Restrepo, S; Duque, M; Tohme, J; Verdier, V
1999-01-01
Xanthomonas axonopodis pv. manihotis (Xam) is the causative agent of cassava bacterial blight (CBB), a worldwide disease that is particularly destructive in South America and Africa. CBB is controlled essentially through the use of resistant varieties. To develop an appropriate disease management strategy, the genetic diversity of the pathogen's populations must be assessed. Until now, the genetic diversity of Xam was characterized by RFLP analyses using ribotyping, and plasmid and genomic Xam probes. We used AFLP (amplified fragment length polymorphism), a novel PCR-based technique, to characterize the genetic diversity of Colombian Xam isolates. Six Xam strains were tested with 65 AFLP primer combinations to identify the best selective primers. Eight primer combinations were selected according to their reproducibility, number of polymorphic bands and polymorphism detected between Xam strains. Forty-seven Xam strains, originating from different Colombian ecozones, were analysed with the selected combinations. Results obtained with AFLP are consistent with those obtained with RFLP, using plasmid DNA as a probe. Some primer combinations differentiated Xam strains that were not distinguished by RFLP analyses, thus AFLP fingerprinting allowed a better definition of the genetic relationships between Xam strains.
Hybridization in the section Mentha (Lamiaceae) inferred from AFLP markers.
Gobert, V; Moja, S; Colson, M; Taberlet, P
2002-12-01
The amplified fragment length polymorphism (AFLP) method was used to evaluate genetic diversity and to assess genetic relationships within the section Mentha in order to clarify the taxonomy of several interspecific mint hybrids with molecular markers. To this end, genetic diversity of 62 Mentha accessions from different geographic origins, representing five species and three hybrids, was assessed. Three EcoRI/MseI AFLP primer combinations generated an average of 40 AFLP markers per primer combination, ranging in size from 50 to 500 base pairs (bp). The percentage of markers polymorphic ranged from 50% to 60% across all accessions studied. According to phenetic and cladistic analysis, the 62 mint accessions were grouped into two major clusters. Principal coordinates analysis separated species into well-defined groups, and clear relationships between species and hybrids could be described. Our AFLP analysis supports taxonomic classification established among Mentha species by conventional (morphological, cytological, and chemical) methods. It allows the assessment of phenetic relationships between species and the hybrids M. spicata and M. × piperita, largely cultivated all over the world for their menthol source, and provides new insights into the subdivision of M. spicata, based for the first time on molecular markers.
Mapping of AFLP markers linked to seed coat colour loci in Brassica juncea (L.) Czern.
Sabharwal, V; Negi, M S; Banga, S S; Lakshmikumaran, M
2004-06-01
Association mapping of the seed-coat colour with amplified fragment length polymorphism (AFLP) markers was carried out in 39 Brassica juncea lines. The lines had genetically diverse parentages and varied for seed-coat colour and other morphological characters. Eleven AFLP primer combinations were used to screen the 39 B. juncea lines, and a total of 335 polymorphic bands were detected. The bands were analysed for association with seed-coat colour using multiple regression analysis. This analysis revealed 15 markers associated with seed-coat colour, obtained with eight AFLP primer combinations. The marker E-ACA/M-CTG(350 )explained 69% of the variation in seed-coat colour. This marker along with markers E-AAC/M-CTC(235 )and E-AAC/M-CTA(250) explained 89% of the total variation. The 15 associated markers were validated for linkage with the seed-coat colour loci using a recombinant inbred line (RIL) mapping population. Bands were amplified with the eight AFLP primer combinations in 54 RIL progenies. Of the 15 associated markers, 11 mapped on two linkage groups. Eight markers were placed on linkage group 1 at a marker density of 6.0 cM, while the remaining three were mapped on linkage group 2 at a marker density of 3.6 cM. Marker E-ACA/M-CTG(350 )co-segregated with Gene1 controlling seed-coat colour; it was specific for yellow seed-coat colour and mapped to linkage group 1. Marker E-AAC/M-CTC(235) (AFLP8), which had been studied previously, was present on linkage group 2; it was specific for brown seed-coat colour. Since AFLP markers are not adapted for large-scale applications in plant breeding, it is important to convert these to sequence-characterised amplified region (SCAR) markers. Marker E-AAC/M-CTC(235) (AFLP8) had been previously converted into a SCAR. Work is in progress to convert the second of the linked markers, E-ACA/M-CTG(350), to a SCAR. The two linked AFLP markers converted to SCARs will be useful for developing yellow-seeded B. juncea lines by means of
Liu, Zhanjiang; Karsi, Attila; Li, Ping; Cao, Dongfeng; Dunham, R
2003-01-01
Catfish is the major aquaculture species in the United States. The hybrid catfish produced by crossing channel catfish females with blue catfish males exhibit a number of desirable production traits, but their mass production has been difficult. To introduce desirable genes from blue catfish into channel catfish through introgression, a genetic linkage map is helpful. In this project, a genetic linkage map was constructed using amplified fragment length polymorphism (AFLP). A total of 607 AFLP markers were analyzed using 65 primer combinations and an interspecific backcross resource family. A total of 418 AFLP markers were assigned to 44 linkage groups. Among the remaining 189 markers, 101 were not used because of significant segregation distortion, 29 were unlinked, and 59 were eliminated because they span very large distances. The 418 AFLP markers covered 1593 cM Kosambi. The AFLP markers showed a high level of clustering that appears to be related to certain primer combinations. This linkage map will serve as the basis for mapping a greater number of markers to provide a map with high enough resolution for it to be useful for selective breeding programs using introgression. PMID:14573480
Lanteri, S; Acquadro, A; Comino, C; Mauro, R; Mauromicale, G; Portis, E
2006-05-01
We present the first genetic maps of globe artichoke (Cynara cardunculus var. scolymus L. 2n=2x=34), constructed with a two-way pseudo-testcross strategy. A F1 mapping population of 94 individuals was generated between a late-maturing, non-spiny type and an early-maturing spiny type. The 30 AFLP, 13 M-AFLP and 9 S-SAP primer combinations chosen identified, respectively, 352, 38 and 41 polymorphic markers. Of 32 microsatellite primer pairs tested, 12 identified heterozygous loci in one or other parent, and 7 were fully informative as they segregated in both parents. The female parent map comprised 204 loci, spread over 18 linkage groups and spanned 1330.5 cM with a mean marker density of 6.5 cM. The equivalent figures for the male parent map were 180 loci, 17 linkage groups, 1239.4 and 6.9 cM. About 3% of the AFLP and AFLP-derived markers displayed segregation distortion with a P value below 0.01, and were not used for map construction. All the SSR loci were included in the linkage analysis, although one locus did show some segregation distortion. The presence of 78 markers in common to both maps allowed the alignment of 16 linkage groups. The maps generated provide a firm basis for the mapping of agriculturally relevant traits, which will then open the way for the application of a marker-assisted selection breeding strategy in this species.
Screening interspecific hybrids of Populus (P. ciliata x maximowiczii) using AFLP markers.
Chauhan, N; Negi, M S; Sabharwal, V; Khurana, D K; Lakshmikumaran, M
2004-03-01
Hybrids of Populus ciliata x maximowiczii are very vigorous and outperform both the parents in growth performance and yield. Genetic evaluation of 24 of these interspecific hybrids along with the two mother trees ( Populus ciliata), and five male-parent ( Populus maximowiczii) genotypes was carried out using the AFLP marker assay. Eight AFLP primer combinations detected 428 markers, of which 280 (66%) were polymorphic. Genetic relationships within the samples were evaluated by generating the similarity matrix based on Jaccard's coefficient. The phenetic dendrograms, as well as the PCO plots, separated the hybrids and the two parent species into three distinct clusters. The hybrids grouped closer to the P. ciliata (female parent) cluster as compared to the P. maximowiczii (male parent) cluster. The hybrid cluster contained internal groupings, which correlated to some extent with growth performance. The four best performing hybrids (42m1, 65m1, 23m2, Cm2-5-20/91) formed a distinct sub-cluster. Data from a single primer combination was sufficient for distinguishing the hybrids from the parents and assigning paternity. The hybrids showed 22 markers that were absent in P. ciliata but were monomorphically present in all the hybrids, suggesting outcrossing and common paternity. Further, these 22 markers were found in all the P. maximowiczii genotypes confirming it as the male parent. These male-specific markers can be converted to SCAR markers and used for rapid screening of the P.ciliata x maximowiczii hybrids. The primer combination E-AAC x M-CAA was identified as most suitable for ascertaining true hybridity. AFLP proves to be a useful tool for screening of P. ciliata x maximowiczii hybrids at the early stages of development.
Sabir, Jamal S M; Abo-Aba, Salah; Bafeel, Sameera; Zari, Talal A; Edris, Sherif; Shokry, Ahmed M; Atef, Ahmed; Gadalla, Nour O; Ramadan, Ahmed M; Al-Kordy, Magdy A; El-Domyati, Fotouh M; Jansen, Robert K; Bahieldin, Ahmed
2014-01-01
Date palm is the most economically important plant in the Middle East due to its nutritionally valuable fruit. The development of accurate DNA fingerprints to characterize cultivars and the detection of genetic diversity are of great value for breeding programs. The present study explores the usefulness of ISSR and AFLP molecular markers to detect relationships among 10 date palm (Phoenix dactylifera L.) cultivars from Saudi Arabia. Thirteen ISSR primers and six AFLP primer combinations were examined. The level of polymorphism among cultivars for ISSRs ranged from 20% to 100% with an average of 85%. Polymorphism levels for AFLPs ranged from 63% to 84% with an average of 76%. The total number of cultivar-specific markers was 241, 208 of which were generated from AFLP analysis. AJWA cultivar had the highest number of cultivar-specific ISSR markers, whereas DEK, PER, SUK-Q, SHA and MOS-H cultivars had the lowest. RAB and SHA cultivars had the most and least AFLP cultivar-specific markers, respectively. The highest pairwise similarity indices for ISSRs, AFLPs and combined markers were 84% between DEK (female) and PER (female), 81% between SUK-Q (male) and RAB (male), and 80% between SUK-Q (male) and RAB (male), respectively. The lowest similarity indices were 65% between TAB (female) and SUK-Q (male), 67% between SUK-A (female) and SUK-Q (male), and 67% between SUK-A (female) and SUK-Q (male). Cultivars of the same sex had higher pairwise similarities than those between cultivars of different sex. The Neighbor-Joining (NJ) tree generated from the ISSR dataset was not well resolved and bootstrap support for resolved nodes in the tree was low. AFLP and combined data generated completely resolved trees with high levels of bootstrap support. In conclusion, AFLP and ISSR approaches enabled discrimination among 10 date palm cultivars of from Saudi Arabia, which will provide valuable information for future improvement of this important crop. Copyright © 2013 Académie des
Genetics and phylogeny of genus Coilia in China based on AFLP markers
NASA Astrophysics Data System (ADS)
Yang, Qiaoli; Han, Zhiqiang; Sun, Dianrong; Xie, Songguang; Lin, Longshan; Gao, Tianxiang
2010-07-01
The taxonomy of Coilia has been extensively studied in China, and yet phylogenetic relationships among component taxa remain controversial. We used a PCR-based fingerprinting technique, amplified fragment length polymorphism (AFLP) to characterize and identify all four species of Coilia in China. We examined the genetic relationships of the four species of Coilia and a subspecies of Coilia nasus with AFLP. A total of 180 AFLP loci were generated from six primer combinations, of which 76.11% were polymorphic. The mean genetic distance between pairs of taxa ranged from 0.047 to 0.596. The neighbor-joining tree and UPGMA dendrogram resolved the investigated species into three separate lineages: (1) C. mystus, (2) C. grayii and (3) C. brachygnathus, C. nasus, and C. nasus taihuensis. Phylogenetic analysis of the AFLP data is inconsistent with current morphological taxonomic systems. The AFLP data indicated a close relationship among C. brachygnathus, C. nasus taihuensis, and C. nasus. Therefore, the two species described under Coilia ( C. brachygnathus and C. nasus taihuensis) are treated as synonyms of C. nasus.
NASA Astrophysics Data System (ADS)
Zhou, Wei; Ding, Hongye; Sui, Zhenghong; Wang, Zhongxia; Wang, Jinguo
2014-05-01
The red alga Gracilariopsis lemaneiformis (Bory) is an economically valuable macroalgae. As a means to identify the sex of immature Gracilariopsis lemaneiformis, the amplified fragment length polymorphism (AFLP) technique was used to search for possible sex- or phase-related markers in male gametophytes, female gametophytes, and tetrasporophytes, respectively. Seven AFLP selective amplification primers were used in this study. The primer combination E-TG/M-CCA detected a specific band linked to male gametophytes. The DNA fragment was recovered and a 402-bp fragment was sequenced. However, no DNA sequence match was found in public databases. Sequence characterized amplified region (SCAR) primers were designed from the sequence to test the repeatability of the relationship to the sex, using 69 male gametophytes, 139 female gametophytes, and 47 tetrasporophytes. The test results demonstrate a good linkage and repeatability of the SCAR marker to sex. The SCAR primers developed in this study could reduce the time required for sex identification of Gracilariopsis lemaneiformis by four to six months. This can reduce both the time investment and number of specimens required in breeding experiments.
AFLP analysis of a worldwide collection of Didymella bryoniae.
Kothera, Ronald T; Keinath, Anthony P; Dean, Ralph A; Farnham, Mark W
2003-03-01
Didymella bryoniae (anamorph Phoma cucurbitacearum) is an ascomycete that causes gummy stem blight, a foliar disease that occurs on cucurbits in greenhouses and fields throughout the world. In a previous study using RAPD analysis, little genetic diversity was found among isolates of D. bryoniae from New York and South Carolina, USA. Here we report the use of amplified fragment length polymorphism (AFLP) analysis to assess the genetic variation within a worldwide collection of D. bryoniae, 102 field and greenhouse isolates from ten states in the USA (California, Delaware, Florida, Georgia, Indiana, Maryland, Michigan, Oklahoma, South Carolina, and Texas) and seven other countries (Australia, Canada, China, Greece, Israel, Sweden, and The Netherlands) were examined. Seven different AFLP primer-pair combinations generated 450 bands, of which 134 were polymorphic (30%). Using cluster analysis, two groups and a total of seven subgroups were delineated. Representative isolates varied in their virulence on muskmelon and watermelon seedlings, but the degree of virulence was not strongly associated with AFLP groupings. However, isolates from the northern USA grouped separately from isolates originating from the southern USA.
Monteiro, E R; Strioto, D K; Meirelles, A C S; Mangolin, C A; Machado, M F P S
2015-12-15
Amplified fragment length polymorphism (AFLP) analysis was used to evaluate DNA polymorphism in Pilosocereus gounellei with the aim of differentiating samples grown in different Brazilian semiarid regions. Seven primer pairs were used to amplify 703 AFLP markers, of which 700 (99.21%) markers were polymorphic. The percentage of polymorphic markers ranged from 95.3% for the primer combination E-AAG/M-CTT to 100% for E-ACC/M-CAT, E-ACC/M-CAA, E-AGC/M-CAG, E-ACT/M-CTA, and E-AGG/M-CTG. The largest number of informative markers (126) was detected using the primer combination E-AAC/M-CTA. Polymorphism of the amplified DNA fragments ranged from 72.55% (in sample from Piauí State) to 82.79% (in samples from Rio Grande Norte State), with an average of 75.39%. Despite the high genetic diversity of AFLP markers in xiquexique, analysis using the STRUCTURE software identified relatively homogeneous clusters of xiquexique from the same location, indicating a differentiation at the molecular level, among the plant samples from different regions of the Caatinga biome. The AFLP methodology identified genetically homogeneous and contrasting plants, as well as plants from different regions with common DNA markers. Seeds from such plants can be used for further propagation of plants for establishment of biodiversity conservation units and restoration of degraded areas of the Caatinga biome.
Klein, Patricia E.; Klein, Robert R.; Cartinhour, Samuel W.; Ulanch, Paul E.; Dong, Jianmin; Obert, Jacque A.; Morishige, Daryl T.; Schlueter, Shannon D.; Childs, Kevin L.; Ale, Melissa; Mullet, John E.
2000-01-01
Sorghum is an important target for plant genomic mapping because of its adaptation to harsh environments, diverse germplasm collection, and value for comparing the genomes of grass species such as corn and rice. The construction of an integrated genetic and physical map of the sorghum genome (750 Mbp) is a primary goal of our sorghum genome project. To help accomplish this task, we have developed a new high-throughput PCR-based method for building BAC contigs and locating BAC clones on the sorghum genetic map. This task involved pooling 24,576 sorghum BAC clones (∼4× genome equivalents) in six different matrices to create 184 pools of BAC DNA. DNA fragments from each pool were amplified using amplified fragment length polymorphism (AFLP) technology, resolved on a LI-COR dual-dye DNA sequencing system, and analyzed using Bionumerics software. On average, each set of AFLP primers amplified 28 single-copy DNA markers that were useful for identifying overlapping BAC clones. Data from 32 different AFLP primer combinations identified ∼2400 BACs and ordered ∼700 BAC contigs. Analysis of a sorghum RIL mapping population using the same primer pairs located ∼200 of the BAC contigs on the sorghum genetic map. Restriction endonuclease fingerprinting of the entire collection of sorghum BAC clones was applied to test and extend the contigs constructed using this PCR-based methodology. Analysis of the fingerprint data allowed for the identification of 3366 contigs each containing an average of 5 BACs. BACs in ∼65% of the contigs aligned by AFLP analysis had sufficient overlap to be confirmed by DNA fingerprint analysis. In addition, 30% of the overlapping BACs aligned by AFLP analysis provided information for merging contigs and singletons that could not be joined using fingerprint data alone. Thus, the combination of fingerprinting and AFLP-based contig assembly and mapping provides a reliable, high-throughput method for building an integrated genetic and physical map
Optimization of cDNA-AFLP experiments using genomic sequence data.
Kivioja, Teemu; Arvas, Mikko; Saloheimo, Markku; Penttilä, Merja; Ukkonen, Esko
2005-06-01
cDNA amplified fragment length polymorphism (cDNA-AFLP) is one of the few genome-wide level expression profiling methods capable of finding genes that have not yet been cloned or even predicted from sequence but have interesting expression patterns under the studied conditions. In cDNA-AFLP, a complex cDNA mixture is divided into small subsets using restriction enzymes and selective PCR. A large cDNA-AFLP experiment can require a substantial amount of resources, such as hundreds of PCR amplifications and gel electrophoresis runs, followed by manual cutting of a large number of bands from the gels. Our aim was to test whether this workload can be reduced by rational design of the experiment. We used the available genomic sequence information to optimize cDNA-AFLP experiments beforehand so that as many transcripts as possible could be profiled with a given amount of resources. Optimization of the selection of both restriction enzymes and selective primers for cDNA-AFLP experiments has not been performed previously. The in silico tests performed suggest that substantial amounts of resources can be saved by the optimization of cDNA-AFLP experiments.
Phylogenetic relationships in the genus Leontopodium (Asteraceae: Gnaphalieae) based on AFLP data
SAFER, STEFAN; TREMETSBERGER, KARIN; GUO, YAN-PING; KOHL, GUDRUN; SAMUEL, MARY R.; STUESSY, TOD F.; STUPPNER, HERMANN
2012-01-01
The genus Leontopodium comprises 30–41 species. The centre of diversity is the Sino-Himalayan region in south-western China, where about 15 species occur. The two species native to Europe, L. alpinum (known as the common ‘Edelweiss’) and L. nivale, are part of the cultural heritage of the people living there. Despite its importance, very little is known about the systematics of the genus. Because recent molecular studies have shown that species within this genus are closely related and difficult to distinguish with rDNA and cpDNA data, we used AFLPs to obtain a more detailed understanding of the phylogeny of the genus. Our main aims were as follows: (1) to clarify species relationships within the genus; and (2) to reveal information about the biogeography of the genus. We used AFLPs with six primer combinations to investigate 216 individuals in 38 populations of 16 different species. With AFLPs, we were able to recognize 10 different groups, all of which had strong bootstrap support. These results were also congruent with the morphology-based taxonomy of the genus. Most private and rare fragments were found in the Yunnan region (south-western China) relative to Europe and Mongolia/central China, suggesting a long-lasting in situ history of populations in the centre of diversity of the genus. Our results illustrate the utility of AFLPs to resolve phylogenetic relationships between these closely related species. PMID:23258943
Ipek, M; Seker, M; Ipek, A; Gul, M K
2015-03-31
The purpose of this study was to characterize olive core collection with amplified fragment length polymorphism (AFLP) markers and fruit traits and to determine AFLP markers significantly associated with these fruit characters in olive. A total of 168 polymorphic AFLP markers generated by five primer combinations and nine fruit traits were used to characterize relationships between 18 olive cultivars. Although all olive cultivars were discriminated from each other by either AFLP markers (<0.75 similarity level) or fruit traits, clustering based on the AFLP markers and fruit traits was not significantly correlated (r = 0.13). Partial clustering of olive cultivars by AFLP markers according to their geographical origin was observed. Associations of AFLP markers with fruits were determined using a multiple-regression analysis with stepwise addition of AFLP markers. Significant associations between eight AFLP markers and fruit traits were identified. While five AFLP markers demonstrated significant negative correlation with fruit and stone weight, width and length and total polyphenols (P < 0.05), three AFLP markers displayed significant positive correlation with α-tocopherol and γ-tocopherol (P < 0.01). This is the first report on the association of molecular markers with fruit traits in olive. Molecular markers associated with morphological and agronomic traits could be utilized for the breeding of olive cultivars. However, the association power of these markers needs to be confirmed in larger populations, and highly correlated markers should then be converted to PCR-based DNA markers such as sequence-characterized amplified region markers for better utilization.
Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.
Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis
2018-03-01
Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.
Osman, Magda Abbaker; Dhawan, Sunita Singh; Bahl, Janak Raj; Darokar, Mahendra P; Khanuja, Suman P S
2011-11-01
The level of polymorphism among twelve selected progenies of Gymnema sylvestre was investigated through AFLP markers by multiplexing PCR reactions using 64 (8x8) primer combinations. Fourteen primer combinations were selected as the most suitable combination for G. sylvestre. Analysis of the 12 progenies with these 14 primer pairs produced 1689 fragments of which 972 (57.5%) were polymorphic and 485 (28.7%) were unique to a particular genotype. The number of fragments produced by individual primer pairs was in the range of 55 to 225. Out of these, polymorphic fragments were in the range of 34 (E-ACC/M-CAC) to 157 (E-AGG/M-CAG) and unique bands observed were 8 (E-ACC / M-CAC) to 69 (E-AGG/M-CAC). Different primer combinations detected different levels of polymorphism, ranging from 33% (E-AGG/ M-CAC) to 69.8% (E-AGG/ M-CAC). From the observations, it appears that the primer combinations E-AGG/M-CAC, E-AGG/CTG, E-AGG/CAG and E-ACA/CAT were the most informative for the detection of polymorphism among the progenies compared with others, since they produced a high number of unique fragments. The similarity coefficient ranged from 0.212 to 0.731. High similarity was observed between progeny S8 and S9 (73%) and high divergence between progenies S3 and S11. Among the selected progeny, S9 was found to be the most similar to the parent (63%), while genotype S11 was the most distant (36.9%).
Genetic analysis of floating Enteromorpha prolifera in the Yellow Sea with AFLP marker
NASA Astrophysics Data System (ADS)
Liu, Cui; Zhang, Jing; Sun, Xiaoyu; Li, Jian; Zhang, Xi; Liu, Tao
2011-09-01
Extremely large accumulation of green algae Enteromorpha prolifera floated along China' coastal region of the Yellow Sea ever since the summer of 2008. Amplified Fragment Length Polymorphism (AFLP) analysis was applied to assess the genetic diversity and relationships among E. prolifera samples collected from 9 affected areas of the Yellow Sea. Two hundred reproducible fragments were generated with 8 AFLP primer combinations, of which 194 (97%) were polymorphic. The average Nei's genetic diversity, the coefficiency of genetic differentiation (Gst), and the average gene flow estimated from Gst in the 9 populations were 0.4018, 0.6404 and 0.2807 respectively. Cluster analysis based on the unweighed pair group method with arithmetic averages (UPGMA) showed that the genetic relationships within one population or among different populations were all related to their collecting locations and sampling time. Large genetic differentiation was detected among the populations. The E. prolifera originated from different areas and were undergoing a course of mixing.
Lin, Juan; Gunter, Lee E; Harding, Scott A; Kopp, Richard F; McCord, Rachel P; Tsai, Chung-Jui; Tuskan, Gerald A; Smart, Lawrence B
2007-11-01
Salix matsudana Koidz. cultivar 'Tortuosa' (corkscrew willow) is characterized by extensive stem bending and curling of leaves. To investigate the genetic basis of this trait, controlled crosses were made between a corkscrew female (S. matsudana 'Tortuosa') and a straight-stemmed, wild-type male (Salix alba L. Clone 99010). Seventy-seven seedlings from this family (ID 99270) were grown in the field for phenotypic observation. Among the progeny, 39 had straight stems and leaves and 38 had bent stems and curled leaves, suggesting that a dominant allele at a single locus controls this phenotype. As a first step in characterizing the locus, we searched for amplified fragment length polymorphism (AFLP) and randomly amplified polymorphic DNA (RAPD) markers linked to the tortuosa allele using bulked segregant analysis. Samples of DNA from 10 corkscrew individuals were combined to produce a corkscrew pool, and DNA from 10 straight progeny was combined to make a wild-type pool. Sixty-four AFLP primer combinations and 640 RAPD primers were screened to identify marker bands amplified from the corkscrew parent and progeny pool, but not from the wild-type parent or progeny pool. An AFLP marker and a RAPD marker linked to and flanking the tortuosa locus were placed on a preliminary linkage map constructed based on segregation among the 77 progeny. Sectioning and analysis of shoot tips revealed that the corkscrew phenotype is associated with vascular cell collapse, smaller cell size in regions near the cambium and less developed phloem fibers than in wild-type progeny. Identification of a gene associated with this trait could lead to greater understanding of the control of normal stem development in woody plants.
Flores Berrios, E P; Alba González, J F; Arrizon Gaviño, J P; Romano, P; Capece, A; Gschaedler Mathis, A
2005-01-01
The objectives were to determine the variability and to compare the genetic diversity obtained using amplified fragment length polymorphism (AFLP) markers in analyses of wine, tequila, mezcal, sotol and raicilla yeasts. A molecular characterization of yeasts isolated from Mexican agave musts, has been performed by AFLP marker analysis, using reference wine strains from Italian and South African regions. A direct co-relation between genetic profile, origin and fermentation process of strains was found especially in strains isolated from agave must. In addition, unique molecular markers were obtained for all the strains using six combination primers, confirming the discriminatory power of AFLP markers. This is the first report of molecular characterization between yeasts isolated from different Mexican traditional agave-distilled beverages, which shows high genetic differences with respect to wine strains.
Kageyama, Shinji; Shinmura, Kazuya; Yamamoto, Hiroko; Goto, Masanori; Suzuki, Koichi; Tanioka, Fumihiko; Tsuneyoshi, Toshihiro; Sugimura, Haruhiko
2008-04-01
The PCR-based DNA fingerprinting method called the methylation-sensitive amplified fragment length polymorphism (MS-AFLP) analysis is used for genome-wide scanning of methylation status. In this study, we developed a method of fluorescence-labeled MS-AFLP (FL-MS-AFLP) analysis by applying a fluorescence-labeled primer and fluorescence-detecting electrophoresis apparatus to the existing method of MS-AFLP analysis. The FL-MS-AFLP analysis enables quantitative evaluation of more than 350 random CpG loci per run. It was shown to allow evaluation of the differences in methylation level of blood DNA of gastric cancer patients and evaluation of hypermethylation and hypomethylation in DNA from gastric cancer tissue in comparison with adjacent non-cancerous tissue.
Rathore, Mangal S; Jha, Bhavanath
2016-03-01
The present investigation aimed to evaluate the degree and pattern of DNA methylation using methylation-sensitive AFLP (MS-AFLP) markers in genetically stable in vitro regenerates of Jatropha curcas L.. The genetically stable in vitro regenerates were raised through direct organogenesis via enhanced axillary shoot bud proliferation (Protocol-1) and in vitro-derived leaf regeneration (Protocol-2). Ten selective combinations of MS-AFLP primers produced 462 and 477 MS-AFLP bands in Protocol-1 (P-1) and Protocol-2 (P-2) regenerates, respectively. In P-1 regenerates, 15.8-31.17 % DNA was found methylated with an average of 25.24 %. In P-2 regenerates, 15.93-32.7 % DNA was found methylated with an average of 24.11 %. Using MS-AFLP in P-1 and P-2 regenerates, 11.52-25.53 % and 13.33-25.47 % polymorphism in methylated DNA was reported, respectively. Compared to the mother plant, P-1 regenerates showed hyper-methylation while P-2 showed hypo-methylation. The results clearly indicated alternation in degree and pattern of DNA methylation; hence, epigenetic instability in the genetically stable in vitro regenerates of J. curcas, developed so far using two different regeneration systems and explants of two different origins. The homologous nucleotide fragments in genomes of P-1 and P-2 regenerates showing methylation re-patterning might be involved in immediate adaptive responses and developmental processes through differential regulation of transcriptome under in vitro conditions.
Janeja, H S; Banga, S S; Lakshmikumaran, M
2003-06-01
The tournefortii cytoplasmic male-sterility system is being used as a method of pollination control to develop hybrids in Brassica napus. Genetic analyses have indicated that two dominant genes, one major ( Rft1) and another minor ( Rft2), were required to achieve complete fertility restoration. Though the major gene ( Rft1) can cause complete fertility restoration on its own, its expression was significantly enhanced in the presence of the minor gene ( Rft2). In the absence of Rft1, Rft2 caused only partial fertility restoration. We used a pair of near-isogenic lines (NILs), differing for the presence/absence of Rf genes, to identify AFLP markers linked to fertility restorer genes. A total of 64 EcoRI/ MseI primer combinations were surveyed which produced 3,225 bands, of which 19 (0.006%) were polymorphic between parental NILs. Primer combinations which led to the identification of polymorphic bands present in fertile parental NILs were used for assaying a mapping population of 70 F(2) plants for determining the segregation pattern of markers. Initial screening resulted in the identification of five AFLP markers. The recombination analyses of these AFLP markers revealed that at least two (EACC/MCTT(105), EAAG/MCTC(80)) were present in the same linkage group along with the Rf loci. Marker EACC/MCTT(105) was separated from the major gene ( Rft1) by a distance of 18.1 cM, while it was 33.2 cM away from the minor fertility restorer gene ( Rft2). Another marker EAAG/MCTC(80) was also located adjacent to Rft1 at a distance of 18.1 cM, but on other side. Identification of flanking markers (EACC/MCTT(105), EAAG/MCTC(80)) for the major fertility restorer gene ( Rft1) provides a crucial component for marker-assisted selection and map-based cloning of the restorer genes, and can hence be used to construct elite restorer genotypes.
Improved coverage of cDNA-AFLP by sequential digestion of immobilized cDNA.
Weiberg, Arne; Pöhler, Dirk; Morgenstern, Burkhard; Karlovsky, Petr
2008-10-13
cDNA-AFLP is a transcriptomics technique which does not require prior sequence information and can therefore be used as a gene discovery tool. The method is based on selective amplification of cDNA fragments generated by restriction endonucleases, electrophoretic separation of the products and comparison of the band patterns between treated samples and controls. Unequal distribution of restriction sites used to generate cDNA fragments negatively affects the performance of cDNA-AFLP. Some transcripts are represented by more than one fragment while other escape detection, causing redundancy and reducing the coverage of the analysis, respectively. With the goal of improving the coverage of cDNA-AFLP without increasing its redundancy, we designed a modified cDNA-AFLP protocol. Immobilized cDNA is sequentially digested with several restriction endonucleases and the released DNA fragments are collected in mutually exclusive pools. To investigate the performance of the protocol, software tool MECS (Multiple Enzyme cDNA-AFLP Simulation) was written in Perl. cDNA-AFLP protocols described in the literature and the new sequential digestion protocol were simulated on sets of cDNA sequences from mouse, human and Arabidopsis thaliana. The redundancy and coverage, the total number of PCR reactions, and the average fragment length were calculated for each protocol and cDNA set. Simulation revealed that sequential digestion of immobilized cDNA followed by the partitioning of released fragments into mutually exclusive pools outperformed other cDNA-AFLP protocols in terms of coverage, redundancy, fragment length, and the total number of PCRs. Primers generating 30 to 70 amplicons per PCR provided the highest fraction of electrophoretically distinguishable fragments suitable for normalization. For A. thaliana, human and mice transcriptome, the use of two marking enzymes and three sequentially applied releasing enzymes for each of the marking enzymes is recommended.
Giacomin, Renata M.; Ruas, Paulo M.; Ruas, Eduardo A.; Barbieri, Rosa L.; Rodrigues, Rosana
2018-01-01
Capsicum baccatum is one of the main pepper species grown and consumed in South America. In Brazil, it is commonly cultivated by family farmers, using mostly the genotypes bishop's hat genotypes (locally cambuci) and red chili pepper (dedo-de-moça). This study had the objective of characterizing 116 C. baccatum accessions from different regions of Brazil, based on morphological fruit descriptors and AFLP (Amplified Fragment Length Polymorphisms) markers. Broad phenotypic variability among the C. baccatum accessions was detected when using morphological fruit descriptors. The Ward modified location model (Ward-MLM) discriminated five groups, based mainly on fruit shape. Six combinations of AFLP primers detected polymorphism in 97.93% of the 2466 identified bands, indicating the high genetic variability in the accessions. The UPGMA coincided with the Bayesian clustering analysis and three large groups were formed, separating the wild variety C. baccatum var. praetermissum from the other accessions. There was no relation between genetic distance and geographical origin of the accessions, probably due to the intense exchange of fruits and seeds between farmers. Morphological descriptors used together with AFLP markers proved efficient in detecting the levels of genetic variability among the accessions maintained in the germplasm collections. These results can be used as an additional source of helpful information to be exploited in C. baccatum breeding programs. PMID:29758023
Fumière, Olivier; Dubois, Marc; Grégoire, Dimitrie; Théwis, André; Berben, Gilbert
2003-02-26
The European chicken meat market is characterized by numerous quality marks: "Label de Qualité Wallon" in Belgium, "Label Rouge" in France, denominations of geographical origin, organic agriculture, etc. Most of those certified productions have specifications requiring the use of slow-growing chicken strains. The amplified fragment length polymorphism (AFLP) technique has been used to search molecular markers able to discriminate slow-growing chicken strains from fast-growing ones and to authenticate certified products. Two pairs of restriction enzymes (EcoRI/MseI and EcoRI/TaqI) and 121 selective primer combinations were tested on individual DNA samples from chicken products essentially in carcass form that were ascribed as belonging to either slow- or fast-growing strains. Within the resulting fingerprints, two fragments were identified as type-strains specific markers. One primer combination gives a band (333 bp) that is specific for slow-growing chickens, and another primer pair generates a band (372 bp) that was found to be characteristic of fast-growing chickens. The two markers were isolated, cloned, and sequenced. The effectiveness and the specificity of the two interesting determinants were assessed on individuals of two well-known strains (ISA 657 and Cobb 500) and on commercialized products coming from various origins.
AFLP-based genetic diversity assessment of commercially important tea germplasm in India.
Sharma, R K; Negi, M S; Sharma, S; Bhardwaj, P; Kumar, R; Bhattachrya, E; Tripathi, S B; Vijayan, D; Baruah, A R; Das, S C; Bera, B; Rajkumar, R; Thomas, J; Sud, R K; Muraleedharan, N; Hazarika, M; Lakshmikumaran, M; Raina, S N; Ahuja, P S
2010-08-01
India has a large repository of important tea accessions and, therefore, plays a major role in improving production and quality of tea across the world. Using seven AFLP primer combinations, we analyzed 123 commercially important tea accessions representing major populations in India. The overall genetic similarity recorded was 51%. No significant differences were recorded in average genetic similarity among tea populations cultivated in various geographic regions (northwest 0.60, northeast and south both 0.59). UPGMA cluster analysis grouped the tea accessions according to geographic locations, with a bias toward China or Assam/Cambod types. Cluster analysis results were congruent with principal component analysis. Further, analysis of molecular variance detected a high level of genetic variation (85%) within and limited genetic variation (15%) among the populations, suggesting their origin from a similar genetic pool.
Roy, J K; Lakshmikumaran, M S; Balyan, H S; Gupta, P K
2004-02-01
Data on AFLP (eight primer pairs) and 14 phenotypic traits, collected on 55 elite and exotic bread wheat genotypes, were utilized for estimations of genetic diversity. We earlier used these 55 genotypes for a similar study using SSRs and SAMPL. As many as 615 scorable AFLP bands visualized included 287 (46.6%) polymorphic bands. The phenotypic traits included yield and its component traits, as well as physiomorphological traits like flag leaf area. Dendrograms were prepared using cluster analysis based on Jaccard's similarity coefficients in case of AFLP and on squared Euclidean distances in case of phenotypic traits. PCA was conducted using AFLP data and a PCA plot was prepared, which was compared with clustering patterns in two dendrograms, one each for AFLP and phenotypic traits. The results were also compared with published results that included studies conducted elsewhere using entirely different wheat germplasm and our own SSR and SAMPL studies based on the same 55 genotypes used in the present study. It was shown that molecular markers are superior to phenotypic traits and that AFLP and SAMPL are superior to other molecular markers for estimation of genetic diversity. On the basis of AFLP analysis and keeping in view the yield performance and stability, a pair of genotypes (E3876 and E677) was recommended for hybridization in order to develop superior cultivars.
Ghosh, S; Majumder, P B; Sen Mandi, S
2011-02-08
The Zingiber genus, which includes the herbs known as gingers, commonly used in cooking, is well known for its medicinal properties, as described in the Indian pharmacopoeia. Different members of this genus, although somewhat similar in morphology, differ widely in their pharmacological and therapeutic properties. The most important species of this genus, with maximal therapeutic properties, is Zingiber officinale (garden ginger), which is often adulterated with other less-potent Zingiber sp. There is an existing demand in the herbal drug industry for an authentication system for the Zingiber sp in order to facilitate their commercial use as genuine phytoceuticals. To this end, we used amplified fragment length polymorphism (AFLP) to produce DNA fingerprints for three Zingiber species. Sixteen collections (six of Z. officinale, five of Z. montanum, and five of Z. zerumbet) were used in the study. Seven selective primer pairs were found to be useful for all the accessions. A total of 837 fragments were produced by these primer pairs. Species-specific markers were identified for all three Zingiber species (91 for Z. officinale, 82 for Z. montanum, and 55 for Z. zerumbet). The dendogram analysis generated from AFLP patterns showed that Z. montanum and Z. zerumbet are phylogenetically closer to each other than to Z. officinale. The AFLP fingerprints of the Zingiber species could be used to authenticate Zingiber sp-derived drugs and to resolve adulteration-related problems faced by the commercial users of these herbs.
AFLP analysis of Cynodon dactylon (L.) Pers. var. dactylon genetic variation.
Wu, Y Q; Taliaferro, C M; Bai, G H; Anderson, M P
2004-08-01
Cynodon dactylon (L.) Pers. var. dactylon (common bermudagrass) is geographically widely distributed between about lat 45 degrees N and lat 45 degrees S, penetrating to about lat 53 degrees N in Europe. The extensive variation of morphological and adaptive characteristics of the taxon is substantially documented, but information is lacking on DNA molecular variation in geographically disparate forms. Accordingly, this study was conducted to assess molecular genetic variation and genetic relatedness among 28 C. dactylon var. dactylon accessions originating from 11 countries on 4 continents (Africa, Asia, Australia, and Europe). A fluorescence-labeled amplified fragment length polymorphism (AFLP) DNA profiling method was used to detect the genetic diversity and relatedness. On the basis of 443 polymorphic AFLP fragments from 8 primer combinations, the accessions were grouped into clusters and subclusters associating with their geographic origins. Genetic similarity coefficients (SC) for the 28 accessions ranged from 0.53 to 0.98. Accessions originating from Africa, Australia, Asia, and Europe formed major groupings as indicated by cluster and principal coordinate analysis. Accessions from Australia and Asia, though separately clustered, were relatively closely related and most distantly related to accessions of European origin. African accessions formed two distant clusters and had the greatest variation in genetic relatedness relative to accessions from other geographic regions. Sampling the full extent of genetic variation in C. dactylon var. dactylon would require extensive germplasm collection in the major geographic regions of its distributional range.
Opara, Umezuruike Linus; Jacobson, Dan; Al-Saady, Nadiya Abubakar
2010-01-01
Banana is an important crop grown in Oman and there is a dearth of information on its genetic diversity to assist in crop breeding and improvement programs. This study employed amplified fragment length polymorphism (AFLP) to investigate the genetic variation in local banana cultivars from the southern region of Oman. Using 12 primer combinations, a total of 1094 bands were scored, of which 1012 were polymorphic. Eighty-two unique markers were identified, which revealed the distinct separation of the seven cultivars. The results obtained show that AFLP can be used to differentiate the banana cultivars. Further classification by phylogenetic, hierarchical clustering and principal component analyses showed significant differences between the clusters found with molecular markers and those clusters created by previous studies using morphological analysis. Based on the analytical results, a consensus dendrogram of the banana cultivars is presented. PMID:20443211
Genetic Diversity of Hibiscus tiliaceus (Malvaceae) in China Assessed using AFLP Markers
TANG, TIAN; ZHONG, YANG; JIAN, SHUGUANG; SHI, SUHUA
2003-01-01
Amplified fragment length polymorphism (AFLP) markers were used to investigate the genetic variations within and among nine natural populations of Hibiscus tiliaceus in China. DNA from 145 individuals was amplified with eight primer pairs. No polymorphisms were found among the 20 samples of a marginal population of recent origin probably due to a founder effect. Across the other 125 individuals, 501 of 566 bands (88·5 %) were polymorphic, and 125 unique AFLP phenotypes were observed. Estimates of genetic diversity agreed with life history traits of H. tiliaceus and geographical distribution. AMOVA analysis revealed that most genetic diversity resided within populations (84·8 %), which corresponded to results reported for outcrossing plants. The indirect estimate of gene flow based on ϕST was moderate (Nm = 1·395). Long-distance dispersal of floating seeds and local environments may play an important role in shaping the genetic diversity of the population and the genetic structure of this species. PMID:12930729
Özbek, Özlem; Görgülü, Elçin; Yıldırımlı, Şinasi
2013-12-01
Isatidae L. is a complex and systematically difficult genus in Brassicaceae. The genus displays great morphological polymorphism, which makes the classification of species and subspecies difficult as it is observed in Isatis glauca Aucher ex Boiss. The aim of this study is characterization of the genetic diversity in subspecies of Isatis glauca Aucher ex Boiss. distributed widely in Central Anatolia, in Turkey by using Amplified Fragment Length Polymorphism (AFLP) technique. Eight different Eco RI-Mse I primer combinations produced 805 AFLP loci, 793 (98.5%) of which were polymorphic in 67 accessions representing nine different populations. The data obtained by AFLP was computed with using GDA (Genetic Data Analysis) and STRUCTURE (version 2.3.3) software programs for population genetics. The mean proportion of the polymorphic locus (P), the mean number of alleles (A), the number of unique alleles (U) and the mean value of gene diversity (He) were 0.59, 1.59, 20, and 0.23 respectively. The coancestry coefficient (ϴ) was 0.24. The optimal number of K was identified as seven. The principal component analysis (PCA) explained 85.61% of the total genetic variation. Isatis glauca ssp. populations showed a high level of genetic diversity, and the AFLP analysis revealed that high polymorphism and differentiated subspecies could be used conveniently for population genetic studies. The principal coordinate analysis (PCoA) based on the dissimilarity matrix, the dendrogram drawn with UPGMA method and STRUCTURE cluster analysis distinguished the accessions successfully. The accessions formed distinctive population structures for populations AA, AB, E, K, and S. Populations AG1 and AG2 seemed to have similar genetic content, in addition, in both populations several hybrid individuals were observed. The accessions did not formed distinctive population structures for both populations AI and ANP. Consequently, Ankara province might be the area, where species Isatis glauca Aucher
Zhang, Yuejin; Guo, Lijun; Shu, Zhiming; Sun, Yiyue; Chen, Yuanyuan; Liang, Zongsuo; Guo, Hongbo
2013-01-01
Consistent grain yield in drought environment has attracted wide attention due to global climate change. However, the important drought-related traits/genes in crops have been rarely reported. Many near-isogenic lines (NILs) of male sterile and fertile Salvia miltiorrhiza have been obtained in our previous work through testcross and backcross in continuous field experiments conducted in 2006–2009. Both segregating sterile and fertile populations were subjected to bulked segregant analysis (BSA) and amplified fragment length polymorphism (AFLP) with 384 and 170 primer combinations, respectively. One out of 14 AFLP markers (E9/M3246) was identified in treated fertile population as tightly linked to the drought stress gene with a recombination frequency of 6.98% and at a distance of 7.02 cM. One of 15 other markers (E2/M5357) was identified in a treated sterile population that is closely associated with the drought stress gene. It had a recombination frequency of 4.65% and at a distance of 4.66 cM. Interestingly, the E9/M3246 fragment was found to be identical to another AFLP fragment E11/M4208 that was tightly linked to the male sterile gene of S. miltiorrhiza with 95% identity and e-value 4 × 10−93. Blastn analysis suggested that the drought stress gene sequence showed higher identity with nucleotides in Arabidopsis chromosome 1–5. PMID:23525049
Yamamoto, F; Yamamoto, M
2004-07-01
We previously developed a PCR-based DNA fingerprinting technique named the Methylation Sensitive (MS)-AFLP method, which permits comparative genome-wide scanning of methylation status with a manageable number of fingerprinting experiments. The technique uses the methylation sensitive restriction enzyme NotI in the context of the existing Amplified Fragment Length Polymorphism (AFLP) method. Here we report the successful conversion of this gel electrophoresis-based DNA fingerprinting technique into a DNA microarray hybridization technique (DNA Microarray MS-AFLP). By performing a total of 30 (15 x 2 reciprocal labeling) DNA Microarray MS-AFLP hybridization experiments on genomic DNA from two breast and three prostate cancer cell lines in all pairwise combinations, and Southern hybridization experiments using more than 100 different probes, we have demonstrated that the DNA Microarray MS-AFLP is a reliable method for genetic and epigenetic analyses. No statistically significant differences were observed in the number of differences between the breast-prostate hybridization experiments and the breast-breast or prostate-prostate comparisons.
Chromosomal assignment of ALFP markers in upland cotton (Gossypium hirsutum L.)
USDA-ARS?s Scientific Manuscript database
In this research, we used two sets of cotton aneuploid (G. hirsutum × G. tomentosum and G. hirsutum × G. barbadense) plants to locate AFLP markers to chromosome using deletion analysis method. Thirty-eight primer combinations were used to generate 608 polymorphic AFLP markers. Ninety-eight AFLP mark...
Kutlunina, N A; Polezhaeva, M A; Permiakova, M V
2013-04-01
In populations of four species of tulips, (Tulipa biebersteiniana, T. patens, T. scytica and T. riparia) from the Volgograd, Kurgansk, Orenburg, and Chelyabinsk regions and the Republic of Bashkortostan, genetic diversity was studied by means of morphological and AFLP analysis. A morphological analysis of seven quantitative and two qualitative criteria was carried out. Three selective EcoRI/MseI primer pairs allowed one to genotype 81 individuals from 13 tulip populations with 87 loci. The low level of variability by AFLP loci were revealed in all species, including T. biebersteiniana (P = 20.41%, UH(e) = 0.075), T. patens (26.97%, 0.082), T. scytica (27.53%, 0.086), and T. riparia (27.72%, 0.096). According to the AMOVA results, the variability proportion that characterizes the differences between the four Tulip species was lower (F(CT) = 0.235) than between populations within species (F(ST) = 0.439). Tulipa patens is well differentiated by means of Nei's distances, coordination, and analysis in the STRUCTURE program. An analysis in the STRUCTURE revealed four genetic groups of tulips that are not completely in accordance with the analyzed species. This acknowledges the presence of complicated genetic process in the tulip population.
Genetic Comparison of B. Anthracis and its Close Relatives Using AFLP and PCR Analysis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jackson, P.J.; Hill, K.K.; Laker, M.T.
1999-02-01
cannot be rapidly generated by other means. AFLP sample analysis quickly generates a very large amount of molecular information about microbial genomes. However, this information cannot be analyzed rapidly using manual methods. The authors are developing a large archive of electronic AFLP signatures that is being used to identify isolates collected from medical, veterinary, forensic and environmental samples. They are also developing the computational packages necessary to rapidly and unambiguously analyze the AFLP profiles and conduct a phylogenetic comparison of these data relative to information already in the database. They will use this archive and the associated algorithms to determine the species identity of previously uncharacterized isolates and place them phylogenetically relative to other microbes based on their AFLP signatures. This study provides significant new information about microbes with environmental, veterinary and medical significance. This information can be used in further studies to understand the relationships among these species and the factors that distinguish them from one another. It should also allow identification of unique factors that contribute to important microbial traits including pathogenicity and virulence. They are also using AFLP data to identify, isolate and sequence DNA fragments that are unique to particular microbial species and strains. The fragment patterns and sequence information provide insights into the complexity and organization of bacterial genomes relative to one another. They also provide the information necessary for development of species-specific PCR primers that can be used to interrogate complex samples for the presence of B. anthracis, other microbial pathogens or their remnants.« less
Jérôme, Marc; Macé, Sabrina; Dousset, Xavier; Pot, Bruno; Joffraud, Jean-Jacques
2016-01-18
An accurate amplified fragment length polymorphism (AFLP) method, including three primer sets for the selective amplification step, was developed to display the phylogenetic position of Photobacterium isolates collected from salmon products. This method was efficient for discriminating the three species Photobacterium phosphoreum, Photobacterium iliopiscarium and Photobacterium kishitanii, until now indistinctly gathered in the P. phosphoreum species group known to be strongly responsible for seafood spoilage. The AFLP fingerprints enabled the isolates to be separated into two main clusters that, according to the type strains, were assigned to the two species P. phosphoreum and P. iliopiscarium. P. kishitanii was not found in the collection. The accuracy of the method was validated by using gyrB-gene sequencing and luxA-gene PCR amplification, which confirmed the species delineation. Most of the isolates of each species were clonally distinct and even those that were isolated from the same source showed some diversity. Moreover, this AFLP method may be an excellent tool for genotyping isolates in bacterial communities and for clarifying our knowledge of the role of the different members of the Photobacterium species group in seafood spoilage. Copyright © 2015 Elsevier B.V. All rights reserved.
Sorkheh, Karim; Masaeli, Mohammad; Chaleshtori, Maryam Hosseini; Adugna, Asfaw; Ercisli, Sezai
2016-04-01
Analysis of the genetic diversity and population structure of crops is very important for use in breeding programs and for genetic resources conservation. We analyzed the genetic diversity and population structure of 47 rice genotypes from diverse origins using amplified fragment length polymorphism (AFLP) markers and morphological characters. The 47 genotypes, which were composed of four populations: Iranian native varieties, Iranian improved varieties, International Rice Research Institute (IRRI) rice varieties, and world rice collections, were analyzed using ten primer combinations. A total of 221 scorable bands were produced with an average of 22.1 alleles per pair of primers, of which 120 (54.30%) were polymorphic. The polymorphism information content (PIC) values varied from 0.32 to 0.41 with an average of 0.35. The high percentage of polymorphic bands (%PB) was found to be 64.71 and the resolving power (R p) collections were 63.36. UPGMA clustering based on numerical data from AFLP patterns clustered all 47 genotypes into three large groups. The genetic similarity between individuals ranged from 0.54 to 0.94 with an average of 0.74. Population genetic tree showed that Iranian native cultivars formed far distant cluster from the other populations, which may indicate that these varieties had minimal genetic change over time. Analysis of molecular variance (AMOVA) revealed that the largest proportion of the variation (84%) to be within populations showing the inbreeding nature of rice. Therefore, Iranian native varieties (landraces) may have unique genes, which can be used for future breeding programs and there is a need to conserve this unique diversity. Furthermore, crossing of Iranian genotypes with the genetically distant genotypes in the other three populations may result in useful combinations, which can be used as varieties and/or lines for future rice breeding programs.
AFLP analysis of genetic diversity and phylogenetic relationships of Brassica oleracea in Ireland.
El-Esawi, Mohamed A; Germaine, Kieran; Bourke, Paula; Malone, Renee
2016-01-01
Brassica oleracea L. is one of the most economically important vegetable crop species of the genus Brassica L. This species is threatened in Ireland, without any prior reported genetic studies. The use of this species is being very limited due to its imprecise phylogeny and uncompleted genetic characterisation. The main objective of this study was to assess the genetic diversity and phylogenetic relationships of a set of 25 Irish B. oleracea accessions using the powerful amplified fragment length polymorphism (AFLP) technique. A total of 471 fragments were scored across all the 11 AFLP primer sets used, out of which 423 (89.8%) were polymorphic and could differentiate the accessions analysed. The dendrogram showed that cauliflowers were more closely related to cabbages than kales were, and accessions of some cabbage types were distributed among different clusters within cabbage subgroups. Approximately 33.7% of the total genetic variation was found among accessions, and 66.3% of the variation resided within accessions. The total genetic diversity (HT) and the intra-accessional genetic diversity (HS) were 0.251 and 0.156, respectively. This high level of variation demonstrates that the Irish B. oleracea accessions studied should be managed and conserved for future utilisation and exploitation in food and agriculture. In conclusion, this study addressed important phylogenetic questions within this species, and provided a new insight into the inclusion of four accessions of cabbages and kales in future breeding programs for improving varieties. AFLP markers were efficient for assessing genetic diversity and phylogenetic relationships in Irish B. oleracea species. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.
Kaya, Hilal Betul; Cetin, Oznur; Kaya, Hulya; Sahin, Mustafa; Sefer, Filiz; Kahraman, Abdullah; Tanyolac, Bahattin
2013-01-01
Background The olive tree (Olea europaea L.) is a diploid (2n = 2x = 46) outcrossing species mainly grown in the Mediterranean area, where it is the most important oil-producing crop. Because of its economic, cultural and ecological importance, various DNA markers have been used in the olive to characterize and elucidate homonyms, synonyms and unknown accessions. However, a comprehensive characterization and a full sequence of its transcriptome are unavailable, leading to the importance of an efficient large-scale single nucleotide polymorphism (SNP) discovery in olive. The objectives of this study were (1) to discover olive SNPs using next-generation sequencing and to identify SNP primers for cultivar identification and (2) to characterize 96 olive genotypes originating from different regions of Turkey. Methodology/Principal Findings Next-generation sequencing technology was used with five distinct olive genotypes and generated cDNA, producing 126,542,413 reads using an Illumina Genome Analyzer IIx. Following quality and size trimming, the high-quality reads were assembled into 22,052 contigs with an average length of 1,321 bases and 45 singletons. The SNPs were filtered and 2,987 high-quality putative SNP primers were identified. The assembled sequences and singletons were subjected to BLAST similarity searches and annotated with a Gene Ontology identifier. To identify the 96 olive genotypes, these SNP primers were applied to the genotypes in combination with amplified fragment length polymorphism (AFLP) and simple sequence repeats (SSR) markers. Conclusions/Significance This study marks the highest number of SNP markers discovered to date from olive genotypes using transcriptome sequencing. The developed SNP markers will provide a useful source for molecular genetic studies, such as genetic diversity and characterization, high density quantitative trait locus (QTL) analysis, association mapping and map-based gene cloning in the olive. High levels of
Gilbert (nee Stoker), G.; Garton, S.; Karam, A.; Arnold, M.; Karp, A.; Edwards, J.; Cooke, T.; Barker, A.
2002-05-01
Genetic diversity in 38 genotypes, representing 28 individual genotypes from five landraces of Isatis tinctoria (three German: Tubingen, Potsdam and Erfurt, one Swiss and one English), five genotypes of Isatis indigotica (Chinese woad) and five genotypes of Isatis glauca, were investigated using AFLP analysis. Five primer combinations detected a total of 502 fragments of which 436 (86.9%) were polymorphic. The level of polymorphism recorded within each species was 29.8, 86.9 and 35.8% for I. indigotica, I. tinctoria and I. glauca, respectively. Clearly, genetic diversity within I. tinctoria was greater than that observed in I. indigotica or I. glauca. Cluster analyses of the AFLP data using UPGMA and PCO revealed the complete separation of the genotypes of each species into distinct groups. I. indigotica separated as an entirely independent group, whereas I. glauca formed a separate cluster within the I. tinctoria group. Indeed, I. tinctoria and I. glauca are more closely related to each other than either is to I. indigotica. In addition, the genotypes of each landrace, apart from one from the English group, were clearly discriminated. However, the anomalous genotype did associate with the rest of its group when it was linked with the Erfurt group. These results provide new and useful information about the make-up of the Isatis genome, which has not previously been evaluated. They will be useful in the selection of plant material for variety development and conservation of the gene-pool.
Lazzi, Camilla; Bove, Claudio Giorgio; Sgarbi, Elisa; Gatti, Monica; Monica, Gatti; La Gioia, Federica; Torriani, Sandra; Sandra, Torriani; Neviani, Erasmo
2009-10-01
Streptococcus thermophilus is a lactic acid bacteria (LAB) widely used in milk fermentation processes as a starter culture. In this work the genetic diversity of S. thermophilus isolates from different sources was analyzed using Amplified Fragment Length Polymorphism fingerprinting (AFLP). Since this is the first report that indicates the application of AFLP in order to study genotypic polymorphism in S. thermophilus species, an optimization of experimental conditions was carried out to decide the optimal AFLP analysis protocol. Furthermore the fingerprinting resolutions of AFLP and RAPD (Random Amplified Polymorphic DNA) were evaluated and compared. The overall data suggest that genotypic characterization performed by AFLP provide a better view of microbial diversity of S. thermophilus, indicating that RAPD is less discriminating than AFLP. The successful use of AFLP analysis in the characterization of S. thermophilus strains reported in this study suggests the potential uses for this technique to define the whole-genome diversity of each specific strain, as an alternative to the fingerprinting methods used till now.
Zou, Keshu; Zhang, Dianchang; Guo, Huayang; Zhu, Caiyan; Li, Min; Jiang, Shigui
2014-05-25
Pearl oyster Pinctada fucata is widely cultured to produce seawater pearl in South China, and the quality of pearl is significantly affected by its shell color. Thus the Pearl Oyster Selective Breeding Program (POSBP) was carried out for the shell color and growth traits. The black (B), gold (G), red (R) and white (W) shell strains with fast growth trait were achieved after five successive generation selection. In this study, AFLP technique was used to scan genome of four strains with different shell colors to identify the candidate markers under artificial selection. Eight AFLP primer combinations were screened and yielded 688 loci, 676 (98.26%) of which were polymorphic. In black, gold, red and white strains, the percentage of polymorphic loci was 90.41%, 87.79%, 93.60% and 93.31%, respectively, Nei's gene diversity was 0.3225, 0.2829, 0.3221 and 0.3292, Shannon's information index was 0.4801, 0.4271, 0.4825 and 0.4923, and the value of FST was 0.1805. These results suggested that the four different shell color strains had high genetic diversity and great genetic differentiation among strains, which had been subjected to the continuous selective pressures during the artificial selective breeding. Furthermore, six outlier loci were considered as the candidate markers under artificial selection for shell color. This study provides a molecular evidence for the inheritance of shell color of P. fucata. Copyright © 2014 Elsevier B.V. All rights reserved.
Aiba, Toshiki; Saito, Toshiyuki; Hayashi, Akiko; Sato, Shinji; Yunokawa, Harunobu; Maruyama, Toru; Fujibuchi, Wataru; Kurita, Hisaka; Tohyama, Chiharu; Ohsako, Seiichiroh
2017-03-09
It has been pointed out that environmental factors or chemicals can cause diseases that are developmental in origin. To detect abnormal epigenetic alterations in DNA methylation, convenient and cost-effective methods are required for such research, in which multiple samples are processed simultaneously. We here present methylated site display (MSD), a unique technique for the preparation of DNA libraries. By combining it with amplified fragment length polymorphism (AFLP) analysis, we developed a new method, MSD-AFLP. Methylated site display libraries consist of only DNAs derived from DNA fragments that are CpG methylated at the 5' end in the original genomic DNA sample. To test the effectiveness of this method, CpG methylation levels in liver, kidney, and hippocampal tissues of mice were compared to examine if MSD-AFLP can detect subtle differences in the levels of tissue-specific differentially methylated CpGs. As a result, many CpG sites suspected to be tissue-specific differentially methylated were detected. Nucleotide sequences adjacent to these methyl-CpG sites were identified and we determined the methylation level by methylation-sensitive restriction endonuclease (MSRE)-PCR analysis to confirm the accuracy of AFLP analysis. The differences of the methylation level among tissues were almost identical among these methods. By MSD-AFLP analysis, we detected many CpGs showing less than 5% statistically significant tissue-specific difference and less than 10% degree of variability. Additionally, MSD-AFLP analysis could be used to identify CpG methylation sites in other organisms including humans. MSD-AFLP analysis can potentially be used to measure slight changes in CpG methylation level. Regarding the remarkable precision, sensitivity, and throughput of MSD-AFLP analysis studies, this method will be advantageous in a variety of epigenetics-based research.
AFLP and MS-AFLP Analysis of the Variation within Saffron Crocus (Crocus sativus L.) Germplasm
Busconi, Matteo; Colli, Licia; Sánchez, Rosa Ana; Santaella, Marcela; De-Los-Mozos Pascual, Marcelino; Santana, Omar; Roldán, Marta; Fernández, José-Antonio
2015-01-01
The presence and extent of genetic variation in saffron crocus are still debated, as testified by several contradictory articles providing contrasting results about the monomorphism or less of the species. Remarkably, phenotypic variations have been frequently observed in the field, such variations are usually unstable and can change from one growing season to another. Considering that gene expression can be influenced both by genetic and epigenetic changes, epigenetics could be a plausible cause of the alternative phenotypes. In order to obtain new insights into this issue, we carried out a molecular marker analysis of 112 accessions from the World Saffron and Crocus Collection. The accessions were grown for at least three years in the same open field conditions. The same samples were analysed using Amplified Fragment Length Polymorphism (AFLP) and Methyl Sensitive AFLP in order to search for variation at the genetic (DNA sequence) and epigenetic (cytosine methylation) level. While the genetic variability was low (4.23% polymorphic peaks and twelve (12) effective different genotypes), the methyl sensitive analysis showed the presence of high epigenetic variability (33.57% polymorphic peaks and twenty eight (28) different effective epigenotypes). The pattern obtained by Factorial Correspondence Analysis of AFLP and, in particular, of MS-AFLP data was consistent with the geographical provenance of the accessions. Very interestingly, by focusing on Spanish accessions, it was observed that the distribution of the accessions in the Factorial Correspondence Analysis is not random but tends to reflect the geographical origin. Two clearly defined clusters grouping accessions from the West (Toledo and Ciudad Real) and accessions from the East (Cuenca and Teruel) were clearly recognised. PMID:25885113
Vašek, Jakub; Viehmannová, Iva; Ocelák, Martin; Cachique Huansi, Danter; Vejl, Pavel
2017-01-01
An analysis of the population structure and genetic diversity for any organism often depends on one or more molecular marker techniques. Nonetheless, these techniques are not absolutely reliable because of various sources of errors arising during the genotyping process. Thus, a complex analysis of genotyping error was carried out with the AFLP method in 169 samples of the oil seed plant Plukenetia volubilis L. from small isolated subpopulations in the Peruvian Amazon. Samples were collected in nine localities from the region of San Martin. Analysis was done in eight datasets with a genotyping error from 0 to 5%. Using eleven primer combinations, 102 to 275 markers were obtained according to the dataset. It was found that it is only possible to obtain the most reliable and robust results through a multiple-level filtering process. Genotyping error and software set up influence both the estimation of population structure and genetic diversity, where in our case population number (K) varied between 2–9 depending on the dataset and statistical method used. Surprisingly, discrepancies in K number were caused more by statistical approaches than by genotyping errors themselves. However, for estimation of genetic diversity, the degree of genotyping error was critical because descriptive parameters (He, FST, PLP 5%) varied substantially (by at least 25%). Due to low gene flow, P. volubilis mostly consists of small isolated subpopulations (ΦPT = 0.252–0.323) with some degree of admixture given by socio-economic connectivity among the sites; a direct link between the genetic and geographic distances was not confirmed. The study illustrates the successful application of AFLP to infer genetic structure in non-model plants. PMID:28910307
An AFLP genetic linkage map of pacific abalone ( Haliotis discus hannai)
NASA Astrophysics Data System (ADS)
Qi, Li; Yanhong, Xu; Ruihai, Yu; Akihiro, Kijima
2007-07-01
A genetic linkage map of Pacific abalone ( Haliotis discus hannai) was constructed using AFLP markers based on a two-way pseudo-testeross strategy in a full-sib family. With 33 primer combinations, a total of 455 markers (225 from the female parent and 230 from the male parent) segregated in a 1:1 ratio, corresponding to DNA polymorphism: heterozygous in one parent and null in the other. The female framework map consisted of 174 markers distributed in 18 linkage groups, equivalent to the H. discus hannai haploid chromosome number, and spanning a total length of 2031.4 cM, with an average interval of 13.0 cM between adjacent markers. The male framework map consisted of 195 markers mapped on 19 linkage groups, spanning a total length of 2273.4 cM, with an average spacing of 12.9 cM between adjacent markers. The estimated coverage for the framework linkage maps was 81.2% for the female and 82.1% for the male, on the basis of two estimates of genome length. Fifty-two markers (11.4%) remained unlinked. The level of segregation distortion observed in this cross was 20.4%. These linkage maps will serve as a starting point for linkage studies in the Pacific abalone with potential application for marker-assisted selection in breeding programs.
Herrera, S.; Cabrera, R.; Ramirez, M. M.; Usera, M. A.; Echeita, M. A.
2002-01-01
Shigella flexneri infections are one of the main causes of acute diarrhoea in Cuba. Twenty strains isolated from sporadic cases in nine different Cuban provinces were characterized. Serotyping, antibiotic-resistance typing, plasmid-typing and AFLP-typing were used to determine their suitability for use in epidemiological studies of S. flexneri. The predominant serotypes were serotype 6 (35%) and serotype 2 (35%). Eleven different plasmid profiles were detected (Diversity Index = 0.92). AFLP-typing discriminated 12 different patterns (DI = 0.95), these patterns were not coincident with plasmid-typing patterns. Both techniques combined distinguished 14 patterns among the 20 studied strains (DI = 0.99). There was no consistent relationship between plasmid-typing and AFLP-typing patterns or antibiotic-resistance typing patterns. Ninety-five percent of S. flexneri strains were multiresistant. PMID:12558326
Amini, Saeed; Maali-Amiri, Reza; Mohammadi, Rahmat; Kazemi-Shahandashti, Seyyedeh-Sanam
2017-02-01
We evaluated the effect of TiO 2 nanoparticles (NPs) on cold tolerance (CT) development in two chickpea (Cicer arietinum L.) genotypes (Sel96Th11439, cold tolerant, and ILC533, cold susceptible) by using cDNA-amplified fragment length polymorphism (cDNA-AFLP) technique during the first and sixth days of cold stress (CS) at 4 °C. Selective amplification by primer combinations generated 4200 transcript-derived fragments (TDFs) while 100 of them (2.62%) were differentially expressed. During CS, 60 differentially expressed TDFs of TiO 2 NPs-treated plants were cloned and 10 of them produced successfully readable sequences. These data represented different groups of genes involved in metabolism pathways, cellular defense, cell connections and signaling, transcriptional regulation and chromatin architecture. Two out of 10 TDFs were unknown genes with uncharacterized functions or sequences without homology to known ones. The network-based analysis showed a gene-gene relationship in response to CS. Quantitative reverse-transcriptase polymerase chain reaction (qPCR) confirmed differential expression of identified genes (six out of 10 TDFs) with potential functions in CT and showed similar patterns with cDNA-AFLP results. An increase in transcription level of these TDFs, particularly on the first day of CS, was crucial for developing CT through decreasing electrolyte leakage index (ELI) content in tolerant plants compared to susceptible ones, as well as in TiO 2 NPs-treated plants compared to control ones. It could also indicate probable role of TiO 2 NPs against CS-induced oxidative stress. Therefore, a new application of TiO 2 NPs in CT development is suggested for preventing or controlling the damages in field conditions and increasing crop productivity. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
2012-01-01
Background Buckwheat, consisting of two cultivated species Fagopyrum tataricum and F. esculentum, is the richest source of flavonoid rutin. Vegetative tissues of both the Fagopyrum species contain almost similar amount of rutin; however, rutin content in seed of F. tataricum are ~50 folds of that in seed of F. esculentum. In order to understand the molecular basis of high rutin content in F. tataricum, differential transcript profiling through cDNA-AFLP has been utilized to decipher what genetic factors in addition to flavonoid structural genes contribute to high rutin content of F. tataricum compared to F. esculentum. Results Differential transcript profiling through cDNA-AFLP in seed maturing stages (inflorescence to seed maturation) with 32 primer combinations generated total of 509 transcript fragments (TDFs). 167 TDFs were then eluted, cloned and sequenced from F. tataricum and F. esculentum. Categorization of TDFs on the basis of their presence/absence (qualitative variation) or differences in the amount of expression (quantitative variation) between both the Fagopyrum species showed that majority of variants are quantitative (64%). The TDFs represented genes controlling different biological processes such as basic and secondary metabolism (33%), regulation (18%), signal transduction (14%), transportation (13%), cellular organization (10%), and photosynthesis & energy (4%). Most of the TDFs except belonging to cellular metabolism showed relatively higher transcript abundance in F. tataricum over F. esculentum. Quantitative RT-PCR analysis of nine TDFs representing genes involved in regulation, metabolism, signaling and transport of secondary metabolites showed that all the tested nine TDFs (Ubiquitin protein ligase, ABC transporter, sugar transporter) except MYB 118 showed significantly higher expression in early seed formation stage (S7) of F. tataricum compared to F. esculentum. qRT-PCR results were found to be consistent with the cDNA-AFLP results
Genetic analyses of captive Alala (Corvus hawaiiensis) using AFLP analyses
Jarvi, Susan I.; Bianchi, Kiara R.
2006-01-01
Population level studies of genetic diversity can provide information about population structure, individual genetic distinctiveness and former population size. They are especially important for rare and threatened species like the Alala, where they can be used to assess extinction risks and evolutionary potential. In an ideal situation multiple methods should be used to detect variation, and these methods should be comparable across studies. In this report, we discuss AFLP (Amplified Fragment Length Polymorphism) as a genetic approach for detecting variation in the Alala , describe our findings, and discuss these in relation to mtDNA and microsatellite data reported elsewhere in this same population. AFLP is a technique for DNA fingerprinting that has wide applications. Because little or no prior knowledge of the particular species is required to carry out this method of analysis, AFLP can be used universally across varied taxonomic groups. Within individuals, estimates of diversity or heterozygosity across genomes may be complex because levels of diversity differ between and among genes. One of the more traditional methods of estimating diversity employs the use of codominant markers such as microsatellites. Codominant markers detect each allele at a locus independently. Hence, one can readily distinguish heterozygotes from homozygotes, directly assess allele frequencies and calculate other population level statistics. Dominant markers (for example, AFLP) are scored as either present or absent (null) so heterozygotes cannot be directly distinguished from homozygotes. However, the presence or absence data can be converted to expected heterozygosity estimates which are comparable to those determined by codominant markers. High allelic diversity and heterozygosity inherent in microsatellites make them excellent tools for studies of wild populations and they have been used extensively. One limitation to the use of microsatellites is that heterozygosity estimates are
Wang, Jianshu; Wang, Xuemin; Yuan, Bohua; Qiang, Sheng
2013-01-01
Gene expression profiles of Digitaria sanguinalis infected by Curvularia eragrostidis strain QZ-2000 at two concentrations of conidia and two dew durations were analyzed by cDNA amplified fragment length polymorphisms (cDNA-AFLP). Inoculum strength was more determinant of gene expression than dew duration. A total of 256 primer combinations were used for selective amplification and 1214 transcript-derived fragments (TDFs) were selected for their differential expression. Of these, 518 up-regulated differentially expressed TDFs were identified. Forty-six differential cDNA fragments were chosen to be cloned and 35 of them were successfully cloned and sequenced, of which 25 were homologous to genes of known function according to the GenBank database. Only 6 genes were up-regulated in Curvularia eragrostidis-inoculated D. sanguinalis, with functions involved in signal transduction, energy metabolism, cell growth and development, stress responses, abscisic acid biosynthesis and response. It appears that a few pathways may be important parts of the pathogenic strategy of C. eragrostidis strain QZ-2000 on D. sanguinalis. Our study provides the fundamentals to further study the pathogenic mechanism, screen for optimal C. eragrostidis strains as potential mycoherbicide and apply this product to control D. sanguinalis.
Wang, Xiaojie; Tang, Chunlei; Zhang, Gang; Li, Yingchun; Wang, Chenfang; Liu, Bo; Qu, Zhipeng; Zhao, Jie; Han, Qingmei; Huang, Lili; Chen, Xianming; Kang, Zhensheng
2009-01-01
Background Puccinia striiformis f. sp. tritici is a fungal pathogen causing stripe rust, one of the most important wheat diseases worldwide. The fungus is strictly biotrophic and thus, completely dependent on living host cells for its reproduction, which makes it difficult to study genes of the pathogen. In spite of its economic importance, little is known about the molecular basis of compatible interaction between the pathogen and wheat host. In this study, we identified wheat and P. striiformis genes associated with the infection process by conducting a large-scale transcriptomic analysis using cDNA-AFLP. Results Of the total 54,912 transcript derived fragments (TDFs) obtained using cDNA-AFLP with 64 primer pairs, 2,306 (4.2%) displayed altered expression patterns after inoculation, of which 966 showed up-regulated and 1,340 down-regulated. 186 TDFs produced reliable sequences after sequencing of 208 TDFs selected, of which 74 (40%) had known functions through BLAST searching the GenBank database. Majority of the latter group had predicted gene products involved in energy (13%), signal transduction (5.4%), disease/defence (5.9%) and metabolism (5% of the sequenced TDFs). BLAST searching of the wheat stem rust fungus genome database identified 18 TDFs possibly from the stripe rust pathogen, of which 9 were validated of the pathogen origin using PCR-based assays followed by sequencing confirmation. Of the 186 reliable TDFs, 29 homologous to genes known to play a role in disease/defense, signal transduction or uncharacterized genes were further selected for validation of cDNA-AFLP expression patterns using qRT-PCR analyses. Results confirmed the altered expression patterns of 28 (96.5%) genes revealed by the cDNA-AFLP technique. Conclusion The results show that cDNA-AFLP is a reliable technique for studying expression patterns of genes involved in the wheat-stripe rust interactions. Genes involved in compatible interactions between wheat and the stripe rust pathogen
DNA damage and genetic methylation changes caused by Cd in Arabidopsis thaliana seedlings.
Li, Zhaoling; Liu, Zhihong; Chen, Ruijuan; Li, Xiaojun; Tai, Peidong; Gong, Zongqiang; Jia, Chunyun; Liu, Wan
2015-09-01
Amplified fragment length polymorphism (AFLP) and methylation-sensitive amplification polymorphism (MASP) techniques are sensitive to deoxyribonucleic acid (DNA) damage and genetic methylation, respectively. Using these 2 techniques, Arabidopsis thaliana cultured with 0 mg/L (control), 0.5 mg/L, 1.5 mg/L, and 5.0 mg/L Cd(2+) for 16 d was used to analyze the DNA damage and methylation changes as a result of cadmium (Cd). The DNA was amplified by 14 AFLP primer pairs and 13 MSAP primer combinations. In the AFLP experiment, 62 polymorphic sites were found in the patterns of 11 primer combinations and a total of 1116 fragments were obtained in these patterns. There were no polymorphic bands in the remaining 3 pairs. The proportions of polymorphic sites in the 0.5-mg/L Cd(2+) and 5.0-mg/L Cd(2+) treatments were significantly different. Seven polymorphic fragments were then separated and successfully sequenced, yielding 6 nucleobase substitutions and 1 nucleobase deletion. Similarly, in the MSAP experiment, the MSAP% and number of demethylated-type bands were unchanged after Cd treatment, but the number of methylated-type bands was increased significantly in the 5.0-mg/L Cd(2+) treatment group, a finding that may be associated with the AFLP results. The polymorphic bands were also sequenced and the functions of their homologous genes were determined. The DNA damage and methylation changes may be the primary cause of certain pathology changes as a result of Cd uptake in plants. © 2015 SETAC.
Galaktionov, N K; Podgornaya, O I; Strelkov, P P; Galaktionov, K V
2016-12-01
The aim of this study was to reveal genomic diversity formed during parthenogenetic reproduction of rediae of the trematode Himasthla elongata in its molluskan host Littorina littorea. We applied amplification fragment length polymorphism (AFLP) to determine the genomic diversity of individual cercariae within the clone, that is, the infrapopulation of parthenogenetic progeny in a single molluskan host. The level of genomic diversity of particular cercariae isolates from a single clone, detected with EcoR1/Mse1 AFLP reaction, was significantly lower than the variability of cercariae from different clones. The presence of intraclonal genomic diversity indicates a nonsexual shuffle of alleles during parthenogenesis in the rediae of H. elongata. The obtained polymorphic AFLP fragments were long enough to detect the sequences that may be responsible for clonal genomic variability. Based on this, AFLP can be recommended as a tool for the study of genetic mechanisms of this variability.
Genetic diversity of populations and clones of Rhopilema esculentum in China based on AFLP analysis
NASA Astrophysics Data System (ADS)
Qiao, Hongjin; Liu, Xiangquan; Zhang, Xijia; Jiang, Haibin; Wang, Jiying; Zhang, Limin
2013-03-01
Amplified fragment length polymorphisms (AFLP) markers were developed to assess the genetic variation of populations and clones of Rhopilema esculentum Kishinouye (Scyphozoa, Rhizostomatidae). One hundred and seventy-nine loci from 56 individuals of two hatchery populations and two wild populations were genotyped with five primer combinations. The polymorphic ratio, Shannon's diversity index and average heterozygosity were 70.3%, 0.346 and 0.228 for the white hatchery population, 74.3%, 0.313, and 0.201 for the red hatchery population, 79.3%, 0.349, and 0.224 for the Jiangsu wild population, and 74.9%, 0.328 and 0.210 for the Penglai wild population, respectively. Thus, all populations had a relatively high level of genetic diversity. A specific band was identified that could separate the white from the red hatchery population. There was 84.85% genetic differentiation within populations. Individual cluster analysis using unweighted pair-group method with arithmetic mean (UPGMA) suggested that hatchery populations and wild populations could be divided. For the hatchery populations, the white and red populations clustered separately; however, for the wild populations, Penglai and Jiangsu populations clustered together. The genetic diversity at the clone level was also determined. Our data suggest that there are relatively high genetic diversities within populations but low genetic differentiation between populations, which may be related to the long-term use of germplasm resources from Jiangsu Province for artificial seeding and releasing. These findings will benefit the artificial seeding and conservation of the germplasm resources.
Blanco, Eleonora Zambrano; Bajay, Miklos Maximiliano; Siqueira, Marcos Vinícius Bohrer Monteiro; Zucchi, Maria Imaculada; Pinheiro, José Baldin
2016-12-01
Ginger is a vegetable with medicinal and culinary properties widely cultivated in the Southern and Southeastern Brazil. The knowledge of ginger species' genetic variability is essential to direct correctly future studies of conservation and genetic improvement, but in Brazil, little is known about this species' genetic variability. In this study, we analyzed the genetic diversity and structure of 55 Brazilian accessions and 6 Colombian accessions of ginger, using AFLP (Amplified Fragment Length Polymorphism) molecular markers. The molecular characterization was based on 13 primers combinations, which generated an average of 113.5 polymorphic loci. The genetic diversity estimates of Nei (Hj), Shannon-Weiner index (I) and an effective number of alleles (n e ) were greater in the Colombian accessions in relation to the Brazilian accessions. The analysis of molecular variance showed that most of the genetic variation occurred between the two countries while in the Brazilian populations there is no genetic structure and probably each region harbors 100 % of genetic variation found in the samples. The bayesian model-based clustering and the dendrogram using the dissimilarity's coefficient of Jaccard were congruent with each other and showed that the Brazilian accessions are highly similar between themselves, regardless of the geographic region of origin. We suggested that the exploration of the interspecific variability and the introduction of new varieties of Z.officinale are viable alternatives for generating diversity in breeding programs in Brazil. The introduction of new genetic materials will certainly contribute to a higher genetic basis of such crop.
Nucleic acid amplification using modular branched primers
Ulanovsky, Levy; Raja, Mugasimangalam C.
2001-01-01
Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.
Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction
2012-01-01
Background Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of hits. Furthermore, although the BLAST program has been widely used for primer target detection, it is in fact not an ideal tool for this purpose as BLAST is a local alignment algorithm and does not necessarily return complete match information over the entire primer range. Results We present a new software tool called Primer-BLAST to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Primer-BLAST also supports placing primers based on exon/intron locations and excluding single nucleotide polymorphism (SNP) sites in primers. Conclusions We describe a robust and fully implemented general purpose primer design tool
Kvitt, H; Ucko, M; Colorni, A; Batargias, C; Zlotkin, A; Knibb, W
2002-04-05
A PCR protocol for the rapid diagnosis of fish 'pasteurellosis' based on 16S rRNA gene sequences was developed. The procedure combines low annealing temperature that detects low titers of Photobacterium damselae but also related species, and high annealing temperature for the specific identification of P. damselae directly from infected fish. The PCR protocol was validated on 19 piscine isolates of P. damselae ssp. piscicida from different geographic regions (Japan, Italy, Spain, Greece and Israel), on spontaneously infected sea bream Sparus aurata and sea bass Dicentrarchus labrax, and on closely related American Type Culture Collection (ATCC) reference strains. PCR using high annealing temperature (64 degrees C) discriminated between P. damselae and closely related reference strains, including P. histaminum. Sixteen isolates of P. damselae ssp. piscicida, 2 P. damselae ssp. piscicida reference strains and 1 P. damselae ssp. damselae reference strain were subjected to Amplified Fragment Length Polymorphism (AFLP) analysis, and a similarity matrix was produced. Accordingly, the Japanese isolates of P. damselae ssp. piscicida were distinguished from the Mediterranean/European isolates at a cut-off value of 83% similarity. A further subclustering at a cut-off value of 97% allowed discrimination between the Israeli P. damselae ssp. piscicida isolates and the other Mediterranean/European isolates. The combination of PCR direct amplification and AFLP provides a 2-step procedure, where P. damselae is rapidly identified at genus level on the basis of its 16S rRNA gene sequence and then grouped into distinct clusters on the basis of AFLP polymorphisms. The first step of direct amplification is highly sensitive and has immediate practical consequences, offering fish farmers a rapid diagnosis, while the AFLP is more specific and detects intraspecific variation which, in our study, also reflected geographic correspondence. Because of its superior discriminative properties
NASA Technical Reports Server (NTRS)
Calle, Luz M.
1994-01-01
This investigation explored the use of Electrochemical Impedance Spectroscopy (EIS) in combination with atmospheric exposure as a short term method for analyzing the performance of twenty-one commercially available zinc-rich primers. The twenty-one zinc-rich primers were: Carboline CZ-11, Ameron Devoe-Marine Catha-Coat 304, Briner V-65, Ameron D-21-9, Sherwin Williams Zinc Clad II, Carboline CZ-D7, Ameron D-4, Dupont Ganicin 347WB, Porter TQ-4374H, Inorganic Coatings IC-531, Subox Galvanox IV, Southern Coatings Chemtec 600, GLidden Glidzinc 5530, Byco SP-101, Tnemec 90E-75, Devoe Catha-Coat 302H, Glidden Glidzinc 5536, Koppers 701, Ameron D-21-5, Coronado 935-152, and Subox Galvanox V. Data were also collected on galvanized steel for comparison purposes. A library of Bode magnitude plots was generated for each coating including curves for the initial time and after each week of atmospheric exposure at the Beach Corrosion Test site near the Space Shuttle launch pad at the Kennedy Space Center for up to four weeks. Subsequent measurements were collected after 8 weeks and after one year of atmospheric exposure. Analysis of the impedance data was performed with the purpose of identifying parameters that could be used to predict the long-term performance of zinc-rich primers. It has been shown that there is a correlation between the long-term performance of zinc-rich primers and several parameters obtained from EIS measurements in combination with atmospheric exposure. The equivalent circuit R2(R2C(R3W)) provided a satisfactory fit for the EIS data. The corrosion potential and the R2 resistance are parameters indicative of the galvanic mechanism of protection. The capacitance of the coating is related to the barrier mechanism of protection.
Gu, Yu; Zhao, Qian-Cheng; Sun, De-Ling; Song, Wen-Qin
2007-06-01
Nucleotide binding site (NBS) profiling, a new method was used to map resistance gene analogues (RGAs) in cauliflower (Brassica oleracea var. botrytis). This method allows amplification and the mapping of genetic markers anchored in the conserved NBS encoding domain of plant disease resistance genes. AFLP was also performed to construct the cauliflower intervarietal genetic map. The aim of constructing genetic map was to identify potential molecular markers linked to important agronomic traits that would be particularly useful for development and improving the species. Using 17 AFLP primer combinations and two degeneration primer/enzyme combinations, a total of 234 AFLP markers and 21 NBS markers were mapped in the F2 population derived from self-pollinating a single F1 plant of the cross AD White Flower x C-8. The markers were mapped in 9 of major linkage groups spanning 668.4 cM, with an average distance of 2.9 cM between adjacent mapped markers. The AFLP markers were well distributed throughout the linkage groups. The linkage groups contained from 12 to 47 loci each and the distance between two consecutive loci ranged from 0 to 14.9 cM. NBS markers were mapped on 8 of the 9 linkage groups of the genetic map. Most of these markers were organized in clusters. This result demonstrates the feasibility of the NBS-profiling method for generating NBS markers for resistance loci in cauliflower. The clustering of the markers mapped in this study adds to the evidence that most of them could be real RGAs.
Bakker, Erin; Achenbach, Ute; Bakker, Jeroen; van Vliet, Joke; Peleman, Johan; Segers, Bart; van der Heijden, Stefan; van der Linde, Piet; Graveland, Robert; Hutten, Ronald; van Eck, Herman; Coppoolse, Eric; van der Vossen, Edwin; Bakker, Jaap; Goverse, Aska
2004-06-01
The resistance gene H1 confers resistance to the potato cyst nematode Globodera rostochiensis and is located at the distal end of the long arm of chromosome V of potato. For marker enrichment of the H1 locus, a bulked segregant analysis (BSA) was carried out using 704 AFLP primer combinations. A second source of markers tightly linked to H1 is the ultra-high-density (UHD) genetic map of the potato cross SH x RH. This map has been produced with 387 AFLP primer combinations and consists of 10,365 AFLP markers in 1,118 bins (http://www.dpw.wageningen-ur.nl/uhd/). Comparing these two methods revealed that BSA resulted in one marker/cM and the UHD map in four markers/cM in the H1 interval. Subsequently, a high-resolution genetic map of the H1 locus has been developed using a segregating F(1) SH x RH population consisting of 1,209 genotypes. Two PCR-based markers were designed at either side of the H1 gene to screen the 1,209 genotypes for recombination events. In the high-resolution genetic map, two of the four co-segregating AFLP markers could be separated from the H1 gene. Marker EM1 is located at a distance of 0.2 cM, and marker EM14 is located at a distance of 0.8 cM. The other two co-segregating markers CM1 (in coupling) and EM15 (in repulsion) could not be separated from the H1 gene.
MethPrimer: designing primers for methylation PCRs.
Li, Long-Cheng; Dahiya, Rajvir
2002-11-01
DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.
Green, Stefan J.; Venkatramanan, Raghavee; Naqib, Ankur
2015-01-01
The polymerase chain reaction (PCR) is sensitive to mismatches between primer and template, and mismatches can lead to inefficient amplification of targeted regions of DNA template. In PCRs in which a degenerate primer pool is employed, each primer can behave differently. Therefore, inefficiencies due to different primer melting temperatures within a degenerate primer pool, in addition to mismatches between primer binding sites and primers, can lead to a distortion of the true relative abundance of targets in the original DNA pool. A theoretical analysis indicated that a combination of primer-template and primer-amplicon interactions during PCR cycles 3–12 is potentially responsible for this distortion. To test this hypothesis, we developed a novel amplification strategy, entitled “Polymerase-exonuclease (PEX) PCR”, in which primer-template interactions and primer-amplicon interactions are separated. The PEX PCR method substantially and significantly improved the evenness of recovery of sequences from a mock community of known composition, and allowed for amplification of templates with introduced mismatches near the 3’ end of the primer annealing sites. When the PEX PCR method was applied to genomic DNA extracted from complex environmental samples, a significant shift in the observed microbial community was detected. Furthermore, the PEX PCR method provides a mechanism to identify which primers in a primer pool are annealing to target gDNA. Primer utilization patterns revealed that at high annealing temperatures in the PEX PCR method, perfect match annealing predominates, while at lower annealing temperatures, primers with up to four mismatches with templates can contribute substantially to amplification. The PEX PCR method is simple to perform, is limited to PCR mixes and a single exonuclease step which can be performed without reaction cleanup, and is recommended for reactions in which degenerate primer pools are used or when mismatches between primers
Castilla, Karina Salvagni; de Gobbi, Débora Dirani Sena; Moreno, Luisa Zanolli; Paixão, Renata; Coutinho, Tania Alen; dos Santos, José Lúcio; Moreno, Andrea Micke
2012-06-01
Haemophilus parasuis infection in pigs is characterized by fibrinous polyserositis, arthritis and meningitis. Despite the fact that traditional diagnosis is based on herd history, clinical signs, bacterial isolation and serotyping, molecular-based methods are alternatives for species-specific tests and epidemiological studies. The aim of this study was to characterize H. parasuis field strains from different states of Brazil, employing serotyping and genotyping methods. Serotyping revealed that serovar 4 was the most prevalent (26.1%), followed by serovars 5 (17.4%), 14 (8.7%), 13 (4.4%) and 2 (4.4%), whereas 39% of the strains were considered as untypeable. AFLP with a single enzyme and PFGE were able to type all isolates tested, generating 34 and 20 different profiles, respectively, including untypeable strains. Besides the slightly higher discrimination index presented by AFLP, PFGE with Not I restriction enzyme showed a better correlation with epidemiological data, grouping strains of the same serovar, animal or farm origin. The results indicated AFLP and PFGE as valuable tools for typing H. parasuis isolates collected in Brazil. Copyright © 2011 Elsevier Ltd. All rights reserved.
First genetic linkage map of Taraxacum koksaghyz Rodin based on AFLP, SSR, COS and EST-SSR markers.
Arias, Marina; Hernandez, Monica; Remondegui, Naroa; Huvenaars, Koen; van Dijk, Peter; Ritter, Enrique
2016-08-04
Taraxacum koksaghyz Rodin (TKS) has been studied in many occasions as a possible alternative source for natural rubber production of good quality and for inulin production. Some tire companies are already testing TKS tire prototypes. There are also many investigations on the production of bio-fuels from inulin and inulin applications for health improvement and in the food industry. A limited amount of genomic resources exist for TKS and particularly no genetic linkage map is available in this species. We have constructed the first TKS genetic linkage map based on AFLP, COS, SSR and EST-SSR markers. The integrated linkage map with eight linkage groups (LG), representing the eight chromosomes of Russian dandelion, has 185 individual AFLP markers from parent 1, 188 individual AFLP markers from parent 2, 75 common AFLP markers and 6 COS, 1 SSR and 63 EST-SSR loci. Blasting the EST-SSR sequences against known sequences from lettuce allowed a partial alignment of our TKS map with a lettuce map. Blast searches against plant gene databases revealed some homologies with useful genes for downstream applications in the future.
First genetic linkage map of Taraxacum koksaghyz Rodin based on AFLP, SSR, COS and EST-SSR markers
Arias, Marina; Hernandez, Monica; Remondegui, Naroa; Huvenaars, Koen; van Dijk, Peter; Ritter, Enrique
2016-01-01
Taraxacum koksaghyz Rodin (TKS) has been studied in many occasions as a possible alternative source for natural rubber production of good quality and for inulin production. Some tire companies are already testing TKS tire prototypes. There are also many investigations on the production of bio-fuels from inulin and inulin applications for health improvement and in the food industry. A limited amount of genomic resources exist for TKS and particularly no genetic linkage map is available in this species. We have constructed the first TKS genetic linkage map based on AFLP, COS, SSR and EST-SSR markers. The integrated linkage map with eight linkage groups (LG), representing the eight chromosomes of Russian dandelion, has 185 individual AFLP markers from parent 1, 188 individual AFLP markers from parent 2, 75 common AFLP markers and 6 COS, 1 SSR and 63 EST-SSR loci. Blasting the EST-SSR sequences against known sequences from lettuce allowed a partial alignment of our TKS map with a lettuce map. Blast searches against plant gene databases revealed some homologies with useful genes for downstream applications in the future. PMID:27488242
Design of a Combined Ballistic Simulator and Primer Force Experimental Fixture
2015-08-01
preload bolt and breech, and between the breech and chamber, were found to be too loose. When heavy grease or Teflon tape was used to tighten the...increase the difficulty of removing and tightening the breech. The preload bolt does not have to be removed between firing and in future designs could use... tightened it could loosen the primer plate, so left-handed threads were machined on the primer plate. The ballistic simulator fixture was occasionally
Fernandes Santos, Carlos Antonio; de Souza Gama, Renata Natália Cândido
2013-06-01
The umbu tree (Spondias tuberosa) is one of the most important endemic species to the Brazilian tropical semiarid region. The umbu tree has edible fruits with a peculiar flavor that are consumed in natura or in a semi-industrialized form, such as jams, candies and juices. The majority of endemic species to Brazilian semiarid region have not been studied or sampled to form germ-plasm collections, which increases the risk of losing genetic variability of the adapted species to xerophytic conditions. The aim of this study was to estimate outcrossing rates in S. tuberosa using a multilocus mixed model in order to guide genetic resources and breeding programs of this species. DNA samples were extracted from 92 progenies of umbu trees, which were distributed among 12 families. These trees were planted by seed in 1991 in Petrolina, PE, Brazil. The experimental design was a randomized block, with a total of 42 progenies sampled in three regions. The experimental units were composed by five plants and five replications. The outcrossing rate was estimated by the multilocus model, which is available in the MLTR software, and was based on 17 polymorphic AFLP bands obtained from AAA_CTG and AAA_CTC primer combinations. The observed heterozygotes ranged from 0.147 to 0.499, with a maximum frequency estimated for the AAA_CTC 10 amplicon. The multilocus outcrossing estimation (t(m)) was 0.804 +/- 0.072, while the single-locus (t(s)) was 0.841 +/- 0.079, which suggests that S. tuberosa is predominantly an outcrossing species. The difference between t(m) and t(s) was -0.037 +/- 0.029, which indicates that biparental inbreeding was nearly absent. The mean inbreeding coefficient or fixation index (F) among maternal plants was--0.103 +/- 0.045, and the expected F was 0.108, which indicates that there was no excess of heterozygotes in the maternal population. The outcrossing estimates obtained in the present study indicate that S. tuberosa is an open-pollinated species. Biometrical
Vitales, Daniel; García-Fernández, Alfredo; Pellicer, Jaume; Vallès, Joan; Santos-Guerra, Arnoldo; Cowan, Robyn S; Fay, Michael F; Hidalgo, Oriane; Garnatje, Teresa
2014-01-01
The radiation of the genus Cheirolophus (Asteraceae) in Macaronesia constitutes a spectacular case of rapid diversification on oceanic islands. Twenty species - nine of them included in the IUCN Red List of Threatened Species - have been described to date inhabiting the Madeiran and Canarian archipelagos. A previous phylogenetic study revealed that the diversification of Cheirolophus in Macaronesia started less than 2 Ma. As a result of such an explosive speciation process, limited phylogenetic resolution was reported, mainly due to the low variability of the employed molecular markers. In the present study, we used highly polymorphic AFLP markers to i) evaluate species' boundaries, ii) infer their evolutionary relationships and iii) investigate the patterns of genetic diversity in relation to the potential processes likely involved in the radiation of Cheirolophus. One hundred and seventy-two individuals representing all Macaronesian Cheirolophus species were analysed using 249 AFLP loci. Our results suggest that geographic isolation played an important role in this radiation process. This was likely driven by the combination of poor gene flow capacity and a good ability for sporadic long-distance colonisations. In addition, we also found some traces of introgression and incipient ecological adaptation, which could have further enhanced the extraordinary diversification of Cheirolophus in Macaronesia. Last, we hypothesize that current threat categories assigned to Macaronesian Cheirolophus species do not reflect their respective evolutionary relevance, so future evaluations of their conservation status should take into account the results presented here.
Vitales, Daniel; García-Fernández, Alfredo; Pellicer, Jaume; Vallès, Joan; Santos-Guerra, Arnoldo; Cowan, Robyn S.; Fay, Michael F.; Hidalgo, Oriane; Garnatje, Teresa
2014-01-01
The radiation of the genus Cheirolophus (Asteraceae) in Macaronesia constitutes a spectacular case of rapid diversification on oceanic islands. Twenty species – nine of them included in the IUCN Red List of Threatened Species – have been described to date inhabiting the Madeiran and Canarian archipelagos. A previous phylogenetic study revealed that the diversification of Cheirolophus in Macaronesia started less than 2 Ma. As a result of such an explosive speciation process, limited phylogenetic resolution was reported, mainly due to the low variability of the employed molecular markers. In the present study, we used highly polymorphic AFLP markers to i) evaluate species' boundaries, ii) infer their evolutionary relationships and iii) investigate the patterns of genetic diversity in relation to the potential processes likely involved in the radiation of Cheirolophus. One hundred and seventy-two individuals representing all Macaronesian Cheirolophus species were analysed using 249 AFLP loci. Our results suggest that geographic isolation played an important role in this radiation process. This was likely driven by the combination of poor gene flow capacity and a good ability for sporadic long-distance colonisations. In addition, we also found some traces of introgression and incipient ecological adaptation, which could have further enhanced the extraordinary diversification of Cheirolophus in Macaronesia. Last, we hypothesize that current threat categories assigned to Macaronesian Cheirolophus species do not reflect their respective evolutionary relevance, so future evaluations of their conservation status should take into account the results presented here. PMID:25412495
Perrini, Rosaria; Alba, Vittorio; Ruta, Claudia; Morone-Fortunato, Irene; Blanco, Antonio; Montemurro, Cinzia
2009-01-01
A protocol for the induction of regeneration from leaves of Helichrysum italicum was established. Calli were found to form on the basal medium only when it was supplemented with thidiazuron (TDZ) alone or in combination with naphthalene acetic acid (NAA), with a percentage ranking of at least 80%. The hormone-free medium showed the highest percentage of shoot regeneration (62%) even though no callus formed. AFLP markers were employed to verify tissue culture-induced variation in the regenerated plantlets obtained by direct shoot regeneration or the indirect shoot regeneration process (callus formation). Seven out of the eleven AFLP primer pairs yielded polymorphic patterns. The average number of fragments per primer pair was 64.1. Singletons were represented by 12 (2.7%) fragments. Student's T-test was performed both on the average number of shared fragments and on the nucleotide diversity, and no significant statistical difference was observed between the two regeneration treatments.
Genetic variation and relationship among and within Withania species as revealed by AFLP markers.
Negi, M S; Singh, A; Lakshmikumaran, M
2000-12-01
Withania somnifera is an important medicinal plant, and its anticancerous properties have been attributed to various classes of withanolide compounds. The objective of the present study was to investigate the inter- and intraspecific genetic variation present in 35 individuals of W. somnifera and 5 individuals of W. coagulans using AFLP (amplified fragment length polymorphism) marker technique. The information about genetic variation determined from AFLP data for 40 individuals was employed to estimate similarity matrix value based on Jaccard's coefficient. The similarity values were further used to construct a phenetic dendrogram revealing the genetic relationships. The dendrogram generated by UPGMA (unweighted pair group method of arithmetic averages) distinguished W. somnifera from W. coagulans and formed two major clusters. These two main clusters shared a similarity coefficient of 0.3, correlating with the high level of polymorphism detected. The dendrogram further separated W. somnifera into three subclasses corresponding to Kashmiri and Nagori groups and an intermediate type. The AFLP profile of Kashmiri individuals was distinct from that of the Nagori group of plants. The intermediate genotype was distinct as it shared bands with both the Kashmiri and Nagori individuals, even though it was identified as a Kashmiri morphotype. Furthermore, the intermediate type shared a similarity coefficient of 0.8 with the Kashmiri individuals. The present work revealed low levels of variation within a population though high levels of polymorphism were detected between Nagori and Kashmiri populations. The ability of AFLP markers for efficient and rapid detection of genetic variations at the species as well as intraspecific level qualifies it as an efficient tool for estimating genetic similarity in plant species and effective management of genetic resources.
Liang, Xiao; Liang, Zongsuo; Zhang, Meixiang; Shen, Shuang; Liu, Hongyun; Liu, Yan
2012-01-01
Plants of the genus Salvia produce various types of phenolic compounds and tanshinones which are effective for treatment of coronary heart disease. Salvia miltiorrhiza and S. castanea Diels f. tomentosa Stib are two important members of the genus. In this study, metabolic profiles and cDNA-AFLP analysis of four samples were employed to identify novel genes potentially involved in phenolic compounds and tanshinones biosynthesis, including the red roots from the two species and two tanshinone-free roots from S. miltiorrhiza. The results showed that the red roots of S. castanea Diels f. tomentosa Stib produced high contents of rosmarinic acid (21.77 mg/g) and tanshinone IIA (12.60 mg/g), but low content of salvianolic acid B (1.45 mg/g). The red roots of S. miltiorrhiza produced high content of salvianolic acid B (18.69 mg/g), while tanshinones accumulation in this sample was much less than that in S. castanea Diels f. tomentosa Stib. Tanshinones were not detected in the two tanshinone-free samples, which produced high contents of phenolic compounds. A cDNA-AFLP analysis with 128 primer pairs revealed that 2300 transcript derived fragments (TDFs) were differentially expressed among the four samples. About 323 TDFs were sequenced, of which 78 TDFs were annotated with known functions through BLASTX searching the Genbank database and 14 annotated TDFs were assigned into secondary metabolic pathways through searching the KEGGPATHWAY database. The quantitative real-time PCR analysis indicated that the expression of 9 TDFs was positively correlated with accumulation of phenolic compounds and tanshinones. These TDFs additionally showed coordinated transcriptional response with 6 previously-identified genes involved in biosynthesis of tanshinones and phenolic compounds in S. miltiorrhiza hairy roots treated with yeast extract. The sequence data in the present work not only provided us candidate genes involved in phenolic compounds and tanshinones biosynthesis but also gave us
Tollenaere, C; Jacquet, S; Ivanova, S; Loiseau, A; Duplantier, J-M; Streiff, R; Brouat, C
2013-01-01
Genome scans using amplified fragment length polymorphism (AFLP) markers became popular in nonmodel species within the last 10 years, but few studies have tried to characterize the anonymous outliers identified. This study follows on from an AFLP genome scan in the black rat (Rattus rattus), the reservoir of plague (Yersinia pestis infection) in Madagascar. We successfully sequenced 17 of the 22 markers previously shown to be potentially affected by plague-mediated selection and associated with a plague resistance phenotype. Searching these sequences in the genome of the closely related species Rattus norvegicus assigned them to 14 genomic regions, revealing a random distribution of outliers in the genome (no clustering). We compared these results with those of an in silico AFLP study of the R. norvegicus genome, which showed that outlier sequences could not have been inferred by this method in R. rattus (only four of the 15 sequences were predicted). However, in silico analysis allowed the prediction of AFLP markers distribution and the estimation of homoplasy rates, confirming its potential utility for designing AFLP studies in nonmodel species. The 14 genomic regions surrounding AFLP outliers (less than 300 kb from the marker) contained 75 genes encoding proteins of known function, including nine involved in immune function and pathogen defence. We identified the two interleukin 1 genes (Il1a and Il1b) that share homology with an antigen of Y. pestis, as the best candidates for genes subject to plague-mediated natural selection. At least six other genes known to be involved in proinflammatory pathways may also be affected by plague-mediated selection. © 2012 Blackwell Publishing Ltd.
Huang, Yanyan; Khan, Mazhar; Măndoiu, Ion I.
2013-01-01
We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers. PMID:24312367
URPD: a specific product primer design tool.
Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong
2012-06-19
Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.
PrimerZ: streamlined primer design for promoters, exons and human SNPs.
Tsai, Ming-Fang; Lin, Yi-Jung; Cheng, Yu-Chang; Lee, Kuo-Hsi; Huang, Cheng-Chih; Chen, Yuan-Tsong; Yao, Adam
2007-07-01
PrimerZ (http://genepipe.ngc.sinica.edu.tw/primerz/) is a web application dedicated primarily to primer design for genes and human SNPs. PrimerZ accepts genes by gene name or Ensembl accession code, and SNPs by dbSNP rs or AFFY_Probe IDs. The promoter and exon sequence information of all gene transcripts fetched from the Ensembl database (http://www.ensembl.org) are processed before being passed on to Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) for individual primer design. All results returned from Primer 3 are organized and integrated in a specially designed web page for easy browsing. Besides the web page presentation, csv text file export is also provided for enhanced user convenience. PrimerZ automates highly standard but tedious gene primer design to improve the success rate of PCR experiments. More than 2000 primers have been designed with PrimerZ at our institute since 2004 and the success rate is over 70%. The addition of several new features has made PrimerZ even more useful to the research community in facilitating primer design for promoters, exons and SNPs.
Ley, A C; Hardy, O J
2013-04-01
AFLP markers are often used to study patterns of population genetic variation and gene flow because they offer a good coverage of the nuclear genome, but the reliability of AFLP scoring is critical. To assess interspecific gene flow in two African rainforest liana species (Haumania danckelmaniana, H. liebrechtsiana) where previous evidence of chloroplast captures questioned the importance of hybridization and species boundaries, we developed new AFLP markers and a novel approach to select reliable bands from their degree of reproducibility. The latter is based on the estimation of the broad-sense heritability of AFLP phenotypes, an improvement over classical scoring error rates, which showed that the polymorphism of most AFLP bands was affected by a substantial nongenetic component. Therefore, using a quantitative genetics framework, we also modified an existing estimator of pairwise kinship coefficient between individuals correcting for the limited heritability of markers. Bayesian clustering confirms the recognition of the two Haumania species. Nevertheless, the decay of the relatedness between individuals of distinct species with geographic distance demonstrates that hybridization affects the nuclear genome. In conclusion, although we showed that AFLP markers might be substantially affected by nongenetic factors, their analysis using the new methods developed considerably advanced our understanding of the pattern of gene flow in our model species. © 2013 Blackwell Publishing Ltd.
URPD: a specific product primer design tool
2012-01-01
Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312
AFLP-based genetic mapping of the “bud-flowering” trait in heather (Calluna vulgaris)
2013-01-01
Background Calluna vulgaris is one of the most important landscaping plants produced in Germany. Its enormous economic success is due to the prolonged flower attractiveness of mutants in flower morphology, the so-called bud-bloomers. In this study, we present the first genetic linkage map of C. vulgaris in which we mapped a locus of the economically highly desired trait “flower type”. Results The map was constructed in JoinMap 4.1. using 535 AFLP markers from a single mapping population. A large fraction (40%) of markers showed distorted segregation. To test the effect of segregation distortion on linkage estimation, these markers were sorted regarding their segregation ratio and added in groups to the data set. The plausibility of group formation was evaluated by comparison of the “two-way pseudo-testcross” and the “integrated” mapping approach. Furthermore, regression mapping was compared to the multipoint-likelihood algorithm. The majority of maps constructed by different combinations of these methods consisted of eight linkage groups corresponding to the chromosome number of C. vulgaris. Conclusions All maps confirmed the independent inheritance of the most important horticultural traits “flower type”, “flower colour”, and “leaf colour”. An AFLP marker for the most important breeding target “flower type” was identified. The presented genetic map of C. vulgaris can now serve as a basis for further molecular marker selection and map-based cloning of the candidate gene encoding the unique flower architecture of C. vulgaris bud-bloomers. PMID:23915059
Bootsie: estimation of coefficient of variation of AFLP data by bootstrap analysis
USDA-ARS?s Scientific Manuscript database
Bootsie is an English-native replacement for ASG Coelho’s “DBOOT” utility for estimating coefficient of variation of a population of AFLP marker data using bootstrapping. Bootsie improves on DBOOT by supporting batch processing, time-to-completion estimation, built-in graphs, and a suite of export t...
Dal Cin, Valeriano; Barbaro, Enrico; Danesin, Marcello; Murayama, Hideki; Velasco, Riccardo; Ramina, Angelo
2009-08-01
Apple Malus X domestica fruitlet abscission is preceded by a stimulation of ethylene biosynthesis and a gain in sensitivity to the hormone. This phase was studied by a differential screening carried out by cDNA-AFLP in abscising (AF) and non-abscising (NAF) fruitlet populations. Fifty-three primer combinations allowed for the isolation of 131, 66 and 30 differentially expressed bands from cortex, peduncle and seed, respectively. All sequences were then classified as up- or down-regulated by comparing the profile in AFs and NAFs. Almost all of these sequences showed significant homology to genes encoding proteins with known or putative function. The gene ontology analysis of the TDFs isolated indicated a deep change in metabolism, plastid and hormonal status, especially auxin. Furthermore, some common elements between abscission and senescence were identified. The isolation of the full length of one of these TDFs allowed for the identification of a gene encoding an auxin hydrogen symporter (MdAHS). Bioinformatic analysis indicated that the deduced protein shares some features with other auxin efflux carriers, which include PINs. Nevertheless the 3D structure pointed out substantial differences and a conformation largely dissimilar from canonical ion transporters. The expression analysis demonstrated that this gene is regulated by light and development but not affected by ethylene or auxin.
Primer3_masker: integrating masking of template sequence with primer design software.
Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido
2018-06-01
Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.
Sudheer Pamidimarri, D V N; Singh, Sweta; Mastan, Shaik G; Patel, Jalpa; Reddy, Muppala P
2009-07-01
Jatropha curcas L., a multipurpose shrub has acquired significant economic importance for its seed oil which can be converted to biodiesel, is emerging as an alternative to petro-diesel. The deoiled seed cake remains after oil extraction is toxic and cannot be used as a feed despite having best nutritional contents. No quantitative and qualitative differences were observed between toxic and non-toxic varieties of J. curcas except for phorbol esters content. Development of molecular marker will enable to differentiate non-toxic from toxic variety in a mixed population and also help in improvement of the species through marker assisted breeding programs. The present investigation was undertaken to characterize the toxic and non-toxic varieties at molecular level and to develop PCR based molecular markers for distinguishing non-toxic from toxic or vice versa. The polymorphic markers were successfully identified specific to non-toxic and toxic variety using RAPD and AFLP techniques. Totally 371 RAPD, 1,442 AFLP markers were analyzed and 56 (15.09%) RAPD, 238 (16.49%) AFLP markers were found specific to either of the varieties. Genetic similarity between non-toxic and toxic verity was found to be 0.92 by RAPD and 0.90 by AFLP fingerprinting. In the present study out of 12 microsatellite markers analyzed, seven markers were found polymorphic. Among these seven, jcms21 showed homozygous allele in the toxic variety. The study demonstrated that both RAPD and AFLP techniques were equally competitive in identifying polymorphic markers and differentiating both the varieties of J. curcas. Polymorphism of SSR markers prevailed between the varieties of J. curcas. These RAPD and AFLP identified markers will help in selective cultivation of specific variety and along with SSRs these markers can be exploited for further improvement of the species through breeding and Marker Assisted Selection (MAS).
Rouppe van der Voort, J N; van Eck, H J; van Zandvoort, P M; Overmars, H; Helder, J; Bakker, J
1999-07-01
A mapping strategy is described for the construction of a linkage map of a non-inbred species in which individual offspring genotypes are not amenable to marker analysis. After one extra generation of random mating, the segregating progeny was propagated, and bulked populations of offspring were analyzed. Although the resulting population structure is different from that of commonly used mapping populations, we show that the maximum likelihood formula for a normal F2 is applicable for the estimation of recombination. This "pseudo-F2" mapping strategy, in combination with the development of an AFLP assay for single cysts, facilitated the construction of a linkage map for the potato cyst nematode Globodera rostochiensis. Using 12 pre-selected AFLP primer combinations, a total of 66 segregating markers were identified, 62 of which were mapped to nine linkage groups. These 62 AFLP markers are randomly distributed and cover about 65% of the genome. An estimate of the physical size of the Globodera genome was obtained from comparisons of the number of AFLP fragments obtained with the values for Caenorhabditis elegans. The methodology presented here resulted in the first genomic map for a cyst nematode. The low value of the kilobase/centimorgan (kb/cM) ratio for the Globodera genome will facilitate map-based cloning of genes that mediate the interaction between the nematode and its host plant.
Julier, Bernadette; Flajoulot, Sandrine; Barre, Philippe; Cardinet, Gaëlle; Santoni, Sylvain; Huguet, Thierry; Huyghe, Christian
2003-01-01
Background Alfalfa (Medicago sativa) is a major forage crop. The genetic progress is slow in this legume species because of its autotetraploidy and allogamy. The genetic structure of this species makes the construction of genetic maps difficult. To reach this objective, and to be able to detect QTLs in segregating populations, we used the available codominant microsatellite markers (SSRs), most of them identified in the model legume Medicago truncatula from EST database. A genetic map was constructed with AFLP and SSR markers using specific mapping procedures for autotetraploids. The tetrasomic inheritance was analysed in an alfalfa mapping population. Results We have demonstrated that 80% of primer pairs defined on each side of SSR motifs in M. truncatula EST database amplify with the alfalfa DNA. Using a F1 mapping population of 168 individuals produced from the cross of 2 heterozygous parental plants from Magali and Mercedes cultivars, we obtained 599 AFLP markers and 107 SSR loci. All but 3 SSR loci showed a clear tetrasomic inheritance. For most of the SSR loci, the double-reduction was not significant. For the other loci no specific genotypes were produced, so the significant double-reduction could arise from segregation distortion. For each parent, the genetic map contained 8 groups of four homologous chromosomes. The lengths of the maps were 2649 and 3045 cM, with an average distance of 7.6 and 9.0 cM between markers, for Magali and Mercedes parents, respectively. Using only the SSR markers, we built a composite map covering 709 cM. Conclusions Compared to diploid alfalfa genetic maps, our maps cover about 88–100% of the genome and are close to saturation. The inheritance of the codominant markers (SSR) and the pattern of linkage repulsions between markers within each homology group are consistent with the hypothesis of a tetrasomic meiosis in alfalfa. Except for 2 out of 107 SSR markers, we found a similar order of markers on the chromosomes between the
Shan, X H; Li, Y D; Liu, X M; Wu, Y; Zhang, M Z; Guo, W L; Liu, B; Yuan, Y P
2012-08-17
We analyzed genetic diversity and population genetic structure of four artificial populations of wild barley (Hordeum brevisubulatum); 96 plants collected from the Songnen Prairie in northeastern China were analyzed using amplified fragment length polymorphism (AFLP), specific-sequence amplified polymorphism (SSAP) and methylation-sensitive amplified polymorphism (MSAP) markers. Indices of (epi-)genetic diversity, (epi-)genetic distance, gene flow, genotype frequency, cluster analysis, PCA analysis and AMOVA analysis generated from MSAP, AFLP and SSAP markers had the same trend. We found a high level of correlation in the artificial populations between MSAP, SSAP and AFLP markers by the Mantel test (r > 0.8). This is incongruent with previous findings showing that there is virtually no correlation between DNA methylation polymorphism and classical genetic variation; the high level of genetic polymorphism could be a result of epigenetic regulation. We compared our results with data from natural populations. The population diversity of the artificial populations was lower. However, different from what was found using AFLP and SSAP, based on MSAP results the methylation polymorphism of the artificial populations was not significantly reduced. This leads us to suggest that the DNA methylation pattern change in H. brevisubulatum populations is not only related to DNA sequence variation, but is also regulated by other controlling systems.
Genetic diversity of sweet sorghum germplasm in Mexico using AFLP and SSR markers
USDA-ARS?s Scientific Manuscript database
The objective of this work was to evaluate the diversity and genetic relationships between lines and varieties of the sweet sorghum (Sorghum bicolor) germplasm bank of the National Institute for Forestry, Agriculture and Livestock Research, Mexico, using AFLP and SSR markers. The molecular markers ...
2009-01-01
Background Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. Methods We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. Results RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully
Kanchanaketu, T; Sangduen, N; Toojinda, T; Hongtrakul, V
2012-04-13
Genetic analysis of 56 samples of Jatropha curcas L. collected from Thailand and other countries was performed using the methylation-sensitive amplification polymorphism (MSAP) technique. Nine primer combinations were used to generate MSAP fingerprints. When the data were interpreted as amplified fragment length polymorphism (AFLP) markers, 471 markers were scored. All 56 samples were classified into three major groups: γ-irradiated, non-toxic and toxic accessions. Genetic similarity among the samples was extremely high, ranging from 0.95 to 1.00, which indicated very low genetic diversity in this species. The MSAP fingerprint was further analyzed for DNA methylation polymorphisms. The results revealed differences in the DNA methylation level among the samples. However, the samples collected from saline areas and some species hybrids showed specific DNA methylation patterns. AFLP data were used, together with methylation-sensitive AFLP (MS-AFLP) data, to construct a phylogenetic tree, resulting in higher efficiency to distinguish the samples. This combined analysis separated samples previously grouped in the AFLP analysis. This analysis also distinguished some hybrids. Principal component analysis was also performed; the results confirmed the separation in the phylogenetic tree. Some polymorphic bands, involving both nucleotide and DNA methylation polymorphism, that differed between toxic and non-toxic samples were identified, cloned and sequenced. BLAST analysis of these fragments revealed differences in DNA methylation in some known genes and nucleotide polymorphism in chloroplast DNA. We conclude that MSAP is a powerful technique for the study of genetic diversity for organisms that have a narrow genetic base.
Dini-Andreote, Francisco; Pietrobon, Vivian Cristina; Andreote, Fernando Dini; Romão, Aline Silva; Spósito, Marcel Bellato; Araújo, Welington Luiz
2009-01-01
The Alternaria brown spot (ABS) is a disease caused in tangerine plants and its hybrids by the fungus Alternaria alternata f. sp. citri which has been found in Brazil since 2001. Due to the recent occurrence in Brazilian orchards, the epidemiology and genetic variability of this pathogen is still an issue to be addressed. Here it is presented a survey about the genetic variability of this fungus by the characterization of twenty four pathogenic isolates of A. alternata f. sp. citri from citrus plants and four endophytic isolates from mango (one Alternaria tenuissima and three Alternaria arborescens). The application of two molecular markers Random Amplified Polymorphic DNA (RAPD) and Amplified Fragment Length Polymorphism (AFLP) had revealed the isolates clustering in distinct groups when fingerprintings were analyzed by Principal Components Analysis (PCA). Despite the better assessment of the genetic variability through the AFLP, significant modifications in clusters components were not observed, and only slight shifts in the positioning of isolates LRS 39/3 and 25M were observed in PCA plots. Furthermore, in both analyses, only the isolates from lemon plants revealed to be clustered, differently from the absence of clustering for other hosts or plant tissues. Summarizing, both RAPD and AFLP analyses were both efficient to detect the genetic variability within the population of the pathogenic fungus Alternaria spp., supplying information on the genetic variability of this species as a basis for further studies aiming the disease control. PMID:24031413
[AFLP Analysis of Genetic Diversity in the Genus Mallus Mill. (Apple)].
Savelyeva, E N; Kudryavtsev, A M
2015-10-01
The first molecular genetic analysis of the apple species and varieties from Russian collections with the AFLP marker system was performed in order to study the genetic diversity of the genus Malus, as well as to clarify the phylogeny and solve some systematic issues of the genus. Nienty-one apple accessions, including species from five sections of the genus Malus and hybrid species, were examined. The level of polymorphism constituted 90.2%. It was demonstrated that the classical taxonomy of the genus Malus, which identifies five sections based on differences in their morphological characters, is valid and may be used to classify apple species. The species assignment of the Antonovka landraces was established. All of them belonged to the species M. domestica. It was demonstrated that the Yakutskaya apple variety was a domesticated species of the section Gymnomeles, presumably, M. baccata. AFLP analysis confirmed the hybrid nature of many species. The relationships between apple varieties of the Golden group with American wild species were demonstrated. The data suggest that the species M. sieversii was the ancestor of not only the domestic apple but also of other species of the Malus sections.
MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.
Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G
2012-11-05
Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.
MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling
2012-01-01
Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base. PMID:23126469
Witsenboer, H; Michelmore, R W; Vogel, J
1997-12-01
Selectively amplified microsatellite polymorphic locus (SAMPL) analysis is a method of amplifying microsatellite loci using generic PCR primers. SAMPL analysis uses one AFLP primer in combination with a primer complementary to microsatellite sequences. SAMPL primers based on compound microsatellite sequences provided the clearest amplification patterns. We explored the potential of SAMPL analysis in lettuce to detect PCR-based codominant microsatellite markers. Fifty-eight SAMPLs were identified and placed on the genetic map. Seventeen were codominant. SAMPLs were dispersed with RFLP markers on 11 of the 12 main linkage groups in lettuce, indicating that they have a similar genomic distribution. Some but not all fragments amplified by SAMPL analysis were confirmed to contain microsatellite sequences by Southern hybridization. Forty-five cultivars of lettuce and five wild species of Lactuca were analyzed to determine the allelic diversity for codominant SAMPLs. From 3 to 11 putative alleles were found for each SAMPL; 2-6 alleles were found within Lactuca sativa and 1-3 alleles were found among the crisphead genotypes, the most genetically homogeneous plant type of L. sativa. This allelic diversity is greater than that found for RFLP markers. Numerous new alleles were observed in the wild species; however, there were frequent null alleles. Therefore, SAMPL analysis is more applicable to intraspecific than to interspecific comparisons. A phenetic analysis based on SAMPLs resulted in a dendrogram similar to those based on RFLP and AFLP markers.
USDA-ARS?s Scientific Manuscript database
Sixty one persimmon (Diospyros kaki Thunb.) selections, including 17 Italian, 11 Spanish, 13 Japanese, six Korean, five Chinese, one Israeli, and eight of unknown origin, were evaluated for genetic differences by AFLP analysis. Relationships among cultivars were evaluated by UPGMA clustering, Neigh...
Zhong, Daibin; Menge, David M; Temu, Emmanuel A; Chen, Hong; Yan, Guiyun
2006-07-01
The yellow fever mosquito Aedes aegypti has been the subject of extensive genetic research due to its medical importance and the ease with which it can be manipulated in the laboratory. A molecular genetic linkage map was constructed using 148 amplified fragment length polymorphism (AFLP) and six single-strand conformation polymorphism (SSCP) markers. Eighteen AFLP primer combinations were used to genotype two reciprocal F2 segregating populations. Each primer combination generated an average of 8.2 AFLP markers eligible for linkage mapping. The length of the integrated map was 180.9 cM, giving an average marker resolution of 1.2 cM. Composite interval mapping revealed a total of six QTL significantly affecting Plasmodium susceptibility in the two reciprocal crosses of Ae. aegypti. Two common QTL on linkage group 2 were identified in both crosses that had similar effects on the phenotype, and four QTL were unique to each cross. In one cross, the four main QTL accounted for 64% of the total phenotypic variance, and digenic epistasis explained 11.8% of the variance. In the second cross, the four main QTL explained 66% of the variance, and digenic epistasis accounted for 16% of the variance. The actions of these QTL were either dominance or underdominance. Our results indicated that at least three new QTL were mapped on chromosomes 1 and 3. The polygenic nature of susceptibility to P. gallinaceum and epistasis are important factors for significant variation within or among mosquito strains. The new map provides additional information useful for further genetic investigation, such as identification of new genes and positional cloning.
Bouajila, A; Zoghlami, N; Murad, S; Baum, M; Ghorbel, A; Nazari, K
2013-06-01
To investigate the level of genetic differentiation and diversity among Pyrenophora teres isolate populations originating from different agro-ecological areas of Syria and Tunisia and to determine the potential of AFLP profiling in genotyping Pyrenophora teres f. teres. In this study, AFLP markers have been employed to identify patterns of population structure in 20 Pyrenophora teres f. teres populations from Syria and Tunisia. Ninety-four isolates were studied by the use of a protocol that involved stringent PCR amplification of fragments derived from digestion of genomic DNA with restriction enzymes EcoRI and MesI. Based on 401 amplified polymorphic DNA markers (AFLP), variance analyses indicated that most of the variation was partitioned within rather than between populations. Genotypic diversity (GD) was high for populations from Rihane, local landraces and different agro-ecological zones (GD = 0·75-0·86). There was high genetic differentiation among pathogen populations from different host populations in Syria (Gst = 0·31, ht = 0·190) and Tunisia (Gst = 0·39, ht = 0·263), which may be partly explained by the low gene flow around the areas sampled. A phenetic tree revealed three groups with high bootstrap values (55, 68, 76) and reflected the grouping of isolates based on host, or agro-ecological areas. AFLP profiling is an effective method for typing the genetically diverse pathogen Pyrenophora teres f. teres. The study represents a comparative analysis of the genetic diversity in P. teres isolates from two countries spanning two continents and also shows that several distinct P. teres genotypes may be found in a given environment. The implications of these findings for Pyrenophora teres f. teres evolutionary potential and net blotch-resistance breeding in Syria and Tunisia were also discussed. © 2012 The Society for Applied Microbiology.
Quintela, María; Johansson, Magnus P.; Kristjánsson, Bjarni K.; Barreiro, Rodolfo; Laurila, Anssi
2014-01-01
The way environmental variation shapes neutral and adaptive genetic variation in natural populations is a key issue in evolutionary biology. Genome scans allow the identification of the genetic basis of local adaptation without previous knowledge of genetic variation or traits under selection. Candidate loci for divergent adaptation are expected to show higher FST than neutral loci influenced solely by random genetic drift, migration and mutation. The comparison of spatial patterns of neutral markers and loci under selection may help disentangle the effects of gene flow, genetic drift and selection among populations living in contrasting environments. Using the gastropod Radix balthica as a system, we analyzed 376 AFLP markers and 25 mtDNA COI haplotypes for candidate loci and associations with local adaptation among contrasting thermal environments in Lake Mývatn, a volcanic lake in northern Iceland. We found that 2% of the analysed AFLP markers were under directional selection and 12% of the mitochondrial haplotypes correlated with differing thermal habitats. The genetic networks were concordant for AFLP markers and mitochondrial haplotypes, depicting distinct topologies at neutral and candidate loci. Neutral topologies were characterized by intense gene flow revealed by dense nets with edges connecting contrasting thermal habitats, whereas the connections at candidate loci were mostly restricted to populations within each thermal habitat and the number of edges decreased with temperature. Our results suggest microgeographic adaptation within Lake Mývatn and highlight the utility of genome scans in detecting adaptive divergence. PMID:25007329
Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.
Yofe, Ido; Schuldiner, Maya
2014-02-01
The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.
CODEHOP (COnsensus-DEgenerate Hybrid Oligonucleotide Primer) PCR primer design
Rose, Timothy M.; Henikoff, Jorja G.; Henikoff, Steven
2003-01-01
We have developed a new primer design strategy for PCR amplification of distantly related gene sequences based on consensus-degenerate hybrid oligonucleotide primers (CODEHOPs). An interactive program has been written to design CODEHOP PCR primers from conserved blocks of amino acids within multiply-aligned protein sequences. Each CODEHOP consists of a pool of related primers containing all possible nucleotide sequences encoding 3–4 highly conserved amino acids within a 3′ degenerate core. A longer 5′ non-degenerate clamp region contains the most probable nucleotide predicted for each flanking codon. CODEHOPs are used in PCR amplification to isolate distantly related sequences encoding the conserved amino acid sequence. The primer design software and the CODEHOP PCR strategy have been utilized for the identification and characterization of new gene orthologs and paralogs in different plant, animal and bacterial species. In addition, this approach has been successful in identifying new pathogen species. The CODEHOP designer (http://blocks.fhcrc.org/codehop.html) is linked to BlockMaker and the Multiple Alignment Processor within the Blocks Database World Wide Web (http://blocks.fhcrc.org). PMID:12824413
PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.
Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt
2017-01-24
The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com).
PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection
O’Halloran, Damien M.
2016-01-01
Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558
Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi.
Lee, Jaikoo; Lee, Sangsun; Young, J Peter W
2008-08-01
A set of PCR primers that should amplify all subgroups of arbuscular mycorrhizal fungi (AMF, Glomeromycota), but exclude sequences from other organisms, was designed to facilitate rapid detection and identification directly from field-grown plant roots. The small subunit rRNA gene was targeted for the new primers (AML1 and AML2) because phylogenetic relationships among the Glomeromycota are well understood for this gene. Sequence comparisons indicate that the new primers should amplify all published AMF sequences except those from Archaeospora trappei. The specificity of the new primers was tested using 23 different AMF spore morphotypes from trap cultures and Miscanthus sinensis, Glycine max and Panax ginseng roots sampled from the field. Non-AMF DNA of 14 plants, 14 Basidiomycota and 18 Ascomycota was also tested as negative controls. Sequences amplified from roots using the new primers were compared with those obtained using the established NS31 and AM1 primer combination. The new primers have much better specificity and coverage of all known AMF groups.
PrimerStation: a highly specific multiplex genomic PCR primer design server for the human genome
Yamada, Tomoyuki; Soma, Haruhiko; Morishita, Shinichi
2006-01-01
PrimerStation () is a web service that calculates primer sets guaranteeing high specificity against the entire human genome. To achieve high accuracy, we used the hybridization ratio of primers in liquid solution. Calculating the status of sequence hybridization in terms of the stringent hybridization ratio is computationally costly, and no web service checks the entire human genome and returns a highly specific primer set calculated using a precise physicochemical model. To shorten the response time, we precomputed candidates for specific primers using a massively parallel computer with 100 CPUs (SunFire 15 K) about 3 months in advance. This enables PrimerStation to search and output qualified primers interactively. PrimerStation can select highly specific primers suitable for multiplex PCR by seeking a wider temperature range that minimizes the possibility of cross-reaction. It also allows users to add heuristic rules to the primer design, e.g. the exclusion of single nucleotide polymorphisms (SNPs) in primers, the avoidance of poly(A) and CA-repeats in the PCR products, and the elimination of defective primers using the secondary structure prediction. We performed several tests to verify the PCR amplification of randomly selected primers for ChrX, and we confirmed that the primers amplify specific PCR products perfectly. PMID:16845094
Evaluation of different primers for PCR-DGGE analysis of cheese-associated enterococci.
Lorbeg, Petra Mohar; Majhenic, Andreja Canzek; Rogelj, Irena
2009-08-01
Enterococci represent an important part of bacterial microbiota in different types of artisanal cheeses, made from either raw or pasteurized milk. Polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE) of ribosomal DNA is currently one of the most frequently used fingerprinting method to study diversity and dynamics of microbial communities and also a tool for microbial identification. Among several primer pairs for DGGE analysis published so far, six primer pairs amplifying different variable regions of 16S rDNA were selected and applied in our DGGE analysis of 12 species belonging to genus Enterococcus and eight other bacterial species often found in cheeses (seven lactobacilli and one Lactoccocus lactis). When DGGE procedures were optimized, the same set of primers was used for DGGE analysis of five cheese samples. Our study demonstrates that the use of different primer pairs generate significant differences in DGGE analysis of enterococcal population, consequently, appropriate primers regarding the purpose of analysis can be selected. For differentiation and identification of pure enterococcal isolates, primer pair P1V1/P2V1 showed the most promising results since all 12 enterococcal isolates gave distinctive DGGE fingerprints, but with multiple bands patterns; therefore, these primers do not seem to be appropriate for identification of enterococcal species in mixed cultures. Use of primer pairs HDA1/HDA2 and V3f/V3r amplifying V3 region showed better potential for detection and identification of enterococci in mixed communities, but since some bacterial species showed the same fingerprint, for clear identification combination of DGGE and some other method (e.g. species specific PCR) or combined DGGE analysis using two primer pairs generating distinctive results should be used.
Primer design for a prokaryotic differential display RT-PCR.
Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H
1997-01-01
We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR. PMID:9108168
Primer design for a prokaryotic differential display RT-PCR.
Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H
1997-05-01
We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.
Han, Zhi-Qiang; Han, Gang; Wang, Zhi-Yong; Gao, Tian-Xiang
2015-02-03
In order to ascertain the taxonomic status of the Ariake Sea population of Japanese grenadier anchovy, Coilia nasus, and assess the contemporary possible genetic barrier between the west and east coastal waters of the East China Sea, we used amplified fragment length polymorphism (AFLP) markers to detect the genetic structure of C. nasus, in the East China Sea and Yellow Sea. Eighty-one individuals of C. nasus were collected from five locations and 12 individuals of Coilia mystus were sampled from the Yangtze River Estuary. A total of 371 loci were detected by five primer combinations, 310 of which were polymorphic (83.56%). Analysis of molecular variation (AMOVA) and pairwise fixation index (FST) revealed significant genetic differentiation among five samples, indicating limited gene flow among populations. The dendrogram for populations by neighbor-joining (NJ) cluster analysis provided evidence of a clear relationship between genetic and geographic patterns, supporting significant genetic differentiation between China coastal populations and Ariake Sea populations. Compared to the genetic divergence between C. nasus and C. mystus, the level of genetic differentiation between China and the Ariake Sea populations of C. nasus is obvious below the species level, indicating isolated populations of C. nasus in the Ariake Sea. Isolation by distance analysis revealed that direct ocean distance with deep-water at the continental slope and high salinity between west and east coastal waters of the East China Sea served as major physical barrier to C. nasus, supporting the coastal dispersal pattern in this estuarine species, and rejecting offshore dispersal strategy.
miPrimer: an empirical-based qPCR primer design method for small noncoding microRNA
Kang, Shih-Ting; Hsieh, Yi-Shan; Feng, Chi-Ting; Chen, Yu-Ting; Yang, Pok Eric; Chen, Wei-Ming
2018-01-01
MicroRNAs (miRNAs) are 18–25 nucleotides (nt) of highly conserved, noncoding RNAs involved in gene regulation. Because of miRNAs’ short length, the design of miRNA primers for PCR amplification remains a significant challenge. Adding to the challenge are miRNAs similar in sequence and miRNA family members that often only differ in sequences by 1 nt. Here, we describe a novel empirical-based method, miPrimer, which greatly reduces primer dimerization and increases primer specificity by factoring various intrinsic primer properties and employing four primer design strategies. The resulting primer pairs displayed an acceptable qPCR efficiency of between 90% and 110%. When tested on miRNA families, miPrimer-designed primers are capable of discriminating among members of miRNA families, as validated by qPCR assays using Quark Biosciences’ platform. Of the 120 miRNA primer pairs tested, 95.6% and 93.3% were successful in amplifying specifically non-family and family miRNA members, respectively, after only one design trial. In summary, miPrimer provides a cost-effective and valuable tool for designing miRNA primers. PMID:29208706
Shang, Ying; Xu, Wentao; Wang, Yong; Xu, Yuancong; Huang, Kunlun
2017-12-15
This study described a novel multiplex qualitative detection method using pyrosequencing. Based on the principle of the universal primer-multiplex-PCR, only one sequencing primer was employed to realize the detection of the multiple targets. Samples containing three genetically modified (GM) crops in different proportions were used to validate the method. The dNTP dispensing order was designed based on the product sequences. Only 12 rounds (ATCTGATCGACT) of dNTPs addition and, often, as few as three rounds (CAT) under ideal conditions, were required to detect the GM events qualitatively, and sensitivity was as low as 1% of a mixture. However, when considering a mixture, calculating signal values allowed the proportion of each GM to be estimated. Based on these results, we concluded that our novel method not only realized detection but also allowed semi-quantitative detection of individual events. Copyright © 2017. Published by Elsevier Ltd.
Yoon, Hyejin; Leitner, Thomas
2014-12-17
Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-Mmore » finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.« less
Polyacid macromolecule primers
Sugama, Toshifumi
1989-01-01
Hydrophylic polyacids, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests.
Genetic diversity of Kenyan native oyster mushroom (Pleurotus).
Otieno, Ojwang D; Onyango, Calvin; Onguso, Justus Mungare; Matasyoh, Lexa G; Wanjala, Bramwel W; Wamalwa, Mark; Harvey, Jagger J W
2015-01-01
Members of the genus Pleurotus, also commonly known as oyster mushroom, are well known for their socioeconomic and biotechnological potentials. Despite being one of the most important edible fungi, the scarce information about the genetic diversity of the species in natural populations has limited their sustainable utilization. A total of 71 isolates of Pleurotus species were collected from three natural populations: 25 isolates were obtained from Kakamega forest, 34 isolates from Arabuko Sokoke forest and 12 isolates from Mount Kenya forest. Amplified fragment length polymorphism (AFLP) was applied to thirteen isolates of locally grown Pleurotus species obtained from laboratory samples using five primer pair combinations. AFLP markers and internal transcribed spacer (ITS) sequences of the ribosomal DNA were used to estimate the genetic diversity and evaluate phylogenetic relationships, respectively, among and within populations. The five primer pair combinations generated 293 polymorphic loci across the 84 isolates. The mean genetic diversity among the populations was 0.25 with the population from Arabuko Sokoke having higher (0.27) diversity estimates compared to Mount Kenya population (0.24). Diversity between the isolates from the natural population (0.25) and commercial cultivars (0.24) did not differ significantly. However, diversity was greater within (89%; P > 0.001) populations than among populations. Homology search analysis against the GenBank database using 16 rDNA ITS sequences randomly selected from the two clades of AFLP dendrogram revealed three mushroom species: P. djamor, P. floridanus and P. sapidus; the three mushrooms form part of the diversity of Pleurotus species in Kenya. The broad diversity within the Kenyan Pleurotus species suggests the possibility of obtaining native strains suitable for commercial cultivation. © 2015 by The Mycological Society of America.
Molecular analysis of post-harvest withering in grape by AFLP transcriptional profiling
Zamboni, Anita; Minoia, Leone; Ferrarini, Alberto; Tornielli, Giovanni Battista; Zago, Elisa; Delledonne, Massimo; Pezzotti, Mario
2008-01-01
Post-harvest withering of grape berries is used in the production of dessert and fortified wines to alter must quality characteristics and increase the concentration of simple sugars. The molecular processes that occur during withering are poorly understood, so a detailed transcriptomic analysis of post-harvest grape berries was carried out by AFLP-transcriptional profiling analysis. This will help to elucidate the molecular mechanisms of berry withering and will provide an opportunity to select markers that can be used to follow the drying process and evaluate different drying techniques. AFLP-TP identified 699 withering-specific genes, 167 and 86 of which were unique to off-plant and on-plant withering, respectively. Although similar molecular events were revealed in both withering processes, it was apparent that off-plant withering induced a stronger dehydration stress response resulting in the high level expression of genes involved in stress protection mechanisms, such as dehydrin and osmolite accumulation. Genes involved in hexose metabolism and transport, cell wall composition, and secondary metabolism (particularly the phenolic and terpene compound pathways) were similarly regulated in both processes. This work provides the first comprehensive analysis of the molecular events underpinning post-harvest withering and could help to define markers for different withering processes. PMID:19010774
Molecular analysis of post-harvest withering in grape by AFLP transcriptional profiling.
Zamboni, Anita; Minoia, Leone; Ferrarini, Alberto; Tornielli, Giovanni Battista; Zago, Elisa; Delledonne, Massimo; Pezzotti, Mario
2008-01-01
Post-harvest withering of grape berries is used in the production of dessert and fortified wines to alter must quality characteristics and increase the concentration of simple sugars. The molecular processes that occur during withering are poorly understood, so a detailed transcriptomic analysis of post-harvest grape berries was carried out by AFLP-transcriptional profiling analysis. This will help to elucidate the molecular mechanisms of berry withering and will provide an opportunity to select markers that can be used to follow the drying process and evaluate different drying techniques. AFLP-TP identified 699 withering-specific genes, 167 and 86 of which were unique to off-plant and on-plant withering, respectively. Although similar molecular events were revealed in both withering processes, it was apparent that off-plant withering induced a stronger dehydration stress response resulting in the high level expression of genes involved in stress protection mechanisms, such as dehydrin and osmolite accumulation. Genes involved in hexose metabolism and transport, cell wall composition, and secondary metabolism (particularly the phenolic and terpene compound pathways) were similarly regulated in both processes. This work provides the first comprehensive analysis of the molecular events underpinning post-harvest withering and could help to define markers for different withering processes.
Identification of Genes Related to Paulownia Witches’ Broom by AFLP and MSAP
Cao, Xibing; Fan, Guoqiang; Deng, Minjie; Zhao, Zhenli; Dong, Yanpeng
2014-01-01
DNA methylation is believed to play important roles in regulating gene expression in plant growth and development. Paulownia witches’ broom (PaWB) infection has been reported to be related to gene expression changes in paulownia plantlets. To determine whether DNA methylation is associated with gene expression changes in response to phytoplasma, we investigated variations in genomic DNA sequence and methylation in PaWB plantlets treated with methyl methane sulfonate (MMS) using amplified fragment length polymorphism (AFLP) and methylation-sensitive amplification polymorphism (MSAP) techniques, respectively. The results indicated that PaWB seedings recovered a normal morphology after treatment with more than 15 mg·L−1 MMS. PaWB infection did not cause changes of the paulownia DNA sequence at the AFLP level; However, DNA methylation levels and patterns were altered. Quantitative real-time PCR (qRT-PCR) showed that three of the methylated genes were up-regulated and three were down-regulated in the MMS-treated PaWB plantlets that had regained healthy morphology. These six genes might be involved in transcriptional regulation, plant defense, signal transduction and energy. The possible roles of these genes in PaWB are discussed. The results showed that changes of DNA methylation altered gene expression levels, and that MSAP might help identify genes related to PaWB. PMID:25196603
Identification of genes related to Paulownia witches' broom by AFLP and MSAP.
Cao, Xibing; Fan, Guoqiang; Deng, Minjie; Zhao, Zhenli; Dong, Yanpeng
2014-08-21
DNA methylation is believed to play important roles in regulating gene expression in plant growth and development. Paulownia witches' broom (PaWB) infection has been reported to be related to gene expression changes in paulownia plantlets. To determine whether DNA methylation is associated with gene expression changes in response to phytoplasma, we investigated variations in genomic DNA sequence and methylation in PaWB plantlets treated with methyl methane sulfonate (MMS) using amplified fragment length polymorphism (AFLP) and methylation-sensitive amplification polymorphism (MSAP) techniques, respectively. The results indicated that PaWB seedings recovered a normal morphology after treatment with more than 15 mg·L(-1) MMS. PaWB infection did not cause changes of the paulownia DNA sequence at the AFLP level; However, DNA methylation levels and patterns were altered. Quantitative real-time PCR (qRT-PCR) showed that three of the methylated genes were up-regulated and three were down-regulated in the MMS-treated PaWB plantlets that had regained healthy morphology. These six genes might be involved in transcriptional regulation, plant defense, signal transduction and energy. The possible roles of these genes in PaWB are discussed. The results showed that changes of DNA methylation altered gene expression levels, and that MSAP might help identify genes related to PaWB.
Polyacid macromolecule primers
Sugama, Toshifumi.
1989-12-26
Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.
MARHOLD, KAROL; LIHOVÁ, JUDITA; PERNÝ, MARIÁN; BLEEKER, WALTER
2004-01-01
• Background and Aims Diploid representatives from the related polyploid complexes of Cardamine amara, C. pratensis and C. raphanifolia (Brassicaceae), were studied to elucidate phylogenetic relationships among the complexes and among the individual taxa included. • Methods Two independent molecular data sets were used: nucleotide sequences from the internal transcribed spacers (ITS) of nrDNA, and amplified fragment length polymorphism (AFLP) markers. Seventeen diploid taxa from the studied groups were sampled. • Key Results Both ITS and AFLP analyses provided congruent results in inferred relationships, and revealed two main lineages. While the C. amara group, consisting of C. wiedemanniana and four subspecies of C. amara, was resolved as a well‐supported monophyletic group, taxa from the C. pratensis and C. tenera groups (the latter representing diploid taxa of the complex of C. raphanifolia) all appeared together in a single clade/cluster with no support for the recognition of either of the groups. Intra‐individual polymorphisms and patterns of nucleotide variation in the ITS region in C. uliginosa and C. tenera, together with the distribution of AFLP bands, indicate ancient hybridization and introgression among these Caucasian diploids. • Conclusions The lack of supported hierarchical structure suggests that extensive reticulate evolution between these groups, even at the diploid level, has occurred (although an alternative explanation, namely ancestral polymorphism in ITS data, cannot be completely excluded). Several implications for the investigation of the polyploid complexes of concern are drawn. When tracing origins of polyploid taxa, a much more complex scenario should be expected, taking into account all relatives as potential parents, irrespective of the group in which they are classified. PMID:15037449
Genetic diversity analysis of common beans based on molecular markers
Gill-Langarica, Homar R.; Muruaga-Martínez, José S.; Vargas-Vázquez, M.L. Patricia; Rosales-Serna, Rigoberto; Mayek-Pérez, Netzahualcoyotl
2011-01-01
A core collection of the common bean (Phaseolus vulgaris L.), representing genetic diversity in the entire Mexican holding, is kept at the INIFAP (Instituto Nacional de Investigaciones Forestales, Agricolas y Pecuarias, Mexico) Germplasm Bank. After evaluation, the genetic structure of this collection (200 accessions) was compared with that of landraces from the states of Oaxaca, Chiapas and Veracruz (10 genotypes from each), as well as a further 10 cultivars, by means of four amplified fragment length polymorphisms (AFLP) +3/+3 primer combinations and seven simple sequence repeats (SSR) loci, in order to define genetic diversity, variability and mutual relationships. Data underwent cluster (UPGMA) and molecular variance (AMOVA) analyses. AFLP analysis produced 530 bands (88.5% polymorphic) while SSR primers amplified 174 alleles, all polymorphic (8.2 alleles per locus). AFLP indicated that the highest genetic diversity was to be found in ten commercial-seed classes from two major groups of accessions from Central Mexico and Chiapas, which seems to be an important center of diversity in the south. A third group included genotypes from Nueva Granada, Mesoamerica, Jalisco and Durango races. Here, SSR analysis indicated a reduced number of shared haplotypes among accessions, whereas the highest genetic components of AMOVA variation were found within accessions. Genetic diversity observed in the common-bean core collection represents an important sample of the total Phaseolus genetic variability at the main Germplasm Bank of INIFAP. Molecular marker strategies could contribute to a better understanding of the genetic structure of the core collection as well as to its improvement and validation. PMID:22215964
Genetic diversity analysis of common beans based on molecular markers.
Gill-Langarica, Homar R; Muruaga-Martínez, José S; Vargas-Vázquez, M L Patricia; Rosales-Serna, Rigoberto; Mayek-Pérez, Netzahualcoyotl
2011-10-01
A core collection of the common bean (Phaseolus vulgaris L.), representing genetic diversity in the entire Mexican holding, is kept at the INIFAP (Instituto Nacional de Investigaciones Forestales, Agricolas y Pecuarias, Mexico) Germplasm Bank. After evaluation, the genetic structure of this collection (200 accessions) was compared with that of landraces from the states of Oaxaca, Chiapas and Veracruz (10 genotypes from each), as well as a further 10 cultivars, by means of four amplified fragment length polymorphisms (AFLP) +3/+3 primer combinations and seven simple sequence repeats (SSR) loci, in order to define genetic diversity, variability and mutual relationships. Data underwent cluster (UPGMA) and molecular variance (AMOVA) analyses. AFLP analysis produced 530 bands (88.5% polymorphic) while SSR primers amplified 174 alleles, all polymorphic (8.2 alleles per locus). AFLP indicated that the highest genetic diversity was to be found in ten commercial-seed classes from two major groups of accessions from Central Mexico and Chiapas, which seems to be an important center of diversity in the south. A third group included genotypes from Nueva Granada, Mesoamerica, Jalisco and Durango races. Here, SSR analysis indicated a reduced number of shared haplotypes among accessions, whereas the highest genetic components of AMOVA variation were found within accessions. Genetic diversity observed in the common-bean core collection represents an important sample of the total Phaseolus genetic variability at the main Germplasm Bank of INIFAP. Molecular marker strategies could contribute to a better understanding of the genetic structure of the core collection as well as to its improvement and validation.
Limited-life cartridge primers
Makowiecki, Daniel M.; Rosen, Robert S.
1998-01-01
A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.
Limited-life cartridge primers
Makowiecki, Daniel M.; Rosen, Robert S.
2005-04-19
A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.
Limited-life cartridge primers
Makowiecki, D.M.; Rosen, R.S.
1998-06-30
A cartridge primer is described which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML`s would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers. 10 figs.
Linares, Carlos; Colom, María Francisca; Torreblanca, Marina; Esteban, Violeta; Romera, Álvaro; Hagen, Ferry
2015-01-01
Cryptococcus gattii is a pathogenic basidiomycetous yeast that is emerging in temperate climate zones worldwide. C. gattii has repetitively been isolated from numerous tree species. Ongoing environmental sampling and molecular characterization is essential to understand the presence of this primary pathogenic microorganism in the Mediterranean environment. To report the first isolation of the rare C. gattii genotype AFLP7/VGIV from the environment in Europe. Samples were collected from woody debris of carob trees (Ceratonia siliqua) and olive trees (Olea europaea) in El Perelló, Tarragona, Spain. Cryptococcus species were further characterized by using URA5-RFLP, MALDI-TOF, AFLP and MLST. The antifungal susceptibility profile to amphotericin B, 5-fluorocytosine, fluconazole, itraconazole, posaconazole and voriconazole was determined using Sensititre Yeast One and E-test. Cultures from one carob tree revealed the presence of ten Cryptococcus-like colonies. One colony was identified as C. gattii, and subsequent molecular characterization showed that it was an α mating-type that belonged to the rare genotype AFLP7/VGIV. Antifungal susceptibility testing showed values within the range of sensitivity described for other isolates of the same genotype and within the epidemiological cutoff values for this species. The isolation of the rare C. gattii genotype AFLP7/VGIV in Spain is the first report in the European environment, implying the possible presence in other regions of the Mediterranean area, and underlines that clinicians must be aware for C. gattii infections in healthy individuals. Copyright © 2014 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.
Takahashi, Hiroshi; Møller, Peter R; Shedko, Sergei V; Ramatulla, Temirbekov; Joen, Sang-Rin; Zhang, Chun-Guang; Sideleva, Valentina G; Takata, Keisuke; Sakai, Harumi; Goto, Akira; Nishida, Mutsumi
2016-06-01
Pungitius is a highly diversified genus of sticklebacks (Gasterosteidae) occurring widely in northern parts of the Northern Hemisphere. Several ecologically and genetically divergent types that are largely isolated reproductively but occasionally hybridize in sympatry have been discovered in Northeast Asia, although the taxonomy and evolutionary relationships among them remain unclear. We used amplified fragment length polymorphism (AFLP) and mitochondrial DNA (mtDNA) markers to infer phylogenies among individuals collected from sympatric and allopatric populations, including the type localities of the described species. Phylogenetic analyses based on 2683 polymorphic AFLP loci confirmed seven species, each of which (except for one entirely allopatric species P. platygaster) was clearly differentiated from one or two other sympatric species and constituted a highly supported monophyletic clade with conspecific allopatric populations. The phylogeny showed that two lineages arose early; one gave rise to two species (circumpolar species P. pungitius and Paratethys species P. platygaster) and the other to five species endemic to Northeast Asia (P. sinensis, P. tymensis, P. polyakovi, P. kaibarae, and P. bussei). The brackish-water, freshwater, and Omono types previously discovered in Japan were reidentified as P. pungitius, P. sinensis, and P. kaibarae, respectively. A marked incongruence was noted between the phylogenies of AFLP and mtDNA markers, suggesting the occasional occurrence of hybridization and mtDNA introgression among distinct species. Our results highlight that the marginal seas of Northeast Asia played a key role as barriers to or facilitators of gene flow in the evolution of species diversity of Pungitius concentrated in this region. Copyright © 2016 Elsevier Inc. All rights reserved.
A primer on the hormone-free interval for combined oral contraceptives.
Hauck, Brian A; Brown, Vivien
2015-01-01
The dosing, schedules, and other aspects of combined oral contraceptive (COC) design have evolved in recent years to address a variety of issues including short- and long-term safety, bleeding profiles, and contraceptive efficacy. In particular, several newer formulations have altered the length of the hormone-free interval (HFI), in order to minimize two key undesired effects that occur during this time: hormone-withdrawal-associated symptoms (HWaS) and follicular development. This primer reviews our current understanding of the key biological processes that occur during the HFI and how this understanding has led to changes in the dosing and schedule of newer COC formulations. In brief, HWaS are common, underappreciated, and a likely contributor to COC discontinuation; because of this, shortening the HFI and/or supplementing with estrogen during the progestin-free interval may provide relief from these symptoms and improve adherence. A short HFI (with or without estrogen supplementation) may also help maintain effective follicular suppression and contraceptive efficacy, even when the overall dose of estrogen throughout the cycle is low. Taken together, the available data about HWaS and follicular activity during the HFI support the rationale for recent COC designs that use a low estrogen dose and a short HFI. The availability of a variety of COC regimens gives physicians a range of choices when selecting the most appropriate COC for each woman's particular priorities and needs.
VizPrimer: a web server for visualized PCR primer design based on known gene structure.
Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang
2011-12-15
The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.
Ganeshan, Seedhabadee; Sharma, Pallavi; Young, Lester; Kumar, Ashwani; Fowler, D Brian; Chibbar, Ravindra N
2011-03-01
Low-temperature (LT) tolerance in winter wheat (Triticum aestivum L.) is an economically important but complex trait. Four selected wheat genotypes, a winter hardy cultivar, Norstar, a tender spring cultivar, Manitou and two near-isogenic lines with Vrn-A1 (spring Norstar) and vrn-A1 (winter Manitou) alleles of Manitou and Norstar were cold-acclimated at 6°C and crown and leaf tissues were collected at 0, 2, 14, 21, 35, 42, 56 and 70 days of cold acclimation. cDNA-AFLP profiling was used to determine temporal expression profiles of transcripts during cold-acclimation in crown and leaf tissues, separately to determine if LT regulatory circuitries in crown and leaf tissues could be delineated using this approach. Screening 64 primer combinations identified 4,074 and 2,757 differentially expressed transcript-derived fragments (TDFs) out of which 38 and 16% were up-regulated as compared to 3 and 6% that were down-regulated in crown and leaf tissues, respectively. DNA sequencing of TDFs revealed sequences common to both tissues including genes coding for DEAD-box RNA helicase, choline-phosphate cytidylyltransferase and delta-1-pyrroline carboxylate synthetase. TDF specific to crown tissues included genes coding for phospahtidylinositol kinase, auxin response factor protein and brassinosteroid insensitive 1-associated receptor kinase. In leaf, genes such as methylene tetrahydrofolate reductase, NADH-cytochrome b5 reductase and malate dehydrogenase were identified. However, 30 and 14% of the DNA sequences from the crown and leaf tissues, respectively, were hypothetical or unknown proteins. Cluster analysis of up-, down-regulated and unique TDFs, DNA sequence and real-time PCR validation, infer that mechanisms operating in crown and leaf tissue in response to LT are differently regulated and warrant further studies.
Xing, Lei; Liu, Xue-Mei
2012-02-01
Birch (Betula platyphylla), an eminent tree species in Northeast and Inner Mongolia of China, has been widely used in architecture, furniture, and paper making in recent years. In order to retrieve genes involved in early development of B. platyphylla male inflorescence, RNA populations extracted from early and late developmental stage were analyzed by cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) technique. Following amplification of 256 pairs of primer combinations, ~7000 fragments were generated, of which 350 transcripts expressing more in early stage than late. Of 350 specific transcripts, 198 clear and reproducible electrophoresis bands were retrieved and sequenced successfully, 74 of them (37%) showing significant homologies to known genes after GO annotation. Majority of the predicted gene products were involved in metabolism (24.56%), cellular process (27.19%), response to stimulus (11.4%) and cell growth (8.7%). Transcripts ME56, ME108, ME206 and ME310, representing metabolism, cellular process, response to stimulus and cell growth, respectively, were selected for further study to validate cDNA-AFLP expression patterns via RT-PCR and qRT-PCR analysis. RT-PCR and qRT-PCR expression pattern results were consistent with cDNA-AFLP analysis results.
Space environment induced mutations prefer to occur at polymorphic sites of rice genomes
NASA Astrophysics Data System (ADS)
Li, Y.; Liu, M.; Cheng, Z.; Sun, Y.
To explore the genomic characteristics of rice mutants induced by space environment, space-induced mutants 971-5, 972-4, and R955, which acquired new traits after space flight such as increased yield, reduced resistance to rice blast, and semi-dwarfism compared with their on-ground controls, 971ck, 972ck, and Bing95-503, respectively, together with other 8 japonica and 3 indica rice varieties, 17 in total, were analyzed by amplified fragment length polymorphism (AFLP) method. We chose 16 AFLP primer-pairs which generated a total of 1251 sites, of which 745 (59.6%) were polymorphic over all the genotypes. With the 16 pairs of primer combinations, 54 space-induced mutation sites were observed in 971-5, 86 in 972-4, and 5 in R955 compared to their controls, and the mutation rates were 4.3%, 6.9% and 0.4%, respectively. Interestingly, 75.9%, 84.9% and 100% of the mutation sites identified in 971-5, 972-4, and R955 occurred in polymorphic sites. This result suggests that the space environment preferentially induced mutations at polymorphic sites in rice genomes and might share a common mechanism with other types of mutagens. It also implies that polymorphic sites in genomes are potential "hotspots" for mutations induced by the space environment.
Lee, J C; Cole, M; Linacre, A
2000-05-01
Unambiguous identification of the hallucinogenic fungi of the genera Psilocybe and Panaeolus is required by national and international drug control legislation. We report on a DNA-based test using the technique of amplified fragment length polymorphism (AFLP). AFLP can differentiate species of the two genera Psilocybe and Panaeolus by using different primer sets. The identification of hallucinogenic fungi using a DNA-based test, which can be used in conjunction with morphological features, will assist in forensic investigations.
Code of Federal Regulations, 2011 CFR
2011-07-01
... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection of...-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? If your...
Code of Federal Regulations, 2010 CFR
2010-07-01
... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection of...-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? If your...
Elsheikha, H. M.; Schott, H. C.; Mansfield, L. S.
2006-01-01
Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelphis virginiana), and one isolate was from a cowbird (Molothrus ater). Additionally, four outgroup taxa were also fingerprinted. Nine primer pairs were used to generate AFLP patterns, with a total number of amplified fragments ranging from 30 to 60, depending on the isolate and primers tested. Based on the presence/absence of amplified AFLP fragments and pairwise similarity values, all the S. neurona isolates tested were clustered in one monophyletic group. No significant correlation could be found between genomic similarity and host origin of the S. neurona isolates. AFLP revealed significant intraspecific genetic variations, and S. neurona appeared as a highly variable species. Furthermore, linkage disequilibrium analysis suggested that S. neurona populations within Michigan have an intermediate type of population structure that includes characteristics of both clonal and panamictic population structures. AFLP is a reliable molecular technique that has provided one of the most informative approaches to ascertain phylogenetic relationships in S. neurona and its closest relatives, allowing them to be clustered by relative similarity using band matching and unweighted pair group method with arithmetic mean analysis, which may be applicable to other related protozoal species. PMID:16714575
Elsheikha, H M; Schott, H C; Mansfield, L S
2006-06-01
Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelphis virginiana), and one isolate was from a cowbird (Molothrus ater). Additionally, four outgroup taxa were also fingerprinted. Nine primer pairs were used to generate AFLP patterns, with a total number of amplified fragments ranging from 30 to 60, depending on the isolate and primers tested. Based on the presence/absence of amplified AFLP fragments and pairwise similarity values, all the S. neurona isolates tested were clustered in one monophyletic group. No significant correlation could be found between genomic similarity and host origin of the S. neurona isolates. AFLP revealed significant intraspecific genetic variations, and S. neurona appeared as a highly variable species. Furthermore, linkage disequilibrium analysis suggested that S. neurona populations within Michigan have an intermediate type of population structure that includes characteristics of both clonal and panamictic population structures. AFLP is a reliable molecular technique that has provided one of the most informative approaches to ascertain phylogenetic relationships in S. neurona and its closest relatives, allowing them to be clustered by relative similarity using band matching and unweighted pair group method with arithmetic mean analysis, which may be applicable to other related protozoal species.
Low-copy nuclear primers and ycf1 primers in Cactaceae.
Franck, Alan R; Cochrane, Bruce J; Garey, James R
2012-10-01
To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.
Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.
2012-01-01
DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820
Electro-Deposited Primer Development and Low-Polluting Primer Evaluation
1989-08-01
in the use of spray-applied primers are nonuniform corrosion protection, poor control of primer thickness, and variable strength of the adhesive bond...AL=)r- U’) LA C) .LAV) . L" () - C:’. L L :0 3c’. ) %D r- LAIr - LA I r-.%D ’D( o oDt- LA Ln DLI m to r- 0 0l- I cn M - in C.0 CD I (n m~ : c) = I V
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.
M. -S. Kim; N. B. Klopfenstein; J. W. Hanna; G. I. McDonald
2006-01-01
Phylogenetic and genetic relationships among 10 North American Armillaria species were analysed using sequence data from ribosomal DNA (rDNA), including intergenic spacer (IGS-1), internal transcribed spacers with associated 5.8S (ITS + 5.8S), and nuclear large subunit rDNA (nLSU), and amplified fragment length polymorphism (AFLP) markers. Based on rDNA sequence data,...
Sex Stereotyping in Mexican Reading Primers.
ERIC Educational Resources Information Center
Heathcote, Olivia
A study was conducted comparing the sex stereotypes present in selected Mexican reading primers published in 1960 with those present in primers published in 1972 to determine whether any significant changes in sex stereotyping were reflected in the 1972 primers. Comparisons were made between four primers published in 1960 for grades one through…
Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou
2016-11-01
It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.
van der Wal, Fimme J.; Achterberg, René P.; van Solt-Smits, Conny; Bergervoet, Jan H. W.; de Weerdt, Marjanne; Wisselink, Henk J.
2017-01-01
We investigated the feasibility of an assay based on target-specific primer extension, combined with a suspension array, for the multiplexed detection and typing of a veterinary pathogen in animal samples, using Streptococcus suis as a model pathogen. A procedure was established for simultaneous detection of 6 S. suis targets in pig tonsil samples (i.e., 4 genes associated with serotype 1, 2, 7, or 9, the generic S. suis glutamate dehydrogenase gene [gdh], and the gene encoding the extracellular protein factor [epf]). The procedure was set up as a combination of protocols: DNA isolation from porcine tonsils, a multiplex PCR, a multiplex target-specific primer extension, and finally a suspension array as the readout. The resulting assay was compared with a panel of conventional PCR assays. The proposed multiplex assay can correctly identify the serotype of isolates and is capable of simultaneous detection of multiple targets in porcine tonsillar samples. The assay is not as sensitive as the current conventional PCR assays, but with the correct sampling strategy, the assay can be useful for screening pig herds to establish which S. suis serotypes are circulating in a pig population. PMID:28980519
USDA-ARS?s Scientific Manuscript database
DNA-based marker analysis of plant genebank material has become a useful tool in the evaluation of levels of genetic diversity and for the informed use and maintenance of germplasm. In this study we quantify levels of Amplified Fragment Length Polymorphism (AFLP) in representative accessions of wild...
Output testing of small-arms primers
NASA Technical Reports Server (NTRS)
Bement, Laurence J.; Doris, Thomas A.; Schimmel, Morry L.
1991-01-01
The performance of two standard primers for initiating small-caliber ammunition are compared to that of a primer for initiating aircraft escape-system components. Three testing methods are employed including: (1) firing the primer to measure total energy delivered; (2) monitoring output in terms of gaseous product-mass flow rate and pressure as a function of time; and (3) firing the primer onto ignition material to study gas pressure produced during ignition and burning as a function of time. The results of the test demonstrate differences in the ignitability factors of the standard primers and time peak pressures of less than 100 microseconds. One unexpected result is that two percussion primers (the FA-41 and the M42C1) developed for different applications have the same ignitability. The ignitability test method is shown to yield the most useful data and can be used to specify percussion primers and optimize their performance.
Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.
Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela
2014-08-01
Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.
Pauthenier, Cyrille; Faulon, Jean-Loup
2014-07-01
PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch. PMID:21917859
CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.
Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei
2015-07-01
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.
Adamiak, Paul; Vanderkooi, Otto G; Kellner, James D; Schryvers, Anthony B; Bettinger, Julie A; Alcantara, Joenel
2014-06-03
Multi-locus sequence typing (MLST) is a portable, broadly applicable method for classifying bacterial isolates at an intra-species level. This methodology provides clinical and scientific investigators with a standardized means of monitoring evolution within bacterial populations. MLST uses the DNA sequences from a set of genes such that each unique combination of sequences defines an isolate's sequence type. In order to reliably determine the sequence of a typing gene, matching sequence reads for both strands of the gene must be obtained. This study assesses the ability of both the standard, and an alternative set of, Streptococcus pneumoniae MLST primers to completely sequence, in both directions, the required typing alleles. The results demonstrated that for five (aroE, recP, spi, xpt, ddl) of the seven S. pneumoniae typing alleles, the standard primers were unable to obtain the complete forward and reverse sequences. This is due to the standard primers annealing too closely to the target regions, and current sequencing technology failing to sequence the bases that are too close to the primer. The alternative primer set described here, which includes a combination of primers proposed by the CDC and several designed as part of this study, addresses this limitation by annealing to highly conserved segments further from the target region. This primer set was subsequently employed to sequence type 105 S. pneumoniae isolates collected by the Canadian Immunization Monitoring Program ACTive (IMPACT) over a period of 18 years. The inability of several of the standard S. pneumoniae MLST primers to fully sequence the required region was consistently observed and is the result of a shift in sequencing technology occurring after the original primers were designed. The results presented here introduce clear documentation describing this phenomenon into the literature, and provide additional guidance, through the introduction of a widely validated set of alternative
Pfeiffer, Tanja; Roschanski, Anna M; Pannell, John R; Korbecka, Grazyna; Schnittler, Martin
2011-01-01
For many applications in population genetics, codominant simple sequence repeats (SSRs) may have substantial advantages over dominant anonymous markers such as amplified fragment length polymorphisms (AFLPs). In high polyploids, however, allele dosage of SSRs cannot easily be determined and alleles are not easily attributable to potentially diploidized loci. Here, we argue that SSRs may nonetheless be better than AFLPs for polyploid taxa if they are analyzed as effectively dominant markers because they are more reliable and more precise. We describe the transfer of SSRs developed for diploid Mercurialis huetii to the clonal dioecious M. perennis. Primers were tested on a set of 54 male and female plants from natural decaploid populations. Eight of 65 tested loci produced polymorphic fragments. Binary profiles from 4 different scoring routines were used to define multilocus lineages (MLLs). Allowing for fragment differences within 1 MLL, all analyses revealed the same 14 MLLs without conflicting with merigenet, sex, or plot assignment. For semiautomatic scoring, a combination of as few as 2 of the 4 most polymorphic loci resulted in unambiguous discrimination of clones. Our study demonstrates that microsatellite fingerprinting of polyploid plants is a cost efficient and reliable alternative to AFLPs, not least because fewer loci are required than for diploids.
Ratchadaporn, Janthasri; Sureeporn, Katengam; Khumcha, U
2007-09-15
The experiment was carried out at the Department of Horticulture, Ubon Ratchathani University, Ubon Ratchathani province, Northeast Thailand during June 2002 to May 2003 aims to identify DNA fingerprints of thirty papaya cultivars with the use of Amplified Fragment Length Polymorphisms (AFLP) technique. Papaya cultivars were collected from six different research centers in Thailand. Papaya plants of each cultivar were grown under field conditions up to four months then leaf numbers 2 and 3 of each cultivar (counted from top) were chosen for DNA extraction and the samples were used for AFLP analysis. Out of 64 random primers being used, 55 pairs gave an increase in DNA bands but only 12 pairs of random primers were randomly chosen for the final analysis of the experiment. The results showed that AFLP markers gave Polymorphic Information Contents (PIC) of three ranges i.e., AFLP markers of 235 lied on a PIC range of 0.003-0.05, 47 for a PIC range of 0.15-0.20 and 12 for a PIC range of 0.35-0.40. The results on dendrogram cluster analysis revealed that the thirty papaya cultivars were classified into six groups i.e., (1) Kaeg Dum and Malador (2) Kaeg Nuan (3) Pakchong and Solo (4) Taiwan (5) Co Coa Hai Nan and (6) Sitong. Nevertheless, in spite of the six papaya groups all papaya cultivars were genetically related to each other where diversity among the cultivars was not significantly found.
Alonso, Sergio; Suzuki, Koichi; Yamamoto, Fumiichiro; Perucho, Manuel
2018-01-01
Somatic, and in a minor scale also germ line, epigenetic aberrations are fundamental to carcinogenesis, cancer progression, and tumor phenotype. DNA methylation is the most extensively studied and arguably the best understood epigenetic mechanisms that become altered in cancer. Both somatic loss of methylation (hypomethylation) and gain of methylation (hypermethylation) are found in the genome of malignant cells. In general, the cancer cell epigenome is globally hypomethylated, while some regions-typically gene-associated CpG islands-become hypermethylated. Given the profound impact that DNA methylation exerts on the transcriptional profile and genomic stability of cancer cells, its characterization is essential to fully understand the complexity of cancer biology, improve tumor classification, and ultimately advance cancer patient management and treatment. A plethora of methods have been devised to analyze and quantify DNA methylation alterations. Several of the early-developed methods relied on the use of methylation-sensitive restriction enzymes, whose activity depends on the methylation status of their recognition sequences. Among these techniques, methylation-sensitive amplification length polymorphism (MS-AFLP) was developed in the early 2000s, and successfully adapted from its original gel electrophoresis fingerprinting format to a microarray format that notably increased its throughput and allowed the quantification of the methylation changes. This array-based platform interrogates over 9500 independent loci putatively amplified by the MS-AFLP technique, corresponding to the NotI sites mapped throughout the human genome.
C. Mae Culumber; Steve R. Larson; Kevin B. Jensen; Thomas A. Jones
2011-01-01
Leymus is a genomically defined allopolyploid of genus Triticeae with two distinct subgenomes. Chloroplast DNA sequences of Eurasian and North American species are distinct and polyphyletic. However, phylogenies derived from chloroplast and nuclear DNA sequences are confounded by polyploidy and lack of polymorphism among many taxa. The AFLP technique can resolve...
Housley, Donna JE; Zalewski, Zachary A; Beckett, Stephanie E; Venta, Patrick J
2006-01-01
Background Cross-species primers have been used with moderate success to address a variety of questions concerning genome structure, evolution, and gene function. However, the factors affecting their success have never been adequately addressed, particularly with respect to producing a consistent method to achieve high throughput. Using 1,147 mammalian cross-species primer pairs (1089 not previously reported), we tested several factors to determine their influence on the probability that a given target will amplify in a given species under a single amplification condition. These factors included: number of mismatches between the two species (the index species) used to identify conserved regions to which the primers were designed, GC-content of the gene and amplified region, CpG dinucleotides in the primer region, degree of encoded protein conservation, length of the primers, and the degree of evolutionary distance between the target species and the two index species. Results The amplification success rate for the cross-species primers was significantly influenced by the number of mismatches between the two index species (6–8% decrease per mismatch in a primer pair), the GC-content within the amplified region (for the dog, GC ≥ 50%, 56.9% amplified; GC<50%, 74.2% amplified), the degree of protein conservation (R2 = 0.14) and the relatedness of the target species to the index species. For the dog, 598 products of 930 primer pairs (64.3%) (excluding primers in which dog was an index species) were sequenced and shown to be the expected product, with an additional three percent producing the incorrect sequence. When hamster DNA was used with the single amplification condition in a microtiter plate-based format, 510 of 1087 primer pairs (46.9%) produced amplified products. The primer pairs are spaced at an average distance of 2.3 Mb in the human genome and may be used to produce up to several hundred thousand bp of species-specific sequence. Conclusion The most
An Investigation to Improve Quality Evaluations of Primers and Propellant for 20mm Munitions
NASA Technical Reports Server (NTRS)
Bement, L. J.; Holmes, C.; McGrory, J.; Schimmel, M. L.
1997-01-01
To reduce the frequency of electrically initiated, 20mm munition hangfires (delayed ignitions), a joint Army/NASA investigation was conducted to recommend quality evaluation improvements for acceptance of both primers and gun propellant. This effort focused only on evaluating ignition and combustion performance as potential causes of hangfires: poor electrical initiation of the primer, low output performance of the primer, low ignition sensitivity of the gun propellant, and the effects of cold temperature. The goal was to determine the "best" of the Army and NASA test methods to assess the functional performance of primers and gun propellants. The approach was to evaluate the performance of both high-quality and deliberately defective primers to challenge the sensitivity of test methods. In addition, the ignition sensitivity of different manufacturing batches of gun propellants was evaluated. The results of the investigation revealed that improvements can be made in functional evaluations that can assist in identifying and reducing ignition and performance variations. The "best" functional evaluation of primers and propellant is achieved through a combination of both Army and NASA test methods. Incorporating the recommendations offered in this report may provide for considerable savings in reducing the number of cartridge firings, while significantly lowering the rejection rate of primer, propellant and cartridge lots. The most probable causes for ignition and combustion-related hangfires were the lack of calcium silicide in the primer mix, a low output performance of primers, and finally, poor ignition sensitivity of gun propellant. Cold temperatures further reduce propellant ignition sensitivity, as well as reducing burn rate and chamber pressures.
Analysis of short tandem repeat polymorphisms using infrared fluorescence with M18 tailed primers
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oetting, W.S.; Wiesner, G.; Laken, S.
The use of short tandem repeat polymorphisms (STRPs) are becoming increasingly important as markers for linkage analysis due to their large numbers of the human genome and their high degree of polymorphism. Fluorescence based detection of the STRP pattern using the LI-COR model 4000S automated DNA sequencer eliminates the need for radioactivity and produces a digitized image that can be used for the analysis of the polymorphisms. In an effort to reduce the cost of STRP analysis, we have synthesized primers with a 19 bp extension complementary to the sequence of the M13 primer on the 5{prime} end of onemore » of the two primers used in the amplification of the STRP instead of using primers with direct conjugation of the infrared fluorescent dye. Up to 5 primer pairs can be multiplexed together with the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye. Comparisons between primers that have been directly conjugated to the fluor with those having the M13 sequence extension show no difference in the ability to determine the STRP pattern. At present, the entire Weber 4A set of STRP markers is available with the M13 5{prime} extension. We are currently using this technique for linkage analysis of familial breast cancer and asthma. The combination of STRP analysis using fluorescence detection will allow this technique to be fully automated for allele scoring and linkage analysis.« less
30 CFR 56.6304 - Primer protection.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...
USDA-ARS?s Scientific Manuscript database
Salinity is an important environmental factor limiting growth and productivity of plants, and affects almost every aspect of the plant physiology and biochemistry. The objective of this study was to apply cDNA-AFLP and to identify differentially expressed genes in response to NaCl stress vs. no-stre...
KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bowman, Stephen M
2008-09-01
The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VImore » in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific
Pérez-Collazos, Ernesto; Catalán, Pilar
2006-04-01
Vella pseudocytisus subsp. paui (Cruciferae) is a narrow endemic plant to the Teruel province (eastern Spain), which is listed in the National Catalogue of Endangered Species. Two distinct ploidy levels (diploid, 2n = 34, and tetraploid, 2n = 68) have been reported for this taxon that belongs to the core subtribe Vellinae, a western Mediterranean group of shrubby taxa with a chromosome base number of x = 17. Allozyme and AFLP analyses were conducted (a) to test for the ploidy and putative palaeo-allopolyploid origin of this taxon, (b) to explore levels of genetic diversity and spatial structure of its populations, and (c) to address in-situ and ex-situ strategies for its conservation. Six populations that covered the entire geographical range of this taxon were sampled and examined for 19 allozyme loci and three AFLP primer pair combinations. In addition, the gametic progenies of five individuals were analysed for two allozyme loci that showed fixed heterozygosity. Multiple banded allozyme profiles for most of the surveyed loci indicated the polyploidy of this taxon. Co-inherited fixed heterozygous patterns were exhibited by the gametophytic tissues of the mother plants. Both allozyme and AFLP markers detected high levels of genetic diversity, and a strong micro-spatial genetic structure was recovered from AFLP phenetic analyses and Mantel correlograms. Allozyme data support the hypothesis of an allotetraploid origin of Vella pseudocytisus subsp. paui that could be representative of other taxa of the core Vellinae group. AFLP data distinguished three geographically distinct groups with no genetic interaction among them. Allotetraploidy and outcrossing reproduction have probably contributed to maintenance of high levels of genetic variability of the populations, whereas habitat fragmentation may have enhanced the high genetic isolation observed among groups. In-situ microgenetic reserves and a selective sampling of germplasm stocks for ex-situ conservation of this
Traceability of plant contribution in olive oil by amplified fragment length polymorphisms.
Pafundo, Simona; Agrimonti, Caterina; Marmiroli, Nelson
2005-09-07
Application of DNA molecular markers to traceability of foods is thought to bring new benefit to consumer's protection. Even in a complex matrix such as olive oil, DNA could be traced with PCR markers such as the amplified fragment length polymorphisms (AFLPs). In this work, fluorescent AFLPs were optimized for the characterization of olive oil DNA, to obtain highly reproducible, high-quality fingerprints, testing different parameters: the concentrations of dNTPs and labeled primer, the kind of Taq DNA polymerase and thermal cycler, and the quantity of DNA employed. It was found that correspondence of fingerprinting by comparing results in oils and in plants was close to 70% and that the DNA extraction from olive oil was the limiting step for the reliability of AFLP profiles, due to the complex matrix analyzed.
Basak, Supriyo; Ramesh, Aadi Moolam; Kesari, Vigya; Parida, Ajay; Mitra, Sudip; Rangan, Latha
2014-12-01
Molecular genetic fingerprints of eleven Hedychium species from Northeast India were developed using PCR based markers. Fifteen inter-simple sequence repeats (ISSRs) and five amplified fragment length polymorphism (AFLP) primers produced 547 polymorphic fragments. Positive correlation (r = 0.46) was observed between the mean genetic similarity and genetic diversity parameters at the inter-species level. AFLP and ISSR markers were able to group the species according to its altitude and intensity of flower aroma. Cophenetic correlation coefficients between the dendrogram and the original similarity matrix were significant for ISSR (r = 0.89) compared to AFLP (r = 0.83) markers. This genetic characterization of Hedychium from Northeast India contributes to the knowledge of genetic structure of the species and can be used to define strategies for their conservation and management.
De Vos, Stephanie; Bossier, Peter; Van Stappen, Gilbert; Vercauteren, Ilse; Sorgeloos, Patrick; Vuylsteke, Marnik
2013-01-01
We report on the construction of sex-specific linkage maps, the identification of sex-linked markers and the genome size estimation for the brine shrimp Artemia franciscana. Overall, from the analysis of 433 AFLP markers segregating in a 112 full-sib family we identified 21 male and 22 female linkage groups (2n = 42), covering 1,041 and 1,313 cM respectively. Fifteen putatively homologous linkage groups, including the sex linkage groups, were identified between the female and male linkage map. Eight sex-linked AFLP marker alleles were inherited from the female parent, supporting the hypothesis of a WZ–ZZ sex-determining system. The haploid Artemia genome size was estimated to 0.93 Gb by flow cytometry. The produced Artemia linkage maps provide the basis for further fine mapping and exploring of the sex-determining region and are a possible marker resource for mapping genomic loci underlying phenotypic differences among Artemia species. PMID:23469207
Nanotechnology: A Policy Primer
2010-03-12
clean water. Nanotechnology water desalination and filtration systems may offer affordable, scalable, and portable water filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...DATES COVERED 00-00-2010 to 00-00-2010 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c
Nanotechnology: A Policy Primer
2010-01-04
clean water. Nanotechnology water desalination and filtration systems may offer affordable, scalable, and portable water filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...DATES COVERED 00-00-2010 to 00-00-2010 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c
Plastid primers for angiosperm phylogenetics and phylogeography.
Prince, Linda M
2015-06-01
PCR primers are available for virtually every region of the plastid genome. Selection of which primer pairs to use is second only to selection of the genic region. This is particularly true for research at the species/population interface. Primer pairs for 130 regions of the chloroplast genome were evaluated in 12 species distributed across the angiosperms. Likelihood of amplification success was inferred based upon number and location of mismatches to target sequence. Intraspecific sequence variability was evaluated under three different criteria in four species. Many published primer pairs should work across all taxa sampled, with the exception of failure due to genomic reorganization events. Universal barcoding primers were the least likely to work (65% success). The list of most variable regions for use within species has little in common with the lists identified in prior studies. Published primer sequences should amplify a diversity of flowering plant DNAs, even those designed for specific taxonomic groups. "Universal" primers may have extremely limited utility. There was little consistency in likelihood of amplification success for any given publication across lineages or within lineage across publications.
The effect of zoledronate-containing primer on dentin bonding of a universal adhesive.
Zenobi, Walter; Feitosa, Victor Pinheiro; Moura, Maria Elisa Martins; D'arcangelo, Camillo; Rodrigues, Lidiany Karla de Azevedo; Sauro, Salvatore
2018-01-01
To evaluate the bonding ability and nanoleakage of a universal adhesive applied to dentin pre-treated using a zoledronate-containing primer (zol-primer) before and after mechanical load cycling. Flat dentin surfaces obtained from human molars were assigned to one of the following adhesion procedures (n=6): 1-Single Bond Universal (SBU) applied in etch-and-rinse mode; 2- SBU applied as etch-and-rinse after the application of zol-primer; 3- SBU applied in self-etch strategy; 4- SBU applied as self-etch after the use of zol-primer. Half of the specimens were processed for microtensile bond strength test after 24h, while the other half part was submitted to 200,000 mechanical cycles. Further specimens were silver-impregnated and assessed for interface nanoleakage by SEM. Data were analyzed with two-way ANOVA and Tukey's test (p<0.05). At 24h evaluation, the four groups presented similar bond strengths, whilst both groups bonded with etch-and-rinse technique showed significant bond strength reduction after mechanical load (p<0.05), with the highest drop in bond strength for the specimens pre-treated with the zol-primer. No negative effects were found for self-etch strategy (p>0.05) in microtensile test. Lower nanoleakage expression was observed for etch-and-rinse specimens treated with zol-primer. However, noteworthy reduction of adhesive layer thickness was observed when combining the zol-primer with the self-etch bonding approach. It can be concluded that zol-primer should not be used along with a universal adhesive in etch-and-rinse mode, but its application before self-etch application may provide less degradation of the resin-dentin interface. Copyright © 2017 Elsevier Ltd. All rights reserved.
PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences
Machida, Ryuji J.; Knowlton, Nancy
2012-01-01
Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets
Nanotechnology: A Policy Primer
2010-06-02
States of 24 million barrels of oil.3 • Universal access to clean water. Nanotechnology water desalination and filtration systems may offer...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...00-00-2010 to 00-00-2010 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT
Nanotechnology: A Policy Primer
2008-05-20
of oil.3 ! Universal access to clean water. Nanotechnology water desalination and filtration systems may offer affordable, scalable, and portable...Order Code RL34511 Nanotechnology : A Policy Primer May 20, 2008 John F. Sargent Specialist in Science and Technology Policy Resources, Science, and...REPORT DATE 20 MAY 2008 2. REPORT TYPE 3. DATES COVERED 00-00-2008 to 00-00-2008 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a
Cheng, Lei; Weir, Michael D.; Zhang, Ke; Arola, Dwayne D.; Zhou, Xuedong; Xu, Hockin H. K.
2013-01-01
Objectives The main reason for restoration failure is secondary caries caused by biofilm acids. Replacing the failed restorations accounts for 50–70% of all operative work. The objectives of this study were to incorporate a new quaternary ammonium monomer (dimethylaminododecyl methacrylate, DMADDM) and nanoparticles of silver (NAg) into a primer and an adhesive, and to investigate their effects on antibacterial and dentin bonding properties. Methods Scotchbond Multi-Purpose (SBMP) served as control. DMADDM was synthesized and incorporated with NAg into primer/adhesive. A dental plaque microcosm biofilm model with human saliva was used to investigate metabolic activity, colony-forming units (CFU), and lactic acid. Dentin shear bond strengths were measured. Results Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of the new DMADDM were orders of magnitude lower than those of a previous quaternary ammonium dimethacrylate (QADM). Uncured primer with DMADDM had much larger inhibition zones than QADM (p<0.05). Cured primer/adhesive with DMADDM-NAg greatly reduced biofilm metabolic activity (p<0.05). Combining DMADDM with NAg in primer/adhesive resulted in less CFU than DMADDM alone (p<0.05). Lactic acid production by biofilms was reduced by 20-fold via DMADDM-NAg, compared to control. Incorporation of DMADDM and NAg into primer/adhesive did not adversely affect dentin bond strength. Conclusions A new antibacterial monomer DMADDM was synthesized and incorporated into primer/adhesive for the first time. The bonding agents are promising to combat residual bacteria in tooth cavity and invading bacteria at tooth-restoration margins to inhibit caries. DMADDM and NAg are promising for use into a wide range of dental adhesive systems and restoratives. PMID:23353068
Genetic characterization of fig tree mutants with molecular markers.
Rodrigues, M G F; Martins, A B G; Desidério, J A; Bertoni, B W; Alves, M C
2012-08-06
The fig (Ficus carica L.) is a fruit tree of great world importance and, therefore, the genetic improvement becomes an important field of research for better crops, being necessary to gather information on this species, mainly regarding its genetic variability so that appropriate propagation projects and management are made. The improvement programs of fig trees using conventional procedures in order to obtain new cultivars are rare in many countries, such as Brazil, especially due to the little genetic variability and to the difficulties in obtaining plants from gamete fusion once the wasp Blastophaga psenes, responsible for the natural pollinating, is not found in Brazil. In this way, the mutagenic genetic improvement becomes a solution of it. For this reason, in an experiment conducted earlier, fig plants formed by cuttings treated with gamma ray were selected based on their agronomic characteristics of interest. We determined the genetic variability in these fig tree selections, using RAPD and AFLP molecular markers, comparing them to each other and to the Roxo-de-Valinhos, used as the standard. For the reactions of DNA amplification, 140 RAPD primers and 12 primer combinations for AFLP analysis were used. The selections did not differ genetically between themselves and between them and the Roxo-de-Valinhos cultivar. Techniques that can detect polymorphism between treatments, such as DNA sequencing, must be tested. The phenotypic variation of plants may be due to epigenetic variation, necessitating the use of techniques with methylation-sensitive restriction enzymes.
Patil, Tejas Suresh; Tamboli, Asif Shabodin; Patil, Swapnil Mahadeo; Bhosale, Amrut Ravindra; Govindwar, Sanjay Prabhu; Muley, Dipak Vishwanathrao
2016-01-01
Genus Nemacheilus, Nemachilichthys and Schistura belong to the family Nemacheilidae of the order Cypriniformes. The present investigation was undertaken to observe genetic diversity, phylogenetic relationship and to develop a molecular-based tool for taxonomic identification. For this purpose, four different types of molecular markers were utilized in which 29 random amplified polymorphic DNA (RAPD), 25 inter-simple sequence repeat (ISSR) markers, and 10 amplified fragment length polymorphism (AFLP) marker sets were screened and mitochondrial COI gene was sequenced. This study added COI barcodes for the identification of Nemacheilus anguilla, Nemachilichthys rueppelli and Schistura denisoni. RAPD showed higher polymorphism (100%) than the ISSR (93.75-100%) and AFLP (93.86-98.96%). The polymorphic information content (PIC), heterozygosity, multiplex ratio, and gene diversity was observed highest for AFLP primers, whereas the major allele frequency was observed higher for RAPD (0.5556) and lowest for AFLP (0.1667). The COI region of all individuals was successfully amplified and sequenced, which gave a 100% species resolution. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.
Bryan, Glenn J.; McLean, Karen; Waugh, Robbie; Spooner, David M.
2017-01-01
DNA-based marker analysis of plant genebank material has become a useful tool in the evaluation of levels of genetic diversity and for the informed use and maintenance of germplasm. In this study, we quantify levels of amplified fragment length polymorphism (AFLP) in representative accessions of wild and cultivated potato species of differing geographic origin, ploidy, and breeding system. We generated 449 polymorphic AFLP fragments in 619 plants, representing multiple plants (16–23) from 17 accessions of 14 potato taxa as well as single plants sampled from available accessions (from 3 to 56) of the same 14 taxa. Intra-accession diversities were compared to those of a synthetic ‘taxon-wide’ population comprising a single individual from a variable number of available accessions of each sampled taxon. Results confirm the expected considerably lower levels of polymorphism within accessions of self-compatible as compared to self-incompatible taxa. We observed broadly similar levels of ‘taxon-wide’ polymorphism among self-compatible and self-incompatible species, with self-compatible taxa showing only slightly lower rates of polymorphism. The most diverse accessions were the two cultivated potato accessions examined, the least diverse being the Mexican allohexaploids Solanum demissum and S. iopetalum. Generally allopolyploid self-compatible accessions exhibited lower levels of diversity. Some purported self-incompatible accessions showed relatively low levels of marker diversity, similar to the more diverse self-compatible material surveyed. Our data indicate that for self-compatible species a single plant is highly representative of a genebank accession. The situation for self-incompatible taxa is less clear, and sampling strategies used will depend on the type of investigation. These results have important implications for those seeking novel trait variation (e.g., disease resistance) in gene banks as well as for the selection of individuals for genomics
Analysis of genetic variation in Ganoderma Lucidum after space flight
NASA Astrophysics Data System (ADS)
Qi, Jian-Jun; Ma, Rong-Cai; Chen, Xiang-Dong; Lan, Jin
A modified CTAB method was used in the extraction of total cellular DNA of Ganoderma lucidum. Four strains Cx, Ch, C3 and C4, and their counterparts, four space flown strains Sx, Xh, S3 and S4, were analysed by amplified fragment length polymorphism (AFLP) with several primer combinations. Polymorphic bands were detected between Sx and Cx, S3 and C3, respectively. Somatic incompatibility tests further confirmed their heterogeneity. However, no disparity between Sh and Ch, S4 and C4 was detectable. The results suggest that spaceflight may be used to accelerate breeding of Ganoderma lucidum strains for commercial cultivation.
Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi
2018-01-01
Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.
2018-01-01
Abstract Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study. PMID:29742254
A multiplex primer design algorithm for target amplification of continuous genomic regions.
Ozturk, Ahmet Rasit; Can, Tolga
2017-06-19
Targeted Next Generation Sequencing (NGS) assays are cost-efficient and reliable alternatives to Sanger sequencing. For sequencing of very large set of genes, the target enrichment approach is suitable. However, for smaller genomic regions, the target amplification method is more efficient than both the target enrichment method and Sanger sequencing. The major difficulty of the target amplification method is the preparation of amplicons, regarding required time, equipment, and labor. Multiplex PCR (MPCR) is a good solution for the mentioned problems. We propose a novel method to design MPCR primers for a continuous genomic region, following the best practices of clinically reliable PCR design processes. On an experimental setup with 48 different combinations of factors, we have shown that multiple parameters might effect finding the first feasible solution. Increasing the length of the initial primer candidate selection sequence gives better results whereas waiting for a longer time to find the first feasible solution does not have a significant impact. We generated MPCR primer designs for the HBB whole gene, MEFV coding regions, and human exons between 2000 bp to 2100 bp-long. Our benchmarking experiments show that the proposed MPCR approach is able produce reliable NGS assay primers for a given sequence in a reasonable amount of time.
Formaldehyde as hypothetical primer of biohomochirality
NASA Astrophysics Data System (ADS)
Goldanskii, Vitalii I.
1996-07-01
One of the most intriguing and crucial problems of the prebiotic evolution and the origin of life is the explanation of the origin of biohomochirality. A scheme of conversions originated by formaldehyde (FA) as hypothetical primer of biohomochirality is proposed. The merit of FA as executor of this function is based -inter alia - on the distinguished role of FA as one of the earliest and simplest molecules in both warm, terrestrial and cold, extraterrestrial scenarios of the origin of life. The confirmation of the role of FA as primer of biohomochirality would support the option of an RNA world as an alternative to the protein world. The suggested hypothesis puts forward for the first time a concrete sequence of chemical reactions which can lead to biohomochirality. The spontaneous breaking of the mirror symmetry is secured by the application of the well-known Frank scheme (combination of autocatalysis and ``annihilation'' of L and D enantiomers) to the series of interactions of FA ``trimers'' (i.e. C3H6O3 compounds) of (aaa), (apa) and (app) types, where the monomeric groups (a) means ``achirons'' (a=CHn, n>=2 and C=M, M=C,O) and (p) mean ``prochirons'' (p=HC*OM, M=H,C).
1991-05-01
AL-TP-1 991-0011 LA )_ NEURAL NETWORKS : A PRIMER.R • M 1 - T< R Vince L Wiggins 0 RRC, Incorporated N 3833 Texas Avenue, Suite 256 G Bryan, TX 77802T...5.av bln)2FUOTDTEF.-EOTTP NDIN NUMBCOERSD Neural Networks : A Primer C - F41 689-88-D-0251 PE - 62205F PR - 7719 6. AUTHOR(S) TA - 20 Vin~ce L Wiggins...Maximum 200 words) Neural network technology has recently demonstrated capabilities in areas important to personnel research such as statistical analysis
Li, Yong; Zhai, Sheng-Nan; Qiu, Ying-Xiong; Guo, Yan-Ping; Ge, Xue-Jun; Comes, Hans Peter
2011-05-01
Molecular phylogeographic studies have recently begun to elucidate how plant species from the Qinghai-Tibetan Plateau (QTP) and adjacent regions responded to the Quaternary climatic oscillations. In this regard, however, far less attention has been paid to the southern and south-eastern declivities of the QTP, i.e. the Himalaya-Hengduan Mountains (HHM) region. Here, we report a survey of amplified fragment length polymorphisms (AFLPs) and chloroplast DNA (cpDNA) sequence variation in the HHM endemic Sinopodophyllum hexandrum, a highly selfing alpine perennial herb with mainly gravity-dispersed berries (105 individuals, 19 localities). We specifically aimed to test a vicariant evolutionary hypothesis across the 'Mekong-Salween Divide', a known biogeographic and phytogeographic boundary of north-to-south trending river valleys separating the East Himalayas and Hengduan Mts. Both cpDNA and AFLPs identified two divergent phylogroups largely congruent with these mountain ranges. There was no genetic depauperation in the more strongly glaciated East Himalayas (AFLPs: H(E)=0.031; cpDNA: h(S)=0.133) compared to the mainly ice-free Hengduan Mts. (AFLPs: H(E)=0.037; cpDNA: h(S)=0.082), while population differentiation was consistently higher in the former region (AFLPs: Φ(ST)=0.522 vs. 0.312; cpDNA: Φ(ST)=0.785 vs. 0.417). Our results suggest that East Himalayan and Hengduan populations of S. hexandrum were once fragmented, persisted in situ during glacials in both areas, and have not merged again, except for a major instance of inter-lineage chloroplast capture identified at the MSD boundary. Our coalescent time estimate for all cpDNA haplotypes (c. 0.37-0.48 mya), together with paleogeological evidence, strongly rejects paleo-drainage formation as a mechanism underlying allopatric fragmentation, whereas mountain glaciers following the ridges of the MSD during glacials (and possible interglacials) could have been responsible. This study thus indicates an important role
Bog, Manuela; Schneider, Philipp; Hellwig, Frank; Sachse, Svea; Kochieva, Elena Z; Martyrosian, Elena; Landolt, Elias; Appenroth, Klaus-J
2013-01-01
The genus Wolffia of the duckweed family (Lemnaceae) contains the smallest flowering plants. Presently, 11 species are recognized and categorized mainly on the basis of morphology. Because of extreme reduction of structure of all species, molecular methods are especially required for barcoding and identification of species and clones of this genus. We applied AFLP combined with Bayesian analysis of population structure to 66 clones covering all 11 species. Nine clusters were identified: (1) W. angusta and W. microscopica (only one clone), (2) W. arrhiza, (3) W. cylindracea (except one clone that might be a transition form), (4) W. australiana, (5) W. globosa, (6) W. globosa, W. neglecta, and W. borealis, (7) W. brasiliensis, and W. columbiana, (8) W. columbiana, (9) W. elongata. Furthermore, we investigated the sequences of plastidic regions rps16 (54 clones) and rpl16 (55 clones), and identified the following species: W. angusta, W. australiana, W. brasiliensis, W. cylindracea, W. elongata, W. microscopica, and W. neglecta. Wolffia globosa has been separated into two groups by both methods. One group which consists only of clones from North America and East Asia was labelled here "typical W. globosa". The other group of W. globosa, termed operationally "W. neglecta", contains also clones of W. neglecta and shows high similarity to W. borealis. None of the methods recognized W. borealis as a distinct species. Although each clone could be characterized individually by AFLP and plastidic sequences, and most species could be bar-coded, the presently available data are not sufficient to identify all taxa of Wolffia.
In vitro cytotoxicity of orthodontic primers.
D'Antò, Vincenzo; Spagnuolo, Gianrico; Polito, Ilaria; Paduano, Sergio; Ambrosio, Luigi; Valletta, Rosa
2009-01-01
The aim of this study was to evaluate the cytotoxicity of four orthodontic primers: Transbond XT and Transbond MIP (3M, USA), Eagle Fluorsure (American Orthodontics, USA) and Ortho Solo (Ormco, USA). Balb 3T3 cells were exposed to different concentrations of primers (0-0.25 mg/ml). Mitochondrial dehydrogenase activity was evaluated by MTT assay and cell necrosis was measured by flow cytometry (propidium iodide staining). All the materials decreased cell viability in a dose related manner. Cytotoxicity of orthodontic primers based on concentrations which caused a 50% decrease of mitochondrial activity was ranked as follows: Transbond XT (45.57 mg/ml) > Eagle Fluorsure (49.27 mg/ml) > Transbond MIP (64.35 mg/ml) > Ortho solo (70.09 mg/ml). Our results suggest that the cytotoxic potencies demonstrated by orthodontic primers might be of clinical relevance since they disturbed cell metabolism and induced cell death in monolayer cultures.
Narrowing down the region of the Vf locus for scab resistance in apple using AFLP-derived SCARs.
Huaracha, E; Xu, M; Korban, S S
2004-01-01
A narrow-down strategy to restrict the Vf region, which controls resistance to the fungal disease apple scab in apple, to a genetic distance of 0.4 cM is presented. Using 11 AFLP-derived SCARs and three RAPD-derived SCARs, all linked to the Vf gene, we subjected 1,412 scab-resistant individuals from 16 mapping populations to genotype analysis. Eleven recombinant individuals were identified within a genetic distance of 0.9 cM around the Vf gene. Using these 11 recombinants, we achieved fine-resolution of several AFLP-derived SCAR markers surrounding the Vf gene, resulting in the following genetic linkage map: ACS-6 and ACS are located left of the Vf gene at genetic distances of 0.2 cM and 0.1 cM, respectively; ACS-7 and ACS-9 are inseparable from the Vf gene; ACS-8, ACS-10, and ACS-4 are located to the right of the Vf gene at genetic distances of 0.1 cM, 0.4 cM, and 0.5 cM, respectively; the remaining five SCARs-ACS-11, ACS-5, ACS-2, ACS-1, and AL07-are inseparable and are located right of the Vf gene at a genetic distance of 0.7 cM. By integrating this linkage data with our previous physical map, we generated a revised map of the narrowed-down region of Vf.
A PCR primer bank for quantitative gene expression analysis.
Wang, Xiaowei; Seed, Brian
2003-12-15
Although gene expression profiling by microarray analysis is a useful tool for assessing global levels of transcriptional activity, variability associated with the data sets usually requires that observed differences be validated by some other method, such as real-time quantitative polymerase chain reaction (real-time PCR). However, non-specific amplification of non-target genes is frequently observed in the latter, confounding the analysis in approximately 40% of real-time PCR attempts when primer-specific labels are not used. Here we present an experimentally validated algorithm for the identification of transcript-specific PCR primers on a genomic scale that can be applied to real-time PCR with sequence-independent detection methods. An online database, PrimerBank, has been created for researchers to retrieve primer information for their genes of interest. PrimerBank currently contains 147 404 primers encompassing most known human and mouse genes. The primer design algorithm has been tested by conventional and real-time PCR for a subset of 112 primer pairs with a success rate of 98.2%.
Charter School Primer. Peter Lang Primer. Volume 34
ERIC Educational Resources Information Center
Tryjankowski, Anne Marie
2012-01-01
The "Charter School Primer" presents an overview of public charter schools in the United States. The book discusses what charter schools are; the history of public charter school choice in the United States; the role of teachers, parents, boards, and unions in the charter school movement; and gives examples of innovations in education made…
Hexavalent Chromium IV-Free Primer Development
NASA Technical Reports Server (NTRS)
Alldredge, Michael J.; Buck, Amy L.
2015-01-01
Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.
Tooley, Paul W; Bandyopadhyay, Ranajit; Carras, Marie M; Pazoutová, Sylvie
2006-04-01
Isolates of Claviceps causing ergot on sorghum in India were analysed by AFLP analysis, and by analysis of DNA sequences of the EF-1alpha gene intron 4 and beta-tubulin gene intron 3 region. Of 89 isolates assayed from six states in India, four were determined to be C. sorghi, and the rest C. africana. A relatively low level of genetic diversity was observed within the Indian C. africana population. No evidence of genetic exchange between C. africana and C. sorghi was observed in either AFLP or DNA sequence analysis. Phylogenetic analysis was conducted using DNA sequences from 14 different Claviceps species. A multigene phylogeny based on the EF-1alpha gene intron 4, the beta-tubulin gene intron 3 region, and rDNA showed that C. sorghi grouped most closely with C. gigantea and C. africana. Although the Claviceps species we analysed were closely related, they colonize hosts that are taxonomically very distinct suggesting that there is no direct coevolution of Claviceps with its hosts.
Multiplex primer prediction software for divergent targets
Gardner, Shea N.; Hiddessen, Amy L.; Williams, Peter L.; Hara, Christine; Wagner, Mark C.; Colston, Bill W.
2009-01-01
We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets to amplify all members of large, diverse and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers (∼3700 18-mers or ∼2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus (FMDV), hemagglutinin (HA) and neuraminidase (NA) segments of influenza A virus, Norwalk virus, and HIV-1. We empirically demonstrated the application of the software with a multiplex set of 16 short (10 nt) primers designed to amplify the Poxviridae family to produce a specific amplicon from vaccinia virus. PMID:19759213
Primer on spontaneous heating and pyrophoricity
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
1994-12-01
This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardousmore » material training.« less
30 CFR 57.6304 - Primer protection.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...
PÉREZ-COLLAZOS, ERNESTO; CATALÁN, PILAR
2006-01-01
• Background and Aims Vella pseudocytisus subsp. paui (Cruciferae) is a narrow endemic plant to the Teruel province (eastern Spain), which is listed in the National Catalogue of Endangered Species. Two distinct ploidy levels (diploid, 2n = 34, and tetraploid, 2n = 68) have been reported for this taxon that belongs to the core subtribe Vellinae, a western Mediterranean group of shrubby taxa with a chromosome base number of x = 17. Allozyme and AFLP analyses were conducted (a) to test for the ploidy and putative palaeo-allopolyploid origin of this taxon, (b) to explore levels of genetic diversity and spatial structure of its populations, and (c) to address in-situ and ex-situ strategies for its conservation. • Methods Six populations that covered the entire geographical range of this taxon were sampled and examined for 19 allozyme loci and three AFLP primer pair combinations. In addition, the gametic progenies of five individuals were analysed for two allozyme loci that showed fixed heterozygosity. • Key Results Multiple banded allozyme profiles for most of the surveyed loci indicated the polyploidy of this taxon. Co-inherited fixed heterozygous patterns were exhibited by the gametophytic tissues of the mother plants. Both allozyme and AFLP markers detected high levels of genetic diversity, and a strong micro-spatial genetic structure was recovered from AFLP phenetic analyses and Mantel correlograms. • Conclusions Allozyme data support the hypothesis of an allotetraploid origin of Vella pseudocytisus subsp. paui that could be representative of other taxa of the core Vellinae group. AFLP data distinguished three geographically distinct groups with no genetic interaction among them. Allotetraploidy and outcrossing reproduction have probably contributed to maintenance of high levels of genetic variability of the populations, whereas habitat fragmentation may have enhanced the high genetic isolation observed among groups. In-situ microgenetic reserves and a
Lubell, Jessica D; Brand, Mark H; Lehrer, Jonathan M; Holsinger, Kent E
2008-06-01
Japanese barberry (Berberis thunbergii DC.) is a widespread invasive plant that remains an important landscape shrub represented by ornamental, purple-leaved forms of the botanical variety atropurpurea. These forms differ greatly in appearance from feral plants, bringing into question whether they contribute to invasive populations or whether the invasions represent self-sustaining populations derived from the initial introduction of the species in the late 19th century. In this study we used amplified fragment length polymorphism (AFLP) markers to determine whether genetic contributions from B. t. var. atropurpurea are found within naturalized Japanese barberry populations in southern New England. Bayesian clustering of AFLP genotypes and principal coordinate analysis distinguished B. t. var. atropurpurea genotypes from 85 plants representing five invasive populations. While a single feral plant resembled B. t. var. atropurpurea phenotypically and fell within the same genetic cluster, all other naturalized plants sampled were genetically distinct from the purple-leaved genotypes. Seven plants from two different sites possessed morphology consistent with Berberis vulgaris (common barberry) or B. ×ottawensis (B. thunbergii × B. vulgaris). Genetic analysis placed these plants in two clusters separate from B. thunbergii. Although the Bayesian analysis indicated some introgression of B. t. var. atropurpurea and B. vulgaris, these genotypes have had limited influence on extant feral populations of B. thunbergii.
Ma, Ni; Li, Zai-Yun; Cartagena, J A; Fukui, K
2006-10-01
New Brassica napus inbred lines with different petal colors and with canola quality and increased levels of oleic (approximately 70%, 10% higher than that of B. napus parent) and linoleic (28%) acids have been developed in the progenies of one B. napus cv. Oro x Orychophragmus violaceus F5 hybrid plant (2n = 31). Their genetic constituents were analyzed by using the methods of genomic in situ hybridization (GISH) and amplified fragments length polymorphism (AFLP). No intact chromosomes of O. violaceus origin were detected by GISH in their somatic cells of ovaries and root tips (2n = 38) and pollen mother cells (PMCs) with normal chromosome pairing (19 bivalents) and segregation (19:19), though signals of variable sizes and intensities were located mainly at terminal and centromeric parts of some mitotic chromosomes and meiotic bivalents at diakinesis or chromosomes in anaphase I groups and one large patch of chromatin was intensively labeled and separated spatially in some telophase I nuclei and metaphase II PMCs. AFLP analysis revealed that substantial genomic changes have occurred in these lines and O. violaceus-specific bands, deleted bands in 'Oro' and novel bands for two parents were detected. The possible mechanisms for these results were discussed.
Multiplexing Short Primers for Viral Family PCR
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, S N; Hiddessen, A L; Hara, C A
We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and formore » several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.« less
3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.
Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong
2008-09-01
We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.
DOT National Transportation Integrated Search
1972-01-01
This primer was directed to the district and resident engineers of the Virginia Department of Highways, who are responsible for conducting highway public hearings, and to the environmental specialists of the Department's Environmental Quality Divisio...
Howland, Shanshan W; Poh, Chek-Meng; Rénia, Laurent
2011-09-01
Directional cloning of complementary DNA (cDNA) primed by oligo(dT) is commonly achieved by appending a restriction site to the primer, whereas the second strand is synthesized through the combined action of RNase H and Escherichia coli DNA polymerase I (PolI). Although random primers provide more uniform and complete coverage, directional cloning with the same strategy is highly inefficient. We report that phosphorothioate linkages protect the tail sequence appended to random primers from the 5'→3' exonuclease activity of PolI. We present a simple strategy for constructing a random-primed cDNA library using the efficient, size-independent, and seamless In-Fusion cloning method instead of restriction enzymes. Copyright © 2011 Elsevier Inc. All rights reserved.
Rust transformation/rust compatible primers
NASA Technical Reports Server (NTRS)
Emeric, Dario A.; Miller, Christopher E.
1993-01-01
Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.
Beam shaping for laser initiated optical primers
NASA Astrophysics Data System (ADS)
Lizotte, Todd E.
2008-08-01
Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.
Van Geel, Maarten; Busschaert, Pieter; Honnay, Olivier; Lievens, Bart
2014-11-01
In the last few years, 454 pyrosequencing-based analysis of arbuscular mycorrhizal fungal (AMF; Glomeromycota) communities has tremendously increased our knowledge of the distribution and diversity of AMF. Nonetheless, comparing results between different studies is difficult, as different target genes (or regions thereof) and primer combinations, with potentially dissimilar specificities and efficacies, are being utilized. In this study we evaluated six primer pairs that have previously been used in AMF studies (NS31-AM1, AMV4.5NF-AMDGR, AML1-AML2, NS31-AML2, FLR3-LSUmBr and Glo454-NDL22) for their use in 454 pyrosequencing based on both an in silico approach and 454 pyrosequencing of AMF communities from apple tree roots. Primers were evaluated in terms of (i) in silico coverage of Glomeromycota fungi, (ii) the number of high-quality sequences obtained, (iii) selectivity for AMF species, (iv) reproducibility and (v) ability to accurately describe AMF communities. We show that primer pairs AMV4.5NF-AMDGR, AML1-AML2 and NS31-AML2 outperformed the other tested primer pairs in terms of number of Glomeromycota reads (AMF specificity and coverage). Additionally, these primer pairs were found to have no or only few mismatches to AMF sequences and were able to consistently describe AMF communities from apple roots. However, whereas most high-quality AMF sequences were obtained for AMV4.5NF-AMDGR, our results also suggest that this primer pair favored amplification of Glomeraceae sequences at the expense of Ambisporaceae, Claroideoglomeraceae and Paraglomeraceae sequences. Furthermore, we demonstrate the complementary specificity of AMV4.5NF-AMDGR with AML1-AML2, and of AMV4.5NF-AMDGR with NS31-AML2, making these primer combinations highly suitable for tandem use in covering the diversity of AMF communities. Copyright © 2014 Elsevier B.V. All rights reserved.
Yang, J M; Sun, G H; Zheng, X D; Ren, L H; Wang, W J; Li, G R; Sun, B C
2015-12-02
Octopus minor (Sasaki, 1920) is an economically important cephalopod that is found in the northern coastal waters of China. In this study, we investigated genetic differentiation in fishery populations using amplified fragment length polymorphisms (AFLPs). A total of 150 individuals were collected from five locations: Dalian (DL), Yan-tai (YT), Qingdao (QD), Lianyungang (LY), and Zhoushan (ZS), and 243 reproducible bands were amplified using five AFLP primer combinations. The percentage of polymorphic bands ranged from 53.33 to 76.08%. Nei's genetic identity ranged from 0.9139 to 0.9713, and the genetic distance ranged from 0.0291 to 0.0900. A phylogenetic tree was constructed using the unweighted pair group method with arithmetic mean, based on the genetic distance. The DL and YT populations originated from one clade, while the QD, LY, and ZS populations originated from another. The results indicate that the O. minor stock consisted of two genetic populations with an overall significantly analogous FST value (0.1088, P < 0.05). Most of the variance was within populations. These findings will be important for more sustainable octopus fisheries, so that this marine resource can be conserved for its long-term utilization.
Amplified Fragment Length Polymorphism Diversity in Cephalosporium maydis from Egypt.
Saleh, Amgad A; Zeller, Kurt A; Ismael, Abou-Serie M; Fahmy, Zeinab M; El-Assiuty, Elhamy M; Leslie, John F
2003-07-01
ABSTRACT Cephalosporium maydis, the causal agent of late wilt of maize, was first described in Egypt in the 1960s, where it can cause yield losses of up to 40% in susceptible plantings. We characterized 866 isolates of C. maydis collected from 14 governates in Egypt, 7 in the Nile River Delta and 7 in southern (Middle and Upper) Egypt, with amplified fragment length polymorphism (AFLP) markers. The four AFLP primer-pair combinations generated 68 bands, 25 of which were polymorphic, resulting in 52 clonal haplotypes that clustered the 866 isolates into four phylogenetic lineages. Three lineages were found in both the Nile River Delta and southern Egypt. Lineage IV, the most diverse group (20 haplotypes), was recovered only from governates in the Nile River Delta. In some locations, one lineage dominated (up to 98% of the isolates recovered) and, from some fields, only a single haplotype was recovered. Under field conditions in Egypt, there is no evidence that C. maydis reproduces sexually. The nonuniform geographic distribution of the pathogen lineages within the country could be due to differences in climate or in the farming system, because host material differs in susceptibility and C. maydis lineages differ in pathogenicity.
Design of primers and probes for quantitative real-time PCR methods.
Rodríguez, Alicia; Rodríguez, Mar; Córdoba, Juan J; Andrade, María J
2015-01-01
Design of primers and probes is one of the most crucial factors affecting the success and quality of quantitative real-time PCR (qPCR) analyses, since an accurate and reliable quantification depends on using efficient primers and probes. Design of primers and probes should meet several criteria to find potential primers and probes for specific qPCR assays. The formation of primer-dimers and other non-specific products should be avoided or reduced. This factor is especially important when designing primers for SYBR(®) Green protocols but also in designing probes to ensure specificity of the developed qPCR protocol. To design primers and probes for qPCR, multiple software programs and websites are available being numerous of them free. These tools often consider the default requirements for primers and probes, although new research advances in primer and probe design should be progressively added to different algorithm programs. After a proper design, a precise validation of the primers and probes is necessary. Specific consideration should be taken into account when designing primers and probes for multiplex qPCR and reverse transcription qPCR (RT-qPCR). This chapter provides guidelines for the design of suitable primers and probes and their subsequent validation through the development of singlex qPCR, multiplex qPCR, and RT-qPCR protocols.
Cervera, M T; Storme, V; Ivens, B; Gusmão, J; Liu, B H; Hostyn, V; Van Slycken, J; Van Montagu, M; Boerjan, W
2001-06-01
Populus deltoides, P. nigra, and P. trichocarpa are the most important species for poplar breeding programs worldwide. In addition, Populus has become a model for fundamental research on trees. Linkage maps were constructed for these three species by analyzing progeny of two controlled crosses sharing the same female parent, Populus deltoides cv. S9-2 x P. nigra cv. Ghoy and P. deltoides cv. S9-2 x P. trichocarpa cv. V24. The two-way pseudotestcross mapping strategy was used to construct the maps. Amplified fragment length polymorphism (AFLP) markers that segregated 1:1 were used to form the four parental maps. Microsatellites and sequence-tagged sites were used to align homoeologous groups between the maps and to merge linkage groups within the individual maps. Linkage analysis and alignment of the homoeologous groups resulted in 566 markers distributed over 19 groups for P. deltoides covering 86% of the genome, 339 markers distributed over 19 groups for P. trichocarpa covering 73%, and 369 markers distributed over 28 groups for P. nigra covering 61%. Several tests for randomness showed that the AFLP markers were randomly distributed over the genome.
Cervera, M T; Storme, V; Ivens, B; Gusmão, J; Liu, B H; Hostyn, V; Van Slycken, J; Van Montagu, M; Boerjan, W
2001-01-01
Populus deltoides, P. nigra, and P. trichocarpa are the most important species for poplar breeding programs worldwide. In addition, Populus has become a model for fundamental research on trees. Linkage maps were constructed for these three species by analyzing progeny of two controlled crosses sharing the same female parent, Populus deltoides cv. S9-2 x P. nigra cv. Ghoy and P. deltoides cv. S9-2 x P. trichocarpa cv. V24. The two-way pseudotestcross mapping strategy was used to construct the maps. Amplified fragment length polymorphism (AFLP) markers that segregated 1:1 were used to form the four parental maps. Microsatellites and sequence-tagged sites were used to align homoeologous groups between the maps and to merge linkage groups within the individual maps. Linkage analysis and alignment of the homoeologous groups resulted in 566 markers distributed over 19 groups for P. deltoides covering 86% of the genome, 339 markers distributed over 19 groups for P. trichocarpa covering 73%, and 369 markers distributed over 28 groups for P. nigra covering 61%. Several tests for randomness showed that the AFLP markers were randomly distributed over the genome. PMID:11404342
A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.
The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less
A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys
Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.
2015-12-09
The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less
Protective Coats For Zinc-Rich Primers
NASA Technical Reports Server (NTRS)
Macdowell, Louis G, III
1993-01-01
Report describes tests of topcoats for inorganic zinc-rich primers on carbon steel. Topcoats intended to provide additional protection against corrosion in acidic, salty seacoast-air/rocket-engine-exhaust environment of Space Shuttle launch site. Tests focused on polyurethane topcoats on epoxy tie coats on primers. Part of study involved comparison between "high-build" coating materials and thin-film coating materials.
Gulvik, Christopher A.; Effler, T. Chad; Wilhelm, Steven W.; Buchan, Alison
2012-01-01
Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies). Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s) and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI’s BLAST (De-MetaST-BLAST), the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications. PMID:23189198
Vygotsky on Education Primer. Peter Lang Primer. Volume 30
ERIC Educational Resources Information Center
Lake, Robert
2012-01-01
The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…
PRISE2: software for designing sequence-selective PCR primers and probes.
Huang, Yu-Ting; Yang, Jiue-in; Chrobak, Marek; Borneman, James
2014-09-25
PRISE2 is a new software tool for designing sequence-selective PCR primers and probes. To achieve high level of selectivity, PRISE2 allows the user to specify a collection of target sequences that the primers are supposed to amplify, as well as non-target sequences that should not be amplified. The program emphasizes primer selectivity on the 3' end, which is crucial for selective amplification of conserved sequences such as rRNA genes. In PRISE2, users can specify desired properties of primers, including length, GC content, and others. They can interactively manipulate the list of candidate primers, to choose primer pairs that are best suited for their needs. A similar process is used to add probes to selected primer pairs. More advanced features include, for example, the capability to define a custom mismatch penalty function. PRISE2 is equipped with a graphical, user-friendly interface, and it runs on Windows, Macintosh or Linux machines. PRISE2 has been tested on two very similar strains of the fungus Dactylella oviparasitica, and it was able to create highly selective primers and probes for each of them, demonstrating the ability to create useful sequence-selective assays. PRISE2 is a user-friendly, interactive software package that can be used to design high-quality selective primers for PCR experiments. In addition to choosing primers, users have an option to add a probe to any selected primer pair, enabling design of Taqman and other primer-probe based assays. PRISE2 can also be used to design probes for FISH and other hybridization-based assays.
Transcriptional responses in Honey Bee larvae infected with chalkbrood fungus
2010-01-01
Background Diseases and other stress factors working synergistically weaken honey bee health and may play a major role in the losses of bee populations in recent years. Among a large number of bee diseases, chalkbrood has been on the rise. We present here the experimental identification of honey bee genes that are differentially expressed in response to infection of honey bee larvae with the chalkbrood fungus, Ascosphaera apis. Results We used cDNA-AFLP ®Technology to profile transcripts in infected and uninfected bee larvae. From 64 primer combinations, over 7,400 transcriptionally-derived fragments were obtained A total of 98 reproducible polymorphic cDNA-AFLP fragments were excised and sequenced, followed by quantitative real-time RT-PCR (qRT-PCR) analysis of these and additional samples. We have identified a number of differentially-regulated transcripts that are implicated in general mechanisms of stress adaptation, including energy metabolism and protein transport. One of the most interesting differentially-regulated transcripts is for a chitinase-like enzyme that may be linked to anti-fungal activities in the honey bee larvae, similarly to gut and fat-body specific chitinases found in mosquitoes and the red flour beetle. Surprisingly, we did not find many components of the well-characterized NF-κB intracellular signaling pathways to be differentially-regulated using the cDNA-AFLP approach. Therefore, utilizing qRT-PCR, we probed some of the immune related genes to determine whether the lack of up-regulation of their transcripts in our analysis can be attributed to lack of immune activation or to limitations of the cDNA-AFLP approach. Conclusions Using a combination of cDNA-AFLP and qRT-PCR analyses, we were able to determine several key transcriptional events that constitute the overall effort in the honey bee larvae to fight natural fungal infection. Honey bee transcripts identified in this study are involved in critical functions related to
Transcriptional responses in honey bee larvae infected with chalkbrood fungus.
Aronstein, Katherine A; Murray, Keith D; Saldivar, Eduardo
2010-06-21
Diseases and other stress factors working synergistically weaken honey bee health and may play a major role in the losses of bee populations in recent years. Among a large number of bee diseases, chalkbrood has been on the rise. We present here the experimental identification of honey bee genes that are differentially expressed in response to infection of honey bee larvae with the chalkbrood fungus, Ascosphaera apis. We used cDNA-AFLP Technology to profile transcripts in infected and uninfected bee larvae. From 64 primer combinations, over 7,400 transcriptionally-derived fragments were obtained A total of 98 reproducible polymorphic cDNA-AFLP fragments were excised and sequenced, followed by quantitative real-time RT-PCR (qRT-PCR) analysis of these and additional samples.We have identified a number of differentially-regulated transcripts that are implicated in general mechanisms of stress adaptation, including energy metabolism and protein transport. One of the most interesting differentially-regulated transcripts is for a chitinase-like enzyme that may be linked to anti-fungal activities in the honey bee larvae, similarly to gut and fat-body specific chitinases found in mosquitoes and the red flour beetle. Surprisingly, we did not find many components of the well-characterized NF-kappaB intracellular signaling pathways to be differentially-regulated using the cDNA-AFLP approach. Therefore, utilizing qRT-PCR, we probed some of the immune related genes to determine whether the lack of up-regulation of their transcripts in our analysis can be attributed to lack of immune activation or to limitations of the cDNA-AFLP approach. Using a combination of cDNA-AFLP and qRT-PCR analyses, we were able to determine several key transcriptional events that constitute the overall effort in the honey bee larvae to fight natural fungal infection. Honey bee transcripts identified in this study are involved in critical functions related to transcriptional regulation, apoptotic
Simple sequence repeat marker loci discovery using SSR primer.
Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David
2004-06-12
Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/
Value for money assessment for public-private partnerships : a primer.
DOT National Transportation Integrated Search
2015-01-01
This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of primers.
Initialization of Formation Flying Using Primer Vector Theory
NASA Technical Reports Server (NTRS)
Mailhe, Laurie; Schiff, Conrad; Folta, David
2002-01-01
In this paper, we extend primer vector analysis to formation flying. Optimization of the classical rendezvous or free-time transfer problem between two orbits using primer vector theory has been extensively studied for one spacecraft. However, an increasing number of missions are now considering flying a set of spacecraft in close formation. Missions such as the Magnetospheric MultiScale (MMS) and Leonardo-BRDF (Bidirectional Reflectance Distribution Function) need to determine strategies to transfer each spacecraft from the common launch orbit to their respective operational orbit. In addition, all the spacecraft must synchronize their states so that they achieve the same desired formation geometry over each orbit. This periodicity requirement imposes constraints on the boundary conditions that can be used for the primer vector algorithm. In this work we explore the impact of the periodicity requirement in optimizing each spacecraft transfer trajectory using primer vector theory. We first present our adaptation of primer vector theory to formation flying. Using this method, we then compute the AV budget for each spacecraft subject to different formation endpoint constraints.
Antimicrobial and physical characteristics of orthodontic primers containing antimicrobial agents.
Chung, Shin-Hye; Cho, Soha; Kim, Kyungsun; Lim, Bum-Soon; Ahn, Sug-Joon
2017-03-01
To compare the antimicrobial and physical properties of experimental primers containing chlorhexidine (CHX) or ursolic acid (UA) with a commercial primer. Two antibacterial agents, 3 mg each of CHX and UA were incorporated respectively into 1 ml of Transbond XT primer (TX) to form antibacterial primers, TX-CHX and TX-UA. The antimicrobial activity of the three primers (TX, TX-CHX, and TX-UA) against Streptococcus mutans in both planktonic and biofilm phases was analyzed by determining minimum inhibitory and bactericidal concentrations and by performing growth and biofilm assays. Growth and biofilm assays were performed in both the absence and presence of thermocycling in a water tank to analyze the effects of water aging on the antimicrobial activities of primers. After bonding brackets onto bovine incisors using the primers, shear bond strength and mode of fracture were analyzed to compare physical properties. TX-CHX had stronger antimicrobial activity against S. mutans in the planktonic and biofilm phases than did TX or TX-UA. When applied, TX-CHX completely inhibited the growth and biofilm formation of S. mutans . In addition, the antimicrobial activity of TX-CHX was maintained after thermocycling. However, TX-UA did not show significant antimicrobial activity compared with TX. There was no significant difference in either shear bond strength or bond failure interface among the primers. Incorporation of CHX into an orthodontic primer may help prevent enamel demineralization around surfaces without compromising its physical properties.
A Primer on Sampling for Statewide Assessment.
ERIC Educational Resources Information Center
Jaeger, Richard M.
This paper is a primer on sampling procedures for statewide assessment. The careful reader should gain substantial knowledge about the promises and pitfalls of sampling for assessment. The primer has three basic objectives: (1) to define terms and concepts basic to sampling theory and its application, including population, sampling unit, sampling…
Phylum- and Class-Specific PCR Primers for General Microbial Community Analysis
Blackwood, Christopher B.; Oaks, Adam; Buyer, Jeffrey S.
2005-01-01
Amplification of a particular DNA fragment from a mixture of organisms by PCR is a common first step in methods of examining microbial community structure. The use of group-specific primers in community DNA profiling applications can provide enhanced sensitivity and phylogenetic detail compared to domain-specific primers. Other uses for group-specific primers include quantitative PCR and library screening. The purpose of the present study was to develop several primer sets targeting commonly occurring and important groups. Primers specific for the 16S ribosomal sequences of Alphaproteobacteria, Betaproteobacteria, Bacilli, Actinobacteria, and Planctomycetes and for parts of both the 18S ribosomal sequence and the internal transcribed spacer region of Basidiomycota were examined. Primers were tested by comparison to sequences in the ARB 2003 database, and chosen primers were further tested by cloning and sequencing from soil community DNA. Eighty-five to 100% of the sequences obtained from clone libraries were found to be placed with the groups intended as targets, demonstrating the specificity of the primers under field conditions. It will be important to reevaluate primers over time because of the continual growth of sequence databases and revision of microbial taxonomy. PMID:16204538
Novel ITS1 Fungal Primers for Characterization of the Mycobiome
Usyk, Mykhaylo; Zolnik, Christine P.; Patel, Hitesh; Levi, Michael H.
2017-01-01
ABSTRACT Studies of the human microbiome frequently omit characterization of fungal communities (the mycobiome), which limits our ability to investigate how fungal communities influence human health. The internal transcribed spacer 1 (ITS1) region of the eukaryotic ribosomal cluster has features allowing for wide taxonomic coverage and has been recognized as a suitable barcode region for species-level identification of fungal organisms. We developed custom ITS1 primer sets using iterative alignment refinement. Primer performance was evaluated using in silico testing and experimental testing of fungal cultures and human samples. Using an expanded novel reference database, SIS (18S-ITS1-5.8S), the newly designed primers showed an average in silico taxonomic coverage of 79.9% ± 7.1% compared to a coverage of 44.6% ± 13.2% using previously published primers (P = 0.05). The newly described primer sets recovered an average of 21,830 ± 225 fungal reads from fungal isolate culture samples, whereas the previously published primers had an average of 3,305 ± 1,621 reads (P = 0.03). Of note was an increase in the taxonomic coverage of the Candida genus, which went from a mean coverage of 59.5% ± 13% to 100.0% ± 0.0% (P = 0.0015) comparing the previously described primers to the new primers, respectively. The newly developed ITS1 primer sets significantly improve general taxonomic coverage of fungal communities infecting humans and increased read depth by an order of magnitude over the best-performing published primer set tested. The overall best-performing primer pair in terms of taxonomic coverage and read recovery, ITS1-30F/ITS1-217R, will aid in advancing research in the area of the human mycobiome. IMPORTANCE The mycobiome constitutes all the fungal organisms within an environment or biological niche. The fungi are eukaryotes, are extremely heterogeneous, and include yeasts and molds that colonize humans as part of the microbiome. In addition, fungi can also infect
Elouafi, I; Nachit, M M
2004-02-01
Durum wheat ( Triticum turgidum L. var durum) is mainly produced and consumed in the Mediterranean region; it is used to produce several specific end-products; such as local pasta, couscous and burghul. To study the genetics of grain-milling quality traits, chromosomal locations, and interaction with the environment, a genetic linkage map of durum was constructed and the quantitative trait loci QTLs for the milling-related traits, test weight (TW) and thousand-kernel weight (TKW), were identified. The population constituted 114 recombinant inbred lines derived from the cross: Omrabi 5 /Triticum dicoccoides 600545// Omrabi 5. TW and TKW were analyzed over 18 environments (sites x years). Single-sequence-repeat markers (SSRs), Amplified-fragment-length-polymorphism markers (AFLPs), and seed storage proteins (SSPs) showed a high level of polymorphism (>60%). The map was constructed with 124 SSRs, 149 AFLPs and 6 SSPs; its length covered 2,288.8 cM (8.2 cM/marker). The map showed high synteny with previous wheat maps, and both SSRs and AFLPs mapped evenly across the genome, with more markers in the B genome. However, some rearrangements were observed. For TW, a high genotypic effect was detected and two QTLs with epistasic effect were identified on 7AS and 6BS, explaining 30% of the total variation. The TKW showed a significant transgressive inheritance and five QTLs were identified, explaining 32% of the total variation, out of which 25% was of a genetic nature, and showing QTLxE interaction. The major TKW-QTLs were around the centromere region of 6B. For both traits, Omrabi 5 alleles had a significant positive effect. This population will be used to determine other QTLs of interest, as its parents are likely to harbor different genes for diseases and drought tolerance.
NASA Astrophysics Data System (ADS)
Luo, Ya-Zhong; Zhang, Jin; Li, Hai-yang; Tang, Guo-Jin
2010-08-01
In this paper, a new optimization approach combining primer vector theory and evolutionary algorithms for fuel-optimal non-linear impulsive rendezvous is proposed. The optimization approach is designed to seek the optimal number of impulses as well as the optimal impulse vectors. In this optimization approach, adding a midcourse impulse is determined by an interactive method, i.e. observing the primer-magnitude time history. An improved version of simulated annealing is employed to optimize the rendezvous trajectory with the fixed-number of impulses. This interactive approach is evaluated by three test cases: coplanar circle-to-circle rendezvous, same-circle rendezvous and non-coplanar rendezvous. The results show that the interactive approach is effective and efficient in fuel-optimal non-linear rendezvous design. It can guarantee solutions, which satisfy the Lawden's necessary optimality conditions.
Ludovic J. A. Capo-chichi; Wilson H. Faircloth; A. G. Williamson; Michael G. Patterson; James H. Miller; Edzard van Santen
2008-01-01
Nine sites of cogongrass were included in a study of genotypic dimity and spread dynamics at the point of introduction and its adjacent areas in the southern United States. Clones evaluated with two primer pairs yielded a total of 137 amplified fragment length polymorphism (AFLP) hi of which 102 (74.4%) were polymorphic. Genetic diversity was measured as the percentage...
Economics : pricing, demand, and economic efficiency : a primer.
DOT National Transportation Integrated Search
2008-11-01
The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...
Crystallographic observation of nonenzymatic RNA primer extension.
Zhang, Wen; Walton, Travis; Li, Li; Szostak, Jack W
2018-05-31
The importance of genome replication has inspired detailed crystallographic studies of enzymatic DNA/RNA polymerization. In contrast, the mechanism of nonenzymatic polymerization is less well understood, despite its critical role in the origin of life. Here we report the direct observation of nonenzymatic RNA primer extension through time-resolved crystallography. We soaked crystals of an RNA primer-template-dGMP complex with guanosine-5'-phosphoro-2-aminoimidazolide for increasing times. At early times we see the activated ribonucleotides bound to the template, followed by formation of the imidazolium-bridged dinucleotide intermediate. At later times, we see a new phosphodiester bond forming between the primer and the incoming nucleotide. The intermediate is pre-organized because of the constraints of base-pairing with the template and hydrogen bonding between the imidazole amino group and both flanking phosphates. Our results provide atomic-resolution insight into the mechanism of nonenzymatic primer extension, and set the stage for further structural dissection and optimization of the RNA copying process. © 2018, Zhang et al.
Emshwiller, Eve; Theim, Terra; Grau, Alfredo; Nina, Victor; Terrazas, Franz
2009-10-01
Many crops are polyploids, and it can be challenging to untangle the often complicated history of their origins of domestication and origins of polyploidy. To complement other studies of the origins of polyploidy of the octoploid tuber crop oca (Oxalis tuberosa) that used DNA sequence data and phylogenetic methods, we here compared AFLP data for oca with four wild, tuber-bearing Oxalis taxa found in different regions of the central Andes. Results confirmed the divergence of two use-categories of cultivated oca that indigenous farmers use for different purposes, suggesting the possibility that they might have had separate origins of domestication. Despite previous results with nuclear-encoded, chloroplast-expressed glutamine synthetase suggesting that O. picchensis might be a progenitor of oca, AFLP data of this species, as well as different populations of wild, tuber-bearing Oxalis found in Lima Department, Peru, were relatively divergent from O. tuberosa. Results from all analytical methods suggested that the unnamed wild, tuber-bearing Oxalis found in Bolivia and O. chicligastensis in NW Argentina are the best candidates as the genome donors for polyploid O. tuberosa, but the results were somewhat equivocal about which of these two taxa is the more strongly supported as oca's progenitor.
Tollenaere, C; Duplantier, J-M; Rahalison, L; Ranjalahy, M; Brouat, C
2011-03-01
The black rat (Rattus rattus) is the main reservoir of plague (Yersinia pestis infection) in Madagascar's rural zones. Black rats are highly resistant to plague within the plague focus (central highland), whereas they are susceptible where the disease is absent (low altitude zone). To better understand plague wildlife circulation and host evolution in response to a highly virulent pathogen, we attempted to determine genetic markers associated with plague resistance in this species. To this purpose, we combined a population genomics approach and an association study, both performed on 249 AFLP markers, in Malagasy R. rattus. Simulated distributions of genetic differentiation were compared to observed data in four independent pairs, each consisting of one population from the plague focus and one from the plague-free zone. We found 22 loci (9% of 249) with higher differentiation in at least two independent population pairs or with combining P-values over the four pairs significant. Among the 22 outlier loci, 16 presented significant association with plague zone (plague focus vs. plague-free zone). Population genetic structure inferred from outlier loci was structured by plague zone, whereas the neutral loci dataset revealed structure by geography (eastern vs. western populations). A phenotype association study revealed that two of the 22 loci were significantly associated with differentiation between dying and surviving rats following experimental plague challenge. The 22 outlier loci identified in this study may undergo plague selective pressure either directly or more probably indirectly due to hitchhiking with selected loci. © 2010 Blackwell Publishing Ltd.
Quick spacecraft charging primer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Larsen, Brian Arthur
2014-03-12
This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.
Mastan, Shaik G; Rathore, Mangal S; Bhatt, Vacha D; Chikara, J; Ghosh, A
2014-12-01
We investigated DNA methylation and polymorphism in the methylated DNA using AFLP based methylation-sensitive amplification polymorphism (MS-AFLP) markers in ecotypes of Jatropha curcas L. growing in similar and different geo-ecological conditions. Three ecotypes growing in different geo-ecological conditions with environmental heterogeneity (Group-1) and five ecotypes growing in similar environmental conditions (Group-2) were assessed. In ecotypes growing in group-1, 44.32 % DNA was methylated and of which 93.59 % DNA was polymorphic. While in group-2, 32.27 % DNA was methylated, of which 51.64 % DNA was polymorphic. In site 1 and site 2 of group-1, overall methylation was 18.94 and 22.44 % respectively with difference of 3.5 %, while overall polymorphism was 41.14 and 39.23 % with a difference of 1.91 %. In site 1 and site 2 of group-2, overall methylation was 24.68 and 24.18 % respectively with difference of 0.5 %, while overall polymorphism was 12.19 and 12.65 % with a difference of 0.46 %. The difference of methylation percentage and percentage of methylation polymorphism throughout the genome of J. curcas at site 1 and 2 of group-1 is higher than that of J. curcas at site 1 and 2 of group-2. These results correlated the physico-chemical properties of soil at these sites. The variations of physico-chemical properties of soil at Chorwadla (site 1 in group-1 and site 2 in group-2) compared to the soil at Brahmapur (site 2 in group-1) is higher than that of soil at Neswad (site 1 in group-2). The study suggests that these homologous nucleotide sequences probably play important role in ecotype adaptation to environmental heterogeneity by creating epiallelic variations hence in evolution of ecotypes/clines or forms of species showing phenotypic/genotypic differences in different geographical areas.
A Dozen Primers on Important Information Standards
ERIC Educational Resources Information Center
Dempsey, Kathy, Comp.
2007-01-01
This is a compilation of 12 primers on important information standards and protocols. These primers are: (1) Atom; (2) COinS; (3) MADS; (4) MARC 21/MARCXML; (5) MIX; (6) MXG; (7) OpenSearch; (8) PREMIS; (9) RESTful HTTP; (10) unAPI; (11) XMPP (aka Jabber); and (12) ZeeRex. The Atom Syndication Format defines a new XML-based syndication format for…
Climate Change, Health, and Communication: A Primer.
Chadwick, Amy E
2016-01-01
Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.
ERIC Educational Resources Information Center
Whetstone, B. D.; Yates, Benny
This primer introduces the basics of Program Management and Budgeting (PMB) in an effort to demonstrate how PMB can benefit school systems. Short quotes from previous publications on the topic are paired with cartoons designed to clarify the purposes and workings of the program. The publication begins by defining PMB as an alternative financial…
Bond Strength of Resin Cements to Zirconia Ceramic Using Adhesive Primers.
Stefani, Ariovaldo; Brito, Rui Barbosa; Kina, Sidney; Andrade, Oswaldo Scopin; Ambrosano, Gláucia Maria Bovi; Carvalho, Andreia Assis; Giannini, Marcelo
2016-07-01
To evaluate the influence of adhesive primers on the microshear bond strength of resin cements to zirconia ceramic. Fifty zirconia plates (12 mm × 5 mm × 1.5 mm thick) of a commercially available zirconium oxide ceramic (ZirCad) were sintered, sandblasted with aluminum oxide particles, and cleaned ultrasonically before bonding. The plates were randomly divided into five groups of 10. Three resin cements were selected (RelyX ARC, Multilink Automix, Clearfil SA Cement self-adhesive resin cement), along with two primers (Metal-Zirconia Primer, Alloy Primer) and one control group. The primers and resin cements were used according to manufacturers' recommendations. The control group comprised the conventional resin cement (RelyX ARC) without adhesive primer. Test cylinders (0.75 mm diameter × 1 mm high) were formed on zirconia surfaces by filling cylindrical Tygon tube molds with resin cement. The specimens were stored in distilled water for 24 hours at 37°C, then tested for shear strength on a Shimadzu EZ Test testing machine at 0.5 mm/min. Bond strength data were analyzed statistically by two-way ANOVA and Dunnett's test (5%). The bond strength means in MPa (± s.d.) were: RelyX ARC: 28.1 (6.6); Multilink Automix: 37.6 (4.5); Multilink Automix + Metal-Zirconia Primer: 55.7 (4.0); Clearfil SA Cement: 46.2 (3.3); and Clearfil SA Cement + Alloy Primer: 47.0 (4.1). Metal-Zirconia Primer increased the bond strength of Multilink Automix resin cement to zirconia, but no effect was observed for Alloy Primer using Clearfil SA Cement. RelyX ARC showed the lowest bond strength to zirconia. © 2015 by the American College of Prosthodontists.
Fan, Yan; Zhang, Chenglin; Wu, Wendan; He, Wei; Zhang, Li; Ma, Xiao
2017-10-16
Indigofera pseudotinctoria Mats is an agronomically and economically important perennial legume shrub with a high forage yield, protein content and strong adaptability, which is subject to natural habitat fragmentation and serious human disturbance. Until now, our knowledge of the genetic relationships and intraspecific genetic diversity for its wild collections is still poor, especially at small spatial scales. Here amplified fragment length polymorphism (AFLP) technology was employed for analysis of genetic diversity, differentiation, and structure of 364 genotypes of I. pseudotinctoria from 15 natural locations in Wushan Montain, a highly structured mountain with typical karst landforms in Southwest China. We also tested whether eco-climate factors has affected genetic structure by correlating genetic diversity with habitat features. A total of 515 distinctly scoreable bands were generated, and 324 of them were polymorphic. The polymorphic information content (PIC) ranged from 0.694 to 0.890 with an average of 0.789 per primer pair. On species level, Nei's gene diversity ( H j ), the Bayesian genetic diversity index ( H B ) and the Shannon information index ( I ) were 0.2465, 0.2363 and 0.3772, respectively. The high differentiation among all sampling sites was detected ( F ST = 0.2217, G ST = 0.1746, G' ST = 0.2060, θ B = 0.1844), and instead, gene flow among accessions ( N m = 1.1819) was restricted. The population genetic structure resolved by the UPGMA tree, principal coordinate analysis, and Bayesian-based cluster analyses irrefutably grouped all accessions into two distinct clusters, i.e., lowland and highland groups. The population genetic structure resolved by the UPGMA tree, principal coordinate analysis, and Bayesian-based cluster analyses irrefutably grouped all accessions into two distinct clusters, i.e., lowland and highland groups. This structure pattern may indicate joint effects by the neutral evolution and natural selection. Restricted N m was
Defense Primer: A Guide for New Members
2017-03-03
1 President’s Constitutional Authority with Regard to the Armed Forces ................................... 1 The Department of Defense ...primers to give Members of Congress an overview of key aspects of the Department of Defense and how Congress exercises authority over it. A consolidated...for New Members Congressional Research Service 2 The Department of Defense CRS In Focus IF10543, Defense Primer: The Department of Defense , by
NASA Astrophysics Data System (ADS)
Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.
2016-03-01
Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.
Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.
2016-01-01
Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity. PMID:26965911
A Transportation Modeling Primer
DOT National Transportation Integrated Search
2006-06-01
This primer is intended to explain the urban transportation modeling process works, the assumptions made and the steps used to forecast travel demand for urban transportation planning. This is done in order to help to understand the process and its i...
A physicists guide to The Los Alamos Primer
NASA Astrophysics Data System (ADS)
Reed, B. Cameron
2016-11-01
In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer, which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons.
Goetze, Márcia; Schulte, Katharina; Palma-Silva, Clarisse; Zanella, Camila M; Büttow, Miriam V; Capra, Fernanda; Bered, Fernanda
2016-05-01
Aechmea subgenus Ortgiesia comprises ca. 20 species distributed in Brazil, Argentina, Paraguay, and Uruguay, with a center of diversity in the Brazilian Atlantic rainforest. We examined interspecific relationships of Ortgiesia based on Amplified Fragment Length Polymorphisms (AFLP). Ninety-six accessions belonging to 14 species of Ortgiesia were sampled, and genotyped with 11 AFLP primer combinations. The neighbor joining (NJ) tree depicted two main genetic groups within Aechmea subgenus Ortgiesia, and four subgroups. The NJ tree showed short internal branches, indicating an overall shallow genetic divergence among Ortgiesia species as expected for the recently radiated subfamily Bromelioideae. Our results suggest that hybridization and/or incomplete lineage sorting may have hampered the reconstruction of interspecific relationships in Aechmea subgenus Ortgiesia. The mapping of petal color (yellow, blue, pink, or white), inflorescence type (simple or compound), and inflorescence shape (ellipsoid, subcylindric, cylindric, or pyramidal) against the NJ tree indicated that these characters are of limited taxonomic use in Aechmea subgenus Ortgiesia due to homoplasy. An analysis of the current distribution of Ortgiesia identified the southern region of the Brazilian Atlantic rainforest, between latitudes of 26° and 27°S, as the center of diversity for the subgenus. Copyright © 2016 Elsevier Inc. All rights reserved.
Genetic diversity and population structure of a protected species: Polygala tenuifolia Willd.
Peng, Yan Qun; Fan, Ling Ling; Mao, Fu Ying; Zhao, Yun Sheng; Xu, Rui; Yin, Yu Jie; Chen, Xin; Wan, De Guang; Zhang, Xin Hui
2018-03-01
Polygala tenuifolia Willd. is an important protected species used in traditional Chinese medicine. In the present study, amplified fragment length polymorphism (AFLP) markers were employed to characterize the genetic diversity in wild and cultivated P. tenuifolia populations. Twelve primer combinations of AFLP produced 310 unambiguous and repetitious bands. Among these bands, 261 (84.2%) were polymorphic. The genetic diversity was high at the species level: percentage of polymorphic loci (PPL)=84.2%, Nei's gene diversity (h)=0.3296 and Shannon's information index (I)=0.4822. Between the two populations, the genetic differentiation of 0.1250 was low and the gene flow was relatively high, at 3.4989. The wild population (PPL=81.9%, h=0.3154, I=0.4635) showed a higher genetic diversity level than the cultivated population (PPL=63.9%, h=0.2507, I=0.3688). The results suggest that the major factors threatening the persistence of P. tenuifolia resources are ecological and human factors rather than genetic. These results will assist with the design of conservation and management programs, such as in natural habitat conservation, setting the excavation time interval for resource regeneration and the substitution of cultivated for wild plants. Copyright © 2018 Académie des sciences. Published by Elsevier Masson SAS. All rights reserved.
Comparison and Validation of Some ITS Primer Pairs Useful for Fungal Metabarcoding Studies
Op De Beeck, Michiel; Lievens, Bart; Busschaert, Pieter; Declerck, Stéphan; Vangronsveld, Jaco; Colpaert, Jan V.
2014-01-01
Current metabarcoding studies aiming to characterize microbial communities generally rely on the amplification and sequencing of relatively short DNA regions. For fungi, the internal transcribed spacer (ITS) region in the ribosomal RNA (rRNA) operon has been accepted as the formal fungal barcode. Despite an increasing number of fungal metabarcoding studies, the amplification efficiency of primers is generally not tested prior to their application in metabarcoding studies. Some of the challenges that metabarcoding primers should overcome efficiently are the amplification of target DNA strands in samples rich in non-target DNA and environmental pollutants, such as humic acids, that may have been co-extracted with DNA. In the current study, three selected primer pairs were tested for their suitability as fungal metabarcoding primers. The selected primer pairs include two primer pairs that have been frequently used in fungal metabarcoding studies (ITS1F/ITS2 and ITS3/ITS4) and a primer pair (ITS86F/ITS4) that has been shown to efficiently amplify the ITS2 region of a broad range of fungal taxa in environmental soil samples. The selected primer pairs were evaluated in a 454 amplicon pyrosequencing experiment, real-time PCR (qPCR) experiments and in silico analyses. Results indicate that experimental evaluation of primers provides valuable information that could aid in the selection of suitable primers for fungal metabarcoding studies. Furthermore, we show that the ITS86F/ITS4 primer pair outperforms other primer pairs tested in terms of in silico primer efficiency, PCR efficiency, coverage, number of reads and number of species-level operational taxonomic units (OTUs) obtained. These traits push the ITS86F/ITS4 primer pair forward as highly suitable for studying fungal diversity and community structures using DNA metabarcoding. PMID:24933453
Cheng, Lei; Zhang, Ke; Weir, Michael D.; Liu, Huaibing; Zhou, Xuedong; Xu, Hockin H. K.
2013-01-01
Objectives Recent studies developed antibacterial bonding agents and composites containing a quaternary ammonium dimethacrylate (QADM) and nanoparticles of silver (NAg). The objectives of this study were to investigate: (1) the effect of antibacterial primers containing QADM and NAg on the inhibition of Streptococcus mutans (S. mutans) impregnated into dentin blocks for the first time, and (2) the effect of QADM or NAg alone or in combination, and the effect of NAg mass fraction, on S. mutans viability in dentin. Methods Scotchbond Multi-Purpose (SBMP) bonding agent was used. QADM and NAg were incorporated into SBMP primer. Six primers were tested: SBMP primer control, control + 10% QADM (mass %), control + 0.05% NAg, control + 10% QADM + 0.05% NAg, control + 0.1% NAg, and control + 10% QADM + 0.1% NAg. S. mutans were impregnated into dentin blocks, then a primer was applied. The viable colony-forming units (CFU) were then measured by harvesting the bacteria in dentin using a sonication method. Results Control + 10% QADM + 0.1% NAg had bacteria inhibition zone 8-fold that of control (p < 0.05). The sonication method successfully harvested bacteria from dentin blocks. Control + 10% QADM + 0.1% NAg inhibited S. mutans in dentin blocks, reducing the viable CFU in dentin by three orders of magnitude, compared to control dentin without primer. Using QADM+NAg was more effective than QADM alone. Higher NAg content increased the potency. Dentin shear bond strength was similar for all groups (p > 0.1). Significance Antibacterial primer with QADM and NAg were shown to inhibit the S. mutans impregnated into dentin blocks for the first time. Bonding agent containing QADM and NAg is promising to eradicate bacteria in tooth cavity and inhibit caries. The QADM and NAg may have applicability to other adhesives, cements, sealants and composites. PMID:23422420
Effect of metal primers on bond strength of resin cements to base metals.
Fonseca, Renata Garcia; de Almeida, Juliana Gomes dos Santos Paes; Haneda, Isabella Gagliardi; Adabo, Gelson Luis
2009-04-01
A strong and durable bond between a metal framework and a resin-based luting agent is desired. Metal primers have been shown to be very effective on noble alloys. However, there is insufficient information about their effect on base metals. The purpose of this study was to evaluate the effect of metal primers on the shear bond strength of resin cements to base metals. A total of 160 cast commercially pure titanium (CP Ti) and NiCr alloy (VeraBond II) disks were embedded in a polyvinyl chloride ring, and their surfaces were smoothed with silicon carbide papers (320, 400, and 600 grit) and airborne-particle abraded with 50-mum aluminum oxide. Specimens of each metal were divided into 4 groups (n=20), which received one of the following luting techniques: (1) Panavia F, (2) Alloy Primer plus Panavia F, (3) Bistite II DC, or (4) Metaltite plus Bistite II DC. Forty minutes after preparation, all specimens were stored in distilled water at 37 degrees C for 24 hours and then thermal cycled (1000 cycles, 5-55 degrees C). After thermal cycling, the specimens were stored in 37 degrees C distilled water for an additional 24 hours or 6 months before being tested in shear mode. Data (MPa) were analyzed using 3-way ANOVA and the post hoc Tukey test (alpha=.05). Each specimen was examined under an optical microscope (x30), and the failure mode was classified as adhesive, cohesive, or a combination of these. The only significant difference between the Panavia F and Alloy Primer plus Panavia F groups occurred in the NiCr alloy at 24 hours, at which point Panavia F demonstrated superior bond strength compared to Alloy Primer plus Panavia F (P<.001). The Bistite II DC and Metaltite plus Bistite II DC groups were not significantly different. The Bistite II DC and Metaltite plus Bistite II DC groups demonstrated significantly lower bond strength to CP Ti (P<.001) than the Panavia F and Alloy Primer plus Panavia F groups, and significantly lower bond strength to NiCr alloy (P<.001) than
Reading Assessment: A Primer for Teachers and Tutors.
ERIC Educational Resources Information Center
Caldwell, JoAnne Schudt
This primer provides the basic information that teachers and tutors need to get started on the complex process of reading assessment. Designed for maximum utility in today's standards-driven classroom, the primer presents simple, practical assessment strategies that are based on theory and research. It takes teachers step by step through learning…
PD5: a general purpose library for primer design software.
Riley, Michael C; Aubrey, Wayne; Young, Michael; Clare, Amanda
2013-01-01
Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C(++) with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: http://code.google.com/p/primer-design.
Uncoupling primer and releaser responses to pheromone in honey bees
NASA Astrophysics Data System (ADS)
Grozinger, Christina M.; Fischer, Patrick; Hampton, Jacob E.
2007-05-01
Pheromones produce dramatic behavioral and physiological responses in a wide variety of species. Releaser pheromones elicit rapid responses within seconds or minutes, while primer pheromones produce long-term changes which may take days to manifest. Honeybee queen mandibular pheromone (QMP) elicits multiple distinct behavioral and physiological responses in worker bees, as both a releaser and primer, and thus produces responses on vastly different time scales. In this study, we demonstrate that releaser and primer responses to QMP can be uncoupled. First, treatment with the juvenile hormone analog methoprene leaves a releaser response (attraction to QMP) intact, but modulates QMP’s primer effects on sucrose responsiveness. Secondly, two components of QMP (9-ODA and 9-HDA) do not elicit a releaser response (attraction) but are as effective as QMP at modulating a primer response, downregulation of foraging-related brain gene expression. These results suggest that different responses to a single pheromone may be produced via distinct pathways.
2014-01-01
Background Descendants from the extinct aurochs (Bos primigenius), taurine (Bos taurus) and zebu cattle (Bos indicus) were domesticated 10,000 years ago in Southwestern and Southern Asia, respectively, and colonized the world undergoing complex events of admixture and selection. Molecular data, in particular genome-wide single nucleotide polymorphism (SNP) markers, can complement historic and archaeological records to elucidate these past events. However, SNP ascertainment in cattle has been optimized for taurine breeds, imposing limitations to the study of diversity in zebu cattle. As amplified fragment length polymorphism (AFLP) markers are discovered and genotyped as the samples are assayed, this type of marker is free of ascertainment bias. In order to obtain unbiased assessments of genetic differentiation and structure in taurine and zebu cattle, we analyzed a dataset of 135 AFLP markers in 1,593 samples from 13 zebu and 58 taurine breeds, representing nine continental areas. Results We found a geographical pattern of expected heterozygosity in European taurine breeds decreasing with the distance from the domestication centre, arguing against a large-scale introgression from European or African aurochs. Zebu cattle were found to be at least as diverse as taurine cattle. Western African zebu cattle were found to have diverged more from Indian zebu than South American zebu. Model-based clustering and ancestry informative markers analyses suggested that this is due to taurine introgression. Although a large part of South American zebu cattle also descend from taurine cows, we did not detect significant levels of taurine ancestry in these breeds, probably because of systematic backcrossing with zebu bulls. Furthermore, limited zebu introgression was found in Podolian taurine breeds in Italy. Conclusions The assessment of cattle diversity reported here contributes an unbiased global view to genetic differentiation and structure of taurine and zebu cattle
Effects of different orthodontic primers on enamel demineralization around orthodontic brackets.
Baysal, Asli; Yasa, Asli; Sogut, Ozlem; Ozturk, Mehmet Ali; Uysal, Tancan
2015-09-01
The purpose of this work is to evaluate the effectiveness of one self-etching and two filled orthodontic primers on enamel demineralization around orthodontic brackets. Brackets were bonded to 84 bovine teeth and the vestibular enamel surfaces covered with acid-resistant nail varnish exposing 1 mm of space on each side of the bracket base. The teeth were allocated to four groups, using either Transbond XT conventional primer on etched enamel (group 1), Transbond Plus Self-Etching Primer on untreated enamel (group 2), Pro Seal filled resin primer on etched enamel (group 3), or Opal Seal filled resin primer on etched enamel (group 4). Each tooth was subjected to 15,000 strokes of brushing followed by exposure to an acid challenge. Calcium-ion release from each sample was calculated using atomic absorption spectrophotometry. Data were analyzed using one-way ANOVA and a post hoc Tukey test. Differences were considered statistically significant at p ≤ 0.05. Statistically significant differences were observed between the four groups (p < 0.001). No significant difference was found between the controls (group 1) and the Opal Seal group. Higher calcium release was observed in the Pro Seal group and the self-etching primer group compared to the controls. The highest calcium release was recorded in the self-etching primer group. Filled sealants may not have a protective effect against enamel demineralization. Transbond Plus Self-Etching Primer should be used cautiously, considering the risk of demineralization involved in its application.
Aluminum Rich Epoxy Primer for Ground and Air Vehicles
2017-03-01
UNCLASSIFIED DOCUMENT Aluminum Rich Epoxy Primer for Ground and Air Vehicles Monthly Technical Report for the Period: January 20, 2017...Objective: To further develop the Aluminum Rich Epoxy Primer systems for Air and Ground Vehicles while addressing the objective requirements
Primer on consumer marketing research : procedures, methods, and tools
DOT National Transportation Integrated Search
1994-03-01
The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...
Ou, Xiufang; Long, Likun; Wu, Ying; Yu, Yingjie; Lin, Xiuyun; Qi, Xin; Liu, Bao
2010-07-01
An array of studies have reported that the spaceflight environment is mutagenic and may induce phenotypic and genetic changes in diverse organisms. We reported recently that in at least some plant species (e.g., rice) the spaceflight environment can be particularly potent in generating heritable epigenetic changes in the form of altered cytosine methylation patterns and activation of transposable elements. To further study the issue of spaceflight-induced genomic instability, and in particular to test whether the incurred genetic and epigenetic changes are connected or independent of each other, we performed the present study. We subjected seeds of the standard laboratory rice (Oryza sativa L.) cultivar Nipponbare to a spaceflight in the spaceship Long March 2 for 18 days. We then investigated the genetic and DNA methylation stabilities of 11 randomly selected plants germinated from the spaceflown seeds by using two kinds of DNA markers, amplified fragment length polymorphism (AFLP) and methylation sensitive amplified polymorphism (MSAP). For AFLP, by using 15 primer combinations, we assessed 460 genomic loci and found that the frequencies of genetic changes across the 11 plants ranged from 0.7% to 6.7% with an average frequency of 3.5%. For MSAP, by using 14 primer combinations, we assessed 467 loci and detected the occurrence of four major types of cytosine methylation alterations at the CCGG sites, namely CG or CNG hypomethylation and CG or CNG hypermethylation. Collectively, the frequencies of the two kinds of hypermethylation, CG (1.95%) and CNG (1.44%), are about two times higher than those of the two kinds of hypomethylation, CG (0.76%) and CNG (0.80%), though different plants showed variable frequencies for each type of alteration. Further analysis suggested that both the genetic and cytosine methylation changes manifested apparent mutational bias towards specific genomic regions, but the two kinds of instabilities are independent of each other based on
Joy, Nisha; Abraham, Z; Soniya, EV
2007-01-01
Background The impact of diseases such as Phytophthora foot rot and the replacement of unproductive cultivars by high yielding ones has brought about the disappearance of varieties in Piper species, like any other crop. Black pepper (King of spices), is a major spice crop consumed throughout the world. It is widely cultivated across various parts of the world apart from India. The different cultivars may be genetically related and could be a source of valuable genes for disease resistance and an increase in quantity and quality. Even though Western Ghats in India is believed to be the site of origin of this crop, numerous accessions from the NBPGR have not yet been evaluated. Our study aims to investigate the genetic relatedness in major cultivars of black pepper using Amplified Fragment Length Polymorphism. Results Amplified Fragment Length Polymorphic (AFLP) DNA analysis was performed in thirty popular cultivars of black pepper from National Bureau of Plant Genetic Resources (NBPGR), India. Fingerprint profiles were generated initially with, five different primer combinations, from which three primer pair combinations (EAGC/MCAA, EAGG/MCTA and EAGC/MCTG) gave consistent and scorable banding patterns. From 173 scorable markers, 158(> 90%) were polymorphic which shows there is considerable variation in the available germplasm. The dendrogram derived by unweighted pair group method analysis (UPGMA) grouped the accessions into three major clusters and four diverse cultivars with only 30% similarity. Karimunda, a widely grown and popular cultivar was unique in the fingerprint profiles obtained. Conclusion There are currently few fingerprinting studies using the valuable spice crop black pepper. We found considerable genetic variability among cultivars of black pepper. Fingerprinting analysis with AFLP proved to be an ideal tool for cultivar identification and phylogenetic studies. It shows the high level of polymorphism and the unique characterization of the major
swga: a primer design toolkit for selective whole genome amplification.
Clarke, Erik L; Sundararaman, Sesh A; Seifert, Stephanie N; Bushman, Frederic D; Hahn, Beatrice H; Brisson, Dustin
2017-07-15
Population genomic analyses are often hindered by difficulties in obtaining sufficient numbers of genomes for analysis by DNA sequencing. Selective whole-genome amplification (SWGA) provides an efficient approach to amplify microbial genomes from complex backgrounds for sequence acquisition. However, the process of designing sets of primers for this method has many degrees of freedom and would benefit from an automated process to evaluate the vast number of potential primer sets. Here, we present swga , a program that identifies primer sets for SWGA and evaluates them for efficiency and selectivity. We used swga to design and test primer sets for the selective amplification of Wolbachia pipientis genomic DNA from infected Drosophila melanogaster and Mycobacterium tuberculosis from human blood. We identify primer sets that successfully amplify each against their backgrounds and describe a general method for using swga for arbitrary targets. In addition, we describe characteristics of primer sets that correlate with successful amplification, and present guidelines for implementation of SWGA to detect new targets. Source code and documentation are freely available on https://www.github.com/eclarke/swga . The program is implemented in Python and C and licensed under the GNU Public License. ecl@mail.med.upenn.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.
Berruti, Andrea; Desirò, Alessandro; Visentin, Stefano; Zecca, Odoardo; Bonfante, Paola
2017-10-01
ITS primers commonly used to describe soil fungi are flawed for AMF although it is unknown the extent to which they distort the interpretation of community patterns. Here, we focus on how the use of a specific ITS2 fungal barcoding primer pair biased for AMF changes the interpretation of AMF community patterns from three mountain vineyards compared to a novel AMF-specific approach on the 18S. We found that although discrepancies were present in the taxonomic composition of the two resulting datasets, the estimation of diversity patterns among AMF communities was similar and resulted in both primer systems being able to correctly assess the community-structuring effect of location, compartment (root vs. soil) and environment. Both methodologies made it possible to detect the same alpha-diversity trend among the locations under study but not between root and soil transects. We show that the ITS2 primer system for fungal barcoding provides a good estimate of both AMF community structure and relation to environmental variables. However, this primer system does not fit in with cross-compartment surveys (roots vs. soil) as it can underestimate AMF diversity in soil samples. When specifically focusing on AMF, the 18S primer system resulted in wide coverage and marginal non-target amplification. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.
UniPrime2: a web service providing easier Universal Primer design.
Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C
2009-07-01
The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.
Assessment of genetic and epigenetic variation during long-term Taxus cell culture.
Fu, Chunhua; Li, Liqin; Wu, Wenjuan; Li, Maoteng; Yu, Xiaoqing; Yu, Longjiang
2012-07-01
Gradual loss of secondary metabolite production is a common obstacle in the development of a large-scale plant cell production system. In this study, cell morphology, paclitaxel (Taxol®) biosynthetic ability, and genetic and epigenetic variations in the long-term culture of Taxus media cv Hicksii cells were assessed over a 5-year period to evaluate the mechanisms of the loss of secondary metabolites biosynthesis capacity in Taxus cell. The results revealed that morphological variations, gradual loss of paclitaxel yield and decreased transcriptional level of paclitaxel biosynthesis key genes occurred during long-term subculture. Genetic and epigenetic variations in these cultures were also studied at different times during culture using amplified fragment-length polymorphism (AFLP), methylation-sensitive amplified polymorphism (MSAP), and high-performance liquid chromatography (HPLC) analyses. A total of 32 primer combinations were used in AFLP amplification, and none of the AFLP loci were found to be polymorphic, thus no major genetic rearrangements were detected in any of the tested samples. However, results from both MSAP and HPLC indicated that there was a higher level of DNA methylation in the low-paclitaxel yielding cell line after long-term culture. Based on these results, we proposed that accumulation of paclitaxel in Taxus cell cultures might be regulated by DNA methylation. To our knowledge, this is the first report of increased methylation with the prolongation of culture time in Taxus cell culture. It provides substantial clues for exploring the gradual loss of the taxol biosynthesis capacity of Taxus cell lines during long-term subculture. DNA methylation maybe involved in the regulation of paclitaxel biosynthesis in Taxus cell culture.
Shi, Liang; Mu, Da-Shuai; Jiang, Ai-Liang; Han, Qin; Zhao, Ming-Wen
2013-01-01
Ganoderma lucidum is a mushroom with traditional medicinal properties that has been widely used in China and other countries in Eastern Asia. Ganoderic acids (GA) produced by G. lucidum exhibit important pharmacological activities. Previous studies have demonstrated that methyl jasmonate (MeJA) is a potent inducer of GA biosynthesis and the expression of genes involved in the GA biosynthesis pathway in G. lucidum. To further explore the mechanism of GA biosynthesis, cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) was used to identify genes that are differentially expressed in response to MeJA. Using 64 primer combinations, over 3910 transcriptionally derived fragments (TDFs) were obtained. Reliable sequence data were obtained for 390 of 458 selected TDFs. Ninety of these TDFs were annotated with known functions through BLASTX searching the GenBank database, and 12 annotated TDFs were assigned into secondary metabolic pathways by searching the KEGGPATHWAY database. Twenty-five TDFs were selected for qRT-PCR analysis to confirm the expression patterns observed with cDNA-AFLP. The qRT-PCR results were consistent with the altered patterns of gene expression revealed by the cDNA-AFLP technique. Additionally, the transcript levels of 10 genes were measured at the mycelium, primordia, and fruiting body developmental stages of G. lucidum. The greatest expression levels were reached during primordia for all of the genes except cytochrome b2 reached its highest expression level in the mycelium stage. This study not only identifies new candidate genes involved in the regulation of GA biosynthesis but also provides further insight into MeJA-induced gene expression and secondary metabolic response in G. lucidum. PMID:23762280
Shear bond strength between autopolymerizing acrylic resin and Co-Cr alloy using different primers.
Sanohkan, Sasiwimol; Urapepon, Somchai; Harnirattisai, Choltacha; Sirisinha, Chakrit; Sunintaboon, Panya
2012-01-01
This study aimed to examine the shear bond strength between cobalt chromium alloy and autopolymerizing acrylic resin using experimental primers containing 5, 10, and 15 wt% of 4-methacryloxyethyl trimellitic anhydride or 1, 2, and 3 wt% of 3-methacryloxypropyl-trimethoxysilane comparison to 5 commercial primers (ML primers, Alloy primer, Metal/Zirconia primer, Monobond S, and Monobond plus). Sixty alloy specimens were sandblasted and treated with each primer before bonded with an acrylic resin. The control group was not primed. The shear bond strengths were tested and statistically compared. Specimens treated with commercial primers significantly increased the shear bond strength of acrylic resin to cobalt chromium alloy (p<0.05). The highest shear bond strength was found in the Alloy primer group. Among experimental group, using 10 wt% of 4-methacryloxyethyl trimellitic anhydride -or 2 wt% of 3-methacryloxypropyltrimethoxysilane enhanced highest shear bond strength. The experimental and commercial primers in this study all improved bonding of acrylic resin to cobalt chromium alloy.
Shear bond strength of orthodontic metal brackets to aged composite using three primers
Tayebi, Ali; Fallahzadeh, Farnoosh
2017-01-01
Background This study aimed to assess the effect of surface preparation with sandblasting and diamond bur along with the use of three primers on shear bond strength (SBS) of metal brackets to aged composite. Material and Methods In this in vitro, experimental study, 60 Filtek Z250 composite discs were fabricated (10×2mm), immersed in distilled water for 24 hours and subjected to 5000 thermal cycles. They were randomly divided into two groups (n=30) of sandblasting with aluminum oxide particles for 10 seconds and surface roughening with bur. Each group was randomly divided into three subgroups (n=10) for use of Transbond XT, Assure Plus and Composite Primer. Metal brackets were bonded and the samples were stored in distilled water for 24 hours followed by 2000 thermal cycles. The SBS of brackets was measured and the adhesive remnant index (ARI) score was calculated. The data were analyzed by one-way ANOVA, t-test and Chi square test. Results The difference in the mean SBS was not significant among the six subgroups. Conclusions All combinations of primers and surface preparation methods provided adequately high SBS between brackets and aged composite surfaces. Considering the ARI scores, surface roughening by bur is superior to sandblasting. Key words:Shear strength, composite resins, orthodontic brackets, aged composite, surface preparation. PMID:28638550
NASA Astrophysics Data System (ADS)
Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok
2018-03-01
We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.
A multiple-alignment based primer design algorithm for genetically highly variable DNA targets
2013-01-01
Background Primer design for highly variable DNA sequences is difficult, and experimental success requires attention to many interacting constraints. The advent of next-generation sequencing methods allows the investigation of rare variants otherwise hidden deep in large populations, but requires attention to population diversity and primer localization in relatively conserved regions, in addition to recognized constraints typically considered in primer design. Results Design constraints include degenerate sites to maximize population coverage, matching of melting temperatures, optimizing de novo sequence length, finding optimal bio-barcodes to allow efficient downstream analyses, and minimizing risk of dimerization. To facilitate primer design addressing these and other constraints, we created a novel computer program (PrimerDesign) that automates this complex procedure. We show its powers and limitations and give examples of successful designs for the analysis of HIV-1 populations. Conclusions PrimerDesign is useful for researchers who want to design DNA primers and probes for analyzing highly variable DNA populations. It can be used to design primers for PCR, RT-PCR, Sanger sequencing, next-generation sequencing, and other experimental protocols targeting highly variable DNA samples. PMID:23965160
STITCHER 2.0: primer design for overlapping PCR applications.
O'Halloran, Damien M; Uriagereka-Herburger, Isabel; Bode, Katrin
2017-03-30
Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to 'stitch' individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user's input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html.
MRPrimerV: a database of PCR primers for RNA virus detection
Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Kim, Doyun; Koo, JaeHyung; Kim, Min-Soo
2017-01-01
Many infectious diseases are caused by viral infections, and in particular by RNA viruses such as MERS, Ebola and Zika. To understand viral disease, detection and identification of these viruses are essential. Although PCR is widely used for rapid virus identification due to its low cost and high sensitivity and specificity, very few online database resources have compiled PCR primers for RNA viruses. To effectively detect viruses, the MRPrimerV database (http://MRPrimerV.com) contains 152 380 247 PCR primer pairs for detection of 1818 viruses, covering 7144 coding sequences (CDSs), representing 100% of the RNA viruses in the most up-to-date NCBI RefSeq database. Due to rigorous similarity testing against all human and viral sequences, every primer in MRPrimerV is highly target-specific. Because MRPrimerV ranks CDSs by the penalty scores of their best primer, users need only use the first primer pair for a single-phase PCR or the first two primer pairs for two-phase PCR. Moreover, MRPrimerV provides the list of genome neighbors that can be detected using each primer pair, covering 22 192 variants of 532 RefSeq RNA viruses. We believe that the public availability of MRPrimerV will facilitate viral metagenomics studies aimed at evaluating the variability of viruses, as well as other scientific tasks. PMID:27899620
Selected Transportation Topics : Energy Primer
DOT National Transportation Integrated Search
1975-01-01
Energy involved in transportation has become a critical consideration in recent years. This primer contains ten representative articles of those resulting from government reports, conference papers, etc., on what the current energy situation is, and ...
White primer permits a corrosion-resistant coating of minimum weight
NASA Technical Reports Server (NTRS)
Albrecht, R. H.; Jensen, D. P.; Schnake, P.
1966-01-01
White primer for coating 2219 aluminum alloy supplies a base for a top coating of enamel. A formulation of pigments and vehicle results in a primer with high corrosion resistance and minimum film thickness.
Nanotechnology: A Policy Primer
2013-06-24
National Science Foundation (NSF), Department of Energy (DOE), National Aeronautics and Space Administration ( NASA ), Department of Commerce (DOC...and Extension Service, Department of Agriculture ( USDA ); (continued...) Nanotechnology: A Policy Primer Congressional Research Service 6 NSET...State; Department of Transportation; Department of the Treasury; EPA; Food and Drug Administration; Forest Service, USDA ; Intelligence Technology
Exploration of Deinococcus-Thermus molecular diversity by novel group-specific PCR primers
Theodorakopoulos, Nicolas; Bachar, Dipankar; Christen, Richard; Alain, Karine; Chapon, Virginie
2013-01-01
The deeply branching Deinococcus-Thermus lineage is recognized as one of the most extremophilic phylum of bacteria. In previous studies, the presence of Deinococcus-related bacteria in the hot arid Tunisian desert of Tataouine was demonstrated through combined molecular and culture-based approaches. Similarly, Thermus-related bacteria have been detected in Tunisian geothermal springs. The present work was conducted to explore the molecular diversity within the Deinococcus-Thermus phylum in these extreme environments. A set of specific primers was designed in silico on the basis of 16S rRNA gene sequences, validated for the specific detection of reference strains, and used for the polymerase chain reaction (PCR) amplification of metagenomic DNA retrieved from the Tataouine desert sand and Tunisian hot spring water samples. These analyses have revealed the presence of previously undescribed Deinococcus-Thermus bacterial sequences within these extreme environments. The primers designed in this study thus represent a powerful tool for the rapid detection of Deinococcus-Thermus in environmental samples and could also be applicable to clarify the biogeography of the Deinococcus-Thermus phylum. PMID:23996915
PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, S. N.
2013-08-08
Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.
Pritchard, Leighton; Holden, Nicola J; Bielaszewska, Martina; Karch, Helge; Toth, Ian K
2012-01-01
An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS) technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC) E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 'positive' E. coli O104:H4 outbreak and 32 'negative' non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high throughput primer design strategies will enable faster, more precise responses to
Bielaszewska, Martina; Karch, Helge; Toth, Ian K.
2012-01-01
Background An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS) technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC) E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. Methodology/Principal Findings Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 ‘positive’ E. coli O104:H4 outbreak and 32 ‘negative’ non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. Conclusions/Significance Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high throughput
Congestion pricing : a primer : overview
DOT National Transportation Integrated Search
2008-10-01
This Overview primer was produced to explain the concept of congestion pricing and its benefits, to present examples of congestion-pricing approaches implemented in the United States and abroad, and to briefly discuss federal-aid policy and programs ...
Do we need primer for orthodontic bonding? A randomized controlled trial.
Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R
2015-04-01
To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P < 0.0001). As the study was only performed by one operator, the results can therefore only be truly be applied to their practice
A Tale of Tails: Dissecting the Enhancing Effect of Tailed Primers in Real-Time PCR
Vandenbussche, Frank; Mathijs, Elisabeth; Lefebvre, David; De Clercq, Kris; Van Borm, Steven
2016-01-01
Non-specific tail sequences are often added to the 5’-terminus of primers to improve the robustness and overall performance of diagnostic assays. Despite the widespread use of tailed primers, the underlying working mechanism is not well understood. To address this problem, we conducted a detailed in vitro and in silico analysis of the enhancing effect of primer tailing on 2 well-established foot-and-mouth disease virus (FMDV) RT-qPCR assays using an FMDV reference panel. Tailing of the panFMDV-5UTR primers mainly affected the shape of the amplification curves. Modelling of the raw fluorescence data suggested a reduction of the amplification efficiency due to the accumulation of inhibitors. In depth analysis of PCR products indeed revealed the rapid accumulation of forward-primer derived artefacts. More importantly, tailing of the forward primer delayed artefacts formation and concomitantly restored the sigmoidal shape of the amplification curves. Our analysis also showed that primer tailing can alter utilisation patterns of degenerate primers and increase the number of primer variants that are able to participate in the reaction. The impact of tailed primers was less pronounced in the panFMDV-3D assay with only 5 out of 50 isolates showing a clear shift in Cq values. Sequence analysis of the target region of these 5 isolates revealed several mutations in the inter-primer region that extend an existing hairpin structure immediately downstream of the forward primer binding site. Stabilisation of the forward primer with either a tail sequence or cationic spermine units restored the sensitivity of the assay, which suggests that the enhancing effect in the panFMDV-3D assay is due to a more efficient extension of the forward primer. ur results show that primer tailing can alter amplification through various mechanisms that are determined by both the assay and target region. These findings expand our understanding of primer tailing and should enable a more targeted and
Menzies, J G; Bakkeren, G; Matheson, F; Procunier, J D; Woods, S
2003-02-01
ABSTRACT In the smut fungi, few features are available for use as taxonomic criteria (spore size, shape, morphology, germination type, and host range). DNA-based molecular techniques are useful in expanding the traits considered in determining relationships among these fungi. We examined the phylogenetic relationships among seven species of Ustilago (U. avenae, U. bullata, U. hordei, U. kolleri, U. nigra, U. nuda, and U. tritici) using inter-simple sequence repeats (ISSRs) and amplified fragment length polymorphisms (AFLPs) to compare their DNA profiles. Fifty-four isolates of different Ustilago spp. were analyzed using ISSR primers, and 16 isolates of Ustilago were studied using AFLP primers. The variability among isolates within species was low for all species except U. bullata. The isolates of U. bullata, U. nuda, and U. tritici were well separated and our data supports their speciation. U. avenae and U. kolleri isolates did not separate from each other and there was little variability between these species. U. hordei and U. nigra isolates also showed little variability between species, but the isolates from each species grouped together. Our data suggest that U. avenae and U. kolleri are monophyletic and should be considered one species, as should U. hordei and U. nigra.
ERIC Educational Resources Information Center
Elkins, Kelly M.; Kadunc, Raelynn E.
2012-01-01
In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…
Strategies to Improve Efficiency and Specificity of Degenerate Primers in PCR.
Campos, Maria Jorge; Quesada, Alberto
2017-01-01
PCR with degenerate primers can be used to identify the coding sequence of an unknown protein or to detect a genetic variant within a gene family. These primers, which are complex mixtures of slightly different oligonucleotide sequences, can be optimized to increase the efficiency and/or specificity of PCR in the amplification of a sequence of interest by the introduction of mismatches with the target sequence and balancing their position toward the primers 5'- or 3'-ends. In this work, we explain in detail examples of rational design of primers in two different applications, including the use of specific determinants at the 3'-end, to: (1) improve PCR efficiency with coding sequences for members of a protein family by fully degeneration at a core box of conserved genetic information, with the reduction of degeneration at the 5'-end, and (2) optimize specificity of allelic discrimination of closely related orthologous by 5'-end degenerate primers.
STITCHER 2.0: primer design for overlapping PCR applications
O’Halloran, Damien M.; Uriagereka-Herburger, Isabel; Bode, Katrin
2017-01-01
Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to ‘stitch’ individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user’s input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html. PMID:28358011
An evaluation of corrosion protection by two epoxy primers on 2219-T87 and 7075-T73 aluminum
NASA Technical Reports Server (NTRS)
Mendrek, M. J.
1992-01-01
A comparison of the corrosion protection provided by two amine epoxy primers was made using salt fog, alternate immersion, and total immersion as exposure media. The study is the result of a request to use an unqualified low volatile organic carbon (VOC) primer (AKZO 463-6-78) in place of the current primer (AKZO 463-6-3) because environmental regulations have eliminated use of the current primer in many states. Primed, scribed samples of 2219-T87 and 7075-T73 aluminum were exposed to 5-percent NaCl salt fog and 3.5-percent NaCl alternate immersion for a period of 90 days. In addition, electrode samples immersed in 3.5-percent NaCl were tested using electrochemical impedance spectroscopy (EIS). The EG&G model 368 ac impedance measurement system was used to monitor changing properties of AKZO 463-6-78 and AKZO 463-6-3 primed 2219-T87 aluminum for a period of 30 days. The response of the corroding system of a frequency scan can be modeled in terms of an equivalent circuit consisting of resistors and capacitors in a specific arrangement. Each resistor/capacitor combination represents physical processes taking place within the electrolyte, at the electrolyte/primer surface, within the coating, and at the coating/substrate surface. Values for the resistors and capacitors are assigned following a nonlinear least squares fit of the data to the equivalent circuit. Changes in the values of equivalent circuit parameters during the 30-day exposure allow assessment of the time to and mechanism of coating breakdown.
Primer and platform effects on 16S rRNA tag sequencing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tremblay, Julien; Singh, Kanwar; Fern, Alison
Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less
Primer and platform effects on 16S rRNA tag sequencing
Tremblay, Julien; Singh, Kanwar; Fern, Alison; ...
2015-08-04
Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less
,
1992-01-01
substance and will present a nontechnical overview of the techniques used to measure crystalline silica. Because this primer is meant to be a starting point for anyone interested in learning more about crystalline silica, a list of selected readings and other resources is included. The detailed glossary, which defines many terms that are beyond the scope of this publication, is designed to help the reader move from this presentation to a more technical one, the inevitable next step.
Microsatellites for the genus Cucurbita and an SSR-based genetic linkage map of Cucurbita pepo L.
Gong, L.; Stift, G.; Kofler, R.; Pachner, M.
2008-01-01
Until recently, only a few microsatellites have been available for Cucurbita, thus their development is highly desirable. The Austrian oil-pumpkin variety Gleisdorfer Ölkürbis (C. pepo subsp. pepo) and the C. moschata cultivar Soler (Puerto Rico) were used for SSR development. SSR-enriched partial genomic libraries were established and 2,400 clones were sequenced. Of these 1,058 (44%) contained an SSR at least four repeats long. Primers were designed for 532 SSRs; 500 primer pairs produced fragments of expected size. Of these, 405 (81%) amplified polymorphic fragments in a set of 12 genotypes: three C. moschata, one C. ecuadorensis, and eight C. pepo representing all eight cultivar groups. On an average, C. pepo and C. moschata produced 3.3 alleles per primer pair, showing high inter-species transferability. There were 187 SSR markers detecting polymorphism between the USA oil-pumpkin variety “Lady Godiva” (O5) and the Italian crookneck variety “Bianco Friulano” (CN), which are the parents of our previous F2 mapping population. It has been used to construct the first published C. pepo map, containing mainly RAPD and AFLP markers. Now the updated map comprises 178 SSRs, 244 AFLPs, 230 RAPDs, five SCARs, and two morphological traits (h and B). It contains 20 linkage groups with a map density of 2.9 cM. The observed genome coverage (Co) is 86.8%. Electronic supplementary material The online version of this article (doi:10.1007/s00122-008-0750-2) contains supplementary material, which is available to authorized users. PMID:18379753
Chemical and mechanical aspects of HMR primer in relationship to wood bonding
Alfred W. Christiansen
2005-01-01
The mechanism by which hydroxymethylated resorcinol (HMR) primer improves the durability of various adhesives to wood has been hypothesized as covalent chemical links between the adhesive and primer and possibly between the primer and wood. The present work presents experiments to test this hypothesis. In the first test, some resorcinol was displaced by 2- methylres-...
Design of a Percussion and Electric Primer Gun Firing Power Supply
2014-07-01
solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply
Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R
2013-06-06
Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.
MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool
Zhou, Quan
2017-01-01
An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876
Comparison of shear bond strength of orthodontic brackets using various zirconia primers.
Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju
2015-07-01
The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.
Primer-Free Aptamer Selection Using A Random DNA Library
Pan, Weihua; Xin, Ping; Patrick, Susan; Dean, Stacey; Keating, Christine; Clawson, Gary
2010-01-01
Aptamers are highly structured oligonucleotides (DNA or RNA) that can bind to targets with affinities comparable to antibodies 1. They are identified through an in vitro selection process called Systematic Evolution of Ligands by EXponential enrichment (SELEX) to recognize a wide variety of targets, from small molecules to proteins and other macromolecules 2-4. Aptamers have properties that are well suited for in vivo diagnostic and/or therapeutic applications: Besides good specificity and affinity, they are easily synthesized, survive more rigorous processing conditions, they are poorly immunogenic, and their relatively small size can result in facile penetration of tissues. Aptamers that are identified through the standard SELEX process usually comprise ~80 nucleotides (nt), since they are typically selected from nucleic acid libraries with ~40 nt long randomized regions plus fixed primer sites of ~20 nt on each side. The fixed primer sequences thus can comprise nearly ~50% of the library sequences, and therefore may positively or negatively compromise identification of aptamers in the selection process 3, although bioinformatics approaches suggest that the fixed sequences do not contribute significantly to aptamer structure after selection 5. To address these potential problems, primer sequences have been blocked by complementary oligonucleotides or switched to different sequences midway during the rounds of SELEX 6, or they have been trimmed to 6-9 nt 7, 8. Wen and Gray 9 designed a primer-free genomic SELEX method, in which the primer sequences were completely removed from the library before selection and were then regenerated to allow amplification of the selected genomic fragments. However, to employ the technique, a unique genomic library has to be constructed, which possesses limited diversity, and regeneration after rounds of selection relies on a linear reamplification step. Alternatively, efforts to circumvent problems caused by fixed primer sequences
Lim, Myung-Jin; Yu, Mi-Kyung; Lee, Kwang-Won
2018-05-01
This study investigated the effect of continuous application of 10-methacryloyloxydecyldihydrogen phosphate (MDP)-containing primer and luting resin cement on bond strength to tribochemical silica-coated yttria-stabilized tetragonal zirconia polycrystal (Y-TZP). Forty bovine teeth and Y-TZP specimens were prepared. The dentin specimens were embedded in molds, with one side of the dentin exposed for cementation with the zirconia specimen. The Y-TZP specimen was prepared in the form of a cylinder with a diameter of 3 mm and a height of 10 mm. The bonding surface of the Y-TZP specimen was sandblasted with silica-coated aluminium oxide particles. The forty tribochemical silica-coated Y-TZP specimens were cemented to the bovine dentin (4 groups; n = 10) with either an MDP-free primer or an MDP-containing primer and either an MDP-free resin cement or an MDP-containing resin cement. After a shear bond strength (SBS) test, the data were analyzed using 1-way analysis of variance and the Tukey test (α = 0.05). The group with MDP-free primer and resin cement showed significantly lower SBS values than the MDP-containing groups ( p < 0.05). Among the MDP-containing groups, the group with MDP-containing primer and resin cement showed significantly higher SBS values than the other groups ( p < 0.05). The combination of MDP-containing primer and luting cement following tribochemical silica coating to Y-TZP was the best choice among the alternatives tested in this study.
Gao, Xinxin; Yo, Peggy; Keith, Andrew; Ragan, Timothy J.; Harris, Thomas K.
2003-01-01
A novel thermodynamically-balanced inside-out (TBIO) method of primer design was developed and compared with a thermodynamically-balanced conventional (TBC) method of primer design for PCR-based gene synthesis of codon-optimized gene sequences for the human protein kinase B-2 (PKB2; 1494 bp), p70 ribosomal S6 subunit protein kinase-1 (S6K1; 1622 bp) and phosphoinositide-dependent protein kinase-1 (PDK1; 1712 bp). Each of the 60mer TBIO primers coded for identical nucleotide regions that the 60mer TBC primers covered, except that half of the TBIO primers were reverse complement sequences. In addition, the TBIO and TBC primers contained identical regions of temperature- optimized primer overlaps. The TBC method was optimized to generate sequential overlapping fragments (∼0.4–0.5 kb) for each of the gene sequences, and simultaneous and sequential combinations of overlapping fragments were tested for their ability to be assembled under an array of PCR conditions. However, no fully synthesized gene sequences could be obtained by this approach. In contrast, the TBIO method generated an initial central fragment (∼0.4–0.5 kb), which could be gel purified and used for further inside-out bidirectional elongation by additional increments of 0.4–0.5 kb. By using the newly developed TBIO method of PCR-based gene synthesis, error-free synthetic genes for the human protein kinases PKB2, S6K1 and PDK1 were obtained with little or no corrective mutagenesis. PMID:14602936
Real-time PCR (qPCR) primer design using free online software.
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.
A tool for design of primers for microRNA-specific quantitative RT-qPCR.
Busk, Peter K
2014-01-28
MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. I have developed the software miRprimer for automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed by this method have been distributed to several labs and used successfully in published studies. The software miRprimer is an automatic and easy method for design of functional primers for miR-specific RT-qPCR. The application is available as stand-alone software that will work on the MS Windows platform and in a developer version written in the Ruby programming language.
ERIC Educational Resources Information Center
Yetter, Carol J.
2009-01-01
This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…
2011-01-01
Background Fusarium oxysporum f. sp. melonis Snyd. & Hans. (FOM) causes Fusarium wilt, the most important infectious disease of melon (Cucumis melo L.). The four known races of this pathogen can be distinguished only by infection on appropriate cultivars. No molecular tools are available that can discriminate among the races, and the molecular basis of compatibility and disease progression are poorly understood. Resistance to races 1 and 2 is controlled by a single dominant gene, whereas only partial polygenic resistance to race 1,2 has been described. We carried out a large-scale cDNA-AFLP analysis to identify host genes potentially related to resistance and susceptibility as well as fungal genes associated with the infection process. At the same time, a systematic reisolation procedure on infected stems allowed us to monitor fungal colonization in compatible and incompatible host-pathogen combinations. Results Melon plants (cv. Charentais Fom-2), which are susceptible to race 1,2 and resistant to race 1, were artificially infected with a race 1 strain of FOM or one of two race 1,2 w strains. Host colonization of stems was assessed at 1, 2, 4, 8, 14, 16, 18 and 21 days post inoculation (dpi), and the fungus was reisolated from infected plants. Markedly different colonization patterns were observed in compatible and incompatible host-pathogen combinations. Five time points from the symptomless early stage (2 dpi) to obvious wilting symptoms (21 dpi) were considered for cDNA-AFLP analysis. After successful sequencing of 627 transcript-derived fragments (TDFs) differentially expressed in infected plants, homology searching retrieved 305 melon transcripts, 195 FOM transcripts expressed in planta and 127 orphan TDFs. RNA samples from FOM colonies of the three strains grown in vitro were also included in the analysis to facilitate the detection of in planta-specific transcripts and to identify TDFs differentially expressed among races/strains. Conclusion Our data
Preliminary genetic linkage map of the abalone Haliotis diversicolor Reeve
NASA Astrophysics Data System (ADS)
Shi, Yaohua; Guo, Ximing; Gu, Zhifeng; Wang, Aimin; Wang, Yan
2010-05-01
Haliotis diversicolor Reeve is one of the most important mollusks cultured in South China. Preliminary genetic linkage maps were constructed with amplified fragment length polymorphism (AFLP) markers. A total of 2 596 AFLP markers were obtained from 28 primer combinations in two parents and 78 offsprings. Among them, 412 markers (15.9%) were polymorphic and segregated in the mapping family. Chi-square tests showed that 151 (84.4%) markers segregated according to the expected 1:1 Mendelian ratio ( P<0.05) in the female parent, and 200 (85.8%) in the male parent. For the female map, 179 markers were used for linkage analysis and 90 markers were assigned to 17 linkage groups with an average interval length of 25.7 cm. For the male map, 233 markers were used and 94 were mapped into 18 linkage groups, with an average interval of 25.0 cm. The estimated genome length was 2 773.0 cm for the female and 2 817.1 cm for the male map. The observed length of the linkage map was 1 875.2 cm and 1 896.5 cm for the female and male maps, respectively. When doublets were considered, the map length increased to 2 152.8 cm for the female and 2 032.7 cm for the male map, corresponding to genome coverage of 77.6% and 72.2%, respectively.
Use of tannin anticorrosive reaction primer to improve traditional coating systems
DOE Office of Scientific and Technical Information (OSTI.GOV)
Matamala, G.; Droguett, G.; Smeltzer, W.
1994-04-01
Different anticorrosive schemes applied over plain or previously shot-blasted surfaces of AISI 1010 (UNS G10100) steel plates were compared. Plates were painted with alkydic, vinylic, and epoxy anticorrosive schemes over metal treated previously with pine tannin reaction primer and over its own schemes without previous primer treatment. Anticorrosive tests were conducted in a salt fog chamber according to ASTM B 117-73. Rusting, blistering, and adhesion were assessed over time. The survey was complemented with potentiodynamic scanning tests in sodium chloride (NaCl) solution with a concentration equivalent to seawater. Corrosion currents were determined using Tafel and polarization resistance techniques. Results showedmore » the reaction primer inhibited corrosion by improving adherence. Advantages over traditional conversion primers formulated in a base of zinc chromate in phosphoric medium were evident.« less
Direct role for the RNA polymerase domain of T7 primase in primer delivery
Zhu, Bin; Lee, Seung-Joo; Richardson, Charles C.
2010-01-01
Gene 4 protein (gp4) encoded by bacteriophage T7 contains a C-terminal helicase and an N-terminal primase domain. After synthesis of tetraribonucleotides, gp4 must transfer them to the polymerase for use as primers to initiate DNA synthesis. In vivo gp4 exists in two molecular weight forms, a 56-kDa form and the full-length 63-kDa form. The 56-kDa gp4 lacks the N-terminal Cys4 zinc-binding motif important in the recognition of primase sites in DNA. The 56-kDa gp4 is defective in primer synthesis but delivers a wider range of primers to initiate DNA synthesis compared to the 63-kDa gp4. Suppressors exist that enable the 56-kDa gp4 to support the growth of T7 phage lacking gene 4 (T7Δ4). We have identified 56-kDa DNA primases defective in primer delivery by screening for their ability to support growth of T7Δ4 phage in the presence of this suppressor. Trp69 is critical for primer delivery. Replacement of Trp69 with lysine in either the 56- or 63-kDa gp4 results in defective primer delivery with other functions unaffected. DNA primase harboring lysine at position 69 fails to stabilize the primer on DNA. Thus, a primase subdomain not directly involved in primer synthesis is involved in primer delivery. The stabilization of the primer by DNA primase is necessary for DNA polymerase to initiate synthesis. PMID:20439755
RUCS: rapid identification of PCR primers for unique core sequences.
Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik; Kaya, Hülya; Lund, Ole
2017-12-15
Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs for the targets in silico. Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin resistance gene. Three of the predicted pairs were chosen for experimental validation using PCR and gel electrophoresis. All three pairs successfully produced an amplicon with the target length for the samples containing mcr-1 and no amplification products were produced for the negative samples. The novel methods presented in this manuscript can reduce the time needed to identify target sequences, and provide a quick virtual PCR validation to eliminate time wasted on ambiguously binding primers. Source code is freely available on https://bitbucket.org/genomicepidemiology/rucs. Web service is freely available on https://cge.cbs.dtu.dk/services/RUCS. mcft@cbs.dtu.dk. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.
2011-10-06
composites were prepared with varying metal to oxidizer (M/O) ratios ranging from 0.782 to 3.165 (see Table 7). The performance was measured by the...and the Army was expecting to begin their processing efforts in the near future. The Army purchased primer metal parts and was prepared to perform...43 Table 19 – Samples Prepared Using Different Mix Times and Amplitudes
Gonthier, Lucy; Blassiau, Christelle; Mörchen, Monika; Cadalen, Thierry; Poiret, Matthieu; Hendriks, Theo; Quillet, Marie-Christine
2013-08-01
High-density genetic maps were constructed for loci involved in nuclear male sterility (NMS1-locus) and sporophytic self-incompatibility (S-locus) in chicory (Cichorium intybus L.). The mapping population consisted of 389 F1' individuals derived from a cross between two plants, K28 (male-sterile) and K59 (pollen-fertile), both heterozygous at the S-locus. This F1' mapping population segregated for both male sterility (MS) and strong self-incompatibility (SI) phenotypes. Phenotyping F1' individuals for MS allowed us to map the NMS1-locus to linkage group (LG) 5, while controlled diallel and factorial crosses to identify compatible/incompatible phenotypes mapped the S-locus to LG2. To increase the density of markers around these loci, bulked segregant analysis was used. Bulks and parental plants K28 and K59 were screened using amplified fragment length polymorphism (AFLP) analysis, with a complete set of 256 primer combinations of EcoRI-ANN and MseI-CNN. A total of 31,000 fragments were generated, of which 2,350 showed polymorphism between K59 and K28. Thirteen AFLP markers were identified close to the NMS1-locus and six in the vicinity of the S-locus. From these AFLP markers, eight were transformed into sequence-characterized amplified region (SCAR) markers and of these five showed co-dominant polymorphism. The chromosomal regions containing the NMS1-locus and the S-locus were each confined to a region of 0.8 cM. In addition, we mapped genes encoding proteins similar to S-receptor kinase, the female determinant of sporophytic SI in the Brasicaceae, and also markers in the vicinity of the putative S-locus of sunflower, but none of these genes or markers mapped close to the chicory S-locus.
Yu, Yi; Fan, Qiang; Shen, Rujiang; Guo, Wei; Jin, Jianhua; Cui, Dafang; Liao, Wenbo
2014-01-01
Disanthus cercidifolius subsp. longipes is an endangered species in China. Genetic diversity and structure analysis of this species was investigated using amplified fragments length polymorphism (AFLP) fingerprinting. Nei's gene diversity ranged from 0.1290 to 0.1394. The AMOVA indicated that 75.06% of variation was distributed within populations, while the between-group component 5.04% was smaller than the between populations-within-group component 19.90%. Significant genetic differentiation was detected between populations. Genetic and geographical distances were not correlated. PCA and genetic structure analysis showed that populations from East China were together with those of the Nanling Range. These patterns of genetic diversity and levels of genetic variation may be the result of D. c. subsp. longipes restricted to several isolated habitats and “excess flowers production, but little fruit set”. It is necessary to protect all existing populations of D. c. subsp. longipes in order to preserve as much genetic variation as possible. PMID:25250583
A primer on safety performance measures for the transportation planning process
DOT National Transportation Integrated Search
2009-09-01
This Primer is a tool to help State and local practitioners, transportation planners, and decision-makers identify, select, and use safety performance measures as a part of the transportation planning process. The Primer draws from current literature...
Gemi: PCR Primers Prediction from Multiple Alignments
Sobhy, Haitham; Colson, Philippe
2012-01-01
Designing primers and probes for polymerase chain reaction (PCR) is a preliminary and critical step that requires the identification of highly conserved regions in a given set of sequences. This task can be challenging if the targeted sequences display a high level of diversity, as frequently encountered in microbiologic studies. We developed Gemi, an automated, fast, and easy-to-use bioinformatics tool with a user-friendly interface to design primers and probes based on multiple aligned sequences. This tool can be used for the purpose of real-time and conventional PCR and can deal efficiently with large sets of sequences of a large size. PMID:23316117
Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.
Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less
Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes
Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; ...
2014-01-01
Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less
Photoaffinity labeling of the primer binding domain in murine leukemia virus reverse transcriptase.
Tirumalai, R S; Modak, M J
1991-07-02
We have labeled the primer binding domain of murine leukemia virus reverse transcriptase (MuLV RT) by covalently cross-linking 5' end labeled d(T)8 to MuLV RT, using ultraviolet light energy. The specificity and the functional significance of the primer cross-linking reaction were demonstrated by the fact that (i) other oligomeric primers, tRNAs, and also template-primers readily compete with radiolabeled d(T)8 for the cross-linking reaction, (ii) under similar conditions, the competing primers and template-primer also inhibit the DNA polymerase activity of MuLV RT to a similar extent, (iii) substrate deoxynucleotides have no effect, and (iv) the reaction is sensitive to high ionic strength. In order to identify the primer binding domains/sites in MuLV RT; tryptic digests prepared from the covalently cross-linked MuLV RT and [32P]d(T)8 complexes were resolved on C-18 columns by reverse-phase HPLC. Three distinct radiolabeled peptides were found to contain the majority of the bound primer. Of these, peptide I contained approximately 65% radioactivity, while the remainder was associated with peptides II and III. Amino acid composition and sequence analyses of the individual peptides revealed that peptide I spans amino acid residues 72-80 in the primary amino acid sequence of MuLV RT and is located in the polymerase domain. The primer cross-linking site appears to be at or near Pro-76. Peptides II and III span amino acid residues 602-609 and 615-622, respectively, and are located in the RNase H domain. The probable cross-linking sites in peptides II and III are suggested to be at or near Leu-604 and Leu-618, respectively.
Cheng, Yu-Huei
2014-12-01
Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.
Composite-composite repair bond strength: effect of different adhesion primers.
Tezvergil, A; Lassila, L V J; Vallittu, P K
2003-11-01
Recently, new products have been introduced to repair composite restorations that may be used as 'one-step' primers or monomers and silane compounds which are used separately as 'multi-step' primers. The aim of this study was to compare the shear bond strength of the new composite resin to aged composite, by using different adhesion primers. The substrates were particulate filler composite (Z250, 3M-ESPE), which was aged by boiling for 8 h and storing at 37 degrees C in water for 3 weeks. The aged substrate surfaces were wet-ground flat with 320-grit silicon carbide paper and subjected randomly (n=8) to either one-step adhesion primer: Compoconnect (CC) (Heraus Kulzer), or multi-step: Clearfil Repair (CF) (Kuraray) or an intermediate resin: Scothchbond Multi-purpose adhesive resin (3M-ESPE) according to the manufacturers' recommendations. Specimens with no surface treatment were used as control (C). New composite resin (Z250) was added to the substrate using 2 mm layer increments and light cured. The specimens were either water stored for 48 h or water stored for 24 h and then thermocycled for 6000 cycles. The shear bond strengths were measured with a crosshead speed of 1.0 mm/min using a universal testing machine. Data were analysed by two-way ANOVA and Tukey's post-hoc tests (p=0.05). All surface treatment methods showed significant difference compared to control (p<0.05). CF showed higher bond strength than CC and MP (p<0.05). Storage condition did not show a significant difference (p>0.05) in bond strength values. It was concluded that multi-step adhesion primer yielded higher bond strength compared to one-step primer or intermediate resin.
Analysis of DNA methylation in Arabidopsis thaliana based on methylation-sensitive AFLP markers.
Cervera, M T; Ruiz-García, L; Martínez-Zapater, J M
2002-12-01
AFLP analysis using restriction enzyme isoschizomers that differ in their sensitivity to methylation of their recognition sites has been used to analyse the methylation state of anonymous CCGG sequences in Arabidopsis thaliana. The technique was modified to improve the quality of fingerprints and to visualise larger numbers of scorable fragments. Sequencing of amplified fragments indicated that detection was generally associated with non-methylation of the cytosine to which the isoschizomer is sensitive. Comparison of EcoRI/ HpaII and EcoRI/ MspI patterns in different ecotypes revealed that 35-43% of CCGG sites were differentially digested by the isoschizomers. Interestingly, the pattern of digestion among different plants belonging to the same ecotype is highly conserved, with the rate of intra-ecotype methylation-sensitive polymorphisms being less than 1%. However, pairwise comparisons of methylation patterns between samples belonging to different ecotypes revealed differences in up to 34% of the methylation-sensitive polymorphisms. The lack of correlation between inter-ecotype similarity matrices based on methylation-insensitive or methylation-sensitive polymorphisms suggests that whatever the mechanisms regulating methylation may be, they are not related to nucleotide sequence variation.
Comparison of the antibacterial activity of different self-etching primers and adhesives.
Korkmaz, Yonca; Ozalp, Meral; Attar, Nuray
2008-11-01
The aim of this study was to evaluate the antibacterial effects of different one-step and two-step self-etching primer/adhesives on Streptococcus mutans (S. mutans), Lactobacillus casei (L. casei), and Lactobacillus acidophilus (L. acidophilus). The antibacterial effects of Clearfil Protect Bond Primer and Bonding agent; AdheSE Primer and Bonding agent; Adper Prompt L-Pop; Futurabond NR; Clearfil Tri S Bond; and Cervitec (positive control, 1% chlorhexidine varnish) were tested against standard strains of S. mutans, L. Casei, and L. acidophilus using the disk diffusion method. Standard filter paper disks (n=5) impregnated with 20 microL of each material were prepared. After incubation at 37 masculineC for 48 hours in a 5-10% CO2 atmosphere, the diameter of inhibition zones were measured in millimeters. Data were analyzed using one way analysis of variance (ANOVA) and multivariate analysis of variance (MANOVA). Duncan's Multiple Range Test was used for pairwise comparison. The size of inhibition zones produced by primer/adhesives varied among the brands. AdheSE Primer: S. mutans (20.6+/-1.51); L. casei (14.8+/-1.78); L. acidophilus (11.4+/-0.54). Adper Prompt L-Pop: S. mutans (19.6+/-1.51); L. casei (13.8+/-1.64); L. acidophilus (13.8+/-1.09). Cervitec: S. mutans (23+/-0.00); L. casei (27+/-0.70); L. acidophilus (22.4+/-0.54). Clearfil Protect Bond Primer: S. mutans (17+/-0.00); L. casei (17.6+/-0.54); L. acidophilus (22.4+/-0.54). Futurabond NR was found effective only against S. mutans (14.6+/-1.67). Of all the materials tested, AdheSE Bonding agent, Clearfil Protect Bond Bonding agent, and Clearfil Tri S Bond exhibited no inhibition zone (-) for all bacteria tested. Among the adhesives tested Clearafil Protect Bond Primer based upon monomer methacryloyloxydodecylpyridiniium bromide (MDPB) was found to be the most potent material against L. acidophilus and L. casei. AdheSE Primer and Adper Prompt L-Pop are highly effective against S. mutans. Compared with other
The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.
ERIC Educational Resources Information Center
Zellweger, Polle T.; Mackinlay, Jock D.
A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…
Freshwater Wetlands: A Citizen's Primer.
ERIC Educational Resources Information Center
Catskill Center for Conservation and Development, Inc., Hobart, NY.
The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…
Quantitative Microbial Risk Assessment Tutorial - Primer
This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...
Poliovirus serotype-specific VP1 sequencing primers.
Kilpatrick, David R; Iber, Jane C; Chen, Qi; Ching, Karen; Yang, Su-Ju; De, Lina; Mandelbaum, Mark D; Emery, Brian; Campagnoli, Ray; Burns, Cara C; Kew, Olen
2011-06-01
The Global Polio Laboratory Network routinely uses poliovirus-specific PCR primers and probes to determine the serotype and genotype of poliovirus isolates obtained as part of global poliovirus surveillance. To provide detailed molecular epidemiologic information, poliovirus isolates are further characterized by sequencing the ~900-nucleotide region encoding the major capsid protein, VP1. It is difficult to obtain quality sequence information when clinical or environmental samples contain poliovirus mixtures. As an alternative to conventional methods for resolving poliovirus mixtures, sets of serotype-specific primers were developed for amplifying and sequencing the VP1 regions of individual components of mixed populations of vaccine-vaccine, vaccine-wild, and wild-wild polioviruses. Published by Elsevier B.V.
Single-primer fluorescent sequencing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ruth, J.L.; Morgan, C.A.; Middendorf, L.R.
Modified linker arm oligonucleotides complementary to standard M13 priming sites were synthesized, labelled with either one, two, or three fluoresceins, and purified by reverse-phase HPLC. When used as primers in standard dideoxy M13 sequencing with /sup 32/P-dNTPs, normal autoradiographic patterns were obtained. To eliminate the radioactivity, direct on-line fluorescence detection was achieved by the use of a scanning 10 mW Argon laser emitting 488 nm light. Fluorescent bands were detected directly in standard 0.2 or 0.35 mm thick polyacrylamide gels at a distance of 24 cm from the loading wells by a photomultiplier tube filtered at 520 nm. Horizontal andmore » temporal location of each band was displayed by computer as a band in real time, providing visual appearance similar to normal 4-lane autoradiograms. Using a single primer labelled with two fluoresceins, sequences of between 500 and 600 bases have been read in a single loading with better than 98% accuracy; up to 400 bases can be read reproducibly with no errors. More than 50 sequences have been determined by this method. This approach requires only 1-2 ug of cloned template, and produces continuous sequence data at about one band per minute.« less
Primer on transportation and climate change
DOT National Transportation Integrated Search
2008-04-01
This primer is an introduction to the issue of climate change and its implications for transportation policy in the United States. Its purpose is to outline the current thinking of governmental agencies, researchers, and advocacy groups on the issue ...
Climate Ready Estuaries Rolling Easements Primer
Rolling easements enable wetlands and beaches to migrate inland and allow society to avoid the costs and hazards of protecting low lands from rising sea levels. This document provides a primer on more than a dozen rolling easement approaches.
Chuang, Hui-Ping; Hsu, Mao-Hsuan; Chen, Wei-Yu
2013-01-01
In this study, we established a rapid multiplex method to detect the relative abundances of amplified 16S rRNA genes from known cultivatable methanogens at hierarchical specificities in anaerobic digestion systems treating industrial wastewater and sewage sludge. The method was based on the hierarchical oligonucleotide primer extension (HOPE) technique and combined with a set of 27 primers designed to target the total archaeal populations and methanogens from 22 genera within 4 taxonomic orders. After optimization for their specificities and detection sensitivity under the conditions of multiple single-nucleotide primer extension reactions, the HOPE approach was applied to analyze the methanogens in 19 consortium samples from 7 anaerobic treatment systems (i.e., 513 reactions). Among the samples, the methanogen populations detected with order-level primers accounted for >77.2% of the PCR-amplified 16S rRNA genes detected using an Archaea-specific primer. The archaeal communities typically consisted of 2 to 7 known methanogen genera within the Methanobacteriales, Methanomicrobiales, and Methanosarcinales and displayed population dynamic and spatial distributions in anaerobic reactor operations. Principal component analysis of the HOPE data further showed that the methanogen communities could be clustered into 3 distinctive groups, in accordance with the distribution of the Methanosaeta, Methanolinea, and Methanomethylovorans, respectively. This finding suggested that in addition to acetotrophic and hydrogenotrophic methanogens, the methylotrophic methanogens might play a key role in the anaerobic treatment of industrial wastewater. Overall, the results demonstrated that the HOPE approach is a specific, rapid, and multiplexing platform to determine the relative abundances of targeted methanogens in PCR-amplified 16S rRNA gene products. PMID:24077716
Sensory reception of the primer pheromone ethyl oleate
NASA Astrophysics Data System (ADS)
Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang
2012-05-01
Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.
A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis
Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo
2012-01-01
In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223
Novel Primer Sets for Next Generation Sequencing-Based Analyses of Water Quality
Lee, Elvina; Khurana, Maninder S.; Whiteley, Andrew S.; Monis, Paul T.; Bath, Andrew; Gordon, Cameron; Ryan, Una M.; Paparini, Andrea
2017-01-01
Next generation sequencing (NGS) has rapidly become an invaluable tool for the detection, identification and relative quantification of environmental microorganisms. Here, we demonstrate two new 16S rDNA primer sets, which are compatible with NGS approaches and are primarily for use in water quality studies. Compared to 16S rRNA gene based universal primers, in silico and experimental analyses demonstrated that the new primers showed increased specificity for the Cyanobacteria and Proteobacteria phyla, allowing increased sensitivity for the detection, identification and relative quantification of toxic bloom-forming microalgae, microbial water quality bioindicators and common pathogens. Significantly, Cyanobacterial and Proteobacterial sequences accounted for ca. 95% of all sequences obtained within NGS runs (when compared to ca. 50% with standard universal NGS primers), providing higher sensitivity and greater phylogenetic resolution of key water quality microbial groups. The increased selectivity of the new primers allow the parallel sequencing of more samples through reduced sequence retrieval levels required to detect target groups, potentially reducing NGS costs by 50% but still guaranteeing optimal coverage and species discrimination. PMID:28118368
The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers
NASA Technical Reports Server (NTRS)
Danford, M. D.; Mendrek, M. J.; Walsh, D. W.
1995-01-01
The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.
The corrosion protection of 2219-T87 aluminum by organic and inorganic zinc-rich primers
NASA Technical Reports Server (NTRS)
Danford, M. D.; Mendrek, M. J.; Walsh, D. W.
1995-01-01
The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electro-chemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. the galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 micro A/cm(exp 2) and 23.7 micro A/cm(exp 2) for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.
The corrosion protection of AISI(TM) 1010 steel by organic and inorganic zinc-rich primers
NASA Technical Reports Server (NTRS)
Danford, M. D.; Mendrek, M. J.
1995-01-01
The behavior of zinc-rich primer-coated AISI 1010 steel in 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR), were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electromechanical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 1010 steel cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high current between the steel cathode and both zinc-rich primer anodes (38.8 and 135.2 microns A/sq cm for the organic and inorganic primers, respectively). The results of corrosion rate determinations demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. EIS equivalent circuit parameters confirmed this conclusion. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application on solid rocket booster steel hardware.
Electrocoat Process for Non-Chromate Primers in DoD Manufacturing
2011-02-01
requirements are uniquely suited for aerospace aluminum. ↑ O2 ↑ H2 Anode (+) Cathode (-) Deposited Film Alkaline clean Rinse ElectrocoatSurface...Objectives ● Demonstration and validation of a novel, non‐chromated, environmentally friendly, electrodeposited primer. ● The primers will be
GST-PRIME: an algorithm for genome-wide primer design.
Leister, Dario; Varotto, Claudio
2007-01-01
The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.
Effect of N-acetyl cysteine on orthodontic primers cytotoxicity.
D'Antò, Vincenzo; Spagnuolo, Gianrico; Schweikl, Helmut; Rengo, Sandro; Ambrosio, Luigi; Martina, Roberto; Valletta, Rosa
2011-02-01
The aims of this study were to evaluate the cytotoxicity of four orthodontic primers, including two hydrophilic and two hydrophobic materials, and to investigate the role of the reactive oxygen species (ROS) in induced cell damage. Moreover, the effects of the anti-oxidant N-acetyl cysteine (NAC) on primers toxicity was analyzed. Human gingival fibroblasts (HGF) were exposed to different concentrations of primers (0-0.25 mg/ml) in the presence or absence of NAC, and the cytotoxicity was assessed by the MTT assay, while cell death was quantified by flow cytometry after propidium iodide staining. The increase in the induced ROS levels was detected by flow cytometry measuring the fluorescence of the oxidation-sensitive dye 2',7'-dichlorofluorescein diacetate (DCFH-DA). All materials decreased cell viability in a dose-related manner after a 24 h exposure period. Cytotoxicity of orthodontic primers based on concentrations which caused a 50% decrease in cell viability (TC₅₀) in HGF was ranked as follows (median values): Eagle Fluorsure (0.078 mg/ml)>Transbond XT (0.081 mg/ml)>Transbond MIP (0.128 mg/ml)>Ortho solo (0.130 mg/ml). Moreover, in HGF cells, all materials induced a dose-dependent increase in ROS levels compared to untreated cells. Incubation of HGF with NAC significantly reduced ROS production and decreased the cell damage and cytotoxicity caused by all materials tested (p<0.001). Our results suggested that hydrophilic primers were less cytotoxic than hydrophobic materials. Moreover, we demonstrated a major role of ROS in the induction of cell death since the antioxidant N-acetyl cysteine was able to prevent cell damage induced by all materials tested. Copyright © 2010 Academy of Dental Materials. Published by Elsevier Ltd. All rights reserved.
Evaluation of genetic diversity of Panicum turgidum Forssk from Saudi Arabia.
Assaeed, Abdulaziz M; Al-Faifi, Sulieman A; Migdadi, Hussein M; El-Bana, Magdy I; Al Qarawi, Abdulaziz A; Khan, Mohammad Altaf
2018-01-01
The genetic diversity of 177 accessions of Panicum turgidum Forssk, representing ten populations collected from four geographical regions in Saudi Arabia, was analyzed using amplified fragment length polymorphism (AFLP) markers. A set of four primer-pairs with two/three selective nucleotides scored 836 AFLP amplified fragments (putative loci/genome landmarks), all of which were polymorphic. Populations collected from the southern region of the country showed the highest genetic diversity parameters, whereas those collected from the central regions showed the lowest values. Analysis of molecular variance (AMOVA) revealed that 78% of the genetic variability was attributable to differences within populations. Pairwise values for population differentiation and genetic structure were statistically significant for all variances. The UPGMA dendrogram, validated by principal coordinate analysis-grouped accessions, corresponded to the geographical origin of the accessions. Mantel's test showed that there was a significant correlation between the genetic and geographical distances ( r = 0.35, P < 0.04). In summary, the AFLP assay demonstrated the existence of substantial genetic variation in P. turgidum . The relationship between the genetic diversity and geographical source of P. turgidum populations of Saudi Arabia, as revealed through this comprehensive study, will enable effective resource management and restoration of new areas without compromising adaptation and genetic diversity.
Primer vector theory and applications
NASA Technical Reports Server (NTRS)
Jezewski, D. J.
1975-01-01
A method developed to compute two-body, optimal, N-impulse trajectories was presented. The necessary conditions established define the gradient structure of the primer vector and its derivative for any set of boundary conditions and any number of impulses. Inequality constraints, a conjugate gradient iterator technique, and the use of a penalty function were also discussed.
Roy, Subarna; Biswas, Debabrata; Vijayachari, P; Sugunan, A P; Sehgal, Subhash C
2004-11-01
To evaluate the discriminatory power and usefulness of arbitrarily primed-polymerase chain reaction (AP-PCR) characterization of leptospires with M16 primer. AP-PCR fingerprints of 20 reference strains of Leptospira representing 20 different serovars belonging to seven genospecies (Leptospira interrogans, 11; L. noguchii, 2; L. borgpetersenii, 1; L. santarosai, 2; L. biflexa, 2; L. kirschneri, 1; L. weilii, 1) were generated by employing M16 primer. Fingerprints generated with this primer were compared with those generated with two other commonly used primers PB1, and L10. An attempt was also made to type 20 leptospiral isolates with the M16 primer. Fingerprints with M16 primer could not only differentiate between strains of different genospecies, but also between strains of the same genospecies belonging to different serovars. While two commonly used primers (PB1 and L10) failed to discriminate between some of the different serovars belonging to the same genospecies, this primer was able to generate discriminatory fingerprints for all strains tested. All 20 Leptospira isolates, recovered from patients in Andaman Islands, could also be typed by fingerprints generated with the M16 primer. The discriminatory power of M16 primer adds more specificity to the rapidity of this system of characterization and can be used as an excellent tool in epidemiological studies on Leptospira.
Shop primer as part of the corrosion protective coating for submerged steel structures
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bjordal, M.; Steinsmo, U.
In Norwegian workshops the standard pre-treatment procedures for steel structures intended for sub-sea use, normally include removal of shop primer by blast cleaning to Sa 2 1/2 before application of corrosion protective coatings. This is also stated in the Norwegian offshore standard NORSOK. Omitting this stage in fabrication will represent large reductions in both time consumption and costs, and reduce the volume of waste from the blast cleaning. This report presents results from investigations of how a shop primer will influence on the coating properties. The aim of the investigation was to test whether the systems are good enough ifmore » the shop primer is left on the surface. Two different zinc silicate shop primers have been included in the investigation. As protective coatings the authors have used three different epoxy mastic systems with Al pigments. In addition to panels with original shop primer, they have also tested shop primed panels pre-treated in various ways, such as heated, corroded and blast cleaned to various degrees before coating. The coatings have been tested in the ASTM-G8 121 test and in a long term test in sea water polarized with a Zn anode. They have found that coatings including the zinc silicate shop primer are more susceptible to cathodic disbonding than the coating applied directly on blast cleaned steel. It is however possible to meet the NORSOK criteria with a zinc silicate shop primer as first coat.« less
Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.
Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe
2018-01-17
In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.
Carro, Belén; Quintela, María; Ruiz, José Miguel; Barreiro, Rodolfo
2012-01-01
Dispersal has received growing attention in marine ecology, particularly since evidence obtained with up-to-date techniques challenged the traditional view. The dogwhelk Nucella lapillus L., a sedentary gastropod with direct development, is a good example: dispersal was traditionally assumed to be limited until studies with microsatellites disputed this idea. To shed some light on this controversy, the genetic structure of dogwhelk populations in northwest Spain was investigated with highly polymorphic AFLP markers giving special attention to the influence of hydrodynamic stress. In agreement with the expectations for a poor disperser, our results show a significant genetic structure at regional (<200 km) and areal scales (<15 km). However, the spatial genetic structure varied with wave-exposure in the present case study: IBD was evident under sheltered conditions but absent from the exposed area where genetic differentiation was stronger. Our results provide evidence that differences in wave-exposure can exert a detectable influence on the genetic structure of coastal organisms, even in species without a planktonic larva.
Primer sets for cloning the human repertoire of T cell Receptor Variable regions.
Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele
2008-08-29
Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.
Integrating PCR theory and bioinformatics into a research-oriented primer design exercise.
Robertson, Amber L; Phillips, Allison R
2008-01-01
Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessments of student performance and perceptions. We developed this interactive Primer Design Exercise using the principles of scientific teaching to enhance student understanding of the theory behind PCR and provide practice in designing PCR primers to amplify DNA. In the end, the students were more poised to troubleshoot problems that arose in real experiments using PCR. In addition, students had the opportunity to utilize several bioinformatics tools to gain an increased understanding of primer quality, directionality, and specificity. In the course of this study many misconceptions about DNA replication during PCR and the need for primer specificity were identified and addressed. Students were receptive to the new materials and the majority achieved the learning goals.
Galkiewicz, Julia P; Kellogg, Christina A
2008-12-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Coppi, Andrea; Lastrucci, Lorenzo; Cappelletti, David; Cerri, Martina; Ferranti, Francesco; Ferri, Valentina; Foggi, Bruno; Gigante, Daniela; Venanzoni, Roberto; Viciani, Daniele; Selvaggi, Roberta; Reale, Lara
2018-01-01
Phragmites australis is a subcosmopolitan species typical of wetlands being studied in Europe for its disappearance from natural stands, a phenomenon called reed die-back syndrome (RDBS). Although it is conjectured that low genetic variability contributes to RDBS, this aspect remains neglected to this day. Using a molecular fingerprinting approach and a sequence analysis of the trnT-trnL/rbcL-psaI regions of cpDNA, this study aimed to compare the genetic structure of stable vs. RDBS-affected P. australis stands from five wetlands of central Italy. Beforehand, in order to characterize the health condition of reed populations, the occurrence of the main macromorphological descriptors for RDBS was considered on 40 reed stands. Soil samples were also collected to examine the total content of heavy metals. The current study analyzed cpDNA in 19 samples and AFLP profiles in 381 samples to investigate the genetic structure of Phragmites populations. Based on the multinomial-Dirichlet model, an analysis of candidate loci under selective pressure was also performed. The relationships among AFLP data, RDBS descriptors and chemicals were evaluated with the use of Linear Mixed Models. The analysis of the cpDNA shows the occurrence of the haplotypes M (the most widespread), and K here recorded for the first time in Italy. Three new haplotypes were also described. The DNA fingerprinting analysis has produced a total of 322 loci (98% polymorphic) and shows the medium-to-high amount of genetic diversity. The significant genetic differentiation among wetlands (Fst = 0.337) suggests either low gene flow or small effective population size. Moreover, the low amount of outlier loci (only 5; l.5% of the total), seems to indicate the scarce occurrence of selective pressure upon the reed’s genome. Genetic diversity increased in relationship to the decrease in diameter and of flowering buds of the reed, two of the trends associated with the die-back. The current study rejects the
Yamashita, Y; Shigeoka, T; Hanada, N; Takehara, T
1988-05-01
Streptococcus mutans serotype g secretes at least three kinds of glucosyltransferase with different enzymological and immunological properties. One of them is a primer-independent enzyme and seems to be the source of primer for the others, both of which are primer-dependent enzymes. Recently, we purified the primer-independent enzyme, the third glucosyltransferase in this group from S. mutans strain AHT-k serotype g. In the present study, we examined the specificity of the antiserum against the primer-independent glucosyltransferase using extracellular culture-conditioned fluids of many strains of the various serotypes of S. mutans. The antiserum cross-reacted with the extracellular culture fluids from strains of serotypes d and a, in addition to serotype g, but not with those of other serotypes, indicating that the primer-independent glucosyltransferase is secreted by the S. sobrinus and S. cricetus, but not by S. mutans and S. rattus. The antiserum did not completely inhibit the activity of the enzyme, even at more than twofold antibody excess, determined by indirect precipitation with immobilized staphylococcal protein A.
Evaluation of inorganic zinc-rich primers using Electrochemical Impedance Spectroscopy (EIS)
NASA Technical Reports Server (NTRS)
Calle, Luz M.
1993-01-01
This investigation explores the use of Electrochemical Impedance Spectroscopy (EIS) in combination with beach exposure as a short term method for analyzing the performance of twenty-one zinc-rich primers. The twenty-one zinc-rich primers were: Carboline CZ-11, Ameron Devoe-Marine Catha-Coat 304, Briner V-65, Ameron D-21-9, Sherwin Williams Zinc Clad II, Carboline CZ-D7, Ameron D-4, Dupont Ganicin 347WB, Porter TQ-4374H, Inorganic Coatings IC-531, Subox Galvanox IV, Southern Coatings Chemtec 600, Glidden Glidzinc 5530, Byco SP-101, Tnemec 90E-75, Devoe Catha-Coat 302H, Glidden Glidzinc 5536, Koppers 701, Ameron D-21-5, Coronado 935-152, and Subox Galvanoz V. Data were also collected on galvanized steel for comparison purposes. A library of Bode magnitude plots was generated for each coating including curves for the initial time and after each week of atmospheric exposure as Beach Corrosion Test Site near the Space Shuttle launch pad at the Kennedy Space Center for up to three weeks. An examination of the variation of the Bode magnitude plots with atmospheric exposure revealed no clearly identifiable trend at this point that could distinguish between the good and the poor coatings. The test will be continued by including EIS measurements after six months and one year of atmospheric exposure.
Genetic linkage analysis using pooled DNA and infrared detection of tailed STRP primer patterns
NASA Astrophysics Data System (ADS)
Oetting, William S.; Wildenberg, Scott C.; King, Richard A.
1996-04-01
The mapping of a disease locus to a specific chromosomal region is an important step in the eventual isolation and analysis of a disease causing gene. Conventional mapping methods analyze large multiplex families and/or smaller nuclear families to find linkage between the disease and a chromosome marker that maps to a known chromosomal region. This analysis is time consuming and tedious, typically requiring the determination of 30,000 genotypes or more. For appropriate populations, we have instead utilized pooled DNA samples for gene mapping which greatly reduces the amount of time necessary for an initial chromosomal screen. This technique assumes a common founder for the disease locus of interest and searches for a region of a chromosome shared between affected individuals. Our analysis involves the PCR amplification of short tandem repeat polymorphisms (STRP) to detect these shared regions. In order to reduce the cost of genotyping, we have designed unlabeled tailed PCR primers which, when combined with a labeled universal primer, provides for an alternative to synthesizing custom labeled primers. The STRP pattern is visualized with an infrared fluorescence based automated DNA sequencer and the patterns quantitated by densitometric analysis of the allele pattern. Differences in the distribution of alleles between pools of affected and unaffected individuals, including a reduction in the number of alleles in the affected pool, indicate the sharing of a region of a chromosome. We have found this method effective for markers 10 - 15 cM away from the disease locus for a recessive genetic disease.
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299
Specific primer design of mitochondrial 12S rRNA for species identification in raw meats
NASA Astrophysics Data System (ADS)
Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.
2018-01-01
Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.
Mahmood, Shahid; Freitag, Thomas E; Prosser, James I
2006-06-01
PCR-based techniques are commonly used to characterize microbial communities, but are subject to bias that is difficult to assess. This study aimed to evaluate bias of several PCR primer-based strategies used to study diversity of autotrophic ammonia oxidizers. 16S rRNA genes from soil- or sediment-DNA were amplified using primers considered either selective or specific for betaproteobacterial ammonia oxidizers. Five approaches were assessed: (a) amplification with primers betaAMO143f-betaAMO1315r; (b) amplification with primers CTO189f-CTO654r; (c) nested amplification with betaAMO143f-betaAMO1315r followed by CTO189f-CTO654r primers; (d) nested amplification with betaAMO143f-betaAMO1315r and CTO189f-Pf1053r primers; (e) nested amplification with 27f-1492r and CTO189f-CTO654r primers. Amplification products were characterized by denaturing gradient gel electrophoresis (DGGE) analysis after further amplification with 357f-GC-518r primers. DGGE profiles of soil communities were heterogeneous and depended on the approach followed. Ammonia oxidizer diversity was higher using approaches (b), (c) and (e) than using (a) and (d), where sequences of the most prominent bands showed similarities to nonammonia oxidizers. Profiles from marine sediments were more consistent, regardless of the approach adopted, and sequence analysis of excised bands indicated that these consisted of ammonia oxidizers only. The study demonstrates the importance of choice of primer, of screening for sequences of nontarget organisms and use of several approaches when characterizing microbial communities in natural environments.
MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR
Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo
2015-01-01
Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. PMID:26109350
Hao, Yu-Jin; You, Chun-Xiang; Deng, Xui-Xin
2002-01-01
Shoot-tips of 10 strawberry genotypes were successfully cryopreserved using a modified encapsulation-dehydration method. All genotypes survived cryopreservation with high survival and regeneration rates. Eight Joho single-bud sibling lines were established as a model system for genetic analysis. Although cytological examination found chromosomal variation in both non-cryopreserved and cryopreserved samples, the ploidy constitution remained relatively stable after cryopreservation. DNA samples digested with MseI and PstI were used for amplified fragmentation length polymorphism (AFLP) assay. In 16 primer combinations, only one, namely, PCCA-MCAG, detected one site where band pattern changed after cryopreservation, which might be contributed to the change in DNA methylation status at PstI recognition site. Methylation sensitive amplified polymorphism (MSAP) assay was carried out for further investigation on the influence of cryopreservation on DNA methylation status. It was found that cryopreservation induced a significant change in DNA methylation status.
Koester, Meike; Gergs, René
2017-10-05
Analyzing food webs is essential for a better understanding of ecosystems. For example, food web interactions can undergo severe changes caused by the invasion of non-indigenous species. However, an exact identification of field predator-prey interactions is difficult in many cases. These analyses are often based on a visual evaluation of gut content or the analysis of stable isotope ratios (δ 15 N and δ 13 C). Such methods require comprehensive knowledge about, respectively, morphologic diversity or isotopic signature from individual prey organisms, leading to obstacles in the exact identification of prey organisms. Visual gut content analyses especially underestimate soft bodied prey organisms, because maceration, ingestion and digestion of prey organisms make identification of specific species difficult. Hence, polymerase chain reaction (PCR) based strategies, for example the use of group-specific primer sets, provide a powerful tool for the investigation of food web interactions. Here, we describe detailed protocols to investigate the gut contents of macroinvertebrate consumers from the field using group-specific primer sets for nuclear ribosomal deoxyribonucleic acid (rDNA). DNA can be extracted either from whole specimens (in the case of small taxa) or out of gut contents of specimens collected in the field. Presence and functional efficiency of the DNA templates need to be confirmed directly from the tested individual using universal primer sets targeting the respective subunit of DNA. We also demonstrate that consumed prey can be determined further down to species level via PCR with unmodified group-specific primers combined with subsequent single strand conformation polymorphism (SSCP) analyses using polyacrylamide gels. Furthermore, we show that the use of different fluorescent dyes as labels enables parallel screening for DNA fragments of different prey groups from multiple gut content samples via automated fragment analysis.
Bonding of Resin Cement to Zirconia with High Pressure Primer Coating
Wang, Ying-jie; Jiao, Kai; Liu, Yan; Zhou, Wei; Shen, Li-juan; Fang, Ming; Li, Meng; Zhang, Xiang; Tay, Franklin R.; Chen, Ji-hua
2014-01-01
Objectives To investigate the effect of air-drying pressure during ceramic primer coating on zirconia/resin bonding and the surface characteristics of the primed zirconia. Methods Two ceramic primers (Clearfil Ceramic Primer, CCP, Kuraray Medical Inc. and Z-Prime Plus, ZPP, Bisco Inc.) were applied on the surface of air-abraded zirconia (Katana zirconia, Noritake) and dried at 4 different air pressures (0.1–0.4 MPa). The primed zirconia ceramic specimens were bonded with a resin-based luting agent (SA Luting Cement, Kuraray). Micro-shear bond strengths of the bonded specimens were tested after 3 days of water storage or 5,000× thermocycling (n = 12). Failure modes of the fractured specimens were examined with scanning electron miscopy. The effects of air pressure on the thickness of the primer layers and the surface roughness (Sa) of primed zirconia were evaluated using spectroscopic ellipsometry (n = 6), optical profilometry and environmental scanning electron microscopy (ESEM) (n = 6), respectively. Results Clearfil Ceramic Primer air-dried at 0.3 and 0.4 MPa, yielding significantly higher µSBS than gentle air-drying subgroups (p<0.05). Compared to vigorous drying conditions, Z-Prime Plus air-dried at 0.2 MPa exhibited significantly higher µSBS (p<0.05). Increasing air-drying pressure reduced the film thickness for both primers. Profilometry measurements and ESEM showed rougher surfaces in the high pressure subgroups of CCP and intermediate pressure subgroup of ZPP. Conclusion Air-drying pressure influences resin/zirconia bond strength and durability significantly. Higher air-drying pressure (0.3-0.4 MPa) for CCP and intermediate pressure (0.2 MPa) for ZPP are recommended to produce strong, durable bonds between resin cement and zirconia ceramics. PMID:24992678
Sediment transport primer: estimating bed-material transport in gravel-bed rivers
Peter Wilcock; John Pitlick; Yantao Cui
2009-01-01
This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...
Caetano-Anollés, G; Gresshoff, P M
1996-06-01
DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.
Specific primers for rapid detection of Microsporum audouinii by PCR in clinical samples.
Roque, H D; Vieira, R; Rato, S; Luz-Martins, M
2006-12-01
This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis.
In vivo effect of a self-etching primer on dentin.
Milia, E; Lallai, M R; García-Godoy, F
1999-08-01
To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.
A method for predicting service life of zinc rich primers on carbon steel
NASA Technical Reports Server (NTRS)
Hoppesch, C. W.
1986-01-01
The service life of zinc rich primers on carbon steel can be estimated by immersing a primer coated glass slide into an aqueous copper sulfate solution and measuring the amount of zinc that reacts with the copper in 15 minutes. This zinc availability test was used to evaluate eleven primers currently available for which marine beach exposure data was available from previous programs. Results were evaluated and a correlation between zinc availability and ASTM rust grade was shown.
Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito
2012-01-01
Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625
Primer sets for cloning the human repertoire of T cell Receptor Variable regions
Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele
2008-01-01
Background Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets. PMID:18759974
A Primer on Simulation and Gaming.
ERIC Educational Resources Information Center
Barton, Richard F.
In a primer intended for the administrative professions, for the behavioral sciences, and for education, simulation and its various aspects are defined, illustrated, and explained. Man-model simulation, man-computer simulation, all-computer simulation, and analysis are discussed as techniques for studying object systems (parts of the "real…
Minami, Hiroyuki; Murahara, Sadaaki; Suzuki, Shiro; Tanaka, Takuo
2011-12-01
Although the effectiveness of primers for resin bonding to noble alloys has been demonstrated, no effective clinical technique for bonding to noble metal ceramic alloys has been established. The purpose of this study was to evaluate the effects of metal primers on the shear bond strength of an adhesive resin to noble metal ceramic alloys after thermal cycling. Sixty-three disk-shaped specimens (10 × 2.5 mm) were cast from high-gold-content alloys (Super Metal W-85: W85 or IFK88 GR: IFK88), a high-palladium-content alloy (Super Metal N-40: N40), and an Ag-Pd-Cu-Au alloy (Castwell M.C.12: MC12). Smaller-sized disk-shaped specimens (8 × 2.5 mm) were fabricated with MC12. Bonding surfaces were finished with 600-grit SiC-paper and airborne-particle abraded with 50-μm alumina. Pairs of disks were primed (V-Primer: VP; ML Primer: ML; or Metaltite: MT) and bonded with an adhesive resin (Super-Bond C&B). The bond strengths were determined before and after 20,000 and 50,000 thermal cycles (n=7). Data were analyzed by using a 3-way ANOVA and the Bonferroni test (α=.05). Failure modes were determined by optical microscope and SEM observation. Bond strengths to high-gold-content alloys with VP and MT significantly decreased after the thermal cycling (P<.001). Bond strengths to W85 (35.27 ±4.25 MPa) and IFK88 (33.57 ±3.56 MPa) after 50,000 thermal cycles obtained by ML were the highest (P<.001), and these groups showed combination failures. Bond strengths to N40 significantly decreased after 50,000 thermal cycles (P<.001), regardless of primers. Shear bond strengths (SBS) to high-gold-content alloys were not degraded up to 50,000 thermal cycles when primed with ML. None of the primers evaluated was effective for high-palladium-content alloy. Copyright © 2011 The Editorial Council of the Journal of Prosthetic Dentistry. Published by Mosby, Inc. All rights reserved.
Schneider, Uffe Vest; Mikkelsen, Nikolaj Dam; Lindqvist, Anja; Okkels, Limei Meng; Jøhnk, Nina; Lisby, Gorm
2012-01-01
We introduce quantitative polymerase chain reaction (qPCR) primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA) molecule at the 5′-end. In qPCR, the 5′-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5′-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5′-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5′-o-TINA modified primers allows for a further reduction (>45% or approximately one hour) in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5′-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5′-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions. PMID:22701644
Villard, Pierre; Malausa, Thibaut
2013-07-01
SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php. © 2013 John Wiley & Sons Ltd.
GSP: A web-based platform for designing genome-specific primers in polyploids
USDA-ARS?s Scientific Manuscript database
The sequences among subgenomes in a polyploid species have high similarity. This makes difficult to design genome-specific primers for sequence analysis. We present a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome backgr...
Genus-Specific Primers for Study of Fusarium Communities in Field Samples
Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna
2015-01-01
Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387
Development of Strain-Specific Primers for Identification of Bifidobacterium bifidum BGN4.
Youn, So Youn; Ji, Geun Eog; Han, Yoo Ri; Park, Myeong Soo
2017-05-28
Bifidobacterium bifidum BGN4 (BGN4) has many proven beneficial effects, including antiallergy and anticancer properties. It has been commercialized and used in several probiotic products, and thus strain-specific identification of this strain is very valuable for further strain-dependent physiological study. For this purpose, we developed novel multiplex polymerase chain reaction (PCR) primer sets for strain-specific detection of BGN4 in commercial products and fecal samples of animal models. The primer set was tested on seven strains of B. bifidum and 75 strains of the other Bifidobacterium species. The BGN4-specific regions were derived using megaBLAST against genome sequences of various B. bifidum databases and four sets of primers were designed. As a result, only BGN4 produced four PCR products simultaneously whereas the other strains did not. The PCR detection limit using BGN4-specific primer sets was 2.8 × 10 1 CFU/ml of BGN4. Those primer sets also detected and identified BGN4 in the probiotic products containing BNG4 and fecal samples from a BGN4-fed animal model with high specificity. Our results indicate that the PCR assay from this study is an efficient tool for the simple, rapid, and reliable identification of BGN4, for which probiotic strains are known.
MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR.
Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo
2015-11-16
Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Technologies that complement congestion pricing : a primer.
DOT National Transportation Integrated Search
2008-10-01
The purpose of this volume is to consider the technology options that are available to complement congestion-pricing approaches. This primer explores how technology broadens the success for congestion pricing by supporting the traveler's decision to ...
Galkiewicz, J.P.; Kellogg, C.A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.
NASA Astrophysics Data System (ADS)
Majid, Shahn
2002-05-01
Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.
Specific Primers for Rapid Detection of Microsporum audouinii by PCR in Clinical Samples▿
Roque, H. D.; Vieira, R.; Rato, S.; Luz-Martins, M.
2006-01-01
This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis. PMID:17005755
Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region.
Smart, C D; Schneider, B; Blomquist, C L; Guerra, L J; Harrison, N A; Ahrens, U; Lorenz, K H; Seemüller, E; Kirkpatrick, B C
1996-01-01
In order to develop a diagnostic tool to identify phytoplasmas and classify them according to their phylogenetic group, we took advantage of the sequence diversity of the 16S-23S intergenic spacer regions (SRs) of phytoplasmas. Ten PCR primers were developed from the SR sequences and were shown to amplify in a group-specific fashion. For some groups of phytoplasmas, such as elm yellows, ash yellows, and pear decline, the SR primer was paired with a specific primer from within the 16S rRNA gene. Each of these primer pairs was specific for a specific phytoplasma group, and they did not produce PCR products of the correct size from any other phytoplasma group. One primer was designed to anneal within the conserved tRNA(Ile) and, when paired with a universal primer, amplified all phytoplasmas tested. None of the primers produced PCR amplification products of the correct size from healthy plant DNA. These primers can serve as effective tools for identifying particular phytoplasmas in field samples. PMID:8702291
Microsatellite primers for vulnerable seagrass Halophila beccarii (Hydrocharitaceae).
Jiang, Kai; Shi, Yi-Su; Zhang, Jian; Xu, Na-Na
2011-06-01
Polymorphic microsatellite primers were developed in the vulnerable seagrass Halophila beccarii to investigate genetic variation and provide necessary markers for studying its population genetic structure. Six polymorphic and six monomorphic microsatellite loci were developed in H. beccarii. Most loci were successfully amplified across 40 H. beccarii individuals collected from three populations from coastal regions of southern China. Two to four alleles per locus were observed at the six polymorphic loci. The highest expected heterozygosity was 0.5737. The results demonstrate low levels of polymorphism in H. beccarii from coastal regions of southern China. They also illustrate that these primers may be useful for studying the mating system and population genetics of H. beccarii on a global scale.
Effect of surface preparation on service life of top-coats applied to weathered primer paint
R. Sam Williams; Mark Knaebe; Peter Sotos
2008-01-01
Paint companies usually recommend that topcoats be applied to primer paint within two weeks. Unfortunately, this is not always possible. For example, onset of winter weather shortly after applying primer may delay topcoat application until spring. Scuff sanding or repriming are often recommended remedial methods for preparing a weathered primer for topcoats, but there...
Primer synthesis by a eukaryotic-like archaeal primase is independent of its Fe-S cluster.
Holzer, Sandro; Yan, Jiangyu; Kilkenny, Mairi L; Bell, Stephen D; Pellegrini, Luca
2017-11-23
DNA replication depends on primase, the specialised polymerase responsible for synthesis of the RNA primers that are elongated by the replicative DNA polymerases. In eukaryotic and archaeal replication, primase is a heterodimer of two subunits, PriS and PriL. Recently, a third primase subunit named PriX was identified in the archaeon Sulfolobus solfataricus. PriX is essential for primer synthesis and is structurally related to the Fe-S cluster domain of eukaryotic PriL. Here we show that PriX contains a nucleotide-binding site required for primer synthesis, and demonstrate equivalence of nucleotide-binding residues in PriX with eukaryotic PriL residues that are known to be important for primer synthesis. A primase chimera, where PriX is fused to a truncated version of PriL lacking the Fe-S cluster domain retains wild-type levels of primer synthesis. Our evidence shows that PriX has replaced PriL as the subunit that endows primase with the unique ability to initiate nucleic acid synthesis. Importantly, our findings reveal that the Fe-S cluster is not required for primer synthesis.
Prunier, Rachel; Latimer, Andrew
2010-01-01
Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.
Hoorijani, Mohammad Neshvan; Rostami, Hosein; Pourhajibagher, Maryam; Chiniforush, Nasim; Heidari, Mansour; Pourakbari, Babak; Kazemian, Hossein; Davari, Kambiz; Amini, Vahid; Raoofian, Reza; Bahador, Abbas
2017-09-01
Widespread methicillin resistant Staphylococcus aureus (MRSA) and absence of effective antimicrobial agents has led to limited therapeutic options for treating MRSA infection. We aimed to evaluate the effect of antimicrobial photodynamic therapy (aPDT) on the expression of novel identified methicillin resistance markers (NIMRMs) in S. aureus using complementary DNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) approaches to address the therapeutic alternatives for MRSA infections. We used cDNA-AFLP to compare MRSA and methicillin susceptible S. aureus (MSSA) for identification of target genes implicated in methicillin resistance. To determine the sub-lethal aPDT (sPDT), MRSA and MSSA clinical isolates photosensitized with toluidine blue O (TBO), and then were irradiated with diode laser. After sPDT, the colony forming units/mL was quantified. Antimicrobial susceptibility against methicillin was assessed for cell-surviving aPDT. Effects of sPDT on the expression of NIMRMs were evaluated by real-time quantitative reverse transcription PCR. According to our results, serine hydrolase family protein (Shfp) encoding gene and a gene encoding a conserved hypothetical protein (Chp) were implicated in methicillin resistance in MRSA. sPDT reduced the minimum inhibitory concentrations of methicillin by 3-fold in MRSA. sPDT could lead to about 10- and 6.2- fold suppression of expression of the Chp and Shfp encoding genes, respectively. sPDT would lead to reduction in resistance to methicillin of MRSA in surviving cells by suppressing the expression of the Shfp and Chp encoding genes associated with methicillin resistance. This may have potential implications of aPDT for the treatment of MRSA infections. Copyright © 2017 Elsevier B.V. All rights reserved.
Winn-Deen
1998-12-01
Background: Currently analysis of point mutations can be done by allele-specific polymerase chain reaction (PCR) followed by gel analysis or by gene-specific PCR followed by hybridization with an allele-specific probe. Both of these mutation detection methods require post-PCR laboratory time and run the risk of contaminating subsequent experiments with the PCR product liberated during the detection step. The author has combined the PCR amplification and detection steps into a single procedure suitable for closed-tube analysis. Methods and Results: Allele-specific PCR primers were designed as Sunrise energy-transfer primers and contained a 3' terminal mismatch to distinguish between normal and mutant DNA. Cloned normal (W64) and mutant (R64) templates of the beta3-adrenergic receptor gene were tested to verify amplification specificity and yield. A no-target negative control was also run with each reaction. After PCR, each reaction was tested for fluorescence yield by measuring fluorescence on a spectrofluorimeter or fluorescent microtitreplate reader. The cloned controls and 24 patient samples were tested for the W64R mutation by two methods. The direct fluorescence results with the Sunrise allele-specific PCR method gave comparable genotypes to those obtained with the PCR/ restriction digest/gel electrophoresis control method. No PCR artifacts were observed in the negative controls or in the PCR reactions run with the mismatched target. Conclusions: The results of this pilot study indicate good PCR product and fluorescence yield from allele-specific energy-transfer labeled primers, and the capability of distinguishing between normal and mutant alleles based on fluorescence alone, without the need for restriction digestion, gel electrophoresis, or hybridization with an allele-specific probe.
Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G
2017-02-01
To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.
A primer on motor vehicle air pollution.
DOT National Transportation Integrated Search
1973-01-01
This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...
Best Development Practices: A Primer for Smart Growth
Best Development Practices: A Primer for Smart Growth lists specific practices to achieve development principles that mix land uses, support transportation options, protect natural systems, and provide housing choices.
Carro, Belén; Quintela, María; Ruiz, José Miguel; Barreiro, Rodolfo
2012-01-01
Dispersal has received growing attention in marine ecology, particularly since evidence obtained with up-to-date techniques challenged the traditional view. The dogwhelk Nucella lapillus L., a sedentary gastropod with direct development, is a good example: dispersal was traditionally assumed to be limited until studies with microsatellites disputed this idea. To shed some light on this controversy, the genetic structure of dogwhelk populations in northwest Spain was investigated with highly polymorphic AFLP markers giving special attention to the influence of hydrodynamic stress. In agreement with the expectations for a poor disperser, our results show a significant genetic structure at regional (<200 km) and areal scales (<15 km). However, the spatial genetic structure varied with wave-exposure in the present case study: IBD was evident under sheltered conditions but absent from the exposed area where genetic differentiation was stronger. Our results provide evidence that differences in wave-exposure can exert a detectable influence on the genetic structure of coastal organisms, even in species without a planktonic larva. PMID:23185435
Microsatellite primers for red drum (Sciaenops ocellatus)
USDA-ARS?s Scientific Manuscript database
In this note, we document polymerase-chain-reaction (PCR) primer pairs for 101, nuclear-encoded microsatellites designed and developed from a red drum (Sciaenops ocellatus) genomic library. The 101 microsatellites (Genbank Accession Numbers EU015882-EU015982) were amplified successfully and used to...
Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo
2016-01-01
Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. PMID:27154272
Forest Interpreter's Primer on Fire Management.
ERIC Educational Resources Information Center
Zelker, Thomas M.
Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…
Apparatus For Tests Of Percussion Primers
NASA Technical Reports Server (NTRS)
Bement, Laurence J.; Bailey, James W.; Schimmel, Morry L.
1991-01-01
Test apparatus and method developed to measure ignition capability of percussion primers. Closely simulates actual conditions and interfaces encountered in such applications as in munitions and rocket motors. Ignitability-testing apparatus is small bomb instrumented with pressure transducers. Sizes, shapes, and positions of bomb components and materials under test selected to obtain quantitative data on ignition.
Designing for transportation management and operations : a primer.
DOT National Transportation Integrated Search
2013-02-01
This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...
Narihiro, Takashi; Sekiguchi, Yuji
2011-01-01
Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721
Profitability primer: a guide to profitability analysis in the electric power industry
DOE Office of Scientific and Technical Information (OSTI.GOV)
Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.
1996-06-01
As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to variousmore » functions and how revenues are collected and allocated.« less
Krosch, Matt N; Strutt, Francesca; Blacket, Mark J; Batovska, Jana; Starkie, Melissa; Clarke, Anthony R; Cameron, Stephen L; Schutze, Mark K
2018-06-06
Accurate species-level identifications underpin many aspects of basic and applied biology; however, identifications can be hampered by a lack of discriminating morphological characters, taxonomic expertise or time. Molecular approaches, such as DNA 'barcoding' of the cytochrome c oxidase (COI) gene, are argued to overcome these issues. However, nuclear encoding of mitochondrial genes (numts) and poor amplification success of suboptimally preserved specimens can lead to erroneous identifications. One insect group for which these molecular and morphological problems are significant are the dacine fruit flies (Diptera: Tephritidae: Dacini). We addressed these issues associated with COI barcoding in the dacines by first assessing several 'universal' COI primers against public mitochondrial genome and numt sequences for dacine taxa. We then modified a set of four primers that more closely matched true dacine COI sequence and amplified two overlapping portions of the COI barcode region. Our new primers were tested alongside universal primers on a selection of dacine species, including both fresh preserved and decades-old dry specimens. Additionally, Bactrocera tryoni mitochondrial and nuclear genomes were compared to identify putative numts. Four numt clades were identified, three of which were amplified using existing universal primers. In contrast, our new primers preferentially amplified the 'true' mitochondrial COI barcode in all dacine species tested. The new primers also successfully amplified partial barcodes from dry specimens for which full length barcodes were unobtainable. Thus we recommend these new primers be incorporated into the suites of primers used by diagnosticians and quarantine labs for the accurate identification of dacine species. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Zhou, Zhichao; Chen, Jing; Meng, Han; Dvornyk, Volodymyr; Gu, Ji-Dong
2017-02-01
PCR primers targeting genes encoding the two proteins of anammox bacteria, hydrazine synthase and cytochrome c biogenesis protein, were designed and tested in this study. Three different ecotypes of samples, namely ocean sediments, coastal wetland sediments, and wastewater treatment plant (WWTP) samples, were used to assess the primer efficiency and the community structures of anammox bacteria retrieved by 16S ribosomal RNA (rRNA) and the functional genes. Abundances of hzsB gene of anammox bacteria in South China Sea (SCS) samples were significantly correlated with 16S rRNA gene by qPCR method. And hzsB and hzsC gene primer pair hzsB364f-hzsB640r and hzsC745f-hzsC862r in combination with anammox bacterial 16S rRNA gene primers were recommended for quantifying anammox bacteria. Congruent with 16S rRNA gene-based community study, functional gene hzsB could also delineate the coastal-ocean distributing pattern, and seawater depth was positively associated with the diversity and abundance of anammox bacteria from shallow- to deep-sea. Both hzsC and ccsA genes could differentiate marine samples between deep and shallow groups of the Scalindua sp. clades. As for WWTP samples, non-Scalindua anammox bacteria reflected by hzsB, hzsC, ccsA, and ccsB gene-based libraries showed a similar distribution pattern with that by 16S rRNA gene. NH 4 + and NH 4 + /Σ(NO 3 - + NO 2 - ) positively correlated with anammox bacteria gene diversity, but organic matter contents correlated negatively with anammox bacteria gene diversity in SCS. Salinity was positively associated with diversity indices of hzsC and ccsB gene-harboring anammox bacteria communities and could potentially differentiate the distribution patterns between shallow- and deep-sea sediment samples. SCS surface sediments harbored considerably diverse community of Scalindua. A new Mai Po clade representing coastal estuary wetland anammox bacteria group based on 16S rRNA gene phylogeny is proposed. Existence of anammox
NASA Astrophysics Data System (ADS)
Wright, K. E.; Domagal-Goldman, S. D.
2011-12-01
We are early-career scientists jointly leading a project to write 'The Astrobiology Primer', a brief but comprehensive introduction to astrobiology, and we are using the process of producing the document as an innovative way of strengthening the international community of early-career astrobiologists. Astrobiology is the study of the origin, evolution, distribution and future of life in our universe. It includes not just study of life on Earth, but also the potential for life to exist beyond Earth, and the development of techniques to search for such life. It therefore incorporates geological and earth sciences, life sciences, chemistry, astronomy and planetary sciences. This requires astrobiologists to integrate these different disciplines in order to address questions such as 'How did Earth and its biosphere originate?', 'How do life and the physical, chemical and geological cycles on Earth interact, and affect each other?' and so 'What does life on Earth tell us about the habitability of environments outside Earth?'. The primer will provide a brief but comprehensive introduction to the field; it will be significantly more comprehensive than a normal review paper but much shorter than a textbook. This project is an initiative run entirely by early-career scientists, for the benefit of other early-career scientists and others. All the writers and editors of the primer are graduate/post-graduate students or post-doctoral fellows, and our primary target group for the primer is other early-career scientists, although we hope and expect that the primer will also be useful far more broadly in education and outreach work. An Astrobiology Primer was first published in 2006(Ref1), written and edited by a small group of early-career astrobiologists to provide an introduction to astrobiology for other early-career scientists new to the field. It has been used not only by the target group for private study, but in formal education and outreach settings at universities and
Bokulich, Nicholas A.
2013-01-01
Ultra-high-throughput sequencing (HTS) of fungal communities has been restricted by short read lengths and primer amplification bias, slowing the adoption of newer sequencing technologies to fungal community profiling. To address these issues, we evaluated the performance of several common internal transcribed spacer (ITS) primers and designed a novel primer set and work flow for simultaneous quantification and species-level interrogation of fungal consortia. Primer comparison and validation were predicted in silico and by sequencing a “mock community” of mixed yeast species to explore the challenges of amplicon length and amplification bias for reconstructing defined yeast community structures. The amplicon size and distribution of this primer set are smaller than for all preexisting ITS primer sets, maximizing sequencing coverage of hypervariable ITS domains by very-short-amplicon, high-throughput sequencing platforms. This feature also enables the optional integration of quantitative PCR (qPCR) directly into the HTS preparatory work flow by substituting qPCR with these primers for standard PCR, yielding quantification of individual community members. The complete work flow described here, utilizing any of the qualified primer sets evaluated, can rapidly profile mixed fungal communities and capably reconstructed well-characterized beer and wine fermentation fungal communities. PMID:23377949
A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets
DOE Office of Scientific and Technical Information (OSTI.GOV)
Warwick, William M.
2002-06-03
This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.
Recombination of polynucleotide sequences using random or defined primers
Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin H; Giver, Lorraine J.
2000-01-01
A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.
Recombination of polynucleotide sequences using random or defined primers
Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin; Giver, Lorraine J.
2001-01-01
A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.
Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.
Françoso, E; Arias, M C
2013-09-01
Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.
Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo
2016-07-08
Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Novel primers for detection of genetically diverse virulent Agrobacterium tumefaciens bv1 strains
USDA-ARS?s Scientific Manuscript database
Novel primers were developed to amplify a 243 bp fragment of an intergenic region between gene5 and tms2 on the T-DNA of Agrobacterium tumefaciens. These primers exhibit 100% positive correlation with strain virulence, 100% negative correlation with avirulence and did not generate extraneous bands,...
Hu, Yanhui; Sopko, Richelle; Foos, Marianna; Kelley, Colleen; Flockhart, Ian; Ammeux, Noemie; Wang, Xiaowei; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.
2013-01-01
The evaluation of specific endogenous transcript levels is important for understanding transcriptional regulation. More specifically, it is useful for independent confirmation of results obtained by the use of microarray analysis or RNA-seq and for evaluating RNA interference (RNAi)-mediated gene knockdown. Designing specific and effective primers for high-quality, moderate-throughput evaluation of transcript levels, i.e., quantitative, real-time PCR (qPCR), is nontrivial. To meet community needs, predefined qPCR primer pairs for mammalian genes have been designed and sequences made available, e.g., via PrimerBank. In this work, we adapted and refined the algorithms used for the mammalian PrimerBank to design 45,417 primer pairs for 13,860 Drosophila melanogaster genes, with three or more primer pairs per gene. We experimentally validated primer pairs for ~300 randomly selected genes expressed in early Drosophila embryos, using SYBR Green-based qPCR and sequence analysis of products derived from conventional PCR. All relevant information, including primer sequences, isoform specificity, spatial transcript targeting, and any available validation results and/or user feedback, is available from an online database (www.flyrnai.org/flyprimerbank). At FlyPrimerBank, researchers can retrieve primer information for fly genes either one gene at a time or in batch mode. Importantly, we included the overlap of each predicted amplified sequence with RNAi reagents from several public resources, making it possible for researchers to choose primers suitable for knockdown evaluation of RNAi reagents (i.e., to avoid amplification of the RNAi reagent itself). We demonstrate the utility of this resource for validation of RNAi reagents in vivo. PMID:23893746
Simple Heat Treatment of Zirconia Ceramic Pre-Treated with Silane Primer to Improve Resin Bonding.
Ha, Jung-Yun; Son, Jun Sik; Kim, Kyo-Han; Kwon, Tae-Yub
2015-01-01
Establishing a strong resin bond to dental zirconia ceramic remains difficult. Previous studies have shown that the conventional application of silane does not work well with zirconia. This paper reports that a silane pre-treatment of dental zirconia ceramic combined with subsequent heat treatment has potential as an adhesive cementation protocol for improving zirconia-resin bonding. Among the various concentrations (0.1 to 16 vol%) of experimental γ-methacryloxypropyltrimethoxysilane (γ-MPTS) primers assessed, the 1% solution was found to be the most effective in terms of the shear bond strength of the resin cement to dental zirconia ceramic. A high shear bond strength (approx. 30 MPa) was obtained when zirconia specimens were pre-treated with this primer and then heat-treated in a furnace for 60 min at 150 degrees C. Heat treatment appeared to remove the hydrophilic constituents from the silane film formed on the zirconia ceramic surface and accelerate the condensation reactions between the silanol groups of the hydrolyzed silane molecules at the zirconia/resin interface, finally making a more desirable surface for bonding with resin. This estimation was supported by Fourier transform infrared spectroscopy of the silanes prepared in this study.
A Primer on Building Teacher Evaluation Instruments.
ERIC Educational Resources Information Center
Bitner, Ted; Kratzner, Ron
This paper presents a primer on building a scientifically oriented teacher evaluation instrument. It stresses the importance of accurate measures and accepts the presupposition that scientific approaches provide the most accurate measures of student teacher performance. The paper discusses the scientific concepts of validity and reliability, and…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oetting, W.S.; Lee, H.K.; Flanders, D.J.
The use of short tandem repeat polymorphisms (STRPs) as marker loci for linkage analysis is becoming increasingly important due to their large numbers in the human genome and their high degree of polymorphism. Fluorescence-based detection of the STRP pattern with an automated DNA sequencer has improved the efficiency of this technique by eliminating the need for radioactivity and producing a digitized autoradiogram-like image that can be used for computer analysis. In an effort to simplify the procedure and to reduce the cost of fluorescence STRP analysis, we have developed a technique known as multiplexing STRPs with tailed primers (MSTP) usingmore » primers that have a 19-bp extension, identical to the sequence of an M13 sequencing primer, on the 5{prime} end of the forward primer in conjunction with multiplexing several primer pairs in a single polymerase chain reaction (PCR) amplification. The banding pattern is detected with the addition of the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye, eliminating the need for direct conjugation of the infrared fluorescent dye to the STRP primers. The use of MSTP for linkage analysis greatly reduces the number of PCR reactions. Up to five primer pairs can be multiplexed together in the same reaction. At present, a set of 148 STRP markers spaced at an average genetic distance of 28 cM throughout the autosomal genome can be analyzed in 37 sets of multiplexed amplification reactions. We have automated the analysis of these patterns for linkage using software that both detects the STRP banding pattern and determines their sizes. This information can then be exported in a user-defined format from a database manager for linkage analysis. 15 refs., 2 figs., 4 tabs.« less
Leopold, Luna Bergere; Langbein, Walter Basil
1960-01-01
When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to
A Primer on Brain Imaging in Developmental Psychopathology: What Is It Good For?
ERIC Educational Resources Information Center
Pine, Daniel S.
2006-01-01
This primer introduces a Special Section on brain imaging, which includes a commentary and 10 data papers presenting applications of brain imaging to questions on developmental psychopathology. This primer serves two purposes. First, the article summarizes the strength and weaknesses of various brain-imaging techniques typically employed in…
Chen, Huaihai; Yu, Fangbo; Shi, Wei
2016-12-01
Fungal denitrification has been increasingly investigated, but its community ecology is poorly understood due to the lack of culture-independent tools. In this work, four pairs of nirK-targeting primers were designed and evaluated for primer specificity and efficiency using thirty N 2 O-producing fungal cultures and an agricultural soil. All primers amplified nirK from fungi and soil, but their efficiency and specificity were different. A primer set, FnirK_F3/R2 amplified ∼80 % of tested fungi, including Aspergillus, Fusarium, Penicillium, and Trichoderma, as compared to ∼40-70 % for other three primers. The nirK fragments of fungal and soil DNA amplified by FnirK_F3/R2 were phylogenetically related to denitrifying fungi in the orders Eurotiales, Hypocreales, and Sordariales; and clone sequences were also distributed in the clusters of Chaetomium, Metarhizium, and Myceliophthora that were uncultured from soil in our previous work. This proved the wide-range capability of primers for amplifying diverse denitrifying fungi from environment. However, our primers and recently-developed other primers amplified bacterial nirK from soil and this co-amplification of fungal and bacterial nirK was theoretically discussed. The FnirK_F3/R2 was further compared with published primers; results from clone libraries demonstrated that FnirK_F3/R2 was more specifically targeted on fungi and had broader taxonomical coverage than some others. Copyright © 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.
DOT National Transportation Integrated Search
2007-09-01
This primer presents key issues and challenges related to the conversion of high occupancy vehicle (HOV) lanes to high occupancy toll (HOT) lanes. The primer is intended for community leaders, administrators, : the public, and other stakeholders resp...
2016-01-01
Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658
NASA Astrophysics Data System (ADS)
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
NASA Astrophysics Data System (ADS)
D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto
2018-02-01
Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.
Novel nuclear intron-spanning primers for Arecaceae evolutionary biology.
Bacon, Christine D; Feltus, F Alex; Paterson, Andrew H; Bailey, C Donovan
2008-01-01
In this study, 96 nuclear 'conserved intron-scanning primers' were screened across subfamilies the Arecaceae (palms) for potential use in research focused on palm evolutionary biology. Primers were evaluated based on their ability to amplify single polymerase chain reaction products in Arecaceae, the clarity of sequencing reads, and the interspecific variability observed. Ultimately, the results suggest that: (i) seven of the loci are likely to be suitable when comparing non-Arecaceae outgroups and Arecaceae ingroups; (ii) seven loci may be of use when comparing subfamilies of Arecaceae; and (iii) four of the loci may be of use when comparing closely related genera. © 2007 Blackwell Publishing Ltd No claim to original US government works.
Novel primers for complete mitochondrial cytochrome b genesequencing in mammals
Naidu, Ashwin; Fitak, Robert R.; Munguia-Vega, Adrian; Culver, Melanie
2011-01-01
Sequence-based species identification relies on the extent and integrity of sequence data available in online databases such as GenBank. When identifying species from a sample of unknown origin, partial DNA sequences obtained from the sample are aligned against existing sequences in databases. When the sequence from the matching species is not present in the database, high-scoring alignments with closely related sequences might produce unreliable results on species identity. For species identification in mammals, the cytochrome b (cyt b) gene has been identified to be highly informative; thus, large amounts of reference sequence data from the cyt b gene are much needed. To enhance availability of cyt b gene sequence data on a large number of mammalian species in GenBank and other such publicly accessible online databases, we identified a primer pair for complete cyt b gene sequencing in mammals. Using this primer pair, we successfully PCR amplified and sequenced the complete cyt b gene from 40 of 44 mammalian species representing 10 orders of mammals. We submitted 40 complete, correctly annotated, cyt b protein coding sequences to GenBank. To our knowledge, this is the first single primer pair to amplify the complete cyt b gene in a broad range of mammalian species. This primer pair can be used for the addition of new cyt b gene sequences and to enhance data available on species represented in GenBank. The availability of novel and complete gene sequences as high-quality reference data can improve the reliability of sequence-based species identification.
Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang
2009-01-01
PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.
Primer Vector Optimization: Survey of Theory, New Analysis and Applications
NASA Technical Reports Server (NTRS)
Guzman, J. J.; Mailhe, L. M.; Schiff, C.; Hughes, S. P.; Folta, D. C.
2002-01-01
In this paper, a summary of primer vector theory is presented. The applicability of primer vector theory is examined in an effort to understand when and why the theory can fail. For example, since the Calculus of Variations is based on "small" variations, singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyse that employ small variations. Two examples, the initialization of an orbit and a line of apsides rotation, are presented. Recommendations, future work, and the possible addition of other optimization techniques are also discussed.
Liu, Xiaojing; Locasale, Jason W
2017-04-01
Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.
Primer and interviews: Molecular mechanisms of morphological evolution
Kiefer, Julie C
2010-01-01
The beauty of the developing embryo, and the awe that it inspires, lure many scientists into the field of developmental biology. What compels cells to divide, migrate, and morph into a being with a complex body plan? Evolutionary developmental biologists hold similar fascinations, with dynamics that take place on a grander timescale. How do phenotypic traits diverge over evolutionary time? This primer illustrates how a deep understanding of the basic principles that underlie developmental biology have changed how scientists think about the evolution of body form. The primer culminates in a conversation with David Stern, PhD, and Michael Shapiro, PhD, who discuss current topics in morphological evolution, why the field should be of interest to classic developmental biologists, and what lies ahead. Developmental Dynamics 239:3497–3505, 2010. © 2010 Wiley-Liss, Inc. PMID:21069831
Hydrology of Central Florida Lakes - A Primer
Schiffer, Donna M.
1998-01-01
INTRODUCTION Lakes are among the most valued natural resources of central Florida. The landscape of central Florida is riddled with lakeswhen viewed from the air, it almost seems there is more water than land. Florida has more naturally formed lakes than other southeastern States, where many lakes are created by building dams across streams. The abundance of lakes on the Florida peninsula is a result of the geology and geologic history of the State. An estimated 7,800 lakes in Florida are greater than 1 acre in surface area. Of these, 35 percent are located in just four counties (fig. 1): Lake, Orange, Osceola, and Polk (Hughes, 1974b). Lakes add to the aesthetic and commercial value of the area and are used by many residents and visitors for fishing, boating, swimming, and other types of outdoor recreation. Lakes also are used for other purposes such as irrigation, flood control, water supply, and navigation. Residents and visitors commonly ask questions such as Whyare there so many lakes here?, Why is my lake drying up (or flooding)?, or Is my lake spring-fed? These questions indicate that the basic hydrology of lakes and the interaction of lakes with ground water and surface water are not well understood by the general population. Because of the importance of lakes to residents of central Florida and the many questions and misconceptions about lakes, this primer was prepared by the U.S. Geological Survey (USGS) in cooperation with the St. Johns River Water Management District and the South Florida Water Management District. The USGS has been collecting hydrologic data in central Florida since the 1920s, obtaining valuable information that has been used to better understand the hydrology of the water resources of central Florida, including lakes. In addition to data collection, as of 1994, the USGS had published 66 reports and maps on central Florida lakes (Garcia and Hoy, 1995). The main purpose of this primer is to describe the hydrology of lakes in central
Li, Huamin; Cui, Yanhua; Wu, Lixian; Tu, Ran; Chen, Sanfeng
2011-12-20
Our previous study indicated org35 was involved in chemotaxis and interacted with nitrogen fixation transcriptional activator NifA via PAS domain. In order to reveal the role of org35 in nitrogen regulation, the downstream target genes of org35 were identified. We here report differentially expressed genes in org35 mutants comparing with wild type Sp7 by means of cDNA-AFLP. Four up-regulated transcript-derived fragments (TDFs) homologues of chemotaxis transduction proteins were found, including CheW, methyl-accepting chemotaxis protein and response regulator CheY-like receiver. Three distinct TDFs (AB46, AB58 and AB63) were similar to PHB de-polymerase C-terminus, cell shape-determining protein and flagellin domain protein. And 11 TDFs showed similarities with signal transduction proteins, including homologous protein of the nitrogen regulation protein NtrY and nitrate/nitrite response regulator protein NarL. These data suggested that the Azospirillum brasilense org35 was a multi-effecter and involved in chemotaxis, cyst development and regulation of nitrogen fixation. Copyright © 2010 Elsevier GmbH. All rights reserved.
Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico
Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola
2016-01-01
Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666
Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.
Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola
2016-01-01
Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.
Laser Doppler velocimetry primer
NASA Technical Reports Server (NTRS)
Bachalo, William D.
1985-01-01
Advanced research in experimental fluid dynamics required a familiarity with sophisticated measurement techniques. In some cases, the development and application of new techniques is required for difficult measurements. Optical methods and in particular, the laser Doppler velocimeter (LDV) are now recognized as the most reliable means for performing measurements in complex turbulent flows. And such, the experimental fluid dynamicist should be familiar with the principles of operation of the method and the details associated with its application. Thus, the goals of this primer are to efficiently transmit the basic concepts of the LDV method to potential users and to provide references that describe the specific areas in greater detail.
Yang, Jun-Bo; Li, De-Zhu; Li, Hong-Tao
2014-09-01
Chloroplast genomes supply indispensable information that helps improve the phylogenetic resolution and even as organelle-scale barcodes. Next-generation sequencing technologies have helped promote sequencing of complete chloroplast genomes, but compared with the number of angiosperms, relatively few chloroplast genomes have been sequenced. There are two major reasons for the paucity of completely sequenced chloroplast genomes: (i) massive amounts of fresh leaves are needed for chloroplast sequencing and (ii) there are considerable gaps in the sequenced chloroplast genomes of many plants because of the difficulty of isolating high-quality chloroplast DNA, preventing complete chloroplast genomes from being assembled. To overcome these obstacles, all known angiosperm chloroplast genomes available to date were analysed, and then we designed nine universal primer pairs corresponding to the highly conserved regions. Using these primers, angiosperm whole chloroplast genomes can be amplified using long-range PCR and sequenced using next-generation sequencing methods. The primers showed high universality, which was tested using 24 species representing major clades of angiosperms. To validate the functionality of the primers, eight species representing major groups of angiosperms, that is, early-diverging angiosperms, magnoliids, monocots, Saxifragales, fabids, malvids and asterids, were sequenced and assembled their complete chloroplast genomes. In our trials, only 100 mg of fresh leaves was used. The results show that the universal primer set provided an easy, effective and feasible approach for sequencing whole chloroplast genomes in angiosperms. The designed universal primer pairs provide a possibility to accelerate genome-scale data acquisition and will therefore magnify the phylogenetic resolution and species identification in angiosperms. © 2014 John Wiley & Sons Ltd.
Reforming Science Instruction in California: A Primer
ERIC Educational Resources Information Center
EdSource, 2017
2017-01-01
As schools across the state implement the Next Generation Science Standards, this EdSource primer provides an easy-to-read guide for parents and other community members to understand the rationale for the standards and their potential to affect science instruction in California schools. California adopted the Next Generation Science Standards, or…
Adult Learning Theory: A Primer. Information Series.
ERIC Educational Resources Information Center
Baumgartner, Lisa M.; Lee, Ming-Yeh; Birden, Susan; Flowers, Doris
The purpose of this monograph is to serve as a primer for practitioners on the foundational theories of adult learning. It begins with an explanation two lenses through which learning theory is viewed: behaviorism and constructivism. The next section defines andragogy and delineates Knowles's five assumptions about adult learners. This is followed…
Jaros, U; Fischer, G A; Pailler, T; Comes, H P
2016-05-01
Bulbophyllum occultum, an epiphytic orchid mainly distributed in the rainforests of (north)eastern Madagascar and La Réunion, represents an interesting model case for testing the effects of anthropogenic vs historical (e.g., climate induced) habitat isolation and long-distance colonization on the genetic structure of plant species with disjunct distributions in the Madagascan region. To this aim, we surveyed amplified fragment length polymorphisms (AFLPs) across 13 populations in Madagascar and nine in La Réunion (206 individuals in total). We found overall high levels of population subdivision (Φ(PT)=0.387) and low within-population diversity (H(E), range: 0.026-0.124), indicating non-equilibrium conditions in a mainly selfing species. There was no impact of recent deforestation (Madagascar) or habitat disturbance (La Réunion) detectable on AFLP diversity. K-means clustering and BARRIER analyses identified multiple gene pools and several genetic breaks, both within and among islands. Inter-island levels of population genetic diversity and subdivision were similar, whereby inter-individual divergence in flower colour explained a significant part of gene pool divergence in La Réunion. Our results suggest that (i) B. occultum persisted across multiple isolated ('refugial') regions along the eastern rainforest corridor of Madagascar over recent climatic cycles and (ii) populations in La Réunion arose from either single or few independent introductions from Madagascar. High selfing rates and sufficient time for genetic drift likely promoted unexpectedly high population genetic and phenotypic (flower colour) differentiation in La Réunion. Overall, this study highlights a strong imprint of history on the genetic structure of a low-gene-dispersing epiphytic orchid from the Madagascan region.
Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft
2011-08-17
system Significant hexavalent chrome reduction in finish system Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT
Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A
2015-04-01
Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.
Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forwardmore » or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource
Cheng, Y Z; Xu, T J; Jin, X X; Tang, D; Wei, T; Sun, Y Y; Meng, F Q; Shi, G; Wang, R X
2012-01-01
Through multiple alignment analysis of mitochondrial tRNA-Thr and tRNA-Phe sequences from 161 fishes, new universal primers specially targeting the entire mitochondrial control region were designed. This new primer set successfully amplified the expected PCR products from various kinds of marine fish species, belonging to various families, and the amplified segments were confirmed to be the control region by sequencing. These primers provide a useful tool to study the control region diversity in economically important fish species, the possible mechanism of control region evolution, and the functions of the conserved motifs in the control region.
2009-07-01
24 iii ACRONYMS AND ABBREVIATIONS ATF Armaments Technology Facility ATK Alliant Techsystems, Inc. ARDEC Armament Research...Technology Facility ( ATF ) firings there, and was instrumental in producing the primers and loading the cartridges needed for the supplemental...and CADs known as the percussion primer. The novel properties associated with nanostructure materials have resulted in the development of thermite
Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas
2016-01-01
Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic
Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.
Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce
2009-01-01
Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.
School Safety & Youth Violence: A Legal Primer.
ERIC Educational Resources Information Center
Bailey, Kirk A.; Ross, Catherine J.
This legal primer on violence in schools addresses the responsibility of school officials to respond to undisciplined youths whose behavior threatens the welfare and safety of other children in attendance. It is broken down into sections that provide a brief overview of the key rules and guidelines for school officials and teachers in each topic…
Casimiro-Soriguer, Ramón; Talavera, María; Balao, Francisco; Terrab, Anass; Herrera, Javier; Talavera, Salvador
2010-07-01
The genus Erophaca comprises a single herbaceous perennial species with two subspecies distributed at opposite ends of the Mediterranean region. We used nrDNA ITS to investigate the phylogeny of the genus, and AFLP markers (9 primers, 20 populations) to establish the genetic relationship between subspecies, and among populations at each side of the Gibraltar Strait. According to nrDNA ITS, Erophaca is monophyletic, old (Miocene), and sister to the Astragalean clade. Life form attributes and molecular clock estimates suggest that Erophaca is one of the many Tertiary relicts that form part of the present Mediterranean flora. Within the occidental subspecies, European plants are clearly derived from North-African populations (Morocco) which, despite being rare on a regional scale, present the highest genetic diversity (as estimated by private and rare fragment numbers). In general, genetic diversity decreased with increasing distance from Morocco. AFLP and nrDNA ITS markers evidenced that the Eastern and the Western subspecies are genetically distinct. Possible causes for their disjunct distribution are discussed. Copyright 2010 Elsevier Inc. All rights reserved.
Meagher, Robert J.; Priye, Aashish; Light, Yooli K.; ...
2018-03-27
Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Meagher, Robert J.; Priye, Aashish; Light, Yooli K.
Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less
Development of Species-specific Primers for Rapid Detection of Phellinus linteus and P. baumii
Kim, Mun-Ok; Kim, Gi-Young; Nam, Byung-Hyouk; Jin, Cheng-Yun; Lee, Ki-Won; Park, Jae-Min; Lee, Sang-Joon
2005-01-01
Genus Phellinus taxonomically belongs to Aphyllophorales and some species of this genus have been used as a medicinal ingredients and Indian folk medicines. Especially, P. linteus and morphological-related species are well-known medicinal fungi that have various biological activities such as humoral and cell-mediated, anti-mutagenic, and anti-cancer activities. However, little is known about the rapid detection for complex Phellinus species. Therefore, this study was carried out to develop specific primers for the rapid detection of P. linteus and other related species. Designing the species-specific primers was done based on internal transcribed spacer sequence data. Each primer set detected specifically P. linteus (PL2/PL5R) and P. baumii (PB1/PB4R). These primer sets could be useful for the rapid detection of specific-species among unidentified Phellinus species. Moreover, restriction fragment length polymorphism analysis of the ITS region with HaeIII was also useful for clarifying the relationship between each 5 Phellinus species. PMID:24049482
2013-01-01
Background Over the past decades site-directed mutagenesis (SDM) has become an indispensable tool for biological structure-function studies. In principle, SDM uses modified primer pairs in a PCR reaction to introduce a mutation in a cDNA insert. DpnI digestion of the reaction mixture is used to eliminate template copies before amplification in E. coli; however, this process is inefficient resulting in un-mutated clones which can only be distinguished from mutant clones by sequencing. Results We have developed a program – ‘SDM-Assist’ which creates SDM primers adding a specific identifier: through additional silent mutations a restriction site is included or a previous one removed which allows for highly efficient identification of ‘mutated clones’ by a simple restriction digest. Conclusions The direct identification of SDM clones will save time and money for researchers. SDM-Assist also scores the primers based on factors such as Tm, GC content and secondary structure allowing for simplified selection of optimal primer pairs. PMID:23522286
Issues Primer. EEE708 Negotiated Study Program.
ERIC Educational Resources Information Center
Jennings, Leonie
This issues primer is structured around a series of 20 contemporary concerns in the changing world of work and training in Australia in the early 1990s. It is part of the study materials for the one-semester distance education unit, Negotiated Study Program, in the Open Campus Program at Deakin University (Australia). Information on each issue is…
Njiru, Zablon K; Mbae, Cecilia K; Mburugu, Gitonga N
2017-01-01
The World Health Organization has targeted Human African Trypanosomiasis (HAT) for elimination by 2020 with zero incidence by 2030. To achieve and sustain this goal, accurate and easy-to-deploy diagnostic tests for Gambian trypanosomiasis which accounts for over 98% of reported cases will play a crucial role. Most needed will be tools for surveillance of pathogen in vectors (xenomonitoring) since population screening tests are readily available. The development of new tests is expensive and takes a long time while incremental improvement of existing technologies that have potential for xenomonitoring may offer a shorter pathway to tools for HAT surveillance. We have investigated the effect of including a second set of reaction accelerating primers (stem primers) to the standard T. brucei gambiense LAMP test format. The new test format was analyzed with and without outer primers. Amplification was carried out using Rotorgene 6000 and the portable ESE Quant amplification unit capable of real-time data output. The stem LAMP formats indicated shorter time to results (~8 min), were 10-100-fold more sensitive, and indicated higher diagnostic sensitivity and accuracy compared to the standard LAMP test. It was possible to confirm the predicted product using ESE melt curves demonstrating the potential of combining LAMP and real-time technologies as possible tool for HAT molecular xenomonitoring.
Improved primer for bonding polyurethane adhesives to metals
NASA Technical Reports Server (NTRS)
Constanza, L. J.
1969-01-01
Primer ensures effective bonding integrity of polyurethane adhesives on metal surfaces at temperatures ranging from minus 423 degrees to plus 120 degrees F. It provides greater metal surface protection and bond strengths over this temperature range than could be attained with other adhesive systems.
Defense Primer: The National Defense Budget Function (050)
2017-03-17
in parenthesis). This defense primer addresses the National Defense Budget (050), which is frequently used to explain trends in military spending...but which also includes some activities not conducted by the Department of Defense. What Is the Purpose of the Budget Function System? The budget
Beauchaine, Theodore P.
2009-01-01
Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222
Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da
2016-07-15
Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.
EPA recently released a primer that provides guidance to Region 10 Tribes, States, and local watershed community groups to support the identification, protection, and restoration of critical cold water refuges for the protection of salmonids. This primer will assist these entiti...
Zhang, Hong; Jing, Ye; Nie, Rongrong; Meng, Xiangfeng
2015-10-01
To evaluate the bond strength and durability of a self-adhesive resin cement with a zirconia ceramic pretreated by a zirconia primer. Zirconia ceramic (Vita Inceram YZ) plates with a thickness of 2.5 mm were fired, polished, and then cleaned. Half of the polished ceramic plates were sandblasted with 50 μm alumina particles at 0.3 MPa for 20 s. The surface compound weight ratios were measured via X-ray fluorescence microscopy. The polished and sandblasted ceramic plates were directly bonded with self-adhesive resin cement (Biscem) or were pretreated by a zirconia primer (Z Primer Plus) before bonding with Biscem. The specimens of each test group were divided into two subgroups (n=10) and subjected to the shear test after 0 and 10,000 thermal cycles. The data were analyzed via three-way ANOVA. After air abrasion, 8.27% weight ratio of alumina attached to the zirconia surface. Compared with air abrasion, primer treatment more significantly improved the primary resin bond strength of the zirconia ceramic. The primary resin bond strength of the zirconia ceramic with no primer treatment was not affected by thermocycling (P>0.05). However, the primary resin bond strength of the zirconia ceramic with primer treatment was significantly decreased by thermocycling (P<0.05). Primer treatment can improve the primary resin bond strengths of zirconia ceramics. However, the bond interface of the primer is not stable and rapidly degraded during thermocycling.
Identification and characterization of the WRKY transcription factor family in Pinus monticola.
Liu, Jun-Jun; Ekramoddoullah, Abul K M
2009-01-01
The WRKY gene family represents an ancient and highly complex group of transcription factors involved in signal transduction pathways of numerous plant developmental processes and host defense response. Up to now, most WRKY proteins have been identified in a few angiosperm species. Identification of WRKY genes in a conifer species would facilitate a comprehensive understanding of the evolutionary and function-adaptive process of this superfamily in plants. We performed PCR on genomic DNA to clone WRKY sequences from western white pine (Pinus monticola), one of the most valuable conifer species endangered by white pine blister rust (Cronartium ribicola). In total, 83 P. monticola WRKY (PmWRKY) sequences were identified using degenerate primers targeted to the WRKY domain. A phylogenetic analysis revealed that PmWRKY members fell into four major groups (1, 2a+2b, 2c, and 2d+2e) described in Arabidopsis and rice. Because of high genetic diversity of the PmWRKY family, a modified AFLP method was used to detect DNA polymorphism of this gene family. Polymorphic fragments accounted for 17%-35% of total PCR products in the AFLP profiles. Among them, one WRKY AFLP marker was linked to the major resistance gene (Cr2) against C. ribicola. The results of this study provide basic genomic information for a conifer WRKY gene family, which will pave the way for elucidating gene evolutionary mechanisms in plants and unveiling the precise roles of PmWRKY in conifer development and defense response.
TSUNAMI Primer: A Primer for Sensitivity/Uncertainty Calculations with SCALE
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rearden, Bradley T; Mueller, Don; Bowman, Stephen M
2009-01-01
This primer presents examples in the application of the SCALE/TSUNAMI tools to generate k{sub eff} sensitivity data for one- and three-dimensional models using TSUNAMI-1D and -3D and to examine uncertainties in the computed k{sub eff} values due to uncertainties in the cross-section data used in their calculation. The proper use of unit cell data and need for confirming the appropriate selection of input parameters through direct perturbations are described. The uses of sensitivity and uncertainty data to identify and rank potential sources of computational bias in an application system and TSUNAMI tools for assessment of system similarity using sensitivity andmore » uncertainty criteria are demonstrated. Uses of these criteria in trending analyses to assess computational biases, bias uncertainties, and gap analyses are also described. Additionally, an application of the data adjustment tool TSURFER is provided, including identification of specific details of sources of computational bias.« less
Molecular Diagnosis of Malaria by Photo-Induced Electron Transfer Fluorogenic Primers: PET-PCR
Lucchi, Naomi W.; Narayanan, Jothikumar; Karell, Mara A.; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J.; Hill, Vincent; Udhayakumar, Venkatachalam
2013-01-01
There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs. PMID:23437209
Molecular diagnosis of malaria by photo-induced electron transfer fluorogenic primers: PET-PCR.
Lucchi, Naomi W; Narayanan, Jothikumar; Karell, Mara A; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J; Hill, Vincent; Udhayakumar, Venkatachalam
2013-01-01
There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs.
Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.
Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong
2014-08-01
The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.
A primer on multifactor productivity : description, benefits, and uses
DOT National Transportation Integrated Search
2008-04-01
This primer presents a description of multifactor : productivity (MFP) and its calculation. Productivity : is an important measure of the state of the : economy at various levels: firm, industry, sectoral, : and the macroeconomic. The method describe...
Byoun, Mun Sub; Yoo, Changhoon; Sim, Sang Jun; Lim, Chae Seung; Kim, Sung Woo
2018-01-01
Real-time PCR, also called quantitative PCR (qPCR), has been powerful analytical tool for detection of nucleic acids since it developed. Not only for biological research but also for diagnostic needs, qPCR technique requires capacity to detect multiple genes in recent years. Solid phase PCR (SP-PCR) where one or two directional primers are immobilized on solid substrates could analyze multiplex genetic targets. However, conventional SP-PCR was subjected to restriction of application for lack of PCR efficiency and quantitative resolution. Here we introduce an advanced qPCR with primer-incorporated network (PIN). One directional primers are immobilized in the porous hydrogel particle by covalent bond and the other direction of primers are temporarily immobilized at so-called 'Supplimers'. Supplimers released the primers to aqueous phase in the hydrogel at the thermal cycling of PCR. It induced the high PCR efficiency over 92% with high reliability. It reduced the formation of primer dimers and improved the selectivity of qPCR thanks to the strategy of 'right primers supplied to right place only'. By conducting a six-plex qPCR of 30 minutes, we analyzed DNA samples originated from malaria patients and successfully identified malaria species in a single reaction. PMID:29293604
NASA Astrophysics Data System (ADS)
Liu, Min; Xue, Huai; Pan, Yi; Zhang, Chunhua; Lu, Jinying
Leaf cell ultrastructures and DNA variations in the firstand the second-generation of Earthgrown tomato (Lycopersicon esculentun Mill) plants that had been endured a long-term six years spaceflight in the Mir were compared to their ground-based control plants, under observations with a Transmission Electron Microscope and the Amplification Fragment Length Polymorphism (AFLP) analysis. For alterations in the morphological ultrastructures, one plant among the 11 first-generation plants generated from 30 Mir-flown seeds had a three-layered palisade cell structure, while other 10 first-generation plants and all ground-based controls had one-layered palisade cell structure in leaves. Starch grains were larger and in clusters, numbers of starch grains increased in the chloroplasts in the Mir-flown plants. Leaf cells became contracted and deformed, and cell shape patterns were different in the Mir-flown plants. For the leaf genomic DNA alterations, 34 DNA bands were polymorphic with a 1.32% polymorphism among 2582 DNA bands in the first-generation Mir-flown plants. Band types in the spaceflight treated plants were also different from those in the ground-based control. Of 11 survived first-generation plants, 7 spaceflight treated plants (Plant Nos. 1-6 and No. 9) had a same 7 polymorphic bands and a same 0.27%DNA mutation. The DNA mutation rate was greatest in Plants No.10 and No.7 (0.90% and 0.94%), less in Plant No.11 (0.31%) and least in Plant No.8 (0.20%). For the 38 send-generation plants propagated from the No. 5 Mir-flown seed, 6 DNA bands were polymorphic with a 0.23% polymorphism among 2564 amplified DNA bands. Among those 38 second-generation plants amplified by primer pair (E4: ACC, M8: CTT), one DNA band disappeared in 29 second-generation plants and in the original Mir-flown No. 5 plant, compared to the ground-base controls. Among the 38 second-generation plants generated from the Mir-flown No. 5 seed, the DNA band types of 29 second-generation plants were
A primer set to determine sex in the small Indian mongoose, Herpestes auropunctatus.
Murata, C; Ogura, G; Kuroiwa, A
2011-03-01
To enable the accurate sexing of individuals of introduced populations of the small Indian mongoose, Herpestes auropunctatus, we designed a primer set for the amplification of the sex-specific fragments EIF2S3Y and EIF2S3X. Using this primer set, the expected amplification products were obtained for all samples of genomic DNA tested: males yielded two bands and females a single band. Sequencing of each PCR product confirmed that the 769-bp fragment amplified from DNA samples of both sexes was derived from EIF2S3X, whereas the 546-bp fragment amplified only from male DNA samples was derived from EIF2S3Y. The results indicated that this primer set is useful for sex identification in this species. © 2010 Blackwell Publishing Ltd.
The astrobiology primer: an outline of general knowledge--version 1, 2006.
Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S
2006-10-01
The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.
Sarafianou, Aspasia; Seimenis, Ioannis; Papadopoulos, Triantafillos
2008-05-01
adhesive failures and significantly lower bond strength compared to group R. Groups MPII50, MPII250, and SRL50, SRL250 showed combination failures and no significant difference compared with group R. EDS revealed interfacial rather than adhesive failures. Airborne-particle abrasion with 50-microm Al2O3 particles may result in improved bond strength, independent of the primer used. The bond strength of Metal Primer II and SR Link specimens was comparable to that of specimens treated with Rocatec.
Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V
2015-12-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.
Status of NC Primer Demonstration & Transition
2014-11-20
Camo Paint Scheme H-53 • Six a/c selected for demonstration of Hentzen 17176KEP FRCE • Full non-chromate coating stack-up demo – Hentzen...CCC • BUNO #: #163076 #163080 #164859 11 NC Primer Demos: Camo Paint Scheme F/A-18A-D • 13 a/c selected for demonstration of PPG-Deft 02-GN... Strippability 5. Dry Time (-23377) 6. Fluid Resistance (Skydrol) 7. Solvent Resistance 8. Thickness Tolerance 9. Application Method 10. Packaging (1K
Gonzales, J L; Loza, A; Chacon, E
2006-03-15
There are several T. vivax specific primers developed for PCR diagnosis. Most of these primers were validated under different DNA extraction methods and study designs leading to heterogeneity of results. The objective of the present study was to validate PCR as a diagnostic test for T. vivax trypanosomosis by means of determining the test sensitivity of different published specific primers with different sample preparations. Four different DNA extraction methods were used to test the sensitivity of PCR with four different primer sets. DNA was extracted directly from whole blood samples, blood dried on filter papers or blood dried on FTA cards. The results showed that the sensitivity of PCR with each primer set was highly dependant of the sample preparation and DNA extraction method. The highest sensitivities for all the primers tested were determined using DNA extracted from whole blood samples, while the lowest sensitivities were obtained when DNA was extracted from filter paper preparations. To conclude, the obtained results are discussed and a protocol for diagnosis and surveillance for T. vivax trypanosomosis is recommended.
Development of microsatellite primers of the largest seagrass, Enhalus acoroides (Hydrocharitaceae).
Gao, Hui; Jiang, Kai; Geng, Yan; Chen, Xiao-Yong
2012-03-01
Microsatellite primers were developed for the seagrass Enhalus acoroides to investigate genetic variation and identify clonal structure. Four polymorphic loci and 32 monomorphic loci were developed in E. acoroides. Two to four alleles per locus were observed at the polymorphic loci across 60 individuals of two E. acoroides populations. The observed and expected heterozygosities within populations ranged from 0.100 to 0.5667 and from 0.0977 to 0.5079, respectively. Our study revealed very low polymorphism in E. acoroides, even at the polymorphic loci. Nevertheless, these primers are a useful tool to study genetic variation, clonal structure, and mating system.
GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms
David, Fabrice P.A.; Rougemont, Jacques; Deplancke, Bart
2017-01-01
GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. PMID:28053161
Takahashi, Shunsuke; Tomita, Junko; Nishioka, Kaori; Hisada, Takayoshi; Nishijima, Miyuki
2014-01-01
For the analysis of microbial community structure based on 16S rDNA sequence diversity, sensitive and robust PCR amplification of 16S rDNA is a critical step. To obtain accurate microbial composition data, PCR amplification must be free of bias; however, amplifying all 16S rDNA species with equal efficiency from a sample containing a large variety of microorganisms remains challenging. Here, we designed a universal primer based on the V3-V4 hypervariable region of prokaryotic 16S rDNA for the simultaneous detection of Bacteria and Archaea in fecal samples from crossbred pigs (Landrace×Large white×Duroc) using an Illumina MiSeq next-generation sequencer. In-silico analysis showed that the newly designed universal prokaryotic primers matched approximately 98.0% of Bacteria and 94.6% of Archaea rRNA gene sequences in the Ribosomal Database Project database. For each sequencing reaction performed with the prokaryotic universal primer, an average of 69,330 (±20,482) reads were obtained, of which archaeal rRNA genes comprised approximately 1.2% to 3.2% of all prokaryotic reads. In addition, the detection frequency of Bacteria belonging to the phylum Verrucomicrobia, including members of the classes Verrucomicrobiae and Opitutae, was higher in the NGS analysis using the prokaryotic universal primer than that performed with the bacterial universal primer. Importantly, this new prokaryotic universal primer set had markedly lower bias than that of most previously designed universal primers. Our findings demonstrate that the prokaryotic universal primer set designed in the present study will permit the simultaneous detection of Bacteria and Archaea, and will therefore allow for a more comprehensive understanding of microbial community structures in environmental samples. PMID:25144201
2012-08-01
Building Information Modeling ( BIM ) Primer Report 1: Facility Life-cycle Process and Technology Innovation In fo...is unlimited. ERDC/ITL TR-12-2 August 2012 Building Information Modeling ( BIM ) Primer Report 1: Facility Life-cycle Process and Technology...and to enhance the quality of projects through the design, construction, and handover phases. Building Information Modeling ( BIM ) is a
Yanagida, Hiroaki; Tanoue, Naomi; Ide, Takako; Matsumura, Hideo
2009-07-01
We evaluated the effects of two dual-functional primers and a tribochemical surface modification system on the bond strength between an indirect composite resin and gold alloy or titanium. Disk specimens (diameter, 10 mm; thickness, 2.5 mm) were cast from type 4 gold alloy and commercially pure titanium. The specimens were wetground to a final surface finish using 600-grit silicone carbide paper. The specimens were then air-dried and treated using the following four bonding systems: (1) air-abrasion with 50-70 mum alumina, (2) system 1 + alloy primer, (3) system 1 + metal link primer, and (4) tribochemical silica/silane coating (Rocatec). A light-polymerizing indirect composite resin (Ceramage) was applied to each metal specimen and polymerized according to the manufacturer's specifications. Shear bond strengths (MPa) were determined both before and after thermocycling (4 degrees C and 60 degrees C for 1 min each for 20 000 cycles). The values were compared using analysis of variance, post hoc Scheffe tests, and Mann-Whitney U tests (alpha = 0.05). The strengths decreased after thermocycling for all combinations. For both gold alloy and titanium, the bond strength with air-abrasion only was statistically lower than that with the other three modification methods after thermocycling. Titanium exhibited a significantly higher value (13.4 MPa) than gold alloy (10.5 MPa) with the air. abrasion and alloy primer system. Treatment with the tribochemical system or air abrasion followed by treatment with dual-functional priming agents was found to be effective for enhancement of the bonding between the indirect composite and gold alloy or titanium.
A set of primers for analyzing chloroplast DNA diversity in Citrus and related genera.
Cheng, Yunjiang; de Vicente, M Carmen; Meng, Haijun; Guo, Wenwu; Tao, Nengguo; Deng, Xiuxin
2005-06-01
Chloroplast simple sequence repeat (cpSSR) markers in Citrus were developed and used to analyze chloroplast diversity of Citrus and closely related genera. Fourteen cpSSR primer pairs from the chloroplast genomes of tobacco (Nicotiana tabacum L.) and Arabidopsis were found useful for analyzing the Citrus chloroplast genome (cpDNA) and recoded with the prefix SPCC (SSR Primers for Citrus Chloroplast). Eleven of the 14 primer pairs revealed some degree of polymorphism among 34 genotypes of Citrus, Fortunella, Poncirus and some of their hybrids, with polymorphism information content (PIC) values ranging from 0.057 to 0.732, and 18 haplotypes were identified. The cpSSR data were analyzed with NTSYS-pc software, and the genetic relationships suggested by the unweighted pair group method based on arithmetic means (UPGMA) dendrogram were congruent with previous taxonomic investigations: the results showed that all samples fell into seven major clusters, i.e., Citrus medica L., Poncirus, Fortunella, C. ichangensis Blanco, C. reticulata Swingle, C. aurantifolia (Christm.) Swingle and C. grandis (L.) Osbeck. The results of previous studies combined with our cpSSR analyses revealed that: (1) Calamondin (C. madurensis Swingle) is the result of hybridization between kumquat (Fortunella) and mandarin (C. reticulata), where kumquat acted as the female parent; (2) Ichang papeda (C. ichangensis) has a unique taxonomic status; and (3) although Bendiguangju mandarin (C. reticulata) and Satsuma mandarin (C. reticulata) are similar in fruit shape and leaf morphology, they have different maternal parents. Bendiguangju mandarin has the same cytoplasm as sweet orange (C. sinensis), whereas Satsuma mandarin has the cytoplasm of C. reticulata. Seventeen PCR products from SPCC1 and 21 from SPCC11 were cloned and sequenced. The results revealed that mononucleotide repeats as well as insertions and deletions of small segments of DNA were associated with SPCC1 polymorphism, whereas polymorphism
Atwood-Moore, Angela; Yan, Kenneth; Judson, Robert L; Levin, Henry L
2006-08-01
The long terminal repeat retrotransposon Tf1 of Schizosaccharomyces pombe uses a unique mechanism of self priming to initiate reverse transcription. Instead of using a tRNA, Tf1 primes minus-strand synthesis with an 11-nucleotide RNA removed from the 5' end of its own transcript. We tested whether the self primer of Tf1 was similar to tRNA primers in being removed from the cDNA by RNase H. Our analysis of Tf1 cDNA extracted from virus-like particles revealed the surprising observation that the dominant species of cDNA retained the self primer. This suggests that integration of the cDNA relies on mechanisms other than reverse transcription to remove the primer.
Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup
This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.
Development of a unique polyurethane primer/topcoat
NASA Technical Reports Server (NTRS)
Novak, Howard L.; Klotz, James M.
1994-01-01
USBI Company, a Division of Pratt & Whitney Government Engines and Space Propulsion, is involved in corrosion and environmental research and development activities both at their headquarters in Huntsville, Alabama and their Florida Operations at Kennedy Space Center, Florida. The programs involve the development of environmentally compatible materials that improve the corrosion protection of expensive Solid Rocket Boosters (SRB) that are part of the Space Shuttle systems developed and managed by Marshall Space Flight Center in Huntsville, Alabama. Coatings For Industry, a paint manufacturer in Souderton, PA helped formulate and produce the first lot of BOOSTERCOAT paint. High strength aluminum aerospace flight hardware exposed to harsh seacoast environments and seawater immersion presently uses high volatile organic compound (VOC) chromated and lead bearing primers and epoxy topcoats for corrosion protection. Epoxy paint tends to be brittle and has relatively low ultraviolet (UV) exposure resistance. A unique, environmentally compatible, non-leaded/non-chromated, low VOC polyurethane single coat (primer/topcoat) trade named BOOSTERCOAT has been developed for excellent corrosion protection, flexibility, adhesion, chemical and solvent resistance properties. This report will discuss the development of BOOSTERCOAT and the potential opportunities for commercial use in the energy, transportation, chemical, maritime, structural fields.
Effect of a metal primer on the bond strength of the resin-metal interface.
Freitas, Anderson Pinheiro de; Francisconi, Paulo Afonso Silveira
2004-06-01
To evaluate the effect of different surface treatments on shear bond strength between a metallic alloy (Co-Cr-Mo - Remanium CD) and a resin cement (Rely X TM) and to evaluate the mode of fracture after testing, forty couples of metallic-alloy disks were melted, regularized, polished, submitted to four thermal cycles (Vacuum, 960ºC, 8 minutes) and randomly separated into four groups. Each group received a different type of treatment: Group PSP: Polished with sandpaper 600; Group PCP: Polished with sandpaper 600 and application of the metal primer Alloy Primer (Kuraray); Group JSP: Sandblasted with 100µm aluminum oxide; Group JCP: Sandblasted with 100mm aluminum oxide and treated with a metal Primer. The groups were cemented and stored in distilled water at 37ºC for 36 hours and submitted to the shear bond strength test. The mean and standard deviation (in Kgf/cm²) obtained for each group was: PSP 4.0/0.4; PCP 88.9/33.6; JSP 163.2/27.6; JCP 144.5/54.0. After the statistical analysis the authors concluded that: the highest values were obtained for the sandblasted groups (JSP, JCP), regardless of the primer application; the Alloy Primer increased the retention between the Rely X cement and the polished surface of the Co-Cr-Mo alloy, yet its bond strength was not greater than that obtained with sandblasting; all specimens showed adhesive failures in the tested interface.
Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc
2009-10-28
GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.
Sulzinski, Michael A; Wasilewski, Melissa A; Farrell, James C; Glick, David L
2009-07-01
It is an extraordinary challenge to offer an undergraduate laboratory course in virology that teaches hands-on, relevant molecular biology techniques using nonpathogenic models of human virus detection. To our knowledge, there exists no inexpensive kits or reagent sets that are appropriate for demonstrating real-time PCR (RT-PCR) in an undergraduate laboratory course in virology. Here we describe simple procedures for student exercises that demonstrate the PCR detection of an HIV target nucleic acid. Our procedures combine a commercially available kit for conventional PCR with a modification for RT-PCR using the same reagents in the kit, making it possible for an instructor with access to a LightCycler® instrument to implement a relevant student exercise on RT-PCR detection of HIV nucleic acid targets. This combination of techniques is useful for demonstrating and comparing conventional PCR amplification and detection with agarose gel electrophoresis, with real-time PCR over a series of three laboratory periods. The series of laboratory periods also is used to provide the foundation for teaching the concept of PCR primer design, optimization of PCR detection systems, and introduction to nucleic acid queries using NCBI-BLAST to find and identify primers, amplicons, and other potential amplification targets within the HIV viral genome. The techniques were successfully implemented at the Biology 364 undergraduate virology course at the University of Scranton during the Fall 2008 semester. The techniques are particularly targeted to students who intend to pursue either postgraduate technical employment or graduate studies in the molecular life sciences. Copyright © 2009 International Union of Biochemistry and Molecular Biology, Inc.
Grachev, M A; Zaychikov, E F; Ivanova, E M; Komarova, N I; Kutyavin, I V; Sidelnikova, N P; Frolova, I P
1984-01-01
Primer-dependent transcription by E. coli RNA polymerase on T7 promoter A2 has been studied. Synthetic deoxyribonucleotides complementary to the promoter over the region -8...+2 were taken as primers. A ribonucleoside residue was present at the 3'-end of some of these oligonucleotides. The octanucleotide complementary to the region -8...-1 appeared to be an active primer. Oligonucleotides having lengths from 3 to 6 nucleotide residues complementary to the promoter over the region -4...+2 also exhibited primer activity. The latter was some 5-10 times greater in the case of oligonucleotides having a ribonucleoside residue at the 3'-end. Oligonucleotides which on complementary binding do not reach the center of phosphodiester bond synthesis, as well as the decanucleotides (-8...+2) and octanucleotides (-6...+2) of both the ribo- and deoxyribo-series were inactive as primers. Images PMID:6390344
NASA Technical Reports Server (NTRS)
Bill, R. C.; Sovey, J.; Allen, G. P.
1981-01-01
The development of plasma-sprayed yttria stabilized zirconia (YSZ) ceramic turbine blade tip seal components is discussed. The YSZ layers are quite thick (0.040 to 0.090 in.). The service potential of seal components with such thick ceramic layers is cyclic thermal shock limited. The most usual failure mode is ceramic layer delamination at or very near the interface between the plasma sprayed YSZ layer and the NiCrAlY bondcoat. Deposition of a thin RF sputtered YSZ primer to the bondcoat prior to deposition of the thick plasma sprayed YSZ layer was found to reduce laminar cracking in cyclic thermal shock testing. The cyclic thermal shock life of one ceramic seal design was increased by a factor of 5 to 6 when the sputtered YSZ primer was incorporated. A model based on thermal response of plasma sprayed YSZ particles impinging on the bondcoat surface with and without the sputtered YSZ primer provides a basis for understanding the function of the primer.
BTSC VAPOR INSTRUSION PRIMER "VAPOR INTRUSION CONSIDERATION FOR REDEVELOPMENT"
This primer is designed for brownfields stakeholders concerned about vapor intrusion, including property owners, real estate developers, and contractors performing environmental site investigations. It provides an overview of the vapor intrusion issue and how it can impact the ap...
Steinmacher, D. A.; Krohn, N. G.; Dantas, A. C. M.; Stefenon, V. M.; Clement, C. R.; Guerra, M. P.
2007-01-01
Background and Aims The thin cell layer (TCL) technique is based on the use of very small explants and has allowed enhanced in vitro morphogenesis in several plant species. The present study evaluated the TCL technique as a procedure for somatic embryo production and plantlet regeneration of peach palm. Methods TCL explants from different positions in the shoot apex and leaf sheath of peach palm were cultivated in MS culture medium supplemented with 0–600 µm Picloram in the presence of activated charcoal. The production of primary calli and embryogenic calli was evaluated in these different conditions. Histological and amplified fragment length polymorphism (AFLP) analyses were conducted to study in vitro morphogenetic responses and genetic stability, respectively, of the regenerated plantlets. Key Results Abundant primary callus induction was observed from TCLs of the shoot meristem in culture media supplemented with 150–600 µm Picloram (83–97 %, respectively). The production of embryogenic calli depends on Picloram concentration and explant position. The best response observed was 43 % embryogenic callus production from shoot meristem TCL on 300 µm Picloram. In maturation conditions, 34 ± 4 somatic embryos per embryogenic callus were obtained, and 45·0 ± 3·4 % of these fully developed somatic embryos were converted, resulting in plantlets ready for acclimatization, of which 80 % survived. Histological studies revealed that the first cellular division events occurred in cells adjacent to vascular tissue, resulting in primary calli, whose growth was ensured by a meristematic zone. A multicellular origin of the resulting somatic embryos arising from the meristematic zone is suggested. During maturation, histological analyses revealed bipolarization of the somatic embryos, as well as the development of new somatic embryos. AFLP analyses revealed that 92 % of the regenerated plantlets were true to type. The use of TCL explants considerably improves the
Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.
Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won
2018-05-01
DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.
Krüger, Manuela; Stockinger, Herbert; Krüger, Claudia; Schüssler, Arthur
2009-01-01
* At present, molecular ecological studies of arbuscular mycorrhizal fungi (AMF) are only possible above species level when targeting entire communities. To improve molecular species characterization and to allow species level community analyses in the field, a set of newly designed AMF specific PCR primers was successfully tested. * Nuclear rDNA fragments from diverse phylogenetic AMF lineages were sequenced and analysed to design four primer mixtures, each targeting one binding site in the small subunit (SSU) or large subunit (LSU) rDNA. To allow species resolution, they span a fragment covering the partial SSU, whole internal transcribed spacer (ITS) rDNA region and partial LSU. * The new primers are suitable for specifically amplifying AMF rDNA from material that may be contaminated by other organisms (e.g., samples from pot cultures or the field), characterizing the diversity of AMF species from field samples, and amplifying a SSU-ITS-LSU fragment that allows phylogenetic analyses with species level resolution. * The PCR primers can be used to monitor entire AMF field communities, based on a single rDNA marker region. Their application will improve the base for deep sequencing approaches; moreover, they can be efficiently used as DNA barcoding primers.
Kim, Seong U; Batule, Bhagwan S; Mun, Hyoyoung; Byun, Ju-Young; Shim, Won-Bo; Kim, Min-Gon
2018-02-07
We have developed a novel strategy for the colorimetric detection of PCR products by utilizing a target-specific primer modified at the 5'-end with an anti-DNAzyme sequence. A single-stranded DNAzyme sequence folds into a G-quadruplex structure with hemin and shows strong peroxidase activity. When the complementary strand binds to the DNAzyme sequence, it blocks the formation of the G-quadraduplex structure and loses its peroxidase activity. In the presence of the target gene, PCR amplification proceeds, and anti-DNAzyme sequence modified primers present in the reaction mixture form a double strand through primer extension. Therefore, it does not block the DNAzyme sequence. Further, a colorimetric signal is generated by the addition of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) and H 2 O 2 at the end of the reaction. We have successfully detected a single copy of the HIV type 1 gag gene in buffer and 10 copies in human serum. The strategy developed could be used to detect DNA and RNA in complex biological samples by simple primer designing that includes DNAzyme and a DNA extended primer.
Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR
Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan
2002-01-01
AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381
Microsatellite primers for the Pacific Northwest conifer Callitropsis nootkatensis (Cupressaceae)
Tar N. Jennings; Brian J. Knaus; Katherine Alderman; Paul E. Hennon; David V. D’Amore; Richard. Cronn
2013-01-01
Microsatellite primers were developed for Nootka cypress ( Callitropsis nootkatensis ) to provide quantitative measures for gene conservation that can assist in guiding management decisions for a species experiencing climate-induced decline.
PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome
Sarika; Arora, Vasu; Iquebal, M. A.; Rai, Anil; Kumar, Dinesh
2013-01-01
Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on ‘three-tier architecture’ that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers’ search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/ PMID:23396298
PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome.
Sarika; Arora, Vasu; Iquebal, M A; Rai, Anil; Kumar, Dinesh
2013-01-01
Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on 'three-tier architecture' that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers' search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/
Children on Medication: A Primer for School Personnel.
ERIC Educational Resources Information Center
Gadow, Kenneth D.
Intended as a primer for school personnel, the book discusses children whose various disorders require them to be on medication, and describes the behavioral effects of these drugs along with their major side effects. Fundamental concepts in pharmacotherapy are reviewed, including dosage adjustment and side effects, and a brief introduction to the…
Komatsu, K; Mateus, S; Zucchi, R; Nascimento, F; Kudô, K
2012-06-01
Microsatellite primers developed for a given species are sometimes useful for another in the same genus and in other genera within the same family, making possible to search for pre-existing suitable primers in the databanks such as GenBank. We examined whether existing primers developed for Polistes could be used for Polistes satan Bequaert. We tested 50 microsatellite primers from three Polistes species and found that six microsatellite loci show polymorphism in size in P. satan. These six loci were highly polymorphic, having four to 15 alleles in P. satan with an expected heterozygosity of 0.525-0.832. These loci can be used to study parameters concerning genetic relatedness such as social interactions in colonies and genetic conflicts of interest among nestmate individuals.
Atwood-Moore, Angela; Yan, Kenneth; Judson, Robert L.; Levin, Henry L.
2006-01-01
The long terminal repeat retrotransposon Tf1 of Schizosaccharomyces pombe uses a unique mechanism of self priming to initiate reverse transcription. Instead of using a tRNA, Tf1 primes minus-strand synthesis with an 11-nucleotide RNA removed from the 5′ end of its own transcript. We tested whether the self primer of Tf1 was similar to tRNA primers in being removed from the cDNA by RNase H. Our analysis of Tf1 cDNA extracted from virus-like particles revealed the surprising observation that the dominant species of cDNA retained the self primer. This suggests that integration of the cDNA relies on mechanisms other than reverse transcription to remove the primer. PMID:16873283
Lead-free precussion primer mixes based on metastable interstitial composite (MIC) technology
Dixon, George P.; Martin, Joe A.; Thompson, Don
1998-01-01
A lead-free percussion primer composition and a percussion cup containing e composition. The lead-free percussion primer composition is comprised of a mixture of about 45 wt % aluminum powder having an outer coating of aluminum oxide and molybdenum trioxide powder or a mixture of about 50 wt % aluminum powder having an outer coating of aluminum oxide and polytetrafluoroethylene powder. The aluminum powder, molybdenum trioxide powder and polytetrafluoroethylene powder has a particle size of 0.1 .mu.m or less, more preferably a particle size of from about 200-500 angstroms.
Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko
2016-02-01
The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.
GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms.
David, Fabrice P A; Rougemont, Jacques; Deplancke, Bart
2017-01-04
GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
2006-08-01
Maneuver Ammunition Systems is acknowledged for continued support of this effort. This research was performed while the first author held a National...the ignition system (i.e., the primer in small-caliber guns, the primer and flashtube in medium-caliber guns, and the primer and igniter-tube in large...primer model that is compatible with the ARL- NGEN3 IB code is the subject of this report. The conventional ignition system for a large-caliber (120 mm
Method to amplify variable sequences without imposing primer sequences
Bradbury, Andrew M.; Zeytun, Ahmet
2006-11-14
The present invention provides methods of amplifying target sequences without including regions flanking the target sequence in the amplified product or imposing amplification primer sequences on the amplified product. Also provided are methods of preparing a library from such amplified target sequences.
Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.
Wu, Z; Nagano, I; Xu, D; Takahashi, Y
1997-03-01
Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.
Detection of canine distemper virus (CDV) through one step RT-PCR combined with nested PCR.
Kim, Y H; Cho, K W; Youn, H Y; Yoo, H S; Han, H R
2001-04-01
A one step reverse transcription PCR (RT-PCR) combined nested PCR was set up to increase efficiency in the diagnosis of canine distemper virus (CDV) infection after developement of nested PCR. Two PCR primer sets were designed based on the sequence of nucleocapsid gene of CDV Onderstepoort strain. One-step RT-PCR with the outer primer pair was revealed to detect 10(2) PFU/ml. The sensitivity was increased hundredfold using the one-step RT-PCR combined with the nested PCR. Specificity of the PCR was also confirmed using other related canine virus and peripheral blood mononuclear cells (PBMC) and body secretes of healthy dogs. Of the 51 blood samples from dogs clinically suspected of CD, 45 samples were revealed as positive by one-step RT-PCR combined with nested PCR. However, only 15 samples were identified as positive with a single one step RT-PCR. Therefore approximately 60% increase in the efficiency of the diagnosis was observed by the combined method. These results suggested that one step RT-PCR combined with nested PCR could be a sensitive, specific, and practical method for diagnosis of CDV infection.
Factor Scores, Structure and Communality Coefficients: A Primer
ERIC Educational Resources Information Center
Odum, Mary
2011-01-01
(Purpose) The purpose of this paper is to present an easy-to-understand primer on three important concepts of factor analysis: Factor scores, structure coefficients, and communality coefficients. Given that statistical analyses are a part of a global general linear model (GLM), and utilize weights as an integral part of analyses (Thompson, 2006;…
Adhesive bonding and the use of corrosion resistant primers. [for metal surface preparation
NASA Technical Reports Server (NTRS)
Hockridge, R. R.; Thibault, H. G.
1972-01-01
The use of an anti-corrosive primer has been shown to be essential to assure survival of a bonded structure in a hostile environment, particularly if a stress is to be applied to the adhesively bonded joint during the environmental exposure. For example, the Lockheed L-1011 TriStar assembly, after exhaustive evaluation tests specifies use of chromate filled inhibitive polysulfide sealants, and use of corrosion inhibiting adhesive primers prior to structural bonding with film adhesive.
Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P; Panitz, Frank; Bendixen, Christian; Nielsen, Rasmus; Willerslev, Eske
2007-02-14
The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources. We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences). Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis. We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%). Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial analyses