from 50 to 500 μg/mL. TEO reached minimum inhibitory concentration (MIC) and minimum fungicidal concentration (MFC) at 250 μg/mL. Inhibition of ergosterol biosynthesis was detected at a concentration of 100 μg/mL of TEO. Morphological evaluation performed by both light microscopy and scanning electron microscopy showed that antifungal activity of TEO could be detected starting at a concentration of 50 μg/mL and the fungicide effect at a concentration of 250 μg/mL. TEO completely inhibited production of both B1 and B2 aflatoxins (AFB1 and AFB2) at a concentration of 150 μg/mL. This way, fungal biomass development and aflatoxin production were dependent on TEO concentration. Therefore, TEO was capable of controlling the growth of A. flavus and its production of aflatoxins. PMID:25466118

  4. A Case for Regular Aflatoxin Monitoring in Peanut Butter in Sub-Saharan Africa: Lessons from a 3-Year Survey in Zambia.


    Njoroge, Samuel M C; Matumba, Limbikani; Kanenga, Kennedy; Siambi, Moses; Waliyar, Farid; Maruwo, Joseph; Monyo, Emmanuel S


    A 3-year comprehensive analysis of aflatoxin contamination in peanut butter was conducted in Zambia, sub-Saharan Africa. The study analyzed 954 containers of 24 local and imported peanut butter brands collected from shops in Chipata, Mambwe, Petauke, Katete, and Nyimba districts and also in Lusaka from 2012 to 2014. For analysis, a sample included six containers of a single brand, from the same processing batch number and the same shop. Each container was quantitatively analyzed for aflatoxin B1 (AFB1) in six replicates by using competitive enzyme-linked immunosorbent assay; thus, aflatoxin contamination level of a given sample was derived from an average of 36 test values. Results showed that 73% of the brands tested in 2012 were contaminated with AFB1 levels >20 μg/kg and ranged up to 130 μg/kg. In 2013, 80% of the brands were contaminated with AFB1 levels >20 μg/kg and ranged up to 10,740 μg/kg. Compared with brand data from 2012 and 2013, fewer brands in 2014, i.e., 53%, had aflatoxin B1 levels >20 μg/kg and ranged up to 1,000 μg/kg. Of the eight brands tested repeatedly across the 3-year period, none consistently averaged ≤20 μg/kg. Our survey clearly demonstrates the regular occurrence of high levels of AF B1 in peanut butter in Zambia. Considering that some of the brands tested originated from neighboring countries such as Malawi, Zimbabwe, and South Africa, the current findings provide a sub-Saharan regional perspective regarding the safety of peanut butter. PMID:27296427

  5. Application of essential oils in maize grain: impact on Aspergillus section Flavi growth parameters and aflatoxin accumulation.


    Bluma, Romina V; Etcheverry, Miriam G


    The antifungal activity of Pimpinella anisum L. (anise), Pëumus boldus Mol (boldus), Hedeoma multiflora Benth (mountain thyme), Syzygium aromaticum L. (clove), and Lippia turbinate var. integrifolia (griseb) (poleo) essential oils (EOs) against Aspergillus section Flavi was evaluated in sterile maize grain under different water activity (a(w)) condition (0.982, 0.955, and 0.90). The effect of EOs added to maize grains on growth rate, lag phase, and aflatoxin B(1) (AFB(1)) accumulation of Aspergillus section Flavi were evaluated at different water activity conditions. The five EOs analyzed have been shown to influence lag phase and growth rate. Their efficacy depended mainly on the essential oil concentrations and substrate water activity conditions. All EOs showed significant impact on AFB(1) accumulation. This effect was closely dependent on the water activity, concentration, and incubation periods. Important reduction of AFB(1) accumulation was observed in the majority of EO treatments at 11 days of incubation. Boldus, poleo, and mountain thyme EO completely inhibited AFB(1) at 2000 and 3000 microg g(-1). Inhibition of AFB(1) accumulation was also observed when aflatoxigenic isolates grew with different concentration of EOs during 35 days. PMID:18206775

  6. Comparative Genomics in Identifying Aflatoxin Biosynthetic Genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aspergillus flavus produces the most toxic and the most carcinogenic mycotoxins, aflatoxin B1 and B2. In order to solve aflatoxin contamination of food commodities, A. flavus genomics tools for identification of genes involved in aflatoxin biosynthesis have been employed. A. flavus Expressed Seque...

  7. Aflatoxin M1 contamination of human breast milk in Isfahan, Iran

    PubMed Central

    Jafarian-Dehkordi, Abbas; Pourradi, Nasibeh


    Background: During the last decades there has been great attention paid to aflatoxins. They are highly toxic, immunosuppressive, mutagenic, teratogenic, and carcinogenic compounds. Aflatoxin M1 (AFM1), a hydroxylated metabolite of aflatoxin B1 (AFB1), is formed in the liver and excreted into the breast milk. It is considered to cause certain hygienic risks for infant health. The aim of this study was to evaluate the presence of the AFM1 in the breast milk using AFM1 in milk as a biomarker for exposure to aflatoxin B1 and determine the level of AFM1 contamination in the lactating mothers in Isfahan, Iran. Materials and Methods: This study was carried out on 80 lactating women randomly selected from two urban health centers. Mother's milk samples and information on food intake were collected from the participants using structured food-frequency questionnaire. Breast milk samples were tested for AFM1 by a competitive ELISA technique. Results: Our findings showed that only one sample was contaminated with AFM1 with concentrations of 6.8 ng/L. However, the AFM1 level in this sample was lower than the maximum tolerable limit (25 ng/L) accepted by the European Communities and Codex Alimentarius. Conclusion: Although the concentration of AFM1 in none of the samples was higher than the acceptable level, the presence of AFM1 in only one of them confirms the need for developing strategies to reduce exposure to aflatoxin in foods and to carry out biological monitoring of aflatoxins as a food quality control measure routinely. PMID:24524032

  8. Molecular cloning, expression and catalytic activity of a human AKR7 member of the aldo-keto reductase superfamily: evidence that the major 2-carboxybenzaldehyde reductase from human liver is a homologue of rat aflatoxin B1-aldehyde reductase.

    PubMed Central

    Ireland, L S; Harrison, D J; Neal, G E; Hayes, J D


    The masking of charged amino or carboxy groups by N-phthalidylation and O-phthalidylation has been used to improve the absorption of many drugs, including ampicillin and 5-fluorouracil. Following absorption of such prodrugs, the phthalidyl group is hydrolysed to release 2-carboxybenzaldehyde (2-CBA) and the pharmaceutically active compound; in humans, 2-CBA is further metabolized to 2-hydroxymethylbenzoic acid by reduction of the aldehyde group. In the present work, the enzyme responsible for the reduction of 2-CBA in humans is identified as a homologue of rat aflatoxin B1-aldehyde reductase (rAFAR). This novel human aldo-keto reductase (AKR) has been cloned from a liver cDNA library, and together with the rat protein, establishes the AKR7 family of the AKR superfamily. Unlike its rat homologue, human AFAR (hAFAR) appears to be constitutively expressed in human liver, and is widely expressed in extrahepatic tissues. The deduced human and rat protein sequences share 78% identity and 87% similarity. Although the two AKR7 proteins are predicted to possess distinct secondary structural features which distinguish them from the prototypic AKR1 family of AKRs, the catalytic- and NADPH-binding residues appear to be conserved in both families. Certain of the predicted structural features of the AKR7 family members are shared with the AKR6 beta-subunits of voltage-gated K+-channels. In addition to reducing the dialdehydic form of aflatoxin B1-8,9-dihydrodiol, hAFAR shows high affinity for the gamma-aminobutyric acid metabolite succinic semialdehyde (SSA) which is structurally related to 2-CBA, suggesting that hAFAR could function as both a SSA reductase and a 2-CBA reductase in vivo. This hypothesis is supported in part by the finding that the major peak of 2-CBA reductase activity in human liver co-purifies with hAFAR protein. PMID:9576847

  9. Aflatoxins and ochratoxin a reduction in black and white pepper by gamma radiation

    NASA Astrophysics Data System (ADS)

    Jalili, M.; Jinap, S.; Noranizan, M. A.


    Irradiation is an important means of decontamination of food commodities, especially spices. The aim of the current study was to investigate the efficacy of gamma radiation (60Co) for decontaminating ochratoxin A (OTA) and aflatoxins B1 (AFB1), B2 (AFB2), G1 (AFG1) and G2 (AFG2) residues in artificially contaminated black and white pepper samples. The moisture content of the pepper samples was set at 12% or 18%, and the applied gamma dose ranged from 5 to 30 kGy. Mycotoxin levels were determined by high-performance liquid chromatography (HPLC) after immunoaffinity column (IAC) chromatography. Both the gamma irradiation dose and moisture content showed significant effects (P<0.05) on mycotoxin reduction. The maximum toxin reductions, found at 18% moisture content and 30 kGy, were 55.2%, 50.6%, 39.2%, 47.7% and 42.9% for OTA, AFB1, AFB2, AFG1 and AFG2, respectively.

  10. DNA-damaging potency and genotoxicity of aflatoxin M1 in somatic cells in vivo of Drosophila melanogaster.


    Shibahara, T; Ogawa, H I; Ryo, H; Fujikawa, K


    Aflatoxin M1 (AFM1), a metabolic hydroxylation product of aflatoxin B1 (AFB1), and the parent compound were comparatively assayed for DNA-damaging potency and genotoxicity in vivo in Drosophila melanogaster using, respectively, the mei-9a mei-41D5 DNA repair test and the mwh/flr3 wing spot test. In the repair test, larval stock, consisting of meiotic recombination-deficient double mutant mei-9a mei-41D5 males and repair-proficient females, was exposed to the test agents, and the preferential killing of the mutant larvae was taken as evidence of the DNA-damaging effect. In this test, AFM1 was registered as a DNA-damaging agent with an activity approximately 3-fold lower than that of AFB1. In the wing spot test, where larval flies, trans-heterozygous for the somatic cell markers mwh and flr3, were treated and the wings were inspected at adulthood for spots manifesting the phenotypes of the markers, AFM1 exerted a genotoxic effect compatible to that of AFB1. Based on these results and other data, we predict that AFM1 may be genotoxic in mammalian in-vivo systems as well. PMID:7666765

  11. Effect of supplementation of fermented milk drink containing probiotic Lactobacillus casei Shirota on the concentrations of aflatoxin biomarkers among employees of Universiti Putra Malaysia: a randomised, double-blind, cross-over, placebo-controlled study.


    Mohd Redzwan, Sabran; Abd Mutalib, Mohd Sokhini; Wang, Jia-Sheng; Ahmad, Zuraini; Kang, Min-Su; Abdul Rahman, Nurul 'Aqilah; Nikbakht Nasrabadi, Elham; Jamaluddin, Rosita


    Human exposure to aflatoxin is through the diet, and probiotics are able to bind aflatoxin and prevent its absorption in the small intestine. This study aimed to determine the effectiveness of a fermented milk drink containing Lactobacillus casei Shirota (LcS) (probiotic drink) to prevent aflatoxin absorption and reduce serum aflatoxin B1-lysine adduct (AFB1-lys) and urinary aflatoxin M1 concentrations. The present study was a randomised, double-blind, cross-over, placebo-controlled study with two 4-week intervention phases. In all, seventy-one subjects recruited from the screening stage were divided into two groups--the Yellow group and the Blue group. In the 1st phase, one group received probiotic drinks twice a day and the other group received placebo drinks. Blood and urine samples were collected at baseline, 2nd and 4th week of the intervention. After a 2-week wash-out period, the treatments were switched between the groups, and blood and urine samples were collected at the 6th, 8th and 10th week (2nd phase) of the intervention. No significant differences in aflatoxin biomarker concentrations were observed during the intervention. A within-group analysis was further carried out. Aflatoxin biomarker concentrations were not significantly different in the Yellow group. Nevertheless, ANOVA for repeated measurements indicated that AFB1-lys concentrations were significantly different (P=0·035) with the probiotic intervention in the Blue group. The 2nd week AFB1-lys concentrations (5·14 (SD 2·15) pg/mg albumin (ALB)) were significantly reduced (P=0·048) compared with the baseline (6·24 (SD 3·42) pg/mg ALB). Besides, the 4th week AFB1-lys concentrations were significantly lower (P<0·05) with probiotic supplementation than with the placebo. Based on these findings, a longer intervention study is warranted to investigate the effects of continuous LcS consumption to prevent dietary aflatoxin exposure. PMID:26490018

  12. Survey of aflatoxins in maize tortillas from Mexico City.


    Castillo-Urueta, Pável; Carvajal, Magda; Méndez, Ignacio; Meza, Florencia; Gálvez, Amanda


    In Mexico, maize tortillas are consumed on a daily basis, leading to possible aflatoxin exposure. In a survey of 396 2-kg samples, taken over four sampling days in 2006 and 2007 from tortilla shops and supermarkets in Mexico City, aflatoxin levels were quantified by HPLC. In Mexico, the regulatory limit is 12 µg kg⁻¹ total aflatoxins for maize tortillas. In this survey, 17% of tortillas contained aflatoxins at levels of 3-385 µg kg⁻¹ or values below the limit of quantification (12 µg kg⁻¹ and 87% were below the regulatory limit. Average aflatoxin concentrations in 56 contaminated samples were: AFB1 (12.1 µg kg⁻¹); AFB2 (2.7 µg kg⁻¹); AFG1 (64.1 µg kg⁻¹) and AFG2 (3.7 µg kg⁻¹), and total AF (20.3 µg kg⁻¹). PMID:24779661

  13. Immunochemical and genetic analysis of the p53 gene in liver preneoplastic nodules from aflatoxin-induced rats in one year.


    Liu, Y P; Lin, Y; Ng, M L


    Mutations of the p53 tumour-suppressor gene in human hepatocellular carcinomas from certain geographic areas appear to be associated with high dietary exposure to aflatoxin B1 (AFB1). In this study, the effects of AFB1 on p53 locus at the preneoplastic stage of rat liver oncogenesis were assessed. Male Wistar rats were treated with a single dose of 1.5 mg AFB1/kg body weight by a gastric tube. Liver biopsies over a period of one year were examined for aberrations of the p53 gene together with the expression of placental glutathione-S transferase (GST-P), a marker for preneoplasia. Immunohistochemistry, Western blot, polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP) and DNA sequencing techniques were used. AFB1 induction resulted in GST-P overexpression, forming GST-P-positive multi-foci and nodules of hepatocytes, but no aberrations in the p53 expression and the microstructure of exons 5-8 of the p53 gene. These results suggested that p53 mutation(s) might not occur at this early stage of AFB1-induced hepatocarcinogenesis. PMID:8779543

  14. Efficacy of aqueous garlic extract on growth, aflatoxin B1 production, and cyto-morphological aberrations of Aspergillus flavus, causing human ophthalmic infection: topical treatment of A. flavus keratitis.


    Ismaiel, Ahmed A; Rabie, Gamal H; Kenawey, Saied E M; Abd El-Aal, Marwa A


    By using agar well diffusion assay, antifungal activity of aqueous extract prepared from Egyptian garlic (Allium sativum L.) was evaluated in vitro against two strains of Aspergillus flavus (OC1 and OC10) causing human ocular infection. The recorded minimum inhibitory concentration (MIC) for growth inhibition of both strains was 3.60 mg/ml. Aqueous garlic extract (AGE) was used in successive in vivo tests as an attempt to cure rabbit's fungal keratitis caused by A. flavus OC1. Findings showed that diluted preparation of AGE was effective topical antifungal agent and succeeded to cure severe A. flavus keratitis in a time course less than 10 days without any observable side effects. Microscopic examination showed that AGE induced deleterious cyto-morphological aberrations in A. flavus target cells. AGE applied to Czapek's broth via contact method was more effective on growth, spores and aflatoxin B1 production than AGE applied to the same broth at the same concentration via fumigation method. PMID:24031964

  15. Infants’ Exposure to Aflatoxin M1 from Mother’s Breast Milk in Iran

    PubMed Central

    Ghiasian, SA; Maghsood, AH


    Background The occurrence of aflatoxin M1 (AFM1) in milk, especially breast milk, is a valuable biomarker for exposure determination to aflatoxin B1 (AFB1). In the present study, the risk of exposure to AFM1 in infants fed breast milk was investigated. Methods: An enzyme-linked immunosorbent assay (ELISA) was used for the analysis of AFM1 in breast milk samples from 132 lactating mothers referred to four urban Mothers and Babies Care Unit of Hamadan, western Iran. Results: AFM1 was detected in eight samples (6.06%) at mean concentration of 9.45 ng/L. The minimum and maximum of concentration was 7.1 to 10.8 ng/L, respectively. Although the concentration of AFM1 in none of the samples was higher than the maximum tolerance limit accepted by USA and European Union (25 ng/kg) however, 25% had a level of AFM1 above the allowable level of Australia and Switzerland legal limit (10 ng/L). Conclusions: Lactating mothers and infants in western parts of Iran could be at risk for AFB1 and AFM1 exposure, respectively. Considering all this information, the investigation of AFM1 in lactating mothers as a biomarker for post-natal exposure of infants to this carcinogen deserves further studies in various seasons and different parts of Iran. PMID:23113156

  16. Aflatoxins in hazelnuts and dried figs: Occurrence and exposure assessment.


    Kabak, Bulent


    A total of 300 samples of hazelnuts and dried fig were analysed for the incidence of any aflatoxins (AFs). High-performance liquid chromatography coupled with fluorescence detection (HPLC-FLD) method was used to quantify the amounts of AFs. The limit of quantification varied from 0.21 to 0.30μgkg(-1). No AFs were detected in shells of the hazelnuts, while six raw hazelnut kernel samples (12%) and five roasted hazelnut kernel samples (8.3%) contained AFs ranging from 0.09 to 11.3μgkg(-1) and from 0.17 to 11.2μgkg(-1), respectively. Sixteen dried fig samples (12.3%) contained AFs ranging from 0.1 to 28.2μgkg(-1) and a mean value of 3.8μgkg(-1). Three hazelnuts and six dried fig samples exceeded the European maximum limits (MLs) of 5 and 2μgkg(-1) for aflatoxin B1 (AFB1), respectively. The contribution of hazelnuts to AFs exposure is higher than that of dried figs. PMID:27283601

  17. Transport via xylem and accumulation of aflatoxin in seeds of groundnut plant.


    Snigdha, M; Hariprasad, P; Venkateswaran, G


    Aflatoxin contamination in groundnut seeds in the absence of any aflatoxigenic fungi leads to a hypothesis that aflatoxins are present naturally in soil and is transferred to seeds through uptake by roots. A survey was conducted on the natural occurrence of aflatoxins in agricultural soils, among nine main groundnut-growing regions of Karnataka state, India. All 71 soil samples collected in this survey were contaminated with aflatoxins esp. AFB1. An in vitro xylem sap experiment proved the ability of groundnut plant roots to absorb AFB1, and transport to aerial plant parts via the xylem. Hydroponics experiment also proved the uptake of AFB1 by the roots and their translocation to shoot. Uptake was affected by the initial concentration of toxin and pH of the medium. Among the 14 varieties screened, GPBD4 and MLT.K.107 (III) recorded highest and least AFB1 uptake, respectively. The above results were validated using a greenhouse experiment. Here, the aflatoxin absorbed by root gradually transferred to shoot that was later found in seeds towards the end of experiment. Thus, the groundnut seeds can also get contaminated with aflatoxin by direct uptake of aflatoxin through conducting tissue in addition to fungal infection. The present study revealed the novel mode of aflatoxin contamination in groundnut seeds without fungal infection. PMID:25112578

  18. Banana peel: an effective biosorbent for aflatoxins.


    Shar, Zahid Hussain; Fletcher, Mary T; Sumbal, Gul Amer; Sherazi, Syed Tufail Hussain; Giles, Cindy; Bhanger, Muhammad Iqbal; Nizamani, Shafi Muhammad


    This work reports the application of banana peel as a novel bioadsorbent for in vitro removal of five mycotoxins (aflatoxins (AFB1, AFB2, AFG1, AFG2) and ochratoxin A). The effect of operational parameters including initial pH, adsorbent dose, contact time and temperature were studied in batch adsorption experiments. Scanning electron microscopy (SEM), Fourier transform infrared spectroscopy (FTIR) and point of zero charge (pHpzc) analysis were used to characterise the adsorbent material. Aflatoxins' adsorption equilibrium was achieved in 15 min, with highest adsorption at alkaline pH (6-8), while ochratoxin has not shown any significant adsorption due to surface charge repulsion. The experimental equilibrium data were tested by Langmuir, Freundlich and Hill isotherms. The Langmuir isotherm was found to be the best fitted model for aflatoxins, and the maximum monolayer coverage (Q0) was determined to be 8.4, 9.5, 0.4 and 1.1 ng mg(-1) for AFB1, AFB2, AFG1 and AFG2 respectively. Thermodynamic parameters including changes in free energy (ΔG), enthalpy (ΔH) and entropy (ΔS) were determined for the four aflatoxins. Free energy change and enthalpy change demonstrated that the adsorption process was exothermic and spontaneous. Adsorption and desorption study at different pH further demonstrated that the sorption of toxins was strong enough to sustain pH changes that would be experienced in the gastrointestinal tract. This study suggests that biosorption of aflatoxins by dried banana peel may be an effective low-cost decontamination method for incorporation in animal feed diets. PMID:27052947

  19. Determination of Aflatoxin M1 Levels in Produced Pasteurized Milk in Ahvaz City by Using HPLC

    PubMed Central

    Behfar, Abdolazim; Nazari Khorasgani, Zahra; Alemzadeh, Ziyaaddin; Goudarzi, Mehdi; Ebrahimi, Rezvan; Tarhani, Najmedin


    Background Aflatoxins are one of the most potent toxic substances that occur naturally. Nowadays extensive attention has been taken to their existence in food and environment, as there is the possibility of harm to humans following chronic exposure to extremely low levels via food chain. Aflatoxin M1 (AFM1) is a hepatic carcinogenic metabolite found in the milk of lactating animals fed with contaminated feed contaminated by aflatoxin B1 (AFB1). Objectives This study aimed to determine the levels of AFM1 in produced pasteurized milk in the Ahvaz of city. Materials and Methods For this purpose, 100 samples of pasteurized milk from the Jamus Factory were analyzed the to determine AFM1 content by using an immunoaffinity column for clean-up and high-performance liquid chromatography (HPLC) with a C18 column, a fluorescence detector (excitation 365 nm, emission 435 nm) and a mobile phase of acetonitrile–water (25:75, v/v) at a flow rate of 1 mL/min. Results AFM1 was detected in all 100 samples of pasteurized milk at concentrations ranging from 0.45 to 9.760 ng/L. Conclusions The mean concentration of AFM1 in the the pasteurized milk samples was 2.7 ng/L, which was below the 50 ng/L, accepted as level of for milk in Iran. PMID:24624159

  20. Occurrence of aflatoxin M1 in urines from rural and urban adult cohorts in Bangladesh.


    Ali, Nurshad; Hossain, Khaled; Blaszkewicz, Meinolf; Rahman, Mashiur; Mohanto, Nayan Chandra; Alim, Abdul; Degen, Gisela H


    Aflatoxins are important mycotoxins produced by Aspergillus flavus and A. parasiticus, moulds which contaminate mainly grains and nuts, especially in hot and humid climate. Presence of aflatoxin B1 (AFB1), the most toxic one and a potent hepatocarcinogen, has been reported in food and feed in Bangladesh and raised concerns about mycotoxin exposure in the population. Biomonitoring provides the best approach to assess human exposure from various sources and by all routes. Part of the ingested AFB1 is converted in the body to aflatoxin M1 (AFM1), a metabolite that has served as biomarker of AFB1 exposure, as it is excreted in urine, and thus enables non-invasive sampling, a relevant aspect in field studies. This investigation measured the AFM1 concentration in urines collected from adult residents of a rural (n = 52) and an urban (n = 43) area in the Rajshahi district of Bangladesh. The urinary levels of AFM1 were determined by enzyme-linked immunosorbent assay. AFM1 was detected in 46 % of all urine samples at a range of 31-348 pg/mL. The median and mean concentration of AFM1 in urine was 61 and 80 ± 60 pg/mL, respectively. A significant difference (p < 0.05) was found at the mean level of AFM1 between the rural (99 ± 71 pg/mL) and urban (54 ± 15 pg/mL) cohort. Urinary AFM1 levels did not show significant correlations with food frequency data or age, gender and body mass index of the participants. Among them, the highest mean AFM1 level (101 ± 71 pg/mL) was observed in the 50-60 years age group. In conclusion, detection frequency and urinary AFM1 levels in the Bangladeshi adults support concerns regarding their dietary exposure to AFB1. These first data warrant further biomarker-based studies in children and in cohorts of other parts of the country. PMID:26391179

  1. Aflatoxins and ochratoxin A in stored barley grain in Spain and impact of PCR-based strategies to assess the occurrence of aflatoxigenic and ochratoxigenic Aspergillus spp.


    Mateo, Eva M; Gil-Serna, Jéssica; Patiño, Belén; Jiménez, Misericordia


    Contamination of barley by moulds and mycotoxins results in quality and nutritional losses and represents a significant hazard to the food chain. The presence of aflatoxin B1 (AFB1), B2 (AFB2), G1 (AFG1) and G2 (AFG2) and ochratoxin A (OTA) in stored barley in Spain has been studied. Species-specific PCR assays were used for detection of Aspergillus flavus, A. parasiticus, A. ochraceus, A. steynii, A. westerdijkiae, A. carbonarius and A. niger aggregate in mycotoxin-positive barley samples at different incubation times (0, 1 and 2 days). Classical enumeration techniques (CFU/g) in different culture media for evaluation of Aspergillus in sections Flavi, Circumdati and Nigri were also used. One hundred and five barley kernel samples were collected in Spanish grain stores from 2008 to 2010, and analyzed using a previously optimized method involving accelerated solvent extraction, cleanup by immunoaffinity column, liquid chromatographic separation, post-column derivatization with iodine and fluorescence detection. Twenty-nine samples were contaminated with at least one of the studied mycotoxins. AFB1, AFB2, AFG1, AFG2, and OTA were detected in 12.4%, 2.9%, 4.8%, 2.9%, and 20% of the samples, respectively. Aflatoxins and OTA co-occurred in 4.8% of the samples. Maximum mycotoxin levels (ng/g) were 0.61 (AFB1), 0.06 (AFB2), 0.26 (AFG1), 0.05 (AFG2), and 2.0 (OTA). The results of PCR assays indicated the presence of all the studied species, except A. westerdijkiae. The PCR assays showed high levels of natural contamination of barley with the studied species of Aspergillus which do not correspond to the expected number of CFU/g in the cultures. These results suggest that a high number of non-viable spores or hyphae may exist in the samples. This is the first study carried out on the levels of aflatoxins and OTA in barley grain in Spain. Likewise, this is the first report on the presence of aflatoxigenic and ochratoxigenic Aspergillus spp. in barley grain naturally

  2. Fungal Aflatoxins Reduce Respiratory Mucosal Ciliary Function.


    Lee, Robert J; Workman, Alan D; Carey, Ryan M; Chen, Bei; Rosen, Phillip L; Doghramji, Laurel; Adappa, Nithin D; Palmer, James N; Kennedy, David W; Cohen, Noam A


    Aflatoxins are mycotoxins secreted by Aspergillus flavus, which can colonize the respiratory tract and cause fungal rhinosinusitis or bronchopulmonary aspergillosis. A. flavus is the second leading cause of invasive aspergillosis worldwide. Because many respiratory pathogens secrete toxins to impair mucociliary immunity, we examined the effects of acute exposure to aflatoxins on airway cell physiology. Using air-liquid interface cultures of primary human sinonasal and bronchial cells, we imaged ciliary beat frequency (CBF), intracellular calcium, and nitric oxide (NO). Exposure to aflatoxins (0.1 to 10 μM; 5 to 10 minutes) reduced baseline (~6-12%) and agonist-stimulated CBF. Conditioned media (CM) from A. fumigatus, A. niger, and A. flavus cultures also reduced CBF by ~10% after 60 min exposure, but effects were blocked by an anti-aflatoxin antibody only with A. flavus CM. CBF reduction required protein kinase C but was not associated with changes in calcium or NO. However, AFB2 reduced NO production by ~50% during stimulation of the ciliary-localized T2R38 receptor. Using a fluorescent reporter construct expressed in A549 cells, we directly observed activation of PKC activity by AFB2. Aflatoxins secreted by respiratory A. flavus may impair motile and chemosensory functions of airway cilia, contributing to pathogenesis of fungal airway diseases. PMID:27623953

  3. A Rapid and Sensitive Detection of Aflatoxin-producing Fungus Using an Optimized Polymerase Chain Reaction (PCR)

    PubMed Central

    Bintvihok, Anong; Treebonmuang, Supitchaya; Srisakwattana, Kitiya; Nuanchun, Wisut; Patthanachai, Koranis; Usawang, Sungworn


    Aflatoxin B1 (AFB1) is produced by Aspergillus flavus growing in feedstuffs. Early detection of maize contamination by aflatoxigenic fungi is advantageous since aflatoxins exert adverse health effects. In this study, we report the development of an optimized conventional PCR for AFB1 detection and a rapid, sensitive and simple screening Real-time PCR (qPCR) with SYBR Green and two pairs of primers targeting the aflR genes which involved aflatoxin biosynthesis. AFB1 contaminated maize samples were divided into three groups by the toxin concentration. Genomic DNA was extracted from those samples. The target genes for A. flavus were tested by conventional PCR and the PCR products were analyzed by electrophoresis. A conventional PCR was carried out as nested PCR to verify the gene amplicon sizes. PCR-RFLP patterns, obtained with Hinc II and Pvu II enzyme analysis showed the differences to distinguish aflatoxin-producing fungi. However, they are not quantitative and need a separation of the products on gel and their visualization under UV light. On the other hand, qPCR facilitates the monitoring of the reaction as it progresses. It does not require post-PCR handling, which reduces the risk of cross-contamination and handling errors. It results in a much faster throughout. We found that the optimal primer annealing temperature was 65°C. The optimized template and primer concentration were 1.5 μL (50 ng/μL) and 3 μL (10 μM/μL) respectively. SYBR Green qPCR of four genes demonstrated amplification curves and melting peaks for tub1, afIM, afIR, and afID genes are at 88.0°C, 87.5°C, 83.5°C, and 89.5°C respectively. Consequently, it was found that the four primers had elevated annealing temperatures, nevertheless it is desirable since it enhances the DNA binding specificity of the dye. New qPCR protocol could be employed for the determination of aflatoxin content in feedstuff samples. PMID:26977262

  4. Chemistry and Biology of Aflatoxin-DNA Adducts

    SciTech Connect

    Stone, Michael P.; Banerjee, Surajit; Brown, Kyle L.; Egli, Martin


    Aspergillus flavus is a fungal contaminant of stored rice, wheat, corn, and other grainstuffs, and peanuts. This is of concern to human health because it produces the mycotoxin aflatoxin B{sub 1} (AFB{sub 1}), which is genotoxic and is implicated in the etiology of liver cancer. AFB{sub 1} is oxidized in vivo by cytochrome P450 to form aflatoxin B{sub 1} epoxide, which forms an N7-dG adduct (AFB{sub 1}-N7-dG) in DNA. The latter rearranges to a formamidopyrimidine (AFB{sub 1}-FAPY) derivative that equilibrates between {alpha} and {beta} anomers of the deoxyribose. In DNA, both the AFB{sub 1}-N7-dG and AFB{sub 1}-{beta}-FAPY adducts intercalate above the 5'-face of the damaged guanine. Each produces G {yields} T transversions in Escherichia coli, but the AFB{sub 1}-{beta}-FAPY adduct is more mutagenic. The Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4) provides a model for understanding error-prone bypass of the AFB{sub 1}-N7-dG and AFB{sub 1}-{beta}-FAPY adducts. It bypasses the AFB{sub 1}-N7-dG adduct, but it conducts error-prone replication past the AFB{sub 1}-FAPY adduct, including mis-insertion of dATP, consistent with the G {yields} T mutations characteristic of AFB{sub 1} mutagenesis in E. coli. Crystallographic analyses of a series of binary and ternary complexes with the Dpo4 polymerase revealed differing orientations of the N7-C8 bond of the AFB{sub 1}-N7-dG adduct as compared to the N{sup 5}-C8 bond in the AFB{sub 1}-{beta}-FAPY adduct, and differential accommodation of the intercalated AFB{sub 1} moieties within the active site. These may modulate AFB{sub 1} lesion bypass by this polymerase.

  5. Detoxification and antioxidant effects of garlic and curcumin in Oreochromis niloticus injected with aflatoxin B1 with reference to gene expression of glutathione peroxidase (GPx) by RT-PCR.


    El-Barbary, Manal I


    The present study aims to investigate the effects of both garlic and curcumin through evaluating their therapeutic properties as antioxidants on liver and kidney functions, hepatic antioxidants and GPx gene expression against aflatoxicosis of O. niloticus. In total, 180 of tilapia were divided into ten groups; T1 represented the negative control fed on a basal diet, and T2 was injected with a single intraperitoneal (i.p.) dose of AFB1 (6 mg/kg b.w.). Fish in T3-T6 were fed on a basal diet supplemented with both garlic (T3 and T4) and curcumin (T5 and T6) at the two concentrations of 10 and 20 g/kg diet, respectively. Fish in T7-T10 groups were injected with AFB1 and fed on the garlic (T7 and T8) and curcumin (T9 and T10) dietaries. The results showed that AFB1 has significant potency for increasing the activity of plasma AST, ALT, creatinine and uric acid values, and hepatic MDA as well as for reducing the concentrations of plasma TP, AL, GL and hepatic activity of TAC, while AFB1 led to up-regulated GPx gene expression when compared to the control (T1). These harmful effects of AFB1 were alleviated due to the garlic and curcumin dietaries in some studied parameters. Garlic reflected the highest induction of gene expression (T7); however, curcumin showed significant down-regulated (T9). These results concluded that the effects of garlic were better than curcumin at the two concentrations and the low concentration of them is more beneficial than the high concentration when it used against AFB1 in O. niloticus. PMID:26590820

  6. Detection of serum AFB1-lysine adduct in Malaysia and its association with liver and kidney functions.


    Mohd Redzwan, S; Rosita, Jamaluddin; Mohd Sokhini, A M; Nurul 'Aqilah, A R; Wang, Jia-Sheng; Kang, Min-Su; Zuraini, Ahmad


    Aflatoxin is ubiquitously found in many foodstuffs and produced by Aspergillus species of fungi. Of many aflatoxin metabolites, AFB1 is classified by the International Agency for Research on Cancer (IARC) as group one carcinogen and linked to the development of hepatocellular carcinoma (HCC). The study on molecular biomarker of aflatoxin provides a better assessment on the extent of human exposure to aflatoxin. In Malaysia, the occurrences of aflatoxin-contaminated foods have been documented, but there is a lack of data on human exposure to aflatoxin. Hence, this study investigated the occurrence of AFB1-lysine adduct in serum samples and its association with liver and kidney functions. 5ml fasting blood samples were collected from seventy-one subjects (n=71) for the measurement of AFB1-lysine adduct, albumin, total bilirubin, AST (aspartate aminotransferase), ALT (alanine transaminase), ALP (alkaline phosphatase), GGT (gamma-glutamyl transpeptidase), creatinine and BUN (blood urea nitrogen). The AFB1-lysine adduct was detected in all serum samples (100% detection rate) with a mean of 6.85±3.20pg/mg albumin (range: 1.13-18.85pg/mg albumin). Male subjects (mean: 8.03±3.41pg/mg albumin) had significantly higher adduct levels than female subjects (mean: 5.64±2.46pg/mg albumin) (p<0.01). It was noteworthy that subjects with adduct levels greater than average (>6.85pg/mg albumin) had significantly elevated level of total bilirubin (p<0.01), GGT (p<0.05) and creatinine (p<0.01). Nevertheless, only the level of total bilirubin, (r=0.347, p-value=0.003) and creatinine (r=0.318, p-value=0.007) showed significant and positive correlation with the level of AFB1-lysine adduct. This study provides a valuable insight on human exposure to aflatoxin in Malaysia. Given that aflatoxin can pose serious problem to the health, intervention strategies should be implemented to limit/reduce human exposure to aflatoxin. Besides, a study with a big sample size should be warranted in

  7. Effect of Carum copticum essential oil on growth and aflatoxin formation by Aspergillus strains.


    Kazemi, M


    The objectives of this study were to determine the antiaflatoxin B1 activity in vitro of the essential oil (EO) extracted from the seeds of Carum copticum and to evaluate its antifungal activity in vivo as a potential food preservative. The C. copticum EO exhibited noticeable inhibition on dry mycelium and synthesis of aflatoxin B1 (AFB1) by Aspergillus flavus, completely inhibiting AFB1 production at 4 μL/mL. C. copticum EOs showed the lowest percentages of decayed cherry tomatoes for all fungi compared with the control at 100 μL/mL with values of 5.01 ± 67% for A. flavus and 5.98 ± 54% for Aspergillus niger. The results indicated that the percentage of infected fruits is significantly (p < 0.01) reduced by the EO at 16°C for 30 days. In this case, the oil at 100 μL/mL concentration showed the highest inhibition of fungal infection with a value of 80.45% compared with the control. Thus, the EO of dill could be used to control food spoilage and as a potential source of food preservative. PMID:25342249

  8. Low-cost and highly sensitive immunosensing platform for aflatoxins using one-step competitive displacement reaction mode and portable glucometer-based detection.


    Tang, Dianping; Lin, Youxiu; Zhou, Qian; Lin, Yuping; Li, Peiwu; Niessner, Reinhard; Knopp, Dietmar


    Aflatoxins are highly toxic secondary metabolites produced by a number of different fungi and present in a wide range of food and feed commodities. Herein, we designed a simple and low-cost immunosensing platform for highly sensitive detection of mycotoxins (aflatoxin B1, AFB1, used as a model) on polyethylenimine (PEI)-coated mesoporous silica nanocontainers (PEI-MSN). The assay was carried out by using a portable personal glucometer (PGM) as the readout based on a competitive displacement reaction mode between target AFB1 and its pseudo-hapten (PEI-MSN) for monoclonal anti-AFB1 antibody (mAb). To construct such an assay protocol, two nanostructures including mAb-labeled gold nanoparticle (mAb-AuNP) and PEI-MSN were initially synthesized, and then numerous glucose molecules were gated into the pores based on the interaction between negatively charged mAb-AuNP and positively charged PEI-MSN. In the presence of target AFB1, a competitive-type displacement reaction was implemented between mAb-AuNP and PEI-MSN by target AFB1 through the specific antigen-antibody reaction. Accompanying the reaction, target AFB1 could displace the mAb-AuNP from the surface of PEI-MSN, resulting in the release of the loading glucose from the pores due to the gate opened. The released glucose molecules could be quantitatively determined by using a portable PGM. Under optimal conditions, the PGM signal increased with the increment of AFB1 concentration in the range from 0.01 to 15 μg/kg (ppb) with a detection limit (LOD) of 5 ng/kg (5 ppt) at the 3sblank criterion. The selectivity and precision were acceptable. Importantly, the methodology was further validated for assaying naturally contaminated or spiked blank peanut samples, and consistent results between the PGM-based immunoassay and the referenced enzyme-linked immunosorbent assay (ELISA) were obtained. Therefore, the developed immunoassay provides a promising approach for rapid screening of organic pollutants because it is simple

  9. Determination of Environmental Exposure to Microcystin and Aflatoxin as a Risk for Renal Function Based on 5493 Rural People in Southwest China.


    Lin, Hui; Liu, Wenyi; Zeng, Hui; Pu, Chaowen; Zhang, Renping; Qiu, Zhiqun; Chen, Ji-An; Wang, Lingqiao; Tan, Yao; Zheng, Chuanfen; Yang, Xiaohong; Tian, Yingqiao; Huang, Yujing; Luo, Jiaohua; Luo, Yang; Feng, Xiaobin; Xiao, Guosheng; Feng, Lei; Li, Heng; Wang, Feng; Yuan, Changyou; Wang, Jia; Zhou, Ziyuan; Wei, Tiantian; Zuo, Yonglin; Wu, Liping; He, Lixiong; Guo, Yaoping; Shu, Weiqun


    Although the nephrotoxicity of microcystin and aflatoxin has been observed in animal and clinical cases, few population data are available. We conducted a cross-sectional study in Southwest China to investigate the association of renal function indicators (RFIs, including BUN, SCr, and eGFR) with exposure to microcystin and aflatoxin in 5493 members of the general population. Microcystin-LR levels in water and aquatic products and aflatoxin B1 levels in daily foods were measured by ELISA, and individual estimated daily intake (EDI) was assessed on the basis of the measurement and questionnaire. We found that participants with abnormal RFIs had a much higher mean level of microcystin-LR EDI than those with normal RFIs and that there was a significant increasing trend for abnormal rates and odds ratios of RFIs with increasing microcystin-LR EDI quartiles (p for trend = 0.000). Compared with the lowest quartile of microcystin-LR exposure, those in the highest quartile had significantly higher risks of abnormal BUN (OR = 1.80, 95% CI = 1.34-2.42), SCr (OR = 4.58, 95% CI = 2.92-7.21), and eGFR (OR = 4.41, 95% CI = 2.55-7.63), respectively, but no higher risk was found in subjects with higher AFB1 exposure. After adjustment for confounding factors, risk associations with microcystin-LR persisted. Consequently, our results suggest that microcystin, rather than aflatoxin, might be one important risk of renal-function impairment. PMID:27071036

  10. Chromosome instability in human hepatocellular carcinoma depends on p53 status and aflatoxin exposure.


    Pineau, Pascal; Marchio, Agnès; Battiston, Carlo; Cordina, Emilie; Russo, Alessandro; Terris, Benoît; Qin, Lun-Xiu; Turlin, Bruno; Tang, Zhao-You; Mazzaferro, Vincenzo; Dejean, Anne


    Hepatocellular carcinoma (HCC) is a heterogeneous disease triggered by various risk factors and frequently characterized by chromosome instability. This instability is considered to be caused primarily by Hepatitis B virus (HBV), although aflatoxin B1 (AFB1), a potent fungal mutagen is also suspected to influence chromosomal repair. We studied 90 HCCs from Italy, the country with the highest incidence of hepatocellular carcinoma in Europe, 81 samples from France and 52 specimens from Shanghai, in a region where intake of AFB1 via the diet is known to be high. All 223 tumours were characterized for 15 different genomic targets, including allelic loss at 13 chromosome arms and mutations of beta-catenin and p53 genes. Despite disparity in risk-factor distribution, Italian and French cases did not significantly differ for 14 of the 15 targets tested. beta-Catenin and p53 displayed moderate and similar mutation rates (18-29% of cases) in European series. By contrast, tumours from Shanghai were significantly different, with a lower mutation rate for beta-catenin (4% vs. 26%, p<0.0003) and a higher mutation rate for p53 (48% vs. 22%, p<0.0001) when compared with tumours of European origin. The Arg249Ser mutation, hallmark of exposure to AFB1, represented half of the changes in p53 in Shanghai. Furthermore, when stratified for the presence of HBV or p53 mutations, chromosome instability was always higher in Chinese than in European patients. This difference was particularly strong in p53-wildtype tumours (fractional allelic loss, 29.4% vs. 16.7%, p<0.0001). We suggest that AFB1-associated mutagenesis represents a plausible cause for the higher chromosome instability observed in Chinese HCCs, when compared with European primary liver carcinomas. PMID:18467159

  11. Effect of aflatoxins on rat peritoneal macrophages.

    PubMed Central

    Cusumano, V; Costa, G B; Seminara, S


    Phagocytosis, intracellular killing of Candida albicans, and superoxide production by rat peritoneal macrophages exposed to aflatoxins B1, B2, G1, G2, B2a, and M1 at several times and concentrations were analyzed to evaluate the intensity of a depressive effect for each mycotoxin. All aflatoxins used at very low concentrations had a depressive effect on the functions of macrophages. The biggest impairment of phagocytosis, intracellular killing, and spontaneous superoxide production was observed in macrophages exposed to aflatoxins B1 and M1. PMID:2176448

  12. Mycoflora and natural aflatoxin contamination in dried quince seeds from Jammu, India.


    Bala, Pinky; Gupta, Dimple; Sharma, Y P


    Eighty two samples of dried quince seeds, obtained from the markets of Jammu province, were examined for mycoflora by different isolation techniques. A total of 27 fungal species belonging to 11 genera were recovered and identified from these samples. The predominant fungal genera encountered were Aspergillus, Penicillium and Fusarium. In view of the predominance of Aspergillus flavus, a known producer of aflatoxins, screening of the fungal contaminated samples was carried out for total aflatoxin levels using high performance liquid chromatography (HPLC). Twenty one aflatoxin positive samples contained 8.07-33.45 μg g(-1) and 0.05-3946.97 μg g(-1) AFB1 and AFB2 respectively. These results suggest that biochemical composition of dried quince seeds, along with climatic conditions of the region seem to be very favourable for aflatoxin production by toxigenic strains of A. flavus. Therefore, monitoring of aflatoxins in dried quince seeds is recommended for this region. PMID:26930866

  13. Histological Lesions, Cell Cycle Arrest, Apoptosis and T Cell Subsets Changes of Spleen in Chicken Fed Aflatoxin-contaminated Corn

    PubMed Central

    Peng, Xi; Zhang, Keying; Bai, Shiping; Ding, Xuemei; Zeng, Qiufeng; Yang, Jun; Fang, Jing; Chen, Kejie


    The purpose of this study was to evaluate the effects of corn naturally contaminated with aflatoxin B1 and aflatoxin B2 on pathological lesions, apoptosis, cell cycle phases and T lymphocyte subsets of spleen, and to provide an experimental basis for understanding the mechanism of aflatoxin-induced immunosuppression. A total of 900 COBB500 male broilers were randomly allocated into five groups with six replicates per group and 30 birds per replicate. The experiment lasted for 6 weeks and the five dietary treatments consisted of control, 25% contaminated corn, 50% contaminated corn, 75% contaminated corn and 100% contaminated corn groups. The histopathological spleen lesions from the contaminated corn groups was characterized as congestion of red pulp, increased necrotic cells and vacuoles in the splenic corpuscle and periarterial lymphatic sheath. The contaminated corn intake significantly increased relative weight of spleen, percentages of apoptotic splenocytes, induced cell cycle arrest of splenocytes, increased the percentages of CD3+CD8+ T cells and decreased the ratios of CD3+CD4+ to CD3+CD8+. The results suggest that AFB-induced immunosuppression maybe closely related to the lesions of spleen. PMID:25141002

  14. Aflatoxin in betel nut and its control by use of food preservatives.


    Raisuddin, S; Misra, J K


    The occurrence of aflatoxins in market betel nut samples was studied. It was observed that several betel nut samples were infested with aflatoxin-producing fungus, Aspergillus flavus. Out of 32 samples collected from various places, 12 were positive for aflatoxin. Aflatoxin B1 was detected in all the positive samples. Other aflatoxins were also detected in some samples. Boric acid, propionic acid and potassium metabisulphite were used for the control of aflatoxin B1 on betel nuts. Propionic acid was most effective in inhibiting aflatoxin production on betel nut after intervals of 2 (62%) and 4 (85%) weeks. Controlling the occurrence of aflatoxin could safeguard the users from the health hazards of aflatoxins. PMID:1812017

  15. Estimated exposure to EU regulated mycotoxins and risk characterization of aflatoxin-induced hepatic toxicity through the consumption of the toasted cereal flour called "gofio", a traditional food of the Canary Islands (Spain).


    Luzardo, Octavio P; Bernal-Suárez, María Del Mar; Camacho, María; Henríquez-Hernández, Luis Alberto; Boada, Luis D; Rial-Berriel, Cristian; Almeida-González, Maira; Zumbado, Manuel; Díaz-Díaz, Ricardo


    "Gofio" is a type of flour made from toasted grain, which is part of the staple food in the Canary Islands, Spain, in which the occurrence of Aflatoxins B1, B2, G1 and G2 (AFB1, AFB2, AFG1, AFG2), Fumonisins B1 and B2 (FB1 and FB2) Ochratoxin A (OTA), Deoxynivalenol (DNV) and Zearalenone (ZEA) was evaluated. 83% of the samples were contaminated with at least one mycotoxin and 69.2% of the analyzed samples showed co-occurrence of mycotoxins (range 2 to 8). All the concentrations were well below the established limits (maximum values of AFs=0.42 μg/kg; FBs=178.3 μg/kg; OTA=0.3 μg/kg; DON=92.5 μg/kg; and ZEA=9.9 μg/kg). The daily dietary exposure to total AFs was estimated to be 7.1% of the TDI. This value was almost double in children, and considering the upper-bound approach could reach 35% of the TDI. For the rest of mycotoxins, the consumers would be exposed to less than 2% of their TDIs. The risk characterization indicates that there is a potential risk in developing aflatoxin induced liver cancer due to gofio consumption in the subpopulation which is simultaneously exposed to other hepatocarcinogens, such as the hepatitis B virus. PMID:27132021

  16. Aflatoxins and ochratoxin A in tea prepared from naturally contaminated powdered ginger.


    Iha, M H; Trucksess, M W


    The migration of several major mycotoxins, aflatoxins B(1) (AFB(1)), B(2), G(1), and G(2) (AFT, total of the aflatoxins) and ochratoxin A (OTA), from naturally contaminated powdered ginger to surrounding liquid (tea) was investigated. The toxins are commonly found in cereal grains and are toxic, carcinogenic and thermostable. Ginger root is widely used for digestive problems. Powdered ginger (2 g) found to contain AFT and OTA was placed in an empty heat sealable tea bag. The tea bag was heat-sealed and used to prepare tea under different conditions: temperature (50 and 100 degrees C), time (5 and 10 min) and volume (100 and 200 ml). The tea bag was placed in hot water and stirred every 1 min for 5 s during the first 5 min of steeping. After steeping, the tea bag was removed and the tea and ginger residue (in the tea bag) were analysed separately for AFT and OTA. After extraction and immunoaffinity column (IAC) clean-up, the isolated AFT and OTA were separated by reversed-phase liquid chromatography and quantified using a fluorescence detector. At 100 degrees C, approximately 30-40% of AFB(1) and AFT and 20-30% of OTA in the contaminated ginger were found in the ginger tea; the total amounts of AFT and OTA in tea varied less than 5% under the three conditions of preparation. At 50 degrees C, about 10% of OTA and AFT were found in tea. This is the first study on the migration of AFT from botanicals to tea. It is also the first to study the distribution of AFT and OTA from powdered ginger to tea and ginger residue. PMID:20589549

  17. Natural occurrence of aflatoxins and ochratoxin A in processed spices marketed in Malaysia.


    Ali, Norhayati; Hashim, Noor Hasani; Shuib, Nor Shifa


    The analysis of aflatoxins (B1, B2, G1 and G2) and ochratoxin A (OTA) was performed in processed spices marketed in Penang, Malaysia, using immunoaffinity columns and HPLC equipped with fluorescence detector (HPLC-FD). The processed powdered spices analysed include dried chilli, fennel, cumin, turmeric, black and white pepper, poppy seed, coriander, 'garam masala', and mixed spices for fish, meat and chicken curry. Two different studies were carried out. The limit of detection (LOD) was 0.01 ng g(-1) for each aflatoxin (AF) and 0.10 ng g(-1) for OTA (signal-to-noise ratio = 3:1). In the first study, 34 commercial processed spices analysed with a mean level, range and incidence of positive samples for total AF were 1.61 ng g(-1), 0.01-9.34 ng g(-1) and 85%, respectively, and for AFB1 were 1.38 ng g(-1), 0.01-7.68 ng g(-1) and 85%, respectively. The mean level, range and incidence of positive samples for OTA were 2.21 ng g(-1), 0.14-20.40 ng g(-1) and 79%, respectively. Natural co-occurrence of AF and OTA was found in 25 (74%) samples. In the second study of 24 commercial processed spices, the mean level, range and incidence of positive samples for total AF were 8.38 ng g(-1), 0.32-31.17 ng g(-1) and 88%, respectively, and for AFB1 were 7.31 ng g(-1), 0.32-28.43 ng g(-1) and 83%, respectively. Fifteen positive samples for total AF and two positive samples for OTA exceeded the permissible Malaysian limit of 5 ng g(-1). Contamination of both mycotoxins in spices may represent another route of exposure to consumers due to their frequent and prolonged consumption, as spices are common ingredients in popular dishes among Asian countries. PMID:25658149

  18. Buckwheat achenes antioxidant profile modulates Aspergillus flavus growth and aflatoxin production.


    Chitarrini, G; Nobili, C; Pinzari, F; Antonini, A; De Rossi, P; Del Fiore, A; Procacci, S; Tolaini, V; Scala, V; Scarpari, M; Reverberi, M


    Buckwheat (Fagopyrum spp.) is a "pseudo-cereal" of great interest in the production of healthy foods since its flour, derived from achenes, is enriched with bioactive compounds and, due to the absence of gluten, may be used in composition of celiac diets. Amongst buckwheat species, F. tataricum achenes possess a larger amount of the antioxidant flavenol rutin than the common buckwheat F. esculentum. Ongoing climate change may favor plant susceptibility to the attack by pathogenic, often mycotoxigenic, fungi with consequent increase of mycotoxins in previously unexploited feeds and foodstuffs. In particular, Aspergillus flavus, under suitable environmental conditions such as those currently occurring in Italy, may produce aflatoxin B1 (AFB1), the most carcinogenic compound of fungal origin which is classified by IARC as Category 1. In this study, the viable achenes of two buckwheat species, F. tataricum (var. Golden) and F. esculentum (var. Aelita) were inoculated with an AFB1-producing A. flavus NRRL 3357 to analyze their relative performances against fungal invasion and toxin contamination. Notably, we sought the existence of a correlation between the amount of tocols/flavonols in the achenes of buckwheat, infected and non-infected with A. flavus, and to analyze the ability of the pathogen to grow and produce toxin during achene infection. Results suggest that achenes of F. tataricum, the best producer of antioxidant compounds in this study, are less susceptible to A. flavus infection and consequently, but not proportionally, to mycotoxin contamination compared with F. esculentum. Moreover, rutin-derived quercetin appears to be more efficient in inhibiting aflatoxin biosynthesis than the parent compound. PMID:25108759

  19. Reliable HPLC Determination of Aflatoxin M1 in Eggs

    PubMed Central

    Khalil, Mostafa M. H.; Gomaa, Ahmed M.


    Aflatoxin M1 is the foremost metabolite of aflatoxin B1 in humans and animals, which may be present in animal products from animals fed with aflatoxin B1 contaminated feed. In this study a high performance liquid chromatography method for determination of aflatoxin M1 in eggs was described. The egg samples were diluted with warmed water and the toxin was immunoextracted followed by fluorescence detection. The average recovery of aflatoxin M1 at the three different levels 0.05, 0.1, and 0.5 μg/kg varied between 87% and 98%. The method is linear from the limit of quantification 0.05 μg/kg up to 3 μg/kg levels. This method is intended for aflatoxin M1 analyses in eggs simply with minimum toxin lose, excellent recovery, and accurate results with the limit of detection 0.01 μg/kg. PMID:23984192

  20. Inhibition of aflatoxin production by selected insecticides.


    Draughon, F A; Ayres, J C


    The insecticide naled completed inhibition production of aflatoxins B1, B2, G1, and G2 by and growth of Aspergillus parasiticus at a 100-ppm (100 microgram/ml) concentration. The insecticides dichlorvos, Landrin, pyrethrum, Sevin, malathion, and Diazinon significantly (P = 0.05) inhibited production of aflatoxins at a 100-ppm concentration. However, at a concentration of 10 ppm, significant inhibition in production of aflatoxins was found only with naled, dichlorvos, Sevin, Landrin, and pyrethrum. Dichlorvos, Landrin, Sevin, and naled inhibited growth of A. parasiticus by 28.9 , 18.9, 15.7, and 100%, respectively, at 100 ppm. Stimulation of growth was observed when diazinon was added to cultures. Aflatoxin B1 was most resistant to inhibition by insecticides, followed by G1, G2, and B2, respectively. PMID:6786222

  1. Development of structure switching aptamer assay for detection of aflatoxin M1 in milk sample.


    Sharma, Atul; Catanante, Gaëlle; Hayat, Akhtar; Istamboulie, Georges; Ben Rejeb, Ines; Bhand, Sunil; Marty, Jean Louis


    The discovery of in-vitro systematic evolution of ligands by exponential enrichment (SELEX) process has considerably broaden the utility of aptamer as bio-recognition element, providing the high binding affinity and specificity against the target analytes. Recent research has focused on the development of structure switching signaling aptamer assay, transducing the aptamer- target recognition event into an easily detectable signal. In this paper, we demonstrate the development of structure switching aptamer assay for determination of aflatoxin M1 (AFM1) employing the quenching-dequenching mechanism. Hybridization of fluorescein labelled anti-AFM1 aptamer (F-aptamer) with TAMRA labelled complementary sequences (Q-aptamer) brings the fluorophore and the quencher into close proximity, which results in maximum fluorescence quenching. On addition of AFM1, the target induced conformational formation of antiparallel G-quadruplex aptamer-AFM1 complex results in fluorescence recovery. Under optimized experimental conditions, the developed method showed the good linearity with limit of detection (LOD) at 5.0ngkg(-1) for AFM1. The specificity of the sensing platform was carefully investigated against aflatoxin B1 (AFB1) and ochratoxin A (OTA). The developed assay platform showed the high specificity towards AFM1. The practical application of the developed aptamer assay was verified for detection of AFM1 in spiked milk samples. Good recoveries were obtained in the range from 94.40% to 95.28% (n=3) from AFM1 spiked milk sample. PMID:27343575

  2. Occurrence of Aflatoxins in Selected Processed Foods from Pakistan

    PubMed Central

    Mushtaq, Muhammad; Sultana, Bushra; Anwar, Farooq; Khan, Muhammad Zargham; Ashrafuzzaman, Muhammad


    A total of 125 (ready to eat) processed food samples (70 intended for infant and 55 for adult intake) belonging to 20 different food categories were analyzed for aflatoxins contamination using Reverse Phase High Performance Liquid Chromatography (RP-HPLC) with fluorescent detection. A solvent mixture of acetonitrile-water was used for the extraction followed by immunoaffinity clean-up to enhance sensitivity of the method. The limit of detection (LOD) (0.01–0.02 ng·g−1) and limit of quantification (LOQ) (0.02 ng·g−1) was established for aflatoxins based on signal to noise ratio of 3:1 and 10:1, respectively. Of the processed food samples tested, 38% were contaminated with four types of aflatoxins, i.e., AFB1 (0.02–1.24 μg·kg−1), AFB2 (0.02–0.37 μg·kg−1), AFG1 (0.25–2.7 μg·kg−1) and AFG2 (0.21–1.3 μg·kg−1). In addition, the results showed that 21% of the processed foods intended for infants contained AFB1 levels higher than the European Union permissible limits (0.1 μg·kg−1), while all of those intended for adult consumption had aflatoxin contamination levels within the permitted limits. PMID:22942705

  3. Development and in-house validation of a robust and sensitive solid-phase extraction liquid chromatography/tandem mass spectrometry method for the quantitative determination of aflatoxins B1, B2, G1, G2, ochratoxin A, deoxynivalenol, zearalenone, T-2 and HT-2 toxins in cereal-based foods.


    Lattanzio, Veronica M T; Gatta, Stefania Della; Suman, Michele; Visconti, Angelo


    A sensitive and robust liquid chromatography/tandem mass spectrometry (LC/MS/MS) method was developed for the simultaneous determination of aflatoxins (B(1), B(2), G(1), G(2)), ochratoxin A, deoxynivalenol, zearalenone, T-2 and HT-2 toxins in cereal-based foods. Samples were extracted with a mixture of acetonitrile/water (84:16, v/v) and cleaned up through a polymeric solid-phase extraction column. Detection and quantification of the nine mycotoxins were performed by reversed-phase liquid chromatography coupled with electrospray ionization triple quadrupole mass spectrometry (LC/ESI-MS/MS), using fully (13)C-isotope-labelled mycotoxins as internal standards. The method was validated in-house for five different cereal processed products, namely barley, oat and durum wheat flours, rye- and wheat-based crisp bread. Recoveries and repeatability of the whole analytical procedure were evaluated at contamination levels encompassing the EU maximum permitted levels for each tested mycotoxin. Recoveries ranged from 89 to 108% for deoxynivalenol, from 73 to 114% for aflatoxins, from 85 to 114% for T-2 and HT-2 toxins, from 64 to 97% for zearalenone, from 74 to 102% for ochratoxin A. Relative standard deviations were less than 16% for all tested mycotoxins and matrices. Limits of detection (signal-to-noise ratio 3:1) ranged from 0.1 to 59.2 µg/kg. The trueness of the results obtained by the proposed method was demonstrated by analysis of reference materials for aflatoxins, deoxynivalenol, zearalenone. The use of inexpensive clean-up cartridges and the increasing availability of less expensive LC/MS/MS instrumentation strengthen the potential of the proposed method for its effective application for reliable routine analysis to assess compliance of tested cereal products with current regulation. PMID:21638363

  4. Survey on the occurrence of aflatoxins in rice from different provinces of Iran.


    Rahmani, Anosheh; Soleimany, Farhang; Hosseini, Hedayat; Nateghi, Leila


    Aflatoxins were surveyed in 256 rice samples taken from retail markets in different provinces of Iran during October 2007 and July 2008. A methanol/water (80 : 20, v/v) mixture and an aflatoxin immunoaffinity column (IAC) were used for extraction and clean-up. Mycotoxins were determined using HPLC with fluorescence detection and post-column derivatization using a photo-ionization cell. Levels of contamination ranged 0.0-5.8 ng g(-1) (mean, 1.4 ng g(-1)) and 0.1-6.3 ng g(-1) (mean, 1.6 ng g(-1)) for AFB1 and total aflatoxins, respectively. AFB1 was detected in almost all samples. Results showed that 55 samples (21.5%) were contaminated with more than 2 µg kg(-1) of AFB1, while seven samples (2.7 %) contained more than 4 µg kg(-1) total aflatoxins. The calculated probable daily intake of AFB1 from rice for Iranians ranged 1.4-5.8 ng AFB1 per kg body weight per day for average consumers and, hence. exceeding the estimated provisional maximum tolerable daily intake. PMID:24786005

  5. Validation of a confirmatory analytical method for the determination of aflatoxins B₁, B₂, G₁ and G₂ in foods and feed materials by HPLC with on-line photochemical derivatization and fluorescence detection.


    Muscarella, Marilena; Iammarino, Marco; Nardiello, Donatella; Magro, Sonia Lo; Palermo, Carmen; Centonze, Diego; Palermo, Domenico


    A sensitive and selective analytical method for the simultaneous separation and quantitative determination of aflatoxins B1, B2, G1 and G2 in foodstuffs and materials for feed has been validated. The method is based on high performance liquid chromatography with on-line post-column photochemical derivatization and fluorescence detection. The chromatographic separation of aflatoxins was accomplished using a C18 column eluted with an isocratic mobile phase consisting of water, methanol and acetonitrile. The sample preparation required a simple extraction of aflatoxins with MeOH/H2O (80:20, v/v) and a purification step by immunoaffinity column cleanup. The total analysis time, including sample preparation and chromatographic separation, did not exceed 40 min with a run time of 10 min. The on-line photochemical derivatization ensures better results in terms of simplicity, sensitivity and reproducibility with respect to chemical derivatization techniques, and provides an increase of the peak resolution and an extent of automation in comparison with the electrochemical ones. The procedure for the determination of aflatoxins in food samples and cereals for animal consumption was extensively validated following Regulation (EC) No. 882/2004. Detection limits in wheat bran samples of 0.08 μg kg1 for AFB1, 0.02 μg kg1 for AFB2, 0.16 μg kg1 for AFG1 and 0.04 μg kg1 for AFG2 were attained. The method allows high recovery with mean values ranging from 72 to 94% and it satisfies the necessary requirements for sensitivity, linearity, selectivity, precision and ruggedness, demonstrating the conformity of the method with provisions of Regulation (EC) No. 401/2006. PMID:21462585

  6. Evolutionary mechanisms within a single cell, populations and species that influence aflatoxin contamination of crop plants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Mycotoxins, and especially the aflatoxins, are an enormous problem in agriculture, with aflatoxin B1 being the most carcinogenic known natural compound. The worldwide costs associated with aflatoxin monitoring and crop losses are in the hundreds of millions of dollars. Aspergillus flavus and A. para...

  7. Aflatoxin detoxification by manganese peroxidase purified from Pleurotus ostreatus

    PubMed Central

    Yehia, Ramy Sayed


    Manganese peroxidase (MnP) was produced from white rot edible mushroom Pleurotus ostreatus on the culture filtrate. The enzyme was purified to homogeneity using (NH4)2SO4 precipitation, DEAE-Sepharose and Sephadex G-100 column chromatography. The final enzyme activity achieved 81 U mL−1, specific activity 78 U mg−1 with purification fold of 130 and recovery 1.2% of the crude enzyme. SDS-PAGE indicated that the pure enzyme have a molecular mass of approximately 42 kDa. The optimum pH was between 4–5 and the optimum temperature was 25 °C. The pure MnP activity was enhanced by Mn2+, Cu2+, Ca2+ and K+ and inhibited by Hg+2 and Cd+2. H2O2 at 5 mM enhanced MnP activity while at 10 mM inhibited it significantly. The MnP-cDNA encoding gene was sequenced and determined (GenBank accession no. AB698450.1). The MnP-cDNA was found to consist of 497 bp in an Open Reading Frame (ORF) encoding 165 amino acids. MnP from P. ostreatus could detoxify aflatoxin B1 (AFB1) depending on enzyme concentration and incubation period. The highest detoxification power (90%) was observed after 48 h incubation at 1.5 U mL−1 enzyme activities. PMID:24948923

  8. Detection of aflatoxin B₁ with immunochromatographic test strips: Enhanced signal sensitivity using gold nanoflowers.


    Ji, Yanwei; Ren, Meiling; Li, Yanping; Huang, Zhibing; Shu, Mei; Yang, Hongwei; Xiong, Yonghua; Xu, Yang


    Immunochromatographic test strips (ICTS) are commonly limited to higher concentrations of analytes. This limitation stems from the relatively low sensitivity of conventional gold nanospheres (AuNSs with a diameter of 20 nm) to emit detectable brightness values. The larger multi-branched gold nanoflowers (AuNFs) with a higher optical brightness as well as good colloidal stability exhibit significant improvements over conventional AuNSs for enhanced sensitivity of ICTS. In this study, blue AuNFs with an average diameter of 75±5 nm were synthetized and employed as a signal amplification probe for ultrasensitive and quantitative detection of aflatoxin B1 (AFB1) in rice. A portable optical strip reader was used to record the optical densities of test and control lines of the strip. Under the optimal conditions, the AuNF based ICTS system accurately detected AFB1 linearly and dynamically over the range of 0.5-25 pg/mL with a half maximal inhibitory concentration at 4.17 pg/mL. The inhibitory concentration was achieved 10 times lower than that of the traditional AuNS based ICTS systems (41.25 pg/mL). The limit of detection for AFB1 in rice extract was achieved at 0.32 pg/mL. In summary, AuNFs are a novel probe that exhibited excellent sensitivity in the ICTS system and could be used for ultrasensitive detection of other analytes in food safety monitoring, and even medical diagnostics. PMID:26003713

  9. Use of multitoxin immunoaffinity columns for determination of aflatoxins and ochratoxin A in ginseng and ginger.


    Trucksess, Mary W; Weaver, Carol M; Oles, Carolyn J; Rump, Lydia V; White, Kevin D; Betz, Joseph M; Rader, Jeanne I


    Conditions were optimized for the simultaneous, alkaline, aqueous methanol extraction of aflatoxins (AFL), i.e., B1 (AFB1), B2 (AFB2), G1 (AFG1), and G2 (AFG2), and ochratoxin A (OTA) with subsequent purification, isolation, and determination of the toxins in ginseng and ginger. Powdered roots were extracted with methanol-0.5% NaHCO3 solution (7 + 3). After shaking and centrifugation, the supernatant was diluted with 100 mM phosphate buffer containing 1% Tween 20 and filtered through glass microfiber filter paper. The filtrate was then passed through an immunoaffinity column, and the toxins were eluted with methanol. The AFL were separated and determined by reversed-phase liquid chromatography (RPLC) with fluorescence detection after postcolumn UV photochemical derivatization. OTA was separated and determined by RPLC with fluorescence detection. Recoveries of AFL added at 2-16 ng/g and OTA added at 1-8 ng/g to ginseng were 72-80 and 86-95%, respectively. Recoveries of AFL and OTA added to ginger were similar to those for ginseng. A total of 39 commercially available ginger products from 6 manufacturers were analyzed. Twenty-six samples were found to be contaminated with AFL at 1-31 ng/g and 29 samples, with OTA at 1-10 ng/g. Ten samples contained no AFL or OTA. Ten ginseng finished products were also analyzed; 3 contained AFL at 0.1 ng/g and 4 contained OTA at levels ranging from 0.4 to 1.8 ng/g. LC/tandem mass spectrometry with multiple-reaction monitoring of 3 collisionally induced product ions from the protonated molecular ions of OTA, AFB1, and AFG1 was used to confirm the identities of the toxins in extracts of the finished products. PMID:17760342

  10. Immunochromatographic assay for ultrasensitive detection of aflatoxin B₁ in maize by highly luminescent quantum dot beads.


    Ren, Meiling; Xu, Hengyi; Huang, Xiaolin; Kuang, Min; Xiong, Yonghua; Xu, Hong; Xu, Yang; Chen, Hongyu; Wang, Andrew


    Highly luminescent quantum dot beads (QBs) were synthesized by encapsulating CdSe/ZnS and used for the first time as immunochromatographic assay (ICA) signal amplification probe for ultrasensitive detection of aflatoxin B1 (AFB1) in maize. The challenges to using high brightness QBs as probes for ICA are smooth flow of QBs and nonspecific binding on nitrocellulose (NC) membrane, which are overcome by unique polymer encapsulation of quantum dots (QDs) and surface blocking method. Under optimal conditions, the QB-based ICA (QB-ICA) sensor exhibited dynamic linear detection of AFB1 in maize extract from 5 to 60 pg mL(-1), with a median inhibitory concentration (IC50) of 13.87 ± 0.16 pg mL(-1), that is significantly (39-fold) lower than those of the QD as a signal probe (IC50 = 0.54 ± 0.06 ng mL(-1)). The limit of detection (LOD) for AFB1 using QB-ICA sensor was 0.42 pg mL(-1) in maize extract, which is approximately 2 orders of magnitude better than those of previously reported gold nanoparticle based immunochromatographic assay (AuNP-ICA) and is even comparable with or better than the conventional enzyme-linked immunosorbent assay (ELISA) method. The performance and practicability of our QB-ICA sensor were validated with a commercial ELISA kit and further confirmed with liquid chromatography tandem mass spectrometry (LC-MS/MS). Given its efficient signal amplification performance, the proposed QB-ICA offers great potential for rapid, sensitive, and cost-effective quantitative detection of analytes in food safety monitoring. PMID:25109633

  11. Aflatoxin levels and exposure assessment of Spanish infant cereals.


    Hernández-Martínez, Raquel; Navarro-Blasco, Iñigo


    Aflatoxins (AFB1, AFB2, AFG1 and AFG2) are immunosuppressant, mutagenic, teratogenic and carcinogenic agents with a widespread presence in foodstuffs. Since human exposure to aflatoxins occurs primarily by contaminated food intake, and given the greater susceptibility of infants to their adverse effects, the quantification of these mycotoxins in infant food based on cereals is of relevance. Aflatoxin levels were determined in 91 Spanish infant cereals classified in terms of non- and organically produced and several types from 10 different manufacturers, using a extraction procedure followed by inmunoaffinity column clean-up step and HPLC with fluorescence detection (FLD) and post-column derivatisation (Kobra Cell system). Daily aflatoxin intake was also assessed. Preliminary analysis showed a valuable incidence of detected infant cereal samples at an upper concentration level than the detection limit for total aflatoxin (66%), corresponding to a 46, 40, 34 and 11% for AFB1, AFB2, AFG1 and AFG2, respectively. Lower aflatoxin values (median, Q1, Q3) in conventional infant cereal (n = 74, AFB1: AFB2: n.d. (n.d.; 0.01), AFG1: AFB1: 0.02 (0.02; 0.21), AFB2: n.d. (n.d.; 0.03), AFG1: 0.02 (0.01; 0.05), and AFG2: 0.007 (n.d.; 0.02) and AFtotal: 0.05 (0.03; 0.31 µg kg(-1)) were found. In addition, five organic formulations (3.11, 1.98, 0.94, 0.47 and 0.21 µg kg(-1)) exceeded European AFB1 legislation (0.10 µg kg(-1)) versus two conventional cereals (0.35 and 0.12 µg kg(-1)). According to the type of infant cereal, those with cocoa had the highest aflatoxin levels. Gluten-free and cereals with dehydrated fruits had an intermediate level and milk- or honey-based cereals and multi-cereals contained the lowest levels. With the exception of the non-compliant cocoa-based organic formulation

  12. Griffiss AFB integrated resource assessment

    SciTech Connect

    Dixon, D.R.; Armstrong, P.R.; Keller, J.M.


    The US Air Force Air Combat Command has tasked the Pacific Northwest Laboratory (PNL) as the lead laboratory supporting the US Department of Energy (DOE) Federal Energy Management Program's (FEMP) mission to identify, evaluate, and assist in acquiring all cost-effective energy projects at Griffiss Air Force Base (AFB). This is a model program PNL is designing for federal customers served by the Niagara Mohawk Power Company (Niagara Mohawk). It will (1) identify and evaluate all electric cost-effective energy projects; (2) develop a schedule at each installation for project acquisition considering project type, size, timing, and capital requirements, as well as energy and dollar savings; and (3) secure 100% of the financing required to implement electric energy efficiency projects from Niagara Mohawk and have Niagara Mohawk procure the necessary contractors to perform detailed audits and install the technologies. This report documents the assessment of baseline energy use at one of Niagara Mohawk's primary federal facilities, Griffiss AFB, an Air Combat Command facility located near Rome, New York. It is a companion report to Volume 1, the Executive Summary, and Volume 3, the Electric Resource Assessment. The analysis examines the characteristics of electric, gas, oil, propane, coal, and purchased thermal capacity use for fiscal year (FY) 1990. The results include energy-use intensities for the facilities at Griffiss AFB by building type and electric energy end use. A complete electric energy consumption reconciliation is presented that accounts for the distribution of all major electric energy uses and losses among buildings, utilities, and central systems.

  13. Aflatoxin Control in Maize by Trametes versicolor

    PubMed Central

    Scarpari, Marzia; Bello, Cristiano; Pietricola, Chiara; Zaccaria, Marco; Bertocchi, Luigi; Angelucci, Alessandra; Ricciardi, Maria Rosaria; Scala, Valeria; Parroni, Alessia; Fabbri, Anna A.; Reverberi, Massimo; Zjalic, Slaven; Fanelli, Corrado


    Aspergillus flavus is a well-known ubiquitous fungus able to contaminate both in pre- and postharvest period different feed and food commodities. During their growth, these fungi can synthesise aflatoxins, secondary metabolites highly hazardous for animal and human health. The requirement of products with low impact on the environment and on human health, able to control aflatoxin production, has increased. In this work the effect of the basidiomycete Trametes versicolor on the aflatoxin production by A. flavus both in vitro and in maize, was investigated. The goal was to propose an environmental loyal tool for a significant control of aflatoxin production, in order to obtain feedstuffs and feed with a high standard of quality and safety to enhance the wellbeing of dairy cows. The presence of T. versicolor, grown on sugar beet pulp, inhibited the production of aflatoxin B1 in maize by A. flavus. Furthermore, treatment of contaminated maize with culture filtrates of T. versicolor containing ligninolytic enzymes, showed a significant reduction of the content of aflatoxin B1. PMID:25525683

  14. Aflatoxin control in maize by Trametes versicolor.


    Scarpari, Marzia; Bello, Cristiano; Pietricola, Chiara; Zaccaria, Marco; Bertocchi, Luigi; Angelucci, Alessandra; Ricciardi, Maria Rosaria; Scala, Valeria; Parroni, Alessia; Fabbri, Anna A; Reverberi, Massimo; Zjalic, Slaven; Fanelli, Corrado


    Aspergillus flavus is a well-known ubiquitous fungus able to contaminate both in pre- and postharvest period different feed and food commodities. During their growth, these fungi can synthesise aflatoxins, secondary metabolites highly hazardous for animal and human health. The requirement of products with low impact on the environment and on human health, able to control aflatoxin production, has increased. In this work the effect of the basidiomycete Trametes versicolor on the aflatoxin production by A. flavus both in vitro and in maize, was investigated. The goal was to propose an environmental loyal tool for a significant control of aflatoxin production, in order to obtain feedstuffs and feed with a high standard of quality and safety to enhance the wellbeing of dairy cows. The presence of T. versicolor, grown on sugar beet pulp, inhibited the production of aflatoxin B1 in maize by A. flavus. Furthermore, treatment of contaminated maize with culture filtrates of T. versicolor containing ligninolytic enzymes, showed a significant reduction of the content of aflatoxin B1. PMID:25525683

  15. Food Safety Legislation Regarding Of Aflatoxins Contamination

    NASA Astrophysics Data System (ADS)

    Ketney, Otto


    The main objective of the European Union (EU) is to reduce certain contaminants in foodstuffs to acceptable levels. The occurrence of aflatoxin B1 in food was considered to be one of the most important issues of global food security to protect the health of humans and animals, over 100 nations have established maximum tolerable levels for aflatoxin in food. Although EU legislation covers many aspects of food safety was not legally establish an integrated framework that could effectively combat and cover all sectors of the food chain. Monitoring and reporting levels of aflatoxins after controls are essential actions that assist to identify potential risks to human health. The review process for aflatoxin regulations is a complex activity involving many factors and stakeholders.

  16. Mechanism of aflatoxin uptake in roots of intact groundnut (Arachis hypogaea L.) seedlings.


    Snigdha, M; Hariprasad, P; Venkateswaran, G


    Aflatoxins are one of the most potent toxic substances that occur naturally, which enter agricultural soils through the growth of aflatoxigenic fungi in rhizhosphere and nonrhizhosphere soils. Though several reports regarding the uptake of aflatoxin by plants are available, the mechanism of aflatoxin uptake remains unknown. This study characterized the aflatoxin uptake mechanism by in vitro hydroponic experiments under variable conditions. The uptake reached saturation after 48 h of incubation for AFB1 and B2 and 60 h for AFG1 and G2. A linear increase in uptake with increasing aflatoxin concentrations was observed, and it fits both linear and nonlinear regression. AFB1 uptake was directly proportional to transpiration rate, and blocking aquaporin activity using mercuric chloride revealed its involvement in the uptake. None of the metabolic inhibitors used to block active transport had any effect on aflatoxin uptake except for sodium azide. From the present study, it could be concluded that aflatoxin uptake by groundnut roots followed mainly a passive way and is facilitated through aquaporins. The involvement of active component should be studied in detail. PMID:23660803

  17. Biosorption of B-aflatoxins Using Biomasses Obtained from Formosa Firethorn [Pyracantha koidzumii (Hayata) Rehder

    PubMed Central

    Ramales-Valderrama, Rosa Adriana; Vázquez-Durán, Alma; Méndez-Albores, Abraham


    Mycotoxin adsorption onto biomaterials is considered as a promising alternative for decontamination without harmful chemicals. In this research, the adsorption of B-aflatoxins (AFB1 and AFB2) using Pyracantha koidzumii biomasses (leaves, berries and the mixture of leaves/berries) from aqueous solutions was explored. The biosorbent was used at 0.5% (w/v) in samples spiked with 100 ng/mL of B-aflatoxin standards and incubated at 40 °C for up to 24 h. A standard biosorption methodology was employed and aflatoxins were quantified by an immunoaffinity column and UPLC methodologies. The biosorbent-aflatoxin interaction mechanism was investigated from a combination of zeta potential (ζ), Fourier transform infrared spectroscopy (FTIR) and scanning electron microscopy (SEM). The highest aflatoxin uptakes were 86% and 82% at 6 h using leaves and the mixture of leaves/berries biomasses, respectively. A moderate biosorption of 46% was attained when using berries biomass. From kinetic studies, the biosorption process is described using the first order adsorption model. Evidence from FTIR spectra suggests the participation of hydroxyl, amine, carboxyl, amide, phosphate and ketone groups in the biosorption and the mechanism was proposed to be dominated by the electrostatic interaction between the negatively charged functional groups and the positively charged aflatoxin molecules. Biosorption by P. koidzumii biomasses has been demonstrated to be an alternative to conventional systems for B-aflatoxins removal. PMID:27420096

  18. Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.

    PubMed Central

    Jones, W R; Stone, M P


    The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 formed base triplets, and nucleotides G7*C13formed a Watson-Crick base pair. The oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT), designated '1G', also formed a triplex in which nucleotides C24*G3*C24 formed a triplet. Reaction of the two oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide revealed that only the 3G sequence formed an adduct, as determined by UV absorbance and piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis. This site was identified as G7by comparison to the guanine-specific cleavage pattern. The chemistry was extended to a series of nicked bimolecular triple helices, constructed from d(AAAGGGGGAA) and d(CnTTCTTTTTCCCCCTTTATTTTTTC5-n) (n = 1-5). Each oligomer in the series differed only in the placement of the nick. Reaction of the nicked triplexes with AFB1- exo -8,9-epoxide, piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis, revealed cleavage corresponding to the guanine closest to the pyrimidine strand nick. By using the appropriate pyrimidine sequence the lesion was positioned within the purine strand. PMID:9461470

  19. Aflatoxin-Exposure of Vibrio gazogenes as a Novel System for the Generation of Aflatoxin Synthesis Inhibitors

    PubMed Central

    Gummadidala, Phani M.; Chen, Yung Pin; Beauchesne, Kevin R.; Miller, Kristen P.; Mitra, Chandrani; Banaszek, Nora; Velez-Martinez, Michelle; Moeller, Peter D. R.; Ferry, John L.; Decho, Alan W.; Chanda, Anindya


    Aflatoxin is a mycotoxin and a secondary metabolite, and the most potent known liver carcinogen that contaminates several important crops, and represents a significant threat to public health and the economy. Available approaches reported thus far have been insufficient to eliminate this threat, and therefore provide the rational to explore novel methods for preventing aflatoxin accumulation in the environment. Many terrestrial plants and microbes that share ecological niches and encounter the aflatoxin producers have the ability to synthesize compounds that inhibit aflatoxin synthesis. However, reports of natural aflatoxin inhibitors from marine ecosystem components that do not share ecological niches with the aflatoxin producers are rare. Here, we show that a non-pathogenic marine bacterium, Vibrio gazogenes, when exposed to low non-toxic doses of aflatoxin B1, demonstrates a shift in its metabolic output and synthesizes a metabolite fraction that inhibits aflatoxin synthesis without affecting hyphal growth in the model aflatoxin producer, Aspergillus parasiticus. The molecular mass of the predominant metabolite in this fraction was also different from the known prodigiosins, which are the known antifungal secondary metabolites synthesized by this Vibrio. Gene expression analyses using RT-PCR demonstrate that this metabolite fraction inhibits aflatoxin synthesis by down-regulating the expression of early-, middle-, and late- growth stage aflatoxin genes, the aflatoxin pathway regulator, aflR and one global regulator of secondary metabolism, laeA. Our study establishes a novel system for generation of aflatoxin synthesis inhibitors, and emphasizes the potential of the under-explored Vibrio’s silent genome for generating new modulators of fungal secondary metabolism. PMID:27375561

  20. Aflatoxin-Exposure of Vibrio gazogenes as a Novel System for the Generation of Aflatoxin Synthesis Inhibitors.


    Gummadidala, Phani M; Chen, Yung Pin; Beauchesne, Kevin R; Miller, Kristen P; Mitra, Chandrani; Banaszek, Nora; Velez-Martinez, Michelle; Moeller, Peter D R; Ferry, John L; Decho, Alan W; Chanda, Anindya


    Aflatoxin is a mycotoxin and a secondary metabolite, and the most potent known liver carcinogen that contaminates several important crops, and represents a significant threat to public health and the economy. Available approaches reported thus far have been insufficient to eliminate this threat, and therefore provide the rational to explore novel methods for preventing aflatoxin accumulation in the environment. Many terrestrial plants and microbes that share ecological niches and encounter the aflatoxin producers have the ability to synthesize compounds that inhibit aflatoxin synthesis. However, reports of natural aflatoxin inhibitors from marine ecosystem components that do not share ecological niches with the aflatoxin producers are rare. Here, we show that a non-pathogenic marine bacterium, Vibrio gazogenes, when exposed to low non-toxic doses of aflatoxin B1, demonstrates a shift in its metabolic output and synthesizes a metabolite fraction that inhibits aflatoxin synthesis without affecting hyphal growth in the model aflatoxin producer, Aspergillus parasiticus. The molecular mass of the predominant metabolite in this fraction was also different from the known prodigiosins, which are the known antifungal secondary metabolites synthesized by this Vibrio. Gene expression analyses using RT-PCR demonstrate that this metabolite fraction inhibits aflatoxin synthesis by down-regulating the expression of early-, middle-, and late- growth stage aflatoxin genes, the aflatoxin pathway regulator, aflR and one global regulator of secondary metabolism, laeA. Our study establishes a novel system for generation of aflatoxin synthesis inhibitors, and emphasizes the potential of the under-explored Vibrio's silent genome for generating new modulators of fungal secondary metabolism. PMID:27375561

  1. Development and validation of a high-performance liquid chromatography method with post-column derivatization for the detection of aflatoxins in cereals and grains.


    Asghar, Muhammad Asif; Iqbal, Javed; Ahmed, Aftab; Khan, Mobeen Ahmed; Shamsuddin, Zuzzer Ali; Jamil, Khalid


    A novel, reliable and rapid high-performance liquid chromatography (HPLC) method with post-column derivatization was developed and validated. The HPLC method was used for the simultaneous determination of aflatoxin B1 (AFB1), B2 (AFB2), G1 (AFG1) and G2 (AFG2) in various cereals and grains. Samples were extracted with 80:20 (v/v) methanol:water and purified using C18 (40-63 μm) solid-phase extraction cartridges. AFs were separated using a LiChroCART-RP-18 (5 μm, 250 × 4.0 mm(2)) column. The mobile phase consisted of methanol:acetonitrile:buffer (17.5:17.5:65 v/v) (pH 7.4) delivered at the flow rate of 1.0 mL min(-1) The fluorescence of each AF was detected at λex = 365 nm and λem = 435 nm. All four AFs were properly resolved within the total run time of 20 min. The established method was extensively validated as a final verification of the method development by the evaluation of selectivity (AFB1, AFB2, AFG1 and AFG2), linearity (R(2) ≥ 0.9994), precision (average SD ≤ 2.79), accuracy (relative mean error ≤ -5.51), robustness (p < 0.0080), ruggedness (p < 0.0100) and average recoveries (89.2-97.8%). The limits of quantification of AFB1, AFB2, AFG1 and AFG2 were 0.080, 0.073, 0.062 and 0.066 ng g(-1), respectively. Finally, the developed method was applied for the analysis of AFs in 45 samples comprising rice (n = 20), wheat (n = 15) and maize (n = 10). The results showed that 65% of rice, 20% of wheat and 80% of maize samples were found contaminated with AFs. Thus, according to the achieved results, it is suggested that the newly developed HPLC method could be effectively applied for the routine analysis of the AFs in different cereals and grains. PMID:25227226

  2. Fluorimetric Immunoassay for Multianalysis of Aflatoxins

    PubMed Central


    A sensitive fluorimetric ELISA was developed for the analysis of aflatoxins. The assay was performed in a 384 microwell plate, wherein high specificity monoclonal antibody against AFM1 (mAb-AFM1) was used as capture antibody and FITC conjugated secondary antibody was used for detection and quantification of the analyte. The linear range of the immunoassay was found to be 6.25–50 pg/mL. AFM1 as low as 1 pg/mL was detected by this method with assay volume 40 μL. The multi-analysis of different aflatoxins was also investigated in the microwell plate, based on the cross-reactivity (CR) approach.