Sample records for aflp primer pairs

  1. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    PubMed

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  2. Hybridization in the section Mentha (Lamiaceae) inferred from AFLP markers.

    PubMed

    Gobert, V; Moja, S; Colson, M; Taberlet, P

    2002-12-01

    The amplified fragment length polymorphism (AFLP) method was used to evaluate genetic diversity and to assess genetic relationships within the section Mentha in order to clarify the taxonomy of several interspecific mint hybrids with molecular markers. To this end, genetic diversity of 62 Mentha accessions from different geographic origins, representing five species and three hybrids, was assessed. Three EcoRI/MseI AFLP primer combinations generated an average of 40 AFLP markers per primer combination, ranging in size from 50 to 500 base pairs (bp). The percentage of markers polymorphic ranged from 50% to 60% across all accessions studied. According to phenetic and cladistic analysis, the 62 mint accessions were grouped into two major clusters. Principal coordinates analysis separated species into well-defined groups, and clear relationships between species and hybrids could be described. Our AFLP analysis supports taxonomic classification established among Mentha species by conventional (morphological, cytological, and chemical) methods. It allows the assessment of phenetic relationships between species and the hybrids M. spicata and M. × piperita, largely cultivated all over the world for their menthol source, and provides new insights into the subdivision of M. spicata, based for the first time on molecular markers.

  3. A first linkage map of globe artichoke (Cynara cardunculus var. scolymus L.) based on AFLP, S-SAP, M-AFLP and microsatellite markers.

    PubMed

    Lanteri, S; Acquadro, A; Comino, C; Mauro, R; Mauromicale, G; Portis, E

    2006-05-01

    We present the first genetic maps of globe artichoke (Cynara cardunculus var. scolymus L. 2n=2x=34), constructed with a two-way pseudo-testcross strategy. A F1 mapping population of 94 individuals was generated between a late-maturing, non-spiny type and an early-maturing spiny type. The 30 AFLP, 13 M-AFLP and 9 S-SAP primer combinations chosen identified, respectively, 352, 38 and 41 polymorphic markers. Of 32 microsatellite primer pairs tested, 12 identified heterozygous loci in one or other parent, and 7 were fully informative as they segregated in both parents. The female parent map comprised 204 loci, spread over 18 linkage groups and spanned 1330.5 cM with a mean marker density of 6.5 cM. The equivalent figures for the male parent map were 180 loci, 17 linkage groups, 1239.4 and 6.9 cM. About 3% of the AFLP and AFLP-derived markers displayed segregation distortion with a P value below 0.01, and were not used for map construction. All the SSR loci were included in the linkage analysis, although one locus did show some segregation distortion. The presence of 78 markers in common to both maps allowed the alignment of 16 linkage groups. The maps generated provide a firm basis for the mapping of agriculturally relevant traits, which will then open the way for the application of a marker-assisted selection breeding strategy in this species.

  4. Genetics and phylogeny of genus Coilia in China based on AFLP markers

    NASA Astrophysics Data System (ADS)

    Yang, Qiaoli; Han, Zhiqiang; Sun, Dianrong; Xie, Songguang; Lin, Longshan; Gao, Tianxiang

    2010-07-01

    The taxonomy of Coilia has been extensively studied in China, and yet phylogenetic relationships among component taxa remain controversial. We used a PCR-based fingerprinting technique, amplified fragment length polymorphism (AFLP) to characterize and identify all four species of Coilia in China. We examined the genetic relationships of the four species of Coilia and a subspecies of Coilia nasus with AFLP. A total of 180 AFLP loci were generated from six primer combinations, of which 76.11% were polymorphic. The mean genetic distance between pairs of taxa ranged from 0.047 to 0.596. The neighbor-joining tree and UPGMA dendrogram resolved the investigated species into three separate lineages: (1) C. mystus, (2) C. grayii and (3) C. brachygnathus, C. nasus, and C. nasus taihuensis. Phylogenetic analysis of the AFLP data is inconsistent with current morphological taxonomic systems. The AFLP data indicated a close relationship among C. brachygnathus, C. nasus taihuensis, and C. nasus. Therefore, the two species described under Coilia ( C. brachygnathus and C. nasus taihuensis) are treated as synonyms of C. nasus.

  5. AFLP analysis of a worldwide collection of Didymella bryoniae.

    PubMed

    Kothera, Ronald T; Keinath, Anthony P; Dean, Ralph A; Farnham, Mark W

    2003-03-01

    Didymella bryoniae (anamorph Phoma cucurbitacearum) is an ascomycete that causes gummy stem blight, a foliar disease that occurs on cucurbits in greenhouses and fields throughout the world. In a previous study using RAPD analysis, little genetic diversity was found among isolates of D. bryoniae from New York and South Carolina, USA. Here we report the use of amplified fragment length polymorphism (AFLP) analysis to assess the genetic variation within a worldwide collection of D. bryoniae, 102 field and greenhouse isolates from ten states in the USA (California, Delaware, Florida, Georgia, Indiana, Maryland, Michigan, Oklahoma, South Carolina, and Texas) and seven other countries (Australia, Canada, China, Greece, Israel, Sweden, and The Netherlands) were examined. Seven different AFLP primer-pair combinations generated 450 bands, of which 134 were polymorphic (30%). Using cluster analysis, two groups and a total of seven subgroups were delineated. Representative isolates varied in their virulence on muskmelon and watermelon seedlings, but the degree of virulence was not strongly associated with AFLP groupings. However, isolates from the northern USA grouped separately from isolates originating from the southern USA.

  6. AFLP-based genetic diversity and its comparison with diversity based on SSR, SAMPL, and phenotypic traits in bread wheat.

    PubMed

    Roy, J K; Lakshmikumaran, M S; Balyan, H S; Gupta, P K

    2004-02-01

    Data on AFLP (eight primer pairs) and 14 phenotypic traits, collected on 55 elite and exotic bread wheat genotypes, were utilized for estimations of genetic diversity. We earlier used these 55 genotypes for a similar study using SSRs and SAMPL. As many as 615 scorable AFLP bands visualized included 287 (46.6%) polymorphic bands. The phenotypic traits included yield and its component traits, as well as physiomorphological traits like flag leaf area. Dendrograms were prepared using cluster analysis based on Jaccard's similarity coefficients in case of AFLP and on squared Euclidean distances in case of phenotypic traits. PCA was conducted using AFLP data and a PCA plot was prepared, which was compared with clustering patterns in two dendrograms, one each for AFLP and phenotypic traits. The results were also compared with published results that included studies conducted elsewhere using entirely different wheat germplasm and our own SSR and SAMPL studies based on the same 55 genotypes used in the present study. It was shown that molecular markers are superior to phenotypic traits and that AFLP and SAMPL are superior to other molecular markers for estimation of genetic diversity. On the basis of AFLP analysis and keeping in view the yield performance and stability, a pair of genotypes (E3876 and E677) was recommended for hybridization in order to develop superior cultivars.

  7. Species-specific AFLP markers for identification of Zingiber officinale, Z. montanum and Z. zerumbet (Zingiberaceae).

    PubMed

    Ghosh, S; Majumder, P B; Sen Mandi, S

    2011-02-08

    The Zingiber genus, which includes the herbs known as gingers, commonly used in cooking, is well known for its medicinal properties, as described in the Indian pharmacopoeia. Different members of this genus, although somewhat similar in morphology, differ widely in their pharmacological and therapeutic properties. The most important species of this genus, with maximal therapeutic properties, is Zingiber officinale (garden ginger), which is often adulterated with other less-potent Zingiber sp. There is an existing demand in the herbal drug industry for an authentication system for the Zingiber sp in order to facilitate their commercial use as genuine phytoceuticals. To this end, we used amplified fragment length polymorphism (AFLP) to produce DNA fingerprints for three Zingiber species. Sixteen collections (six of Z. officinale, five of Z. montanum, and five of Z. zerumbet) were used in the study. Seven selective primer pairs were found to be useful for all the accessions. A total of 837 fragments were produced by these primer pairs. Species-specific markers were identified for all three Zingiber species (91 for Z. officinale, 82 for Z. montanum, and 55 for Z. zerumbet). The dendogram analysis generated from AFLP patterns showed that Z. montanum and Z. zerumbet are phylogenetically closer to each other than to Z. officinale. The AFLP fingerprints of the Zingiber species could be used to authenticate Zingiber sp-derived drugs and to resolve adulteration-related problems faced by the commercial users of these herbs.

  8. Genetic structure of Pilosocereus gounellei (Cactaceae) as revealed by AFLP marker to guide proposals for improvement and restoration of degraded areas in Caatinga biome.

    PubMed

    Monteiro, E R; Strioto, D K; Meirelles, A C S; Mangolin, C A; Machado, M F P S

    2015-12-15

    Amplified fragment length polymorphism (AFLP) analysis was used to evaluate DNA polymorphism in Pilosocereus gounellei with the aim of differentiating samples grown in different Brazilian semiarid regions. Seven primer pairs were used to amplify 703 AFLP markers, of which 700 (99.21%) markers were polymorphic. The percentage of polymorphic markers ranged from 95.3% for the primer combination E-AAG/M-CTT to 100% for E-ACC/M-CAT, E-ACC/M-CAA, E-AGC/M-CAG, E-ACT/M-CTA, and E-AGG/M-CTG. The largest number of informative markers (126) was detected using the primer combination E-AAC/M-CTA. Polymorphism of the amplified DNA fragments ranged from 72.55% (in sample from Piauí State) to 82.79% (in samples from Rio Grande Norte State), with an average of 75.39%. Despite the high genetic diversity of AFLP markers in xiquexique, analysis using the STRUCTURE software identified relatively homogeneous clusters of xiquexique from the same location, indicating a differentiation at the molecular level, among the plant samples from different regions of the Caatinga biome. The AFLP methodology identified genetically homogeneous and contrasting plants, as well as plants from different regions with common DNA markers. Seeds from such plants can be used for further propagation of plants for establishment of biodiversity conservation units and restoration of degraded areas of the Caatinga biome.

  9. AFLP fingerprinting: an efficient technique for detecting genetic variation of Xanthomonas axonopodis pv. manihotis.

    PubMed

    Restrepo, S; Duque, M; Tohme, J; Verdier, V

    1999-01-01

    Xanthomonas axonopodis pv. manihotis (Xam) is the causative agent of cassava bacterial blight (CBB), a worldwide disease that is particularly destructive in South America and Africa. CBB is controlled essentially through the use of resistant varieties. To develop an appropriate disease management strategy, the genetic diversity of the pathogen's populations must be assessed. Until now, the genetic diversity of Xam was characterized by RFLP analyses using ribotyping, and plasmid and genomic Xam probes. We used AFLP (amplified fragment length polymorphism), a novel PCR-based technique, to characterize the genetic diversity of Colombian Xam isolates. Six Xam strains were tested with 65 AFLP primer combinations to identify the best selective primers. Eight primer combinations were selected according to their reproducibility, number of polymorphic bands and polymorphism detected between Xam strains. Forty-seven Xam strains, originating from different Colombian ecozones, were analysed with the selected combinations. Results obtained with AFLP are consistent with those obtained with RFLP, using plasmid DNA as a probe. Some primer combinations differentiated Xam strains that were not distinguished by RFLP analyses, thus AFLP fingerprinting allowed a better definition of the genetic relationships between Xam strains.

  10. Design factors that influence PCR amplification success of cross-species primers among 1147 mammalian primer pairs

    PubMed Central

    Housley, Donna JE; Zalewski, Zachary A; Beckett, Stephanie E; Venta, Patrick J

    2006-01-01

    Background Cross-species primers have been used with moderate success to address a variety of questions concerning genome structure, evolution, and gene function. However, the factors affecting their success have never been adequately addressed, particularly with respect to producing a consistent method to achieve high throughput. Using 1,147 mammalian cross-species primer pairs (1089 not previously reported), we tested several factors to determine their influence on the probability that a given target will amplify in a given species under a single amplification condition. These factors included: number of mismatches between the two species (the index species) used to identify conserved regions to which the primers were designed, GC-content of the gene and amplified region, CpG dinucleotides in the primer region, degree of encoded protein conservation, length of the primers, and the degree of evolutionary distance between the target species and the two index species. Results The amplification success rate for the cross-species primers was significantly influenced by the number of mismatches between the two index species (6–8% decrease per mismatch in a primer pair), the GC-content within the amplified region (for the dog, GC ≥ 50%, 56.9% amplified; GC<50%, 74.2% amplified), the degree of protein conservation (R2 = 0.14) and the relatedness of the target species to the index species. For the dog, 598 products of 930 primer pairs (64.3%) (excluding primers in which dog was an index species) were sequenced and shown to be the expected product, with an additional three percent producing the incorrect sequence. When hamster DNA was used with the single amplification condition in a microtiter plate-based format, 510 of 1087 primer pairs (46.9%) produced amplified products. The primer pairs are spaced at an average distance of 2.3 Mb in the human genome and may be used to produce up to several hundred thousand bp of species-specific sequence. Conclusion The most

  11. Comparison and Validation of Some ITS Primer Pairs Useful for Fungal Metabarcoding Studies

    PubMed Central

    Op De Beeck, Michiel; Lievens, Bart; Busschaert, Pieter; Declerck, Stéphan; Vangronsveld, Jaco; Colpaert, Jan V.

    2014-01-01

    Current metabarcoding studies aiming to characterize microbial communities generally rely on the amplification and sequencing of relatively short DNA regions. For fungi, the internal transcribed spacer (ITS) region in the ribosomal RNA (rRNA) operon has been accepted as the formal fungal barcode. Despite an increasing number of fungal metabarcoding studies, the amplification efficiency of primers is generally not tested prior to their application in metabarcoding studies. Some of the challenges that metabarcoding primers should overcome efficiently are the amplification of target DNA strands in samples rich in non-target DNA and environmental pollutants, such as humic acids, that may have been co-extracted with DNA. In the current study, three selected primer pairs were tested for their suitability as fungal metabarcoding primers. The selected primer pairs include two primer pairs that have been frequently used in fungal metabarcoding studies (ITS1F/ITS2 and ITS3/ITS4) and a primer pair (ITS86F/ITS4) that has been shown to efficiently amplify the ITS2 region of a broad range of fungal taxa in environmental soil samples. The selected primer pairs were evaluated in a 454 amplicon pyrosequencing experiment, real-time PCR (qPCR) experiments and in silico analyses. Results indicate that experimental evaluation of primers provides valuable information that could aid in the selection of suitable primers for fungal metabarcoding studies. Furthermore, we show that the ITS86F/ITS4 primer pair outperforms other primer pairs tested in terms of in silico primer efficiency, PCR efficiency, coverage, number of reads and number of species-level operational taxonomic units (OTUs) obtained. These traits push the ITS86F/ITS4 primer pair forward as highly suitable for studying fungal diversity and community structures using DNA metabarcoding. PMID:24933453

  12. Genetic Diversity of Hibiscus tiliaceus (Malvaceae) in China Assessed using AFLP Markers

    PubMed Central

    TANG, TIAN; ZHONG, YANG; JIAN, SHUGUANG; SHI, SUHUA

    2003-01-01

    Amplified fragment length polymorphism (AFLP) markers were used to investigate the genetic variations within and among nine natural populations of Hibiscus tiliaceus in China. DNA from 145 individuals was amplified with eight primer pairs. No polymorphisms were found among the 20 samples of a marginal population of recent origin probably due to a founder effect. Across the other 125 individuals, 501 of 566 bands (88·5 %) were polymorphic, and 125 unique AFLP phenotypes were observed. Estimates of genetic diversity agreed with life history traits of H. tiliaceus and geographical distribution. AMOVA analysis revealed that most genetic diversity resided within populations (84·8 %), which corresponded to results reported for outcrossing plants. The indirect estimate of gene flow based on ϕST was moderate (Nm = 1·395). Long-distance dispersal of floating seeds and local environments may play an important role in shaping the genetic diversity of the population and the genetic structure of this species. PMID:12930729

  13. A High-throughput AFLP-based Method for Constructing Integrated Genetic and Physical Maps: Progress Toward a Sorghum Genome Map

    PubMed Central

    Klein, Patricia E.; Klein, Robert R.; Cartinhour, Samuel W.; Ulanch, Paul E.; Dong, Jianmin; Obert, Jacque A.; Morishige, Daryl T.; Schlueter, Shannon D.; Childs, Kevin L.; Ale, Melissa; Mullet, John E.

    2000-01-01

    Sorghum is an important target for plant genomic mapping because of its adaptation to harsh environments, diverse germplasm collection, and value for comparing the genomes of grass species such as corn and rice. The construction of an integrated genetic and physical map of the sorghum genome (750 Mbp) is a primary goal of our sorghum genome project. To help accomplish this task, we have developed a new high-throughput PCR-based method for building BAC contigs and locating BAC clones on the sorghum genetic map. This task involved pooling 24,576 sorghum BAC clones (∼4× genome equivalents) in six different matrices to create 184 pools of BAC DNA. DNA fragments from each pool were amplified using amplified fragment length polymorphism (AFLP) technology, resolved on a LI-COR dual-dye DNA sequencing system, and analyzed using Bionumerics software. On average, each set of AFLP primers amplified 28 single-copy DNA markers that were useful for identifying overlapping BAC clones. Data from 32 different AFLP primer combinations identified ∼2400 BACs and ordered ∼700 BAC contigs. Analysis of a sorghum RIL mapping population using the same primer pairs located ∼200 of the BAC contigs on the sorghum genetic map. Restriction endonuclease fingerprinting of the entire collection of sorghum BAC clones was applied to test and extend the contigs constructed using this PCR-based methodology. Analysis of the fingerprint data allowed for the identification of 3366 contigs each containing an average of 5 BACs. BACs in ∼65% of the contigs aligned by AFLP analysis had sufficient overlap to be confirmed by DNA fingerprint analysis. In addition, 30% of the overlapping BACs aligned by AFLP analysis provided information for merging contigs and singletons that could not be joined using fingerprint data alone. Thus, the combination of fingerprinting and AFLP-based contig assembly and mapping provides a reliable, high-throughput method for building an integrated genetic and physical map

  14. Genetic analysis of floating Enteromorpha prolifera in the Yellow Sea with AFLP marker

    NASA Astrophysics Data System (ADS)

    Liu, Cui; Zhang, Jing; Sun, Xiaoyu; Li, Jian; Zhang, Xi; Liu, Tao

    2011-09-01

    Extremely large accumulation of green algae Enteromorpha prolifera floated along China' coastal region of the Yellow Sea ever since the summer of 2008. Amplified Fragment Length Polymorphism (AFLP) analysis was applied to assess the genetic diversity and relationships among E. prolifera samples collected from 9 affected areas of the Yellow Sea. Two hundred reproducible fragments were generated with 8 AFLP primer combinations, of which 194 (97%) were polymorphic. The average Nei's genetic diversity, the coefficiency of genetic differentiation (Gst), and the average gene flow estimated from Gst in the 9 populations were 0.4018, 0.6404 and 0.2807 respectively. Cluster analysis based on the unweighed pair group method with arithmetic averages (UPGMA) showed that the genetic relationships within one population or among different populations were all related to their collecting locations and sampling time. Large genetic differentiation was detected among the populations. The E. prolifera originated from different areas and were undergoing a course of mixing.

  15. Optimization of cDNA-AFLP experiments using genomic sequence data.

    PubMed

    Kivioja, Teemu; Arvas, Mikko; Saloheimo, Markku; Penttilä, Merja; Ukkonen, Esko

    2005-06-01

    cDNA amplified fragment length polymorphism (cDNA-AFLP) is one of the few genome-wide level expression profiling methods capable of finding genes that have not yet been cloned or even predicted from sequence but have interesting expression patterns under the studied conditions. In cDNA-AFLP, a complex cDNA mixture is divided into small subsets using restriction enzymes and selective PCR. A large cDNA-AFLP experiment can require a substantial amount of resources, such as hundreds of PCR amplifications and gel electrophoresis runs, followed by manual cutting of a large number of bands from the gels. Our aim was to test whether this workload can be reduced by rational design of the experiment. We used the available genomic sequence information to optimize cDNA-AFLP experiments beforehand so that as many transcripts as possible could be profiled with a given amount of resources. Optimization of the selection of both restriction enzymes and selective primers for cDNA-AFLP experiments has not been performed previously. The in silico tests performed suggest that substantial amounts of resources can be saved by the optimization of cDNA-AFLP experiments.

  16. AFLP marking and polymorphism among progenies of Gymnema sylvestre: an important medicinal plant of India.

    PubMed

    Osman, Magda Abbaker; Dhawan, Sunita Singh; Bahl, Janak Raj; Darokar, Mahendra P; Khanuja, Suman P S

    2011-11-01

    The level of polymorphism among twelve selected progenies of Gymnema sylvestre was investigated through AFLP markers by multiplexing PCR reactions using 64 (8x8) primer combinations. Fourteen primer combinations were selected as the most suitable combination for G. sylvestre. Analysis of the 12 progenies with these 14 primer pairs produced 1689 fragments of which 972 (57.5%) were polymorphic and 485 (28.7%) were unique to a particular genotype. The number of fragments produced by individual primer pairs was in the range of 55 to 225. Out of these, polymorphic fragments were in the range of 34 (E-ACC/M-CAC) to 157 (E-AGG/M-CAG) and unique bands observed were 8 (E-ACC / M-CAC) to 69 (E-AGG/M-CAC). Different primer combinations detected different levels of polymorphism, ranging from 33% (E-AGG/ M-CAC) to 69.8% (E-AGG/ M-CAC). From the observations, it appears that the primer combinations E-AGG/M-CAC, E-AGG/CTG, E-AGG/CAG and E-ACA/CAT were the most informative for the detection of polymorphism among the progenies compared with others, since they produced a high number of unique fragments. The similarity coefficient ranged from 0.212 to 0.731. High similarity was observed between progeny S8 and S9 (73%) and high divergence between progenies S3 and S11. Among the selected progeny, S9 was found to be the most similar to the parent (63%), while genotype S11 was the most distant (36.9%).

  17. Mapping of AFLP markers linked to seed coat colour loci in Brassica juncea (L.) Czern.

    PubMed

    Sabharwal, V; Negi, M S; Banga, S S; Lakshmikumaran, M

    2004-06-01

    Association mapping of the seed-coat colour with amplified fragment length polymorphism (AFLP) markers was carried out in 39 Brassica juncea lines. The lines had genetically diverse parentages and varied for seed-coat colour and other morphological characters. Eleven AFLP primer combinations were used to screen the 39 B. juncea lines, and a total of 335 polymorphic bands were detected. The bands were analysed for association with seed-coat colour using multiple regression analysis. This analysis revealed 15 markers associated with seed-coat colour, obtained with eight AFLP primer combinations. The marker E-ACA/M-CTG(350 )explained 69% of the variation in seed-coat colour. This marker along with markers E-AAC/M-CTC(235 )and E-AAC/M-CTA(250) explained 89% of the total variation. The 15 associated markers were validated for linkage with the seed-coat colour loci using a recombinant inbred line (RIL) mapping population. Bands were amplified with the eight AFLP primer combinations in 54 RIL progenies. Of the 15 associated markers, 11 mapped on two linkage groups. Eight markers were placed on linkage group 1 at a marker density of 6.0 cM, while the remaining three were mapped on linkage group 2 at a marker density of 3.6 cM. Marker E-ACA/M-CTG(350 )co-segregated with Gene1 controlling seed-coat colour; it was specific for yellow seed-coat colour and mapped to linkage group 1. Marker E-AAC/M-CTC(235) (AFLP8), which had been studied previously, was present on linkage group 2; it was specific for brown seed-coat colour. Since AFLP markers are not adapted for large-scale applications in plant breeding, it is important to convert these to sequence-characterised amplified region (SCAR) markers. Marker E-AAC/M-CTC(235) (AFLP8) had been previously converted into a SCAR. Work is in progress to convert the second of the linked markers, E-ACA/M-CTG(350), to a SCAR. The two linked AFLP markers converted to SCARs will be useful for developing yellow-seeded B. juncea lines by means of

  18. [Morphologic and AFLP analysis of relationships between tulip species Tulipa biebersteiniana (Liliaceae)].

    PubMed

    Kutlunina, N A; Polezhaeva, M A; Permiakova, M V

    2013-04-01

    In populations of four species of tulips, (Tulipa biebersteiniana, T. patens, T. scytica and T. riparia) from the Volgograd, Kurgansk, Orenburg, and Chelyabinsk regions and the Republic of Bashkortostan, genetic diversity was studied by means of morphological and AFLP analysis. A morphological analysis of seven quantitative and two qualitative criteria was carried out. Three selective EcoRI/MseI primer pairs allowed one to genotype 81 individuals from 13 tulip populations with 87 loci. The low level of variability by AFLP loci were revealed in all species, including T. biebersteiniana (P = 20.41%, UH(e) = 0.075), T. patens (26.97%, 0.082), T. scytica (27.53%, 0.086), and T. riparia (27.72%, 0.096). According to the AMOVA results, the variability proportion that characterizes the differences between the four Tulip species was lower (F(CT) = 0.235) than between populations within species (F(ST) = 0.439). Tulipa patens is well differentiated by means of Nei's distances, coordination, and analysis in the STRUCTURE program. An analysis in the STRUCTURE revealed four genetic groups of tulips that are not completely in accordance with the analyzed species. This acknowledges the presence of complicated genetic process in the tulip population.

  19. Identification on commercialized products of AFLP markers able to discriminate slow- from fast-growing chicken strains.

    PubMed

    Fumière, Olivier; Dubois, Marc; Grégoire, Dimitrie; Théwis, André; Berben, Gilbert

    2003-02-26

    The European chicken meat market is characterized by numerous quality marks: "Label de Qualité Wallon" in Belgium, "Label Rouge" in France, denominations of geographical origin, organic agriculture, etc. Most of those certified productions have specifications requiring the use of slow-growing chicken strains. The amplified fragment length polymorphism (AFLP) technique has been used to search molecular markers able to discriminate slow-growing chicken strains from fast-growing ones and to authenticate certified products. Two pairs of restriction enzymes (EcoRI/MseI and EcoRI/TaqI) and 121 selective primer combinations were tested on individual DNA samples from chicken products essentially in carcass form that were ascribed as belonging to either slow- or fast-growing strains. Within the resulting fingerprints, two fragments were identified as type-strains specific markers. One primer combination gives a band (333 bp) that is specific for slow-growing chickens, and another primer pair generates a band (372 bp) that was found to be characteristic of fast-growing chickens. The two markers were isolated, cloned, and sequenced. The effectiveness and the specificity of the two interesting determinants were assessed on individuals of two well-known strains (ISA 657 and Cobb 500) and on commercialized products coming from various origins.

  20. An AFLP-based genetic linkage map of channel catfish (Ictalurus punctatus) constructed by using an interspecific hybrid resource family.

    PubMed Central

    Liu, Zhanjiang; Karsi, Attila; Li, Ping; Cao, Dongfeng; Dunham, R

    2003-01-01

    Catfish is the major aquaculture species in the United States. The hybrid catfish produced by crossing channel catfish females with blue catfish males exhibit a number of desirable production traits, but their mass production has been difficult. To introduce desirable genes from blue catfish into channel catfish through introgression, a genetic linkage map is helpful. In this project, a genetic linkage map was constructed using amplified fragment length polymorphism (AFLP). A total of 607 AFLP markers were analyzed using 65 primer combinations and an interspecific backcross resource family. A total of 418 AFLP markers were assigned to 44 linkage groups. Among the remaining 189 markers, 101 were not used because of significant segregation distortion, 29 were unlinked, and 59 were eliminated because they span very large distances. The 418 AFLP markers covered 1593 cM Kosambi. The AFLP markers showed a high level of clustering that appears to be related to certain primer combinations. This linkage map will serve as the basis for mapping a greater number of markers to provide a map with high enough resolution for it to be useful for selective breeding programs using introgression. PMID:14573480

  1. SP-Designer: a user-friendly program for designing species-specific primer pairs from DNA sequence alignments.

    PubMed

    Villard, Pierre; Malausa, Thibaut

    2013-07-01

    SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php. © 2013 John Wiley & Sons Ltd.

  2. Development of a SCAR marker for male gametophyte of Gracilariopsis lemaneiformis based on AFLP technique

    NASA Astrophysics Data System (ADS)

    Zhou, Wei; Ding, Hongye; Sui, Zhenghong; Wang, Zhongxia; Wang, Jinguo

    2014-05-01

    The red alga Gracilariopsis lemaneiformis (Bory) is an economically valuable macroalgae. As a means to identify the sex of immature Gracilariopsis lemaneiformis, the amplified fragment length polymorphism (AFLP) technique was used to search for possible sex- or phase-related markers in male gametophytes, female gametophytes, and tetrasporophytes, respectively. Seven AFLP selective amplification primers were used in this study. The primer combination E-TG/M-CCA detected a specific band linked to male gametophytes. The DNA fragment was recovered and a 402-bp fragment was sequenced. However, no DNA sequence match was found in public databases. Sequence characterized amplified region (SCAR) primers were designed from the sequence to test the repeatability of the relationship to the sex, using 69 male gametophytes, 139 female gametophytes, and 47 tetrasporophytes. The test results demonstrate a good linkage and repeatability of the SCAR marker to sex. The SCAR primers developed in this study could reduce the time required for sex identification of Gracilariopsis lemaneiformis by four to six months. This can reduce both the time investment and number of specimens required in breeding experiments.

  3. Fluorescence-labeled methylation-sensitive amplified fragment length polymorphism (FL-MS-AFLP) analysis for quantitative determination of DNA methylation and demethylation status.

    PubMed

    Kageyama, Shinji; Shinmura, Kazuya; Yamamoto, Hiroko; Goto, Masanori; Suzuki, Koichi; Tanioka, Fumihiko; Tsuneyoshi, Toshihiro; Sugimura, Haruhiko

    2008-04-01

    The PCR-based DNA fingerprinting method called the methylation-sensitive amplified fragment length polymorphism (MS-AFLP) analysis is used for genome-wide scanning of methylation status. In this study, we developed a method of fluorescence-labeled MS-AFLP (FL-MS-AFLP) analysis by applying a fluorescence-labeled primer and fluorescence-detecting electrophoresis apparatus to the existing method of MS-AFLP analysis. The FL-MS-AFLP analysis enables quantitative evaluation of more than 350 random CpG loci per run. It was shown to allow evaluation of the differences in methylation level of blood DNA of gastric cancer patients and evaluation of hypermethylation and hypomethylation in DNA from gastric cancer tissue in comparison with adjacent non-cancerous tissue.

  4. Screening interspecific hybrids of Populus (P. ciliata x maximowiczii) using AFLP markers.

    PubMed

    Chauhan, N; Negi, M S; Sabharwal, V; Khurana, D K; Lakshmikumaran, M

    2004-03-01

    Hybrids of Populus ciliata x maximowiczii are very vigorous and outperform both the parents in growth performance and yield. Genetic evaluation of 24 of these interspecific hybrids along with the two mother trees ( Populus ciliata), and five male-parent ( Populus maximowiczii) genotypes was carried out using the AFLP marker assay. Eight AFLP primer combinations detected 428 markers, of which 280 (66%) were polymorphic. Genetic relationships within the samples were evaluated by generating the similarity matrix based on Jaccard's coefficient. The phenetic dendrograms, as well as the PCO plots, separated the hybrids and the two parent species into three distinct clusters. The hybrids grouped closer to the P. ciliata (female parent) cluster as compared to the P. maximowiczii (male parent) cluster. The hybrid cluster contained internal groupings, which correlated to some extent with growth performance. The four best performing hybrids (42m1, 65m1, 23m2, Cm2-5-20/91) formed a distinct sub-cluster. Data from a single primer combination was sufficient for distinguishing the hybrids from the parents and assigning paternity. The hybrids showed 22 markers that were absent in P. ciliata but were monomorphically present in all the hybrids, suggesting outcrossing and common paternity. Further, these 22 markers were found in all the P. maximowiczii genotypes confirming it as the male parent. These male-specific markers can be converted to SCAR markers and used for rapid screening of the P.ciliata x maximowiczii hybrids. The primer combination E-AAC x M-CAA was identified as most suitable for ascertaining true hybridity. AFLP proves to be a useful tool for screening of P. ciliata x maximowiczii hybrids at the early stages of development.

  5. Characterization of ten date palm (Phoenix dactylifera L.) cultivars from Saudi Arabia using AFLP and ISSR markers.

    PubMed

    Sabir, Jamal S M; Abo-Aba, Salah; Bafeel, Sameera; Zari, Talal A; Edris, Sherif; Shokry, Ahmed M; Atef, Ahmed; Gadalla, Nour O; Ramadan, Ahmed M; Al-Kordy, Magdy A; El-Domyati, Fotouh M; Jansen, Robert K; Bahieldin, Ahmed

    2014-01-01

    Date palm is the most economically important plant in the Middle East due to its nutritionally valuable fruit. The development of accurate DNA fingerprints to characterize cultivars and the detection of genetic diversity are of great value for breeding programs. The present study explores the usefulness of ISSR and AFLP molecular markers to detect relationships among 10 date palm (Phoenix dactylifera L.) cultivars from Saudi Arabia. Thirteen ISSR primers and six AFLP primer combinations were examined. The level of polymorphism among cultivars for ISSRs ranged from 20% to 100% with an average of 85%. Polymorphism levels for AFLPs ranged from 63% to 84% with an average of 76%. The total number of cultivar-specific markers was 241, 208 of which were generated from AFLP analysis. AJWA cultivar had the highest number of cultivar-specific ISSR markers, whereas DEK, PER, SUK-Q, SHA and MOS-H cultivars had the lowest. RAB and SHA cultivars had the most and least AFLP cultivar-specific markers, respectively. The highest pairwise similarity indices for ISSRs, AFLPs and combined markers were 84% between DEK (female) and PER (female), 81% between SUK-Q (male) and RAB (male), and 80% between SUK-Q (male) and RAB (male), respectively. The lowest similarity indices were 65% between TAB (female) and SUK-Q (male), 67% between SUK-A (female) and SUK-Q (male), and 67% between SUK-A (female) and SUK-Q (male). Cultivars of the same sex had higher pairwise similarities than those between cultivars of different sex. The Neighbor-Joining (NJ) tree generated from the ISSR dataset was not well resolved and bootstrap support for resolved nodes in the tree was low. AFLP and combined data generated completely resolved trees with high levels of bootstrap support. In conclusion, AFLP and ISSR approaches enabled discrimination among 10 date palm cultivars of from Saudi Arabia, which will provide valuable information for future improvement of this important crop. Copyright © 2013 Académie des

  6. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

    PubMed Central

    Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666

  7. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.

    PubMed

    Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.

  8. Identification of AFLP markers linked to fertility restorer genes for tournefortii cytoplasmic male-sterility system in Brassica napus.

    PubMed

    Janeja, H S; Banga, S S; Lakshmikumaran, M

    2003-06-01

    The tournefortii cytoplasmic male-sterility system is being used as a method of pollination control to develop hybrids in Brassica napus. Genetic analyses have indicated that two dominant genes, one major ( Rft1) and another minor ( Rft2), were required to achieve complete fertility restoration. Though the major gene ( Rft1) can cause complete fertility restoration on its own, its expression was significantly enhanced in the presence of the minor gene ( Rft2). In the absence of Rft1, Rft2 caused only partial fertility restoration. We used a pair of near-isogenic lines (NILs), differing for the presence/absence of Rf genes, to identify AFLP markers linked to fertility restorer genes. A total of 64 EcoRI/ MseI primer combinations were surveyed which produced 3,225 bands, of which 19 (0.006%) were polymorphic between parental NILs. Primer combinations which led to the identification of polymorphic bands present in fertile parental NILs were used for assaying a mapping population of 70 F(2) plants for determining the segregation pattern of markers. Initial screening resulted in the identification of five AFLP markers. The recombination analyses of these AFLP markers revealed that at least two (EACC/MCTT(105), EAAG/MCTC(80)) were present in the same linkage group along with the Rf loci. Marker EACC/MCTT(105) was separated from the major gene ( Rft1) by a distance of 18.1 cM, while it was 33.2 cM away from the minor fertility restorer gene ( Rft2). Another marker EAAG/MCTC(80) was also located adjacent to Rft1 at a distance of 18.1 cM, but on other side. Identification of flanking markers (EACC/MCTT(105), EAAG/MCTC(80)) for the major fertility restorer gene ( Rft1) provides a crucial component for marker-assisted selection and map-based cloning of the restorer genes, and can hence be used to construct elite restorer genotypes.

  9. Improved coverage of cDNA-AFLP by sequential digestion of immobilized cDNA.

    PubMed

    Weiberg, Arne; Pöhler, Dirk; Morgenstern, Burkhard; Karlovsky, Petr

    2008-10-13

    cDNA-AFLP is a transcriptomics technique which does not require prior sequence information and can therefore be used as a gene discovery tool. The method is based on selective amplification of cDNA fragments generated by restriction endonucleases, electrophoretic separation of the products and comparison of the band patterns between treated samples and controls. Unequal distribution of restriction sites used to generate cDNA fragments negatively affects the performance of cDNA-AFLP. Some transcripts are represented by more than one fragment while other escape detection, causing redundancy and reducing the coverage of the analysis, respectively. With the goal of improving the coverage of cDNA-AFLP without increasing its redundancy, we designed a modified cDNA-AFLP protocol. Immobilized cDNA is sequentially digested with several restriction endonucleases and the released DNA fragments are collected in mutually exclusive pools. To investigate the performance of the protocol, software tool MECS (Multiple Enzyme cDNA-AFLP Simulation) was written in Perl. cDNA-AFLP protocols described in the literature and the new sequential digestion protocol were simulated on sets of cDNA sequences from mouse, human and Arabidopsis thaliana. The redundancy and coverage, the total number of PCR reactions, and the average fragment length were calculated for each protocol and cDNA set. Simulation revealed that sequential digestion of immobilized cDNA followed by the partitioning of released fragments into mutually exclusive pools outperformed other cDNA-AFLP protocols in terms of coverage, redundancy, fragment length, and the total number of PCRs. Primers generating 30 to 70 amplicons per PCR provided the highest fraction of electrophoretically distinguishable fragments suitable for normalization. For A. thaliana, human and mice transcriptome, the use of two marking enzymes and three sequentially applied releasing enzymes for each of the marking enzymes is recommended.

  10. Highly effective sequencing whole chloroplast genomes of angiosperms by nine novel universal primer pairs.

    PubMed

    Yang, Jun-Bo; Li, De-Zhu; Li, Hong-Tao

    2014-09-01

    Chloroplast genomes supply indispensable information that helps improve the phylogenetic resolution and even as organelle-scale barcodes. Next-generation sequencing technologies have helped promote sequencing of complete chloroplast genomes, but compared with the number of angiosperms, relatively few chloroplast genomes have been sequenced. There are two major reasons for the paucity of completely sequenced chloroplast genomes: (i) massive amounts of fresh leaves are needed for chloroplast sequencing and (ii) there are considerable gaps in the sequenced chloroplast genomes of many plants because of the difficulty of isolating high-quality chloroplast DNA, preventing complete chloroplast genomes from being assembled. To overcome these obstacles, all known angiosperm chloroplast genomes available to date were analysed, and then we designed nine universal primer pairs corresponding to the highly conserved regions. Using these primers, angiosperm whole chloroplast genomes can be amplified using long-range PCR and sequenced using next-generation sequencing methods. The primers showed high universality, which was tested using 24 species representing major clades of angiosperms. To validate the functionality of the primers, eight species representing major groups of angiosperms, that is, early-diverging angiosperms, magnoliids, monocots, Saxifragales, fabids, malvids and asterids, were sequenced and assembled their complete chloroplast genomes. In our trials, only 100 mg of fresh leaves was used. The results show that the universal primer set provided an easy, effective and feasible approach for sequencing whole chloroplast genomes in angiosperms. The designed universal primer pairs provide a possibility to accelerate genome-scale data acquisition and will therefore magnify the phylogenetic resolution and species identification in angiosperms. © 2014 John Wiley & Sons Ltd.

  11. Identification of molecular markers associated with fruit traits in olive and assessment of olive core collection with AFLP markers and fruit traits.

    PubMed

    Ipek, M; Seker, M; Ipek, A; Gul, M K

    2015-03-31

    The purpose of this study was to characterize olive core collection with amplified fragment length polymorphism (AFLP) markers and fruit traits and to determine AFLP markers significantly associated with these fruit characters in olive. A total of 168 polymorphic AFLP markers generated by five primer combinations and nine fruit traits were used to characterize relationships between 18 olive cultivars. Although all olive cultivars were discriminated from each other by either AFLP markers (<0.75 similarity level) or fruit traits, clustering based on the AFLP markers and fruit traits was not significantly correlated (r = 0.13). Partial clustering of olive cultivars by AFLP markers according to their geographical origin was observed. Associations of AFLP markers with fruits were determined using a multiple-regression analysis with stepwise addition of AFLP markers. Significant associations between eight AFLP markers and fruit traits were identified. While five AFLP markers demonstrated significant negative correlation with fruit and stone weight, width and length and total polyphenols (P < 0.05), three AFLP markers displayed significant positive correlation with α-tocopherol and γ-tocopherol (P < 0.01). This is the first report on the association of molecular markers with fruit traits in olive. Molecular markers associated with morphological and agronomic traits could be utilized for the breeding of olive cultivars. However, the association power of these markers needs to be confirmed in larger populations, and highly correlated markers should then be converted to PCR-based DNA markers such as sequence-characterized amplified region markers for better utilization.

  12. Phylogenetic relationships in the genus Leontopodium (Asteraceae: Gnaphalieae) based on AFLP data

    PubMed Central

    SAFER, STEFAN; TREMETSBERGER, KARIN; GUO, YAN-PING; KOHL, GUDRUN; SAMUEL, MARY R.; STUESSY, TOD F.; STUPPNER, HERMANN

    2012-01-01

    The genus Leontopodium comprises 30–41 species. The centre of diversity is the Sino-Himalayan region in south-western China, where about 15 species occur. The two species native to Europe, L. alpinum (known as the common ‘Edelweiss’) and L. nivale, are part of the cultural heritage of the people living there. Despite its importance, very little is known about the systematics of the genus. Because recent molecular studies have shown that species within this genus are closely related and difficult to distinguish with rDNA and cpDNA data, we used AFLPs to obtain a more detailed understanding of the phylogeny of the genus. Our main aims were as follows: (1) to clarify species relationships within the genus; and (2) to reveal information about the biogeography of the genus. We used AFLPs with six primer combinations to investigate 216 individuals in 38 populations of 16 different species. With AFLPs, we were able to recognize 10 different groups, all of which had strong bootstrap support. These results were also congruent with the morphology-based taxonomy of the genus. Most private and rare fragments were found in the Yunnan region (south-western China) relative to Europe and Mongolia/central China, suggesting a long-lasting in situ history of populations in the centre of diversity of the genus. Our results illustrate the utility of AFLPs to resolve phylogenetic relationships between these closely related species. PMID:23258943

  13. Evaluation of six primer pairs targeting the nuclear rRNA operon for characterization of arbuscular mycorrhizal fungal (AMF) communities using 454 pyrosequencing.

    PubMed

    Van Geel, Maarten; Busschaert, Pieter; Honnay, Olivier; Lievens, Bart

    2014-11-01

    In the last few years, 454 pyrosequencing-based analysis of arbuscular mycorrhizal fungal (AMF; Glomeromycota) communities has tremendously increased our knowledge of the distribution and diversity of AMF. Nonetheless, comparing results between different studies is difficult, as different target genes (or regions thereof) and primer combinations, with potentially dissimilar specificities and efficacies, are being utilized. In this study we evaluated six primer pairs that have previously been used in AMF studies (NS31-AM1, AMV4.5NF-AMDGR, AML1-AML2, NS31-AML2, FLR3-LSUmBr and Glo454-NDL22) for their use in 454 pyrosequencing based on both an in silico approach and 454 pyrosequencing of AMF communities from apple tree roots. Primers were evaluated in terms of (i) in silico coverage of Glomeromycota fungi, (ii) the number of high-quality sequences obtained, (iii) selectivity for AMF species, (iv) reproducibility and (v) ability to accurately describe AMF communities. We show that primer pairs AMV4.5NF-AMDGR, AML1-AML2 and NS31-AML2 outperformed the other tested primer pairs in terms of number of Glomeromycota reads (AMF specificity and coverage). Additionally, these primer pairs were found to have no or only few mismatches to AMF sequences and were able to consistently describe AMF communities from apple roots. However, whereas most high-quality AMF sequences were obtained for AMV4.5NF-AMDGR, our results also suggest that this primer pair favored amplification of Glomeraceae sequences at the expense of Ambisporaceae, Claroideoglomeraceae and Paraglomeraceae sequences. Furthermore, we demonstrate the complementary specificity of AMV4.5NF-AMDGR with AML1-AML2, and of AMV4.5NF-AMDGR with NS31-AML2, making these primer combinations highly suitable for tandem use in covering the diversity of AMF communities. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. The uses of AFLP for detecting DNA polymorphism, genotype identification and genetic diversity between yeasts isolated from Mexican agave-distilled beverages and from grape musts.

    PubMed

    Flores Berrios, E P; Alba González, J F; Arrizon Gaviño, J P; Romano, P; Capece, A; Gschaedler Mathis, A

    2005-01-01

    The objectives were to determine the variability and to compare the genetic diversity obtained using amplified fragment length polymorphism (AFLP) markers in analyses of wine, tequila, mezcal, sotol and raicilla yeasts. A molecular characterization of yeasts isolated from Mexican agave musts, has been performed by AFLP marker analysis, using reference wine strains from Italian and South African regions. A direct co-relation between genetic profile, origin and fermentation process of strains was found especially in strains isolated from agave must. In addition, unique molecular markers were obtained for all the strains using six combination primers, confirming the discriminatory power of AFLP markers. This is the first report of molecular characterization between yeasts isolated from different Mexican traditional agave-distilled beverages, which shows high genetic differences with respect to wine strains.

  15. cDNA-AFLP analysis reveals differential gene expression in compatible interaction of wheat challenged with Puccinia striiformis f. sp. tritici

    PubMed Central

    Wang, Xiaojie; Tang, Chunlei; Zhang, Gang; Li, Yingchun; Wang, Chenfang; Liu, Bo; Qu, Zhipeng; Zhao, Jie; Han, Qingmei; Huang, Lili; Chen, Xianming; Kang, Zhensheng

    2009-01-01

    Background Puccinia striiformis f. sp. tritici is a fungal pathogen causing stripe rust, one of the most important wheat diseases worldwide. The fungus is strictly biotrophic and thus, completely dependent on living host cells for its reproduction, which makes it difficult to study genes of the pathogen. In spite of its economic importance, little is known about the molecular basis of compatible interaction between the pathogen and wheat host. In this study, we identified wheat and P. striiformis genes associated with the infection process by conducting a large-scale transcriptomic analysis using cDNA-AFLP. Results Of the total 54,912 transcript derived fragments (TDFs) obtained using cDNA-AFLP with 64 primer pairs, 2,306 (4.2%) displayed altered expression patterns after inoculation, of which 966 showed up-regulated and 1,340 down-regulated. 186 TDFs produced reliable sequences after sequencing of 208 TDFs selected, of which 74 (40%) had known functions through BLAST searching the GenBank database. Majority of the latter group had predicted gene products involved in energy (13%), signal transduction (5.4%), disease/defence (5.9%) and metabolism (5% of the sequenced TDFs). BLAST searching of the wheat stem rust fungus genome database identified 18 TDFs possibly from the stripe rust pathogen, of which 9 were validated of the pathogen origin using PCR-based assays followed by sequencing confirmation. Of the 186 reliable TDFs, 29 homologous to genes known to play a role in disease/defense, signal transduction or uncharacterized genes were further selected for validation of cDNA-AFLP expression patterns using qRT-PCR analyses. Results confirmed the altered expression patterns of 28 (96.5%) genes revealed by the cDNA-AFLP technique. Conclusion The results show that cDNA-AFLP is a reliable technique for studying expression patterns of genes involved in the wheat-stripe rust interactions. Genes involved in compatible interactions between wheat and the stripe rust pathogen

  16. DNA Methylation and Methylation Polymorphism in Genetically Stable In vitro Regenerates of Jatropha curcas L. Using Methylation-Sensitive AFLP Markers.

    PubMed

    Rathore, Mangal S; Jha, Bhavanath

    2016-03-01

    The present investigation aimed to evaluate the degree and pattern of DNA methylation using methylation-sensitive AFLP (MS-AFLP) markers in genetically stable in vitro regenerates of Jatropha curcas L.. The genetically stable in vitro regenerates were raised through direct organogenesis via enhanced axillary shoot bud proliferation (Protocol-1) and in vitro-derived leaf regeneration (Protocol-2). Ten selective combinations of MS-AFLP primers produced 462 and 477 MS-AFLP bands in Protocol-1 (P-1) and Protocol-2 (P-2) regenerates, respectively. In P-1 regenerates, 15.8-31.17 % DNA was found methylated with an average of 25.24 %. In P-2 regenerates, 15.93-32.7 % DNA was found methylated with an average of 24.11 %. Using MS-AFLP in P-1 and P-2 regenerates, 11.52-25.53 % and 13.33-25.47 % polymorphism in methylated DNA was reported, respectively. Compared to the mother plant, P-1 regenerates showed hyper-methylation while P-2 showed hypo-methylation. The results clearly indicated alternation in degree and pattern of DNA methylation; hence, epigenetic instability in the genetically stable in vitro regenerates of J. curcas, developed so far using two different regeneration systems and explants of two different origins. The homologous nucleotide fragments in genomes of P-1 and P-2 regenerates showing methylation re-patterning might be involved in immediate adaptive responses and developmental processes through differential regulation of transcriptome under in vitro conditions.

  17. Genetic analyses of captive Alala (Corvus hawaiiensis) using AFLP analyses

    USGS Publications Warehouse

    Jarvi, Susan I.; Bianchi, Kiara R.

    2006-01-01

    affected by the mutation rate at microsatellite loci, thus introducing a bias. Also, the number of loci that can be studied is frequently limited to fewer than 10. This theoretically represents a maximum of one marker for each of 10 chromosomes. Dominant markers like AFLP allow a larger fraction of the genome to be screened. Large numbers of loci can be screened by AFLP to resolve very small individual differences that can be used for identification of individuals, estimates of pairwise relatedness and, in some cases, for parentage analyses. Since AFLP is a dominant marker (can not distinguish between +/+ homozygote versus +/- heterozygote), it has limitations for parentage analyses. Only when both parents are homozygous for the absence of alleles (-/-) and offspring show a presence (+/+ or +/-) can the parents be excluded. In this case, microsatellites become preferable as they have the potential to exclude individual parents when the other parent is unknown. Another limitation of AFLP is that the loci are generally less polymorphic (only two alleles/locus) than microsatellite loci (often >10 alleles/locus). While generally fewer than 10 highly polymorphic microsatellite loci are enough to exclude and assign parentage, it might require up to 100 or more AFLP loci. While there are pros and cons to different methodologies, the total number of loci evaluated by AFLP generally offsets the limitations imposed due to the dominant nature of this approach and end results between methods are generally comparable. Overall objectives of this study were to evaluate the level of genetic diversity in the captive population of Alala, to compare genetic data with currently available pedigree information, and to determine the extent of relatedness of mating pairs and among founding individuals.

  18. Genetic Comparison of B. Anthracis and its Close Relatives Using AFLP and PCR Analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jackson, P.J.; Hill, K.K.; Laker, M.T.

    1999-02-01

    cannot be rapidly generated by other means. AFLP sample analysis quickly generates a very large amount of molecular information about microbial genomes. However, this information cannot be analyzed rapidly using manual methods. The authors are developing a large archive of electronic AFLP signatures that is being used to identify isolates collected from medical, veterinary, forensic and environmental samples. They are also developing the computational packages necessary to rapidly and unambiguously analyze the AFLP profiles and conduct a phylogenetic comparison of these data relative to information already in the database. They will use this archive and the associated algorithms to determine the species identity of previously uncharacterized isolates and place them phylogenetically relative to other microbes based on their AFLP signatures. This study provides significant new information about microbes with environmental, veterinary and medical significance. This information can be used in further studies to understand the relationships among these species and the factors that distinguish them from one another. It should also allow identification of unique factors that contribute to important microbial traits including pathogenicity and virulence. They are also using AFLP data to identify, isolate and sequence DNA fragments that are unique to particular microbial species and strains. The fragment patterns and sequence information provide insights into the complexity and organization of bacterial genomes relative to one another. They also provide the information necessary for development of species-specific PCR primers that can be used to interrogate complex samples for the presence of B. anthracis, other microbial pathogens or their remnants.« less

  19. AFLP-Based Analysis of Genetic Diversity, Population Structure, and Relationships with Agronomic Traits in Rice Germplasm from North Region of Iran and World Core Germplasm Set.

    PubMed

    Sorkheh, Karim; Masaeli, Mohammad; Chaleshtori, Maryam Hosseini; Adugna, Asfaw; Ercisli, Sezai

    2016-04-01

    Analysis of the genetic diversity and population structure of crops is very important for use in breeding programs and for genetic resources conservation. We analyzed the genetic diversity and population structure of 47 rice genotypes from diverse origins using amplified fragment length polymorphism (AFLP) markers and morphological characters. The 47 genotypes, which were composed of four populations: Iranian native varieties, Iranian improved varieties, International Rice Research Institute (IRRI) rice varieties, and world rice collections, were analyzed using ten primer combinations. A total of 221 scorable bands were produced with an average of 22.1 alleles per pair of primers, of which 120 (54.30%) were polymorphic. The polymorphism information content (PIC) values varied from 0.32 to 0.41 with an average of 0.35. The high percentage of polymorphic bands (%PB) was found to be 64.71 and the resolving power (R p) collections were 63.36. UPGMA clustering based on numerical data from AFLP patterns clustered all 47 genotypes into three large groups. The genetic similarity between individuals ranged from 0.54 to 0.94 with an average of 0.74. Population genetic tree showed that Iranian native cultivars formed far distant cluster from the other populations, which may indicate that these varieties had minimal genetic change over time. Analysis of molecular variance (AMOVA) revealed that the largest proportion of the variation (84%) to be within populations showing the inbreeding nature of rice. Therefore, Iranian native varieties (landraces) may have unique genes, which can be used for future breeding programs and there is a need to conserve this unique diversity. Furthermore, crossing of Iranian genotypes with the genetically distant genotypes in the other three populations may result in useful combinations, which can be used as varieties and/or lines for future rice breeding programs.

  20. Genetic diversity analysis of isolates belonging to the Photobacterium phosphoreum species group collected from salmon products using AFLP fingerprinting.

    PubMed

    Jérôme, Marc; Macé, Sabrina; Dousset, Xavier; Pot, Bruno; Joffraud, Jean-Jacques

    2016-01-18

    An accurate amplified fragment length polymorphism (AFLP) method, including three primer sets for the selective amplification step, was developed to display the phylogenetic position of Photobacterium isolates collected from salmon products. This method was efficient for discriminating the three species Photobacterium phosphoreum, Photobacterium iliopiscarium and Photobacterium kishitanii, until now indistinctly gathered in the P. phosphoreum species group known to be strongly responsible for seafood spoilage. The AFLP fingerprints enabled the isolates to be separated into two main clusters that, according to the type strains, were assigned to the two species P. phosphoreum and P. iliopiscarium. P. kishitanii was not found in the collection. The accuracy of the method was validated by using gyrB-gene sequencing and luxA-gene PCR amplification, which confirmed the species delineation. Most of the isolates of each species were clonally distinct and even those that were isolated from the same source showed some diversity. Moreover, this AFLP method may be an excellent tool for genotyping isolates in bacterial communities and for clarifying our knowledge of the role of the different members of the Photobacterium species group in seafood spoilage. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. miPrimer: an empirical-based qPCR primer design method for small noncoding microRNA

    PubMed Central

    Kang, Shih-Ting; Hsieh, Yi-Shan; Feng, Chi-Ting; Chen, Yu-Ting; Yang, Pok Eric; Chen, Wei-Ming

    2018-01-01

    MicroRNAs (miRNAs) are 18–25 nucleotides (nt) of highly conserved, noncoding RNAs involved in gene regulation. Because of miRNAs’ short length, the design of miRNA primers for PCR amplification remains a significant challenge. Adding to the challenge are miRNAs similar in sequence and miRNA family members that often only differ in sequences by 1 nt. Here, we describe a novel empirical-based method, miPrimer, which greatly reduces primer dimerization and increases primer specificity by factoring various intrinsic primer properties and employing four primer design strategies. The resulting primer pairs displayed an acceptable qPCR efficiency of between 90% and 110%. When tested on miRNA families, miPrimer-designed primers are capable of discriminating among members of miRNA families, as validated by qPCR assays using Quark Biosciences’ platform. Of the 120 miRNA primer pairs tested, 95.6% and 93.3% were successful in amplifying specifically non-family and family miRNA members, respectively, after only one design trial. In summary, miPrimer provides a cost-effective and valuable tool for designing miRNA primers. PMID:29208706

  2. Development of AFLP and RAPD markers linked to a locus associated with twisted growth in corkscrew willow (Salix matsudana 'Tortuosa').

    PubMed

    Lin, Juan; Gunter, Lee E; Harding, Scott A; Kopp, Richard F; McCord, Rachel P; Tsai, Chung-Jui; Tuskan, Gerald A; Smart, Lawrence B

    2007-11-01

    Salix matsudana Koidz. cultivar 'Tortuosa' (corkscrew willow) is characterized by extensive stem bending and curling of leaves. To investigate the genetic basis of this trait, controlled crosses were made between a corkscrew female (S. matsudana 'Tortuosa') and a straight-stemmed, wild-type male (Salix alba L. Clone 99010). Seventy-seven seedlings from this family (ID 99270) were grown in the field for phenotypic observation. Among the progeny, 39 had straight stems and leaves and 38 had bent stems and curled leaves, suggesting that a dominant allele at a single locus controls this phenotype. As a first step in characterizing the locus, we searched for amplified fragment length polymorphism (AFLP) and randomly amplified polymorphic DNA (RAPD) markers linked to the tortuosa allele using bulked segregant analysis. Samples of DNA from 10 corkscrew individuals were combined to produce a corkscrew pool, and DNA from 10 straight progeny was combined to make a wild-type pool. Sixty-four AFLP primer combinations and 640 RAPD primers were screened to identify marker bands amplified from the corkscrew parent and progeny pool, but not from the wild-type parent or progeny pool. An AFLP marker and a RAPD marker linked to and flanking the tortuosa locus were placed on a preliminary linkage map constructed based on segregation among the 77 progeny. Sectioning and analysis of shoot tips revealed that the corkscrew phenotype is associated with vascular cell collapse, smaller cell size in regions near the cambium and less developed phloem fibers than in wild-type progeny. Identification of a gene associated with this trait could lead to greater understanding of the control of normal stem development in woody plants.

  3. Genetic variability in Brazilian Capsicum baccatum germplasm collection assessed by morphological fruit traits and AFLP markers

    PubMed Central

    Giacomin, Renata M.; Ruas, Paulo M.; Ruas, Eduardo A.; Barbieri, Rosa L.; Rodrigues, Rosana

    2018-01-01

    Capsicum baccatum is one of the main pepper species grown and consumed in South America. In Brazil, it is commonly cultivated by family farmers, using mostly the genotypes bishop's hat genotypes (locally cambuci) and red chili pepper (dedo-de-moça). This study had the objective of characterizing 116 C. baccatum accessions from different regions of Brazil, based on morphological fruit descriptors and AFLP (Amplified Fragment Length Polymorphisms) markers. Broad phenotypic variability among the C. baccatum accessions was detected when using morphological fruit descriptors. The Ward modified location model (Ward-MLM) discriminated five groups, based mainly on fruit shape. Six combinations of AFLP primers detected polymorphism in 97.93% of the 2466 identified bands, indicating the high genetic variability in the accessions. The UPGMA coincided with the Bayesian clustering analysis and three large groups were formed, separating the wild variety C. baccatum var. praetermissum from the other accessions. There was no relation between genetic distance and geographical origin of the accessions, probably due to the intense exchange of fruits and seeds between farmers. Morphological descriptors used together with AFLP markers proved efficient in detecting the levels of genetic variability among the accessions maintained in the germplasm collections. These results can be used as an additional source of helpful information to be exploited in C. baccatum breeding programs. PMID:29758023

  4. Plastid primers for angiosperm phylogenetics and phylogeography.

    PubMed

    Prince, Linda M

    2015-06-01

    PCR primers are available for virtually every region of the plastid genome. Selection of which primer pairs to use is second only to selection of the genic region. This is particularly true for research at the species/population interface. Primer pairs for 130 regions of the chloroplast genome were evaluated in 12 species distributed across the angiosperms. Likelihood of amplification success was inferred based upon number and location of mismatches to target sequence. Intraspecific sequence variability was evaluated under three different criteria in four species. Many published primer pairs should work across all taxa sampled, with the exception of failure due to genomic reorganization events. Universal barcoding primers were the least likely to work (65% success). The list of most variable regions for use within species has little in common with the lists identified in prior studies. Published primer sequences should amplify a diversity of flowering plant DNAs, even those designed for specific taxonomic groups. "Universal" primers may have extremely limited utility. There was little consistency in likelihood of amplification success for any given publication across lineages or within lineage across publications.

  5. AFLP analysis of genetic diversity and phylogenetic relationships of Brassica oleracea in Ireland.

    PubMed

    El-Esawi, Mohamed A; Germaine, Kieran; Bourke, Paula; Malone, Renee

    2016-01-01

    Brassica oleracea L. is one of the most economically important vegetable crop species of the genus Brassica L. This species is threatened in Ireland, without any prior reported genetic studies. The use of this species is being very limited due to its imprecise phylogeny and uncompleted genetic characterisation. The main objective of this study was to assess the genetic diversity and phylogenetic relationships of a set of 25 Irish B. oleracea accessions using the powerful amplified fragment length polymorphism (AFLP) technique. A total of 471 fragments were scored across all the 11 AFLP primer sets used, out of which 423 (89.8%) were polymorphic and could differentiate the accessions analysed. The dendrogram showed that cauliflowers were more closely related to cabbages than kales were, and accessions of some cabbage types were distributed among different clusters within cabbage subgroups. Approximately 33.7% of the total genetic variation was found among accessions, and 66.3% of the variation resided within accessions. The total genetic diversity (HT) and the intra-accessional genetic diversity (HS) were 0.251 and 0.156, respectively. This high level of variation demonstrates that the Irish B. oleracea accessions studied should be managed and conserved for future utilisation and exploitation in food and agriculture. In conclusion, this study addressed important phylogenetic questions within this species, and provided a new insight into the inclusion of four accessions of cabbages and kales in future breeding programs for improving varieties. AFLP markers were efficient for assessing genetic diversity and phylogenetic relationships in Irish B. oleracea species. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  6. Neuraminidase Subtyping of Avian Influenza Viruses with PrimerHunter-Designed Primers and Quadruplicate Primer Pools

    PubMed Central

    Huang, Yanyan; Khan, Mazhar; Măndoiu, Ion I.

    2013-01-01

    We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers. PMID:24312367

  7. DNA damage and genetic methylation changes caused by Cd in Arabidopsis thaliana seedlings.

    PubMed

    Li, Zhaoling; Liu, Zhihong; Chen, Ruijuan; Li, Xiaojun; Tai, Peidong; Gong, Zongqiang; Jia, Chunyun; Liu, Wan

    2015-09-01

    Amplified fragment length polymorphism (AFLP) and methylation-sensitive amplification polymorphism (MASP) techniques are sensitive to deoxyribonucleic acid (DNA) damage and genetic methylation, respectively. Using these 2 techniques, Arabidopsis thaliana cultured with 0 mg/L (control), 0.5 mg/L, 1.5 mg/L, and 5.0 mg/L Cd(2+) for 16 d was used to analyze the DNA damage and methylation changes as a result of cadmium (Cd). The DNA was amplified by 14 AFLP primer pairs and 13 MSAP primer combinations. In the AFLP experiment, 62 polymorphic sites were found in the patterns of 11 primer combinations and a total of 1116 fragments were obtained in these patterns. There were no polymorphic bands in the remaining 3 pairs. The proportions of polymorphic sites in the 0.5-mg/L Cd(2+) and 5.0-mg/L Cd(2+) treatments were significantly different. Seven polymorphic fragments were then separated and successfully sequenced, yielding 6 nucleobase substitutions and 1 nucleobase deletion. Similarly, in the MSAP experiment, the MSAP% and number of demethylated-type bands were unchanged after Cd treatment, but the number of methylated-type bands was increased significantly in the 5.0-mg/L Cd(2+) treatment group, a finding that may be associated with the AFLP results. The polymorphic bands were also sequenced and the functions of their homologous genes were determined. The DNA damage and methylation changes may be the primary cause of certain pathology changes as a result of Cd uptake in plants. © 2015 SETAC.

  8. AFLP analysis of Cynodon dactylon (L.) Pers. var. dactylon genetic variation.

    PubMed

    Wu, Y Q; Taliaferro, C M; Bai, G H; Anderson, M P

    2004-08-01

    Cynodon dactylon (L.) Pers. var. dactylon (common bermudagrass) is geographically widely distributed between about lat 45 degrees N and lat 45 degrees S, penetrating to about lat 53 degrees N in Europe. The extensive variation of morphological and adaptive characteristics of the taxon is substantially documented, but information is lacking on DNA molecular variation in geographically disparate forms. Accordingly, this study was conducted to assess molecular genetic variation and genetic relatedness among 28 C. dactylon var. dactylon accessions originating from 11 countries on 4 continents (Africa, Asia, Australia, and Europe). A fluorescence-labeled amplified fragment length polymorphism (AFLP) DNA profiling method was used to detect the genetic diversity and relatedness. On the basis of 443 polymorphic AFLP fragments from 8 primer combinations, the accessions were grouped into clusters and subclusters associating with their geographic origins. Genetic similarity coefficients (SC) for the 28 accessions ranged from 0.53 to 0.98. Accessions originating from Africa, Australia, Asia, and Europe formed major groupings as indicated by cluster and principal coordinate analysis. Accessions from Australia and Asia, though separately clustered, were relatively closely related and most distantly related to accessions of European origin. African accessions formed two distant clusters and had the greatest variation in genetic relatedness relative to accessions from other geographic regions. Sampling the full extent of genetic variation in C. dactylon var. dactylon would require extensive germplasm collection in the major geographic regions of its distributional range.

  9. Application of AFLP fingerprint analysis for studying the biodiversity of Streptococcus thermophilus.

    PubMed

    Lazzi, Camilla; Bove, Claudio Giorgio; Sgarbi, Elisa; Gatti, Monica; Monica, Gatti; La Gioia, Federica; Torriani, Sandra; Sandra, Torriani; Neviani, Erasmo

    2009-10-01

    Streptococcus thermophilus is a lactic acid bacteria (LAB) widely used in milk fermentation processes as a starter culture. In this work the genetic diversity of S. thermophilus isolates from different sources was analyzed using Amplified Fragment Length Polymorphism fingerprinting (AFLP). Since this is the first report that indicates the application of AFLP in order to study genotypic polymorphism in S. thermophilus species, an optimization of experimental conditions was carried out to decide the optimal AFLP analysis protocol. Furthermore the fingerprinting resolutions of AFLP and RAPD (Random Amplified Polymorphic DNA) were evaluated and compared. The overall data suggest that genotypic characterization performed by AFLP provide a better view of microbial diversity of S. thermophilus, indicating that RAPD is less discriminating than AFLP. The successful use of AFLP analysis in the characterization of S. thermophilus strains reported in this study suggests the potential uses for this technique to define the whole-genome diversity of each specific strain, as an alternative to the fingerprinting methods used till now.

  10. AFLP-based genetic diversity assessment of commercially important tea germplasm in India.

    PubMed

    Sharma, R K; Negi, M S; Sharma, S; Bhardwaj, P; Kumar, R; Bhattachrya, E; Tripathi, S B; Vijayan, D; Baruah, A R; Das, S C; Bera, B; Rajkumar, R; Thomas, J; Sud, R K; Muraleedharan, N; Hazarika, M; Lakshmikumaran, M; Raina, S N; Ahuja, P S

    2010-08-01

    India has a large repository of important tea accessions and, therefore, plays a major role in improving production and quality of tea across the world. Using seven AFLP primer combinations, we analyzed 123 commercially important tea accessions representing major populations in India. The overall genetic similarity recorded was 51%. No significant differences were recorded in average genetic similarity among tea populations cultivated in various geographic regions (northwest 0.60, northeast and south both 0.59). UPGMA cluster analysis grouped the tea accessions according to geographic locations, with a bias toward China or Assam/Cambod types. Cluster analysis results were congruent with principal component analysis. Further, analysis of molecular variance detected a high level of genetic variation (85%) within and limited genetic variation (15%) among the populations, suggesting their origin from a similar genetic pool.

  11. Genetic variation and relationship among and within Withania species as revealed by AFLP markers.

    PubMed

    Negi, M S; Singh, A; Lakshmikumaran, M

    2000-12-01

    Withania somnifera is an important medicinal plant, and its anticancerous properties have been attributed to various classes of withanolide compounds. The objective of the present study was to investigate the inter- and intraspecific genetic variation present in 35 individuals of W. somnifera and 5 individuals of W. coagulans using AFLP (amplified fragment length polymorphism) marker technique. The information about genetic variation determined from AFLP data for 40 individuals was employed to estimate similarity matrix value based on Jaccard's coefficient. The similarity values were further used to construct a phenetic dendrogram revealing the genetic relationships. The dendrogram generated by UPGMA (unweighted pair group method of arithmetic averages) distinguished W. somnifera from W. coagulans and formed two major clusters. These two main clusters shared a similarity coefficient of 0.3, correlating with the high level of polymorphism detected. The dendrogram further separated W. somnifera into three subclasses corresponding to Kashmiri and Nagori groups and an intermediate type. The AFLP profile of Kashmiri individuals was distinct from that of the Nagori group of plants. The intermediate genotype was distinct as it shared bands with both the Kashmiri and Nagori individuals, even though it was identified as a Kashmiri morphotype. Furthermore, the intermediate type shared a similarity coefficient of 0.8 with the Kashmiri individuals. The present work revealed low levels of variation within a population though high levels of polymorphism were detected between Nagori and Kashmiri populations. The ability of AFLP markers for efficient and rapid detection of genetic variations at the species as well as intraspecific level qualifies it as an efficient tool for estimating genetic similarity in plant species and effective management of genetic resources.

  12. AFLP and MS-AFLP Analysis of the Variation within Saffron Crocus (Crocus sativus L.) Germplasm

    PubMed Central

    Busconi, Matteo; Colli, Licia; Sánchez, Rosa Ana; Santaella, Marcela; De-Los-Mozos Pascual, Marcelino; Santana, Omar; Roldán, Marta; Fernández, José-Antonio

    2015-01-01

    The presence and extent of genetic variation in saffron crocus are still debated, as testified by several contradictory articles providing contrasting results about the monomorphism or less of the species. Remarkably, phenotypic variations have been frequently observed in the field, such variations are usually unstable and can change from one growing season to another. Considering that gene expression can be influenced both by genetic and epigenetic changes, epigenetics could be a plausible cause of the alternative phenotypes. In order to obtain new insights into this issue, we carried out a molecular marker analysis of 112 accessions from the World Saffron and Crocus Collection. The accessions were grown for at least three years in the same open field conditions. The same samples were analysed using Amplified Fragment Length Polymorphism (AFLP) and Methyl Sensitive AFLP in order to search for variation at the genetic (DNA sequence) and epigenetic (cytosine methylation) level. While the genetic variability was low (4.23% polymorphic peaks and twelve (12) effective different genotypes), the methyl sensitive analysis showed the presence of high epigenetic variability (33.57% polymorphic peaks and twenty eight (28) different effective epigenotypes). The pattern obtained by Factorial Correspondence Analysis of AFLP and, in particular, of MS-AFLP data was consistent with the geographical provenance of the accessions. Very interestingly, by focusing on Spanish accessions, it was observed that the distribution of the accessions in the Factorial Correspondence Analysis is not random but tends to reflect the geographical origin. Two clearly defined clusters grouping accessions from the West (Toledo and Ciudad Real) and accessions from the East (Cuenca and Teruel) were clearly recognised. PMID:25885113

  13. Genetic Variation among Isolates of Sarcocystis neurona, the Agent of Protozoal Myeloencephalitis, as Revealed by Amplified Fragment Length Polymorphism Markers

    PubMed Central

    Elsheikha, H. M.; Schott, H. C.; Mansfield, L. S.

    2006-01-01

    Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelphis virginiana), and one isolate was from a cowbird (Molothrus ater). Additionally, four outgroup taxa were also fingerprinted. Nine primer pairs were used to generate AFLP patterns, with a total number of amplified fragments ranging from 30 to 60, depending on the isolate and primers tested. Based on the presence/absence of amplified AFLP fragments and pairwise similarity values, all the S. neurona isolates tested were clustered in one monophyletic group. No significant correlation could be found between genomic similarity and host origin of the S. neurona isolates. AFLP revealed significant intraspecific genetic variations, and S. neurona appeared as a highly variable species. Furthermore, linkage disequilibrium analysis suggested that S. neurona populations within Michigan have an intermediate type of population structure that includes characteristics of both clonal and panamictic population structures. AFLP is a reliable molecular technique that has provided one of the most informative approaches to ascertain phylogenetic relationships in S. neurona and its closest relatives, allowing them to be clustered by relative similarity using band matching and unweighted pair group method with arithmetic mean analysis, which may be applicable to other related protozoal species. PMID:16714575

  14. Genetic variation among isolates of Sarcocystis neurona, the agent of protozoal myeloencephalitis, as revealed by amplified fragment length polymorphism markers.

    PubMed

    Elsheikha, H M; Schott, H C; Mansfield, L S

    2006-06-01

    Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelphis virginiana), and one isolate was from a cowbird (Molothrus ater). Additionally, four outgroup taxa were also fingerprinted. Nine primer pairs were used to generate AFLP patterns, with a total number of amplified fragments ranging from 30 to 60, depending on the isolate and primers tested. Based on the presence/absence of amplified AFLP fragments and pairwise similarity values, all the S. neurona isolates tested were clustered in one monophyletic group. No significant correlation could be found between genomic similarity and host origin of the S. neurona isolates. AFLP revealed significant intraspecific genetic variations, and S. neurona appeared as a highly variable species. Furthermore, linkage disequilibrium analysis suggested that S. neurona populations within Michigan have an intermediate type of population structure that includes characteristics of both clonal and panamictic population structures. AFLP is a reliable molecular technique that has provided one of the most informative approaches to ascertain phylogenetic relationships in S. neurona and its closest relatives, allowing them to be clustered by relative similarity using band matching and unweighted pair group method with arithmetic mean analysis, which may be applicable to other related protozoal species.

  15. An evaluation of a new approach to the regeneration of Helichrysum italicum (Roth) G. Don, and the molecular characterization of the variation among sets of differently derived regenerants.

    PubMed

    Perrini, Rosaria; Alba, Vittorio; Ruta, Claudia; Morone-Fortunato, Irene; Blanco, Antonio; Montemurro, Cinzia

    2009-01-01

    A protocol for the induction of regeneration from leaves of Helichrysum italicum was established. Calli were found to form on the basal medium only when it was supplemented with thidiazuron (TDZ) alone or in combination with naphthalene acetic acid (NAA), with a percentage ranking of at least 80%. The hormone-free medium showed the highest percentage of shoot regeneration (62%) even though no callus formed. AFLP markers were employed to verify tissue culture-induced variation in the regenerated plantlets obtained by direct shoot regeneration or the indirect shoot regeneration process (callus formation). Seven out of the eleven AFLP primer pairs yielded polymorphic patterns. The average number of fragments per primer pair was 64.1. Singletons were represented by 12 (2.7%) fragments. Student's T-test was performed both on the average number of shared fragments and on the nucleotide diversity, and no significant statistical difference was observed between the two regeneration treatments.

  16. Metabolic Profiles and cDNA-AFLP Analysis of Salvia miltiorrhiza and Salvia castanea Diel f. tomentosa Stib

    PubMed Central

    Liang, Xiao; Liang, Zongsuo; Zhang, Meixiang; Shen, Shuang; Liu, Hongyun; Liu, Yan

    2012-01-01

    Plants of the genus Salvia produce various types of phenolic compounds and tanshinones which are effective for treatment of coronary heart disease. Salvia miltiorrhiza and S. castanea Diels f. tomentosa Stib are two important members of the genus. In this study, metabolic profiles and cDNA-AFLP analysis of four samples were employed to identify novel genes potentially involved in phenolic compounds and tanshinones biosynthesis, including the red roots from the two species and two tanshinone-free roots from S. miltiorrhiza. The results showed that the red roots of S. castanea Diels f. tomentosa Stib produced high contents of rosmarinic acid (21.77 mg/g) and tanshinone IIA (12.60 mg/g), but low content of salvianolic acid B (1.45 mg/g). The red roots of S. miltiorrhiza produced high content of salvianolic acid B (18.69 mg/g), while tanshinones accumulation in this sample was much less than that in S. castanea Diels f. tomentosa Stib. Tanshinones were not detected in the two tanshinone-free samples, which produced high contents of phenolic compounds. A cDNA-AFLP analysis with 128 primer pairs revealed that 2300 transcript derived fragments (TDFs) were differentially expressed among the four samples. About 323 TDFs were sequenced, of which 78 TDFs were annotated with known functions through BLASTX searching the Genbank database and 14 annotated TDFs were assigned into secondary metabolic pathways through searching the KEGGPATHWAY database. The quantitative real-time PCR analysis indicated that the expression of 9 TDFs was positively correlated with accumulation of phenolic compounds and tanshinones. These TDFs additionally showed coordinated transcriptional response with 6 previously-identified genes involved in biosynthesis of tanshinones and phenolic compounds in S. miltiorrhiza hairy roots treated with yeast extract. The sequence data in the present work not only provided us candidate genes involved in phenolic compounds and tanshinones biosynthesis but also gave us

  17. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    PubMed

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  18. An analysis on DNA fingerprints of thirty papaya cultivars (Carica papaya L.), grown in Thailand with the use of amplified fragment length polymorphisms technique.

    PubMed

    Ratchadaporn, Janthasri; Sureeporn, Katengam; Khumcha, U

    2007-09-15

    The experiment was carried out at the Department of Horticulture, Ubon Ratchathani University, Ubon Ratchathani province, Northeast Thailand during June 2002 to May 2003 aims to identify DNA fingerprints of thirty papaya cultivars with the use of Amplified Fragment Length Polymorphisms (AFLP) technique. Papaya cultivars were collected from six different research centers in Thailand. Papaya plants of each cultivar were grown under field conditions up to four months then leaf numbers 2 and 3 of each cultivar (counted from top) were chosen for DNA extraction and the samples were used for AFLP analysis. Out of 64 random primers being used, 55 pairs gave an increase in DNA bands but only 12 pairs of random primers were randomly chosen for the final analysis of the experiment. The results showed that AFLP markers gave Polymorphic Information Contents (PIC) of three ranges i.e., AFLP markers of 235 lied on a PIC range of 0.003-0.05, 47 for a PIC range of 0.15-0.20 and 12 for a PIC range of 0.35-0.40. The results on dendrogram cluster analysis revealed that the thirty papaya cultivars were classified into six groups i.e., (1) Kaeg Dum and Malador (2) Kaeg Nuan (3) Pakchong and Solo (4) Taiwan (5) Co Coa Hai Nan and (6) Sitong. Nevertheless, in spite of the six papaya groups all papaya cultivars were genetically related to each other where diversity among the cultivars was not significantly found.

  19. Analysis of genetic diversity in banana cultivars (Musa cvs.) from the South of Oman using AFLP markers and classification by phylogenetic, hierarchical clustering and principal component analyses*

    PubMed Central

    Opara, Umezuruike Linus; Jacobson, Dan; Al-Saady, Nadiya Abubakar

    2010-01-01

    Banana is an important crop grown in Oman and there is a dearth of information on its genetic diversity to assist in crop breeding and improvement programs. This study employed amplified fragment length polymorphism (AFLP) to investigate the genetic variation in local banana cultivars from the southern region of Oman. Using 12 primer combinations, a total of 1094 bands were scored, of which 1012 were polymorphic. Eighty-two unique markers were identified, which revealed the distinct separation of the seven cultivars. The results obtained show that AFLP can be used to differentiate the banana cultivars. Further classification by phylogenetic, hierarchical clustering and principal component analyses showed significant differences between the clusters found with molecular markers and those clusters created by previous studies using morphological analysis. Based on the analytical results, a consensus dendrogram of the banana cultivars is presented. PMID:20443211

  20. Genetic diversity of populations and clones of Rhopilema esculentum in China based on AFLP analysis

    NASA Astrophysics Data System (ADS)

    Qiao, Hongjin; Liu, Xiangquan; Zhang, Xijia; Jiang, Haibin; Wang, Jiying; Zhang, Limin

    2013-03-01

    Amplified fragment length polymorphisms (AFLP) markers were developed to assess the genetic variation of populations and clones of Rhopilema esculentum Kishinouye (Scyphozoa, Rhizostomatidae). One hundred and seventy-nine loci from 56 individuals of two hatchery populations and two wild populations were genotyped with five primer combinations. The polymorphic ratio, Shannon's diversity index and average heterozygosity were 70.3%, 0.346 and 0.228 for the white hatchery population, 74.3%, 0.313, and 0.201 for the red hatchery population, 79.3%, 0.349, and 0.224 for the Jiangsu wild population, and 74.9%, 0.328 and 0.210 for the Penglai wild population, respectively. Thus, all populations had a relatively high level of genetic diversity. A specific band was identified that could separate the white from the red hatchery population. There was 84.85% genetic differentiation within populations. Individual cluster analysis using unweighted pair-group method with arithmetic mean (UPGMA) suggested that hatchery populations and wild populations could be divided. For the hatchery populations, the white and red populations clustered separately; however, for the wild populations, Penglai and Jiangsu populations clustered together. The genetic diversity at the clone level was also determined. Our data suggest that there are relatively high genetic diversities within populations but low genetic differentiation between populations, which may be related to the long-term use of germplasm resources from Jiangsu Province for artificial seeding and releasing. These findings will benefit the artificial seeding and conservation of the germplasm resources.

  1. Genetic diversity in populations of Isatis glauca Aucher ex Boiss. ssp. from Central Anatolia in Turkey, as revealed by AFLP analysis.

    PubMed

    Özbek, Özlem; Görgülü, Elçin; Yıldırımlı, Şinasi

    2013-12-01

    Isatidae L. is a complex and systematically difficult genus in Brassicaceae. The genus displays great morphological polymorphism, which makes the classification of species and subspecies difficult as it is observed in Isatis glauca Aucher ex Boiss. The aim of this study is characterization of the genetic diversity in subspecies of Isatis glauca Aucher ex Boiss. distributed widely in Central Anatolia, in Turkey by using Amplified Fragment Length Polymorphism (AFLP) technique. Eight different Eco RI-Mse I primer combinations produced 805 AFLP loci, 793 (98.5%) of which were polymorphic in 67 accessions representing nine different populations. The data obtained by AFLP was computed with using GDA (Genetic Data Analysis) and STRUCTURE (version 2.3.3) software programs for population genetics. The mean proportion of the polymorphic locus (P), the mean number of alleles (A), the number of unique alleles (U) and the mean value of gene diversity (He) were 0.59, 1.59, 20, and 0.23 respectively. The coancestry coefficient (ϴ) was 0.24. The optimal number of K was identified as seven. The principal component analysis (PCA) explained 85.61% of the total genetic variation. Isatis glauca ssp. populations showed a high level of genetic diversity, and the AFLP analysis revealed that high polymorphism and differentiated subspecies could be used conveniently for population genetic studies. The principal coordinate analysis (PCoA) based on the dissimilarity matrix, the dendrogram drawn with UPGMA method and STRUCTURE cluster analysis distinguished the accessions successfully. The accessions formed distinctive population structures for populations AA, AB, E, K, and S. Populations AG1 and AG2 seemed to have similar genetic content, in addition, in both populations several hybrid individuals were observed. The accessions did not formed distinctive population structures for both populations AI and ANP. Consequently, Ankara province might be the area, where species Isatis glauca Aucher

  2. Evaluation of different primers for PCR-DGGE analysis of cheese-associated enterococci.

    PubMed

    Lorbeg, Petra Mohar; Majhenic, Andreja Canzek; Rogelj, Irena

    2009-08-01

    Enterococci represent an important part of bacterial microbiota in different types of artisanal cheeses, made from either raw or pasteurized milk. Polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE) of ribosomal DNA is currently one of the most frequently used fingerprinting method to study diversity and dynamics of microbial communities and also a tool for microbial identification. Among several primer pairs for DGGE analysis published so far, six primer pairs amplifying different variable regions of 16S rDNA were selected and applied in our DGGE analysis of 12 species belonging to genus Enterococcus and eight other bacterial species often found in cheeses (seven lactobacilli and one Lactoccocus lactis). When DGGE procedures were optimized, the same set of primers was used for DGGE analysis of five cheese samples. Our study demonstrates that the use of different primer pairs generate significant differences in DGGE analysis of enterococcal population, consequently, appropriate primers regarding the purpose of analysis can be selected. For differentiation and identification of pure enterococcal isolates, primer pair P1V1/P2V1 showed the most promising results since all 12 enterococcal isolates gave distinctive DGGE fingerprints, but with multiple bands patterns; therefore, these primers do not seem to be appropriate for identification of enterococcal species in mixed cultures. Use of primer pairs HDA1/HDA2 and V3f/V3r amplifying V3 region showed better potential for detection and identification of enterococci in mixed communities, but since some bacterial species showed the same fingerprint, for clear identification combination of DGGE and some other method (e.g. species specific PCR) or combined DGGE analysis using two primer pairs generating distinctive results should be used.

  3. RUCS: rapid identification of PCR primers for unique core sequences.

    PubMed

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik; Kaya, Hülya; Lund, Ole

    2017-12-15

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs for the targets in silico. Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin resistance gene. Three of the predicted pairs were chosen for experimental validation using PCR and gel electrophoresis. All three pairs successfully produced an amplicon with the target length for the samples containing mcr-1 and no amplification products were produced for the negative samples. The novel methods presented in this manuscript can reduce the time needed to identify target sequences, and provide a quick virtual PCR validation to eliminate time wasted on ambiguously binding primers. Source code is freely available on https://bitbucket.org/genomicepidemiology/rucs. Web service is freely available on https://cge.cbs.dtu.dk/services/RUCS. mcft@cbs.dtu.dk. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  4. PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.

    PubMed

    Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt

    2017-01-24

    The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com).

  5. MRPrimerV: a database of PCR primers for RNA virus detection

    PubMed Central

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Kim, Doyun; Koo, JaeHyung; Kim, Min-Soo

    2017-01-01

    Many infectious diseases are caused by viral infections, and in particular by RNA viruses such as MERS, Ebola and Zika. To understand viral disease, detection and identification of these viruses are essential. Although PCR is widely used for rapid virus identification due to its low cost and high sensitivity and specificity, very few online database resources have compiled PCR primers for RNA viruses. To effectively detect viruses, the MRPrimerV database (http://MRPrimerV.com) contains 152 380 247 PCR primer pairs for detection of 1818 viruses, covering 7144 coding sequences (CDSs), representing 100% of the RNA viruses in the most up-to-date NCBI RefSeq database. Due to rigorous similarity testing against all human and viral sequences, every primer in MRPrimerV is highly target-specific. Because MRPrimerV ranks CDSs by the penalty scores of their best primer, users need only use the first primer pair for a single-phase PCR or the first two primer pairs for two-phase PCR. Moreover, MRPrimerV provides the list of genome neighbors that can be detected using each primer pair, covering 22 192 variants of 532 RefSeq RNA viruses. We believe that the public availability of MRPrimerV will facilitate viral metagenomics studies aimed at evaluating the variability of viruses, as well as other scientific tasks. PMID:27899620

  6. URPD: a specific product primer design tool.

    PubMed

    Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong

    2012-06-19

    Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.

  7. Identification of Amplified Fragment Length Polymorphism (AFLP) Markers Tightly Associated with Drought Stress Gene in Male Sterile and Fertile Salvia miltiorrhiza Bunge

    PubMed Central

    Zhang, Yuejin; Guo, Lijun; Shu, Zhiming; Sun, Yiyue; Chen, Yuanyuan; Liang, Zongsuo; Guo, Hongbo

    2013-01-01

    Consistent grain yield in drought environment has attracted wide attention due to global climate change. However, the important drought-related traits/genes in crops have been rarely reported. Many near-isogenic lines (NILs) of male sterile and fertile Salvia miltiorrhiza have been obtained in our previous work through testcross and backcross in continuous field experiments conducted in 2006–2009. Both segregating sterile and fertile populations were subjected to bulked segregant analysis (BSA) and amplified fragment length polymorphism (AFLP) with 384 and 170 primer combinations, respectively. One out of 14 AFLP markers (E9/M3246) was identified in treated fertile population as tightly linked to the drought stress gene with a recombination frequency of 6.98% and at a distance of 7.02 cM. One of 15 other markers (E2/M5357) was identified in a treated sterile population that is closely associated with the drought stress gene. It had a recombination frequency of 4.65% and at a distance of 4.66 cM. Interestingly, the E9/M3246 fragment was found to be identical to another AFLP fragment E11/M4208 that was tightly linked to the male sterile gene of S. miltiorrhiza with 95% identity and e-value 4 × 10−93. Blastn analysis suggested that the drought stress gene sequence showed higher identity with nucleotides in Arabidopsis chromosome 1–5. PMID:23525049

  8. PRISE2: software for designing sequence-selective PCR primers and probes.

    PubMed

    Huang, Yu-Ting; Yang, Jiue-in; Chrobak, Marek; Borneman, James

    2014-09-25

    PRISE2 is a new software tool for designing sequence-selective PCR primers and probes. To achieve high level of selectivity, PRISE2 allows the user to specify a collection of target sequences that the primers are supposed to amplify, as well as non-target sequences that should not be amplified. The program emphasizes primer selectivity on the 3' end, which is crucial for selective amplification of conserved sequences such as rRNA genes. In PRISE2, users can specify desired properties of primers, including length, GC content, and others. They can interactively manipulate the list of candidate primers, to choose primer pairs that are best suited for their needs. A similar process is used to add probes to selected primer pairs. More advanced features include, for example, the capability to define a custom mismatch penalty function. PRISE2 is equipped with a graphical, user-friendly interface, and it runs on Windows, Macintosh or Linux machines. PRISE2 has been tested on two very similar strains of the fungus Dactylella oviparasitica, and it was able to create highly selective primers and probes for each of them, demonstrating the ability to create useful sequence-selective assays. PRISE2 is a user-friendly, interactive software package that can be used to design high-quality selective primers for PCR experiments. In addition to choosing primers, users have an option to add a probe to any selected primer pair, enabling design of Taqman and other primer-probe based assays. PRISE2 can also be used to design probes for FISH and other hybridization-based assays.

  9. URPD: a specific product primer design tool

    PubMed Central

    2012-01-01

    Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312

  10. Construction of two genetic linkage maps in cultivated tetraploid alfalfa (Medicago sativa) using microsatellite and AFLP markers

    PubMed Central

    Julier, Bernadette; Flajoulot, Sandrine; Barre, Philippe; Cardinet, Gaëlle; Santoni, Sylvain; Huguet, Thierry; Huyghe, Christian

    2003-01-01

    Background Alfalfa (Medicago sativa) is a major forage crop. The genetic progress is slow in this legume species because of its autotetraploidy and allogamy. The genetic structure of this species makes the construction of genetic maps difficult. To reach this objective, and to be able to detect QTLs in segregating populations, we used the available codominant microsatellite markers (SSRs), most of them identified in the model legume Medicago truncatula from EST database. A genetic map was constructed with AFLP and SSR markers using specific mapping procedures for autotetraploids. The tetrasomic inheritance was analysed in an alfalfa mapping population. Results We have demonstrated that 80% of primer pairs defined on each side of SSR motifs in M. truncatula EST database amplify with the alfalfa DNA. Using a F1 mapping population of 168 individuals produced from the cross of 2 heterozygous parental plants from Magali and Mercedes cultivars, we obtained 599 AFLP markers and 107 SSR loci. All but 3 SSR loci showed a clear tetrasomic inheritance. For most of the SSR loci, the double-reduction was not significant. For the other loci no specific genotypes were produced, so the significant double-reduction could arise from segregation distortion. For each parent, the genetic map contained 8 groups of four homologous chromosomes. The lengths of the maps were 2649 and 3045 cM, with an average distance of 7.6 and 9.0 cM between markers, for Magali and Mercedes parents, respectively. Using only the SSR markers, we built a composite map covering 709 cM. Conclusions Compared to diploid alfalfa genetic maps, our maps cover about 88–100% of the genome and are close to saturation. The inheritance of the codominant markers (SSR) and the pattern of linkage repulsions between markers within each homology group are consistent with the hypothesis of a tetrasomic meiosis in alfalfa. Except for 2 out of 107 SSR markers, we found a similar order of markers on the chromosomes between the

  11. PrecisePrimer: an easy-to-use web server for designing PCR primers for DNA library cloning and DNA shuffling.

    PubMed

    Pauthenier, Cyrille; Faulon, Jean-Loup

    2014-07-01

    PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. RExPrimer: an integrated primer designing tool increases PCR effectiveness by avoiding 3' SNP-in-primer and mis-priming from structural variation

    PubMed Central

    2009-01-01

    Background Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. Methods We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. Results RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully

  13. Invasion Dynamics and Genotypic Diversity of Cogongrass (Imperata cylindrica) at the Point of Introduction in the Southeastern United States

    Treesearch

    Ludovic J. A. Capo-chichi; Wilson H. Faircloth; A. G. Williamson; Michael G. Patterson; James H. Miller; Edzard van Santen

    2008-01-01

    Nine sites of cogongrass were included in a study of genotypic dimity and spread dynamics at the point of introduction and its adjacent areas in the southern United States. Clones evaluated with two primer pairs yielded a total of 137 amplified fragment length polymorphism (AFLP) hi of which 102 (74.4%) were polymorphic. Genetic diversity was measured as the percentage...

  14. MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR

    PubMed Central

    Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

    2015-01-01

    Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. PMID:26109350

  15. A PMB Primer.

    ERIC Educational Resources Information Center

    Whetstone, B. D.; Yates, Benny

    This primer introduces the basics of Program Management and Budgeting (PMB) in an effort to demonstrate how PMB can benefit school systems. Short quotes from previous publications on the topic are paired with cartoons designed to clarify the purposes and workings of the program. The publication begins by defining PMB as an alternative financial…

  16. A DNA microarray-based methylation-sensitive (MS)-AFLP hybridization method for genetic and epigenetic analyses.

    PubMed

    Yamamoto, F; Yamamoto, M

    2004-07-01

    We previously developed a PCR-based DNA fingerprinting technique named the Methylation Sensitive (MS)-AFLP method, which permits comparative genome-wide scanning of methylation status with a manageable number of fingerprinting experiments. The technique uses the methylation sensitive restriction enzyme NotI in the context of the existing Amplified Fragment Length Polymorphism (AFLP) method. Here we report the successful conversion of this gel electrophoresis-based DNA fingerprinting technique into a DNA microarray hybridization technique (DNA Microarray MS-AFLP). By performing a total of 30 (15 x 2 reciprocal labeling) DNA Microarray MS-AFLP hybridization experiments on genomic DNA from two breast and three prostate cancer cell lines in all pairwise combinations, and Southern hybridization experiments using more than 100 different probes, we have demonstrated that the DNA Microarray MS-AFLP is a reliable method for genetic and epigenetic analyses. No statistically significant differences were observed in the number of differences between the breast-prostate hybridization experiments and the breast-breast or prostate-prostate comparisons.

  17. MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR.

    PubMed

    Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

    2015-11-16

    Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. SNP Discovery by Illumina-Based Transcriptome Sequencing of the Olive and the Genetic Characterization of Turkish Olive Genotypes Revealed by AFLP, SSR and SNP Markers

    PubMed Central

    Kaya, Hilal Betul; Cetin, Oznur; Kaya, Hulya; Sahin, Mustafa; Sefer, Filiz; Kahraman, Abdullah; Tanyolac, Bahattin

    2013-01-01

    Background The olive tree (Olea europaea L.) is a diploid (2n = 2x = 46) outcrossing species mainly grown in the Mediterranean area, where it is the most important oil-producing crop. Because of its economic, cultural and ecological importance, various DNA markers have been used in the olive to characterize and elucidate homonyms, synonyms and unknown accessions. However, a comprehensive characterization and a full sequence of its transcriptome are unavailable, leading to the importance of an efficient large-scale single nucleotide polymorphism (SNP) discovery in olive. The objectives of this study were (1) to discover olive SNPs using next-generation sequencing and to identify SNP primers for cultivar identification and (2) to characterize 96 olive genotypes originating from different regions of Turkey. Methodology/Principal Findings Next-generation sequencing technology was used with five distinct olive genotypes and generated cDNA, producing 126,542,413 reads using an Illumina Genome Analyzer IIx. Following quality and size trimming, the high-quality reads were assembled into 22,052 contigs with an average length of 1,321 bases and 45 singletons. The SNPs were filtered and 2,987 high-quality putative SNP primers were identified. The assembled sequences and singletons were subjected to BLAST similarity searches and annotated with a Gene Ontology identifier. To identify the 96 olive genotypes, these SNP primers were applied to the genotypes in combination with amplified fragment length polymorphism (AFLP) and simple sequence repeats (SSR) markers. Conclusions/Significance This study marks the highest number of SNP markers discovered to date from olive genotypes using transcriptome sequencing. The developed SNP markers will provide a useful source for molecular genetic studies, such as genetic diversity and characterization, high density quantitative trait locus (QTL) analysis, association mapping and map-based gene cloning in the olive. High levels of

  19. MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

    PubMed

    Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

    2016-01-01

    Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic

  20. Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region.

    PubMed Central

    Smart, C D; Schneider, B; Blomquist, C L; Guerra, L J; Harrison, N A; Ahrens, U; Lorenz, K H; Seemüller, E; Kirkpatrick, B C

    1996-01-01

    In order to develop a diagnostic tool to identify phytoplasmas and classify them according to their phylogenetic group, we took advantage of the sequence diversity of the 16S-23S intergenic spacer regions (SRs) of phytoplasmas. Ten PCR primers were developed from the SR sequences and were shown to amplify in a group-specific fashion. For some groups of phytoplasmas, such as elm yellows, ash yellows, and pear decline, the SR primer was paired with a specific primer from within the 16S rRNA gene. Each of these primer pairs was specific for a specific phytoplasma group, and they did not produce PCR products of the correct size from any other phytoplasma group. One primer was designed to anneal within the conserved tRNA(Ile) and, when paired with a universal primer, amplified all phytoplasmas tested. None of the primers produced PCR amplification products of the correct size from healthy plant DNA. These primers can serve as effective tools for identifying particular phytoplasmas in field samples. PMID:8702291

  1. Genomic diversity of cercarial clones of Himasthla elongata (Trematoda, Echinostomatidae) determined with AFLP technique.

    PubMed

    Galaktionov, N K; Podgornaya, O I; Strelkov, P P; Galaktionov, K V

    2016-12-01

    The aim of this study was to reveal genomic diversity formed during parthenogenetic reproduction of rediae of the trematode Himasthla elongata in its molluskan host Littorina littorea. We applied amplification fragment length polymorphism (AFLP) to determine the genomic diversity of individual cercariae within the clone, that is, the infrapopulation of parthenogenetic progeny in a single molluskan host. The level of genomic diversity of particular cercariae isolates from a single clone, detected with EcoR1/Mse1 AFLP reaction, was significantly lower than the variability of cercariae from different clones. The presence of intraclonal genomic diversity indicates a nonsexual shuffle of alleles during parthenogenesis in the rediae of H. elongata. The obtained polymorphic AFLP fragments were long enough to detect the sequences that may be responsible for clonal genomic variability. Based on this, AFLP can be recommended as a tool for the study of genetic mechanisms of this variability.

  2. A high degree of genetic diversity is revealed in Isatis spp. (dyer's woad) by amplified fragment length polymorphism (AFLP).

    PubMed

    Gilbert (nee Stoker), G.; Garton, S.; Karam, A.; Arnold, M.; Karp, A.; Edwards, J.; Cooke, T.; Barker, A.

    2002-05-01

    Genetic diversity in 38 genotypes, representing 28 individual genotypes from five landraces of Isatis tinctoria (three German: Tubingen, Potsdam and Erfurt, one Swiss and one English), five genotypes of Isatis indigotica (Chinese woad) and five genotypes of Isatis glauca, were investigated using AFLP analysis. Five primer combinations detected a total of 502 fragments of which 436 (86.9%) were polymorphic. The level of polymorphism recorded within each species was 29.8, 86.9 and 35.8% for I. indigotica, I. tinctoria and I. glauca, respectively. Clearly, genetic diversity within I. tinctoria was greater than that observed in I. indigotica or I. glauca. Cluster analyses of the AFLP data using UPGMA and PCO revealed the complete separation of the genotypes of each species into distinct groups. I. indigotica separated as an entirely independent group, whereas I. glauca formed a separate cluster within the I. tinctoria group. Indeed, I. tinctoria and I. glauca are more closely related to each other than either is to I. indigotica. In addition, the genotypes of each landrace, apart from one from the English group, were clearly discriminated. However, the anomalous genotype did associate with the rest of its group when it was linked with the Erfurt group. These results provide new and useful information about the make-up of the Isatis genome, which has not previously been evaluated. They will be useful in the selection of plant material for variety development and conservation of the gene-pool.

  3. Methylated site display (MSD)-AFLP, a sensitive and affordable method for analysis of CpG methylation profiles.

    PubMed

    Aiba, Toshiki; Saito, Toshiyuki; Hayashi, Akiko; Sato, Shinji; Yunokawa, Harunobu; Maruyama, Toru; Fujibuchi, Wataru; Kurita, Hisaka; Tohyama, Chiharu; Ohsako, Seiichiroh

    2017-03-09

    It has been pointed out that environmental factors or chemicals can cause diseases that are developmental in origin. To detect abnormal epigenetic alterations in DNA methylation, convenient and cost-effective methods are required for such research, in which multiple samples are processed simultaneously. We here present methylated site display (MSD), a unique technique for the preparation of DNA libraries. By combining it with amplified fragment length polymorphism (AFLP) analysis, we developed a new method, MSD-AFLP. Methylated site display libraries consist of only DNAs derived from DNA fragments that are CpG methylated at the 5' end in the original genomic DNA sample. To test the effectiveness of this method, CpG methylation levels in liver, kidney, and hippocampal tissues of mice were compared to examine if MSD-AFLP can detect subtle differences in the levels of tissue-specific differentially methylated CpGs. As a result, many CpG sites suspected to be tissue-specific differentially methylated were detected. Nucleotide sequences adjacent to these methyl-CpG sites were identified and we determined the methylation level by methylation-sensitive restriction endonuclease (MSRE)-PCR analysis to confirm the accuracy of AFLP analysis. The differences of the methylation level among tissues were almost identical among these methods. By MSD-AFLP analysis, we detected many CpGs showing less than 5% statistically significant tissue-specific difference and less than 10% degree of variability. Additionally, MSD-AFLP analysis could be used to identify CpG methylation sites in other organisms including humans. MSD-AFLP analysis can potentially be used to measure slight changes in CpG methylation level. Regarding the remarkable precision, sensitivity, and throughput of MSD-AFLP analysis studies, this method will be advantageous in a variety of epigenetics-based research.

  4. FlyPrimerBank: An Online Database for Drosophila melanogaster Gene Expression Analysis and Knockdown Evaluation of RNAi Reagents

    PubMed Central

    Hu, Yanhui; Sopko, Richelle; Foos, Marianna; Kelley, Colleen; Flockhart, Ian; Ammeux, Noemie; Wang, Xiaowei; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.

    2013-01-01

    The evaluation of specific endogenous transcript levels is important for understanding transcriptional regulation. More specifically, it is useful for independent confirmation of results obtained by the use of microarray analysis or RNA-seq and for evaluating RNA interference (RNAi)-mediated gene knockdown. Designing specific and effective primers for high-quality, moderate-throughput evaluation of transcript levels, i.e., quantitative, real-time PCR (qPCR), is nontrivial. To meet community needs, predefined qPCR primer pairs for mammalian genes have been designed and sequences made available, e.g., via PrimerBank. In this work, we adapted and refined the algorithms used for the mammalian PrimerBank to design 45,417 primer pairs for 13,860 Drosophila melanogaster genes, with three or more primer pairs per gene. We experimentally validated primer pairs for ~300 randomly selected genes expressed in early Drosophila embryos, using SYBR Green-based qPCR and sequence analysis of products derived from conventional PCR. All relevant information, including primer sequences, isoform specificity, spatial transcript targeting, and any available validation results and/or user feedback, is available from an online database (www.flyrnai.org/flyprimerbank). At FlyPrimerBank, researchers can retrieve primer information for fly genes either one gene at a time or in batch mode. Importantly, we included the overlap of each predicted amplified sequence with RNAi reagents from several public resources, making it possible for researchers to choose primers suitable for knockdown evaluation of RNAi reagents (i.e., to avoid amplification of the RNAi reagent itself). We demonstrate the utility of this resource for validation of RNAi reagents in vivo. PMID:23893746

  5. Novel primers for complete mitochondrial cytochrome b genesequencing in mammals

    USGS Publications Warehouse

    Naidu, Ashwin; Fitak, Robert R.; Munguia-Vega, Adrian; Culver, Melanie

    2011-01-01

    Sequence-based species identification relies on the extent and integrity of sequence data available in online databases such as GenBank. When identifying species from a sample of unknown origin, partial DNA sequences obtained from the sample are aligned against existing sequences in databases. When the sequence from the matching species is not present in the database, high-scoring alignments with closely related sequences might produce unreliable results on species identity. For species identification in mammals, the cytochrome b (cyt b) gene has been identified to be highly informative; thus, large amounts of reference sequence data from the cyt b gene are much needed. To enhance availability of cyt b gene sequence data on a large number of mammalian species in GenBank and other such publicly accessible online databases, we identified a primer pair for complete cyt b gene sequencing in mammals. Using this primer pair, we successfully PCR amplified and sequenced the complete cyt b gene from 40 of 44 mammalian species representing 10 orders of mammals. We submitted 40 complete, correctly annotated, cyt b protein coding sequences to GenBank. To our knowledge, this is the first single primer pair to amplify the complete cyt b gene in a broad range of mammalian species. This primer pair can be used for the addition of new cyt b gene sequences and to enhance data available on species represented in GenBank. The availability of novel and complete gene sequences as high-quality reference data can improve the reliability of sequence-based species identification.

  6. Space environment induced mutations prefer to occur at polymorphic sites of rice genomes

    NASA Astrophysics Data System (ADS)

    Li, Y.; Liu, M.; Cheng, Z.; Sun, Y.

    To explore the genomic characteristics of rice mutants induced by space environment, space-induced mutants 971-5, 972-4, and R955, which acquired new traits after space flight such as increased yield, reduced resistance to rice blast, and semi-dwarfism compared with their on-ground controls, 971ck, 972ck, and Bing95-503, respectively, together with other 8 japonica and 3 indica rice varieties, 17 in total, were analyzed by amplified fragment length polymorphism (AFLP) method. We chose 16 AFLP primer-pairs which generated a total of 1251 sites, of which 745 (59.6%) were polymorphic over all the genotypes. With the 16 pairs of primer combinations, 54 space-induced mutation sites were observed in 971-5, 86 in 972-4, and 5 in R955 compared to their controls, and the mutation rates were 4.3%, 6.9% and 0.4%, respectively. Interestingly, 75.9%, 84.9% and 100% of the mutation sites identified in 971-5, 972-4, and R955 occurred in polymorphic sites. This result suggests that the space environment preferentially induced mutations at polymorphic sites in rice genomes and might share a common mechanism with other types of mutagens. It also implies that polymorphic sites in genomes are potential "hotspots" for mutations induced by the space environment.

  7. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    PubMed Central

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  8. A PCR primer bank for quantitative gene expression analysis.

    PubMed

    Wang, Xiaowei; Seed, Brian

    2003-12-15

    Although gene expression profiling by microarray analysis is a useful tool for assessing global levels of transcriptional activity, variability associated with the data sets usually requires that observed differences be validated by some other method, such as real-time quantitative polymerase chain reaction (real-time PCR). However, non-specific amplification of non-target genes is frequently observed in the latter, confounding the analysis in approximately 40% of real-time PCR attempts when primer-specific labels are not used. Here we present an experimentally validated algorithm for the identification of transcript-specific PCR primers on a genomic scale that can be applied to real-time PCR with sequence-independent detection methods. An online database, PrimerBank, has been created for researchers to retrieve primer information for their genes of interest. PrimerBank currently contains 147 404 primers encompassing most known human and mouse genes. The primer design algorithm has been tested by conventional and real-time PCR for a subset of 112 primer pairs with a success rate of 98.2%.

  9. A preliminary study for identification of candidate AFLP markers under artificial selection for shell color in pearl oyster Pinctada fucata.

    PubMed

    Zou, Keshu; Zhang, Dianchang; Guo, Huayang; Zhu, Caiyan; Li, Min; Jiang, Shigui

    2014-05-25

    Pearl oyster Pinctada fucata is widely cultured to produce seawater pearl in South China, and the quality of pearl is significantly affected by its shell color. Thus the Pearl Oyster Selective Breeding Program (POSBP) was carried out for the shell color and growth traits. The black (B), gold (G), red (R) and white (W) shell strains with fast growth trait were achieved after five successive generation selection. In this study, AFLP technique was used to scan genome of four strains with different shell colors to identify the candidate markers under artificial selection. Eight AFLP primer combinations were screened and yielded 688 loci, 676 (98.26%) of which were polymorphic. In black, gold, red and white strains, the percentage of polymorphic loci was 90.41%, 87.79%, 93.60% and 93.31%, respectively, Nei's gene diversity was 0.3225, 0.2829, 0.3221 and 0.3292, Shannon's information index was 0.4801, 0.4271, 0.4825 and 0.4923, and the value of FST was 0.1805. These results suggested that the four different shell color strains had high genetic diversity and great genetic differentiation among strains, which had been subjected to the continuous selective pressures during the artificial selective breeding. Furthermore, six outlier loci were considered as the candidate markers under artificial selection for shell color. This study provides a molecular evidence for the inheritance of shell color of P. fucata. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Dealing with AFLP genotyping errors to reveal genetic structure in Plukenetia volubilis (Euphorbiaceae) in the Peruvian Amazon

    PubMed Central

    Vašek, Jakub; Viehmannová, Iva; Ocelák, Martin; Cachique Huansi, Danter; Vejl, Pavel

    2017-01-01

    An analysis of the population structure and genetic diversity for any organism often depends on one or more molecular marker techniques. Nonetheless, these techniques are not absolutely reliable because of various sources of errors arising during the genotyping process. Thus, a complex analysis of genotyping error was carried out with the AFLP method in 169 samples of the oil seed plant Plukenetia volubilis L. from small isolated subpopulations in the Peruvian Amazon. Samples were collected in nine localities from the region of San Martin. Analysis was done in eight datasets with a genotyping error from 0 to 5%. Using eleven primer combinations, 102 to 275 markers were obtained according to the dataset. It was found that it is only possible to obtain the most reliable and robust results through a multiple-level filtering process. Genotyping error and software set up influence both the estimation of population structure and genetic diversity, where in our case population number (K) varied between 2–9 depending on the dataset and statistical method used. Surprisingly, discrepancies in K number were caused more by statistical approaches than by genotyping errors themselves. However, for estimation of genetic diversity, the degree of genotyping error was critical because descriptive parameters (He, FST, PLP 5%) varied substantially (by at least 25%). Due to low gene flow, P. volubilis mostly consists of small isolated subpopulations (ΦPT = 0.252–0.323) with some degree of admixture given by socio-economic connectivity among the sites; a direct link between the genetic and geographic distances was not confirmed. The study illustrates the successful application of AFLP to infer genetic structure in non-model plants. PMID:28910307

  11. The Choice of PCR Primers Has Great Impact on Assessments of Bacterial Community Diversity and Dynamics in a Wastewater Treatment Plant

    PubMed Central

    Fredriksson, Nils Johan; Hermansson, Malte; Wilén, Britt-Marie

    2013-01-01

    Assessments of bacterial community diversity and dynamics are fundamental for the understanding of microbial ecology as well as biotechnological applications. We show that the choice of PCR primers has great impact on the results of analyses of diversity and dynamics using gene libraries and DNA fingerprinting. Two universal primer pairs targeting the 16S rRNA gene, 27F&1492R and 63F&M1387R, were compared and evaluated by analyzing the bacterial community in the activated sludge of a large-scale wastewater treatment plant. The two primer pairs targeted distinct parts of the bacterial community, none encompassing the other, both with similar richness. Had only one primer pair been used, very different conclusions had been drawn regarding dominant phylogenetic and putative functional groups. With 27F&1492R, Betaproteobacteria would have been determined to be the dominating taxa while 63F&M1387R would have described Alphaproteobacteria as the most common taxa. Microscopy and fluorescence in situ hybridization analysis showed that both Alphaproteobacteria and Betaproteobacteria were abundant in the activated sludge, confirming that the two primer pairs target two different fractions of the bacterial community. Furthermore, terminal restriction fragment polymorphism analyses of a series of four activated sludge samples showed that the two primer pairs would have resulted in different conclusions about community stability and the factors contributing to changes in community composition. In conclusion, different PCR primer pairs, although considered universal, target different ranges of bacteria and will thus show the diversity and dynamics of different fractions of the bacterial community in the analyzed sample. We also show that while a database search can serve as an indicator of how universal a primer pair is, an experimental assessment is necessary to evaluate the suitability for a specific environmental sample. PMID:24098498

  12. Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

    PubMed

    Galkiewicz, Julia P; Kellogg, Christina A

    2008-12-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  13. Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

    PubMed Central

    Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

    2012-01-01

    DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

  14. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    PubMed

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  15. Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

    PubMed

    Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

    2016-11-01

    It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

  16. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    PubMed Central

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

  17. Microsatellite primers for red drum (Sciaenops ocellatus)

    USDA-ARS?s Scientific Manuscript database

    In this note, we document polymerase-chain-reaction (PCR) primer pairs for 101, nuclear-encoded microsatellites designed and developed from a red drum (Sciaenops ocellatus) genomic library. The 101 microsatellites (Genbank Accession Numbers EU015882-EU015982) were amplified successfully and used to...

  18. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    PubMed

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

  19. Chromosomal assignment of ALFP markers in upland cotton (Gossypium hirsutum L.)

    USDA-ARS?s Scientific Manuscript database

    In this research, we used two sets of cotton aneuploid (G. hirsutum × G. tomentosum and G. hirsutum × G. barbadense) plants to locate AFLP markers to chromosome using deletion analysis method. Thirty-eight primer combinations were used to generate 608 polymorphic AFLP markers. Ninety-eight AFLP mark...

  20. An AFLP genetic linkage map of pacific abalone ( Haliotis discus hannai)

    NASA Astrophysics Data System (ADS)

    Qi, Li; Yanhong, Xu; Ruihai, Yu; Akihiro, Kijima

    2007-07-01

    A genetic linkage map of Pacific abalone ( Haliotis discus hannai) was constructed using AFLP markers based on a two-way pseudo-testeross strategy in a full-sib family. With 33 primer combinations, a total of 455 markers (225 from the female parent and 230 from the male parent) segregated in a 1:1 ratio, corresponding to DNA polymorphism: heterozygous in one parent and null in the other. The female framework map consisted of 174 markers distributed in 18 linkage groups, equivalent to the H. discus hannai haploid chromosome number, and spanning a total length of 2031.4 cM, with an average interval of 13.0 cM between adjacent markers. The male framework map consisted of 195 markers mapped on 19 linkage groups, spanning a total length of 2273.4 cM, with an average spacing of 12.9 cM between adjacent markers. The estimated coverage for the framework linkage maps was 81.2% for the female and 82.1% for the male, on the basis of two estimates of genome length. Fifty-two markers (11.4%) remained unlinked. The level of segregation distortion observed in this cross was 20.4%. These linkage maps will serve as a starting point for linkage studies in the Pacific abalone with potential application for marker-assisted selection in breeding programs.

  1. Microsatellites for the genus Cucurbita and an SSR-based genetic linkage map of Cucurbita pepo L.

    PubMed Central

    Gong, L.; Stift, G.; Kofler, R.; Pachner, M.

    2008-01-01

    Until recently, only a few microsatellites have been available for Cucurbita, thus their development is highly desirable. The Austrian oil-pumpkin variety Gleisdorfer Ölkürbis (C. pepo subsp. pepo) and the C. moschata cultivar Soler (Puerto Rico) were used for SSR development. SSR-enriched partial genomic libraries were established and 2,400 clones were sequenced. Of these 1,058 (44%) contained an SSR at least four repeats long. Primers were designed for 532 SSRs; 500 primer pairs produced fragments of expected size. Of these, 405 (81%) amplified polymorphic fragments in a set of 12 genotypes: three C. moschata, one C. ecuadorensis, and eight C. pepo representing all eight cultivar groups. On an average, C. pepo and C. moschata produced 3.3 alleles per primer pair, showing high inter-species transferability. There were 187 SSR markers detecting polymorphism between the USA oil-pumpkin variety “Lady Godiva” (O5) and the Italian crookneck variety “Bianco Friulano” (CN), which are the parents of our previous F2 mapping population. It has been used to construct the first published C. pepo map, containing mainly RAPD and AFLP markers. Now the updated map comprises 178 SSRs, 244 AFLPs, 230 RAPDs, five SCARs, and two morphological traits (h and B). It contains 20 linkage groups with a map density of 2.9 cM. The observed genome coverage (Co) is 86.8%. Electronic supplementary material The online version of this article (doi:10.1007/s00122-008-0750-2) contains supplementary material, which is available to authorized users. PMID:18379753

  2. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR

    PubMed Central

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch. PMID:21917859

  3. GISH and AFLP analyses of novel Brassica napus lines derived from one hybrid between B. napus and Orychophragmus violaceus.

    PubMed

    Ma, Ni; Li, Zai-Yun; Cartagena, J A; Fukui, K

    2006-10-01

    New Brassica napus inbred lines with different petal colors and with canola quality and increased levels of oleic (approximately 70%, 10% higher than that of B. napus parent) and linoleic (28%) acids have been developed in the progenies of one B. napus cv. Oro x Orychophragmus violaceus F5 hybrid plant (2n = 31). Their genetic constituents were analyzed by using the methods of genomic in situ hybridization (GISH) and amplified fragments length polymorphism (AFLP). No intact chromosomes of O. violaceus origin were detected by GISH in their somatic cells of ovaries and root tips (2n = 38) and pollen mother cells (PMCs) with normal chromosome pairing (19 bivalents) and segregation (19:19), though signals of variable sizes and intensities were located mainly at terminal and centromeric parts of some mitotic chromosomes and meiotic bivalents at diakinesis or chromosomes in anaphase I groups and one large patch of chromatin was intensively labeled and separated spatially in some telophase I nuclei and metaphase II PMCs. AFLP analysis revealed that substantial genomic changes have occurred in these lines and O. violaceus-specific bands, deleted bands in 'Oro' and novel bands for two parents were detected. The possible mechanisms for these results were discussed.

  4. Differential transcript profiling through cDNA-AFLP showed complexity of rutin biosynthesis and accumulation in seeds of a nutraceutical food crop (Fagopyrum spp.)

    PubMed Central

    2012-01-01

    Background Buckwheat, consisting of two cultivated species Fagopyrum tataricum and F. esculentum, is the richest source of flavonoid rutin. Vegetative tissues of both the Fagopyrum species contain almost similar amount of rutin; however, rutin content in seed of F. tataricum are ~50 folds of that in seed of F. esculentum. In order to understand the molecular basis of high rutin content in F. tataricum, differential transcript profiling through cDNA-AFLP has been utilized to decipher what genetic factors in addition to flavonoid structural genes contribute to high rutin content of F. tataricum compared to F. esculentum. Results Differential transcript profiling through cDNA-AFLP in seed maturing stages (inflorescence to seed maturation) with 32 primer combinations generated total of 509 transcript fragments (TDFs). 167 TDFs were then eluted, cloned and sequenced from F. tataricum and F. esculentum. Categorization of TDFs on the basis of their presence/absence (qualitative variation) or differences in the amount of expression (quantitative variation) between both the Fagopyrum species showed that majority of variants are quantitative (64%). The TDFs represented genes controlling different biological processes such as basic and secondary metabolism (33%), regulation (18%), signal transduction (14%), transportation (13%), cellular organization (10%), and photosynthesis & energy (4%). Most of the TDFs except belonging to cellular metabolism showed relatively higher transcript abundance in F. tataricum over F. esculentum. Quantitative RT-PCR analysis of nine TDFs representing genes involved in regulation, metabolism, signaling and transport of secondary metabolites showed that all the tested nine TDFs (Ubiquitin protein ligase, ABC transporter, sugar transporter) except MYB 118 showed significantly higher expression in early seed formation stage (S7) of F. tataricum compared to F. esculentum. qRT-PCR results were found to be consistent with the cDNA-AFLP results

  5. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    USGS Publications Warehouse

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  6. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

    PubMed

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

    2015-12-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

  7. Crystallographic observation of nonenzymatic RNA primer extension.

    PubMed

    Zhang, Wen; Walton, Travis; Li, Li; Szostak, Jack W

    2018-05-31

    The importance of genome replication has inspired detailed crystallographic studies of enzymatic DNA/RNA polymerization. In contrast, the mechanism of nonenzymatic polymerization is less well understood, despite its critical role in the origin of life. Here we report the direct observation of nonenzymatic RNA primer extension through time-resolved crystallography. We soaked crystals of an RNA primer-template-dGMP complex with guanosine-5'-phosphoro-2-aminoimidazolide for increasing times. At early times we see the activated ribonucleotides bound to the template, followed by formation of the imidazolium-bridged dinucleotide intermediate. At later times, we see a new phosphodiester bond forming between the primer and the incoming nucleotide. The intermediate is pre-organized because of the constraints of base-pairing with the template and hydrogen bonding between the imidazole amino group and both flanking phosphates. Our results provide atomic-resolution insight into the mechanism of nonenzymatic primer extension, and set the stage for further structural dissection and optimization of the RNA copying process. © 2018, Zhang et al.

  8. MethPrimer: designing primers for methylation PCRs.

    PubMed

    Li, Long-Cheng; Dahiya, Rajvir

    2002-11-01

    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

  9. Characterization of Haemophilus parasuis isolated from Brazilian swine through serotyping, AFLP and PFGE.

    PubMed

    Castilla, Karina Salvagni; de Gobbi, Débora Dirani Sena; Moreno, Luisa Zanolli; Paixão, Renata; Coutinho, Tania Alen; dos Santos, José Lúcio; Moreno, Andrea Micke

    2012-06-01

    Haemophilus parasuis infection in pigs is characterized by fibrinous polyserositis, arthritis and meningitis. Despite the fact that traditional diagnosis is based on herd history, clinical signs, bacterial isolation and serotyping, molecular-based methods are alternatives for species-specific tests and epidemiological studies. The aim of this study was to characterize H. parasuis field strains from different states of Brazil, employing serotyping and genotyping methods. Serotyping revealed that serovar 4 was the most prevalent (26.1%), followed by serovars 5 (17.4%), 14 (8.7%), 13 (4.4%) and 2 (4.4%), whereas 39% of the strains were considered as untypeable. AFLP with a single enzyme and PFGE were able to type all isolates tested, generating 34 and 20 different profiles, respectively, including untypeable strains. Besides the slightly higher discrimination index presented by AFLP, PFGE with Not I restriction enzyme showed a better correlation with epidemiological data, grouping strains of the same serovar, animal or farm origin. The results indicated AFLP and PFGE as valuable tools for typing H. parasuis isolates collected in Brazil. Copyright © 2011 Elsevier Ltd. All rights reserved.

  10. SDM-Assist software to design site-directed mutagenesis primers introducing “silent” restriction sites

    PubMed Central

    2013-01-01

    Background Over the past decades site-directed mutagenesis (SDM) has become an indispensable tool for biological structure-function studies. In principle, SDM uses modified primer pairs in a PCR reaction to introduce a mutation in a cDNA insert. DpnI digestion of the reaction mixture is used to eliminate template copies before amplification in E. coli; however, this process is inefficient resulting in un-mutated clones which can only be distinguished from mutant clones by sequencing. Results We have developed a program – ‘SDM-Assist’ which creates SDM primers adding a specific identifier: through additional silent mutations a restriction site is included or a previous one removed which allows for highly efficient identification of ‘mutated clones’ by a simple restriction digest. Conclusions The direct identification of SDM clones will save time and money for researchers. SDM-Assist also scores the primers based on factors such as Tm, GC content and secondary structure allowing for simplified selection of optimal primer pairs. PMID:23522286

  11. First genetic linkage map of Taraxacum koksaghyz Rodin based on AFLP, SSR, COS and EST-SSR markers.

    PubMed

    Arias, Marina; Hernandez, Monica; Remondegui, Naroa; Huvenaars, Koen; van Dijk, Peter; Ritter, Enrique

    2016-08-04

    Taraxacum koksaghyz Rodin (TKS) has been studied in many occasions as a possible alternative source for natural rubber production of good quality and for inulin production. Some tire companies are already testing TKS tire prototypes. There are also many investigations on the production of bio-fuels from inulin and inulin applications for health improvement and in the food industry. A limited amount of genomic resources exist for TKS and particularly no genetic linkage map is available in this species. We have constructed the first TKS genetic linkage map based on AFLP, COS, SSR and EST-SSR markers. The integrated linkage map with eight linkage groups (LG), representing the eight chromosomes of Russian dandelion, has 185 individual AFLP markers from parent 1, 188 individual AFLP markers from parent 2, 75 common AFLP markers and 6 COS, 1 SSR and 63 EST-SSR loci. Blasting the EST-SSR sequences against known sequences from lettuce allowed a partial alignment of our TKS map with a lettuce map. Blast searches against plant gene databases revealed some homologies with useful genes for downstream applications in the future.

  12. cDNA-AFLP analysis of transcripts induced in chickpea plants by TiO2 nanoparticles during cold stress.

    PubMed

    Amini, Saeed; Maali-Amiri, Reza; Mohammadi, Rahmat; Kazemi-Shahandashti, Seyyedeh-Sanam

    2017-02-01

    We evaluated the effect of TiO 2 nanoparticles (NPs) on cold tolerance (CT) development in two chickpea (Cicer arietinum L.) genotypes (Sel96Th11439, cold tolerant, and ILC533, cold susceptible) by using cDNA-amplified fragment length polymorphism (cDNA-AFLP) technique during the first and sixth days of cold stress (CS) at 4 °C. Selective amplification by primer combinations generated 4200 transcript-derived fragments (TDFs) while 100 of them (2.62%) were differentially expressed. During CS, 60 differentially expressed TDFs of TiO 2 NPs-treated plants were cloned and 10 of them produced successfully readable sequences. These data represented different groups of genes involved in metabolism pathways, cellular defense, cell connections and signaling, transcriptional regulation and chromatin architecture. Two out of 10 TDFs were unknown genes with uncharacterized functions or sequences without homology to known ones. The network-based analysis showed a gene-gene relationship in response to CS. Quantitative reverse-transcriptase polymerase chain reaction (qPCR) confirmed differential expression of identified genes (six out of 10 TDFs) with potential functions in CT and showed similar patterns with cDNA-AFLP results. An increase in transcription level of these TDFs, particularly on the first day of CS, was crucial for developing CT through decreasing electrolyte leakage index (ELI) content in tolerant plants compared to susceptible ones, as well as in TiO 2 NPs-treated plants compared to control ones. It could also indicate probable role of TiO 2 NPs against CS-induced oxidative stress. Therefore, a new application of TiO 2 NPs in CT development is suggested for preventing or controlling the damages in field conditions and increasing crop productivity. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  13. Genetic diversity of Kenyan native oyster mushroom (Pleurotus).

    PubMed

    Otieno, Ojwang D; Onyango, Calvin; Onguso, Justus Mungare; Matasyoh, Lexa G; Wanjala, Bramwel W; Wamalwa, Mark; Harvey, Jagger J W

    2015-01-01

    Members of the genus Pleurotus, also commonly known as oyster mushroom, are well known for their socioeconomic and biotechnological potentials. Despite being one of the most important edible fungi, the scarce information about the genetic diversity of the species in natural populations has limited their sustainable utilization. A total of 71 isolates of Pleurotus species were collected from three natural populations: 25 isolates were obtained from Kakamega forest, 34 isolates from Arabuko Sokoke forest and 12 isolates from Mount Kenya forest. Amplified fragment length polymorphism (AFLP) was applied to thirteen isolates of locally grown Pleurotus species obtained from laboratory samples using five primer pair combinations. AFLP markers and internal transcribed spacer (ITS) sequences of the ribosomal DNA were used to estimate the genetic diversity and evaluate phylogenetic relationships, respectively, among and within populations. The five primer pair combinations generated 293 polymorphic loci across the 84 isolates. The mean genetic diversity among the populations was 0.25 with the population from Arabuko Sokoke having higher (0.27) diversity estimates compared to Mount Kenya population (0.24). Diversity between the isolates from the natural population (0.25) and commercial cultivars (0.24) did not differ significantly. However, diversity was greater within (89%; P > 0.001) populations than among populations. Homology search analysis against the GenBank database using 16 rDNA ITS sequences randomly selected from the two clades of AFLP dendrogram revealed three mushroom species: P. djamor, P. floridanus and P. sapidus; the three mushrooms form part of the diversity of Pleurotus species in Kenya. The broad diversity within the Kenyan Pleurotus species suggests the possibility of obtaining native strains suitable for commercial cultivation. © 2015 by The Mycological Society of America.

  14. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae).

    PubMed

    Glennon, Kelsey L; Cron, Glynis V

    2016-05-01

    Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.

  15. First genetic linkage map of Taraxacum koksaghyz Rodin based on AFLP, SSR, COS and EST-SSR markers

    PubMed Central

    Arias, Marina; Hernandez, Monica; Remondegui, Naroa; Huvenaars, Koen; van Dijk, Peter; Ritter, Enrique

    2016-01-01

    Taraxacum koksaghyz Rodin (TKS) has been studied in many occasions as a possible alternative source for natural rubber production of good quality and for inulin production. Some tire companies are already testing TKS tire prototypes. There are also many investigations on the production of bio-fuels from inulin and inulin applications for health improvement and in the food industry. A limited amount of genomic resources exist for TKS and particularly no genetic linkage map is available in this species. We have constructed the first TKS genetic linkage map based on AFLP, COS, SSR and EST-SSR markers. The integrated linkage map with eight linkage groups (LG), representing the eight chromosomes of Russian dandelion, has 185 individual AFLP markers from parent 1, 188 individual AFLP markers from parent 2, 75 common AFLP markers and 6 COS, 1 SSR and 63 EST-SSR loci. Blasting the EST-SSR sequences against known sequences from lettuce allowed a partial alignment of our TKS map with a lettuce map. Blast searches against plant gene databases revealed some homologies with useful genes for downstream applications in the future. PMID:27488242

  16. Bacterial community structure analysis of sediment in the Sagami River, Japan using a rapid approach based on two-dimensional DNA gel electrophoresis mapping with selective primer pairs.

    PubMed

    Liu, Guo-hua; Rajendran, Narasimmalu; Amemiya, Takashi; Itoh, Kiminori

    2011-11-01

    A rapid approach based on two-dimensional DNA gel electrophroesis (2-DGE) mapping with selective primer pairs was employed to analyze bacterial community structure in sediments from upstream, midstream and downstream of Sagami River in Japan. The 2-DGE maps indicated that Alpha- and Delta-proteobacteria were major bacterial populations in the upstream and midstream sediments. Further bacterial community structure analysis showed that richness proportion of Alpha- and Delta-proteobacterial groups reflected a trend toward decreasing from the upstream to downstream sediments. The biomass proportion of bacterial populations in the midstream sediment showed a significantly difference from that in the other sediments, suggesting that there may be an environmental pressure on the midstream bacterial community. Lorenz curves, together with Gini coefficients were successfully applied to the 2-DGE mapping data for resolving evenness of bacterial populations, and showed that the plotted curve from high-resolution 2-DGE mapping became less linear and more an exponential function than that of the 1-DGE methods such as chain length analysis and denaturing gradient gel electrophoresis, suggesting that the 2-DGE mapping may achieve a more detailed evaluation of bacterial community. In conclusion, the 2-DGE mapping combined with the selective primer pairs enables bacterial community structure analysis in river sediment and thus it can also monitor sediment pollution based on the change of bacterial community structure.

  17. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    NASA Astrophysics Data System (ADS)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  18. Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

    PubMed

    Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

    2015-05-01

    Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

  19. Evaluation of Primers Targeting the Diazotroph Functional Gene and Development of NifMAP – A Bioinformatics Pipeline for Analyzing nifH Amplicon Data

    PubMed Central

    Angel, Roey; Nepel, Maximilian; Panhölzl, Christopher; Schmidt, Hannes; Herbold, Craig W.; Eichorst, Stephanie A.; Woebken, Dagmar

    2018-01-01

    Diazotrophic microorganisms introduce biologically available nitrogen (N) to the global N cycle through the activity of the nitrogenase enzyme. The genetically conserved dinitrogenase reductase (nifH) gene is phylogenetically distributed across four clusters (I–IV) and is widely used as a marker gene for N2 fixation, permitting investigators to study the genetic diversity of diazotrophs in nature and target potential participants in N2 fixation. To date there have been limited, standardized pipelines for analyzing the nifH functional gene, which is in stark contrast to the 16S rRNA gene. Here we present a bioinformatics pipeline for processing nifH amplicon datasets – NifMAP (“NifH MiSeq Illumina Amplicon Analysis Pipeline”), which as a novel aspect uses Hidden-Markov Models to filter out homologous genes to nifH. By using this pipeline, we evaluated the broadly inclusive primer pairs (Ueda19F–R6, IGK3–DVV, and F2–R6) that target the nifH gene. To evaluate any systematic biases, the nifH gene was amplified with the aforementioned primer pairs in a diverse collection of environmental samples (soils, rhizosphere and roots samples, biological soil crusts and estuarine samples), in addition to a nifH mock community consisting of six phylogenetically diverse members. We noted that all primer pairs co-amplified nifH homologs to varying degrees; up to 90% of the amplicons were nifH homologs with IGK3–DVV in some samples (rhizosphere and roots from tall oat-grass). In regards to specificity, we observed some degree of bias across the primer pairs. For example, primer pair F2–R6 discriminated against cyanobacteria (amongst others), yet captured many sequences from subclusters IIIE and IIIL-N. These aforementioned subclusters were largely missing by the primer pair IGK3–DVV, which also tended to discriminate against Alphaproteobacteria, but amplified sequences within clusters IIIC (affiliated with Clostridia) and clusters IVB and IVC. Primer pair Ueda19F

  20. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae)1

    PubMed Central

    Glennon, Kelsey L.; Cron, Glynis V.

    2016-01-01

    Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125

  1. Beyond an AFLP genome scan towards the identification of immune genes involved in plague resistance in Rattus rattus from Madagascar.

    PubMed

    Tollenaere, C; Jacquet, S; Ivanova, S; Loiseau, A; Duplantier, J-M; Streiff, R; Brouat, C

    2013-01-01

    Genome scans using amplified fragment length polymorphism (AFLP) markers became popular in nonmodel species within the last 10 years, but few studies have tried to characterize the anonymous outliers identified. This study follows on from an AFLP genome scan in the black rat (Rattus rattus), the reservoir of plague (Yersinia pestis infection) in Madagascar. We successfully sequenced 17 of the 22 markers previously shown to be potentially affected by plague-mediated selection and associated with a plague resistance phenotype. Searching these sequences in the genome of the closely related species Rattus norvegicus assigned them to 14 genomic regions, revealing a random distribution of outliers in the genome (no clustering). We compared these results with those of an in silico AFLP study of the R. norvegicus genome, which showed that outlier sequences could not have been inferred by this method in R. rattus (only four of the 15 sequences were predicted). However, in silico analysis allowed the prediction of AFLP markers distribution and the estimation of homoplasy rates, confirming its potential utility for designing AFLP studies in nonmodel species. The 14 genomic regions surrounding AFLP outliers (less than 300 kb from the marker) contained 75 genes encoding proteins of known function, including nine involved in immune function and pathogen defence. We identified the two interleukin 1 genes (Il1a and Il1b) that share homology with an antigen of Y. pestis, as the best candidates for genes subject to plague-mediated natural selection. At least six other genes known to be involved in proinflammatory pathways may also be affected by plague-mediated selection. © 2012 Blackwell Publishing Ltd.

  2. Base pairing among three cis-acting sequences contributes to template switching during hepadnavirus reverse transcription

    PubMed Central

    Liu, Ning; Tian, Ru; Loeb, Daniel D.

    2003-01-01

    Synthesis of the relaxed-circular (RC) DNA genome of hepadnaviruses requires two template switches during plus-strand DNA synthesis: primer translocation and circularization. Although primer translocation and circularization use different donor and acceptor sequences, and are distinct temporally, they share the common theme of switching from one end of the minus-strand template to the other end. Studies of duck hepatitis B virus have indicated that, in addition to the donor and acceptor sequences, three other cis-acting sequences, named 3E, M, and 5E, are required for the synthesis of RC DNA by contributing to primer translocation and circularization. The mechanism by which 3E, M, and 5E act was not known. We present evidence that these sequences function by base pairing with each other within the minus-strand template. 3E base-pairs with one portion of M (M3) and 5E base-pairs with an adjacent portion of M (M5). We found that disrupting base pairing between 3E and M3 and between 5E and M5 inhibited primer translocation and circularization. More importantly, restoring base pairing with mutant sequences restored the production of RC DNA. These results are consistent with the model that, within duck hepatitis B virus capsids, the ends of the minus-strand template are juxtaposed via base pairing to facilitate the two template switches during plus-strand DNA synthesis. PMID:12578983

  3. Base pairing among three cis-acting sequences contributes to template switching during hepadnavirus reverse transcription.

    PubMed

    Liu, Ning; Tian, Ru; Loeb, Daniel D

    2003-02-18

    Synthesis of the relaxed-circular (RC) DNA genome of hepadnaviruses requires two template switches during plus-strand DNA synthesis: primer translocation and circularization. Although primer translocation and circularization use different donor and acceptor sequences, and are distinct temporally, they share the common theme of switching from one end of the minus-strand template to the other end. Studies of duck hepatitis B virus have indicated that, in addition to the donor and acceptor sequences, three other cis-acting sequences, named 3E, M, and 5E, are required for the synthesis of RC DNA by contributing to primer translocation and circularization. The mechanism by which 3E, M, and 5E act was not known. We present evidence that these sequences function by base pairing with each other within the minus-strand template. 3E base-pairs with one portion of M (M3) and 5E base-pairs with an adjacent portion of M (M5). We found that disrupting base pairing between 3E and M3 and between 5E and M5 inhibited primer translocation and circularization. More importantly, restoring base pairing with mutant sequences restored the production of RC DNA. These results are consistent with the model that, within duck hepatitis B virus capsids, the ends of the minus-strand template are juxtaposed via base pairing to facilitate the two template switches during plus-strand DNA synthesis.

  4. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    NASA Astrophysics Data System (ADS)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  5. Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

    PubMed

    Prunier, Rachel; Latimer, Andrew

    2010-01-01

    Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

  6. Characterization of Betula platyphylla gene transcripts associated with early development of male inflorescence.

    PubMed

    Xing, Lei; Liu, Xue-Mei

    2012-02-01

    Birch (Betula platyphylla), an eminent tree species in Northeast and Inner Mongolia of China, has been widely used in architecture, furniture, and paper making in recent years. In order to retrieve genes involved in early development of B. platyphylla male inflorescence, RNA populations extracted from early and late developmental stage were analyzed by cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) technique. Following amplification of 256 pairs of primer combinations, ~7000 fragments were generated, of which 350 transcripts expressing more in early stage than late. Of 350 specific transcripts, 198 clear and reproducible electrophoresis bands were retrieved and sequenced successfully, 74 of them (37%) showing significant homologies to known genes after GO annotation. Majority of the predicted gene products were involved in metabolism (24.56%), cellular process (27.19%), response to stimulus (11.4%) and cell growth (8.7%). Transcripts ME56, ME108, ME206 and ME310, representing metabolism, cellular process, response to stimulus and cell growth, respectively, were selected for further study to validate cDNA-AFLP expression patterns via RT-PCR and qRT-PCR analysis. RT-PCR and qRT-PCR expression pattern results were consistent with cDNA-AFLP analysis results.

  7. Differential gene expression for Curvularia eragrostidis pathogenic incidence in crabgrass (Digitaria sanguinalis) revealed by cDNA-AFLP analysis.

    PubMed

    Wang, Jianshu; Wang, Xuemin; Yuan, Bohua; Qiang, Sheng

    2013-01-01

    Gene expression profiles of Digitaria sanguinalis infected by Curvularia eragrostidis strain QZ-2000 at two concentrations of conidia and two dew durations were analyzed by cDNA amplified fragment length polymorphisms (cDNA-AFLP). Inoculum strength was more determinant of gene expression than dew duration. A total of 256 primer combinations were used for selective amplification and 1214 transcript-derived fragments (TDFs) were selected for their differential expression. Of these, 518 up-regulated differentially expressed TDFs were identified. Forty-six differential cDNA fragments were chosen to be cloned and 35 of them were successfully cloned and sequenced, of which 25 were homologous to genes of known function according to the GenBank database. Only 6 genes were up-regulated in Curvularia eragrostidis-inoculated D. sanguinalis, with functions involved in signal transduction, energy metabolism, cell growth and development, stress responses, abscisic acid biosynthesis and response. It appears that a few pathways may be important parts of the pathogenic strategy of C. eragrostidis strain QZ-2000 on D. sanguinalis. Our study provides the fundamentals to further study the pathogenic mechanism, screen for optimal C. eragrostidis strains as potential mycoherbicide and apply this product to control D. sanguinalis.

  8. ITS fungal barcoding primers versus 18S AMF-specific primers reveal similar AMF-based diversity patterns in roots and soils of three mountain vineyards.

    PubMed

    Berruti, Andrea; Desirò, Alessandro; Visentin, Stefano; Zecca, Odoardo; Bonfante, Paola

    2017-10-01

    ITS primers commonly used to describe soil fungi are flawed for AMF although it is unknown the extent to which they distort the interpretation of community patterns. Here, we focus on how the use of a specific ITS2 fungal barcoding primer pair biased for AMF changes the interpretation of AMF community patterns from three mountain vineyards compared to a novel AMF-specific approach on the 18S. We found that although discrepancies were present in the taxonomic composition of the two resulting datasets, the estimation of diversity patterns among AMF communities was similar and resulted in both primer systems being able to correctly assess the community-structuring effect of location, compartment (root vs. soil) and environment. Both methodologies made it possible to detect the same alpha-diversity trend among the locations under study but not between root and soil transects. We show that the ITS2 primer system for fungal barcoding provides a good estimate of both AMF community structure and relation to environmental variables. However, this primer system does not fit in with cross-compartment surveys (roots vs. soil) as it can underestimate AMF diversity in soil samples. When specifically focusing on AMF, the 18S primer system resulted in wide coverage and marginal non-target amplification. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  9. PrimerZ: streamlined primer design for promoters, exons and human SNPs.

    PubMed

    Tsai, Ming-Fang; Lin, Yi-Jung; Cheng, Yu-Chang; Lee, Kuo-Hsi; Huang, Cheng-Chih; Chen, Yuan-Tsong; Yao, Adam

    2007-07-01

    PrimerZ (http://genepipe.ngc.sinica.edu.tw/primerz/) is a web application dedicated primarily to primer design for genes and human SNPs. PrimerZ accepts genes by gene name or Ensembl accession code, and SNPs by dbSNP rs or AFFY_Probe IDs. The promoter and exon sequence information of all gene transcripts fetched from the Ensembl database (http://www.ensembl.org) are processed before being passed on to Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) for individual primer design. All results returned from Primer 3 are organized and integrated in a specially designed web page for easy browsing. Besides the web page presentation, csv text file export is also provided for enhanced user convenience. PrimerZ automates highly standard but tedious gene primer design to improve the success rate of PCR experiments. More than 2000 primers have been designed with PrimerZ at our institute since 2004 and the success rate is over 70%. The addition of several new features has made PrimerZ even more useful to the research community in facilitating primer design for promoters, exons and SNPs.

  10. Linkage analysis with multiplexed short tandem repeat polymorphisms using infrared fluorescence and M13 tailed primers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oetting, W.S.; Lee, H.K.; Flanders, D.J.

    The use of short tandem repeat polymorphisms (STRPs) as marker loci for linkage analysis is becoming increasingly important due to their large numbers in the human genome and their high degree of polymorphism. Fluorescence-based detection of the STRP pattern with an automated DNA sequencer has improved the efficiency of this technique by eliminating the need for radioactivity and producing a digitized autoradiogram-like image that can be used for computer analysis. In an effort to simplify the procedure and to reduce the cost of fluorescence STRP analysis, we have developed a technique known as multiplexing STRPs with tailed primers (MSTP) usingmore » primers that have a 19-bp extension, identical to the sequence of an M13 sequencing primer, on the 5{prime} end of the forward primer in conjunction with multiplexing several primer pairs in a single polymerase chain reaction (PCR) amplification. The banding pattern is detected with the addition of the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye, eliminating the need for direct conjugation of the infrared fluorescent dye to the STRP primers. The use of MSTP for linkage analysis greatly reduces the number of PCR reactions. Up to five primer pairs can be multiplexed together in the same reaction. At present, a set of 148 STRP markers spaced at an average genetic distance of 28 cM throughout the autosomal genome can be analyzed in 37 sets of multiplexed amplification reactions. We have automated the analysis of these patterns for linkage using software that both detects the STRP banding pattern and determines their sizes. This information can then be exported in a user-defined format from a database manager for linkage analysis. 15 refs., 2 figs., 4 tabs.« less

  11. Use of AFLP, plasmid typing and phenotyping in a comparative study to assess genetic diversity of Shigella flexneri strains.

    PubMed Central

    Herrera, S.; Cabrera, R.; Ramirez, M. M.; Usera, M. A.; Echeita, M. A.

    2002-01-01

    Shigella flexneri infections are one of the main causes of acute diarrhoea in Cuba. Twenty strains isolated from sporadic cases in nine different Cuban provinces were characterized. Serotyping, antibiotic-resistance typing, plasmid-typing and AFLP-typing were used to determine their suitability for use in epidemiological studies of S. flexneri. The predominant serotypes were serotype 6 (35%) and serotype 2 (35%). Eleven different plasmid profiles were detected (Diversity Index = 0.92). AFLP-typing discriminated 12 different patterns (DI = 0.95), these patterns were not coincident with plasmid-typing patterns. Both techniques combined distinguished 14 patterns among the 20 studied strains (DI = 0.99). There was no consistent relationship between plasmid-typing and AFLP-typing patterns or antibiotic-resistance typing patterns. Ninety-five percent of S. flexneri strains were multiresistant. PMID:12558326

  12. Improving AFLP analysis of large-scale patterns of genetic variation--a case study with the Central African lianas Haumania spp (Marantaceae) showing interspecific gene flow.

    PubMed

    Ley, A C; Hardy, O J

    2013-04-01

    AFLP markers are often used to study patterns of population genetic variation and gene flow because they offer a good coverage of the nuclear genome, but the reliability of AFLP scoring is critical. To assess interspecific gene flow in two African rainforest liana species (Haumania danckelmaniana, H. liebrechtsiana) where previous evidence of chloroplast captures questioned the importance of hybridization and species boundaries, we developed new AFLP markers and a novel approach to select reliable bands from their degree of reproducibility. The latter is based on the estimation of the broad-sense heritability of AFLP phenotypes, an improvement over classical scoring error rates, which showed that the polymorphism of most AFLP bands was affected by a substantial nongenetic component. Therefore, using a quantitative genetics framework, we also modified an existing estimator of pairwise kinship coefficient between individuals correcting for the limited heritability of markers. Bayesian clustering confirms the recognition of the two Haumania species. Nevertheless, the decay of the relatedness between individuals of distinct species with geographic distance demonstrates that hybridization affects the nuclear genome. In conclusion, although we showed that AFLP markers might be substantially affected by nongenetic factors, their analysis using the new methods developed considerably advanced our understanding of the pattern of gene flow in our model species. © 2013 Blackwell Publishing Ltd.

  13. Modified Primers for the Identification of Nonpathogenic Fusarium oxysporum Isolates That Have Biological Control Potential against Fusarium Wilt of Cucumber in Taiwan

    PubMed Central

    Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin

    2013-01-01

    Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289

  14. Primer and platform effects on 16S rRNA tag sequencing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tremblay, Julien; Singh, Kanwar; Fern, Alison

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

  15. Primer and platform effects on 16S rRNA tag sequencing

    DOE PAGES

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; ...

    2015-08-04

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

  16. A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis

    PubMed Central

    Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo

    2012-01-01

    In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223

  17. A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

    The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less

  18. A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

    DOE PAGES

    Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

    2015-12-09

    The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less

  19. Bootsie: estimation of coefficient of variation of AFLP data by bootstrap analysis

    USDA-ARS?s Scientific Manuscript database

    Bootsie is an English-native replacement for ASG Coelho’s “DBOOT” utility for estimating coefficient of variation of a population of AFLP marker data using bootstrapping. Bootsie improves on DBOOT by supporting batch processing, time-to-completion estimation, built-in graphs, and a suite of export t...

  20. Primer3_masker: integrating masking of template sequence with primer design software.

    PubMed

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-06-01

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

  1. Molecular characterization and identification of markers for toxic and non-toxic varieties of Jatropha curcas L. using RAPD, AFLP and SSR markers.

    PubMed

    Sudheer Pamidimarri, D V N; Singh, Sweta; Mastan, Shaik G; Patel, Jalpa; Reddy, Muppala P

    2009-07-01

    Jatropha curcas L., a multipurpose shrub has acquired significant economic importance for its seed oil which can be converted to biodiesel, is emerging as an alternative to petro-diesel. The deoiled seed cake remains after oil extraction is toxic and cannot be used as a feed despite having best nutritional contents. No quantitative and qualitative differences were observed between toxic and non-toxic varieties of J. curcas except for phorbol esters content. Development of molecular marker will enable to differentiate non-toxic from toxic variety in a mixed population and also help in improvement of the species through marker assisted breeding programs. The present investigation was undertaken to characterize the toxic and non-toxic varieties at molecular level and to develop PCR based molecular markers for distinguishing non-toxic from toxic or vice versa. The polymorphic markers were successfully identified specific to non-toxic and toxic variety using RAPD and AFLP techniques. Totally 371 RAPD, 1,442 AFLP markers were analyzed and 56 (15.09%) RAPD, 238 (16.49%) AFLP markers were found specific to either of the varieties. Genetic similarity between non-toxic and toxic verity was found to be 0.92 by RAPD and 0.90 by AFLP fingerprinting. In the present study out of 12 microsatellite markers analyzed, seven markers were found polymorphic. Among these seven, jcms21 showed homozygous allele in the toxic variety. The study demonstrated that both RAPD and AFLP techniques were equally competitive in identifying polymorphic markers and differentiating both the varieties of J. curcas. Polymorphism of SSR markers prevailed between the varieties of J. curcas. These RAPD and AFLP identified markers will help in selective cultivation of specific variety and along with SSRs these markers can be exploited for further improvement of the species through breeding and Marker Assisted Selection (MAS).

  2. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction

    PubMed Central

    2012-01-01

    Background Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of hits. Furthermore, although the BLAST program has been widely used for primer target detection, it is in fact not an ideal tool for this purpose as BLAST is a local alignment algorithm and does not necessarily return complete match information over the entire primer range. Results We present a new software tool called Primer-BLAST to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Primer-BLAST also supports placing primers based on exon/intron locations and excluding single nucleotide polymorphism (SNP) sites in primers. Conclusions We describe a robust and fully implemented general purpose primer design tool

  3. Analysis of Genetic Diversity and Structure Pattern of Indigofera Pseudotinctoria in Karst Habitats of the Wushan Mountains Using AFLP Markers.

    PubMed

    Fan, Yan; Zhang, Chenglin; Wu, Wendan; He, Wei; Zhang, Li; Ma, Xiao

    2017-10-16

    Indigofera pseudotinctoria Mats is an agronomically and economically important perennial legume shrub with a high forage yield, protein content and strong adaptability, which is subject to natural habitat fragmentation and serious human disturbance. Until now, our knowledge of the genetic relationships and intraspecific genetic diversity for its wild collections is still poor, especially at small spatial scales. Here amplified fragment length polymorphism (AFLP) technology was employed for analysis of genetic diversity, differentiation, and structure of 364 genotypes of I. pseudotinctoria from 15 natural locations in Wushan Montain, a highly structured mountain with typical karst landforms in Southwest China. We also tested whether eco-climate factors has affected genetic structure by correlating genetic diversity with habitat features. A total of 515 distinctly scoreable bands were generated, and 324 of them were polymorphic. The polymorphic information content (PIC) ranged from 0.694 to 0.890 with an average of 0.789 per primer pair. On species level, Nei's gene diversity ( H j ), the Bayesian genetic diversity index ( H B ) and the Shannon information index ( I ) were 0.2465, 0.2363 and 0.3772, respectively. The high differentiation among all sampling sites was detected ( F ST = 0.2217, G ST = 0.1746, G' ST = 0.2060, θ B = 0.1844), and instead, gene flow among accessions ( N m = 1.1819) was restricted. The population genetic structure resolved by the UPGMA tree, principal coordinate analysis, and Bayesian-based cluster analyses irrefutably grouped all accessions into two distinct clusters, i.e., lowland and highland groups. The population genetic structure resolved by the UPGMA tree, principal coordinate analysis, and Bayesian-based cluster analyses irrefutably grouped all accessions into two distinct clusters, i.e., lowland and highland groups. This structure pattern may indicate joint effects by the neutral evolution and natural selection. Restricted N m was

  4. Comparative analyses of genetic/epigenetic diversities and structures in a wild barley species (Hordeum brevisubulatum) using MSAP, SSAP and AFLP.

    PubMed

    Shan, X H; Li, Y D; Liu, X M; Wu, Y; Zhang, M Z; Guo, W L; Liu, B; Yuan, Y P

    2012-08-17

    We analyzed genetic diversity and population genetic structure of four artificial populations of wild barley (Hordeum brevisubulatum); 96 plants collected from the Songnen Prairie in northeastern China were analyzed using amplified fragment length polymorphism (AFLP), specific-sequence amplified polymorphism (SSAP) and methylation-sensitive amplified polymorphism (MSAP) markers. Indices of (epi-)genetic diversity, (epi-)genetic distance, gene flow, genotype frequency, cluster analysis, PCA analysis and AMOVA analysis generated from MSAP, AFLP and SSAP markers had the same trend. We found a high level of correlation in the artificial populations between MSAP, SSAP and AFLP markers by the Mantel test (r > 0.8). This is incongruent with previous findings showing that there is virtually no correlation between DNA methylation polymorphism and classical genetic variation; the high level of genetic polymorphism could be a result of epigenetic regulation. We compared our results with data from natural populations. The population diversity of the artificial populations was lower. However, different from what was found using AFLP and SSAP, based on MSAP results the methylation polymorphism of the artificial populations was not significantly reduced. This leads us to suggest that the DNA methylation pattern change in H. brevisubulatum populations is not only related to DNA sequence variation, but is also regulated by other controlling systems.

  5. Genetic diversity of sweet sorghum germplasm in Mexico using AFLP and SSR markers

    USDA-ARS?s Scientific Manuscript database

    The objective of this work was to evaluate the diversity and genetic relationships between lines and varieties of the sweet sorghum (Sorghum bicolor) germplasm bank of the National Institute for Forestry, Agriculture and Livestock Research, Mexico, using AFLP and SSR markers. The molecular markers ...

  6. Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

    PubMed Central

    Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

    2017-01-01

    Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

  7. Characterization and transferability of microsatellite markers of the cultivated peanut (Arachis hypogaea)

    PubMed Central

    Gimenes, Marcos A; Hoshino, Andrea A; Barbosa, Andrea VG; Palmieri, Dario A; Lopes, Catalina R

    2007-01-01

    Background The genus Arachis includes Arachis hypogaea (cultivated peanut) and wild species that are used in peanut breeding or as forage. Molecular markers have been employed in several studies of this genus, but microsatellite markers have only been used in few investigations. Microsatellites are very informative and are useful to assess genetic variability, analyze mating systems and in genetic mapping. The objectives of this study were to develop A. hypogaea microsatellite loci and to evaluate the transferability of these markers to other Arachis species. Results Thirteen loci were isolated and characterized using 16 accessions of A. hypogaea. The level of variation found in A. hypogaea using microsatellites was higher than with other markers. Cross-transferability of the markers was also high. Sequencing of the fragments amplified using the primer pair Ah11 from 17 wild Arachis species showed that almost all wild species had similar repeated sequence to the one observed in A. hypogaea. Sequence data suggested that there is no correlation between taxonomic relationship of a wild species to A. hypogaea and the number of repeats found in its microsatellite loci. Conclusion These results show that microsatellite primer pairs from A. hypogaea have multiple uses. A higher level of variation among A. hypogaea accessions can be detected using microsatellite markers in comparison to other markers, such as RFLP, RAPD and AFLP. The microsatellite primers of A. hypogaea showed a very high rate of transferability to other species of the genus. These primer pairs provide important tools to evaluate the genetic variability and to assess the mating system in Arachis species. PMID:17326826

  8. Genetic variability of Brazilian isolates of Alternaria alternata detected by AFLP and RAPD techniques

    PubMed Central

    Dini-Andreote, Francisco; Pietrobon, Vivian Cristina; Andreote, Fernando Dini; Romão, Aline Silva; Spósito, Marcel Bellato; Araújo, Welington Luiz

    2009-01-01

    The Alternaria brown spot (ABS) is a disease caused in tangerine plants and its hybrids by the fungus Alternaria alternata f. sp. citri which has been found in Brazil since 2001. Due to the recent occurrence in Brazilian orchards, the epidemiology and genetic variability of this pathogen is still an issue to be addressed. Here it is presented a survey about the genetic variability of this fungus by the characterization of twenty four pathogenic isolates of A. alternata f. sp. citri from citrus plants and four endophytic isolates from mango (one Alternaria tenuissima and three Alternaria arborescens). The application of two molecular markers Random Amplified Polymorphic DNA (RAPD) and Amplified Fragment Length Polymorphism (AFLP) had revealed the isolates clustering in distinct groups when fingerprintings were analyzed by Principal Components Analysis (PCA). Despite the better assessment of the genetic variability through the AFLP, significant modifications in clusters components were not observed, and only slight shifts in the positioning of isolates LRS 39/3 and 25M were observed in PCA plots. Furthermore, in both analyses, only the isolates from lemon plants revealed to be clustered, differently from the absence of clustering for other hosts or plant tissues. Summarizing, both RAPD and AFLP analyses were both efficient to detect the genetic variability within the population of the pathogenic fungus Alternaria spp., supplying information on the genetic variability of this species as a basis for further studies aiming the disease control. PMID:24031413

  9. [AFLP Analysis of Genetic Diversity in the Genus Mallus Mill. (Apple)].

    PubMed

    Savelyeva, E N; Kudryavtsev, A M

    2015-10-01

    The first molecular genetic analysis of the apple species and varieties from Russian collections with the AFLP marker system was performed in order to study the genetic diversity of the genus Malus, as well as to clarify the phylogeny and solve some systematic issues of the genus. Nienty-one apple accessions, including species from five sections of the genus Malus and hybrid species, were examined. The level of polymorphism constituted 90.2%. It was demonstrated that the classical taxonomy of the genus Malus, which identifies five sections based on differences in their morphological characters, is valid and may be used to classify apple species. The species assignment of the Antonovka landraces was established. All of them belonged to the species M. domestica. It was demonstrated that the Yakutskaya apple variety was a domesticated species of the section Gymnomeles, presumably, M. baccata. AFLP analysis confirmed the hybrid nature of many species. The relationships between apple varieties of the Golden group with American wild species were demonstrated. The data suggest that the species M. sieversii was the ancestor of not only the domestic apple but also of other species of the Malus sections.

  10. Evaluation of genetic diversity of Panicum turgidum Forssk from Saudi Arabia.

    PubMed

    Assaeed, Abdulaziz M; Al-Faifi, Sulieman A; Migdadi, Hussein M; El-Bana, Magdy I; Al Qarawi, Abdulaziz A; Khan, Mohammad Altaf

    2018-01-01

    The genetic diversity of 177 accessions of Panicum turgidum Forssk, representing ten populations collected from four geographical regions in Saudi Arabia, was analyzed using amplified fragment length polymorphism (AFLP) markers. A set of four primer-pairs with two/three selective nucleotides scored 836 AFLP amplified fragments (putative loci/genome landmarks), all of which were polymorphic. Populations collected from the southern region of the country showed the highest genetic diversity parameters, whereas those collected from the central regions showed the lowest values. Analysis of molecular variance (AMOVA) revealed that 78% of the genetic variability was attributable to differences within populations. Pairwise values for population differentiation and genetic structure were statistically significant for all variances. The UPGMA dendrogram, validated by principal coordinate analysis-grouped accessions, corresponded to the geographical origin of the accessions. Mantel's test showed that there was a significant correlation between the genetic and geographical distances ( r  = 0.35, P  < 0.04). In summary, the AFLP assay demonstrated the existence of substantial genetic variation in P. turgidum . The relationship between the genetic diversity and geographical source of P. turgidum populations of Saudi Arabia, as revealed through this comprehensive study, will enable effective resource management and restoration of new areas without compromising adaptation and genetic diversity.

  11. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

    NASA Astrophysics Data System (ADS)

    Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

    2016-03-01

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.

  12. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

    PubMed Central

    Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

    2016-01-01

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity. PMID:26965911

  13. Relationship of European Persimmon (Diospyros kaki Thunb.) Cultivars to Asian Cultivars, Characterized Using AFLPs.

    USDA-ARS?s Scientific Manuscript database

    Sixty one persimmon (Diospyros kaki Thunb.) selections, including 17 Italian, 11 Spanish, 13 Japanese, six Korean, five Chinese, one Israeli, and eight of unknown origin, were evaluated for genetic differences by AFLP analysis. Relationships among cultivars were evaluated by UPGMA clustering, Neigh...

  14. AFLP genome scan in the black rat (Rattus rattus) from Madagascar: detecting genetic markers undergoing plague-mediated selection.

    PubMed

    Tollenaere, C; Duplantier, J-M; Rahalison, L; Ranjalahy, M; Brouat, C

    2011-03-01

    The black rat (Rattus rattus) is the main reservoir of plague (Yersinia pestis infection) in Madagascar's rural zones. Black rats are highly resistant to plague within the plague focus (central highland), whereas they are susceptible where the disease is absent (low altitude zone). To better understand plague wildlife circulation and host evolution in response to a highly virulent pathogen, we attempted to determine genetic markers associated with plague resistance in this species. To this purpose, we combined a population genomics approach and an association study, both performed on 249 AFLP markers, in Malagasy R. rattus. Simulated distributions of genetic differentiation were compared to observed data in four independent pairs, each consisting of one population from the plague focus and one from the plague-free zone. We found 22 loci (9% of 249) with higher differentiation in at least two independent population pairs or with combining P-values over the four pairs significant. Among the 22 outlier loci, 16 presented significant association with plague zone (plague focus vs. plague-free zone). Population genetic structure inferred from outlier loci was structured by plague zone, whereas the neutral loci dataset revealed structure by geography (eastern vs. western populations). A phenotype association study revealed that two of the 22 loci were significantly associated with differentiation between dying and surviving rats following experimental plague challenge. The 22 outlier loci identified in this study may undergo plague selective pressure either directly or more probably indirectly due to hitchhiking with selected loci. © 2010 Blackwell Publishing Ltd.

  15. Genetic diversity and structure of Brazilian ginger germplasm (Zingiber officinale) revealed by AFLP markers.

    PubMed

    Blanco, Eleonora Zambrano; Bajay, Miklos Maximiliano; Siqueira, Marcos Vinícius Bohrer Monteiro; Zucchi, Maria Imaculada; Pinheiro, José Baldin

    2016-12-01

    Ginger is a vegetable with medicinal and culinary properties widely cultivated in the Southern and Southeastern Brazil. The knowledge of ginger species' genetic variability is essential to direct correctly future studies of conservation and genetic improvement, but in Brazil, little is known about this species' genetic variability. In this study, we analyzed the genetic diversity and structure of 55 Brazilian accessions and 6 Colombian accessions of ginger, using AFLP (Amplified Fragment Length Polymorphism) molecular markers. The molecular characterization was based on 13 primers combinations, which generated an average of 113.5 polymorphic loci. The genetic diversity estimates of Nei (Hj), Shannon-Weiner index (I) and an effective number of alleles (n e ) were greater in the Colombian accessions in relation to the Brazilian accessions. The analysis of molecular variance showed that most of the genetic variation occurred between the two countries while in the Brazilian populations there is no genetic structure and probably each region harbors 100 % of genetic variation found in the samples. The bayesian model-based clustering and the dendrogram using the dissimilarity's coefficient of Jaccard were congruent with each other and showed that the Brazilian accessions are highly similar between themselves, regardless of the geographic region of origin. We suggested that the exploration of the interspecific variability and the introduction of new varieties of Z.officinale are viable alternatives for generating diversity in breeding programs in Brazil. The introduction of new genetic materials will certainly contribute to a higher genetic basis of such crop.

  16. Genetic differentiation in Pyrenophora teres f. teres populations from Syria and Tunisia as assessed by AFLP markers.

    PubMed

    Bouajila, A; Zoghlami, N; Murad, S; Baum, M; Ghorbel, A; Nazari, K

    2013-06-01

    To investigate the level of genetic differentiation and diversity among Pyrenophora teres isolate populations originating from different agro-ecological areas of Syria and Tunisia and to determine the potential of AFLP profiling in genotyping Pyrenophora teres f. teres. In this study, AFLP markers have been employed to identify patterns of population structure in 20 Pyrenophora teres f. teres populations from Syria and Tunisia. Ninety-four isolates were studied by the use of a protocol that involved stringent PCR amplification of fragments derived from digestion of genomic DNA with restriction enzymes EcoRI and MesI. Based on 401 amplified polymorphic DNA markers (AFLP), variance analyses indicated that most of the variation was partitioned within rather than between populations. Genotypic diversity (GD) was high for populations from Rihane, local landraces and different agro-ecological zones (GD = 0·75-0·86). There was high genetic differentiation among pathogen populations from different host populations in Syria (Gst  = 0·31, ht = 0·190) and Tunisia (Gst  = 0·39, ht = 0·263), which may be partly explained by the low gene flow around the areas sampled. A phenetic tree revealed three groups with high bootstrap values (55, 68, 76) and reflected the grouping of isolates based on host, or agro-ecological areas. AFLP profiling is an effective method for typing the genetically diverse pathogen Pyrenophora teres f. teres. The study represents a comparative analysis of the genetic diversity in P. teres isolates from two countries spanning two continents and also shows that several distinct P. teres genotypes may be found in a given environment. The implications of these findings for Pyrenophora teres f. teres evolutionary potential and net blotch-resistance breeding in Syria and Tunisia were also discussed. © 2012 The Society for Applied Microbiology.

  17. New Arsenate Reductase Gene (arrA) PCR Primers for Diversity Assessment and Quantification in Environmental Samples

    PubMed Central

    Sorensen, Darwin L.; Dupont, R. Ryan

    2016-01-01

    ABSTRACT The extent of arsenic contamination in drinking water and its potential threat to human health have resulted in considerable research interest in the microbial species responsible for arsenic reduction. The arsenate reductase gene (arrA), an important component of the microbial arsenate reduction system, has been widely used as a biomarker to study arsenate-reducing microorganisms. A new primer pair was designed and evaluated for quantitative PCR (qPCR) and high-throughput sequencing of the arrA gene, because currently available PCR primers are not suitable for these applications. The primers were evaluated in silico and empirically tested for amplification of arrA genes in clones and for amplification and high-throughput sequencing of arrA genes from soil and groundwater samples. In silico, this primer pair matched (≥90% DNA identity) 86% of arrA gene sequences from GenBank. Empirical evaluation showed successful amplification of arrA gene clones of diverse phylogenetic groups, as well as amplification and high-throughput sequencing of independent soil and groundwater samples without preenrichment, suggesting that these primers are highly specific and can amplify a broad diversity of arrA genes. The arrA gene diversity from soil and groundwater samples from the Cache Valley Basin (CVB) in Utah was greater than anticipated. We observed a significant correlation between arrA gene abundance, quantified through qPCR, and reduced arsenic (AsIII) concentrations in the groundwater samples. Furthermore, we demonstrated that these primers can be useful for studying the diversity of arsenate-reducing microbial communities and the ways in which their relative abundance in groundwater may be associated with different groundwater quality parameters. IMPORTANCE Arsenic is a major drinking water contaminant that threatens the health of millions of people worldwide. The extent of arsenic contamination and its potential threat to human health have resulted in

  18. Novel ITS1 Fungal Primers for Characterization of the Mycobiome

    PubMed Central

    Usyk, Mykhaylo; Zolnik, Christine P.; Patel, Hitesh; Levi, Michael H.

    2017-01-01

    ABSTRACT Studies of the human microbiome frequently omit characterization of fungal communities (the mycobiome), which limits our ability to investigate how fungal communities influence human health. The internal transcribed spacer 1 (ITS1) region of the eukaryotic ribosomal cluster has features allowing for wide taxonomic coverage and has been recognized as a suitable barcode region for species-level identification of fungal organisms. We developed custom ITS1 primer sets using iterative alignment refinement. Primer performance was evaluated using in silico testing and experimental testing of fungal cultures and human samples. Using an expanded novel reference database, SIS (18S-ITS1-5.8S), the newly designed primers showed an average in silico taxonomic coverage of 79.9% ± 7.1% compared to a coverage of 44.6% ± 13.2% using previously published primers (P = 0.05). The newly described primer sets recovered an average of 21,830 ± 225 fungal reads from fungal isolate culture samples, whereas the previously published primers had an average of 3,305 ± 1,621 reads (P = 0.03). Of note was an increase in the taxonomic coverage of the Candida genus, which went from a mean coverage of 59.5% ± 13% to 100.0% ± 0.0% (P = 0.0015) comparing the previously described primers to the new primers, respectively. The newly developed ITS1 primer sets significantly improve general taxonomic coverage of fungal communities infecting humans and increased read depth by an order of magnitude over the best-performing published primer set tested. The overall best-performing primer pair in terms of taxonomic coverage and read recovery, ITS1-30F/ITS1-217R, will aid in advancing research in the area of the human mycobiome. IMPORTANCE The mycobiome constitutes all the fungal organisms within an environment or biological niche. The fungi are eukaryotes, are extremely heterogeneous, and include yeasts and molds that colonize humans as part of the microbiome. In addition, fungi can also infect

  19. AFLPs and Mitochondrial Haplotypes Reveal Local Adaptation to Extreme Thermal Environments in a Freshwater Gastropod

    PubMed Central

    Quintela, María; Johansson, Magnus P.; Kristjánsson, Bjarni K.; Barreiro, Rodolfo; Laurila, Anssi

    2014-01-01

    The way environmental variation shapes neutral and adaptive genetic variation in natural populations is a key issue in evolutionary biology. Genome scans allow the identification of the genetic basis of local adaptation without previous knowledge of genetic variation or traits under selection. Candidate loci for divergent adaptation are expected to show higher FST than neutral loci influenced solely by random genetic drift, migration and mutation. The comparison of spatial patterns of neutral markers and loci under selection may help disentangle the effects of gene flow, genetic drift and selection among populations living in contrasting environments. Using the gastropod Radix balthica as a system, we analyzed 376 AFLP markers and 25 mtDNA COI haplotypes for candidate loci and associations with local adaptation among contrasting thermal environments in Lake Mývatn, a volcanic lake in northern Iceland. We found that 2% of the analysed AFLP markers were under directional selection and 12% of the mitochondrial haplotypes correlated with differing thermal habitats. The genetic networks were concordant for AFLP markers and mitochondrial haplotypes, depicting distinct topologies at neutral and candidate loci. Neutral topologies were characterized by intense gene flow revealed by dense nets with edges connecting contrasting thermal habitats, whereas the connections at candidate loci were mostly restricted to populations within each thermal habitat and the number of edges decreased with temperature. Our results suggest microgeographic adaptation within Lake Mývatn and highlight the utility of genome scans in detecting adaptive divergence. PMID:25007329

  20. Analysis of short tandem repeat polymorphisms using infrared fluorescence with M18 tailed primers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oetting, W.S.; Wiesner, G.; Laken, S.

    The use of short tandem repeat polymorphisms (STRPs) are becoming increasingly important as markers for linkage analysis due to their large numbers of the human genome and their high degree of polymorphism. Fluorescence based detection of the STRP pattern using the LI-COR model 4000S automated DNA sequencer eliminates the need for radioactivity and produces a digitized image that can be used for the analysis of the polymorphisms. In an effort to reduce the cost of STRP analysis, we have synthesized primers with a 19 bp extension complementary to the sequence of the M13 primer on the 5{prime} end of onemore » of the two primers used in the amplification of the STRP instead of using primers with direct conjugation of the infrared fluorescent dye. Up to 5 primer pairs can be multiplexed together with the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye. Comparisons between primers that have been directly conjugated to the fluor with those having the M13 sequence extension show no difference in the ability to determine the STRP pattern. At present, the entire Weber 4A set of STRP markers is available with the M13 5{prime} extension. We are currently using this technique for linkage analysis of familial breast cancer and asthma. The combination of STRP analysis using fluorescence detection will allow this technique to be fully automated for allele scoring and linkage analysis.« less

  1. CODEHOP (COnsensus-DEgenerate Hybrid Oligonucleotide Primer) PCR primer design

    PubMed Central

    Rose, Timothy M.; Henikoff, Jorja G.; Henikoff, Steven

    2003-01-01

    We have developed a new primer design strategy for PCR amplification of distantly related gene sequences based on consensus-degenerate hybrid oligonucleotide primers (CODEHOPs). An interactive program has been written to design CODEHOP PCR primers from conserved blocks of amino acids within multiply-aligned protein sequences. Each CODEHOP consists of a pool of related primers containing all possible nucleotide sequences encoding 3–4 highly conserved amino acids within a 3′ degenerate core. A longer 5′ non-degenerate clamp region contains the most probable nucleotide predicted for each flanking codon. CODEHOPs are used in PCR amplification to isolate distantly related sequences encoding the conserved amino acid sequence. The primer design software and the CODEHOP PCR strategy have been utilized for the identification and characterization of new gene orthologs and paralogs in different plant, animal and bacterial species. In addition, this approach has been successful in identifying new pathogen species. The CODEHOP designer (http://blocks.fhcrc.org/codehop.html) is linked to BlockMaker and the Multiple Alignment Processor within the Blocks Database World Wide Web (http://blocks.fhcrc.org). PMID:12824413

  2. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection

    PubMed Central

    O’Halloran, Damien M.

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  3. Differentiation of mycoplasmalike organisms (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of the apple proliferation MLO.

    PubMed Central

    Jarausch, W; Saillard, C; Dosba, F; Bové, J M

    1994-01-01

    A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180

  4. PrimerStation: a highly specific multiplex genomic PCR primer design server for the human genome

    PubMed Central

    Yamada, Tomoyuki; Soma, Haruhiko; Morishita, Shinichi

    2006-01-01

    PrimerStation () is a web service that calculates primer sets guaranteeing high specificity against the entire human genome. To achieve high accuracy, we used the hybridization ratio of primers in liquid solution. Calculating the status of sequence hybridization in terms of the stringent hybridization ratio is computationally costly, and no web service checks the entire human genome and returns a highly specific primer set calculated using a precise physicochemical model. To shorten the response time, we precomputed candidates for specific primers using a massively parallel computer with 100 CPUs (SunFire 15 K) about 3 months in advance. This enables PrimerStation to search and output qualified primers interactively. PrimerStation can select highly specific primers suitable for multiplex PCR by seeking a wider temperature range that minimizes the possibility of cross-reaction. It also allows users to add heuristic rules to the primer design, e.g. the exclusion of single nucleotide polymorphisms (SNPs) in primers, the avoidance of poly(A) and CA-repeats in the PCR products, and the elimination of defective primers using the secondary structure prediction. We performed several tests to verify the PCR amplification of randomly selected primers for ChrX, and we confirmed that the primers amplify specific PCR products perfectly. PMID:16845094

  5. Development of strain-specific PCR primers for quantitative detection of Bacillus mesentericus strain TO-A in human feces.

    PubMed

    Sato, Naoki; Seo, Genichiro; Benno, Yoshimi

    2014-01-01

    Strain-specific polymerase chain reaction (PCR) primers for detection of Bacillus mesentericus strain TO-A (BM TO-A) were developed. The randomly amplified polymorphic DNA (RAPD) technique was used to produce potential strain-specific markers. A 991-bp RAPD marker found to be strain-specific was sequenced, and two primer pairs specific to BM TO-A were constructed based on this sequence. In addition, we explored a more specific DNA region using inverse PCR, and designed a strain-specific primer set for use in real-time quantitative PCR (qPCR). These primer pairs were tested against 25 Bacillus subtilis strains and were found to be strain-specific. After examination of the detection limit and linearity of detection of BM TO-A in feces, the qPCR method and strain-specific primers were used to quantify BM TO-A in the feces of healthy volunteers who had ingested 3×10(8) colony forming unit (CFU) of BM TO-A per day in tablets. During the administration period, BM TO-A was detected in the feces of all 24 subjects, and the average number of BM TO-A detected using the culture method and qPCR was about 10(4.8) and 10(5.8) cells per gram of feces, respectively. Using the qPCR method, BM TO-A was detected in the feces of half of the subjects 3 d after withdrawal, and was detected in the feces of only one subject 1 week after withdrawal. These results suggest that the qPCR method using BM TO-A strain-specific primers is useful for the quantitative detection of this strain in feces.

  6. Palaeopolyploidy, spatial structure and conservation genetics of the narrow steppe plant Vella pseudocytisus subsp. paui (Vellinae, Cruciferae).

    PubMed

    Pérez-Collazos, Ernesto; Catalán, Pilar

    2006-04-01

    Vella pseudocytisus subsp. paui (Cruciferae) is a narrow endemic plant to the Teruel province (eastern Spain), which is listed in the National Catalogue of Endangered Species. Two distinct ploidy levels (diploid, 2n = 34, and tetraploid, 2n = 68) have been reported for this taxon that belongs to the core subtribe Vellinae, a western Mediterranean group of shrubby taxa with a chromosome base number of x = 17. Allozyme and AFLP analyses were conducted (a) to test for the ploidy and putative palaeo-allopolyploid origin of this taxon, (b) to explore levels of genetic diversity and spatial structure of its populations, and (c) to address in-situ and ex-situ strategies for its conservation. Six populations that covered the entire geographical range of this taxon were sampled and examined for 19 allozyme loci and three AFLP primer pair combinations. In addition, the gametic progenies of five individuals were analysed for two allozyme loci that showed fixed heterozygosity. Multiple banded allozyme profiles for most of the surveyed loci indicated the polyploidy of this taxon. Co-inherited fixed heterozygous patterns were exhibited by the gametophytic tissues of the mother plants. Both allozyme and AFLP markers detected high levels of genetic diversity, and a strong micro-spatial genetic structure was recovered from AFLP phenetic analyses and Mantel correlograms. Allozyme data support the hypothesis of an allotetraploid origin of Vella pseudocytisus subsp. paui that could be representative of other taxa of the core Vellinae group. AFLP data distinguished three geographically distinct groups with no genetic interaction among them. Allotetraploidy and outcrossing reproduction have probably contributed to maintenance of high levels of genetic variability of the populations, whereas habitat fragmentation may have enhanced the high genetic isolation observed among groups. In-situ microgenetic reserves and a selective sampling of germplasm stocks for ex-situ conservation of this

  7. Searching for Beta-Haemolysin hlb Gene in Staphylococcus pseudintermedius with Species-Specific Primers.

    PubMed

    Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin

    2016-07-01

    The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification.

  8. PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes

    DOE PAGES

    Yoon, Hyejin; Leitner, Thomas

    2014-12-17

    Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-Mmore » finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.« less

  9. Genetic diversity in wild populations of Paulownia fortune.

    PubMed

    Li, H Y; Ru, G X; Zhang, J; Lu, Y Y

    2014-11-01

    The genetic diversities of 16 Paulownia fortunei populations involving 143 individuals collected from 6 provinces in China were analyzed using amplified fragment length polymorphism (AFLP). A total of 9 primer pairs with 1169 polymorphic loci were screened out, and each pair possessed 132 bands on average. The percentage of polymorphic bands (98.57%), the effective number of alleles (1.2138-1.2726), Nei's genetic diversity (0.1566-0.1887), and Shannon's information index (0.2692-0.3117) indicated a plentiful genetic diversity and different among Paulownia fortunei populations. The genetic differentiation coefficient between populations was 0.2386, while the gene flow was 1.0954, and the low gene exchange promoted genetic differentiation. Analysis of variance indicated that genetic variation mainly occurred within populations (81.62% of total variation) rather than among populations (18.38%). The 16 populations were divided by unweighted pair-group method with arithmetic means (UPGMA) into 4 groups with obvious regionalism, in which the populations with close geographical locations (latitude) were clustered together.

  10. Polyacid macromolecule primers

    DOEpatents

    Sugama, Toshifumi

    1989-01-01

    Hydrophylic polyacids, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests.

  11. Diversity Measures in Environmental Sequences Are Highly Dependent on Alignment Quality—Data from ITS and New LSU Primers Targeting Basidiomycetes

    PubMed Central

    Fischer, Christiane; Daniel, Rolf; Wubet, Tesfaye

    2012-01-01

    The ribosomal DNA comprised of the ITS1-5.8S-ITS2 regions is widely used as a fungal marker in molecular ecology and systematics but cannot be aligned with confidence across genetically distant taxa. In order to study the diversity of Agaricomycotina in forest soils, we designed primers targeting the more alignable 28S (LSU) gene, which should be more useful for phylogenetic analyses of the detected taxa. This paper compares the performance of the established ITS1F/4B primer pair, which targets basidiomycetes, to that of two new pairs. Key factors in the comparison were the diversity covered, off-target amplification, rarefaction at different Operational Taxonomic Unit (OTU) cutoff levels, sensitivity of the method used to process the alignment to missing data and insecure positional homology, and the congruence of monophyletic clades with OTU assignments and BLAST-derived OTU names. The ITS primer pair yielded no off-target amplification but also exhibited the least fidelity to the expected phylogenetic groups. The LSU primers give complementary pictures of diversity, but were more sensitive to modifications of the alignment such as the removal of difficult-to align stretches. The LSU primers also yielded greater numbers of singletons but also had a greater tendency to produce OTUs containing sequences from a wider variety of species as judged by BLAST similarity. We introduced some new parameters to describe alignment heterogeneity based on Shannon entropy and the extent and contents of the OTUs in a phylogenetic tree space. Our results suggest that ITS should not be used when calculating phylogenetic trees from genetically distant sequences obtained from environmental DNA extractions and that it is inadvisable to define OTUs on the basis of very heterogeneous alignments. PMID:22363808

  12. Molecular analysis of post-harvest withering in grape by AFLP transcriptional profiling

    PubMed Central

    Zamboni, Anita; Minoia, Leone; Ferrarini, Alberto; Tornielli, Giovanni Battista; Zago, Elisa; Delledonne, Massimo; Pezzotti, Mario

    2008-01-01

    Post-harvest withering of grape berries is used in the production of dessert and fortified wines to alter must quality characteristics and increase the concentration of simple sugars. The molecular processes that occur during withering are poorly understood, so a detailed transcriptomic analysis of post-harvest grape berries was carried out by AFLP-transcriptional profiling analysis. This will help to elucidate the molecular mechanisms of berry withering and will provide an opportunity to select markers that can be used to follow the drying process and evaluate different drying techniques. AFLP-TP identified 699 withering-specific genes, 167 and 86 of which were unique to off-plant and on-plant withering, respectively. Although similar molecular events were revealed in both withering processes, it was apparent that off-plant withering induced a stronger dehydration stress response resulting in the high level expression of genes involved in stress protection mechanisms, such as dehydrin and osmolite accumulation. Genes involved in hexose metabolism and transport, cell wall composition, and secondary metabolism (particularly the phenolic and terpene compound pathways) were similarly regulated in both processes. This work provides the first comprehensive analysis of the molecular events underpinning post-harvest withering and could help to define markers for different withering processes. PMID:19010774

  13. Molecular analysis of post-harvest withering in grape by AFLP transcriptional profiling.

    PubMed

    Zamboni, Anita; Minoia, Leone; Ferrarini, Alberto; Tornielli, Giovanni Battista; Zago, Elisa; Delledonne, Massimo; Pezzotti, Mario

    2008-01-01

    Post-harvest withering of grape berries is used in the production of dessert and fortified wines to alter must quality characteristics and increase the concentration of simple sugars. The molecular processes that occur during withering are poorly understood, so a detailed transcriptomic analysis of post-harvest grape berries was carried out by AFLP-transcriptional profiling analysis. This will help to elucidate the molecular mechanisms of berry withering and will provide an opportunity to select markers that can be used to follow the drying process and evaluate different drying techniques. AFLP-TP identified 699 withering-specific genes, 167 and 86 of which were unique to off-plant and on-plant withering, respectively. Although similar molecular events were revealed in both withering processes, it was apparent that off-plant withering induced a stronger dehydration stress response resulting in the high level expression of genes involved in stress protection mechanisms, such as dehydrin and osmolite accumulation. Genes involved in hexose metabolism and transport, cell wall composition, and secondary metabolism (particularly the phenolic and terpene compound pathways) were similarly regulated in both processes. This work provides the first comprehensive analysis of the molecular events underpinning post-harvest withering and could help to define markers for different withering processes.

  14. Identification of Genes Related to Paulownia Witches’ Broom by AFLP and MSAP

    PubMed Central

    Cao, Xibing; Fan, Guoqiang; Deng, Minjie; Zhao, Zhenli; Dong, Yanpeng

    2014-01-01

    DNA methylation is believed to play important roles in regulating gene expression in plant growth and development. Paulownia witches’ broom (PaWB) infection has been reported to be related to gene expression changes in paulownia plantlets. To determine whether DNA methylation is associated with gene expression changes in response to phytoplasma, we investigated variations in genomic DNA sequence and methylation in PaWB plantlets treated with methyl methane sulfonate (MMS) using amplified fragment length polymorphism (AFLP) and methylation-sensitive amplification polymorphism (MSAP) techniques, respectively. The results indicated that PaWB seedings recovered a normal morphology after treatment with more than 15 mg·L−1 MMS. PaWB infection did not cause changes of the paulownia DNA sequence at the AFLP level; However, DNA methylation levels and patterns were altered. Quantitative real-time PCR (qRT-PCR) showed that three of the methylated genes were up-regulated and three were down-regulated in the MMS-treated PaWB plantlets that had regained healthy morphology. These six genes might be involved in transcriptional regulation, plant defense, signal transduction and energy. The possible roles of these genes in PaWB are discussed. The results showed that changes of DNA methylation altered gene expression levels, and that MSAP might help identify genes related to PaWB. PMID:25196603

  15. Identification of genes related to Paulownia witches' broom by AFLP and MSAP.

    PubMed

    Cao, Xibing; Fan, Guoqiang; Deng, Minjie; Zhao, Zhenli; Dong, Yanpeng

    2014-08-21

    DNA methylation is believed to play important roles in regulating gene expression in plant growth and development. Paulownia witches' broom (PaWB) infection has been reported to be related to gene expression changes in paulownia plantlets. To determine whether DNA methylation is associated with gene expression changes in response to phytoplasma, we investigated variations in genomic DNA sequence and methylation in PaWB plantlets treated with methyl methane sulfonate (MMS) using amplified fragment length polymorphism (AFLP) and methylation-sensitive amplification polymorphism (MSAP) techniques, respectively. The results indicated that PaWB seedings recovered a normal morphology after treatment with more than 15 mg·L(-1) MMS. PaWB infection did not cause changes of the paulownia DNA sequence at the AFLP level; However, DNA methylation levels and patterns were altered. Quantitative real-time PCR (qRT-PCR) showed that three of the methylated genes were up-regulated and three were down-regulated in the MMS-treated PaWB plantlets that had regained healthy morphology. These six genes might be involved in transcriptional regulation, plant defense, signal transduction and energy. The possible roles of these genes in PaWB are discussed. The results showed that changes of DNA methylation altered gene expression levels, and that MSAP might help identify genes related to PaWB.

  16. Polyacid macromolecule primers

    DOEpatents

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  17. Comparative ITS and AFLP Analysis of Diploid Cardamine (Brassicaceae) Taxa from Closely Related Polyploid Complexes

    PubMed Central

    MARHOLD, KAROL; LIHOVÁ, JUDITA; PERNÝ, MARIÁN; BLEEKER, WALTER

    2004-01-01

    • Background and Aims Diploid representatives from the related polyploid complexes of Cardamine amara, C. pratensis and C. raphanifolia (Brassicaceae), were studied to elucidate phylogenetic relationships among the complexes and among the individual taxa included. • Methods Two independent molecular data sets were used: nucleotide sequences from the internal transcribed spacers (ITS) of nrDNA, and amplified fragment length polymorphism (AFLP) markers. Seventeen diploid taxa from the studied groups were sampled. • Key Results Both ITS and AFLP analyses provided congruent results in inferred relationships, and revealed two main lineages. While the C. amara group, consisting of C. wiedemanniana and four subspecies of C. amara, was resolved as a well‐supported monophyletic group, taxa from the C. pratensis and C. tenera groups (the latter representing diploid taxa of the complex of C. raphanifolia) all appeared together in a single clade/cluster with no support for the recognition of either of the groups. Intra‐individual polymorphisms and patterns of nucleotide variation in the ITS region in C. uliginosa and C. tenera, together with the distribution of AFLP bands, indicate ancient hybridization and introgression among these Caucasian diploids. • Conclusions The lack of supported hierarchical structure suggests that extensive reticulate evolution between these groups, even at the diploid level, has occurred (although an alternative explanation, namely ancestral polymorphism in ITS data, cannot be completely excluded). Several implications for the investigation of the polyploid complexes of concern are drawn. When tracing origins of polyploid taxa, a much more complex scenario should be expected, taking into account all relatives as potential parents, irrespective of the group in which they are classified. PMID:15037449

  18. Improved Efficiency and Robustness in qPCR and Multiplex End-Point PCR by Twisted Intercalating Nucleic Acid Modified Primers

    PubMed Central

    Schneider, Uffe Vest; Mikkelsen, Nikolaj Dam; Lindqvist, Anja; Okkels, Limei Meng; Jøhnk, Nina; Lisby, Gorm

    2012-01-01

    We introduce quantitative polymerase chain reaction (qPCR) primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA) molecule at the 5′-end. In qPCR, the 5′-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5′-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5′-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5′-o-TINA modified primers allows for a further reduction (>45% or approximately one hour) in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5′-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5′-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions. PMID:22701644

  19. Limited-life cartridge primers

    DOEpatents

    Makowiecki, Daniel M.; Rosen, Robert S.

    1998-01-01

    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  20. Limited-life cartridge primers

    DOEpatents

    Makowiecki, Daniel M.; Rosen, Robert S.

    2005-04-19

    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  1. Limited-life cartridge primers

    DOEpatents

    Makowiecki, D.M.; Rosen, R.S.

    1998-06-30

    A cartridge primer is described which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML`s would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers. 10 figs.

  2. Environmental sampling of Ceratonia siliqua (carob) trees in Spain reveals the presence of the rare Cryptococcus gattii genotype AFLP7/VGIV.

    PubMed

    Linares, Carlos; Colom, María Francisca; Torreblanca, Marina; Esteban, Violeta; Romera, Álvaro; Hagen, Ferry

    2015-01-01

    Cryptococcus gattii is a pathogenic basidiomycetous yeast that is emerging in temperate climate zones worldwide. C. gattii has repetitively been isolated from numerous tree species. Ongoing environmental sampling and molecular characterization is essential to understand the presence of this primary pathogenic microorganism in the Mediterranean environment. To report the first isolation of the rare C. gattii genotype AFLP7/VGIV from the environment in Europe. Samples were collected from woody debris of carob trees (Ceratonia siliqua) and olive trees (Olea europaea) in El Perelló, Tarragona, Spain. Cryptococcus species were further characterized by using URA5-RFLP, MALDI-TOF, AFLP and MLST. The antifungal susceptibility profile to amphotericin B, 5-fluorocytosine, fluconazole, itraconazole, posaconazole and voriconazole was determined using Sensititre Yeast One and E-test. Cultures from one carob tree revealed the presence of ten Cryptococcus-like colonies. One colony was identified as C. gattii, and subsequent molecular characterization showed that it was an α mating-type that belonged to the rare genotype AFLP7/VGIV. Antifungal susceptibility testing showed values within the range of sensitivity described for other isolates of the same genotype and within the epidemiological cutoff values for this species. The isolation of the rare C. gattii genotype AFLP7/VGIV in Spain is the first report in the European environment, implying the possible presence in other regions of the Mediterranean area, and underlines that clinicians must be aware for C. gattii infections in healthy individuals. Copyright © 2014 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

  3. Species phylogeny and diversification process of Northeast Asian Pungitius revealed by AFLP and mtDNA markers.

    PubMed

    Takahashi, Hiroshi; Møller, Peter R; Shedko, Sergei V; Ramatulla, Temirbekov; Joen, Sang-Rin; Zhang, Chun-Guang; Sideleva, Valentina G; Takata, Keisuke; Sakai, Harumi; Goto, Akira; Nishida, Mutsumi

    2016-06-01

    Pungitius is a highly diversified genus of sticklebacks (Gasterosteidae) occurring widely in northern parts of the Northern Hemisphere. Several ecologically and genetically divergent types that are largely isolated reproductively but occasionally hybridize in sympatry have been discovered in Northeast Asia, although the taxonomy and evolutionary relationships among them remain unclear. We used amplified fragment length polymorphism (AFLP) and mitochondrial DNA (mtDNA) markers to infer phylogenies among individuals collected from sympatric and allopatric populations, including the type localities of the described species. Phylogenetic analyses based on 2683 polymorphic AFLP loci confirmed seven species, each of which (except for one entirely allopatric species P. platygaster) was clearly differentiated from one or two other sympatric species and constituted a highly supported monophyletic clade with conspecific allopatric populations. The phylogeny showed that two lineages arose early; one gave rise to two species (circumpolar species P. pungitius and Paratethys species P. platygaster) and the other to five species endemic to Northeast Asia (P. sinensis, P. tymensis, P. polyakovi, P. kaibarae, and P. bussei). The brackish-water, freshwater, and Omono types previously discovered in Japan were reidentified as P. pungitius, P. sinensis, and P. kaibarae, respectively. A marked incongruence was noted between the phylogenies of AFLP and mtDNA markers, suggesting the occasional occurrence of hybridization and mtDNA introgression among distinct species. Our results highlight that the marginal seas of Northeast Asia played a key role as barriers to or facilitators of gene flow in the evolution of species diversity of Pungitius concentrated in this region. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    PubMed

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  5. PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Knowlton, Nancy

    2012-01-01

    Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets

  6. Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

    PubMed Central

    Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J.

    2012-01-01

    The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory β-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory β-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus. PMID:22496223

  7. Deconstructing the Polymerase Chain Reaction: Understanding and Correcting Bias Associated with Primer Degeneracies and Primer-Template Mismatches

    PubMed Central

    Green, Stefan J.; Venkatramanan, Raghavee; Naqib, Ankur

    2015-01-01

    The polymerase chain reaction (PCR) is sensitive to mismatches between primer and template, and mismatches can lead to inefficient amplification of targeted regions of DNA template. In PCRs in which a degenerate primer pool is employed, each primer can behave differently. Therefore, inefficiencies due to different primer melting temperatures within a degenerate primer pool, in addition to mismatches between primer binding sites and primers, can lead to a distortion of the true relative abundance of targets in the original DNA pool. A theoretical analysis indicated that a combination of primer-template and primer-amplicon interactions during PCR cycles 3–12 is potentially responsible for this distortion. To test this hypothesis, we developed a novel amplification strategy, entitled “Polymerase-exonuclease (PEX) PCR”, in which primer-template interactions and primer-amplicon interactions are separated. The PEX PCR method substantially and significantly improved the evenness of recovery of sequences from a mock community of known composition, and allowed for amplification of templates with introduced mismatches near the 3’ end of the primer annealing sites. When the PEX PCR method was applied to genomic DNA extracted from complex environmental samples, a significant shift in the observed microbial community was detected. Furthermore, the PEX PCR method provides a mechanism to identify which primers in a primer pool are annealing to target gDNA. Primer utilization patterns revealed that at high annealing temperatures in the PEX PCR method, perfect match annealing predominates, while at lower annealing temperatures, primers with up to four mismatches with templates can contribute substantially to amplification. The PEX PCR method is simple to perform, is limited to PCR mixes and a single exonuclease step which can be performed without reaction cleanup, and is recommended for reactions in which degenerate primer pools are used or when mismatches between primers

  8. An AFLP estimation of the outcrossing rate of Spondias tuberosa (Anacardiaceae), an endemic species to the Brazilian semiarid region.

    PubMed

    Fernandes Santos, Carlos Antonio; de Souza Gama, Renata Natália Cândido

    2013-06-01

    The umbu tree (Spondias tuberosa) is one of the most important endemic species to the Brazilian tropical semiarid region. The umbu tree has edible fruits with a peculiar flavor that are consumed in natura or in a semi-industrialized form, such as jams, candies and juices. The majority of endemic species to Brazilian semiarid region have not been studied or sampled to form germ-plasm collections, which increases the risk of losing genetic variability of the adapted species to xerophytic conditions. The aim of this study was to estimate outcrossing rates in S. tuberosa using a multilocus mixed model in order to guide genetic resources and breeding programs of this species. DNA samples were extracted from 92 progenies of umbu trees, which were distributed among 12 families. These trees were planted by seed in 1991 in Petrolina, PE, Brazil. The experimental design was a randomized block, with a total of 42 progenies sampled in three regions. The experimental units were composed by five plants and five replications. The outcrossing rate was estimated by the multilocus model, which is available in the MLTR software, and was based on 17 polymorphic AFLP bands obtained from AAA_CTG and AAA_CTC primer combinations. The observed heterozygotes ranged from 0.147 to 0.499, with a maximum frequency estimated for the AAA_CTC 10 amplicon. The multilocus outcrossing estimation (t(m)) was 0.804 +/- 0.072, while the single-locus (t(s)) was 0.841 +/- 0.079, which suggests that S. tuberosa is predominantly an outcrossing species. The difference between t(m) and t(s) was -0.037 +/- 0.029, which indicates that biparental inbreeding was nearly absent. The mean inbreeding coefficient or fixation index (F) among maternal plants was--0.103 +/- 0.045, and the expected F was 0.108, which indicates that there was no excess of heterozygotes in the maternal population. The outcrossing estimates obtained in the present study indicate that S. tuberosa is an open-pollinated species. Biometrical

  9. GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms

    PubMed Central

    David, Fabrice P.A.; Rougemont, Jacques; Deplancke, Bart

    2017-01-01

    GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. PMID:28053161

  10. Detection of N2O-producing fungi in environment using nitrite reductase gene (nirK)-targeting primers.

    PubMed

    Chen, Huaihai; Yu, Fangbo; Shi, Wei

    2016-12-01

    Fungal denitrification has been increasingly investigated, but its community ecology is poorly understood due to the lack of culture-independent tools. In this work, four pairs of nirK-targeting primers were designed and evaluated for primer specificity and efficiency using thirty N 2 O-producing fungal cultures and an agricultural soil. All primers amplified nirK from fungi and soil, but their efficiency and specificity were different. A primer set, FnirK_F3/R2 amplified ∼80 % of tested fungi, including Aspergillus, Fusarium, Penicillium, and Trichoderma, as compared to ∼40-70 % for other three primers. The nirK fragments of fungal and soil DNA amplified by FnirK_F3/R2 were phylogenetically related to denitrifying fungi in the orders Eurotiales, Hypocreales, and Sordariales; and clone sequences were also distributed in the clusters of Chaetomium, Metarhizium, and Myceliophthora that were uncultured from soil in our previous work. This proved the wide-range capability of primers for amplifying diverse denitrifying fungi from environment. However, our primers and recently-developed other primers amplified bacterial nirK from soil and this co-amplification of fungal and bacterial nirK was theoretically discussed. The FnirK_F3/R2 was further compared with published primers; results from clone libraries demonstrated that FnirK_F3/R2 was more specifically targeted on fungi and had broader taxonomical coverage than some others. Copyright © 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  11. Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

    PubMed

    Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

    2009-10-28

    GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.

  12. [Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

    PubMed

    Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

    2010-01-01

    Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

  13. Identification of hallucinogenic fungi from the genera Psilocybe and Panaeolus by amplified fragment length polymorphism.

    PubMed

    Lee, J C; Cole, M; Linacre, A

    2000-05-01

    Unambiguous identification of the hallucinogenic fungi of the genera Psilocybe and Panaeolus is required by national and international drug control legislation. We report on a DNA-based test using the technique of amplified fragment length polymorphism (AFLP). AFLP can differentiate species of the two genera Psilocybe and Panaeolus by using different primer sets. The identification of hallucinogenic fungi using a DNA-based test, which can be used in conjunction with morphological features, will assist in forensic investigations.

  14. A new set of primers for the detection of Toxoplasma gondii in amniotic fluid using polymerase chain reaction.

    PubMed

    Pelloux, H; Weiss, J; Simon, J; Muet, F; Fricker-Hidalgo, H; Goullier-Fleuret, A; Ambroise-Thomas, P

    1996-04-15

    A new PCR system including a pair of primers, a probe and an internal control were designed from the B1 gene of Toxoplasma gondii. The system described allowed the detection of less than 10 tachyzoites of the RH strain of T. gondii. Among 21 amniotic fluid samples, this system diagnosed the cases of congenital toxoplasmosis which were simultaneously diagnosed using mice inoculation, in vitro culture, and serology from both amniotic fluid and fetal blood. These results show that these new primers allow for a highly sensitive detection of T. gondii DNA.

  15. Low-copy nuclear primers and ycf1 primers in Cactaceae.

    PubMed

    Franck, Alan R; Cochrane, Bruce J; Garey, James R

    2012-10-01

    To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

  16. Genetic differentiation of Octopus minor (Mollusca, Cephalopoda) off the northern coast of China as revealed by amplified fragment length polymorphisms.

    PubMed

    Yang, J M; Sun, G H; Zheng, X D; Ren, L H; Wang, W J; Li, G R; Sun, B C

    2015-12-02

    Octopus minor (Sasaki, 1920) is an economically important cephalopod that is found in the northern coastal waters of China. In this study, we investigated genetic differentiation in fishery populations using amplified fragment length polymorphisms (AFLPs). A total of 150 individuals were collected from five locations: Dalian (DL), Yan-tai (YT), Qingdao (QD), Lianyungang (LY), and Zhoushan (ZS), and 243 reproducible bands were amplified using five AFLP primer combinations. The percentage of polymorphic bands ranged from 53.33 to 76.08%. Nei's genetic identity ranged from 0.9139 to 0.9713, and the genetic distance ranged from 0.0291 to 0.0900. A phylogenetic tree was constructed using the unweighted pair group method with arithmetic mean, based on the genetic distance. The DL and YT populations originated from one clade, while the QD, LY, and ZS populations originated from another. The results indicate that the O. minor stock consisted of two genetic populations with an overall significantly analogous FST value (0.1088, P < 0.05). Most of the variance was within populations. These findings will be important for more sustainable octopus fisheries, so that this marine resource can be conserved for its long-term utilization.

  17. Annotation of differentially expressed genes in the somatic embryogenesis of musa and their location in the banana genome.

    PubMed

    Maldonado-Borges, Josefina Ines; Ku-Cauich, José Roberto; Escobedo-Graciamedrano, Rosa Maria

    2013-01-01

    Analysis of cDNA-AFLP was used to study the genes expressed in zygotic and somatic embryogenesis of Musa acuminata Colla ssp. malaccensis, and a comparison was made between their differential transcribed fragments (TDFs) and the sequenced genome of the double haploid- (DH-) Pahang of the malaccensis subspecies that is available in the network. A total of 253 transcript-derived fragments (TDFs) were detected with apparent size of 100-4000 bp using 5 pairs of AFLP primers, of which 21 were differentially expressed during the different stages of banana embryogenesis; 15 of the sequences have matched DH-Pahang chromosomes, with 7 of them being homologous to gene sequences encoding either known or putative protein domains of higher plants. Four TDF sequences were located in all Musa chromosomes, while the rest were located in one or two chromosomes. Their putative individual function is briefly reviewed based on published information, and the potential roles of these genes in embryo development are discussed. Thus the availability of the genome of Musa and the information of TDFs sequences presented here opens new possibilities for an in-depth study of the molecular and biochemical research of zygotic and somatic embryogenesis of Musa.

  18. Amplified Fragment Length Polymorphism Diversity in Cephalosporium maydis from Egypt.

    PubMed

    Saleh, Amgad A; Zeller, Kurt A; Ismael, Abou-Serie M; Fahmy, Zeinab M; El-Assiuty, Elhamy M; Leslie, John F

    2003-07-01

    ABSTRACT Cephalosporium maydis, the causal agent of late wilt of maize, was first described in Egypt in the 1960s, where it can cause yield losses of up to 40% in susceptible plantings. We characterized 866 isolates of C. maydis collected from 14 governates in Egypt, 7 in the Nile River Delta and 7 in southern (Middle and Upper) Egypt, with amplified fragment length polymorphism (AFLP) markers. The four AFLP primer-pair combinations generated 68 bands, 25 of which were polymorphic, resulting in 52 clonal haplotypes that clustered the 866 isolates into four phylogenetic lineages. Three lineages were found in both the Nile River Delta and southern Egypt. Lineage IV, the most diverse group (20 haplotypes), was recovered only from governates in the Nile River Delta. In some locations, one lineage dominated (up to 98% of the isolates recovered) and, from some fields, only a single haplotype was recovered. Under field conditions in Egypt, there is no evidence that C. maydis reproduces sexually. The nonuniform geographic distribution of the pathogen lineages within the country could be due to differences in climate or in the farming system, because host material differs in susceptibility and C. maydis lineages differ in pathogenicity.

  19. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    NASA Astrophysics Data System (ADS)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  20. Photobacterium damselae ssp. piscicida: detection by direct amplification of 16S rRNA gene sequences and genotypic variation as determined by amplified fragment length polymorphism (AFLP).

    PubMed

    Kvitt, H; Ucko, M; Colorni, A; Batargias, C; Zlotkin, A; Knibb, W

    2002-04-05

    A PCR protocol for the rapid diagnosis of fish 'pasteurellosis' based on 16S rRNA gene sequences was developed. The procedure combines low annealing temperature that detects low titers of Photobacterium damselae but also related species, and high annealing temperature for the specific identification of P. damselae directly from infected fish. The PCR protocol was validated on 19 piscine isolates of P. damselae ssp. piscicida from different geographic regions (Japan, Italy, Spain, Greece and Israel), on spontaneously infected sea bream Sparus aurata and sea bass Dicentrarchus labrax, and on closely related American Type Culture Collection (ATCC) reference strains. PCR using high annealing temperature (64 degrees C) discriminated between P. damselae and closely related reference strains, including P. histaminum. Sixteen isolates of P. damselae ssp. piscicida, 2 P. damselae ssp. piscicida reference strains and 1 P. damselae ssp. damselae reference strain were subjected to Amplified Fragment Length Polymorphism (AFLP) analysis, and a similarity matrix was produced. Accordingly, the Japanese isolates of P. damselae ssp. piscicida were distinguished from the Mediterranean/European isolates at a cut-off value of 83% similarity. A further subclustering at a cut-off value of 97% allowed discrimination between the Israeli P. damselae ssp. piscicida isolates and the other Mediterranean/European isolates. The combination of PCR direct amplification and AFLP provides a 2-step procedure, where P. damselae is rapidly identified at genus level on the basis of its 16S rRNA gene sequence and then grouped into distinct clusters on the basis of AFLP polymorphisms. The first step of direct amplification is highly sensitive and has immediate practical consequences, offering fish farmers a rapid diagnosis, while the AFLP is more specific and detects intraspecific variation which, in our study, also reflected geographic correspondence. Because of its superior discriminative properties

  1. GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms.

    PubMed

    David, Fabrice P A; Rougemont, Jacques; Deplancke, Bart

    2017-01-04

    GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Alterations of leaf cell ultrastructures and AFLP DNA profiles in Earth-grown tomato plants propagated from long-term six years Mir-flown seeds

    NASA Astrophysics Data System (ADS)

    Liu, Min; Xue, Huai; Pan, Yi; Zhang, Chunhua; Lu, Jinying

    Leaf cell ultrastructures and DNA variations in the firstand the second-generation of Earthgrown tomato (Lycopersicon esculentun Mill) plants that had been endured a long-term six years spaceflight in the Mir were compared to their ground-based control plants, under observations with a Transmission Electron Microscope and the Amplification Fragment Length Polymorphism (AFLP) analysis. For alterations in the morphological ultrastructures, one plant among the 11 first-generation plants generated from 30 Mir-flown seeds had a three-layered palisade cell structure, while other 10 first-generation plants and all ground-based controls had one-layered palisade cell structure in leaves. Starch grains were larger and in clusters, numbers of starch grains increased in the chloroplasts in the Mir-flown plants. Leaf cells became contracted and deformed, and cell shape patterns were different in the Mir-flown plants. For the leaf genomic DNA alterations, 34 DNA bands were polymorphic with a 1.32% polymorphism among 2582 DNA bands in the first-generation Mir-flown plants. Band types in the spaceflight treated plants were also different from those in the ground-based control. Of 11 survived first-generation plants, 7 spaceflight treated plants (Plant Nos. 1-6 and No. 9) had a same 7 polymorphic bands and a same 0.27%DNA mutation. The DNA mutation rate was greatest in Plants No.10 and No.7 (0.90% and 0.94%), less in Plant No.11 (0.31%) and least in Plant No.8 (0.20%). For the 38 send-generation plants propagated from the No. 5 Mir-flown seed, 6 DNA bands were polymorphic with a 0.23% polymorphism among 2564 amplified DNA bands. Among those 38 second-generation plants amplified by primer pair (E4: ACC, M8: CTT), one DNA band disappeared in 29 second-generation plants and in the original Mir-flown No. 5 plant, compared to the ground-base controls. Among the 38 second-generation plants generated from the Mir-flown No. 5 seed, the DNA band types of 29 second-generation plants were

  3. Electro-Deposited Primer Development and Low-Polluting Primer Evaluation

    DTIC Science & Technology

    1989-08-01

    in the use of spray-applied primers are nonuniform corrosion protection, poor control of primer thickness, and variable strength of the adhesive bond...AL=)r- U’) LA C) .LAV) . L" () - C:’. L L :0 3c’. ) %D r- LAIr - LA I r-.%D ’D( o oD𔃺t- LA Ln DLI m to r- 0 0l- I cn M - in C.0 CD I (n m~ : c) = I V

  4. De-MetaST-BLAST: A Tool for the Validation of Degenerate Primer Sets and Data Mining of Publicly Available Metagenomes

    PubMed Central

    Gulvik, Christopher A.; Effler, T. Chad; Wilhelm, Steven W.; Buchan, Alison

    2012-01-01

    Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies). Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s) and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI’s BLAST (De-MetaST-BLAST), the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications. PMID:23189198

  5. Characterization of North American Armillaria species: Genetic relationships determined by ribosomal DNA sequences and AFLP markers

    Treesearch

    M. -S. Kim; N. B. Klopfenstein; J. W. Hanna; G. I. McDonald

    2006-01-01

    Phylogenetic and genetic relationships among 10 North American Armillaria species were analysed using sequence data from ribosomal DNA (rDNA), including intergenic spacer (IGS-1), internal transcribed spacers with associated 5.8S (ITS + 5.8S), and nuclear large subunit rDNA (nLSU), and amplified fragment length polymorphism (AFLP) markers. Based on rDNA sequence data,...

  6. Sex Stereotyping in Mexican Reading Primers.

    ERIC Educational Resources Information Center

    Heathcote, Olivia

    A study was conducted comparing the sex stereotypes present in selected Mexican reading primers published in 1960 with those present in primers published in 1972 to determine whether any significant changes in sex stereotyping were reflected in the 1972 primers. Comparisons were made between four primers published in 1960 for grades one through…

  7. Palaeopolyploidy, Spatial Structure and Conservation Genetics of the Narrow Steppe Plant Vella pseudocytisus subsp. paui (Vellinae, Cruciferae)

    PubMed Central

    PÉREZ-COLLAZOS, ERNESTO; CATALÁN, PILAR

    2006-01-01

    • Background and Aims Vella pseudocytisus subsp. paui (Cruciferae) is a narrow endemic plant to the Teruel province (eastern Spain), which is listed in the National Catalogue of Endangered Species. Two distinct ploidy levels (diploid, 2n = 34, and tetraploid, 2n = 68) have been reported for this taxon that belongs to the core subtribe Vellinae, a western Mediterranean group of shrubby taxa with a chromosome base number of x = 17. Allozyme and AFLP analyses were conducted (a) to test for the ploidy and putative palaeo-allopolyploid origin of this taxon, (b) to explore levels of genetic diversity and spatial structure of its populations, and (c) to address in-situ and ex-situ strategies for its conservation. • Methods Six populations that covered the entire geographical range of this taxon were sampled and examined for 19 allozyme loci and three AFLP primer pair combinations. In addition, the gametic progenies of five individuals were analysed for two allozyme loci that showed fixed heterozygosity. • Key Results Multiple banded allozyme profiles for most of the surveyed loci indicated the polyploidy of this taxon. Co-inherited fixed heterozygous patterns were exhibited by the gametophytic tissues of the mother plants. Both allozyme and AFLP markers detected high levels of genetic diversity, and a strong micro-spatial genetic structure was recovered from AFLP phenetic analyses and Mantel correlograms. • Conclusions Allozyme data support the hypothesis of an allotetraploid origin of Vella pseudocytisus subsp. paui that could be representative of other taxa of the core Vellinae group. AFLP data distinguished three geographically distinct groups with no genetic interaction among them. Allotetraploidy and outcrossing reproduction have probably contributed to maintenance of high levels of genetic variability of the populations, whereas habitat fragmentation may have enhanced the high genetic isolation observed among groups. In-situ microgenetic reserves and a

  8. A set of primers for analyzing chloroplast DNA diversity in Citrus and related genera.

    PubMed

    Cheng, Yunjiang; de Vicente, M Carmen; Meng, Haijun; Guo, Wenwu; Tao, Nengguo; Deng, Xiuxin

    2005-06-01

    Chloroplast simple sequence repeat (cpSSR) markers in Citrus were developed and used to analyze chloroplast diversity of Citrus and closely related genera. Fourteen cpSSR primer pairs from the chloroplast genomes of tobacco (Nicotiana tabacum L.) and Arabidopsis were found useful for analyzing the Citrus chloroplast genome (cpDNA) and recoded with the prefix SPCC (SSR Primers for Citrus Chloroplast). Eleven of the 14 primer pairs revealed some degree of polymorphism among 34 genotypes of Citrus, Fortunella, Poncirus and some of their hybrids, with polymorphism information content (PIC) values ranging from 0.057 to 0.732, and 18 haplotypes were identified. The cpSSR data were analyzed with NTSYS-pc software, and the genetic relationships suggested by the unweighted pair group method based on arithmetic means (UPGMA) dendrogram were congruent with previous taxonomic investigations: the results showed that all samples fell into seven major clusters, i.e., Citrus medica L., Poncirus, Fortunella, C. ichangensis Blanco, C. reticulata Swingle, C. aurantifolia (Christm.) Swingle and C. grandis (L.) Osbeck. The results of previous studies combined with our cpSSR analyses revealed that: (1) Calamondin (C. madurensis Swingle) is the result of hybridization between kumquat (Fortunella) and mandarin (C. reticulata), where kumquat acted as the female parent; (2) Ichang papeda (C. ichangensis) has a unique taxonomic status; and (3) although Bendiguangju mandarin (C. reticulata) and Satsuma mandarin (C. reticulata) are similar in fruit shape and leaf morphology, they have different maternal parents. Bendiguangju mandarin has the same cytoplasm as sweet orange (C. sinensis), whereas Satsuma mandarin has the cytoplasm of C. reticulata. Seventeen PCR products from SPCC1 and 21 from SPCC11 were cloned and sequenced. The results revealed that mononucleotide repeats as well as insertions and deletions of small segments of DNA were associated with SPCC1 polymorphism, whereas polymorphism

  9. Nearest-neighbor thermodynamics of deoxyinosine pairs in DNA duplexes

    PubMed Central

    Watkins, Norman E.; SantaLucia, John

    2005-01-01

    Nearest-neighbor thermodynamic parameters of the ‘universal pairing base’ deoxyinosine were determined for the pairs I·C, I·A, I·T, I·G and I·I adjacent to G·C and A·T pairs. Ultraviolet absorbance melting curves were measured and non-linear regression performed on 84 oligonucleotide duplexes with 9 or 12 bp lengths. These data were combined with data for 13 inosine containing duplexes from the literature. Multiple linear regression was used to solve for the 32 nearest-neighbor unknowns. The parameters predict the Tm for all sequences within 1.2°C on average. The general trend in decreasing stability is I·C > I·A > I·T ≈ I· G > I·I. The stability trend for the base pair 5′ of the I·X pair is G·C > C·G > A·T > T·A. The stability trend for the base pair 3′ of I·X is the same. These trends indicate a complex interplay between H-bonding, nearest-neighbor stacking, and mismatch geometry. A survey of 14 tandem inosine pairs and 8 tandem self-complementary inosine pairs is also provided. These results may be used in the design of degenerate PCR primers and for degenerate microarray probes. PMID:16264087

  10. Levels of intra-specific AFLP diversity in tuber-bearing potato species with different breeding systems and ploidy levels

    USDA-ARS?s Scientific Manuscript database

    DNA-based marker analysis of plant genebank material has become a useful tool in the evaluation of levels of genetic diversity and for the informed use and maintenance of germplasm. In this study we quantify levels of Amplified Fragment Length Polymorphism (AFLP) in representative accessions of wild...

  11. Output testing of small-arms primers

    NASA Technical Reports Server (NTRS)

    Bement, Laurence J.; Doris, Thomas A.; Schimmel, Morry L.

    1991-01-01

    The performance of two standard primers for initiating small-caliber ammunition are compared to that of a primer for initiating aircraft escape-system components. Three testing methods are employed including: (1) firing the primer to measure total energy delivered; (2) monitoring output in terms of gaseous product-mass flow rate and pressure as a function of time; and (3) firing the primer onto ignition material to study gas pressure produced during ignition and burning as a function of time. The results of the test demonstrate differences in the ignitability factors of the standard primers and time peak pressures of less than 100 microseconds. One unexpected result is that two percussion primers (the FA-41 and the M42C1) developed for different applications have the same ignitability. The ignitability test method is shown to yield the most useful data and can be used to specify percussion primers and optimize their performance.

  12. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    PubMed

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  13. Key processes for Cheirolophus (Asteraceae) diversification on oceanic islands inferred from AFLP data.

    PubMed

    Vitales, Daniel; García-Fernández, Alfredo; Pellicer, Jaume; Vallès, Joan; Santos-Guerra, Arnoldo; Cowan, Robyn S; Fay, Michael F; Hidalgo, Oriane; Garnatje, Teresa

    2014-01-01

    The radiation of the genus Cheirolophus (Asteraceae) in Macaronesia constitutes a spectacular case of rapid diversification on oceanic islands. Twenty species - nine of them included in the IUCN Red List of Threatened Species - have been described to date inhabiting the Madeiran and Canarian archipelagos. A previous phylogenetic study revealed that the diversification of Cheirolophus in Macaronesia started less than 2 Ma. As a result of such an explosive speciation process, limited phylogenetic resolution was reported, mainly due to the low variability of the employed molecular markers. In the present study, we used highly polymorphic AFLP markers to i) evaluate species' boundaries, ii) infer their evolutionary relationships and iii) investigate the patterns of genetic diversity in relation to the potential processes likely involved in the radiation of Cheirolophus. One hundred and seventy-two individuals representing all Macaronesian Cheirolophus species were analysed using 249 AFLP loci. Our results suggest that geographic isolation played an important role in this radiation process. This was likely driven by the combination of poor gene flow capacity and a good ability for sporadic long-distance colonisations. In addition, we also found some traces of introgression and incipient ecological adaptation, which could have further enhanced the extraordinary diversification of Cheirolophus in Macaronesia. Last, we hypothesize that current threat categories assigned to Macaronesian Cheirolophus species do not reflect their respective evolutionary relevance, so future evaluations of their conservation status should take into account the results presented here.

  14. Key Processes for Cheirolophus (Asteraceae) Diversification on Oceanic Islands Inferred from AFLP Data

    PubMed Central

    Vitales, Daniel; García-Fernández, Alfredo; Pellicer, Jaume; Vallès, Joan; Santos-Guerra, Arnoldo; Cowan, Robyn S.; Fay, Michael F.; Hidalgo, Oriane; Garnatje, Teresa

    2014-01-01

    The radiation of the genus Cheirolophus (Asteraceae) in Macaronesia constitutes a spectacular case of rapid diversification on oceanic islands. Twenty species – nine of them included in the IUCN Red List of Threatened Species – have been described to date inhabiting the Madeiran and Canarian archipelagos. A previous phylogenetic study revealed that the diversification of Cheirolophus in Macaronesia started less than 2 Ma. As a result of such an explosive speciation process, limited phylogenetic resolution was reported, mainly due to the low variability of the employed molecular markers. In the present study, we used highly polymorphic AFLP markers to i) evaluate species' boundaries, ii) infer their evolutionary relationships and iii) investigate the patterns of genetic diversity in relation to the potential processes likely involved in the radiation of Cheirolophus. One hundred and seventy-two individuals representing all Macaronesian Cheirolophus species were analysed using 249 AFLP loci. Our results suggest that geographic isolation played an important role in this radiation process. This was likely driven by the combination of poor gene flow capacity and a good ability for sporadic long-distance colonisations. In addition, we also found some traces of introgression and incipient ecological adaptation, which could have further enhanced the extraordinary diversification of Cheirolophus in Macaronesia. Last, we hypothesize that current threat categories assigned to Macaronesian Cheirolophus species do not reflect their respective evolutionary relevance, so future evaluations of their conservation status should take into account the results presented here. PMID:25412495

  15. Methylation-Sensitive Amplification Length Polymorphism (MS-AFLP) Microarrays for Epigenetic Analysis of Human Genomes.

    PubMed

    Alonso, Sergio; Suzuki, Koichi; Yamamoto, Fumiichiro; Perucho, Manuel

    2018-01-01

    Somatic, and in a minor scale also germ line, epigenetic aberrations are fundamental to carcinogenesis, cancer progression, and tumor phenotype. DNA methylation is the most extensively studied and arguably the best understood epigenetic mechanisms that become altered in cancer. Both somatic loss of methylation (hypomethylation) and gain of methylation (hypermethylation) are found in the genome of malignant cells. In general, the cancer cell epigenome is globally hypomethylated, while some regions-typically gene-associated CpG islands-become hypermethylated. Given the profound impact that DNA methylation exerts on the transcriptional profile and genomic stability of cancer cells, its characterization is essential to fully understand the complexity of cancer biology, improve tumor classification, and ultimately advance cancer patient management and treatment. A plethora of methods have been devised to analyze and quantify DNA methylation alterations. Several of the early-developed methods relied on the use of methylation-sensitive restriction enzymes, whose activity depends on the methylation status of their recognition sequences. Among these techniques, methylation-sensitive amplification length polymorphism (MS-AFLP) was developed in the early 2000s, and successfully adapted from its original gel electrophoresis fingerprinting format to a microarray format that notably increased its throughput and allowed the quantification of the methylation changes. This array-based platform interrogates over 9500 independent loci putatively amplified by the MS-AFLP technique, corresponding to the NotI sites mapped throughout the human genome.

  16. Genetic structure of Eurasian and North American Leymus (Triticeae) wildryes assessed by chloroplast DNA sequences and AFLP profiles

    Treesearch

    C. Mae Culumber; Steve R. Larson; Kevin B. Jensen; Thomas A. Jones

    2011-01-01

    Leymus is a genomically defined allopolyploid of genus Triticeae with two distinct subgenomes. Chloroplast DNA sequences of Eurasian and North American species are distinct and polyphyletic. However, phylogenies derived from chloroplast and nuclear DNA sequences are confounded by polyploidy and lack of polymorphism among many taxa. The AFLP technique can resolve...

  17. PCR-based identification of Erysiphe pulchra and Phyllactinia guttata from Cornus florida using ITS-specific primers

    Treesearch

    M. T. Mmbaga; N. B. Klopfenstein; M. -S. Kim; N. C. Mmbaga

    2004-01-01

    The internal transcribed spacer (ITS) regions of rDNA and the intervening 5.8S rRNA gene for the powdery mildew fungi Erysiphe (sect. Microsphaera) pulchra and Phyllactinia guttata were amplified using standard polymerase chain reaction (PCR) protocols and the universal primer pairs, ITS1 and ITS4. PCR products for ITS were analysed by electrophoresis in a 1.5% agarose...

  18. Comparison between Mt-DNA D-Loop and Cyt B primers for porcine DNA detection in meat products

    NASA Astrophysics Data System (ADS)

    Hamzah, Azhana; Mutalib, Sahilah Abd.; Babji, Abdul Salam

    2013-11-01

    This study was conducted to detect the presence of porcine DNA in meat products in the market using conventional polymerase chain reaction (PCR) and commercial PCR-southern hybridization analysis. Porcine DNA detection in meat products was tested due to some issues associated with the adulteration of food products in Malaysia. This is an important issue especially for Halal authentication which is required for some religious practices such as in Islam and Hinduisms. Many techniques have been developed for determining the Halal status of food products. In this paper, mt-DNA D-loop primer and cytochrome (cyt) b were used to detect the presence of porcine DNA in meat products. Positive and negative controls were always present for each batch of extraction. DNA of raw pork meat was used as a positive control while nucleus free water is used as negative control. A pair of oligonucleotide primer was used namely Pork1 and Pork2 which produced amplicon of 531 base pair (bp) in size. While, PCR-southern hybridization was conducted using primers readily supplied by commercial PCR-Southern hybridization and produced amplicon with 276 bp in size. In the present study, demonstrated that none of the samples were contaminated with porcine residuals but selected samples with pork meat were positive. The species-specific PCR amplification yielded excellent results for identification of pork derivatives in food products and it is a potentially reliable and suitable technique in routine food analysis for Halal certification.

  19. A preliminary assessment of genetic relationships among agronomically important cultivars of black pepper

    PubMed Central

    Joy, Nisha; Abraham, Z; Soniya, EV

    2007-01-01

    Background The impact of diseases such as Phytophthora foot rot and the replacement of unproductive cultivars by high yielding ones has brought about the disappearance of varieties in Piper species, like any other crop. Black pepper (King of spices), is a major spice crop consumed throughout the world. It is widely cultivated across various parts of the world apart from India. The different cultivars may be genetically related and could be a source of valuable genes for disease resistance and an increase in quantity and quality. Even though Western Ghats in India is believed to be the site of origin of this crop, numerous accessions from the NBPGR have not yet been evaluated. Our study aims to investigate the genetic relatedness in major cultivars of black pepper using Amplified Fragment Length Polymorphism. Results Amplified Fragment Length Polymorphic (AFLP) DNA analysis was performed in thirty popular cultivars of black pepper from National Bureau of Plant Genetic Resources (NBPGR), India. Fingerprint profiles were generated initially with, five different primer combinations, from which three primer pair combinations (EAGC/MCAA, EAGG/MCTA and EAGC/MCTG) gave consistent and scorable banding patterns. From 173 scorable markers, 158(> 90%) were polymorphic which shows there is considerable variation in the available germplasm. The dendrogram derived by unweighted pair group method analysis (UPGMA) grouped the accessions into three major clusters and four diverse cultivars with only 30% similarity. Karimunda, a widely grown and popular cultivar was unique in the fingerprint profiles obtained. Conclusion There are currently few fingerprinting studies using the valuable spice crop black pepper. We found considerable genetic variability among cultivars of black pepper. Fingerprinting analysis with AFLP proved to be an ideal tool for cultivar identification and phylogenetic studies. It shows the high level of polymorphism and the unique characterization of the major

  20. An Efficient Approach for the Development of Locus Specific Primers in Bread Wheat (Triticum aestivum L.) and Its Application to Re-Sequencing of Genes Involved in Frost Tolerance

    PubMed Central

    Babben, Steve; Perovic, Dragan; Koch, Michael; Ordon, Frank

    2015-01-01

    Recent declines in costs accelerated sequencing of many species with large genomes, including hexaploid wheat (Triticum aestivum L.). Although the draft sequence of bread wheat is known, it is still one of the major challenges to developlocus specific primers suitable to be used in marker assisted selection procedures, due to the high homology of the three genomes. In this study we describe an efficient approach for the development of locus specific primers comprising four steps, i.e. (i) identification of genomic and coding sequences (CDS) of candidate genes, (ii) intron- and exon-structure reconstruction, (iii) identification of wheat A, B and D sub-genome sequences and primer development based on sequence differences between the three sub-genomes, and (iv); testing of primers for functionality, correct size and localisation. This approach was applied to single, low and high copy genes involved in frost tolerance in wheat. In summary for 27 of these genes for which sequences were derived from Triticum aestivum, Triticum monococcum and Hordeum vulgare, a set of 119 primer pairs was developed and after testing on Nulli-tetrasomic (NT) lines, a set of 65 primer pairs (54.6%), corresponding to 19 candidate genes, turned out to be specific. Out of these a set of 35 fragments was selected for validation via Sanger's amplicon re-sequencing. All fragments, with the exception of one, could be assigned to the original reference sequence. The approach presented here showed a much higher specificity in primer development in comparison to techniques used so far in bread wheat and can be applied to other polyploid species with a known draft sequence. PMID:26565976

  1. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

  2. Differentially expressed genes in Populus simonii x P. nigra in respnse to NaCl stress using cDNA-AFLP

    USDA-ARS?s Scientific Manuscript database

    Salinity is an important environmental factor limiting growth and productivity of plants, and affects almost every aspect of the plant physiology and biochemistry. The objective of this study was to apply cDNA-AFLP and to identify differentially expressed genes in response to NaCl stress vs. no-stre...

  3. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bowman, Stephen M

    2008-09-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VImore » in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific

  4. Annotation of Differentially Expressed Genes in the Somatic Embryogenesis of Musa and Their Location in the Banana Genome

    PubMed Central

    Maldonado-Borges, Josefina Ines; Ku-Cauich, José Roberto; Escobedo-GraciaMedrano, Rosa Maria

    2013-01-01

    Analysis of cDNA-AFLP was used to study the genes expressed in zygotic and somatic embryogenesis of Musa acuminata Colla ssp. malaccensis, and a comparison was made between their differential transcribed fragments (TDFs) and the sequenced genome of the double haploid- (DH-) Pahang of the malaccensis subspecies that is available in the network. A total of 253 transcript-derived fragments (TDFs) were detected with apparent size of 100–4000 bp using 5 pairs of AFLP primers, of which 21 were differentially expressed during the different stages of banana embryogenesis; 15 of the sequences have matched DH-Pahang chromosomes, with 7 of them being homologous to gene sequences encoding either known or putative protein domains of higher plants. Four TDF sequences were located in all Musa chromosomes, while the rest were located in one or two chromosomes. Their putative individual function is briefly reviewed based on published information, and the potential roles of these genes in embryo development are discussed. Thus the availability of the genome of Musa and the information of TDFs sequences presented here opens new possibilities for an in-depth study of the molecular and biochemical research of zygotic and somatic embryogenesis of Musa. PMID:24027442

  5. Traceability of plant contribution in olive oil by amplified fragment length polymorphisms.

    PubMed

    Pafundo, Simona; Agrimonti, Caterina; Marmiroli, Nelson

    2005-09-07

    Application of DNA molecular markers to traceability of foods is thought to bring new benefit to consumer's protection. Even in a complex matrix such as olive oil, DNA could be traced with PCR markers such as the amplified fragment length polymorphisms (AFLPs). In this work, fluorescent AFLPs were optimized for the characterization of olive oil DNA, to obtain highly reproducible, high-quality fingerprints, testing different parameters: the concentrations of dNTPs and labeled primer, the kind of Taq DNA polymerase and thermal cycler, and the quantity of DNA employed. It was found that correspondence of fingerprinting by comparing results in oils and in plants was close to 70% and that the DNA extraction from olive oil was the limiting step for the reliability of AFLP profiles, due to the complex matrix analyzed.

  6. Genetic diversity and relationship of Hedychium from Northeast India as dissected using PCA analysis and hierarchical clustering.

    PubMed

    Basak, Supriyo; Ramesh, Aadi Moolam; Kesari, Vigya; Parida, Ajay; Mitra, Sudip; Rangan, Latha

    2014-12-01

    Molecular genetic fingerprints of eleven Hedychium species from Northeast India were developed using PCR based markers. Fifteen inter-simple sequence repeats (ISSRs) and five amplified fragment length polymorphism (AFLP) primers produced 547 polymorphic fragments. Positive correlation (r = 0.46) was observed between the mean genetic similarity and genetic diversity parameters at the inter-species level. AFLP and ISSR markers were able to group the species according to its altitude and intensity of flower aroma. Cophenetic correlation coefficients between the dendrogram and the original similarity matrix were significant for ISSR (r = 0.89) compared to AFLP (r = 0.83) markers. This genetic characterization of Hedychium from Northeast India contributes to the knowledge of genetic structure of the species and can be used to define strategies for their conservation and management.

  7. Characterization of the Kenaf (Hibiscus cannabinus) Global Transcriptome Using Illumina Paired-End Sequencing and Development of EST-SSR Markers

    PubMed Central

    Li, Hui; Li, Defang; Chen, Anguo; Tang, Huijuan; Li, Jianjun; Huang, Siqi

    2016-01-01

    Kenaf (Hibiscus cannabinus L.) is an economically important natural fiber crop grown worldwide. However, only 20 expressed tag sequences (ESTs) for kenaf are available in public databases. The aim of this study was to develop large-scale simple sequence repeat (SSR) markers to lay a solid foundation for the construction of genetic linkage maps and marker-assisted breeding in kenaf. We used Illumina paired-end sequencing technology to generate new EST-simple sequences and MISA software to mine SSR markers. We identified 71,318 unigenes with an average length of 1143 nt and annotated these unigenes using four different protein databases. Overall, 9324 complementary pairs were designated as EST-SSR markers, and their quality was validated using 100 randomly selected SSR markers. In total, 72 primer pairs reproducibly amplified target amplicons, and 61 of these primer pairs detected significant polymorphism among 28 kenaf accessions. Thus, in this study, we have developed large-scale SSR markers for kenaf, and this new resource will facilitate construction of genetic linkage maps, investigation of fiber growth and development in kenaf, and also be of value to novel gene discovery and functional genomic studies. PMID:26960153

  8. Estimates of abundance and diversity of Shewanella genus in natural and engineered aqueous environments with newly designed primers.

    PubMed

    Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing

    2018-05-12

    Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. A first AFLP-Based Genetic Linkage Map for Brine Shrimp Artemia franciscana and Its Application in Mapping the Sex Locus

    PubMed Central

    De Vos, Stephanie; Bossier, Peter; Van Stappen, Gilbert; Vercauteren, Ilse; Sorgeloos, Patrick; Vuylsteke, Marnik

    2013-01-01

    We report on the construction of sex-specific linkage maps, the identification of sex-linked markers and the genome size estimation for the brine shrimp Artemia franciscana. Overall, from the analysis of 433 AFLP markers segregating in a 112 full-sib family we identified 21 male and 22 female linkage groups (2n = 42), covering 1,041 and 1,313 cM respectively. Fifteen putatively homologous linkage groups, including the sex linkage groups, were identified between the female and male linkage map. Eight sex-linked AFLP marker alleles were inherited from the female parent, supporting the hypothesis of a WZ–ZZ sex-determining system. The haploid Artemia genome size was estimated to 0.93 Gb by flow cytometry. The produced Artemia linkage maps provide the basis for further fine mapping and exploring of the sex-determining region and are a possible marker resource for mapping genomic loci underlying phenotypic differences among Artemia species. PMID:23469207

  10. Nanotechnology: A Policy Primer

    DTIC Science & Technology

    2010-03-12

    clean water. Nanotechnology water desalination and filtration systems may offer affordable, scalable, and portable water filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...DATES COVERED 00-00-2010 to 00-00-2010 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c

  11. Nanotechnology: A Policy Primer

    DTIC Science & Technology

    2010-01-04

    clean water. Nanotechnology water desalination and filtration systems may offer affordable, scalable, and portable water filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...DATES COVERED 00-00-2010 to 00-00-2010 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c

  12. [Construction of genetic linkage map and localization of NBS-LRR like resistance gene analogues in cauliflower (Brassica oleracea var. botrytis)].

    PubMed

    Gu, Yu; Zhao, Qian-Cheng; Sun, De-Ling; Song, Wen-Qin

    2007-06-01

    Nucleotide binding site (NBS) profiling, a new method was used to map resistance gene analogues (RGAs) in cauliflower (Brassica oleracea var. botrytis). This method allows amplification and the mapping of genetic markers anchored in the conserved NBS encoding domain of plant disease resistance genes. AFLP was also performed to construct the cauliflower intervarietal genetic map. The aim of constructing genetic map was to identify potential molecular markers linked to important agronomic traits that would be particularly useful for development and improving the species. Using 17 AFLP primer combinations and two degeneration primer/enzyme combinations, a total of 234 AFLP markers and 21 NBS markers were mapped in the F2 population derived from self-pollinating a single F1 plant of the cross AD White Flower x C-8. The markers were mapped in 9 of major linkage groups spanning 668.4 cM, with an average distance of 2.9 cM between adjacent mapped markers. The AFLP markers were well distributed throughout the linkage groups. The linkage groups contained from 12 to 47 loci each and the distance between two consecutive loci ranged from 0 to 14.9 cM. NBS markers were mapped on 8 of the 9 linkage groups of the genetic map. Most of these markers were organized in clusters. This result demonstrates the feasibility of the NBS-profiling method for generating NBS markers for resistance loci in cauliflower. The clustering of the markers mapped in this study adds to the evidence that most of them could be real RGAs.

  13. A high-resolution map of the H1 locus harbouring resistance to the potato cyst nematode Globodera rostochiensis.

    PubMed

    Bakker, Erin; Achenbach, Ute; Bakker, Jeroen; van Vliet, Joke; Peleman, Johan; Segers, Bart; van der Heijden, Stefan; van der Linde, Piet; Graveland, Robert; Hutten, Ronald; van Eck, Herman; Coppoolse, Eric; van der Vossen, Edwin; Bakker, Jaap; Goverse, Aska

    2004-06-01

    The resistance gene H1 confers resistance to the potato cyst nematode Globodera rostochiensis and is located at the distal end of the long arm of chromosome V of potato. For marker enrichment of the H1 locus, a bulked segregant analysis (BSA) was carried out using 704 AFLP primer combinations. A second source of markers tightly linked to H1 is the ultra-high-density (UHD) genetic map of the potato cross SH x RH. This map has been produced with 387 AFLP primer combinations and consists of 10,365 AFLP markers in 1,118 bins (http://www.dpw.wageningen-ur.nl/uhd/). Comparing these two methods revealed that BSA resulted in one marker/cM and the UHD map in four markers/cM in the H1 interval. Subsequently, a high-resolution genetic map of the H1 locus has been developed using a segregating F(1) SH x RH population consisting of 1,209 genotypes. Two PCR-based markers were designed at either side of the H1 gene to screen the 1,209 genotypes for recombination events. In the high-resolution genetic map, two of the four co-segregating AFLP markers could be separated from the H1 gene. Marker EM1 is located at a distance of 0.2 cM, and marker EM14 is located at a distance of 0.8 cM. The other two co-segregating markers CM1 (in coupling) and EM15 (in repulsion) could not be separated from the H1 gene.

  14. Nanotechnology: A Policy Primer

    DTIC Science & Technology

    2010-06-02

    States of 24 million barrels of oil.3 • Universal access to clean water. Nanotechnology water desalination and filtration systems may offer...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...00-00-2010 to 00-00-2010 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

  15. Nanotechnology: A Policy Primer

    DTIC Science & Technology

    2008-05-20

    of oil.3 ! Universal access to clean water. Nanotechnology water desalination and filtration systems may offer affordable, scalable, and portable...Order Code RL34511 Nanotechnology : A Policy Primer May 20, 2008 John F. Sargent Specialist in Science and Technology Policy Resources, Science, and...REPORT DATE 20 MAY 2008 2. REPORT TYPE 3. DATES COVERED 00-00-2008 to 00-00-2008 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a

  16. AFLP-based genetic mapping of the “bud-flowering” trait in heather (Calluna vulgaris)

    PubMed Central

    2013-01-01

    Background Calluna vulgaris is one of the most important landscaping plants produced in Germany. Its enormous economic success is due to the prolonged flower attractiveness of mutants in flower morphology, the so-called bud-bloomers. In this study, we present the first genetic linkage map of C. vulgaris in which we mapped a locus of the economically highly desired trait “flower type”. Results The map was constructed in JoinMap 4.1. using 535 AFLP markers from a single mapping population. A large fraction (40%) of markers showed distorted segregation. To test the effect of segregation distortion on linkage estimation, these markers were sorted regarding their segregation ratio and added in groups to the data set. The plausibility of group formation was evaluated by comparison of the “two-way pseudo-testcross” and the “integrated” mapping approach. Furthermore, regression mapping was compared to the multipoint-likelihood algorithm. The majority of maps constructed by different combinations of these methods consisted of eight linkage groups corresponding to the chromosome number of C. vulgaris. Conclusions All maps confirmed the independent inheritance of the most important horticultural traits “flower type”, “flower colour”, and “leaf colour”. An AFLP marker for the most important breeding target “flower type” was identified. The presented genetic map of C. vulgaris can now serve as a basis for further molecular marker selection and map-based cloning of the candidate gene encoding the unique flower architecture of C. vulgaris bud-bloomers. PMID:23915059

  17. Relative profile analysis of molecular markers for identification and genetic discrimination of loaches (Pisces, Nemacheilidae).

    PubMed

    Patil, Tejas Suresh; Tamboli, Asif Shabodin; Patil, Swapnil Mahadeo; Bhosale, Amrut Ravindra; Govindwar, Sanjay Prabhu; Muley, Dipak Vishwanathrao

    2016-01-01

    Genus Nemacheilus, Nemachilichthys and Schistura belong to the family Nemacheilidae of the order Cypriniformes. The present investigation was undertaken to observe genetic diversity, phylogenetic relationship and to develop a molecular-based tool for taxonomic identification. For this purpose, four different types of molecular markers were utilized in which 29 random amplified polymorphic DNA (RAPD), 25 inter-simple sequence repeat (ISSR) markers, and 10 amplified fragment length polymorphism (AFLP) marker sets were screened and mitochondrial COI gene was sequenced. This study added COI barcodes for the identification of Nemacheilus anguilla, Nemachilichthys rueppelli and Schistura denisoni. RAPD showed higher polymorphism (100%) than the ISSR (93.75-100%) and AFLP (93.86-98.96%). The polymorphic information content (PIC), heterozygosity, multiplex ratio, and gene diversity was observed highest for AFLP primers, whereas the major allele frequency was observed higher for RAPD (0.5556) and lowest for AFLP (0.1667). The COI region of all individuals was successfully amplified and sequenced, which gave a 100% species resolution. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  18. Significant population genetic structure detected in the rock bream Oplegnathus fasciatus (Temminck & Schlegel, 1844) inferred from fluorescent-AFLP analysis

    NASA Astrophysics Data System (ADS)

    Xiao, Yongshuang; Ma, Daoyuan; Xu, Shihong; Liu, Qinghua; Wang, Yanfeng; Xiao, Zhizhong; Li, Jun

    2016-05-01

    Oplegnathus fasciatus (rock bream) is a commercial rocky reef fish species in East Asia that has been considered for aquaculture. We estimated the population genetic diversity and population structure of the species along the coastal waters of China using fluorescent-amplified fragment length polymorphisms technology. Using 53 individuals from three populations and four pairs of selective primers, we amplified 1 264 bands, 98.73% of which were polymorphic. The Zhoushan population showed the highest Nei's genetic diversity and Shannon genetic diversity. The results of analysis of molecular variance (AMOVA) showed that 59.55% of genetic variation existed among populations and 40.45% occurred within populations, which indicated that a significant population genetic structure existed in the species. The pairwise fixation index F st ranged from 0.20 to 0.63 and were significant after sequential Bonferroni correction. The topology of an unweighted pair group method with arithmetic mean tree showed two significant genealogical branches corresponding to the sampling locations of North and South China. The AMOVA and STRUCTURE analyses suggested that the O. fasciatus populations examined should comprise two stocks.

  19. Levels of Intra-specific AFLP Diversity in Tuber-Bearing Potato Species with Different Breeding Systems and Ploidy Levels

    PubMed Central

    Bryan, Glenn J.; McLean, Karen; Waugh, Robbie; Spooner, David M.

    2017-01-01

    DNA-based marker analysis of plant genebank material has become a useful tool in the evaluation of levels of genetic diversity and for the informed use and maintenance of germplasm. In this study, we quantify levels of amplified fragment length polymorphism (AFLP) in representative accessions of wild and cultivated potato species of differing geographic origin, ploidy, and breeding system. We generated 449 polymorphic AFLP fragments in 619 plants, representing multiple plants (16–23) from 17 accessions of 14 potato taxa as well as single plants sampled from available accessions (from 3 to 56) of the same 14 taxa. Intra-accession diversities were compared to those of a synthetic ‘taxon-wide’ population comprising a single individual from a variable number of available accessions of each sampled taxon. Results confirm the expected considerably lower levels of polymorphism within accessions of self-compatible as compared to self-incompatible taxa. We observed broadly similar levels of ‘taxon-wide’ polymorphism among self-compatible and self-incompatible species, with self-compatible taxa showing only slightly lower rates of polymorphism. The most diverse accessions were the two cultivated potato accessions examined, the least diverse being the Mexican allohexaploids Solanum demissum and S. iopetalum. Generally allopolyploid self-compatible accessions exhibited lower levels of diversity. Some purported self-incompatible accessions showed relatively low levels of marker diversity, similar to the more diverse self-compatible material surveyed. Our data indicate that for self-compatible species a single plant is highly representative of a genebank accession. The situation for self-incompatible taxa is less clear, and sampling strategies used will depend on the type of investigation. These results have important implications for those seeking novel trait variation (e.g., disease resistance) in gene banks as well as for the selection of individuals for genomics

  20. Development, validation and application of specific primers for analyzing the clostridial diversity in dark fermentation pit mud by PCR-DGGE.

    PubMed

    Hu, Xiao-Long; Wang, Hai-Yan; Wu, Qun; Xu, Yan

    2014-07-01

    In this study, a Clostridia-specific primer set SJ-F and SJ-R, based on the available 16S rRNA genes sequences from database, was successfully designed and authenticated by theoretical and experimental evaluations. It targeted 19 clostridial families and unclassified_Clostridia with different coverage rates. The specificity and universality of novel primer set was tested again using the dark fermentation pit mud (FPM). It was demonstrated that a total of 13 closest relatives including 12 species were affiliated with 7 clostridial genera, respectively. Compared to the well-accepted bacterial universal primer pair P2/P3, five unexpected clostridial genera including Roseburia, Tissierella, Sporanaerobacter, Alkalibacter and Halothermothrix present in the FPM were also revealed. Therefore, this study could provide a good alternative to investigate the clostridial diversity and monitor their population dynamics rapidly and efficiently in various anaerobic environments and dark fermentation systems in future. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Nucleic acid amplification using modular branched primers

    DOEpatents

    Ulanovsky, Levy; Raja, Mugasimangalam C.

    2001-01-01

    Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.

  2. A newly constructed primer pair for the PCR amplification, cloning and sequencing of the flagellin (flaA) gene from isolatesof urease-negative Campylobacter lari.

    PubMed

    Sekizuka, Tsuyoshi; Yokoi, Taeko; Murayama, Ohoshi; Millar, B Cherie; Moore, Johne; Matsuda, Motoo

    2005-08-01

    A newly constructed primer pair (lari-Af/lari-Ar) designed to generate a product of the flagellin (flaA) gene for urease-negative Campylobacter lari produced a PCR amplicon of about 1700 bp for 16 isolates from 7 seagulls, 5 humans, 3 food animals and one mussel in Japan and Northern Ireland. Nucleotide sequencing and alignments of the flaA amplicons from these isolates demonstrated that the deduced amino acid sequences of the possible open reading frame were 564-572 amino acid residues in length with calculated molecular weights of 58,804 to 59,463. The deduced amino acid sequence similarity analysis strongly suggested that the ORF of the flaA from the 16 isolates showed 70-75% sequence similarities to those of Campylobacter jejuni isolates. The approximate Mr of the flagellin purified from some of the isolates of urease-negative C. lari was estimated to range from 59.6 to 61.8 kDa. Thus, flagellin from the isolates of urease-negative C. lari was shown for the first time to have a molecular size similar to those of C. jejuni and Campylobacter coli isolates, but to be different from the shorter flaA and smaller flagellin of urease-positive thermophilic Campylobacter (UPTC) isolates. Flagellins from C. lari spp., consisting of the two representative taxa of urease-negative C. lari and UPTC, thus show genotypic and phenotypic diversity.

  3. Identification of genes differentially expressed during interaction of resistant and susceptible apple cultivars (Malus × domestica) with Erwinia amylovora

    PubMed Central

    2010-01-01

    Background The necrogenic enterobacterium, Erwinia amylovora is the causal agent of the fire blight (FB) disease in many Rosaceaespecies, including apple and pear. During the infection process, the bacteria induce an oxidative stress response with kinetics similar to those induced in an incompatible bacteria-plant interaction. No resistance mechanism to E. amylovora in host plants has yet been characterized, recent work has identified some molecular events which occur in resistant and/or susceptible host interaction with E. amylovora: In order to understand the mechanisms that characterize responses to FB, differentially expressed genes were identified by cDNA-AFLP analysis in resistant and susceptible apple genotypes after inoculation with E. amylovora. Results cDNA were isolated from M.26 (susceptible) and G.41 (resistant) apple tissues collected 2 h and 48 h after challenge with a virulent E. amylovora strain or mock (buffer) inoculated. To identify differentially expressed transcripts, electrophoretic banding patterns were obtained from cDNAs. In the AFLP experiments, M.26 and G.41 showed different patterns of expression, including genes specifically induced, not induced, or repressed by E. amylovora. In total, 190 ESTs differentially expressed between M.26 and G.41 were identified using 42 pairs of AFLP primers. cDNA-AFLP analysis of global EST expression in a resistant and a susceptible apple genotype identified different major classes of genes. EST sequencing data showed that genes linked to resistance, encoding proteins involved in recognition, signaling, defense and apoptosis, were modulated by E. amylovora in its host plant. The expression time course of some of these ESTs selected via a bioinformatic analysis has been characterized. Conclusion These data are being used to develop hypotheses of resistance or susceptibility mechanisms in Malus to E. amylovora and provide an initial categorization of genes possibly involved in recognition events, early

  4. Schrodinger's scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer.

    PubMed

    Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev

    2016-02-09

    Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.

  5. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    PubMed

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  6. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    PubMed Central

    2012-01-01

    Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base. PMID:23126469

  7. Neural Networks: A Primer

    DTIC Science & Technology

    1991-05-01

    AL-TP-1 991-0011 LA )_ NEURAL NETWORKS : A PRIMER.R • M 1 - T< R Vince L Wiggins 0 RRC, Incorporated N 3833 Texas Avenue, Suite 256 G Bryan, TX 77802T...5.av bln)2FUOTDTEF.-EOTTP NDIN NUMBCOERSD Neural Networks : A Primer C - F41 689-88-D-0251 PE - 62205F PR - 7719 6. AUTHOR(S) TA - 20 Vin~ce L Wiggins...Maximum 200 words) Neural network technology has recently demonstrated capabilities in areas important to personnel research such as statistical analysis

  8. Glacial survival east and west of the 'Mekong-Salween Divide' in the Himalaya-Hengduan Mountains region as revealed by AFLPs and cpDNA sequence variation in Sinopodophyllum hexandrum (Berberidaceae).

    PubMed

    Li, Yong; Zhai, Sheng-Nan; Qiu, Ying-Xiong; Guo, Yan-Ping; Ge, Xue-Jun; Comes, Hans Peter

    2011-05-01

    Molecular phylogeographic studies have recently begun to elucidate how plant species from the Qinghai-Tibetan Plateau (QTP) and adjacent regions responded to the Quaternary climatic oscillations. In this regard, however, far less attention has been paid to the southern and south-eastern declivities of the QTP, i.e. the Himalaya-Hengduan Mountains (HHM) region. Here, we report a survey of amplified fragment length polymorphisms (AFLPs) and chloroplast DNA (cpDNA) sequence variation in the HHM endemic Sinopodophyllum hexandrum, a highly selfing alpine perennial herb with mainly gravity-dispersed berries (105 individuals, 19 localities). We specifically aimed to test a vicariant evolutionary hypothesis across the 'Mekong-Salween Divide', a known biogeographic and phytogeographic boundary of north-to-south trending river valleys separating the East Himalayas and Hengduan Mts. Both cpDNA and AFLPs identified two divergent phylogroups largely congruent with these mountain ranges. There was no genetic depauperation in the more strongly glaciated East Himalayas (AFLPs: H(E)=0.031; cpDNA: h(S)=0.133) compared to the mainly ice-free Hengduan Mts. (AFLPs: H(E)=0.037; cpDNA: h(S)=0.082), while population differentiation was consistently higher in the former region (AFLPs: Φ(ST)=0.522 vs. 0.312; cpDNA: Φ(ST)=0.785 vs. 0.417). Our results suggest that East Himalayan and Hengduan populations of S. hexandrum were once fragmented, persisted in situ during glacials in both areas, and have not merged again, except for a major instance of inter-lineage chloroplast capture identified at the MSD boundary. Our coalescent time estimate for all cpDNA haplotypes (c. 0.37-0.48 mya), together with paleogeological evidence, strongly rejects paleo-drainage formation as a mechanism underlying allopatric fragmentation, whereas mountain glaciers following the ridges of the MSD during glacials (and possible interglacials) could have been responsible. This study thus indicates an important role

  9. In vitro cytotoxicity of orthodontic primers.

    PubMed

    D'Antò, Vincenzo; Spagnuolo, Gianrico; Polito, Ilaria; Paduano, Sergio; Ambrosio, Luigi; Valletta, Rosa

    2009-01-01

    The aim of this study was to evaluate the cytotoxicity of four orthodontic primers: Transbond XT and Transbond MIP (3M, USA), Eagle Fluorsure (American Orthodontics, USA) and Ortho Solo (Ormco, USA). Balb 3T3 cells were exposed to different concentrations of primers (0-0.25 mg/ml). Mitochondrial dehydrogenase activity was evaluated by MTT assay and cell necrosis was measured by flow cytometry (propidium iodide staining). All the materials decreased cell viability in a dose related manner. Cytotoxicity of orthodontic primers based on concentrations which caused a 50% decrease of mitochondrial activity was ranked as follows: Transbond XT (45.57 mg/ml) > Eagle Fluorsure (49.27 mg/ml) > Transbond MIP (64.35 mg/ml) > Ortho solo (70.09 mg/ml). Our results suggest that the cytotoxic potencies demonstrated by orthodontic primers might be of clinical relevance since they disturbed cell metabolism and induced cell death in monolayer cultures.

  10. Narrowing down the region of the Vf locus for scab resistance in apple using AFLP-derived SCARs.

    PubMed

    Huaracha, E; Xu, M; Korban, S S

    2004-01-01

    A narrow-down strategy to restrict the Vf region, which controls resistance to the fungal disease apple scab in apple, to a genetic distance of 0.4 cM is presented. Using 11 AFLP-derived SCARs and three RAPD-derived SCARs, all linked to the Vf gene, we subjected 1,412 scab-resistant individuals from 16 mapping populations to genotype analysis. Eleven recombinant individuals were identified within a genetic distance of 0.9 cM around the Vf gene. Using these 11 recombinants, we achieved fine-resolution of several AFLP-derived SCAR markers surrounding the Vf gene, resulting in the following genetic linkage map: ACS-6 and ACS are located left of the Vf gene at genetic distances of 0.2 cM and 0.1 cM, respectively; ACS-7 and ACS-9 are inseparable from the Vf gene; ACS-8, ACS-10, and ACS-4 are located to the right of the Vf gene at genetic distances of 0.1 cM, 0.4 cM, and 0.5 cM, respectively; the remaining five SCARs-ACS-11, ACS-5, ACS-2, ACS-1, and AL07-are inseparable and are located right of the Vf gene at a genetic distance of 0.7 cM. By integrating this linkage data with our previous physical map, we generated a revised map of the narrowed-down region of Vf.

  11. Fruitlet abscission: A cDNA-AFLP approach to study genes differentially expressed during shedding of immature fruits reveals the involvement of a putative auxin hydrogen symporter in apple (Malus domestica L. Borkh).

    PubMed

    Dal Cin, Valeriano; Barbaro, Enrico; Danesin, Marcello; Murayama, Hideki; Velasco, Riccardo; Ramina, Angelo

    2009-08-01

    Apple Malus X domestica fruitlet abscission is preceded by a stimulation of ethylene biosynthesis and a gain in sensitivity to the hormone. This phase was studied by a differential screening carried out by cDNA-AFLP in abscising (AF) and non-abscising (NAF) fruitlet populations. Fifty-three primer combinations allowed for the isolation of 131, 66 and 30 differentially expressed bands from cortex, peduncle and seed, respectively. All sequences were then classified as up- or down-regulated by comparing the profile in AFs and NAFs. Almost all of these sequences showed significant homology to genes encoding proteins with known or putative function. The gene ontology analysis of the TDFs isolated indicated a deep change in metabolism, plastid and hormonal status, especially auxin. Furthermore, some common elements between abscission and senescence were identified. The isolation of the full length of one of these TDFs allowed for the identification of a gene encoding an auxin hydrogen symporter (MdAHS). Bioinformatic analysis indicated that the deduced protein shares some features with other auxin efflux carriers, which include PINs. Nevertheless the 3D structure pointed out substantial differences and a conformation largely dissimilar from canonical ion transporters. The expression analysis demonstrated that this gene is regulated by light and development but not affected by ethylene or auxin.

  12. Charter School Primer. Peter Lang Primer. Volume 34

    ERIC Educational Resources Information Center

    Tryjankowski, Anne Marie

    2012-01-01

    The "Charter School Primer" presents an overview of public charter schools in the United States. The book discusses what charter schools are; the history of public charter school choice in the United States; the role of teachers, parents, boards, and unions in the charter school movement; and gives examples of innovations in education made…

  13. Hexavalent Chromium IV-Free Primer Development

    NASA Technical Reports Server (NTRS)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  14. Analysis of Claviceps africana and C. sorghi from India using AFLPs, EF-1alpha gene intron 4, and beta-tubulin gene intron 3.

    PubMed

    Tooley, Paul W; Bandyopadhyay, Ranajit; Carras, Marie M; Pazoutová, Sylvie

    2006-04-01

    Isolates of Claviceps causing ergot on sorghum in India were analysed by AFLP analysis, and by analysis of DNA sequences of the EF-1alpha gene intron 4 and beta-tubulin gene intron 3 region. Of 89 isolates assayed from six states in India, four were determined to be C. sorghi, and the rest C. africana. A relatively low level of genetic diversity was observed within the Indian C. africana population. No evidence of genetic exchange between C. africana and C. sorghi was observed in either AFLP or DNA sequence analysis. Phylogenetic analysis was conducted using DNA sequences from 14 different Claviceps species. A multigene phylogeny based on the EF-1alpha gene intron 4, the beta-tubulin gene intron 3 region, and rDNA showed that C. sorghi grouped most closely with C. gigantea and C. africana. Although the Claviceps species we analysed were closely related, they colonize hosts that are taxonomically very distinct suggesting that there is no direct coevolution of Claviceps with its hosts.

  15. Identification, genetic localization, and allelic diversity of selectively amplified microsatellite polymorphic loci in lettuce and wild relatives (Lactuca spp.).

    PubMed

    Witsenboer, H; Michelmore, R W; Vogel, J

    1997-12-01

    Selectively amplified microsatellite polymorphic locus (SAMPL) analysis is a method of amplifying microsatellite loci using generic PCR primers. SAMPL analysis uses one AFLP primer in combination with a primer complementary to microsatellite sequences. SAMPL primers based on compound microsatellite sequences provided the clearest amplification patterns. We explored the potential of SAMPL analysis in lettuce to detect PCR-based codominant microsatellite markers. Fifty-eight SAMPLs were identified and placed on the genetic map. Seventeen were codominant. SAMPLs were dispersed with RFLP markers on 11 of the 12 main linkage groups in lettuce, indicating that they have a similar genomic distribution. Some but not all fragments amplified by SAMPL analysis were confirmed to contain microsatellite sequences by Southern hybridization. Forty-five cultivars of lettuce and five wild species of Lactuca were analyzed to determine the allelic diversity for codominant SAMPLs. From 3 to 11 putative alleles were found for each SAMPL; 2-6 alleles were found within Lactuca sativa and 1-3 alleles were found among the crisphead genotypes, the most genetically homogeneous plant type of L. sativa. This allelic diversity is greater than that found for RFLP markers. Numerous new alleles were observed in the wild species; however, there were frequent null alleles. Therefore, SAMPL analysis is more applicable to intraspecific than to interspecific comparisons. A phenetic analysis based on SAMPLs resulted in a dendrogram similar to those based on RFLP and AFLP markers.

  16. Multiplex primer prediction software for divergent targets

    PubMed Central

    Gardner, Shea N.; Hiddessen, Amy L.; Williams, Peter L.; Hara, Christine; Wagner, Mark C.; Colston, Bill W.

    2009-01-01

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets to amplify all members of large, diverse and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers (∼3700 18-mers or ∼2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus (FMDV), hemagglutinin (HA) and neuraminidase (NA) segments of influenza A virus, Norwalk virus, and HIV-1. We empirically demonstrated the application of the software with a multiplex set of 16 short (10 nt) primers designed to amplify the Poxviridae family to produce a specific amplicon from vaccinia virus. PMID:19759213

  17. Primer on spontaneous heating and pyrophoricity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardousmore » material training.« less

  18. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

  19. Detecting the influence of ornamental Berberis thunbergii var. atropurpurea in invasive populations of Berberis thunbergii (Berberidaceae) using AFLP1.

    PubMed

    Lubell, Jessica D; Brand, Mark H; Lehrer, Jonathan M; Holsinger, Kent E

    2008-06-01

    Japanese barberry (Berberis thunbergii DC.) is a widespread invasive plant that remains an important landscape shrub represented by ornamental, purple-leaved forms of the botanical variety atropurpurea. These forms differ greatly in appearance from feral plants, bringing into question whether they contribute to invasive populations or whether the invasions represent self-sustaining populations derived from the initial introduction of the species in the late 19th century. In this study we used amplified fragment length polymorphism (AFLP) markers to determine whether genetic contributions from B. t. var. atropurpurea are found within naturalized Japanese barberry populations in southern New England. Bayesian clustering of AFLP genotypes and principal coordinate analysis distinguished B. t. var. atropurpurea genotypes from 85 plants representing five invasive populations. While a single feral plant resembled B. t. var. atropurpurea phenotypically and fell within the same genetic cluster, all other naturalized plants sampled were genetically distinct from the purple-leaved genotypes. Seven plants from two different sites possessed morphology consistent with Berberis vulgaris (common barberry) or B. ×ottawensis (B. thunbergii × B. vulgaris). Genetic analysis placed these plants in two clusters separate from B. thunbergii. Although the Bayesian analysis indicated some introgression of B. t. var. atropurpurea and B. vulgaris, these genotypes have had limited influence on extant feral populations of B. thunbergii.

  20. Multiplexing Short Primers for Viral Family PCR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gardner, S N; Hiddessen, A L; Hara, C A

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and formore » several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.« less

  1. Primer on noise.

    DOT National Transportation Integrated Search

    1972-01-01

    This primer was directed to the district and resident engineers of the Virginia Department of Highways, who are responsible for conducting highway public hearings, and to the environmental specialists of the Department's Environmental Quality Divisio...

  2. Nuclear markers reveal that inter-lake cichlids' similar morphologies do not reflect similar genealogy.

    PubMed

    Kassam, Daud; Seki, Shingo; Horic, Michio; Yamaoka, Kosaku

    2006-08-01

    The apparent inter-lake morphological similarity among East African Great Lakes' cichlid species/genera has left evolutionary biologists asking whether such similarity is due to sharing of common ancestor or mere convergent evolution. In order to answer such question, we first used Geometric Morphometrics, GM, to quantify morphological similarity and then subsequently used Amplified Fragment Length Polymorphism, AFLP, to determine if similar morphologies imply shared ancestry or convergent evolution. GM revealed that not all presumed morphological similar pairs were indeed similar, and the dendrogram generated from AFLP data indicated distinct clusters corresponding to each lake and not inter-lake morphological similar pairs. Such results imply that the morphological similarity is due to convergent evolution and not shared ancestry. The congruency of GM and AFLP generated dendrograms imply that GM is capable of picking up phylogenetic signal, and thus GM can be potential tool in phylogenetic systematics.

  3. Rust transformation/rust compatible primers

    NASA Technical Reports Server (NTRS)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  4. Beam shaping for laser initiated optical primers

    NASA Astrophysics Data System (ADS)

    Lizotte, Todd E.

    2008-08-01

    Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.

  5. Design of new genome- and gene-sourced primers and identification of QTL for seed oil content in a specially high-oil Brassica napus cultivar.

    PubMed

    Sun, Meiyu; Hua, Wei; Liu, Jing; Huang, Shunmou; Wang, Xinfa; Liu, Guihua; Wang, Hanzhong

    2012-01-01

    Rapeseed (Brassica napus L.) is one of most important oilseed crops in the world. There are now various rapeseed cultivars in nature that differ in their seed oil content because they vary in oil-content alleles and there are high-oil alleles among the high-oil rapeseed cultivars. For these experiments, we generated doubled haploid (DH) lines derived from the cross between the specially high-oil cultivar zy036 whose seed oil content is approximately 50% and the specially low-oil cultivar 51070 whose seed oil content is approximately 36%. First, to address the deficiency in polymorphic markers, we designed 5944 pairs of newly developed genome-sourced primers and 443 pairs of newly developed primers related to oil-content genes to complement the 2244 pairs of publicly available primers. Second, we constructed a new DH genetic linkage map using 527 molecular markers, consisting of 181 publicly available markers, 298 newly developed genome-sourced markers and 48 newly developed markers related to oil-content genes. The map contained 19 linkage groups, covering a total length of 2,265.54 cM with an average distance between markers of 4.30 cM. Third, we identified quantitative trait loci (QTL) for seed oil content using field data collected at three sites over 3 years, and found a total of 12 QTL. Of the 12 QTL associated with seed oil content identified, 9 were high-oil QTL which derived from the specially high-oil cultivar zy036. Two high-oil QTL on chromosomes A2 and C9 co-localized in two out of three trials. By QTL mapping for seed oil content, we found four candidate genes for seed oil content related to four gene markers: GSNP39, GSSR161, GIFLP106 and GIFLP046. This information will be useful for cloning functional genes correlated with seed oil content in the future.

  6. Design of primers and probes for quantitative real-time PCR methods.

    PubMed

    Rodríguez, Alicia; Rodríguez, Mar; Córdoba, Juan J; Andrade, María J

    2015-01-01

    Design of primers and probes is one of the most crucial factors affecting the success and quality of quantitative real-time PCR (qPCR) analyses, since an accurate and reliable quantification depends on using efficient primers and probes. Design of primers and probes should meet several criteria to find potential primers and probes for specific qPCR assays. The formation of primer-dimers and other non-specific products should be avoided or reduced. This factor is especially important when designing primers for SYBR(®) Green protocols but also in designing probes to ensure specificity of the developed qPCR protocol. To design primers and probes for qPCR, multiple software programs and websites are available being numerous of them free. These tools often consider the default requirements for primers and probes, although new research advances in primer and probe design should be progressively added to different algorithm programs. After a proper design, a precise validation of the primers and probes is necessary. Specific consideration should be taken into account when designing primers and probes for multiplex qPCR and reverse transcription qPCR (RT-qPCR). This chapter provides guidelines for the design of suitable primers and probes and their subsequent validation through the development of singlex qPCR, multiplex qPCR, and RT-qPCR protocols.

  7. Dense genetic linkage maps of three Populus species (Populus deltoides, P. nigra and P. trichocarpa) based on AFLP and microsatellite markers.

    PubMed

    Cervera, M T; Storme, V; Ivens, B; Gusmão, J; Liu, B H; Hostyn, V; Van Slycken, J; Van Montagu, M; Boerjan, W

    2001-06-01

    Populus deltoides, P. nigra, and P. trichocarpa are the most important species for poplar breeding programs worldwide. In addition, Populus has become a model for fundamental research on trees. Linkage maps were constructed for these three species by analyzing progeny of two controlled crosses sharing the same female parent, Populus deltoides cv. S9-2 x P. nigra cv. Ghoy and P. deltoides cv. S9-2 x P. trichocarpa cv. V24. The two-way pseudotestcross mapping strategy was used to construct the maps. Amplified fragment length polymorphism (AFLP) markers that segregated 1:1 were used to form the four parental maps. Microsatellites and sequence-tagged sites were used to align homoeologous groups between the maps and to merge linkage groups within the individual maps. Linkage analysis and alignment of the homoeologous groups resulted in 566 markers distributed over 19 groups for P. deltoides covering 86% of the genome, 339 markers distributed over 19 groups for P. trichocarpa covering 73%, and 369 markers distributed over 28 groups for P. nigra covering 61%. Several tests for randomness showed that the AFLP markers were randomly distributed over the genome.

  8. Dense genetic linkage maps of three Populus species (Populus deltoides, P. nigra and P. trichocarpa) based on AFLP and microsatellite markers.

    PubMed Central

    Cervera, M T; Storme, V; Ivens, B; Gusmão, J; Liu, B H; Hostyn, V; Van Slycken, J; Van Montagu, M; Boerjan, W

    2001-01-01

    Populus deltoides, P. nigra, and P. trichocarpa are the most important species for poplar breeding programs worldwide. In addition, Populus has become a model for fundamental research on trees. Linkage maps were constructed for these three species by analyzing progeny of two controlled crosses sharing the same female parent, Populus deltoides cv. S9-2 x P. nigra cv. Ghoy and P. deltoides cv. S9-2 x P. trichocarpa cv. V24. The two-way pseudotestcross mapping strategy was used to construct the maps. Amplified fragment length polymorphism (AFLP) markers that segregated 1:1 were used to form the four parental maps. Microsatellites and sequence-tagged sites were used to align homoeologous groups between the maps and to merge linkage groups within the individual maps. Linkage analysis and alignment of the homoeologous groups resulted in 566 markers distributed over 19 groups for P. deltoides covering 86% of the genome, 339 markers distributed over 19 groups for P. trichocarpa covering 73%, and 369 markers distributed over 28 groups for P. nigra covering 61%. Several tests for randomness showed that the AFLP markers were randomly distributed over the genome. PMID:11404342

  9. Protective Coats For Zinc-Rich Primers

    NASA Technical Reports Server (NTRS)

    Macdowell, Louis G, III

    1993-01-01

    Report describes tests of topcoats for inorganic zinc-rich primers on carbon steel. Topcoats intended to provide additional protection against corrosion in acidic, salty seacoast-air/rocket-engine-exhaust environment of Space Shuttle launch site. Tests focused on polyurethane topcoats on epoxy tie coats on primers. Part of study involved comparison between "high-build" coating materials and thin-film coating materials.

  10. Barcoded NS31/AML2 primers for sequencing of arbuscular mycorrhizal communities in environmental samples1

    PubMed Central

    Morgan, Benjamin S. T.; Egerton-Warburton, Louise M.

    2017-01-01

    Premise of the study: Arbuscular mycorrhizal fungi (AMF) are globally important root symbioses that enhance plant growth and nutrition and influence ecosystem structure and function. To better characterize levels of AMF diversity relevant to ecosystem function, deeper sequencing depth in environmental samples is needed. In this study, Illumina barcoded primers and a bioinformatics pipeline were developed and applied to study AMF diversity and community structure in environmental samples. Methods: Libraries of small subunit ribosomal RNA fragment amplicons were amplified from environmental DNA using a single-step PCR reaction with barcoded NS31/AML2 primers. Amplicons were sequenced on an Illumina MiSeq sequencer using version 2, 2 × 250-bp paired-end chemistry, and analyzed using QIIME and RDP Classifier. Results: Sequencing captured 196 to 6416 operational taxonomic units (OTUs; depending on clustering parameters) representing nine AMF genera. Regardless of clustering parameters, ∼20 OTUs dominated AMF communities (78–87% reads) with the remaining reads distributed among other OTUs. Analyses also showed significant biogeographic differences in AMF communities and that community composition could be linked to specific edaphic factors. Discussion: Barcoded NS31/AML2 primers and Illumina MiSeq sequencing provide a powerful approach to address AMF diversity and variations in fungal assemblages across host plants, ecosystems, and responses to environmental drivers including global change. PMID:28924511

  11. Vygotsky on Education Primer. Peter Lang Primer. Volume 30

    ERIC Educational Resources Information Center

    Lake, Robert

    2012-01-01

    The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…

  12. Mining for sensitive and reliable species-specific primers for PCR for detection of Cronobacter sakazakii by a bioinformatics approach.

    PubMed

    Qiming, Chen; Tingting, Tao; Xiaomei, Bie; Yingjian, Lu; Fengxia, Lu; Ligong, Zhai; Zhaoxin, Lu

    2015-08-01

    Although several studies have reported PCR assays for distinguishing Cronobacter sakazakii from other species in the genus, reports regarding assay sensitivity and specificity, as well as applications for food testing, are lacking. Hence, the objective of this study was to develop a sensitive and reliable PCR-based method for detection of C. sakazakii by screening for specific target genes. The genome sequence of C. sakazakii in the GenBank database was compared with that of other organisms using BLAST. Thirty-eight DNA fragments unique to C. sakazakii were identified, and primers targeting these sequences were designed. Finally, 3 primer sets (CS14, CS21, and CS38) were found to be specific for C. sakazakii by PCR verification. The detection limit of PCR assays using the 3 pairs of primers was 1.35 pg/μL, 135 fg/μL, and 135 fg/μL, respectively, for genomic DNA, and 5.5×10(5), 5.5×10(3), 5.5×10(3) cfu/mL, respectively, using pure cultures of the bacteria, compared with 13.5 pg/μLand 5.5×10(5) cfu/mLfor primer set SpeCronsaka, which has been previously described. Cronobacter sakazakii were detected in artificially contaminated powdered infant formula (PIF) by PCR using primer sets CS21 and CS38 after 8h of enrichment. The detection limit was 5.5×10(-1) cfu/10g of PIF. Thus, the PCR assay can be used for rapid and sensitive detection of C. sakazakii in PIF. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  13. The yeast retrotransposon Ty5 uses the anticodon stem-loop of the initiator methionine tRNA as a primer for reverse transcription.

    PubMed Central

    Ke, N; Gao, X; Keeney, J B; Boeke, J D; Voytas, D F

    1999-01-01

    Retrotransposons and retroviruses replicate by reverse transcription of an mRNA intermediate. Most retroelements initiate reverse transcription from a host-encoded tRNA primer. DNA synthesis typically extends from the 3'-OH of the acceptor stem, which is complementary to sequences on the retroelement mRNA (the primer binding site, PBS). However, for some retrotransposons, including the yeast Ty5 elements, sequences in the anticodon stem-loop of the initiator methionine tRNA (IMT) are complementary to the PBS. We took advantage of the genetic tractability of the yeast system to investigate the mechanism of Ty5 priming. We found that transposition frequencies decreased at least 800-fold for mutations in the Ty5 PBS that disrupt complementarity with the IMT. Similarly, transposition was reduced at least 200-fold for IMT mutations in the anticodon stem-loop. Base pairing between the Ty5 PBS and IMT is essential for transposition, as compensatory changes that restored base pairing between the two mutant RNAs restored transposition significantly. An analysis of 12 imt mutants with base changes outside of the region of complementarity failed to identify other tRNA residues important for transposition. In addition, assays carried out with heterologous IMTs from Schizosaccharomyces pombe and Arabidopsis thaliana indicated that residues outside of the anticodon stem-loop have at most a fivefold effect on transposition. Our genetic system should make it possible to further define the components required for priming and to understand the mechanism by which Ty5's novel primer is generated. PMID:10411136

  14. Specific primers design based on the superoxide dismutase b gene for Trypanosoma cruzi as a screening tool: Validation method using strains from Colombia classified according to their discrete typing unit.

    PubMed

    Olmo, Francisco; Escobedo-Orteg, Javier; Palma, Patricia; Sánchez-Moreno, Manuel; Mejía-Jaramillo, Ana; Triana, Omar; Marín, Clotilde

    2014-11-01

    To classify 21 new isolates of Trypanosoma cruzi (T. cruzi) according to the Discrete Typing Unit (DTU) which they belong to, as well as tune up a new pair of primers designed to detect the parasite in biological samples. Strains were isolated, DNA extracted, and classified by using three Polymerase Chain Reactions (PCR). Subsequently this DNA was used along with other isolates of various biological samples, for a new PCR using primers designed. Finally, the amplified fragments were sequenced. It was observed the predominance of DTU I in Colombia, as well as the specificity of our primers for detection of T. cruzi, while no band was obtained when other species were used. This work reveals the genetic variability of 21 new isolates of T. cruzi in Colombia.Our primers confirmed their specificity for detecting the presence of T. cruzi. Copyright © 2014 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

  15. Genetic and physical mapping of homologues of the virus resistance gene Rx1 and the cyst nematode resistance gene Gpa2 in potato.

    PubMed

    Bakker, E; Butterbach, P; Rouppe van der Voort, J; van der Vossen, E; van Vliet, J; Bakker, J; Goverse, A

    2003-05-01

    Nine resistance gene homologues (RGHs) were identified in two diploid potato clones (SH and RH), with a specific primer pair based on conserved motifs in the LRR domain of the potato cyst nematode resistance gene Gpa2 and the potato virus X resistance gene Rx1. A modified AFLP method was used to facilitate the genetic mapping of the RGHs in the four haplotypes under investigation. All nine RGHs appeared to be located in the Gpa2/ Rx1 cluster on chromosome XII. Construction of a physical map using bacterial artificial chromosome (BAC) clones for both the Solanum tuberosum ssp. tuberosum and the S. tuberosum ssp. andigena haplotype of SH showed that the RGHs are located within a stretch of less than 200 kb. Sequence analysis of the RGHs revealed that they are highly similar (93 to 95%) to Gpa2 and Rx1. The sequence identities among all RGHs range from 85 to 100%. Two pairs of RGHs are identical, or nearly so (100 and 99.9%), with each member located in a different genotype. Southern-blot analysis on genomic DNA revealed no evidence for additional homologues outside the Gpa2/ Rx1 cluster on chromosome XII.

  16. Simple sequence repeat marker loci discovery using SSR primer.

    PubMed

    Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

    2004-06-12

    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

  17. Value for money assessment for public-private partnerships : a primer.

    DOT National Transportation Integrated Search

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of primers.

  18. Initialization of Formation Flying Using Primer Vector Theory

    NASA Technical Reports Server (NTRS)

    Mailhe, Laurie; Schiff, Conrad; Folta, David

    2002-01-01

    In this paper, we extend primer vector analysis to formation flying. Optimization of the classical rendezvous or free-time transfer problem between two orbits using primer vector theory has been extensively studied for one spacecraft. However, an increasing number of missions are now considering flying a set of spacecraft in close formation. Missions such as the Magnetospheric MultiScale (MMS) and Leonardo-BRDF (Bidirectional Reflectance Distribution Function) need to determine strategies to transfer each spacecraft from the common launch orbit to their respective operational orbit. In addition, all the spacecraft must synchronize their states so that they achieve the same desired formation geometry over each orbit. This periodicity requirement imposes constraints on the boundary conditions that can be used for the primer vector algorithm. In this work we explore the impact of the periodicity requirement in optimizing each spacecraft transfer trajectory using primer vector theory. We first present our adaptation of primer vector theory to formation flying. Using this method, we then compute the AV budget for each spacecraft subject to different formation endpoint constraints.

  19. The possible physical barrier and coastal dispersal strategy for Japanese grenadier anchovy, Coilia nasus in the East China Sea and Yellow Sea: evidence from AFLP markers.

    PubMed

    Han, Zhi-Qiang; Han, Gang; Wang, Zhi-Yong; Gao, Tian-Xiang

    2015-02-03

    In order to ascertain the taxonomic status of the Ariake Sea population of Japanese grenadier anchovy, Coilia nasus, and assess the contemporary possible genetic barrier between the west and east coastal waters of the East China Sea, we used amplified fragment length polymorphism (AFLP) markers to detect the genetic structure of C. nasus, in the East China Sea and Yellow Sea. Eighty-one individuals of C. nasus were collected from five locations and 12 individuals of Coilia mystus were sampled from the Yangtze River Estuary. A total of 371 loci were detected by five primer combinations, 310 of which were polymorphic (83.56%). Analysis of molecular variation (AMOVA) and pairwise fixation index (FST) revealed significant genetic differentiation among five samples, indicating limited gene flow among populations. The dendrogram for populations by neighbor-joining (NJ) cluster analysis provided evidence of a clear relationship between genetic and geographic patterns, supporting significant genetic differentiation between China coastal populations and Ariake Sea populations. Compared to the genetic divergence between C. nasus and C. mystus, the level of genetic differentiation between China and the Ariake Sea populations of C. nasus is obvious below the species level, indicating isolated populations of C. nasus in the Ariake Sea. Isolation by distance analysis revealed that direct ocean distance with deep-water at the continental slope and high salinity between west and east coastal waters of the East China Sea served as major physical barrier to C. nasus, supporting the coastal dispersal pattern in this estuarine species, and rejecting offshore dispersal strategy.

  20. Antimicrobial and physical characteristics of orthodontic primers containing antimicrobial agents.

    PubMed

    Chung, Shin-Hye; Cho, Soha; Kim, Kyungsun; Lim, Bum-Soon; Ahn, Sug-Joon

    2017-03-01

    To compare the antimicrobial and physical properties of experimental primers containing chlorhexidine (CHX) or ursolic acid (UA) with a commercial primer. Two antibacterial agents, 3 mg each of CHX and UA were incorporated respectively into 1 ml of Transbond XT primer (TX) to form antibacterial primers, TX-CHX and TX-UA. The antimicrobial activity of the three primers (TX, TX-CHX, and TX-UA) against Streptococcus mutans in both planktonic and biofilm phases was analyzed by determining minimum inhibitory and bactericidal concentrations and by performing growth and biofilm assays. Growth and biofilm assays were performed in both the absence and presence of thermocycling in a water tank to analyze the effects of water aging on the antimicrobial activities of primers. After bonding brackets onto bovine incisors using the primers, shear bond strength and mode of fracture were analyzed to compare physical properties. TX-CHX had stronger antimicrobial activity against S. mutans in the planktonic and biofilm phases than did TX or TX-UA. When applied, TX-CHX completely inhibited the growth and biofilm formation of S. mutans . In addition, the antimicrobial activity of TX-CHX was maintained after thermocycling. However, TX-UA did not show significant antimicrobial activity compared with TX. There was no significant difference in either shear bond strength or bond failure interface among the primers. Incorporation of CHX into an orthodontic primer may help prevent enamel demineralization around surfaces without compromising its physical properties.

  1. A Primer on Sampling for Statewide Assessment.

    ERIC Educational Resources Information Center

    Jaeger, Richard M.

    This paper is a primer on sampling procedures for statewide assessment. The careful reader should gain substantial knowledge about the promises and pitfalls of sampling for assessment. The primer has three basic objectives: (1) to define terms and concepts basic to sampling theory and its application, including population, sampling unit, sampling…

  2. Phylum- and Class-Specific PCR Primers for General Microbial Community Analysis

    PubMed Central

    Blackwood, Christopher B.; Oaks, Adam; Buyer, Jeffrey S.

    2005-01-01

    Amplification of a particular DNA fragment from a mixture of organisms by PCR is a common first step in methods of examining microbial community structure. The use of group-specific primers in community DNA profiling applications can provide enhanced sensitivity and phylogenetic detail compared to domain-specific primers. Other uses for group-specific primers include quantitative PCR and library screening. The purpose of the present study was to develop several primer sets targeting commonly occurring and important groups. Primers specific for the 16S ribosomal sequences of Alphaproteobacteria, Betaproteobacteria, Bacilli, Actinobacteria, and Planctomycetes and for parts of both the 18S ribosomal sequence and the internal transcribed spacer region of Basidiomycota were examined. Primers were tested by comparison to sequences in the ARB 2003 database, and chosen primers were further tested by cloning and sequencing from soil community DNA. Eighty-five to 100% of the sequences obtained from clone libraries were found to be placed with the groups intended as targets, demonstrating the specificity of the primers under field conditions. It will be important to reevaluate primers over time because of the continual growth of sequence databases and revision of microbial taxonomy. PMID:16204538

  3. A genetic linkage map of the Durum x Triticum dicoccoides backcross population based on SSRs and AFLP markers, and QTL analysis for milling traits.

    PubMed

    Elouafi, I; Nachit, M M

    2004-02-01

    Durum wheat ( Triticum turgidum L. var durum) is mainly produced and consumed in the Mediterranean region; it is used to produce several specific end-products; such as local pasta, couscous and burghul. To study the genetics of grain-milling quality traits, chromosomal locations, and interaction with the environment, a genetic linkage map of durum was constructed and the quantitative trait loci QTLs for the milling-related traits, test weight (TW) and thousand-kernel weight (TKW), were identified. The population constituted 114 recombinant inbred lines derived from the cross: Omrabi 5 /Triticum dicoccoides 600545// Omrabi 5. TW and TKW were analyzed over 18 environments (sites x years). Single-sequence-repeat markers (SSRs), Amplified-fragment-length-polymorphism markers (AFLPs), and seed storage proteins (SSPs) showed a high level of polymorphism (>60%). The map was constructed with 124 SSRs, 149 AFLPs and 6 SSPs; its length covered 2,288.8 cM (8.2 cM/marker). The map showed high synteny with previous wheat maps, and both SSRs and AFLPs mapped evenly across the genome, with more markers in the B genome. However, some rearrangements were observed. For TW, a high genotypic effect was detected and two QTLs with epistasic effect were identified on 7AS and 6BS, explaining 30% of the total variation. The TKW showed a significant transgressive inheritance and five QTLs were identified, explaining 32% of the total variation, out of which 25% was of a genetic nature, and showing QTLxE interaction. The major TKW-QTLs were around the centromere region of 6B. For both traits, Omrabi 5 alleles had a significant positive effect. This population will be used to determine other QTLs of interest, as its parents are likely to harbor different genes for diseases and drought tolerance.

  4. Economics : pricing, demand, and economic efficiency : a primer.

    DOT National Transportation Integrated Search

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  5. Origins of domestication and polyploidy in oca (Oxalis tuberosa; Oxalidaceae). 3. AFLP data of oca and four wild, tuber-bearing taxa.

    PubMed

    Emshwiller, Eve; Theim, Terra; Grau, Alfredo; Nina, Victor; Terrazas, Franz

    2009-10-01

    Many crops are polyploids, and it can be challenging to untangle the often complicated history of their origins of domestication and origins of polyploidy. To complement other studies of the origins of polyploidy of the octoploid tuber crop oca (Oxalis tuberosa) that used DNA sequence data and phylogenetic methods, we here compared AFLP data for oca with four wild, tuber-bearing Oxalis taxa found in different regions of the central Andes. Results confirmed the divergence of two use-categories of cultivated oca that indigenous farmers use for different purposes, suggesting the possibility that they might have had separate origins of domestication. Despite previous results with nuclear-encoded, chloroplast-expressed glutamine synthetase suggesting that O. picchensis might be a progenitor of oca, AFLP data of this species, as well as different populations of wild, tuber-bearing Oxalis found in Lima Department, Peru, were relatively divergent from O. tuberosa. Results from all analytical methods suggested that the unnamed wild, tuber-bearing Oxalis found in Bolivia and O. chicligastensis in NW Argentina are the best candidates as the genome donors for polyploid O. tuberosa, but the results were somewhat equivocal about which of these two taxa is the more strongly supported as oca's progenitor.

  6. Transferability of microsatellite primers developed for stingless bees to four other species of the genus Melipona.

    PubMed

    Viana, M V C; Miranda, E A; de Francisco, A K; Carvalho, C A L; Waldschmidt, A M

    2011-11-22

    Microsatellite markers are a useful tool for ecological monitoring of natural and managed populations. A technical limitation is the necessity for investment in the development of primers. Heterologous primers can provide an alternative to searching for new loci. In bees, these markers have been used in populational and intracolonial genetic analyses. The genus Melipona has the largest number of species among bee genera, about 70, occurring throughout the Neotropical region. However, only five species of the genus Melipona have specific microsatellite markers. Given the great diversity of this genus, this number is not representative. We analyzed the transferability of 49 microsatellite loci to four other species of the genus Melipona (M. scutellaris, M. mondury, M. mandacaia, and M. quadrifasciata). Four individuals of each species, from different localities, were used in amplification tests. Primer pairs described for five Melipona species and for Trigona carbonaria were tested. Among the 49 loci, 22 gave amplification products for all four species, while three gave nonspecific bands and five showed no amplification products. The remaining loci varied in the pattern of amplification, according to the species examined. The number of alleles ranged from 1 to 6. The results demonstrate the possibility of using these heterologous markers in other Melipona species, increasing the number of loci that can be analyzed and contributing to further genetic analyses of intra- and intercolonial structure, which is required for conservation measure planning, genetic improvement and resolution of taxonomic problems.

  7. Quick spacecraft charging primer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Larsen, Brian Arthur

    2014-03-12

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  8. Primer design for a prokaryotic differential display RT-PCR.

    PubMed Central

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-01-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR. PMID:9108168

  9. Primer design for a prokaryotic differential display RT-PCR.

    PubMed

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-05-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

  10. DNA methylation and methylation polymorphism in ecotypes of Jatropha curcas L. using methylation-sensitive AFLP markers.

    PubMed

    Mastan, Shaik G; Rathore, Mangal S; Bhatt, Vacha D; Chikara, J; Ghosh, A

    2014-12-01

    We investigated DNA methylation and polymorphism in the methylated DNA using AFLP based methylation-sensitive amplification polymorphism (MS-AFLP) markers in ecotypes of Jatropha curcas L. growing in similar and different geo-ecological conditions. Three ecotypes growing in different geo-ecological conditions with environmental heterogeneity (Group-1) and five ecotypes growing in similar environmental conditions (Group-2) were assessed. In ecotypes growing in group-1, 44.32 % DNA was methylated and of which 93.59 % DNA was polymorphic. While in group-2, 32.27 % DNA was methylated, of which 51.64 % DNA was polymorphic. In site 1 and site 2 of group-1, overall methylation was 18.94 and 22.44 % respectively with difference of 3.5 %, while overall polymorphism was 41.14 and 39.23 % with a difference of 1.91 %. In site 1 and site 2 of group-2, overall methylation was 24.68 and 24.18 % respectively with difference of 0.5 %, while overall polymorphism was 12.19 and 12.65 % with a difference of 0.46 %. The difference of methylation percentage and percentage of methylation polymorphism throughout the genome of J. curcas at site 1 and 2 of group-1 is higher than that of J. curcas at site 1 and 2 of group-2. These results correlated the physico-chemical properties of soil at these sites. The variations of physico-chemical properties of soil at Chorwadla (site 1 in group-1 and site 2 in group-2) compared to the soil at Brahmapur (site 2 in group-1) is higher than that of soil at Neswad (site 1 in group-2). The study suggests that these homologous nucleotide sequences probably play important role in ecotype adaptation to environmental heterogeneity by creating epiallelic variations hence in evolution of ecotypes/clines or forms of species showing phenotypic/genotypic differences in different geographical areas.

  11. A Dozen Primers on Important Information Standards

    ERIC Educational Resources Information Center

    Dempsey, Kathy, Comp.

    2007-01-01

    This is a compilation of 12 primers on important information standards and protocols. These primers are: (1) Atom; (2) COinS; (3) MADS; (4) MARC 21/MARCXML; (5) MIX; (6) MXG; (7) OpenSearch; (8) PREMIS; (9) RESTful HTTP; (10) unAPI; (11) XMPP (aka Jabber); and (12) ZeeRex. The Atom Syndication Format defines a new XML-based syndication format for…

  12. Climate Change, Health, and Communication: A Primer.

    PubMed

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  13. Genetic diversity analysis of common beans based on molecular markers

    PubMed Central

    Gill-Langarica, Homar R.; Muruaga-Martínez, José S.; Vargas-Vázquez, M.L. Patricia; Rosales-Serna, Rigoberto; Mayek-Pérez, Netzahualcoyotl

    2011-01-01

    A core collection of the common bean (Phaseolus vulgaris L.), representing genetic diversity in the entire Mexican holding, is kept at the INIFAP (Instituto Nacional de Investigaciones Forestales, Agricolas y Pecuarias, Mexico) Germplasm Bank. After evaluation, the genetic structure of this collection (200 accessions) was compared with that of landraces from the states of Oaxaca, Chiapas and Veracruz (10 genotypes from each), as well as a further 10 cultivars, by means of four amplified fragment length polymorphisms (AFLP) +3/+3 primer combinations and seven simple sequence repeats (SSR) loci, in order to define genetic diversity, variability and mutual relationships. Data underwent cluster (UPGMA) and molecular variance (AMOVA) analyses. AFLP analysis produced 530 bands (88.5% polymorphic) while SSR primers amplified 174 alleles, all polymorphic (8.2 alleles per locus). AFLP indicated that the highest genetic diversity was to be found in ten commercial-seed classes from two major groups of accessions from Central Mexico and Chiapas, which seems to be an important center of diversity in the south. A third group included genotypes from Nueva Granada, Mesoamerica, Jalisco and Durango races. Here, SSR analysis indicated a reduced number of shared haplotypes among accessions, whereas the highest genetic components of AMOVA variation were found within accessions. Genetic diversity observed in the common-bean core collection represents an important sample of the total Phaseolus genetic variability at the main Germplasm Bank of INIFAP. Molecular marker strategies could contribute to a better understanding of the genetic structure of the core collection as well as to its improvement and validation. PMID:22215964

  14. Genetic diversity analysis of common beans based on molecular markers.

    PubMed

    Gill-Langarica, Homar R; Muruaga-Martínez, José S; Vargas-Vázquez, M L Patricia; Rosales-Serna, Rigoberto; Mayek-Pérez, Netzahualcoyotl

    2011-10-01

    A core collection of the common bean (Phaseolus vulgaris L.), representing genetic diversity in the entire Mexican holding, is kept at the INIFAP (Instituto Nacional de Investigaciones Forestales, Agricolas y Pecuarias, Mexico) Germplasm Bank. After evaluation, the genetic structure of this collection (200 accessions) was compared with that of landraces from the states of Oaxaca, Chiapas and Veracruz (10 genotypes from each), as well as a further 10 cultivars, by means of four amplified fragment length polymorphisms (AFLP) +3/+3 primer combinations and seven simple sequence repeats (SSR) loci, in order to define genetic diversity, variability and mutual relationships. Data underwent cluster (UPGMA) and molecular variance (AMOVA) analyses. AFLP analysis produced 530 bands (88.5% polymorphic) while SSR primers amplified 174 alleles, all polymorphic (8.2 alleles per locus). AFLP indicated that the highest genetic diversity was to be found in ten commercial-seed classes from two major groups of accessions from Central Mexico and Chiapas, which seems to be an important center of diversity in the south. A third group included genotypes from Nueva Granada, Mesoamerica, Jalisco and Durango races. Here, SSR analysis indicated a reduced number of shared haplotypes among accessions, whereas the highest genetic components of AMOVA variation were found within accessions. Genetic diversity observed in the common-bean core collection represents an important sample of the total Phaseolus genetic variability at the main Germplasm Bank of INIFAP. Molecular marker strategies could contribute to a better understanding of the genetic structure of the core collection as well as to its improvement and validation.

  15. Contrasting cDNA-AFLP profiles between crown and leaf tissues of cold-acclimated wheat plants indicate differing regulatory circuitries for low temperature tolerance.

    PubMed

    Ganeshan, Seedhabadee; Sharma, Pallavi; Young, Lester; Kumar, Ashwani; Fowler, D Brian; Chibbar, Ravindra N

    2011-03-01

    Low-temperature (LT) tolerance in winter wheat (Triticum aestivum L.) is an economically important but complex trait. Four selected wheat genotypes, a winter hardy cultivar, Norstar, a tender spring cultivar, Manitou and two near-isogenic lines with Vrn-A1 (spring Norstar) and vrn-A1 (winter Manitou) alleles of Manitou and Norstar were cold-acclimated at 6°C and crown and leaf tissues were collected at 0, 2, 14, 21, 35, 42, 56 and 70 days of cold acclimation. cDNA-AFLP profiling was used to determine temporal expression profiles of transcripts during cold-acclimation in crown and leaf tissues, separately to determine if LT regulatory circuitries in crown and leaf tissues could be delineated using this approach. Screening 64 primer combinations identified 4,074 and 2,757 differentially expressed transcript-derived fragments (TDFs) out of which 38 and 16% were up-regulated as compared to 3 and 6% that were down-regulated in crown and leaf tissues, respectively. DNA sequencing of TDFs revealed sequences common to both tissues including genes coding for DEAD-box RNA helicase, choline-phosphate cytidylyltransferase and delta-1-pyrroline carboxylate synthetase. TDF specific to crown tissues included genes coding for phospahtidylinositol kinase, auxin response factor protein and brassinosteroid insensitive 1-associated receptor kinase. In leaf, genes such as methylene tetrahydrofolate reductase, NADH-cytochrome b5 reductase and malate dehydrogenase were identified. However, 30 and 14% of the DNA sequences from the crown and leaf tissues, respectively, were hypothetical or unknown proteins. Cluster analysis of up-, down-regulated and unique TDFs, DNA sequence and real-time PCR validation, infer that mechanisms operating in crown and leaf tissue in response to LT are differently regulated and warrant further studies.

  16. The fidelity of replication of the three-base-pair set adenine/thymine, hypoxanthine/cytosine and 6-thiopurine/5-methyl-2-pyrimidinone with T7 DNA polymerase

    PubMed Central

    2004-01-01

    With the goal of constructing a genetic alphabet consisting of a set of three base pairs, the fidelity of replication of the three base pairs TH (5-methyl-2-pyrimidinone)/HS (6-thiopurine; thiohypoxanthine), C/H (hypoxanthine) and T/A was evaluated using T7 DNA polymerase, a polymerase with a strong 3′→5′ exonuclease activity. An evaluation of the suitability of a new base pair for replication should include both the contribution of the fidelity of a polymerase activity and the contribution of proofreading by a 3′→5′ exonuclease activity. Using a steady-state kinetics method that included the contribution of the 3′→5′ exonuclease activity, the fidelity of replication was determined. The method determined the ratio of the apparent rate constant for the addition of a deoxynucleotide to the primer across from a template base by the polymerase activity and the rate constant for removal of the added deoxynucleotide from the primer by the 3′→5′ exonuclease activity. This ratio was designated the eni (efficiency of net incorporation). The eni of the base pair C/H was equal to or greater than the eni of T/A. The eni of the base pair TH/HS was 0.1 times that of A/T for TH in the template and 0.01 times that of A/T for HS in the template. The ratio of the eni of a mismatched deoxynucleotide to the eni of a matched deoxynucleotide was a measure of the error frequency. The error frequencies were as follows: thymine or TH opposite a template hypoxanthine, 2×10−6; HS opposite a template cytosine, <3×10−4. The remaining 24 mismatched combinations of bases gave no detectable net incorporation. Two mismatches, hypoxanthine opposite a template thymine or a template TH, showed trace incorporation in the presence of a standard dNTP complementary to the next template base. T7 DNA polymerase extended the primer beyond each of the matched base pairs of the set. The level of fidelity of replication of the three base pairs with T7 DNA polymerase suggests

  17. Effects of metal primers on the bonding of an adhesive resin cement to noble metal ceramic alloys after thermal cycling.

    PubMed

    Minami, Hiroyuki; Murahara, Sadaaki; Suzuki, Shiro; Tanaka, Takuo

    2011-12-01

    Although the effectiveness of primers for resin bonding to noble alloys has been demonstrated, no effective clinical technique for bonding to noble metal ceramic alloys has been established. The purpose of this study was to evaluate the effects of metal primers on the shear bond strength of an adhesive resin to noble metal ceramic alloys after thermal cycling. Sixty-three disk-shaped specimens (10 × 2.5 mm) were cast from high-gold-content alloys (Super Metal W-85: W85 or IFK88 GR: IFK88), a high-palladium-content alloy (Super Metal N-40: N40), and an Ag-Pd-Cu-Au alloy (Castwell M.C.12: MC12). Smaller-sized disk-shaped specimens (8 × 2.5 mm) were fabricated with MC12. Bonding surfaces were finished with 600-grit SiC-paper and airborne-particle abraded with 50-μm alumina. Pairs of disks were primed (V-Primer: VP; ML Primer: ML; or Metaltite: MT) and bonded with an adhesive resin (Super-Bond C&B). The bond strengths were determined before and after 20,000 and 50,000 thermal cycles (n=7). Data were analyzed by using a 3-way ANOVA and the Bonferroni test (α=.05). Failure modes were determined by optical microscope and SEM observation. Bond strengths to high-gold-content alloys with VP and MT significantly decreased after the thermal cycling (P<.001). Bond strengths to W85 (35.27 ±4.25 MPa) and IFK88 (33.57 ±3.56 MPa) after 50,000 thermal cycles obtained by ML were the highest (P<.001), and these groups showed combination failures. Bond strengths to N40 significantly decreased after 50,000 thermal cycles (P<.001), regardless of primers. Shear bond strengths (SBS) to high-gold-content alloys were not degraded up to 50,000 thermal cycles when primed with ML. None of the primers evaluated was effective for high-palladium-content alloy. Copyright © 2011 The Editorial Council of the Journal of Prosthetic Dentistry. Published by Mosby, Inc. All rights reserved.

  18. Design of New Genome- and Gene-Sourced Primers and Identification of QTL for Seed Oil Content in a Specially High-Oil Brassica napus Cultivar

    PubMed Central

    Liu, Jing; Huang, Shunmou; Wang, Xinfa; Liu, Guihua; Wang, Hanzhong

    2012-01-01

    Rapeseed (Brassica napus L.) is one of most important oilseed crops in the world. There are now various rapeseed cultivars in nature that differ in their seed oil content because they vary in oil-content alleles and there are high-oil alleles among the high-oil rapeseed cultivars. For these experiments, we generated doubled haploid (DH) lines derived from the cross between the specially high-oil cultivar zy036 whose seed oil content is approximately 50% and the specially low-oil cultivar 51070 whose seed oil content is approximately 36%. First, to address the deficiency in polymorphic markers, we designed 5944 pairs of newly developed genome-sourced primers and 443 pairs of newly developed primers related to oil-content genes to complement the 2244 pairs of publicly available primers. Second, we constructed a new DH genetic linkage map using 527 molecular markers, consisting of 181 publicly available markers, 298 newly developed genome-sourced markers and 48 newly developed markers related to oil-content genes. The map contained 19 linkage groups, covering a total length of 2,265.54 cM with an average distance between markers of 4.30 cM. Third, we identified quantitative trait loci (QTL) for seed oil content using field data collected at three sites over 3 years, and found a total of 12 QTL. Of the 12 QTL associated with seed oil content identified, 9 were high-oil QTL which derived from the specially high-oil cultivar zy036. Two high-oil QTL on chromosomes A2 and C9 co-localized in two out of three trials. By QTL mapping for seed oil content, we found four candidate genes for seed oil content related to four gene markers: GSNP39, GSSR161, GIFLP106 and GIFLP046. This information will be useful for cloning functional genes correlated with seed oil content in the future. PMID:23077542

  19. Widespread utility of highly informative AFLP molecular markers across divergent shark species.

    PubMed

    Zenger, Kyall R; Stow, Adam J; Peddemors, Victor; Briscoe, David A; Harcourt, Robert G

    2006-01-01

    Population numbers of many shark species are declining rapidly around the world. Despite the commercial and conservation significance, little is known on even the most fundamental aspects of their population biology. Data collection that relies on direct observation can be logistically challenging with sharks. Consequently, molecular methods are becoming increasingly important to obtain knowledge that is critical for conservation and management. Here we describe an amplified fragment length polymorphism method that can be applied universally to sharks to identify highly informative genome-wide polymorphisms from 12 primer pairs. We demonstrate the value of our method on 15 divergent shark species within the superorder Galeomorphii, including endangered species which are notorious for low levels of genetic diversity. Both the endangered sand tiger shark (Carcharodon taurus, N = 18) and the great white shark (Carcharodon carcharias, N = 7) displayed relatively high levels of allelic diversity. A total of 59 polymorphic loci (H(e) = 0.373) and 78 polymorphic loci (H(e) = 0.316) were resolved in C. taurus and C. carcharias, respectively. Results from other sharks (e.g., Orectolobus ornatus, Orectolobus sp., and Galeocerdo cuvier) produced remarkably high numbers of polymorphic loci (106, 94, and 86, respectively) from a limited sample size of only 2. A major constraint to obtaining much needed genetic data from sharks is the time-consuming process of developing molecular markers. Here we demonstrate the general utility of a technique that provides large numbers of informative loci in sharks.

  20. Bond Strength of Resin Cements to Zirconia Ceramic Using Adhesive Primers.

    PubMed

    Stefani, Ariovaldo; Brito, Rui Barbosa; Kina, Sidney; Andrade, Oswaldo Scopin; Ambrosano, Gláucia Maria Bovi; Carvalho, Andreia Assis; Giannini, Marcelo

    2016-07-01

    To evaluate the influence of adhesive primers on the microshear bond strength of resin cements to zirconia ceramic. Fifty zirconia plates (12 mm × 5 mm × 1.5 mm thick) of a commercially available zirconium oxide ceramic (ZirCad) were sintered, sandblasted with aluminum oxide particles, and cleaned ultrasonically before bonding. The plates were randomly divided into five groups of 10. Three resin cements were selected (RelyX ARC, Multilink Automix, Clearfil SA Cement self-adhesive resin cement), along with two primers (Metal-Zirconia Primer, Alloy Primer) and one control group. The primers and resin cements were used according to manufacturers' recommendations. The control group comprised the conventional resin cement (RelyX ARC) without adhesive primer. Test cylinders (0.75 mm diameter × 1 mm high) were formed on zirconia surfaces by filling cylindrical Tygon tube molds with resin cement. The specimens were stored in distilled water for 24 hours at 37°C, then tested for shear strength on a Shimadzu EZ Test testing machine at 0.5 mm/min. Bond strength data were analyzed statistically by two-way ANOVA and Dunnett's test (5%). The bond strength means in MPa (± s.d.) were: RelyX ARC: 28.1 (6.6); Multilink Automix: 37.6 (4.5); Multilink Automix + Metal-Zirconia Primer: 55.7 (4.0); Clearfil SA Cement: 46.2 (3.3); and Clearfil SA Cement + Alloy Primer: 47.0 (4.1). Metal-Zirconia Primer increased the bond strength of Multilink Automix resin cement to zirconia, but no effect was observed for Alloy Primer using Clearfil SA Cement. RelyX ARC showed the lowest bond strength to zirconia. © 2015 by the American College of Prosthodontists.

  1. Defense Primer: A Guide for New Members

    DTIC Science & Technology

    2017-03-03

    1 President’s Constitutional Authority with Regard to the Armed Forces ................................... 1 The Department of Defense ...primers to give Members of Congress an overview of key aspects of the Department of Defense and how Congress exercises authority over it. A consolidated...for New Members Congressional Research Service 2 The Department of Defense CRS In Focus IF10543, Defense Primer: The Department of Defense , by

  2. A Transportation Modeling Primer

    DOT National Transportation Integrated Search

    2006-06-01

    This primer is intended to explain the urban transportation modeling process works, the assumptions made and the steps used to forecast travel demand for urban transportation planning. This is done in order to help to understand the process and its i...

  3. A physicists guide to The Los Alamos Primer

    NASA Astrophysics Data System (ADS)

    Reed, B. Cameron

    2016-11-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer, which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons.

  4. Reading Assessment: A Primer for Teachers and Tutors.

    ERIC Educational Resources Information Center

    Caldwell, JoAnne Schudt

    This primer provides the basic information that teachers and tutors need to get started on the complex process of reading assessment. Designed for maximum utility in today's standards-driven classroom, the primer presents simple, practical assessment strategies that are based on theory and research. It takes teachers step by step through learning…

  5. Effects of long-term space condition on cell ultrastructure and the molecular level change of the tomato

    NASA Astrophysics Data System (ADS)

    Jinying, L.; Min, L.; Huai, X.; Yi, P.; Chunhua, Z.; Nechitalo, G.

    Effects of long-term exposure to physical factors of space flight on dormant seeds were studied on plants derived from tomato seeds flown for 6 years on board of the space station MIR Upon return to the Earth the seeds were germinated and grown to maturity Samples of plants were compared to plants from parallel ground-based controls Various differences of ultrastructure of the tomato leaf cell were observed with an electron microscope One plant carried by space station has the anatomy of leaves with a three-layered palisade tissue and other plants similar with ground controls have the anatomy of leaves with a one-layered palisade tissue The number of starch grains per chloroplast of every space-treated tomato leaf increased significantly compared with that of the ground control The leaf cell walls of two plants carried by space station became contracted and deformed The size of chloroplast in some space-treated plants was larger and the lamellae s structure of some chloroplasts turned curvature and loose The results obtained point out to significant changes occurring on the molecular level among the space-flight treated seedlings and the ground control The leaves of plants were used for AFLP Amplification Fragment Length Polymorphism analysis For the first generation space-flight treated tomato plants among 64 pairs of primers used in this experiment 43 primers generated the same DNA bands type and 21 primers generated a different DNA band type 2582 DNA bands were produced among which 34 DNA bands were polymorphic with the percentage

  6. PD5: a general purpose library for primer design software.

    PubMed

    Riley, Michael C; Aubrey, Wayne; Young, Michael; Clare, Amanda

    2013-01-01

    Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C(++) with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: http://code.google.com/p/primer-design.

  7. Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi.

    PubMed

    Lee, Jaikoo; Lee, Sangsun; Young, J Peter W

    2008-08-01

    A set of PCR primers that should amplify all subgroups of arbuscular mycorrhizal fungi (AMF, Glomeromycota), but exclude sequences from other organisms, was designed to facilitate rapid detection and identification directly from field-grown plant roots. The small subunit rRNA gene was targeted for the new primers (AML1 and AML2) because phylogenetic relationships among the Glomeromycota are well understood for this gene. Sequence comparisons indicate that the new primers should amplify all published AMF sequences except those from Archaeospora trappei. The specificity of the new primers was tested using 23 different AMF spore morphotypes from trap cultures and Miscanthus sinensis, Glycine max and Panax ginseng roots sampled from the field. Non-AMF DNA of 14 plants, 14 Basidiomycota and 18 Ascomycota was also tested as negative controls. Sequences amplified from roots using the new primers were compared with those obtained using the established NS31 and AM1 primer combination. The new primers have much better specificity and coverage of all known AMF groups.

  8. Genetic diversity analysis of Jatropha curcas L. (Euphorbiaceae) based on methylation-sensitive amplification polymorphism.

    PubMed

    Kanchanaketu, T; Sangduen, N; Toojinda, T; Hongtrakul, V

    2012-04-13

    Genetic analysis of 56 samples of Jatropha curcas L. collected from Thailand and other countries was performed using the methylation-sensitive amplification polymorphism (MSAP) technique. Nine primer combinations were used to generate MSAP fingerprints. When the data were interpreted as amplified fragment length polymorphism (AFLP) markers, 471 markers were scored. All 56 samples were classified into three major groups: γ-irradiated, non-toxic and toxic accessions. Genetic similarity among the samples was extremely high, ranging from 0.95 to 1.00, which indicated very low genetic diversity in this species. The MSAP fingerprint was further analyzed for DNA methylation polymorphisms. The results revealed differences in the DNA methylation level among the samples. However, the samples collected from saline areas and some species hybrids showed specific DNA methylation patterns. AFLP data were used, together with methylation-sensitive AFLP (MS-AFLP) data, to construct a phylogenetic tree, resulting in higher efficiency to distinguish the samples. This combined analysis separated samples previously grouped in the AFLP analysis. This analysis also distinguished some hybrids. Principal component analysis was also performed; the results confirmed the separation in the phylogenetic tree. Some polymorphic bands, involving both nucleotide and DNA methylation polymorphism, that differed between toxic and non-toxic samples were identified, cloned and sequenced. BLAST analysis of these fragments revealed differences in DNA methylation in some known genes and nucleotide polymorphism in chloroplast DNA. We conclude that MSAP is a powerful technique for the study of genetic diversity for organisms that have a narrow genetic base.

  9. Ligase Detection Reaction Generation of Reverse Molecular Beacons for Near Real-Time Analysis of Bacterial Pathogens Using Single-Pair Fluorescence Resonance Energy Transfer and a Cyclic Olefin Copolymer Microfluidic Chip

    PubMed Central

    Peng, Zhiyong; Soper, Steven A.; Pingle, Maneesh R.; Barany, Francis; Davis, Lloyd M.

    2015-01-01

    Detection of pathogenic bacteria and viruses require strategies that can signal the presence of these targets in near real-time due to the potential threats created by rapid dissemination into water and/or food supplies. In this paper, we report an innovative strategy that can rapidly detect bacterial pathogens using reporter sequences found in their genome without requiring polymerase chain reaction (PCR). A pair of strain-specific primers was designed based on the 16S rRNA gene and were end-labeled with a donor (Cy5) or acceptor (Cy5.5) dye. In the presence of the target bacterium, the primers were joined using a ligase detection reaction (LDR) only when the primers were completely complementary to the target sequence to form a reverse molecular beacon (rMB), thus bringing Cy5 (donor) and Cy5.5 (acceptor) into close proximity to allow fluorescence resonance energy transfer (FRET) to occur. These rMBs were subsequently analyzed using single-molecule detection of the FRET pairs (single-pair FRET; spFRET). The LDR was performed using a continuous flow thermal cycling process configured in a cyclic olefin copolymer (COC) microfluidic device using either 2 or 20 thermal cycles. Single-molecule photon bursts from the resulting rMBs were detected on-chip and registered using a simple laser-induced fluorescence (LIF) instrument. The spFRET signatures from the target pathogens were reported in as little as 2.6 min using spFRET. PMID:21047095

  10. Uncoupling primer and releaser responses to pheromone in honey bees

    NASA Astrophysics Data System (ADS)

    Grozinger, Christina M.; Fischer, Patrick; Hampton, Jacob E.

    2007-05-01

    Pheromones produce dramatic behavioral and physiological responses in a wide variety of species. Releaser pheromones elicit rapid responses within seconds or minutes, while primer pheromones produce long-term changes which may take days to manifest. Honeybee queen mandibular pheromone (QMP) elicits multiple distinct behavioral and physiological responses in worker bees, as both a releaser and primer, and thus produces responses on vastly different time scales. In this study, we demonstrate that releaser and primer responses to QMP can be uncoupled. First, treatment with the juvenile hormone analog methoprene leaves a releaser response (attraction to QMP) intact, but modulates QMP’s primer effects on sucrose responsiveness. Secondly, two components of QMP (9-ODA and 9-HDA) do not elicit a releaser response (attraction) but are as effective as QMP at modulating a primer response, downregulation of foraging-related brain gene expression. These results suggest that different responses to a single pheromone may be produced via distinct pathways.

  11. Revisiting AFLP fingerprinting for an unbiased assessment of genetic structure and differentiation of taurine and zebu cattle

    PubMed Central

    2014-01-01

    Background Descendants from the extinct aurochs (Bos primigenius), taurine (Bos taurus) and zebu cattle (Bos indicus) were domesticated 10,000 years ago in Southwestern and Southern Asia, respectively, and colonized the world undergoing complex events of admixture and selection. Molecular data, in particular genome-wide single nucleotide polymorphism (SNP) markers, can complement historic and archaeological records to elucidate these past events. However, SNP ascertainment in cattle has been optimized for taurine breeds, imposing limitations to the study of diversity in zebu cattle. As amplified fragment length polymorphism (AFLP) markers are discovered and genotyped as the samples are assayed, this type of marker is free of ascertainment bias. In order to obtain unbiased assessments of genetic differentiation and structure in taurine and zebu cattle, we analyzed a dataset of 135 AFLP markers in 1,593 samples from 13 zebu and 58 taurine breeds, representing nine continental areas. Results We found a geographical pattern of expected heterozygosity in European taurine breeds decreasing with the distance from the domestication centre, arguing against a large-scale introgression from European or African aurochs. Zebu cattle were found to be at least as diverse as taurine cattle. Western African zebu cattle were found to have diverged more from Indian zebu than South American zebu. Model-based clustering and ancestry informative markers analyses suggested that this is due to taurine introgression. Although a large part of South American zebu cattle also descend from taurine cows, we did not detect significant levels of taurine ancestry in these breeds, probably because of systematic backcrossing with zebu bulls. Furthermore, limited zebu introgression was found in Podolian taurine breeds in Italy. Conclusions The assessment of cattle diversity reported here contributes an unbiased global view to genetic differentiation and structure of taurine and zebu cattle

  12. Effects of different orthodontic primers on enamel demineralization around orthodontic brackets.

    PubMed

    Baysal, Asli; Yasa, Asli; Sogut, Ozlem; Ozturk, Mehmet Ali; Uysal, Tancan

    2015-09-01

    The purpose of this work is to evaluate the effectiveness of one self-etching and two filled orthodontic primers on enamel demineralization around orthodontic brackets. Brackets were bonded to 84 bovine teeth and the vestibular enamel surfaces covered with acid-resistant nail varnish exposing 1 mm of space on each side of the bracket base. The teeth were allocated to four groups, using either Transbond XT conventional primer on etched enamel (group 1), Transbond Plus Self-Etching Primer on untreated enamel (group 2), Pro Seal filled resin primer on etched enamel (group 3), or Opal Seal filled resin primer on etched enamel (group 4). Each tooth was subjected to 15,000 strokes of brushing followed by exposure to an acid challenge. Calcium-ion release from each sample was calculated using atomic absorption spectrophotometry. Data were analyzed using one-way ANOVA and a post hoc Tukey test. Differences were considered statistically significant at p ≤ 0.05. Statistically significant differences were observed between the four groups (p < 0.001). No significant difference was found between the controls (group 1) and the Opal Seal group. Higher calcium release was observed in the Pro Seal group and the self-etching primer group compared to the controls. The highest calcium release was recorded in the self-etching primer group. Filled sealants may not have a protective effect against enamel demineralization. Transbond Plus Self-Etching Primer should be used cautiously, considering the risk of demineralization involved in its application.

  13. Aluminum Rich Epoxy Primer for Ground and Air Vehicles

    DTIC Science & Technology

    2017-03-01

    UNCLASSIFIED DOCUMENT Aluminum Rich Epoxy Primer for Ground and Air Vehicles Monthly Technical Report for the Period: January 20, 2017...Objective: To further develop the Aluminum Rich Epoxy Primer systems for Air and Ground Vehicles while addressing the objective requirements

  14. Primer on consumer marketing research : procedures, methods, and tools

    DOT National Transportation Integrated Search

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  15. swga: a primer design toolkit for selective whole genome amplification.

    PubMed

    Clarke, Erik L; Sundararaman, Sesh A; Seifert, Stephanie N; Bushman, Frederic D; Hahn, Beatrice H; Brisson, Dustin

    2017-07-15

    Population genomic analyses are often hindered by difficulties in obtaining sufficient numbers of genomes for analysis by DNA sequencing. Selective whole-genome amplification (SWGA) provides an efficient approach to amplify microbial genomes from complex backgrounds for sequence acquisition. However, the process of designing sets of primers for this method has many degrees of freedom and would benefit from an automated process to evaluate the vast number of potential primer sets. Here, we present swga , a program that identifies primer sets for SWGA and evaluates them for efficiency and selectivity. We used swga to design and test primer sets for the selective amplification of Wolbachia pipientis genomic DNA from infected Drosophila melanogaster and Mycobacterium tuberculosis from human blood. We identify primer sets that successfully amplify each against their backgrounds and describe a general method for using swga for arbitrary targets. In addition, we describe characteristics of primer sets that correlate with successful amplification, and present guidelines for implementation of SWGA to detect new targets. Source code and documentation are freely available on https://www.github.com/eclarke/swga . The program is implemented in Python and C and licensed under the GNU Public License. ecl@mail.med.upenn.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  16. Linkage analysis by genotyping of sibling populations: a genetic map for the potato cyst nematode constructed using a "pseudo-F2" mapping strategy.

    PubMed

    Rouppe van der Voort, J N; van Eck, H J; van Zandvoort, P M; Overmars, H; Helder, J; Bakker, J

    1999-07-01

    A mapping strategy is described for the construction of a linkage map of a non-inbred species in which individual offspring genotypes are not amenable to marker analysis. After one extra generation of random mating, the segregating progeny was propagated, and bulked populations of offspring were analyzed. Although the resulting population structure is different from that of commonly used mapping populations, we show that the maximum likelihood formula for a normal F2 is applicable for the estimation of recombination. This "pseudo-F2" mapping strategy, in combination with the development of an AFLP assay for single cysts, facilitated the construction of a linkage map for the potato cyst nematode Globodera rostochiensis. Using 12 pre-selected AFLP primer combinations, a total of 66 segregating markers were identified, 62 of which were mapped to nine linkage groups. These 62 AFLP markers are randomly distributed and cover about 65% of the genome. An estimate of the physical size of the Globodera genome was obtained from comparisons of the number of AFLP fragments obtained with the values for Caenorhabditis elegans. The methodology presented here resulted in the first genomic map for a cyst nematode. The low value of the kilobase/centimorgan (kb/cM) ratio for the Globodera genome will facilitate map-based cloning of genes that mediate the interaction between the nematode and its host plant.

  17. New PCR primers targeting hydrazine synthase and cytochrome c biogenesis proteins in anammox bacteria.

    PubMed

    Zhou, Zhichao; Chen, Jing; Meng, Han; Dvornyk, Volodymyr; Gu, Ji-Dong

    2017-02-01

    PCR primers targeting genes encoding the two proteins of anammox bacteria, hydrazine synthase and cytochrome c biogenesis protein, were designed and tested in this study. Three different ecotypes of samples, namely ocean sediments, coastal wetland sediments, and wastewater treatment plant (WWTP) samples, were used to assess the primer efficiency and the community structures of anammox bacteria retrieved by 16S ribosomal RNA (rRNA) and the functional genes. Abundances of hzsB gene of anammox bacteria in South China Sea (SCS) samples were significantly correlated with 16S rRNA gene by qPCR method. And hzsB and hzsC gene primer pair hzsB364f-hzsB640r and hzsC745f-hzsC862r in combination with anammox bacterial 16S rRNA gene primers were recommended for quantifying anammox bacteria. Congruent with 16S rRNA gene-based community study, functional gene hzsB could also delineate the coastal-ocean distributing pattern, and seawater depth was positively associated with the diversity and abundance of anammox bacteria from shallow- to deep-sea. Both hzsC and ccsA genes could differentiate marine samples between deep and shallow groups of the Scalindua sp. clades. As for WWTP samples, non-Scalindua anammox bacteria reflected by hzsB, hzsC, ccsA, and ccsB gene-based libraries showed a similar distribution pattern with that by 16S rRNA gene. NH 4 + and NH 4 + /Σ(NO 3 - + NO 2 - ) positively correlated with anammox bacteria gene diversity, but organic matter contents correlated negatively with anammox bacteria gene diversity in SCS. Salinity was positively associated with diversity indices of hzsC and ccsB gene-harboring anammox bacteria communities and could potentially differentiate the distribution patterns between shallow- and deep-sea sediment samples. SCS surface sediments harbored considerably diverse community of Scalindua. A new Mai Po clade representing coastal estuary wetland anammox bacteria group based on 16S rRNA gene phylogeny is proposed. Existence of anammox

  18. UniPrime2: a web service providing easier Universal Primer design.

    PubMed

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

    2009-07-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  19. Shear bond strength between autopolymerizing acrylic resin and Co-Cr alloy using different primers.

    PubMed

    Sanohkan, Sasiwimol; Urapepon, Somchai; Harnirattisai, Choltacha; Sirisinha, Chakrit; Sunintaboon, Panya

    2012-01-01

    This study aimed to examine the shear bond strength between cobalt chromium alloy and autopolymerizing acrylic resin using experimental primers containing 5, 10, and 15 wt% of 4-methacryloxyethyl trimellitic anhydride or 1, 2, and 3 wt% of 3-methacryloxypropyl-trimethoxysilane comparison to 5 commercial primers (ML primers, Alloy primer, Metal/Zirconia primer, Monobond S, and Monobond plus). Sixty alloy specimens were sandblasted and treated with each primer before bonded with an acrylic resin. The control group was not primed. The shear bond strengths were tested and statistically compared. Specimens treated with commercial primers significantly increased the shear bond strength of acrylic resin to cobalt chromium alloy (p<0.05). The highest shear bond strength was found in the Alloy primer group. Among experimental group, using 10 wt% of 4-methacryloxyethyl trimellitic anhydride -or 2 wt% of 3-methacryloxypropyltrimethoxysilane enhanced highest shear bond strength. The experimental and commercial primers in this study all improved bonding of acrylic resin to cobalt chromium alloy.

  20. Amplified fragment length polymorphism mapping of quantitative trait loci for malaria parasite susceptibility in the yellow fever mosquito Aedes aegypti.

    PubMed

    Zhong, Daibin; Menge, David M; Temu, Emmanuel A; Chen, Hong; Yan, Guiyun

    2006-07-01

    The yellow fever mosquito Aedes aegypti has been the subject of extensive genetic research due to its medical importance and the ease with which it can be manipulated in the laboratory. A molecular genetic linkage map was constructed using 148 amplified fragment length polymorphism (AFLP) and six single-strand conformation polymorphism (SSCP) markers. Eighteen AFLP primer combinations were used to genotype two reciprocal F2 segregating populations. Each primer combination generated an average of 8.2 AFLP markers eligible for linkage mapping. The length of the integrated map was 180.9 cM, giving an average marker resolution of 1.2 cM. Composite interval mapping revealed a total of six QTL significantly affecting Plasmodium susceptibility in the two reciprocal crosses of Ae. aegypti. Two common QTL on linkage group 2 were identified in both crosses that had similar effects on the phenotype, and four QTL were unique to each cross. In one cross, the four main QTL accounted for 64% of the total phenotypic variance, and digenic epistasis explained 11.8% of the variance. In the second cross, the four main QTL explained 66% of the variance, and digenic epistasis accounted for 16% of the variance. The actions of these QTL were either dominance or underdominance. Our results indicated that at least three new QTL were mapped on chromosomes 1 and 3. The polygenic nature of susceptibility to P. gallinaceum and epistasis are important factors for significant variation within or among mosquito strains. The new map provides additional information useful for further genetic investigation, such as identification of new genes and positional cloning.

  1. A multiple-alignment based primer design algorithm for genetically highly variable DNA targets

    PubMed Central

    2013-01-01

    Background Primer design for highly variable DNA sequences is difficult, and experimental success requires attention to many interacting constraints. The advent of next-generation sequencing methods allows the investigation of rare variants otherwise hidden deep in large populations, but requires attention to population diversity and primer localization in relatively conserved regions, in addition to recognized constraints typically considered in primer design. Results Design constraints include degenerate sites to maximize population coverage, matching of melting temperatures, optimizing de novo sequence length, finding optimal bio-barcodes to allow efficient downstream analyses, and minimizing risk of dimerization. To facilitate primer design addressing these and other constraints, we created a novel computer program (PrimerDesign) that automates this complex procedure. We show its powers and limitations and give examples of successful designs for the analysis of HIV-1 populations. Conclusions PrimerDesign is useful for researchers who want to design DNA primers and probes for analyzing highly variable DNA populations. It can be used to design primers for PCR, RT-PCR, Sanger sequencing, next-generation sequencing, and other experimental protocols targeting highly variable DNA samples. PMID:23965160

  2. STITCHER 2.0: primer design for overlapping PCR applications.

    PubMed

    O'Halloran, Damien M; Uriagereka-Herburger, Isabel; Bode, Katrin

    2017-03-30

    Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to 'stitch' individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user's input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html.

  3. Selected Transportation Topics : Energy Primer

    DOT National Transportation Integrated Search

    1975-01-01

    Energy involved in transportation has become a critical consideration in recent years. This primer contains ten representative articles of those resulting from government reports, conference papers, etc., on what the current energy situation is, and ...

  4. Ecology and genetic diversity of the dense-flowered orchid, Neotinea maculata, at the centre and edge of its range

    PubMed Central

    Duffy, Karl J.; Scopece, Giovanni; Cozzolino, Salvatore; Fay, Michael F.; Smith, Rhian J.; Stout, Jane C.

    2009-01-01

    Background and Aims Species may occur over a wide geographical range within which populations can display large variation in reproductive success and genetic diversity. Neotinea maculata is a rare orchid of conservation concern at the edge of its range in Ireland, where it occurs in small populations. However, it is relatively common throughout the Mediterranean region. Here, factors that affect rarity of N. maculata in Ireland are investigated by comparing Irish populations with those found in Italy, where it is more common. Methods Vegetation communities, breeding system and genetic diversity were compared using three amplified fragment length polymorphism (AFLP) primer pairs in populations in Ireland and Italy. Vegetation was quantified using quadrats taken along transects in study populations, and hand pollination experiments were performed to assess reliance of N. maculata on pollinators in both Irish and Italian populations. Key Results Neotinea maculata occupies different vegetation communities in Italian and Irish populations. Breeding system experiments show that N. maculata is 100 % autogamous, and there are no differences in fruit and seed production in selfed, outcrossed and unmanipulated plants. AFLP markers revealed that Irish and Italian populations have similar genetic diversity and are distinct from each other. Conclusions Neotinea maculata does not suffer any negative effects of autogamous reproduction; it self-pollinates and sets seed readily in the absence of pollinators. It occupies a variety of habitats in both Ireland and Italy; however, Irish populations are small and rare and should be conserved. This could be due to climatic factors and the absence of suitable soil mycorrhizas to allow recruitment from seed. PMID:18940852

  5. White primer permits a corrosion-resistant coating of minimum weight

    NASA Technical Reports Server (NTRS)

    Albrecht, R. H.; Jensen, D. P.; Schnake, P.

    1966-01-01

    White primer for coating 2219 aluminum alloy supplies a base for a top coating of enamel. A formulation of pigments and vehicle results in a primer with high corrosion resistance and minimum film thickness.

  6. Nanotechnology: A Policy Primer

    DTIC Science & Technology

    2013-06-24

    National Science Foundation (NSF), Department of Energy (DOE), National Aeronautics and Space Administration ( NASA ), Department of Commerce (DOC...and Extension Service, Department of Agriculture ( USDA ); (continued...) Nanotechnology: A Policy Primer Congressional Research Service 6 NSET...State; Department of Transportation; Department of the Treasury; EPA; Food and Drug Administration; Forest Service, USDA ; Intelligence Technology

  7. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gardner, S. N.

    2013-08-08

    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

  8. Congestion pricing : a primer : overview

    DOT National Transportation Integrated Search

    2008-10-01

    This Overview primer was produced to explain the concept of congestion pricing and its benefits, to present examples of congestion-pricing approaches implemented in the United States and abroad, and to briefly discuss federal-aid policy and programs ...

  9. Do we need primer for orthodontic bonding? A randomized controlled trial.

    PubMed

    Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

    2015-04-01

    To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P < 0.0001). As the study was only performed by one operator, the results can therefore only be truly be applied to their practice

  10. A Tale of Tails: Dissecting the Enhancing Effect of Tailed Primers in Real-Time PCR

    PubMed Central

    Vandenbussche, Frank; Mathijs, Elisabeth; Lefebvre, David; De Clercq, Kris; Van Borm, Steven

    2016-01-01

    Non-specific tail sequences are often added to the 5’-terminus of primers to improve the robustness and overall performance of diagnostic assays. Despite the widespread use of tailed primers, the underlying working mechanism is not well understood. To address this problem, we conducted a detailed in vitro and in silico analysis of the enhancing effect of primer tailing on 2 well-established foot-and-mouth disease virus (FMDV) RT-qPCR assays using an FMDV reference panel. Tailing of the panFMDV-5UTR primers mainly affected the shape of the amplification curves. Modelling of the raw fluorescence data suggested a reduction of the amplification efficiency due to the accumulation of inhibitors. In depth analysis of PCR products indeed revealed the rapid accumulation of forward-primer derived artefacts. More importantly, tailing of the forward primer delayed artefacts formation and concomitantly restored the sigmoidal shape of the amplification curves. Our analysis also showed that primer tailing can alter utilisation patterns of degenerate primers and increase the number of primer variants that are able to participate in the reaction. The impact of tailed primers was less pronounced in the panFMDV-3D assay with only 5 out of 50 isolates showing a clear shift in Cq values. Sequence analysis of the target region of these 5 isolates revealed several mutations in the inter-primer region that extend an existing hairpin structure immediately downstream of the forward primer binding site. Stabilisation of the forward primer with either a tail sequence or cationic spermine units restored the sensitivity of the assay, which suggests that the enhancing effect in the panFMDV-3D assay is due to a more efficient extension of the forward primer. ur results show that primer tailing can alter amplification through various mechanisms that are determined by both the assay and target region. These findings expand our understanding of primer tailing and should enable a more targeted and

  11. Use of inter-simple sequence repeats and amplified fragment length polymorphisms to analyze genetic relationships among small grain-infecting species of ustilago.

    PubMed

    Menzies, J G; Bakkeren, G; Matheson, F; Procunier, J D; Woods, S

    2003-02-01

    ABSTRACT In the smut fungi, few features are available for use as taxonomic criteria (spore size, shape, morphology, germination type, and host range). DNA-based molecular techniques are useful in expanding the traits considered in determining relationships among these fungi. We examined the phylogenetic relationships among seven species of Ustilago (U. avenae, U. bullata, U. hordei, U. kolleri, U. nigra, U. nuda, and U. tritici) using inter-simple sequence repeats (ISSRs) and amplified fragment length polymorphisms (AFLPs) to compare their DNA profiles. Fifty-four isolates of different Ustilago spp. were analyzed using ISSR primers, and 16 isolates of Ustilago were studied using AFLP primers. The variability among isolates within species was low for all species except U. bullata. The isolates of U. bullata, U. nuda, and U. tritici were well separated and our data supports their speciation. U. avenae and U. kolleri isolates did not separate from each other and there was little variability between these species. U. hordei and U. nigra isolates also showed little variability between species, but the isolates from each species grouped together. Our data suggest that U. avenae and U. kolleri are monophyletic and should be considered one species, as should U. hordei and U. nigra.

  12. Strategies to Improve Efficiency and Specificity of Degenerate Primers in PCR.

    PubMed

    Campos, Maria Jorge; Quesada, Alberto

    2017-01-01

    PCR with degenerate primers can be used to identify the coding sequence of an unknown protein or to detect a genetic variant within a gene family. These primers, which are complex mixtures of slightly different oligonucleotide sequences, can be optimized to increase the efficiency and/or specificity of PCR in the amplification of a sequence of interest by the introduction of mismatches with the target sequence and balancing their position toward the primers 5'- or 3'-ends. In this work, we explain in detail examples of rational design of primers in two different applications, including the use of specific determinants at the 3'-end, to: (1) improve PCR efficiency with coding sequences for members of a protein family by fully degeneration at a core box of conserved genetic information, with the reduction of degeneration at the 5'-end, and (2) optimize specificity of allelic discrimination of closely related orthologous by 5'-end degenerate primers.

  13. Relatedness of Indian flax genotypes (Linum usitatissimum L.): an inter-simple sequence repeat (ISSR) primer assay.

    PubMed

    Rajwade, Ashwini V; Arora, Ritu S; Kadoo, Narendra Y; Harsulkar, Abhay M; Ghorpade, Prakash B; Gupta, Vidya S

    2010-06-01

    The objective of this study was to analyze the genetic relationships, using PCR-based ISSR markers, among 70 Indian flax (Linum usitatissimum L.) genotypes actively utilized in flax breeding programs. Twelve ISSR primers were used for the analysis yielding 136 loci, of which 87 were polymorphic. The average number of amplified loci and the average number of polymorphic loci per primer were 11.3 and 7.25, respectively, while the percent loci polymorphism ranged from 11.1 to 81.8 with an average of 63.9 across all the genotypes. The range of polymorphism information content scores was 0.03-0.49, with an average of 0.18. A dendrogram was generated based on the similarity matrix by the Unweighted Pair Group Method with Arithmetic Mean (UPGMA), wherein the flax genotypes were grouped in five clusters. The Jaccard's similarity coefficient among the genotypes ranged from 0.60 to 0.97. When the omega-3 alpha linolenic acid (ALA) contents of the individual genotypes were correlated with the clusters in the dendrogram, the high ALA containing genotypes were grouped in two clusters. This study identified SLS 50, Ayogi, and Sheetal to be the most diverse genotypes and suggested their use in breeding programs and for developing mapping populations.

  14. The establishment of species-specific primers for the molecular identification of ten stored-product psocids based on ITS2 rDNA

    PubMed Central

    Zhao, Zi-Hua; Cui, Bing-Yi; Li, Zhi-Hong; Jiang, Fan; Yang, Qian-Qian; Kučerová, Zuzana; Stejskal, Václav; Opit, George; Cao, Yang; Li, Fu-Jun

    2016-01-01

    Psocids are important stored product pests found worldwide that can be spread through grain trade. Most stored-product psocids, including eggs, nymphs, and adults, are very small (~1 mm) and difficult to identify morphologically. Here, we collected 10 economically important stored-product Liposcelis spp. psocids (L. bostrychophila, L. entomophila, L. decolor, L. paeta, L. brunnea, L. corrodens, L. mendax, L. rufa, L. pearmani, and L. tricolor) from 35 geographical locations in 5 countries (China, Czech Republic, Denmark, Germany, and the United States). The ITS2 rDNA gene was extracted and sequenced. The interspecific genetic distance of the stored-product psocids was significantly higher than the intraspecific genetic distance according to the barcoding gap analysis. Ten pairs of species-specific primers based on the ITS2 rDNA were developed for psocid identification. The sensitivity estimation indicated that the species-specific primers could correctly amplify the target ITS2 gene and successfully identify psocids at 1.0 ng/mL. Additionally, these species-specific primers could quantify specificity and identify 10 stored-product psocids; this approach could also be used to accurately identify other stored-product psocids. This work provides a practical approach for the precise examination of 10 stored-product psocid species and also contributes to the development of an identification method using ITS2 rDNA. PMID:26880378

  15. STITCHER 2.0: primer design for overlapping PCR applications

    PubMed Central

    O’Halloran, Damien M.; Uriagereka-Herburger, Isabel; Bode, Katrin

    2017-01-01

    Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to ‘stitch’ individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user’s input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html. PMID:28358011

  16. Crystalline Silica Primer

    USGS Publications Warehouse

    ,

    1992-01-01

    substance and will present a nontechnical overview of the techniques used to measure crystalline silica. Because this primer is meant to be a starting point for anyone interested in learning more about crystalline silica, a list of selected readings and other resources is included. The detailed glossary, which defines many terms that are beyond the scope of this publication, is designed to help the reader move from this presentation to a more technical one, the inevitable next step.

  17. Chemical and mechanical aspects of HMR primer in relationship to wood bonding

    Treesearch

    Alfred W. Christiansen

    2005-01-01

    The mechanism by which hydroxymethylated resorcinol (HMR) primer improves the durability of various adhesives to wood has been hypothesized as covalent chemical links between the adhesive and primer and possibly between the primer and wood. The present work presents experiments to test this hypothesis. In the first test, some resorcinol was displaced by 2- methylres-...

  18. Design of a Percussion and Electric Primer Gun Firing Power Supply

    DTIC Science & Technology

    2014-07-01

    solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

  19. Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

    PubMed

    Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

    2013-06-06

    Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

  20. High Diversity of Myocyanophage in Various Aquatic Environments Revealed by High-Throughput Sequencing of Major Capsid Protein Gene With a New Set of Primers.

    PubMed

    Hou, Weiguo; Wang, Shang; Briggs, Brandon R; Li, Gaoyuan; Xie, Wei; Dong, Hailiang

    2018-01-01

    Myocyanophages, a group of viruses infecting cyanobacteria, are abundant and play important roles in elemental cycling. Here we investigated the particle-associated viral communities retained on 0.2 μm filters and in sediment samples (representing ancient cyanophage communities) from four ocean and three lake locations, using high-throughput sequencing and a newly designed primer pair targeting a gene fragment (∼145-bp in length) encoding the cyanophage gp23 major capsid protein (MCP). Diverse viral communities were detected in all samples. The fragments of 142-, 145-, and 148-bp in length were most abundant in the amplicons, and most sequences (>92%) belonged to cyanophages. Additionally, different sequencing depths resulted in different diversity estimates of the viral community. Operational taxonomic units obtained from deep sequencing of the MCP gene covered the majority of those obtained from shallow sequencing, suggesting that deep sequencing exhibited a more complete picture of cyanophage community than shallow sequencing. Our results also revealed a wide geographic distribution of marine myocyanophages, i.e., higher dissimilarities of the myocyanophage communities corresponded with the larger distances between the sampling sites. Collectively, this study suggests that the newly designed primer pair can be effectively used to study the community and diversity of myocyanophage from different environments, and the high-throughput sequencing represents a good method to understand viral diversity.

  1. High Diversity of Myocyanophage in Various Aquatic Environments Revealed by High-Throughput Sequencing of Major Capsid Protein Gene With a New Set of Primers

    PubMed Central

    Hou, Weiguo; Wang, Shang; Briggs, Brandon R.; Li, Gaoyuan; Xie, Wei; Dong, Hailiang

    2018-01-01

    Myocyanophages, a group of viruses infecting cyanobacteria, are abundant and play important roles in elemental cycling. Here we investigated the particle-associated viral communities retained on 0.2 μm filters and in sediment samples (representing ancient cyanophage communities) from four ocean and three lake locations, using high-throughput sequencing and a newly designed primer pair targeting a gene fragment (∼145-bp in length) encoding the cyanophage gp23 major capsid protein (MCP). Diverse viral communities were detected in all samples. The fragments of 142-, 145-, and 148-bp in length were most abundant in the amplicons, and most sequences (>92%) belonged to cyanophages. Additionally, different sequencing depths resulted in different diversity estimates of the viral community. Operational taxonomic units obtained from deep sequencing of the MCP gene covered the majority of those obtained from shallow sequencing, suggesting that deep sequencing exhibited a more complete picture of cyanophage community than shallow sequencing. Our results also revealed a wide geographic distribution of marine myocyanophages, i.e., higher dissimilarities of the myocyanophage communities corresponded with the larger distances between the sampling sites. Collectively, this study suggests that the newly designed primer pair can be effectively used to study the community and diversity of myocyanophage from different environments, and the high-throughput sequencing represents a good method to understand viral diversity.

  2. MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool

    PubMed Central

    Zhou, Quan

    2017-01-01

    An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876

  3. Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

    PubMed

    Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

    2015-07-01

    The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

  4. Primer-Free Aptamer Selection Using A Random DNA Library

    PubMed Central

    Pan, Weihua; Xin, Ping; Patrick, Susan; Dean, Stacey; Keating, Christine; Clawson, Gary

    2010-01-01

    Aptamers are highly structured oligonucleotides (DNA or RNA) that can bind to targets with affinities comparable to antibodies 1. They are identified through an in vitro selection process called Systematic Evolution of Ligands by EXponential enrichment (SELEX) to recognize a wide variety of targets, from small molecules to proteins and other macromolecules 2-4. Aptamers have properties that are well suited for in vivo diagnostic and/or therapeutic applications: Besides good specificity and affinity, they are easily synthesized, survive more rigorous processing conditions, they are poorly immunogenic, and their relatively small size can result in facile penetration of tissues. Aptamers that are identified through the standard SELEX process usually comprise ~80 nucleotides (nt), since they are typically selected from nucleic acid libraries with ~40 nt long randomized regions plus fixed primer sites of ~20 nt on each side. The fixed primer sequences thus can comprise nearly ~50% of the library sequences, and therefore may positively or negatively compromise identification of aptamers in the selection process 3, although bioinformatics approaches suggest that the fixed sequences do not contribute significantly to aptamer structure after selection 5. To address these potential problems, primer sequences have been blocked by complementary oligonucleotides or switched to different sequences midway during the rounds of SELEX 6, or they have been trimmed to 6-9 nt 7, 8. Wen and Gray 9 designed a primer-free genomic SELEX method, in which the primer sequences were completely removed from the library before selection and were then regenerated to allow amplification of the selected genomic fragments. However, to employ the technique, a unique genomic library has to be constructed, which possesses limited diversity, and regeneration after rounds of selection relies on a linear reamplification step. Alternatively, efforts to circumvent problems caused by fixed primer sequences

  5. Real-time PCR (qPCR) primer design using free online software.

    PubMed

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  6. PhiSiGns: an online tool to identify signature genes in phages and design PCR primers for examining phage diversity.

    PubMed

    Dwivedi, Bhakti; Schmieder, Robert; Goldsmith, Dawn B; Edwards, Robert A; Breitbart, Mya

    2012-03-04

    Phages (viruses that infect bacteria) have gained significant attention because of their abundance, diversity and important ecological roles. However, the lack of a universal gene shared by all phages presents a challenge for phage identification and characterization, especially in environmental samples where it is difficult to culture phage-host systems. Homologous conserved genes (or "signature genes") present in groups of closely-related phages can be used to explore phage diversity and define evolutionary relationships amongst these phages. Bioinformatic approaches are needed to identify candidate signature genes and design PCR primers to amplify those genes from environmental samples; however, there is currently no existing computational tool that biologists can use for this purpose. Here we present PhiSiGns, a web-based and standalone application that performs a pairwise comparison of each gene present in user-selected phage genomes, identifies signature genes, generates alignments of these genes, and designs potential PCR primer pairs. PhiSiGns is available at (http://www.phantome.org/phisigns/; http://phisigns.sourceforge.net/) with a link to the source code. Here we describe the specifications of PhiSiGns and demonstrate its application with a case study. PhiSiGns provides phage biologists with a user-friendly tool to identify signature genes and design PCR primers to amplify related genes from uncultured phages in environmental samples. This bioinformatics tool will facilitate the development of novel signature genes for use as molecular markers in studies of phage diversity, phylogeny, and evolution.

  7. A tool for design of primers for microRNA-specific quantitative RT-qPCR.

    PubMed

    Busk, Peter K

    2014-01-28

    MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. I have developed the software miRprimer for automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed by this method have been distributed to several labs and used successfully in published studies. The software miRprimer is an automatic and easy method for design of functional primers for miR-specific RT-qPCR. The application is available as stand-alone software that will work on the MS Windows platform and in a developer version written in the Ruby programming language.

  8. A Hearing Aid Primer 1

    ERIC Educational Resources Information Center

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  9. To pair or not to pair: chromosome pairing and evolution.

    PubMed

    Moore, G

    1998-04-01

    Chromosome pairing in wild-type wheat closely resembles the process in both yeast and Drosophila. The recent characterisation of a mutant Ph1 wheat and the observation that chromosome pairing in the absence of Ph1 more closely resembles that of mammals and maize has shed light on the evolution of chromosome pairing in the cereals.

  10. Use of tannin anticorrosive reaction primer to improve traditional coating systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Matamala, G.; Droguett, G.; Smeltzer, W.

    1994-04-01

    Different anticorrosive schemes applied over plain or previously shot-blasted surfaces of AISI 1010 (UNS G10100) steel plates were compared. Plates were painted with alkydic, vinylic, and epoxy anticorrosive schemes over metal treated previously with pine tannin reaction primer and over its own schemes without previous primer treatment. Anticorrosive tests were conducted in a salt fog chamber according to ASTM B 117-73. Rusting, blistering, and adhesion were assessed over time. The survey was complemented with potentiodynamic scanning tests in sodium chloride (NaCl) solution with a concentration equivalent to seawater. Corrosion currents were determined using Tafel and polarization resistance techniques. Results showedmore » the reaction primer inhibited corrosion by improving adherence. Advantages over traditional conversion primers formulated in a base of zinc chromate in phosphoric medium were evident.« less

  11. Direct role for the RNA polymerase domain of T7 primase in primer delivery

    PubMed Central

    Zhu, Bin; Lee, Seung-Joo; Richardson, Charles C.

    2010-01-01

    Gene 4 protein (gp4) encoded by bacteriophage T7 contains a C-terminal helicase and an N-terminal primase domain. After synthesis of tetraribonucleotides, gp4 must transfer them to the polymerase for use as primers to initiate DNA synthesis. In vivo gp4 exists in two molecular weight forms, a 56-kDa form and the full-length 63-kDa form. The 56-kDa gp4 lacks the N-terminal Cys4 zinc-binding motif important in the recognition of primase sites in DNA. The 56-kDa gp4 is defective in primer synthesis but delivers a wider range of primers to initiate DNA synthesis compared to the 63-kDa gp4. Suppressors exist that enable the 56-kDa gp4 to support the growth of T7 phage lacking gene 4 (T7Δ4). We have identified 56-kDa DNA primases defective in primer delivery by screening for their ability to support growth of T7Δ4 phage in the presence of this suppressor. Trp69 is critical for primer delivery. Replacement of Trp69 with lysine in either the 56- or 63-kDa gp4 results in defective primer delivery with other functions unaffected. DNA primase harboring lysine at position 69 fails to stabilize the primer on DNA. Thus, a primase subdomain not directly involved in primer synthesis is involved in primer delivery. The stabilization of the primer by DNA primase is necessary for DNA polymerase to initiate synthesis. PMID:20439755

  12. Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

    PubMed

    Xia, Shuangluo; Konigsberg, William H

    2014-04-01

    Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

  13. Lead Free Electric Primer

    DTIC Science & Technology

    2011-10-06

    composites were prepared with varying metal to oxidizer (M/O) ratios ranging from 0.782 to 3.165 (see Table 7). The performance was measured by the...and the Army was expecting to begin their processing efforts in the near future. The Army purchased primer metal parts and was prepared to perform...43 Table 19 – Samples Prepared Using Different Mix Times and Amplitudes

  14. Genetic Variability and Population Structure of Disanthus cercidifolius subsp. longipes (Hamamelidaceae) Based on AFLP Analysis

    PubMed Central

    Yu, Yi; Fan, Qiang; Shen, Rujiang; Guo, Wei; Jin, Jianhua; Cui, Dafang; Liao, Wenbo

    2014-01-01

    Disanthus cercidifolius subsp. longipes is an endangered species in China. Genetic diversity and structure analysis of this species was investigated using amplified fragments length polymorphism (AFLP) fingerprinting. Nei's gene diversity ranged from 0.1290 to 0.1394. The AMOVA indicated that 75.06% of variation was distributed within populations, while the between-group component 5.04% was smaller than the between populations-within-group component 19.90%. Significant genetic differentiation was detected between populations. Genetic and geographical distances were not correlated. PCA and genetic structure analysis showed that populations from East China were together with those of the Nanling Range. These patterns of genetic diversity and levels of genetic variation may be the result of D. c. subsp. longipes restricted to several isolated habitats and “excess flowers production, but little fruit set”. It is necessary to protect all existing populations of D. c. subsp. longipes in order to preserve as much genetic variation as possible. PMID:25250583

  15. A primer on safety performance measures for the transportation planning process

    DOT National Transportation Integrated Search

    2009-09-01

    This Primer is a tool to help State and local practitioners, transportation planners, and decision-makers identify, select, and use safety performance measures as a part of the transportation planning process. The Primer draws from current literature...

  16. Gemi: PCR Primers Prediction from Multiple Alignments

    PubMed Central

    Sobhy, Haitham; Colson, Philippe

    2012-01-01

    Designing primers and probes for polymerase chain reaction (PCR) is a preliminary and critical step that requires the identification of highly conserved regions in a given set of sequences. This task can be challenging if the targeted sequences display a high level of diversity, as frequently encountered in microbiologic studies. We developed Gemi, an automated, fast, and easy-to-use bioinformatics tool with a user-friendly interface to design primers and probes based on multiple aligned sequences. This tool can be used for the purpose of real-time and conventional PCR and can deal efficiently with large sets of sequences of a large size. PMID:23316117

  17. Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.

    Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

  18. Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

    DOE PAGES

    Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; ...

    2014-01-01

    Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

  19. AFLP fragment isolation technique as a method to produce random sequences for single nucleotide polymorphism discovery in the green turtle, Chelonia mydas.

    PubMed

    Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A

    2009-01-01

    The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.

  20. Photoaffinity labeling of the primer binding domain in murine leukemia virus reverse transcriptase.

    PubMed

    Tirumalai, R S; Modak, M J

    1991-07-02

    We have labeled the primer binding domain of murine leukemia virus reverse transcriptase (MuLV RT) by covalently cross-linking 5' end labeled d(T)8 to MuLV RT, using ultraviolet light energy. The specificity and the functional significance of the primer cross-linking reaction were demonstrated by the fact that (i) other oligomeric primers, tRNAs, and also template-primers readily compete with radiolabeled d(T)8 for the cross-linking reaction, (ii) under similar conditions, the competing primers and template-primer also inhibit the DNA polymerase activity of MuLV RT to a similar extent, (iii) substrate deoxynucleotides have no effect, and (iv) the reaction is sensitive to high ionic strength. In order to identify the primer binding domains/sites in MuLV RT; tryptic digests prepared from the covalently cross-linked MuLV RT and [32P]d(T)8 complexes were resolved on C-18 columns by reverse-phase HPLC. Three distinct radiolabeled peptides were found to contain the majority of the bound primer. Of these, peptide I contained approximately 65% radioactivity, while the remainder was associated with peptides II and III. Amino acid composition and sequence analyses of the individual peptides revealed that peptide I spans amino acid residues 72-80 in the primary amino acid sequence of MuLV RT and is located in the polymerase domain. The primer cross-linking site appears to be at or near Pro-76. Peptides II and III span amino acid residues 602-609 and 615-622, respectively, and are located in the RNase H domain. The probable cross-linking sites in peptides II and III are suggested to be at or near Leu-604 and Leu-618, respectively.

  1. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    PubMed

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  2. Composite-composite repair bond strength: effect of different adhesion primers.

    PubMed

    Tezvergil, A; Lassila, L V J; Vallittu, P K

    2003-11-01

    Recently, new products have been introduced to repair composite restorations that may be used as 'one-step' primers or monomers and silane compounds which are used separately as 'multi-step' primers. The aim of this study was to compare the shear bond strength of the new composite resin to aged composite, by using different adhesion primers. The substrates were particulate filler composite (Z250, 3M-ESPE), which was aged by boiling for 8 h and storing at 37 degrees C in water for 3 weeks. The aged substrate surfaces were wet-ground flat with 320-grit silicon carbide paper and subjected randomly (n=8) to either one-step adhesion primer: Compoconnect (CC) (Heraus Kulzer), or multi-step: Clearfil Repair (CF) (Kuraray) or an intermediate resin: Scothchbond Multi-purpose adhesive resin (3M-ESPE) according to the manufacturers' recommendations. Specimens with no surface treatment were used as control (C). New composite resin (Z250) was added to the substrate using 2 mm layer increments and light cured. The specimens were either water stored for 48 h or water stored for 24 h and then thermocycled for 6000 cycles. The shear bond strengths were measured with a crosshead speed of 1.0 mm/min using a universal testing machine. Data were analysed by two-way ANOVA and Tukey's post-hoc tests (p=0.05). All surface treatment methods showed significant difference compared to control (p<0.05). CF showed higher bond strength than CC and MP (p<0.05). Storage condition did not show a significant difference (p>0.05) in bond strength values. It was concluded that multi-step adhesion primer yielded higher bond strength compared to one-step primer or intermediate resin.

  3. Analysis of DNA methylation in Arabidopsis thaliana based on methylation-sensitive AFLP markers.

    PubMed

    Cervera, M T; Ruiz-García, L; Martínez-Zapater, J M

    2002-12-01

    AFLP analysis using restriction enzyme isoschizomers that differ in their sensitivity to methylation of their recognition sites has been used to analyse the methylation state of anonymous CCGG sequences in Arabidopsis thaliana. The technique was modified to improve the quality of fingerprints and to visualise larger numbers of scorable fragments. Sequencing of amplified fragments indicated that detection was generally associated with non-methylation of the cytosine to which the isoschizomer is sensitive. Comparison of EcoRI/ HpaII and EcoRI/ MspI patterns in different ecotypes revealed that 35-43% of CCGG sites were differentially digested by the isoschizomers. Interestingly, the pattern of digestion among different plants belonging to the same ecotype is highly conserved, with the rate of intra-ecotype methylation-sensitive polymorphisms being less than 1%. However, pairwise comparisons of methylation patterns between samples belonging to different ecotypes revealed differences in up to 34% of the methylation-sensitive polymorphisms. The lack of correlation between inter-ecotype similarity matrices based on methylation-insensitive or methylation-sensitive polymorphisms suggests that whatever the mechanisms regulating methylation may be, they are not related to nucleotide sequence variation.

  4. Comparison of the antibacterial activity of different self-etching primers and adhesives.

    PubMed

    Korkmaz, Yonca; Ozalp, Meral; Attar, Nuray

    2008-11-01

    The aim of this study was to evaluate the antibacterial effects of different one-step and two-step self-etching primer/adhesives on Streptococcus mutans (S. mutans), Lactobacillus casei (L. casei), and Lactobacillus acidophilus (L. acidophilus). The antibacterial effects of Clearfil Protect Bond Primer and Bonding agent; AdheSE Primer and Bonding agent; Adper Prompt L-Pop; Futurabond NR; Clearfil Tri S Bond; and Cervitec (positive control, 1% chlorhexidine varnish) were tested against standard strains of S. mutans, L. Casei, and L. acidophilus using the disk diffusion method. Standard filter paper disks (n=5) impregnated with 20 microL of each material were prepared. After incubation at 37 masculineC for 48 hours in a 5-10% CO2 atmosphere, the diameter of inhibition zones were measured in millimeters. Data were analyzed using one way analysis of variance (ANOVA) and multivariate analysis of variance (MANOVA). Duncan's Multiple Range Test was used for pairwise comparison. The size of inhibition zones produced by primer/adhesives varied among the brands. AdheSE Primer: S. mutans (20.6+/-1.51); L. casei (14.8+/-1.78); L. acidophilus (11.4+/-0.54). Adper Prompt L-Pop: S. mutans (19.6+/-1.51); L. casei (13.8+/-1.64); L. acidophilus (13.8+/-1.09). Cervitec: S. mutans (23+/-0.00); L. casei (27+/-0.70); L. acidophilus (22.4+/-0.54). Clearfil Protect Bond Primer: S. mutans (17+/-0.00); L. casei (17.6+/-0.54); L. acidophilus (22.4+/-0.54). Futurabond NR was found effective only against S. mutans (14.6+/-1.67). Of all the materials tested, AdheSE Bonding agent, Clearfil Protect Bond Bonding agent, and Clearfil Tri S Bond exhibited no inhibition zone (-) for all bacteria tested. Among the adhesives tested Clearafil Protect Bond Primer based upon monomer methacryloyloxydodecylpyridiniium bromide (MDPB) was found to be the most potent material against L. acidophilus and L. casei. AdheSE Primer and Adper Prompt L-Pop are highly effective against S. mutans. Compared with other

  5. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    ERIC Educational Resources Information Center

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  6. Freshwater Wetlands: A Citizen's Primer.

    ERIC Educational Resources Information Center

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  7. Binary electrokinetic separation of target DNA from background DNA primers.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    James, Conrad D.; Derzon, Mark Steven

    2005-10-01

    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting themore » entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.« less

  8. Quantitative Microbial Risk Assessment Tutorial - Primer

    EPA Science Inventory

    This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

  9. An Investigation to Improve Quality Evaluations of Primers and Propellant for 20mm Munitions

    NASA Technical Reports Server (NTRS)

    Bement, L. J.; Holmes, C.; McGrory, J.; Schimmel, M. L.

    1997-01-01

    To reduce the frequency of electrically initiated, 20mm munition hangfires (delayed ignitions), a joint Army/NASA investigation was conducted to recommend quality evaluation improvements for acceptance of both primers and gun propellant. This effort focused only on evaluating ignition and combustion performance as potential causes of hangfires: poor electrical initiation of the primer, low output performance of the primer, low ignition sensitivity of the gun propellant, and the effects of cold temperature. The goal was to determine the "best" of the Army and NASA test methods to assess the functional performance of primers and gun propellants. The approach was to evaluate the performance of both high-quality and deliberately defective primers to challenge the sensitivity of test methods. In addition, the ignition sensitivity of different manufacturing batches of gun propellants was evaluated. The results of the investigation revealed that improvements can be made in functional evaluations that can assist in identifying and reducing ignition and performance variations. The "best" functional evaluation of primers and propellant is achieved through a combination of both Army and NASA test methods. Incorporating the recommendations offered in this report may provide for considerable savings in reducing the number of cartridge firings, while significantly lowering the rejection rate of primer, propellant and cartridge lots. The most probable causes for ignition and combustion-related hangfires were the lack of calcium silicide in the primer mix, a low output performance of primers, and finally, poor ignition sensitivity of gun propellant. Cold temperatures further reduce propellant ignition sensitivity, as well as reducing burn rate and chamber pressures.

  10. Poliovirus serotype-specific VP1 sequencing primers.

    PubMed

    Kilpatrick, David R; Iber, Jane C; Chen, Qi; Ching, Karen; Yang, Su-Ju; De, Lina; Mandelbaum, Mark D; Emery, Brian; Campagnoli, Ray; Burns, Cara C; Kew, Olen

    2011-06-01

    The Global Polio Laboratory Network routinely uses poliovirus-specific PCR primers and probes to determine the serotype and genotype of poliovirus isolates obtained as part of global poliovirus surveillance. To provide detailed molecular epidemiologic information, poliovirus isolates are further characterized by sequencing the ~900-nucleotide region encoding the major capsid protein, VP1. It is difficult to obtain quality sequence information when clinical or environmental samples contain poliovirus mixtures. As an alternative to conventional methods for resolving poliovirus mixtures, sets of serotype-specific primers were developed for amplifying and sequencing the VP1 regions of individual components of mixed populations of vaccine-vaccine, vaccine-wild, and wild-wild polioviruses. Published by Elsevier B.V.

  11. Single-primer fluorescent sequencing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ruth, J.L.; Morgan, C.A.; Middendorf, L.R.

    Modified linker arm oligonucleotides complementary to standard M13 priming sites were synthesized, labelled with either one, two, or three fluoresceins, and purified by reverse-phase HPLC. When used as primers in standard dideoxy M13 sequencing with /sup 32/P-dNTPs, normal autoradiographic patterns were obtained. To eliminate the radioactivity, direct on-line fluorescence detection was achieved by the use of a scanning 10 mW Argon laser emitting 488 nm light. Fluorescent bands were detected directly in standard 0.2 or 0.35 mm thick polyacrylamide gels at a distance of 24 cm from the loading wells by a photomultiplier tube filtered at 520 nm. Horizontal andmore » temporal location of each band was displayed by computer as a band in real time, providing visual appearance similar to normal 4-lane autoradiograms. Using a single primer labelled with two fluoresceins, sequences of between 500 and 600 bases have been read in a single loading with better than 98% accuracy; up to 400 bases can be read reproducibly with no errors. More than 50 sequences have been determined by this method. This approach requires only 1-2 ug of cloned template, and produces continuous sequence data at about one band per minute.« less

  12. Primer on transportation and climate change

    DOT National Transportation Integrated Search

    2008-04-01

    This primer is an introduction to the issue of climate change and its implications for transportation policy in the United States. Its purpose is to outline the current thinking of governmental agencies, researchers, and advocacy groups on the issue ...

  13. Climate Ready Estuaries Rolling Easements Primer

    EPA Pesticide Factsheets

    Rolling easements enable wetlands and beaches to migrate inland and allow society to avoid the costs and hazards of protecting low lands from rising sea levels. This document provides a primer on more than a dozen rolling easement approaches.

  14. Sensory reception of the primer pheromone ethyl oleate

    NASA Astrophysics Data System (ADS)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  15. Novel Primer Sets for Next Generation Sequencing-Based Analyses of Water Quality

    PubMed Central

    Lee, Elvina; Khurana, Maninder S.; Whiteley, Andrew S.; Monis, Paul T.; Bath, Andrew; Gordon, Cameron; Ryan, Una M.; Paparini, Andrea

    2017-01-01

    Next generation sequencing (NGS) has rapidly become an invaluable tool for the detection, identification and relative quantification of environmental microorganisms. Here, we demonstrate two new 16S rDNA primer sets, which are compatible with NGS approaches and are primarily for use in water quality studies. Compared to 16S rRNA gene based universal primers, in silico and experimental analyses demonstrated that the new primers showed increased specificity for the Cyanobacteria and Proteobacteria phyla, allowing increased sensitivity for the detection, identification and relative quantification of toxic bloom-forming microalgae, microbial water quality bioindicators and common pathogens. Significantly, Cyanobacterial and Proteobacterial sequences accounted for ca. 95% of all sequences obtained within NGS runs (when compared to ca. 50% with standard universal NGS primers), providing higher sensitivity and greater phylogenetic resolution of key water quality microbial groups. The increased selectivity of the new primers allow the parallel sequencing of more samples through reduced sequence retrieval levels required to detect target groups, potentially reducing NGS costs by 50% but still guaranteeing optimal coverage and species discrimination. PMID:28118368

  16. MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species

    PubMed Central

    Miya, M.; Sato, Y.; Fukunaga, T.; Sado, T.; Poulsen, J. Y.; Sato, K.; Minamoto, T.; Yamamoto, S.; Yamanaka, H.; Araki, H.; Kondoh, M.; Iwasaki, W.

    2015-01-01

    We developed a set of universal PCR primers (MiFish-U/E) for metabarcoding environmental DNA (eDNA) from fishes. Primers were designed using aligned whole mitochondrial genome (mitogenome) sequences from 880 species, supplemented by partial mitogenome sequences from 160 elasmobranchs (sharks and rays). The primers target a hypervariable region of the 12S rRNA gene (163–185 bp), which contains sufficient information to identify fishes to taxonomic family, genus and species except for some closely related congeners. To test versatility of the primers across a diverse range of fishes, we sampled eDNA from four tanks in the Okinawa Churaumi Aquarium with known species compositions, prepared dual-indexed libraries and performed paired-end sequencing of the region using high-throughput next-generation sequencing technologies. Out of the 180 marine fish species contained in the four tanks with reference sequences in a custom database, we detected 168 species (93.3%) distributed across 59 families and 123 genera. These fishes are not only taxonomically diverse, ranging from sharks and rays to higher teleosts, but are also greatly varied in their ecology, including both pelagic and benthic species living in shallow coastal to deep waters. We also sampled natural seawaters around coral reefs near the aquarium and detected 93 fish species using this approach. Of the 93 species, 64 were not detected in the four aquarium tanks, rendering the total number of species detected to 232 (from 70 families and 152 genera). The metabarcoding approach presented here is non-invasive, more efficient, more cost-effective and more sensitive than the traditional survey methods. It has the potential to serve as an alternative (or complementary) tool for biodiversity monitoring that revolutionizes natural resource management and ecological studies of fish communities on larger spatial and temporal scales. PMID:26587265

  17. MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species.

    PubMed

    Miya, M; Sato, Y; Fukunaga, T; Sado, T; Poulsen, J Y; Sato, K; Minamoto, T; Yamamoto, S; Yamanaka, H; Araki, H; Kondoh, M; Iwasaki, W

    2015-07-01

    We developed a set of universal PCR primers (MiFish-U/E) for metabarcoding environmental DNA (eDNA) from fishes. Primers were designed using aligned whole mitochondrial genome (mitogenome) sequences from 880 species, supplemented by partial mitogenome sequences from 160 elasmobranchs (sharks and rays). The primers target a hypervariable region of the 12S rRNA gene (163-185 bp), which contains sufficient information to identify fishes to taxonomic family, genus and species except for some closely related congeners. To test versatility of the primers across a diverse range of fishes, we sampled eDNA from four tanks in the Okinawa Churaumi Aquarium with known species compositions, prepared dual-indexed libraries and performed paired-end sequencing of the region using high-throughput next-generation sequencing technologies. Out of the 180 marine fish species contained in the four tanks with reference sequences in a custom database, we detected 168 species (93.3%) distributed across 59 families and 123 genera. These fishes are not only taxonomically diverse, ranging from sharks and rays to higher teleosts, but are also greatly varied in their ecology, including both pelagic and benthic species living in shallow coastal to deep waters. We also sampled natural seawaters around coral reefs near the aquarium and detected 93 fish species using this approach. Of the 93 species, 64 were not detected in the four aquarium tanks, rendering the total number of species detected to 232 (from 70 families and 152 genera). The metabarcoding approach presented here is non-invasive, more efficient, more cost-effective and more sensitive than the traditional survey methods. It has the potential to serve as an alternative (or complementary) tool for biodiversity monitoring that revolutionizes natural resource management and ecological studies of fish communities on larger spatial and temporal scales.

  18. PhiSiGns: an online tool to identify signature genes in phages and design PCR primers for examining phage diversity

    PubMed Central

    2012-01-01

    Background Phages (viruses that infect bacteria) have gained significant attention because of their abundance, diversity and important ecological roles. However, the lack of a universal gene shared by all phages presents a challenge for phage identification and characterization, especially in environmental samples where it is difficult to culture phage-host systems. Homologous conserved genes (or "signature genes") present in groups of closely-related phages can be used to explore phage diversity and define evolutionary relationships amongst these phages. Bioinformatic approaches are needed to identify candidate signature genes and design PCR primers to amplify those genes from environmental samples; however, there is currently no existing computational tool that biologists can use for this purpose. Results Here we present PhiSiGns, a web-based and standalone application that performs a pairwise comparison of each gene present in user-selected phage genomes, identifies signature genes, generates alignments of these genes, and designs potential PCR primer pairs. PhiSiGns is available at (http://www.phantome.org/phisigns/; http://phisigns.sourceforge.net/) with a link to the source code. Here we describe the specifications of PhiSiGns and demonstrate its application with a case study. Conclusions PhiSiGns provides phage biologists with a user-friendly tool to identify signature genes and design PCR primers to amplify related genes from uncultured phages in environmental samples. This bioinformatics tool will facilitate the development of novel signature genes for use as molecular markers in studies of phage diversity, phylogeny, and evolution. PMID:22385976

  19. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    NASA Technical Reports Server (NTRS)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  20. The corrosion protection of 2219-T87 aluminum by organic and inorganic zinc-rich primers

    NASA Technical Reports Server (NTRS)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electro-chemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. the galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 micro A/cm(exp 2) and 23.7 micro A/cm(exp 2) for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  1. The corrosion protection of AISI(TM) 1010 steel by organic and inorganic zinc-rich primers

    NASA Technical Reports Server (NTRS)

    Danford, M. D.; Mendrek, M. J.

    1995-01-01

    The behavior of zinc-rich primer-coated AISI 1010 steel in 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR), were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electromechanical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 1010 steel cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high current between the steel cathode and both zinc-rich primer anodes (38.8 and 135.2 microns A/sq cm for the organic and inorganic primers, respectively). The results of corrosion rate determinations demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. EIS equivalent circuit parameters confirmed this conclusion. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application on solid rocket booster steel hardware.

  2. Electrocoat Process for Non-Chromate Primers in DoD Manufacturing

    DTIC Science & Technology

    2011-02-01

    requirements are uniquely  suited for aerospace  aluminum. ↑ O2 ↑ H2 Anode (+) Cathode (-) Deposited Film Alkaline  clean Rinse ElectrocoatSurface...Objectives ● Demonstration and validation of a novel, non‐chromated,  environmentally friendly,  electrodeposited  primer. ● The primers will be

  3. GST-PRIME: an algorithm for genome-wide primer design.

    PubMed

    Leister, Dario; Varotto, Claudio

    2007-01-01

    The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

  4. Effect of N-acetyl cysteine on orthodontic primers cytotoxicity.

    PubMed

    D'Antò, Vincenzo; Spagnuolo, Gianrico; Schweikl, Helmut; Rengo, Sandro; Ambrosio, Luigi; Martina, Roberto; Valletta, Rosa

    2011-02-01

    The aims of this study were to evaluate the cytotoxicity of four orthodontic primers, including two hydrophilic and two hydrophobic materials, and to investigate the role of the reactive oxygen species (ROS) in induced cell damage. Moreover, the effects of the anti-oxidant N-acetyl cysteine (NAC) on primers toxicity was analyzed. Human gingival fibroblasts (HGF) were exposed to different concentrations of primers (0-0.25 mg/ml) in the presence or absence of NAC, and the cytotoxicity was assessed by the MTT assay, while cell death was quantified by flow cytometry after propidium iodide staining. The increase in the induced ROS levels was detected by flow cytometry measuring the fluorescence of the oxidation-sensitive dye 2',7'-dichlorofluorescein diacetate (DCFH-DA). All materials decreased cell viability in a dose-related manner after a 24 h exposure period. Cytotoxicity of orthodontic primers based on concentrations which caused a 50% decrease in cell viability (TC₅₀) in HGF was ranked as follows (median values): Eagle Fluorsure (0.078 mg/ml)>Transbond XT (0.081 mg/ml)>Transbond MIP (0.128 mg/ml)>Ortho solo (0.130 mg/ml). Moreover, in HGF cells, all materials induced a dose-dependent increase in ROS levels compared to untreated cells. Incubation of HGF with NAC significantly reduced ROS production and decreased the cell damage and cytotoxicity caused by all materials tested (p<0.001). Our results suggested that hydrophilic primers were less cytotoxic than hydrophobic materials. Moreover, we demonstrated a major role of ROS in the induction of cell death since the antioxidant N-acetyl cysteine was able to prevent cell damage induced by all materials tested. Copyright © 2010 Academy of Dental Materials. Published by Elsevier Ltd. All rights reserved.

  5. Characterization of microsatellite loci and reliable genotyping in a polyploid plant, Mercurialis perennis (Euphorbiaceae).

    PubMed

    Pfeiffer, Tanja; Roschanski, Anna M; Pannell, John R; Korbecka, Grazyna; Schnittler, Martin

    2011-01-01

    For many applications in population genetics, codominant simple sequence repeats (SSRs) may have substantial advantages over dominant anonymous markers such as amplified fragment length polymorphisms (AFLPs). In high polyploids, however, allele dosage of SSRs cannot easily be determined and alleles are not easily attributable to potentially diploidized loci. Here, we argue that SSRs may nonetheless be better than AFLPs for polyploid taxa if they are analyzed as effectively dominant markers because they are more reliable and more precise. We describe the transfer of SSRs developed for diploid Mercurialis huetii to the clonal dioecious M. perennis. Primers were tested on a set of 54 male and female plants from natural decaploid populations. Eight of 65 tested loci produced polymorphic fragments. Binary profiles from 4 different scoring routines were used to define multilocus lineages (MLLs). Allowing for fragment differences within 1 MLL, all analyses revealed the same 14 MLLs without conflicting with merigenet, sex, or plot assignment. For semiautomatic scoring, a combination of as few as 2 of the 4 most polymorphic loci resulted in unambiguous discrimination of clones. Our study demonstrates that microsatellite fingerprinting of polyploid plants is a cost efficient and reliable alternative to AFLPs, not least because fewer loci are required than for diploids.

  6. Transcriptome Analysis of Houttuynia cordata Thunb. by Illumina Paired-End RNA Sequencing and SSR Marker Discovery

    PubMed Central

    Wei, Lin; Li, Shenghua; Liu, Shenggui; He, Anna; Wang, Dan; Wang, Jie; Tang, Yulian; Wu, Xianjin

    2014-01-01

    Background Houttuynia cordata Thunb. is an important traditional medical herb in China and other Asian countries, with high medicinal and economic value. However, a lack of available genomic information has become a limitation for research on this species. Thus, we carried out high-throughput transcriptomic sequencing of H. cordata to generate an enormous transcriptome sequence dataset for gene discovery and molecular marker development. Principal Findings Illumina paired-end sequencing technology produced over 56 million sequencing reads from H. cordata mRNA. Subsequent de novo assembly yielded 63,954 unigenes, 39,982 (62.52%) and 26,122 (40.84%) of which had significant similarity to proteins in the NCBI nonredundant protein and Swiss-Prot databases (E-value <10−5), respectively. Of these annotated unigenes, 30,131 and 15,363 unigenes were assigned to gene ontology categories and clusters of orthologous groups, respectively. In addition, 24,434 (38.21%) unigenes were mapped onto 128 pathways using the KEGG pathway database and 17,964 (44.93%) unigenes showed homology to Vitis vinifera (Vitaceae) genes in BLASTx analysis. Furthermore, 4,800 cDNA SSRs were identified as potential molecular markers. Fifty primer pairs were randomly selected to detect polymorphism among 30 samples of H. cordata; 43 (86%) produced fragments of expected size, suggesting that the unigenes were suitable for specific primer design and of high quality, and the SSR marker could be widely used in marker-assisted selection and molecular breeding of H. cordata in the future. Conclusions This is the first application of Illumina paired-end sequencing technology to investigate the whole transcriptome of H. cordata and to assemble RNA-seq reads without a reference genome. These data should help researchers investigating the evolution and biological processes of this species. The SSR markers developed can be used for construction of high-resolution genetic linkage maps and for gene

  7. Transcriptome analysis of Houttuynia cordata Thunb. by Illumina paired-end RNA sequencing and SSR marker discovery.

    PubMed

    Wei, Lin; Li, Shenghua; Liu, Shenggui; He, Anna; Wang, Dan; Wang, Jie; Tang, Yulian; Wu, Xianjin

    2014-01-01

    Houttuynia cordata Thunb. is an important traditional medical herb in China and other Asian countries, with high medicinal and economic value. However, a lack of available genomic information has become a limitation for research on this species. Thus, we carried out high-throughput transcriptomic sequencing of H. cordata to generate an enormous transcriptome sequence dataset for gene discovery and molecular marker development. Illumina paired-end sequencing technology produced over 56 million sequencing reads from H. cordata mRNA. Subsequent de novo assembly yielded 63,954 unigenes, 39,982 (62.52%) and 26,122 (40.84%) of which had significant similarity to proteins in the NCBI nonredundant protein and Swiss-Prot databases (E-value <10(-5)), respectively. Of these annotated unigenes, 30,131 and 15,363 unigenes were assigned to gene ontology categories and clusters of orthologous groups, respectively. In addition, 24,434 (38.21%) unigenes were mapped onto 128 pathways using the KEGG pathway database and 17,964 (44.93%) unigenes showed homology to Vitis vinifera (Vitaceae) genes in BLASTx analysis. Furthermore, 4,800 cDNA SSRs were identified as potential molecular markers. Fifty primer pairs were randomly selected to detect polymorphism among 30 samples of H. cordata; 43 (86%) produced fragments of expected size, suggesting that the unigenes were suitable for specific primer design and of high quality, and the SSR marker could be widely used in marker-assisted selection and molecular breeding of H. cordata in the future. This is the first application of Illumina paired-end sequencing technology to investigate the whole transcriptome of H. cordata and to assemble RNA-seq reads without a reference genome. These data should help researchers investigating the evolution and biological processes of this species. The SSR markers developed can be used for construction of high-resolution genetic linkage maps and for gene-based association analyses in H. cordata. This work

  8. Primer vector theory and applications

    NASA Technical Reports Server (NTRS)

    Jezewski, D. J.

    1975-01-01

    A method developed to compute two-body, optimal, N-impulse trajectories was presented. The necessary conditions established define the gradient structure of the primer vector and its derivative for any set of boundary conditions and any number of impulses. Inequality constraints, a conjugate gradient iterator technique, and the use of a penalty function were also discussed.

  9. A 22-mer primer enhances discriminatory power of AP-PCR fingerprinting technique in characterization of leptospires.

    PubMed

    Roy, Subarna; Biswas, Debabrata; Vijayachari, P; Sugunan, A P; Sehgal, Subhash C

    2004-11-01

    To evaluate the discriminatory power and usefulness of arbitrarily primed-polymerase chain reaction (AP-PCR) characterization of leptospires with M16 primer. AP-PCR fingerprints of 20 reference strains of Leptospira representing 20 different serovars belonging to seven genospecies (Leptospira interrogans, 11; L. noguchii, 2; L. borgpetersenii, 1; L. santarosai, 2; L. biflexa, 2; L. kirschneri, 1; L. weilii, 1) were generated by employing M16 primer. Fingerprints generated with this primer were compared with those generated with two other commonly used primers PB1, and L10. An attempt was also made to type 20 leptospiral isolates with the M16 primer. Fingerprints with M16 primer could not only differentiate between strains of different genospecies, but also between strains of the same genospecies belonging to different serovars. While two commonly used primers (PB1 and L10) failed to discriminate between some of the different serovars belonging to the same genospecies, this primer was able to generate discriminatory fingerprints for all strains tested. All 20 Leptospira isolates, recovered from patients in Andaman Islands, could also be typed by fingerprints generated with the M16 primer. The discriminatory power of M16 primer adds more specificity to the rapidity of this system of characterization and can be used as an excellent tool in epidemiological studies on Leptospira.

  10. Shop primer as part of the corrosion protective coating for submerged steel structures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bjordal, M.; Steinsmo, U.

    In Norwegian workshops the standard pre-treatment procedures for steel structures intended for sub-sea use, normally include removal of shop primer by blast cleaning to Sa 2 1/2 before application of corrosion protective coatings. This is also stated in the Norwegian offshore standard NORSOK. Omitting this stage in fabrication will represent large reductions in both time consumption and costs, and reduce the volume of waste from the blast cleaning. This report presents results from investigations of how a shop primer will influence on the coating properties. The aim of the investigation was to test whether the systems are good enough ifmore » the shop primer is left on the surface. Two different zinc silicate shop primers have been included in the investigation. As protective coatings the authors have used three different epoxy mastic systems with Al pigments. In addition to panels with original shop primer, they have also tested shop primed panels pre-treated in various ways, such as heated, corroded and blast cleaned to various degrees before coating. The coatings have been tested in the ASTM-G8 121 test and in a long term test in sea water polarized with a Zn anode. They have found that coatings including the zinc silicate shop primer are more susceptible to cathodic disbonding than the coating applied directly on blast cleaned steel. It is however possible to meet the NORSOK criteria with a zinc silicate shop primer as first coat.« less

  11. Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

    PubMed

    Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

    2018-01-17

    In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

  12. AFLPs reveal different population genetic structure under contrasting environments in the marine snail Nucella lapillus L.

    PubMed

    Carro, Belén; Quintela, María; Ruiz, José Miguel; Barreiro, Rodolfo

    2012-01-01

    Dispersal has received growing attention in marine ecology, particularly since evidence obtained with up-to-date techniques challenged the traditional view. The dogwhelk Nucella lapillus L., a sedentary gastropod with direct development, is a good example: dispersal was traditionally assumed to be limited until studies with microsatellites disputed this idea. To shed some light on this controversy, the genetic structure of dogwhelk populations in northwest Spain was investigated with highly polymorphic AFLP markers giving special attention to the influence of hydrodynamic stress. In agreement with the expectations for a poor disperser, our results show a significant genetic structure at regional (<200 km) and areal scales (<15 km). However, the spatial genetic structure varied with wave-exposure in the present case study: IBD was evident under sheltered conditions but absent from the exposed area where genetic differentiation was stronger. Our results provide evidence that differences in wave-exposure can exert a detectable influence on the genetic structure of coastal organisms, even in species without a planktonic larva.

  13. Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

    PubMed

    Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

    2008-08-29

    Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  14. The effect of zoledronate-containing primer on dentin bonding of a universal adhesive.

    PubMed

    Zenobi, Walter; Feitosa, Victor Pinheiro; Moura, Maria Elisa Martins; D'arcangelo, Camillo; Rodrigues, Lidiany Karla de Azevedo; Sauro, Salvatore

    2018-01-01

    To evaluate the bonding ability and nanoleakage of a universal adhesive applied to dentin pre-treated using a zoledronate-containing primer (zol-primer) before and after mechanical load cycling. Flat dentin surfaces obtained from human molars were assigned to one of the following adhesion procedures (n=6): 1-Single Bond Universal (SBU) applied in etch-and-rinse mode; 2- SBU applied as etch-and-rinse after the application of zol-primer; 3- SBU applied in self-etch strategy; 4- SBU applied as self-etch after the use of zol-primer. Half of the specimens were processed for microtensile bond strength test after 24h, while the other half part was submitted to 200,000 mechanical cycles. Further specimens were silver-impregnated and assessed for interface nanoleakage by SEM. Data were analyzed with two-way ANOVA and Tukey's test (p<0.05). At 24h evaluation, the four groups presented similar bond strengths, whilst both groups bonded with etch-and-rinse technique showed significant bond strength reduction after mechanical load (p<0.05), with the highest drop in bond strength for the specimens pre-treated with the zol-primer. No negative effects were found for self-etch strategy (p>0.05) in microtensile test. Lower nanoleakage expression was observed for etch-and-rinse specimens treated with zol-primer. However, noteworthy reduction of adhesive layer thickness was observed when combining the zol-primer with the self-etch bonding approach. It can be concluded that zol-primer should not be used along with a universal adhesive in etch-and-rinse mode, but its application before self-etch application may provide less degradation of the resin-dentin interface. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. DNA barcode based wildlife forensics for resolving the origin of claw samples using a novel primer cocktail.

    PubMed

    Khedkar, Gulab D; Abhayankar, Shil Bapurao; Nalage, Dinesh; Ahmed, Shaikh Nadeem; Khedkar, Chandraprakash D

    2016-11-01

    Excessive wildlife hunting for commercial purposes can have negative impacts on biodiversity and may result in species extinction. To ensure compliance with legal statutes, forensic identification approaches relying on molecular markers may be used to identify the species of origin of animal material from hairs, claw, blood, bone, or meat. Using this approach, DNA sequences from the COI "barcoding" gene have been used to identify material from a number of domesticated animal species. However, many wild species of carnivores still present great challenges in generating COI barcodes using standard "universal" primer pairs. In the work presented here, the mitochondrial COI gene was successfully amplified using a novel primer cocktail, and the products were sequenced to determine the species of twenty one unknown samples of claw material collected as part of forensic wildlife case investigations. Sixteen of the unknown samples were recognized to have originated from either Panthera leo or P. pardus individuals. The remaining five samples could be identified only to the family level due to the absence of reference animal sequences. This is the first report on the use of COI sequences for the identification of P. pardus and P. leo from claw samples as part of forensic investigations in India. The study also highlights the need for adequate reference material to aid in the resolution of suspected cases of illegal wildlife harvesting.

  16. Integrating PCR theory and bioinformatics into a research-oriented primer design exercise.

    PubMed

    Robertson, Amber L; Phillips, Allison R

    2008-01-01

    Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessments of student performance and perceptions. We developed this interactive Primer Design Exercise using the principles of scientific teaching to enhance student understanding of the theory behind PCR and provide practice in designing PCR primers to amplify DNA. In the end, the students were more poised to troubleshoot problems that arose in real experiments using PCR. In addition, students had the opportunity to utilize several bioinformatics tools to gain an increased understanding of primer quality, directionality, and specificity. In the course of this study many misconceptions about DNA replication during PCR and the need for primer specificity were identified and addressed. Students were receptive to the new materials and the majority achieved the learning goals.

  17. AFLP Approach Reveals Variability in Phragmites australis: Implications for Its Die-Back and Evidence for Genotoxic Effects

    PubMed Central

    Coppi, Andrea; Lastrucci, Lorenzo; Cappelletti, David; Cerri, Martina; Ferranti, Francesco; Ferri, Valentina; Foggi, Bruno; Gigante, Daniela; Venanzoni, Roberto; Viciani, Daniele; Selvaggi, Roberta; Reale, Lara

    2018-01-01

    Phragmites australis is a subcosmopolitan species typical of wetlands being studied in Europe for its disappearance from natural stands, a phenomenon called reed die-back syndrome (RDBS). Although it is conjectured that low genetic variability contributes to RDBS, this aspect remains neglected to this day. Using a molecular fingerprinting approach and a sequence analysis of the trnT-trnL/rbcL-psaI regions of cpDNA, this study aimed to compare the genetic structure of stable vs. RDBS-affected P. australis stands from five wetlands of central Italy. Beforehand, in order to characterize the health condition of reed populations, the occurrence of the main macromorphological descriptors for RDBS was considered on 40 reed stands. Soil samples were also collected to examine the total content of heavy metals. The current study analyzed cpDNA in 19 samples and AFLP profiles in 381 samples to investigate the genetic structure of Phragmites populations. Based on the multinomial-Dirichlet model, an analysis of candidate loci under selective pressure was also performed. The relationships among AFLP data, RDBS descriptors and chemicals were evaluated with the use of Linear Mixed Models. The analysis of the cpDNA shows the occurrence of the haplotypes M (the most widespread), and K here recorded for the first time in Italy. Three new haplotypes were also described. The DNA fingerprinting analysis has produced a total of 322 loci (98% polymorphic) and shows the medium-to-high amount of genetic diversity. The significant genetic differentiation among wetlands (Fst = 0.337) suggests either low gene flow or small effective population size. Moreover, the low amount of outlier loci (only 5; l.5% of the total), seems to indicate the scarce occurrence of selective pressure upon the reed’s genome. Genetic diversity increased in relationship to the decrease in diameter and of flowering buds of the reed, two of the trends associated with the die-back. The current study rejects the

  18. Immunological properties of the primer-independent glucosyltransferase of Streptococcus mutans serotypes d and g.

    PubMed

    Yamashita, Y; Shigeoka, T; Hanada, N; Takehara, T

    1988-05-01

    Streptococcus mutans serotype g secretes at least three kinds of glucosyltransferase with different enzymological and immunological properties. One of them is a primer-independent enzyme and seems to be the source of primer for the others, both of which are primer-dependent enzymes. Recently, we purified the primer-independent enzyme, the third glucosyltransferase in this group from S. mutans strain AHT-k serotype g. In the present study, we examined the specificity of the antiserum against the primer-independent glucosyltransferase using extracellular culture-conditioned fluids of many strains of the various serotypes of S. mutans. The antiserum cross-reacted with the extracellular culture fluids from strains of serotypes d and a, in addition to serotype g, but not with those of other serotypes, indicating that the primer-independent glucosyltransferase is secreted by the S. sobrinus and S. cricetus, but not by S. mutans and S. rattus. The antiserum did not completely inhibit the activity of the enzyme, even at more than twofold antibody excess, determined by indirect precipitation with immobilized staphylococcal protein A.

  19. Comparison of PCR primer-based strategies for characterization of ammonia oxidizer communities in environmental samples.

    PubMed

    Mahmood, Shahid; Freitag, Thomas E; Prosser, James I

    2006-06-01

    PCR-based techniques are commonly used to characterize microbial communities, but are subject to bias that is difficult to assess. This study aimed to evaluate bias of several PCR primer-based strategies used to study diversity of autotrophic ammonia oxidizers. 16S rRNA genes from soil- or sediment-DNA were amplified using primers considered either selective or specific for betaproteobacterial ammonia oxidizers. Five approaches were assessed: (a) amplification with primers betaAMO143f-betaAMO1315r; (b) amplification with primers CTO189f-CTO654r; (c) nested amplification with betaAMO143f-betaAMO1315r followed by CTO189f-CTO654r primers; (d) nested amplification with betaAMO143f-betaAMO1315r and CTO189f-Pf1053r primers; (e) nested amplification with 27f-1492r and CTO189f-CTO654r primers. Amplification products were characterized by denaturing gradient gel electrophoresis (DGGE) analysis after further amplification with 357f-GC-518r primers. DGGE profiles of soil communities were heterogeneous and depended on the approach followed. Ammonia oxidizer diversity was higher using approaches (b), (c) and (e) than using (a) and (d), where sequences of the most prominent bands showed similarities to nonammonia oxidizers. Profiles from marine sediments were more consistent, regardless of the approach adopted, and sequence analysis of excised bands indicated that these consisted of ammonia oxidizers only. The study demonstrates the importance of choice of primer, of screening for sequences of nontarget organisms and use of several approaches when characterizing microbial communities in natural environments.

  20. Bonding of Resin Cement to Zirconia with High Pressure Primer Coating

    PubMed Central

    Wang, Ying-jie; Jiao, Kai; Liu, Yan; Zhou, Wei; Shen, Li-juan; Fang, Ming; Li, Meng; Zhang, Xiang; Tay, Franklin R.; Chen, Ji-hua

    2014-01-01

    Objectives To investigate the effect of air-drying pressure during ceramic primer coating on zirconia/resin bonding and the surface characteristics of the primed zirconia. Methods Two ceramic primers (Clearfil Ceramic Primer, CCP, Kuraray Medical Inc. and Z-Prime Plus, ZPP, Bisco Inc.) were applied on the surface of air-abraded zirconia (Katana zirconia, Noritake) and dried at 4 different air pressures (0.1–0.4 MPa). The primed zirconia ceramic specimens were bonded with a resin-based luting agent (SA Luting Cement, Kuraray). Micro-shear bond strengths of the bonded specimens were tested after 3 days of water storage or 5,000× thermocycling (n = 12). Failure modes of the fractured specimens were examined with scanning electron miscopy. The effects of air pressure on the thickness of the primer layers and the surface roughness (Sa) of primed zirconia were evaluated using spectroscopic ellipsometry (n = 6), optical profilometry and environmental scanning electron microscopy (ESEM) (n = 6), respectively. Results Clearfil Ceramic Primer air-dried at 0.3 and 0.4 MPa, yielding significantly higher µSBS than gentle air-drying subgroups (p<0.05). Compared to vigorous drying conditions, Z-Prime Plus air-dried at 0.2 MPa exhibited significantly higher µSBS (p<0.05). Increasing air-drying pressure reduced the film thickness for both primers. Profilometry measurements and ESEM showed rougher surfaces in the high pressure subgroups of CCP and intermediate pressure subgroup of ZPP. Conclusion Air-drying pressure influences resin/zirconia bond strength and durability significantly. Higher air-drying pressure (0.3-0.4 MPa) for CCP and intermediate pressure (0.2 MPa) for ZPP are recommended to produce strong, durable bonds between resin cement and zirconia ceramics. PMID:24992678

  1. Sediment transport primer: estimating bed-material transport in gravel-bed rivers

    Treesearch

    Peter Wilcock; John Pitlick; Yantao Cui

    2009-01-01

    This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

  2. Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

    PubMed

    Caetano-Anollés, G; Gresshoff, P M

    1996-06-01

    DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

  3. Specific primers for rapid detection of Microsporum audouinii by PCR in clinical samples.

    PubMed

    Roque, H D; Vieira, R; Rato, S; Luz-Martins, M

    2006-12-01

    This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis.

  4. In vivo effect of a self-etching primer on dentin.

    PubMed

    Milia, E; Lallai, M R; García-Godoy, F

    1999-08-01

    To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.

  5. Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions

    PubMed Central

    Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

    2011-01-01

    To clarify the biochemical behavior of 2′-deoxyribonucleoside 5′-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (Co) and adenine N-oxide (Ao), we examined their base recognition ability in DNA duplex formation using melting temperature (Tm) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the Tm values of modified DNA–DNA duplexes incorporating 2′-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo−) and Vent (exo−) suggested that Co and Ao selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo−) toward Ao on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator. PMID:21300642

  6. Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions.

    PubMed

    Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

    2011-04-01

    To clarify the biochemical behavior of 2'-deoxyribonucleoside 5'-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (C(o)) and adenine N-oxide (A(o)), we examined their base recognition ability in DNA duplex formation using melting temperature (T(m)) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the T(m) values of modified DNA-DNA duplexes incorporating 2'-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo(-)) and Vent (exo(-)) suggested that C(o) and A(o) selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo(-)) toward A(o) on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator.

  7. Use of novel species-specific PCR primers targeted to DNA gyrase subunit B (gyrB) gene for species identification of the Cronobacter sakazakii and Cronobacter dublinensis.

    PubMed

    Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Lina

    2013-02-01

    Cronobacter sakazakii and its phylogenetically closest species are considered to be an opportunistic pathogens associated with food-borne disease in neonates and infants. Neither phenotypic nor genotypic (16S ribosomal DNA sequence analysis) techniques can provide sufficient resolutions for accurately and rapidly identification of these species. The objective of this study was to develop species-specific PCR based on the gyrB gene sequence for direct species identification of the C. sakazakii and Cronobacter dublinensis within the C. sakazakii group. Two pair of species-specific primers were designed and used to specifically identify C. sakazakii and C. dublinensis, but none of the other C. sakazakii group strains. Our data indicate that the novel species-specific primers could be used to rapidly and accurately identify the species of C. sakazakii and C. dublinensis from C. sakazakii group by the PCR based assays. Copyright © 2012 Elsevier Ltd. All rights reserved.

  8. A method for predicting service life of zinc rich primers on carbon steel

    NASA Technical Reports Server (NTRS)

    Hoppesch, C. W.

    1986-01-01

    The service life of zinc rich primers on carbon steel can be estimated by immersing a primer coated glass slide into an aqueous copper sulfate solution and measuring the amount of zinc that reacts with the copper in 15 minutes. This zinc availability test was used to evaluate eleven primers currently available for which marine beach exposure data was available from previous programs. Results were evaluated and a correlation between zinc availability and ASTM rust grade was shown.

  9. Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

    PubMed Central

    Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

    2012-01-01

    Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

  10. Sliding over the Blocks in Enzyme-Free RNA Copying – One-Pot Primer Extension in Ice

    PubMed Central

    Löffler, Philipp M. G.; Groen, Joost; Dörr, Mark; Monnard, Pierre-Alain

    2013-01-01

    Template-directed polymerization of RNA in the absence of enzymes is the basis for an information transfer in the ‘RNA-world’ hypothesis and in novel nucleic acid based technology. Previous investigations established that only cytidine rich strands are efficient templates in bulk aqueous solutions while a few specific sequences completely block the extension of hybridized primers. We show that a eutectic water/ice system can support Pb2+/Mg2+-ion catalyzed extension of a primer across such sequences, i.e. AA, AU and AG, in a one-pot synthesis. Using mixtures of imidazole activated nucleotide 5′-monophosphates, the two first “blocking” residues could be passed during template-directed polymerization, i.e., formation of triply extended products containing a high fraction of faithful copies was demonstrated. Across the AG sequence, a mismatch sequence was formed in similar amounts to the correct product due to U·G wobble pairing. Thus, the template-directed extension occurs both across pyrimidine and purine rich sequences and insertions of pyrimidines did not inhibit the subsequent insertions. Products were mainly formed with 2′-5′-phosphodiester linkages, however, the abundance of 3′–5′-linkages was higher than previously reported for pyrimidine insertions. When enzyme-free, template-directed RNA polymerization is performed in a eutectic water ice environment, various intrinsic reaction limitations observed in bulk solution can then be overcome. PMID:24058695

  11. Primer sets for cloning the human repertoire of T cell Receptor Variable regions

    PubMed Central

    Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

    2008-01-01

    Background Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets. PMID:18759974

  12. A Primer on Simulation and Gaming.

    ERIC Educational Resources Information Center

    Barton, Richard F.

    In a primer intended for the administrative professions, for the behavioral sciences, and for education, simulation and its various aspects are defined, illustrated, and explained. Man-model simulation, man-computer simulation, all-computer simulation, and analysis are discussed as techniques for studying object systems (parts of the "real…

  13. GSP: A web-based platform for designing genome-specific primers in polyploids

    USDA-ARS?s Scientific Manuscript database

    The sequences among subgenomes in a polyploid species have high similarity. This makes difficult to design genome-specific primers for sequence analysis. We present a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome backgr...

  14. Development of Strain-Specific Primers for Identification of Bifidobacterium bifidum BGN4.

    PubMed

    Youn, So Youn; Ji, Geun Eog; Han, Yoo Ri; Park, Myeong Soo

    2017-05-28

    Bifidobacterium bifidum BGN4 (BGN4) has many proven beneficial effects, including antiallergy and anticancer properties. It has been commercialized and used in several probiotic products, and thus strain-specific identification of this strain is very valuable for further strain-dependent physiological study. For this purpose, we developed novel multiplex polymerase chain reaction (PCR) primer sets for strain-specific detection of BGN4 in commercial products and fecal samples of animal models. The primer set was tested on seven strains of B. bifidum and 75 strains of the other Bifidobacterium species. The BGN4-specific regions were derived using megaBLAST against genome sequences of various B. bifidum databases and four sets of primers were designed. As a result, only BGN4 produced four PCR products simultaneously whereas the other strains did not. The PCR detection limit using BGN4-specific primer sets was 2.8 × 10 1 CFU/ml of BGN4. Those primer sets also detected and identified BGN4 in the probiotic products containing BNG4 and fecal samples from a BGN4-fed animal model with high specificity. Our results indicate that the PCR assay from this study is an efficient tool for the simple, rapid, and reliable identification of BGN4, for which probiotic strains are known.

  15. Technologies that complement congestion pricing : a primer.

    DOT National Transportation Integrated Search

    2008-10-01

    The purpose of this volume is to consider the technology options that are available to complement congestion-pricing approaches. This primer explores how technology broadens the success for congestion pricing by supporting the traveler's decision to ...

  16. Dental primer and adhesive containing a new antibacterial quaternary ammonium monomer dimethylaminododecyl methacrylate

    PubMed Central

    Cheng, Lei; Weir, Michael D.; Zhang, Ke; Arola, Dwayne D.; Zhou, Xuedong; Xu, Hockin H. K.

    2013-01-01

    Objectives The main reason for restoration failure is secondary caries caused by biofilm acids. Replacing the failed restorations accounts for 50–70% of all operative work. The objectives of this study were to incorporate a new quaternary ammonium monomer (dimethylaminododecyl methacrylate, DMADDM) and nanoparticles of silver (NAg) into a primer and an adhesive, and to investigate their effects on antibacterial and dentin bonding properties. Methods Scotchbond Multi-Purpose (SBMP) served as control. DMADDM was synthesized and incorporated with NAg into primer/adhesive. A dental plaque microcosm biofilm model with human saliva was used to investigate metabolic activity, colony-forming units (CFU), and lactic acid. Dentin shear bond strengths were measured. Results Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of the new DMADDM were orders of magnitude lower than those of a previous quaternary ammonium dimethacrylate (QADM). Uncured primer with DMADDM had much larger inhibition zones than QADM (p<0.05). Cured primer/adhesive with DMADDM-NAg greatly reduced biofilm metabolic activity (p<0.05). Combining DMADDM with NAg in primer/adhesive resulted in less CFU than DMADDM alone (p<0.05). Lactic acid production by biofilms was reduced by 20-fold via DMADDM-NAg, compared to control. Incorporation of DMADDM and NAg into primer/adhesive did not adversely affect dentin bond strength. Conclusions A new antibacterial monomer DMADDM was synthesized and incorporated into primer/adhesive for the first time. The bonding agents are promising to combat residual bacteria in tooth cavity and invading bacteria at tooth-restoration margins to inhibit caries. DMADDM and NAg are promising for use into a wide range of dental adhesive systems and restoratives. PMID:23353068

  17. A Quantum Groups Primer

    NASA Astrophysics Data System (ADS)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  18. Specific Primers for Rapid Detection of Microsporum audouinii by PCR in Clinical Samples▿

    PubMed Central

    Roque, H. D.; Vieira, R.; Rato, S.; Luz-Martins, M.

    2006-01-01

    This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis. PMID:17005755

  19. Pick a Pair. Pancake Pairs

    ERIC Educational Resources Information Center

    Miller, Pat

    2005-01-01

    Cold February weather and pancakes are a traditional pairing. Pancake Day began as a way to eat up the foods that were abstained from in Lent--traditionally meat, fat, eggs and dairy products. The best-known pancake event is The Pancake Day Race in Buckinghamshire, England, which has been run since 1445. This column describes pairs of books that…

  20. Microsatellite primers for vulnerable seagrass Halophila beccarii (Hydrocharitaceae).

    PubMed

    Jiang, Kai; Shi, Yi-Su; Zhang, Jian; Xu, Na-Na

    2011-06-01

    Polymorphic microsatellite primers were developed in the vulnerable seagrass Halophila beccarii to investigate genetic variation and provide necessary markers for studying its population genetic structure. Six polymorphic and six monomorphic microsatellite loci were developed in H. beccarii. Most loci were successfully amplified across 40 H. beccarii individuals collected from three populations from coastal regions of southern China. Two to four alleles per locus were observed at the six polymorphic loci. The highest expected heterozygosity was 0.5737. The results demonstrate low levels of polymorphism in H. beccarii from coastal regions of southern China. They also illustrate that these primers may be useful for studying the mating system and population genetics of H. beccarii on a global scale.

  1. Novel genus-specific broad range primers for the detection of furoviruses, hordeiviruses and rymoviruses and their application in field surveys in South-East Australia.

    PubMed

    Zheng, Linda; Tang, Joe; Clover, Gerard R G; Spackman, Merrin E; Freeman, Angela J; Rodoni, Brendan C

    2015-03-01

    A number of viruses from the genera Furovirus, Hordeivirus and Rymovirus are known to infect and damage the four major temperate cereal crops, wheat, barley, sorghum and oats. Currently, there is no active testing in Australia for any of these viruses, which pose a significant biosecurity threat to the phytosanitary status of Australia's grains industry. To address this, broad spectrum PCR assays were developed to target virus species within the genera Furovirus, Hordeivirus and Rymovirus. Five sets of novel genus-specific primers were designed and tested in reverse-transcription polymerase chain reaction assays against a range of virus isolates in plant virus diagnostic laboratories in both Australia and New Zealand. Three of these assays were then chosen to screen samples in a three-year survey of cereal crops in western Victoria, Australia. Of the 8900 cereal plants screened in the survey, all were tested free of furoviruses, hordeiviruses and rymoviruses. To date, there were no published genus-specific primers available for the detection of furoviruses, hordeiviruses and rymoviruses. This study shows for the first time a broad-spectrum molecular test being used in a survey for exotic grain viruses in Australia. Results from this survey provide important evidence of the use of this method to demonstrate the absence of these viruses in Victoria, Australia. The primer pairs reported here are expected to detect a wide range of virus species within the three genera. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Effect of surface preparation on service life of top-coats applied to weathered primer paint

    Treesearch

    R. Sam Williams; Mark Knaebe; Peter Sotos

    2008-01-01

    Paint companies usually recommend that topcoats be applied to primer paint within two weeks. Unfortunately, this is not always possible. For example, onset of winter weather shortly after applying primer may delay topcoat application until spring. Scuff sanding or repriming are often recommended remedial methods for preparing a weathered primer for topcoats, but there...

  3. Primer synthesis by a eukaryotic-like archaeal primase is independent of its Fe-S cluster.

    PubMed

    Holzer, Sandro; Yan, Jiangyu; Kilkenny, Mairi L; Bell, Stephen D; Pellegrini, Luca

    2017-11-23

    DNA replication depends on primase, the specialised polymerase responsible for synthesis of the RNA primers that are elongated by the replicative DNA polymerases. In eukaryotic and archaeal replication, primase is a heterodimer of two subunits, PriS and PriL. Recently, a third primase subunit named PriX was identified in the archaeon Sulfolobus solfataricus. PriX is essential for primer synthesis and is structurally related to the Fe-S cluster domain of eukaryotic PriL. Here we show that PriX contains a nucleotide-binding site required for primer synthesis, and demonstrate equivalence of nucleotide-binding residues in PriX with eukaryotic PriL residues that are known to be important for primer synthesis. A primase chimera, where PriX is fused to a truncated version of PriL lacking the Fe-S cluster domain retains wild-type levels of primer synthesis. Our evidence shows that PriX has replaced PriL as the subunit that endows primase with the unique ability to initiate nucleic acid synthesis. Importantly, our findings reveal that the Fe-S cluster is not required for primer synthesis.

  4. Clonal structure in Ichthyobacterium seriolicida, the causative agent of bacterial haemolytic jaundice in yellowtail, Seriola quinqueradiata, inferred from molecular epidemiological analysis.

    PubMed

    Matsuyama, T; Fukuda, Y; Sakai, T; Tanimoto, N; Nakanishi, M; Nakamura, Y; Takano, T; Nakayasu, C

    2017-08-01

    Bacterial haemolytic jaundice caused by Ichthyobacterium seriolicida has been responsible for mortality in farmed yellowtail, Seriola quinqueradiata, in western Japan since the 1980s. In this study, polymorphic analysis of I. seriolicida was performed using three molecular methods: amplified fragment length polymorphism (AFLP) analysis, multilocus sequence typing (MLST) and multiple-locus variable-number tandem repeat analysis (MLVA). Twenty-eight isolates were analysed using AFLP, while 31 isolates were examined by MLST and MLVA. No polymorphisms were identified by AFLP analysis using EcoRI and MseI, or by MLST of internal fragments of eight housekeeping genes. However, MLVA revealed variation in repeat numbers of three elements, allowing separation of the isolates into 16 sequence types. The unweighted pair group method using arithmetic averages cluster analysis of the MLVA data identified four major clusters, and all isolates belonged to clonal complexes. It is likely that I. seriolicida populations share a common ancestor, which may be a recently introduced strain. © 2016 John Wiley & Sons Ltd.

  5. The effect of antimicrobial photodynamic therapy on the expression of novel methicillin resistance markers determined using cDNA-AFLP approach in Staphylococcus aureus.

    PubMed

    Hoorijani, Mohammad Neshvan; Rostami, Hosein; Pourhajibagher, Maryam; Chiniforush, Nasim; Heidari, Mansour; Pourakbari, Babak; Kazemian, Hossein; Davari, Kambiz; Amini, Vahid; Raoofian, Reza; Bahador, Abbas

    2017-09-01

    Widespread methicillin resistant Staphylococcus aureus (MRSA) and absence of effective antimicrobial agents has led to limited therapeutic options for treating MRSA infection. We aimed to evaluate the effect of antimicrobial photodynamic therapy (aPDT) on the expression of novel identified methicillin resistance markers (NIMRMs) in S. aureus using complementary DNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) approaches to address the therapeutic alternatives for MRSA infections. We used cDNA-AFLP to compare MRSA and methicillin susceptible S. aureus (MSSA) for identification of target genes implicated in methicillin resistance. To determine the sub-lethal aPDT (sPDT), MRSA and MSSA clinical isolates photosensitized with toluidine blue O (TBO), and then were irradiated with diode laser. After sPDT, the colony forming units/mL was quantified. Antimicrobial susceptibility against methicillin was assessed for cell-surviving aPDT. Effects of sPDT on the expression of NIMRMs were evaluated by real-time quantitative reverse transcription PCR. According to our results, serine hydrolase family protein (Shfp) encoding gene and a gene encoding a conserved hypothetical protein (Chp) were implicated in methicillin resistance in MRSA. sPDT reduced the minimum inhibitory concentrations of methicillin by 3-fold in MRSA. sPDT could lead to about 10- and 6.2- fold suppression of expression of the Chp and Shfp encoding genes, respectively. sPDT would lead to reduction in resistance to methicillin of MRSA in surviving cells by suppressing the expression of the Shfp and Chp encoding genes associated with methicillin resistance. This may have potential implications of aPDT for the treatment of MRSA infections. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

    PubMed

    Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

    2017-02-01

    To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

  7. Centromere pairing precedes meiotic chromosome pairing in plants.

    PubMed

    Zhang, Jing; Han, Fangpu

    2017-11-01

    Meiosis is a specialized eukaryotic cell division, in which diploid cells undergo a single round of DNA replication and two rounds of nuclear division to produce haploid gametes. In most eukaryotes, the core events of meiotic prophase I are chromosomal pairing, synapsis and recombination. To ensure accurate chromosomal segregation, homologs have to identify and align along each other at the onset of meiosis. Although much progress has been made in elucidating meiotic processes, information on the mechanisms underlying chromosome pairing is limited in contrast to the meiotic recombination and synapsis events. Recent research in many organisms indicated that centromere interactions during early meiotic prophase facilitate homologous chromosome pairing, and functional centromere is a prerequisite for centromere pairing such as in maize. Here, we summarize the recent achievements of chromosome pairing research on plants and other organisms, and outline centromere interactions, nuclear chromosome orientation, and meiotic cohesin, as main determinants of chromosome pairing in early meiotic prophase.

  8. A primer on motor vehicle air pollution.

    DOT National Transportation Integrated Search

    1973-01-01

    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  9. Best Development Practices: A Primer for Smart Growth

    EPA Pesticide Factsheets

    Best Development Practices: A Primer for Smart Growth lists specific practices to achieve development principles that mix land uses, support transportation options, protect natural systems, and provide housing choices.

  10. Comparison of three PCR primer sets for identification of vanB gene carriage in feces and correlation with carriage of vancomycin-resistant enterococci: interference by vanB-containing anaerobic bacilli.

    PubMed

    Ballard, S A; Grabsch, E A; Johnson, P D R; Grayson, M L

    2005-01-01

    We assessed the sensitivities and specificities of three previously described PCR primers on enrichment broth cultures of feces for the accurate detection of fecal carriage of vancomycin-resistant enterococci (VRE). In addition, we investigated specimens that were vanB PCR positive but VRE culture negative for the presence of other vanB-containing pathogens. Feces from 59 patients (12 patients carrying vanB Enterococcus faecium strains and 47 patients negative for VRE carriage) were cultured for 36 h in aerobic brain heart infusion (BHI) broth, anaerobic BHI (AnO(2)BHI) broth, or aerobic Enterococcosel (EC) broth. DNA was extracted from the cultures and tested for the presence of vanB by using the PCR primers of Dutka-Malen et al. (S. Dutka-Malen, S. Evers, and P. Courvalin, J. Clin. Microbiol. 33:24-27, 1995), Bell et al. (J. M. Bell, J. C. Paton, and J. Turnidge, J. Clin. Microbiol. 36:2187-2190, 1998), and Stinear et al. (T. P. Stinear, D. C. Olden, P. D. R. Johnson, J. K. Davies, and M. L. Grayson, Lancet 357:855-856, 2001). The sensitivity (specificity) of PCR compared with the results of culture on BHI, AnO(2)BHI, and EC broths were 67% (96%), 50% (94%), and 17% (100%), respectively, with the primers of Dutka-Malen et al.; 92% (60%), 92% (45%), and 92% (83%), respectively, with the primers of Bell et al.; and 92% (49%), 92% (43%), and 100% (51%) respectively, with the primers of Stinear et al. The primers of both Bell et al. and Stinear et al. were significantly more sensitive than those of Dutka-Malen et al. in EC broth (P = 0.001 and P < 0.001, respectively). The poor specificities for all primer pairs were due in part to the isolation and identification of six anaerobic gram-positive bacilli, Clostridium hathewayi (n = 3), a Clostridium innocuum-like organism (n = 1), Clostridium bolteae (n = 1), and Ruminococcus lactaris-like (n = 1), from five fecal specimens that were vanB positive but VRE culture negative. All six organisms were demonstrated to contain

  11. AFLPs Reveal Different Population Genetic Structure under Contrasting Environments in the Marine Snail Nucella lapillus L.

    PubMed Central

    Carro, Belén; Quintela, María; Ruiz, José Miguel; Barreiro, Rodolfo

    2012-01-01

    Dispersal has received growing attention in marine ecology, particularly since evidence obtained with up-to-date techniques challenged the traditional view. The dogwhelk Nucella lapillus L., a sedentary gastropod with direct development, is a good example: dispersal was traditionally assumed to be limited until studies with microsatellites disputed this idea. To shed some light on this controversy, the genetic structure of dogwhelk populations in northwest Spain was investigated with highly polymorphic AFLP markers giving special attention to the influence of hydrodynamic stress. In agreement with the expectations for a poor disperser, our results show a significant genetic structure at regional (<200 km) and areal scales (<15 km). However, the spatial genetic structure varied with wave-exposure in the present case study: IBD was evident under sheltered conditions but absent from the exposed area where genetic differentiation was stronger. Our results provide evidence that differences in wave-exposure can exert a detectable influence on the genetic structure of coastal organisms, even in species without a planktonic larva. PMID:23185435

  12. MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments

    PubMed Central

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

    2016-01-01

    Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. PMID:27154272

  13. Forest Interpreter's Primer on Fire Management.

    ERIC Educational Resources Information Center

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  14. Apparatus For Tests Of Percussion Primers

    NASA Technical Reports Server (NTRS)

    Bement, Laurence J.; Bailey, James W.; Schimmel, Morry L.

    1991-01-01

    Test apparatus and method developed to measure ignition capability of percussion primers. Closely simulates actual conditions and interfaces encountered in such applications as in munitions and rocket motors. Ignitability-testing apparatus is small bomb instrumented with pressure transducers. Sizes, shapes, and positions of bomb components and materials under test selected to obtain quantitative data on ignition.

  15. Designing for transportation management and operations : a primer.

    DOT National Transportation Integrated Search

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  16. Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

    PubMed Central

    Narihiro, Takashi; Sekiguchi, Yuji

    2011-01-01

    Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

  17. Genetic characterization of fig tree mutants with molecular markers.

    PubMed

    Rodrigues, M G F; Martins, A B G; Desidério, J A; Bertoni, B W; Alves, M C

    2012-08-06

    The fig (Ficus carica L.) is a fruit tree of great world importance and, therefore, the genetic improvement becomes an important field of research for better crops, being necessary to gather information on this species, mainly regarding its genetic variability so that appropriate propagation projects and management are made. The improvement programs of fig trees using conventional procedures in order to obtain new cultivars are rare in many countries, such as Brazil, especially due to the little genetic variability and to the difficulties in obtaining plants from gamete fusion once the wasp Blastophaga psenes, responsible for the natural pollinating, is not found in Brazil. In this way, the mutagenic genetic improvement becomes a solution of it. For this reason, in an experiment conducted earlier, fig plants formed by cuttings treated with gamma ray were selected based on their agronomic characteristics of interest. We determined the genetic variability in these fig tree selections, using RAPD and AFLP molecular markers, comparing them to each other and to the Roxo-de-Valinhos, used as the standard. For the reactions of DNA amplification, 140 RAPD primers and 12 primer combinations for AFLP analysis were used. The selections did not differ genetically between themselves and between them and the Roxo-de-Valinhos cultivar. Techniques that can detect polymorphism between treatments, such as DNA sequencing, must be tested. The phenotypic variation of plants may be due to epigenetic variation, necessitating the use of techniques with methylation-sensitive restriction enzymes.

  18. Profitability primer: a guide to profitability analysis in the electric power industry

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.

    1996-06-01

    As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to variousmore » functions and how revenues are collected and allocated.« less

  19. Robust Detection of Rare Species Using Environmental DNA: The Importance of Primer Specificity

    PubMed Central

    Wilcox, Taylor M.; McKelvey, Kevin S.; Young, Michael K.; Jane, Stephen F.; Lowe, Winsor H.; Whiteley, Andrew R.; Schwartz, Michael K.

    2013-01-01

    Environmental DNA (eDNA) is being rapidly adopted as a tool to detect rare animals. Quantitative PCR (qPCR) using probe-based chemistries may represent a particularly powerful tool because of the method’s sensitivity, specificity, and potential to quantify target DNA. However, there has been little work understanding the performance of these assays in the presence of closely related, sympatric taxa. If related species cause any cross-amplification or interference, false positives and negatives may be generated. These errors can be disastrous if false positives lead to overestimate the abundance of an endangered species or if false negatives prevent detection of an invasive species. In this study we test factors that influence the specificity and sensitivity of TaqMan MGB assays using co-occurring, closely related brook trout (Salvelinus fontinalis) and bull trout (S. confluentus) as a case study. We found qPCR to be substantially more sensitive than traditional PCR, with a high probability of detection at concentrations as low as 0.5 target copies/µl. We also found that number and placement of base pair mismatches between the Taqman MGB assay and non-target templates was important to target specificity, and that specificity was most influenced by base pair mismatches in the primers, rather than in the probe. We found that insufficient specificity can result in both false positive and false negative results, particularly in the presence of abundant related species. Our results highlight the utility of qPCR as a highly sensitive eDNA tool, and underscore the importance of careful assay design. PMID:23555689

  20. Robust detection of rare species using environmental DNA: the importance of primer specificity.

    PubMed

    Wilcox, Taylor M; McKelvey, Kevin S; Young, Michael K; Jane, Stephen F; Lowe, Winsor H; Whiteley, Andrew R; Schwartz, Michael K

    2013-01-01

    Environmental DNA (eDNA) is being rapidly adopted as a tool to detect rare animals. Quantitative PCR (qPCR) using probe-based chemistries may represent a particularly powerful tool because of the method's sensitivity, specificity, and potential to quantify target DNA. However, there has been little work understanding the performance of these assays in the presence of closely related, sympatric taxa. If related species cause any cross-amplification or interference, false positives and negatives may be generated. These errors can be disastrous if false positives lead to overestimate the abundance of an endangered species or if false negatives prevent detection of an invasive species. In this study we test factors that influence the specificity and sensitivity of TaqMan MGB assays using co-occurring, closely related brook trout (Salvelinus fontinalis) and bull trout (S. confluentus) as a case study. We found qPCR to be substantially more sensitive than traditional PCR, with a high probability of detection at concentrations as low as 0.5 target copies/µl. We also found that number and placement of base pair mismatches between the Taqman MGB assay and non-target templates was important to target specificity, and that specificity was most influenced by base pair mismatches in the primers, rather than in the probe. We found that insufficient specificity can result in both false positive and false negative results, particularly in the presence of abundant related species. Our results highlight the utility of qPCR as a highly sensitive eDNA tool, and underscore the importance of careful assay design.

  1. Development of internal COI primers to improve and extend barcoding of fruit flies (Diptera: Tephritidae: Dacini).

    PubMed

    Krosch, Matt N; Strutt, Francesca; Blacket, Mark J; Batovska, Jana; Starkie, Melissa; Clarke, Anthony R; Cameron, Stephen L; Schutze, Mark K

    2018-06-06

    Accurate species-level identifications underpin many aspects of basic and applied biology; however, identifications can be hampered by a lack of discriminating morphological characters, taxonomic expertise or time. Molecular approaches, such as DNA 'barcoding' of the cytochrome c oxidase (COI) gene, are argued to overcome these issues. However, nuclear encoding of mitochondrial genes (numts) and poor amplification success of suboptimally preserved specimens can lead to erroneous identifications. One insect group for which these molecular and morphological problems are significant are the dacine fruit flies (Diptera: Tephritidae: Dacini). We addressed these issues associated with COI barcoding in the dacines by first assessing several 'universal' COI primers against public mitochondrial genome and numt sequences for dacine taxa. We then modified a set of four primers that more closely matched true dacine COI sequence and amplified two overlapping portions of the COI barcode region. Our new primers were tested alongside universal primers on a selection of dacine species, including both fresh preserved and decades-old dry specimens. Additionally, Bactrocera tryoni mitochondrial and nuclear genomes were compared to identify putative numts. Four numt clades were identified, three of which were amplified using existing universal primers. In contrast, our new primers preferentially amplified the 'true' mitochondrial COI barcode in all dacine species tested. The new primers also successfully amplified partial barcodes from dry specimens for which full length barcodes were unobtainable. Thus we recommend these new primers be incorporated into the suites of primers used by diagnosticians and quarantine labs for the accurate identification of dacine species. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  2. The Astrobiology Primer - an Early Career Scientist Education, Outreach and Professional Development Project

    NASA Astrophysics Data System (ADS)

    Wright, K. E.; Domagal-Goldman, S. D.

    2011-12-01

    We are early-career scientists jointly leading a project to write 'The Astrobiology Primer', a brief but comprehensive introduction to astrobiology, and we are using the process of producing the document as an innovative way of strengthening the international community of early-career astrobiologists. Astrobiology is the study of the origin, evolution, distribution and future of life in our universe. It includes not just study of life on Earth, but also the potential for life to exist beyond Earth, and the development of techniques to search for such life. It therefore incorporates geological and earth sciences, life sciences, chemistry, astronomy and planetary sciences. This requires astrobiologists to integrate these different disciplines in order to address questions such as 'How did Earth and its biosphere originate?', 'How do life and the physical, chemical and geological cycles on Earth interact, and affect each other?' and so 'What does life on Earth tell us about the habitability of environments outside Earth?'. The primer will provide a brief but comprehensive introduction to the field; it will be significantly more comprehensive than a normal review paper but much shorter than a textbook. This project is an initiative run entirely by early-career scientists, for the benefit of other early-career scientists and others. All the writers and editors of the primer are graduate/post-graduate students or post-doctoral fellows, and our primary target group for the primer is other early-career scientists, although we hope and expect that the primer will also be useful far more broadly in education and outreach work. An Astrobiology Primer was first published in 2006(Ref1), written and edited by a small group of early-career astrobiologists to provide an introduction to astrobiology for other early-career scientists new to the field. It has been used not only by the target group for private study, but in formal education and outreach settings at universities and

  3. Improved Selection of Internal Transcribed Spacer-Specific Primers Enables Quantitative, Ultra-High-Throughput Profiling of Fungal Communities

    PubMed Central

    Bokulich, Nicholas A.

    2013-01-01

    Ultra-high-throughput sequencing (HTS) of fungal communities has been restricted by short read lengths and primer amplification bias, slowing the adoption of newer sequencing technologies to fungal community profiling. To address these issues, we evaluated the performance of several common internal transcribed spacer (ITS) primers and designed a novel primer set and work flow for simultaneous quantification and species-level interrogation of fungal consortia. Primer comparison and validation were predicted in silico and by sequencing a “mock community” of mixed yeast species to explore the challenges of amplicon length and amplification bias for reconstructing defined yeast community structures. The amplicon size and distribution of this primer set are smaller than for all preexisting ITS primer sets, maximizing sequencing coverage of hypervariable ITS domains by very-short-amplicon, high-throughput sequencing platforms. This feature also enables the optional integration of quantitative PCR (qPCR) directly into the HTS preparatory work flow by substituting qPCR with these primers for standard PCR, yielding quantification of individual community members. The complete work flow described here, utilizing any of the qualified primer sets evaluated, can rapidly profile mixed fungal communities and capably reconstructed well-characterized beer and wine fermentation fungal communities. PMID:23377949

  4. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  5. Recombination of polynucleotide sequences using random or defined primers

    DOEpatents

    Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin H; Giver, Lorraine J.

    2000-01-01

    A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

  6. Recombination of polynucleotide sequences using random or defined primers

    DOEpatents

    Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin; Giver, Lorraine J.

    2001-01-01

    A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

  7. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    PubMed

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

  8. Effectiveness of the standard and an alternative set of Streptococcus pneumoniae multi locus sequence typing primers.

    PubMed

    Adamiak, Paul; Vanderkooi, Otto G; Kellner, James D; Schryvers, Anthony B; Bettinger, Julie A; Alcantara, Joenel

    2014-06-03

    Multi-locus sequence typing (MLST) is a portable, broadly applicable method for classifying bacterial isolates at an intra-species level. This methodology provides clinical and scientific investigators with a standardized means of monitoring evolution within bacterial populations. MLST uses the DNA sequences from a set of genes such that each unique combination of sequences defines an isolate's sequence type. In order to reliably determine the sequence of a typing gene, matching sequence reads for both strands of the gene must be obtained. This study assesses the ability of both the standard, and an alternative set of, Streptococcus pneumoniae MLST primers to completely sequence, in both directions, the required typing alleles. The results demonstrated that for five (aroE, recP, spi, xpt, ddl) of the seven S. pneumoniae typing alleles, the standard primers were unable to obtain the complete forward and reverse sequences. This is due to the standard primers annealing too closely to the target regions, and current sequencing technology failing to sequence the bases that are too close to the primer. The alternative primer set described here, which includes a combination of primers proposed by the CDC and several designed as part of this study, addresses this limitation by annealing to highly conserved segments further from the target region. This primer set was subsequently employed to sequence type 105 S. pneumoniae isolates collected by the Canadian Immunization Monitoring Program ACTive (IMPACT) over a period of 18 years. The inability of several of the standard S. pneumoniae MLST primers to fully sequence the required region was consistently observed and is the result of a shift in sequencing technology occurring after the original primers were designed. The results presented here introduce clear documentation describing this phenomenon into the literature, and provide additional guidance, through the introduction of a widely validated set of alternative

  9. MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments.

    PubMed

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

    2016-07-08

    Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Novel primers for detection of genetically diverse virulent Agrobacterium tumefaciens bv1 strains

    USDA-ARS?s Scientific Manuscript database

    Novel primers were developed to amplify a 243 bp fragment of an intergenic region between gene5 and tms2 on the T-DNA of Agrobacterium tumefaciens. These primers exhibit 100% positive correlation with strain virulence, 100% negative correlation with avirulence and did not generate extraneous bands,...

  11. Validation of a PCR-based method for the detection of various rendered materials in feedstuffs using a forensic DNA extraction kit.

    PubMed

    Myers, Michael J; Yancy, Haile F; Araneta, Michael; Armour, Jennifer; Derr, Janice; Hoostelaere, Lawrence A D; Farmer, Doris; Jackson, Falana; Kiessling, William M; Koch, Henry; Lin, Huahua; Liu, Yan; Mowlds, Gabrielle; Pinero, David; Riter, Ken L; Sedwick, John; Shen, Yuelian; Wetherington, June; Younkins, Ronsha

    2006-01-01

    A method trial was initiated to validate the use of a commercial DNA forensic kit to extract DNA from animal feed as part of a PCR-based method. Four different PCR primer pairs (one bovine pair, one porcine pair, one ovine primer pair, and one multispecies pair) were also evaluated. Each laboratory was required to analyze a total of 120 dairy feed samples either not fortified (control, true negative) or fortified with bovine meat and bone meal, porcine meat and bone meal (PMBM), or lamb meal. Feeds were fortified with the animal meals at a concentration of 0.1% (wt/wt). Ten laboratories participated in this trial, and each laboratory was required to evaluate two different primer pairs, i.e., each PCR primer pair was evaluated by five different laboratories. The method was considered to be validated for a given animal source when three or more laboratories achieved at least 97% accuracy (29 correct of 30 samples for 96.7% accuracy, rounded up to 97%) in detecting the fortified samples for that source. Using this criterion, the method was validated for the bovine primer because three laboratories met the criterion, with an average accuracy of 98.9%. The average false-positive rate was 3.0% in these laboratories. A fourth laboratory was 80% accurate in identifying the samples fortified with bovine meat and bone meal. A fifth laboratory was not able to consistently extract the DNA from the feed samples and did not achieve the criterion for accuracy for either the bovine or multispecies PCR primers. For the porcine primers, the method was validated, with four laboratories meeting the criterion for accuracy with an average accuracy of 99.2%. The fifth laboratory had a 93.3% accuracy outcome for the porcine primer. Collectively, these five laboratories had a 1.3% false-positive rate for the porcine primer. No laboratory was able to meet the criterion for accuracy with the ovine primers, most likely because of problems with the synthesis of the primer pair; none of the

  12. A Primer on Building Teacher Evaluation Instruments.

    ERIC Educational Resources Information Center

    Bitner, Ted; Kratzner, Ron

    This paper presents a primer on building a scientifically oriented teacher evaluation instrument. It stresses the importance of accurate measures and accepts the presupposition that scientific approaches provide the most accurate measures of student teacher performance. The paper discusses the scientific concepts of validity and reliability, and…

  13. A primer on water

    USGS Publications Warehouse

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  14. A Primer on Brain Imaging in Developmental Psychopathology: What Is It Good For?

    ERIC Educational Resources Information Center

    Pine, Daniel S.

    2006-01-01

    This primer introduces a Special Section on brain imaging, which includes a commentary and 10 data papers presenting applications of brain imaging to questions on developmental psychopathology. This primer serves two purposes. First, the article summarizes the strength and weaknesses of various brain-imaging techniques typically employed in…

  15. Considerations for high occupancy vehicle (HOV) to high occupancy toll (HOT) lanes conversions primer.

    DOT National Transportation Integrated Search

    2007-09-01

    This primer presents key issues and challenges related to the conversion of high occupancy vehicle (HOV) lanes to high occupancy toll (HOT) lanes. The primer is intended for community leaders, administrators, : the public, and other stakeholders resp...

  16. COMplementary Primer ASymmetric PCR (COMPAS-PCR) Applied to the Identification of Salmo salar, Salmo trutta and Their Hybrids

    PubMed Central

    2016-01-01

    Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658

  17. Design of a Combined Ballistic Simulator and Primer Force Experimental Fixture

    DTIC Science & Technology

    2015-08-01

    preload bolt and breech, and between the breech and chamber, were found to be too loose. When heavy grease or Teflon tape was used to tighten the...increase the difficulty of removing and tightening the breech. The preload bolt does not have to be removed between firing and in future designs could use... tightened it could loosen the primer plate, so left-handed threads were machined on the primer plate. The ballistic simulator fixture was occasionally

  18. Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

    NASA Astrophysics Data System (ADS)

    D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

    2018-02-01

    Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

  19. Novel nuclear intron-spanning primers for Arecaceae evolutionary biology.

    PubMed

    Bacon, Christine D; Feltus, F Alex; Paterson, Andrew H; Bailey, C Donovan

    2008-01-01

    In this study, 96 nuclear 'conserved intron-scanning primers' were screened across subfamilies the Arecaceae (palms) for potential use in research focused on palm evolutionary biology. Primers were evaluated based on their ability to amplify single polymerase chain reaction products in Arecaceae, the clarity of sequencing reads, and the interspecific variability observed. Ultimately, the results suggest that: (i) seven of the loci are likely to be suitable when comparing non-Arecaceae outgroups and Arecaceae ingroups; (ii) seven loci may be of use when comparing subfamilies of Arecaceae; and (iii) four of the loci may be of use when comparing closely related genera. © 2007 Blackwell Publishing Ltd No claim to original US government works.

  20. Base pairing and base mis-pairing in nucleic acids

    NASA Technical Reports Server (NTRS)

    Wang, A. H. J.; Rich, A.

    1986-01-01

    In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.

  1. Genetic characterization and barcoding of taxa in the genus Wolffia Horkel ex Schleid. (Lemnaceae) as revealed by two plastidic markers and amplified fragment length polymorphism (AFLP).

    PubMed

    Bog, Manuela; Schneider, Philipp; Hellwig, Frank; Sachse, Svea; Kochieva, Elena Z; Martyrosian, Elena; Landolt, Elias; Appenroth, Klaus-J

    2013-01-01

    The genus Wolffia of the duckweed family (Lemnaceae) contains the smallest flowering plants. Presently, 11 species are recognized and categorized mainly on the basis of morphology. Because of extreme reduction of structure of all species, molecular methods are especially required for barcoding and identification of species and clones of this genus. We applied AFLP combined with Bayesian analysis of population structure to 66 clones covering all 11 species. Nine clusters were identified: (1) W. angusta and W. microscopica (only one clone), (2) W. arrhiza, (3) W. cylindracea (except one clone that might be a transition form), (4) W. australiana, (5) W. globosa, (6) W. globosa, W. neglecta, and W. borealis, (7) W. brasiliensis, and W. columbiana, (8) W. columbiana, (9) W. elongata. Furthermore, we investigated the sequences of plastidic regions rps16 (54 clones) and rpl16 (55 clones), and identified the following species: W. angusta, W. australiana, W. brasiliensis, W. cylindracea, W. elongata, W. microscopica, and W. neglecta. Wolffia globosa has been separated into two groups by both methods. One group which consists only of clones from North America and East Asia was labelled here "typical W. globosa". The other group of W. globosa, termed operationally "W. neglecta", contains also clones of W. neglecta and shows high similarity to W. borealis. None of the methods recognized W. borealis as a distinct species. Although each clone could be characterized individually by AFLP and plastidic sequences, and most species could be bar-coded, the presently available data are not sufficient to identify all taxa of Wolffia.

  2. The partial sequence of RNA 1 of the ophiovirus Ranunculus white mottle virus indicates its relationship to rhabdoviruses and provides candidate primers for an ophiovirus-specific RT-PCR test.

    PubMed

    Vaira, A M; Accotto, G P; Costantini, A; Milne, R G

    2003-06-01

    A 4018 nucleotide sequence was obtained for RNA 1 of Ranunculus white mottle virus (RWMV), genus Ophiovirus, representing an incomplete ORF of 1339 aa. Amino acid sequence analysis revealed significant similarities with RNA polymerases of viruses in the family Rhabdoviridae and a conserved domain of 685 aa, corresponding to the RdRp domain of those in the order Mononegavirales. Phylogenetic analysis indicated that the genus Ophiovirus is not related to the genus Tenuivirus or the family Bunyaviridae, with which it has been linked, and probably deserves a special taxonomic position, within a new family. A pair of degenerate primers was designed from a consensus sequence obtained from a relatively conserved region in the RNA 1 of two members of the genus, Citrus psorosis virus (CPsV) and RWMV. The primers, used in RT-PCR experiments, amplified a 136 bp DNA fragment from all the three recognized members of the genus, i.e. CPsV, RWMV and Tulip mild mottle mosaic virus (TMMMV) and from two tentative ophioviruses from lettuce and freesia. The amplified DNAs were sequenced and compared with the corresponding sequences of CPsV and RWMV and phylogenetic relationships were evaluated. Assays using extracts from plants infected by viruses belonging to the genera Tospovirus, Tenuivirus, Rhabdovirus and Varicosavirus indicated that the primers are genus-specific.

  3. Chapter 17. Extension of endogenous primers as a tool to detect micro-RNA targets.

    PubMed

    Vatolin, Sergei; Weil, Robert J

    2008-01-01

    Mammalian cells express a large number of small, noncoding RNAs, including micro-RNAs (miRNAs), that can regulate both the level of a target mRNA and the protein produced by the target mRNA. Recognition of miRNA targets is a complicated process, as a single target mRNA may be regulated by several miRNAs. The potential for combinatorial miRNA-mediated regulation of miRNA targets complicates diagnostic and therapeutic applications of miRNAs. Despite significant progress in understanding the biology of miRNAs and advances in computational predictions of miRNA targets, methods that permit direct physical identification of miRNA-mRNA complexes in eukaryotic cells are still required. Several groups have utilized coimmunoprecipitation of RNA associated with a protein(s) that is part of the RNA silencing macromolecular complex. This chapter describes a detailed but straightforward strategy that identifies miRNA targets based on the assumption that small RNAs base paired with a complementary target mRNA can be used as a primer to synthesize cDNA that may be used for cloning, identification, and functional analysis.

  4. Primer Vector Optimization: Survey of Theory, New Analysis and Applications

    NASA Technical Reports Server (NTRS)

    Guzman, J. J.; Mailhe, L. M.; Schiff, C.; Hughes, S. P.; Folta, D. C.

    2002-01-01

    In this paper, a summary of primer vector theory is presented. The applicability of primer vector theory is examined in an effort to understand when and why the theory can fail. For example, since the Calculus of Variations is based on "small" variations, singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyse that employ small variations. Two examples, the initialization of an orbit and a line of apsides rotation, are presented. Recommendations, future work, and the possible addition of other optimization techniques are also discussed.

  5. Metabolomics: A Primer.

    PubMed

    Liu, Xiaojing; Locasale, Jason W

    2017-04-01

    Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Primer and interviews: Molecular mechanisms of morphological evolution

    PubMed Central

    Kiefer, Julie C

    2010-01-01

    The beauty of the developing embryo, and the awe that it inspires, lure many scientists into the field of developmental biology. What compels cells to divide, migrate, and morph into a being with a complex body plan? Evolutionary developmental biologists hold similar fascinations, with dynamics that take place on a grander timescale. How do phenotypic traits diverge over evolutionary time? This primer illustrates how a deep understanding of the basic principles that underlie developmental biology have changed how scientists think about the evolution of body form. The primer culminates in a conversation with David Stern, PhD, and Michael Shapiro, PhD, who discuss current topics in morphological evolution, why the field should be of interest to classic developmental biologists, and what lies ahead. Developmental Dynamics 239:3497–3505, 2010. © 2010 Wiley-Liss, Inc. PMID:21069831

  7. Hydrology of Central Florida Lakes - A Primer

    USGS Publications Warehouse

    Schiffer, Donna M.

    1998-01-01

    INTRODUCTION Lakes are among the most valued natural resources of central Florida. The landscape of central Florida is riddled with lakeswhen viewed from the air, it almost seems there is more water than land. Florida has more naturally formed lakes than other southeastern States, where many lakes are created by building dams across streams. The abundance of lakes on the Florida peninsula is a result of the geology and geologic history of the State. An estimated 7,800 lakes in Florida are greater than 1 acre in surface area. Of these, 35 percent are located in just four counties (fig. 1): Lake, Orange, Osceola, and Polk (Hughes, 1974b). Lakes add to the aesthetic and commercial value of the area and are used by many residents and visitors for fishing, boating, swimming, and other types of outdoor recreation. Lakes also are used for other purposes such as irrigation, flood control, water supply, and navigation. Residents and visitors commonly ask questions such as Whyare there so many lakes here?, Why is my lake drying up (or flooding)?, or Is my lake spring-fed? These questions indicate that the basic hydrology of lakes and the interaction of lakes with ground water and surface water are not well understood by the general population. Because of the importance of lakes to residents of central Florida and the many questions and misconceptions about lakes, this primer was prepared by the U.S. Geological Survey (USGS) in cooperation with the St. Johns River Water Management District and the South Florida Water Management District. The USGS has been collecting hydrologic data in central Florida since the 1920s, obtaining valuable information that has been used to better understand the hydrology of the water resources of central Florida, including lakes. In addition to data collection, as of 1994, the USGS had published 66 reports and maps on central Florida lakes (Garcia and Hoy, 1995). The main purpose of this primer is to describe the hydrology of lakes in central

  8. cDNA-AFLP analysis of differential gene expression related to cell chemotactic and encystment of Azospirillum brasilense.

    PubMed

    Li, Huamin; Cui, Yanhua; Wu, Lixian; Tu, Ran; Chen, Sanfeng

    2011-12-20

    Our previous study indicated org35 was involved in chemotaxis and interacted with nitrogen fixation transcriptional activator NifA via PAS domain. In order to reveal the role of org35 in nitrogen regulation, the downstream target genes of org35 were identified. We here report differentially expressed genes in org35 mutants comparing with wild type Sp7 by means of cDNA-AFLP. Four up-regulated transcript-derived fragments (TDFs) homologues of chemotaxis transduction proteins were found, including CheW, methyl-accepting chemotaxis protein and response regulator CheY-like receiver. Three distinct TDFs (AB46, AB58 and AB63) were similar to PHB de-polymerase C-terminus, cell shape-determining protein and flagellin domain protein. And 11 TDFs showed similarities with signal transduction proteins, including homologous protein of the nitrogen regulation protein NtrY and nitrate/nitrite response regulator protein NarL. These data suggested that the Azospirillum brasilense org35 was a multi-effecter and involved in chemotaxis, cyst development and regulation of nitrogen fixation. Copyright © 2010 Elsevier GmbH. All rights reserved.

  9. Laser Doppler velocimetry primer

    NASA Technical Reports Server (NTRS)

    Bachalo, William D.

    1985-01-01

    Advanced research in experimental fluid dynamics required a familiarity with sophisticated measurement techniques. In some cases, the development and application of new techniques is required for difficult measurements. Optical methods and in particular, the laser Doppler velocimeter (LDV) are now recognized as the most reliable means for performing measurements in complex turbulent flows. And such, the experimental fluid dynamicist should be familiar with the principles of operation of the method and the details associated with its application. Thus, the goals of this primer are to efficiently transmit the basic concepts of the LDV method to potential users and to provide references that describe the specific areas in greater detail.

  10. Reforming Science Instruction in California: A Primer

    ERIC Educational Resources Information Center

    EdSource, 2017

    2017-01-01

    As schools across the state implement the Next Generation Science Standards, this EdSource primer provides an easy-to-read guide for parents and other community members to understand the rationale for the standards and their potential to affect science instruction in California schools. California adopted the Next Generation Science Standards, or…

  11. Adult Learning Theory: A Primer. Information Series.

    ERIC Educational Resources Information Center

    Baumgartner, Lisa M.; Lee, Ming-Yeh; Birden, Susan; Flowers, Doris

    The purpose of this monograph is to serve as a primer for practitioners on the foundational theories of adult learning. It begins with an explanation two lenses through which learning theory is viewed: behaviorism and constructivism. The next section defines andragogy and delineates Knowles's five assumptions about adult learners. This is followed…

  12. Spatial patterns of AFLP diversity in Bulbophyllum occultum (Orchidaceae) indicate long-term refugial isolation in Madagascar and long-distance colonization effects in La Réunion.

    PubMed

    Jaros, U; Fischer, G A; Pailler, T; Comes, H P

    2016-05-01

    Bulbophyllum occultum, an epiphytic orchid mainly distributed in the rainforests of (north)eastern Madagascar and La Réunion, represents an interesting model case for testing the effects of anthropogenic vs historical (e.g., climate induced) habitat isolation and long-distance colonization on the genetic structure of plant species with disjunct distributions in the Madagascan region. To this aim, we surveyed amplified fragment length polymorphisms (AFLPs) across 13 populations in Madagascar and nine in La Réunion (206 individuals in total). We found overall high levels of population subdivision (Φ(PT)=0.387) and low within-population diversity (H(E), range: 0.026-0.124), indicating non-equilibrium conditions in a mainly selfing species. There was no impact of recent deforestation (Madagascar) or habitat disturbance (La Réunion) detectable on AFLP diversity. K-means clustering and BARRIER analyses identified multiple gene pools and several genetic breaks, both within and among islands. Inter-island levels of population genetic diversity and subdivision were similar, whereby inter-individual divergence in flower colour explained a significant part of gene pool divergence in La Réunion. Our results suggest that (i) B. occultum persisted across multiple isolated ('refugial') regions along the eastern rainforest corridor of Madagascar over recent climatic cycles and (ii) populations in La Réunion arose from either single or few independent introductions from Madagascar. High selfing rates and sufficient time for genetic drift likely promoted unexpectedly high population genetic and phenotypic (flower colour) differentiation in La Réunion. Overall, this study highlights a strong imprint of history on the genetic structure of a low-gene-dispersing epiphytic orchid from the Madagascan region.

  13. Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft

    DTIC Science & Technology

    2011-08-17

    system  Significant hexavalent chrome reduction in finish system  Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT

  14. Evaluation of revised polymerase chain reaction primers for more inclusive quantification of ammonia-oxidizing archaea and bacteria.

    PubMed

    Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A

    2015-04-01

    Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  15. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forwardmore » or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  16. Simultaneous Genotyping of the rs4762 and rs699 Polymorphisms in Angiotensinogen Gene and Correlation with Iranian CAD Patients with Novel Hexa-primer ARMS-PCR

    PubMed Central

    KHATAMI, Mehri; HEIDARI, Mohammad Mehdi; HADADZADEH, Mehdi; SCHEIBER-MOJDEHKAR, Barbara; BITARAF SANI, Morteza; HOUSHMAND, Massoud

    2017-01-01

    Background: A significant role of Renin-angiotensin system (RAS) genetic variants in the pathogenesis of essential hypertension and cardiovascular diseases has been proved. This study aimed to develop a new, fast and cheap method for the simultaneous detection of two missense single nucleotide polymorphisms (T207M or rs4762 and M268T orrs699) of angiotensinogen (AGT) in single-step Multiplex Hexa-Primer Amplification Refractory Mutation System - polymerase chain reaction (H-ARMS-PCR). Methods: In this case-control study, 148 patients with coronary artery disease (CAD) and 135 controls were included. The patients were referred to cardiac centers in Afshar Hospital (Yazd, Iran) from 2012 to 2015. Two sets of inner primer (for each SNP) and one set outer primer pairs were designed for genotyping of rs4762 and rs699 in single tube H-ARMS-PCR. Direct sequencing of all samples was also performed to assess the accuracy of this method. DNA sequencing method validated the results of single tube H-ARMS-PCR. Results: We found full accordance for genotype adscription by sequencing method. The frequency of the AGT T521 and C702 alleles was significantly higher in CAD patients than in the control group (OR: 0.551, 95% CI: 0.359–0.846, P=0.008 and OR: 0.629, 95% CI: 0.422–0.936, P=0.028, respectively). Conclusion: This is the first work describing a rapid, low-cost, high-throughput simultaneous detection of rs4762 and rs699 polymorphisms in AGT gene, used in large clinical studies. PMID:28828324

  17. Universal primers for amplification of the complete mitochondrial control region in marine fish species.

    PubMed

    Cheng, Y Z; Xu, T J; Jin, X X; Tang, D; Wei, T; Sun, Y Y; Meng, F Q; Shi, G; Wang, R X

    2012-01-01

    Through multiple alignment analysis of mitochondrial tRNA-Thr and tRNA-Phe sequences from 161 fishes, new universal primers specially targeting the entire mitochondrial control region were designed. This new primer set successfully amplified the expected PCR products from various kinds of marine fish species, belonging to various families, and the amplified segments were confirmed to be the control region by sequencing. These primers provide a useful tool to study the control region diversity in economically important fish species, the possible mechanism of control region evolution, and the functions of the conserved motifs in the control region.

  18. Metastable Intermolecular Composites (MIC) Primers for Small Caliber Cartridges and Cartridge Actuated Devices

    DTIC Science & Technology

    2009-07-01

    24 iii ACRONYMS AND ABBREVIATIONS ATF Armaments Technology Facility ATK Alliant Techsystems, Inc. ARDEC Armament Research...Technology Facility ( ATF ) firings there, and was instrumental in producing the primers and loading the cartridges needed for the supplemental...and CADs known as the percussion primer. The novel properties associated with nanostructure materials have resulted in the development of thermite

  19. A multiplex primer design algorithm for target amplification of continuous genomic regions.

    PubMed

    Ozturk, Ahmet Rasit; Can, Tolga

    2017-06-19

    Targeted Next Generation Sequencing (NGS) assays are cost-efficient and reliable alternatives to Sanger sequencing. For sequencing of very large set of genes, the target enrichment approach is suitable. However, for smaller genomic regions, the target amplification method is more efficient than both the target enrichment method and Sanger sequencing. The major difficulty of the target amplification method is the preparation of amplicons, regarding required time, equipment, and labor. Multiplex PCR (MPCR) is a good solution for the mentioned problems. We propose a novel method to design MPCR primers for a continuous genomic region, following the best practices of clinically reliable PCR design processes. On an experimental setup with 48 different combinations of factors, we have shown that multiple parameters might effect finding the first feasible solution. Increasing the length of the initial primer candidate selection sequence gives better results whereas waiting for a longer time to find the first feasible solution does not have a significant impact. We generated MPCR primer designs for the HBB whole gene, MEFV coding regions, and human exons between 2000 bp to 2100 bp-long. Our benchmarking experiments show that the proposed MPCR approach is able produce reliable NGS assay primers for a given sequence in a reasonable amount of time.

  20. Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.

    PubMed

    Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce

    2009-01-01

    Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  1. School Safety & Youth Violence: A Legal Primer.

    ERIC Educational Resources Information Center

    Bailey, Kirk A.; Ross, Catherine J.

    This legal primer on violence in schools addresses the responsibility of school officials to respond to undisciplined youths whose behavior threatens the welfare and safety of other children in attendance. It is broken down into sections that provide a brief overview of the key rules and guidelines for school officials and teachers in each topic…

  2. Phylogeny and genetic structure of Erophaca (Leguminosae), a East-West Mediterranean disjunct genus from the Tertiary.

    PubMed

    Casimiro-Soriguer, Ramón; Talavera, María; Balao, Francisco; Terrab, Anass; Herrera, Javier; Talavera, Salvador

    2010-07-01

    The genus Erophaca comprises a single herbaceous perennial species with two subspecies distributed at opposite ends of the Mediterranean region. We used nrDNA ITS to investigate the phylogeny of the genus, and AFLP markers (9 primers, 20 populations) to establish the genetic relationship between subspecies, and among populations at each side of the Gibraltar Strait. According to nrDNA ITS, Erophaca is monophyletic, old (Miocene), and sister to the Astragalean clade. Life form attributes and molecular clock estimates suggest that Erophaca is one of the many Tertiary relicts that form part of the present Mediterranean flora. Within the occidental subspecies, European plants are clearly derived from North-African populations (Morocco) which, despite being rare on a regional scale, present the highest genetic diversity (as estimated by private and rare fragment numbers). In general, genetic diversity decreased with increasing distance from Morocco. AFLP and nrDNA ITS markers evidenced that the Eastern and the Western subspecies are genetically distinct. Possible causes for their disjunct distribution are discussed. Copyright 2010 Elsevier Inc. All rights reserved.

  3. Impact of primer dimers and self-amplifying hairpins on reverse transcription loop-mediated isothermal amplification detection of viral RNA

    DOE PAGES

    Meagher, Robert J.; Priye, Aashish; Light, Yooli K.; ...

    2018-03-27

    Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less

  4. Impact of primer dimers and self-amplifying hairpins on reverse transcription loop-mediated isothermal amplification detection of viral RNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meagher, Robert J.; Priye, Aashish; Light, Yooli K.

    Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less

  5. Development of Species-specific Primers for Rapid Detection of Phellinus linteus and P. baumii

    PubMed Central

    Kim, Mun-Ok; Kim, Gi-Young; Nam, Byung-Hyouk; Jin, Cheng-Yun; Lee, Ki-Won; Park, Jae-Min; Lee, Sang-Joon

    2005-01-01

    Genus Phellinus taxonomically belongs to Aphyllophorales and some species of this genus have been used as a medicinal ingredients and Indian folk medicines. Especially, P. linteus and morphological-related species are well-known medicinal fungi that have various biological activities such as humoral and cell-mediated, anti-mutagenic, and anti-cancer activities. However, little is known about the rapid detection for complex Phellinus species. Therefore, this study was carried out to develop specific primers for the rapid detection of P. linteus and other related species. Designing the species-specific primers was done based on internal transcribed spacer sequence data. Each primer set detected specifically P. linteus (PL2/PL5R) and P. baumii (PB1/PB4R). These primer sets could be useful for the rapid detection of specific-species among unidentified Phellinus species. Moreover, restriction fragment length polymorphism analysis of the ITS region with HaeIII was also useful for clarifying the relationship between each 5 Phellinus species. PMID:24049482

  6. Formaldehyde as hypothetical primer of biohomochirality

    NASA Astrophysics Data System (ADS)

    Goldanskii, Vitalii I.

    1996-07-01

    One of the most intriguing and crucial problems of the prebiotic evolution and the origin of life is the explanation of the origin of biohomochirality. A scheme of conversions originated by formaldehyde (FA) as hypothetical primer of biohomochirality is proposed. The merit of FA as executor of this function is based -inter alia - on the distinguished role of FA as one of the earliest and simplest molecules in both warm, terrestrial and cold, extraterrestrial scenarios of the origin of life. The confirmation of the role of FA as primer of biohomochirality would support the option of an RNA world as an alternative to the protein world. The suggested hypothesis puts forward for the first time a concrete sequence of chemical reactions which can lead to biohomochirality. The spontaneous breaking of the mirror symmetry is secured by the application of the well-known Frank scheme (combination of autocatalysis and ``annihilation'' of L and D enantiomers) to the series of interactions of FA ``trimers'' (i.e. C3H6O3 compounds) of (aaa), (apa) and (app) types, where the monomeric groups (a) means ``achirons'' (a=CHn, n>=2 and C=M, M=C,O) and (p) mean ``prochirons'' (p=HC*OM, M=H,C).

  7. Issues Primer. EEE708 Negotiated Study Program.

    ERIC Educational Resources Information Center

    Jennings, Leonie

    This issues primer is structured around a series of 20 contemporary concerns in the changing world of work and training in Australia in the early 1990s. It is part of the study materials for the one-semester distance education unit, Negotiated Study Program, in the Open Campus Program at Deakin University (Australia). Information on each issue is…

  8. Matrilineage differentiation of the genus Tetragonisca using mitochondrial DNA markers and the polymerase chain reaction-restriction fragment length polymorphism technique.

    PubMed

    Santos, S A; Bronzato, A R; Moreira, B M T; Araujo, K F; Ronqui, L; Mangolin, C A; Toledo, V A A; Ruvolo-Takasusuki, M C C

    2015-10-21

    The Meliponinae are important pollinators of plant species, and one of the most managed species is Tetragonisca angustula. Initially, two subspecies were identified in T. angustula: T. angustula angustula and T. angustula fiebrigi. Subsequently, T. a. fiebrigi was considered a species, based on the coloration of its mesepisternum. The objective of the present study was to obtain genetic markers that could differentiate the two species by amplifying regions of mitochondrial DNA and conducting polymerase chain reaction-restriction fragment length polymorphism analysis. Worker bees were collected in three Brazilian states: Paraná (Maringá, Altônia, and Foz do Iguaçu), São Paulo (Dracena, São Carlos, and Santa Cruz do Rio Pardo), and Rondônia (Ariquemes). Ten pairs of insect heterologous primers were tested and four were used (primer pair 1, ND2 and COI; primer pair 2, COI; primer pair 8, 16S and 12S; and primer pair 9, COII). For the restriction analysis, 13 enzymes were tested: EcoRI, EcoRV, HindIII, HinfI, RsaI, PstI, XbaI, HaeIII, ClaI, XhoI, BglII, PvuII, and ScaI. Markers were obtained (primer pair 8 cleaved with EcoRV and XbaI and primer pair 9 cleaved with HaeIII, RsaI, and XbaI) that enabled matrilineage identification in the nests studied, which confirmed that hybridization could occur between both Tetragonisca species. The beginning of speciation was probably recent, and secondary contact has resulted in crosses between T. angustula females and T. fiebrigi males. Because of this hybridization, it would be appropriate to consider them as two subspecies of T. angustula.

  9. Improved primer for bonding polyurethane adhesives to metals

    NASA Technical Reports Server (NTRS)

    Constanza, L. J.

    1969-01-01

    Primer ensures effective bonding integrity of polyurethane adhesives on metal surfaces at temperatures ranging from minus 423 degrees to plus 120 degrees F. It provides greater metal surface protection and bond strengths over this temperature range than could be attained with other adhesive systems.

  10. Defense Primer: The National Defense Budget Function (050)

    DTIC Science & Technology

    2017-03-17

    in parenthesis). This defense primer addresses the National Defense Budget (050), which is frequently used to explain trends in military spending...but which also includes some activities not conducted by the Department of Defense. What Is the Purpose of the Budget Function System? The budget

  11. A Brief Taxometrics Primer

    PubMed Central

    Beauchaine, Theodore P.

    2009-01-01

    Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

  12. Invading stacking primer: A trigger for high-efficiency isothermal amplification reaction with superior selectivity for detecting microRNA variants.

    PubMed

    Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da

    2016-07-15

    Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Primer for identifying cold-water refuges to protect and restore thermal diversity in riverine landscapes

    EPA Science Inventory

    EPA recently released a primer that provides guidance to Region 10 Tribes, States, and local watershed community groups to support the identification, protection, and restoration of critical cold water refuges for the protection of salmonids. This primer will assist these entiti...

  14. [Effect of a chemical primer on the bond strength of a zirconia ceramic with self-adhesive resin cement].

    PubMed

    Zhang, Hong; Jing, Ye; Nie, Rongrong; Meng, Xiangfeng

    2015-10-01

    To evaluate the bond strength and durability of a self-adhesive resin cement with a zirconia ceramic pretreated by a zirconia primer. Zirconia ceramic (Vita Inceram YZ) plates with a thickness of 2.5 mm were fired, polished, and then cleaned. Half of the polished ceramic plates were sandblasted with 50 μm alumina particles at 0.3 MPa for 20 s. The surface compound weight ratios were measured via X-ray fluorescence microscopy. The polished and sandblasted ceramic plates were directly bonded with self-adhesive resin cement (Biscem) or were pretreated by a zirconia primer (Z Primer Plus) before bonding with Biscem. The specimens of each test group were divided into two subgroups (n=10) and subjected to the shear test after 0 and 10,000 thermal cycles. The data were analyzed via three-way ANOVA. After air abrasion, 8.27% weight ratio of alumina attached to the zirconia surface. Compared with air abrasion, primer treatment more significantly improved the primary resin bond strength of the zirconia ceramic. The primary resin bond strength of the zirconia ceramic with no primer treatment was not affected by thermocycling (P>0.05). However, the primary resin bond strength of the zirconia ceramic with primer treatment was significantly decreased by thermocycling (P<0.05). Primer treatment can improve the primary resin bond strengths of zirconia ceramics. However, the bond interface of the primer is not stable and rapidly degraded during thermocycling.

  15. Identification and characterization of the WRKY transcription factor family in Pinus monticola.

    PubMed

    Liu, Jun-Jun; Ekramoddoullah, Abul K M

    2009-01-01

    The WRKY gene family represents an ancient and highly complex group of transcription factors involved in signal transduction pathways of numerous plant developmental processes and host defense response. Up to now, most WRKY proteins have been identified in a few angiosperm species. Identification of WRKY genes in a conifer species would facilitate a comprehensive understanding of the evolutionary and function-adaptive process of this superfamily in plants. We performed PCR on genomic DNA to clone WRKY sequences from western white pine (Pinus monticola), one of the most valuable conifer species endangered by white pine blister rust (Cronartium ribicola). In total, 83 P. monticola WRKY (PmWRKY) sequences were identified using degenerate primers targeted to the WRKY domain. A phylogenetic analysis revealed that PmWRKY members fell into four major groups (1, 2a+2b, 2c, and 2d+2e) described in Arabidopsis and rice. Because of high genetic diversity of the PmWRKY family, a modified AFLP method was used to detect DNA polymorphism of this gene family. Polymorphic fragments accounted for 17%-35% of total PCR products in the AFLP profiles. Among them, one WRKY AFLP marker was linked to the major resistance gene (Cr2) against C. ribicola. The results of this study provide basic genomic information for a conifer WRKY gene family, which will pave the way for elucidating gene evolutionary mechanisms in plants and unveiling the precise roles of PmWRKY in conifer development and defense response.

  16. TSUNAMI Primer: A Primer for Sensitivity/Uncertainty Calculations with SCALE

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rearden, Bradley T; Mueller, Don; Bowman, Stephen M

    2009-01-01

    This primer presents examples in the application of the SCALE/TSUNAMI tools to generate k{sub eff} sensitivity data for one- and three-dimensional models using TSUNAMI-1D and -3D and to examine uncertainties in the computed k{sub eff} values due to uncertainties in the cross-section data used in their calculation. The proper use of unit cell data and need for confirming the appropriate selection of input parameters through direct perturbations are described. The uses of sensitivity and uncertainty data to identify and rank potential sources of computational bias in an application system and TSUNAMI tools for assessment of system similarity using sensitivity andmore » uncertainty criteria are demonstrated. Uses of these criteria in trending analyses to assess computational biases, bias uncertainties, and gap analyses are also described. Additionally, an application of the data adjustment tool TSURFER is provided, including identification of specific details of sources of computational bias.« less

  17. Molecular Diagnosis of Malaria by Photo-Induced Electron Transfer Fluorogenic Primers: PET-PCR

    PubMed Central

    Lucchi, Naomi W.; Narayanan, Jothikumar; Karell, Mara A.; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J.; Hill, Vincent; Udhayakumar, Venkatachalam

    2013-01-01

    There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs. PMID:23437209

  18. Molecular diagnosis of malaria by photo-induced electron transfer fluorogenic primers: PET-PCR.

    PubMed

    Lucchi, Naomi W; Narayanan, Jothikumar; Karell, Mara A; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J; Hill, Vincent; Udhayakumar, Venkatachalam

    2013-01-01

    There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs.

  19. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

    PubMed

    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

    2014-08-01

    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. 40 CFR 63.3092 - How must I control emissions from my electrodeposition primer system if I want to comply with the...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection of...-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? If your...