Science.gov

Sample records for aflp primer pairs

  1. Characterizing Safflower Germplasm with AFLP Molecular Markers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Characterization of safflower (Carthamus tinctorius L.) germplasm with molecular markers is needed to enhance germplasm management and utilization. Amplified Fragment Length Polymorphism (AFLP) analysis was completed in safflower using two selective primer pairs resulting in 102 unambiguous polymor...

  2. Comparison and Validation of Some ITS Primer Pairs Useful for Fungal Metabarcoding Studies

    PubMed Central

    Op De Beeck, Michiel; Lievens, Bart; Busschaert, Pieter; Declerck, Stéphan; Vangronsveld, Jaco; Colpaert, Jan V.

    2014-01-01

    Current metabarcoding studies aiming to characterize microbial communities generally rely on the amplification and sequencing of relatively short DNA regions. For fungi, the internal transcribed spacer (ITS) region in the ribosomal RNA (rRNA) operon has been accepted as the formal fungal barcode. Despite an increasing number of fungal metabarcoding studies, the amplification efficiency of primers is generally not tested prior to their application in metabarcoding studies. Some of the challenges that metabarcoding primers should overcome efficiently are the amplification of target DNA strands in samples rich in non-target DNA and environmental pollutants, such as humic acids, that may have been co-extracted with DNA. In the current study, three selected primer pairs were tested for their suitability as fungal metabarcoding primers. The selected primer pairs include two primer pairs that have been frequently used in fungal metabarcoding studies (ITS1F/ITS2 and ITS3/ITS4) and a primer pair (ITS86F/ITS4) that has been shown to efficiently amplify the ITS2 region of a broad range of fungal taxa in environmental soil samples. The selected primer pairs were evaluated in a 454 amplicon pyrosequencing experiment, real-time PCR (qPCR) experiments and in silico analyses. Results indicate that experimental evaluation of primers provides valuable information that could aid in the selection of suitable primers for fungal metabarcoding studies. Furthermore, we show that the ITS86F/ITS4 primer pair outperforms other primer pairs tested in terms of in silico primer efficiency, PCR efficiency, coverage, number of reads and number of species-level operational taxonomic units (OTUs) obtained. These traits push the ITS86F/ITS4 primer pair forward as highly suitable for studying fungal diversity and community structures using DNA metabarcoding. PMID:24933453

  3. Duck (Anas platyrhynchos) linkage mapping by AFLP fingerprinting

    PubMed Central

    Huang, Chang-Wen; Cheng, Yu-Shin; Rouvier, Roger; Yang, Kuo-Tai; Wu, Chean-Ping; Huang, Hsiu-Lin; Huang, Mu-Chiou

    2009-01-01

    Amplified fragment length polymorphism (AFLP) with multicolored fluorescent molecular markers was used to analyze duck (Anas platyrhynchos) genomic DNA and to construct the first AFLP genetic linkage map. These markers were developed and genotyped in 766 F2 individuals from six families from a cross between two different selected duck lines, brown Tsaiya and Pekin. Two hundred and ninety-six polymorphic bands (64% of all bands) were detected using 18 pairs of fluorescent TaqI/EcoRI primer combinations. Each primer set produced a range of 7 to 29 fragments in the reactions, and generated on average 16.4 polymorphic bands. The AFLP linkage map included 260 co-dominant markers distributed in 32 linkage groups. Twenty-one co-dominant markers were not linked with any other marker. Each linkage group contained three to 63 molecular markers and their size ranged between 19.0 cM and 171.9 cM. This AFLP linkage map provides important information for establishing a duck chromosome map, for mapping quantitative trait loci (QTL mapping) and for breeding applications. PMID:19291328

  4. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

    PubMed Central

    Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666

  5. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.

    PubMed

    Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666

  6. The application of high-throughput AFLP's in assessing genetic diversity in Fusarium oxysporum f. sp. cubense.

    PubMed

    Groenewald, Susan; Van Den Berg, Noëlani; Marasas, Walter F O; Viljoen, Altus

    2006-03-01

    Fusarium oxysporum f. sp. cubense (Foc) is responsible for fusarium wilt of bananas. The pathogen consists of several variants that are divided into three races and 21 vegetative compatibility groups (VCGs). Several DNA-based techniques have previously been used to analyse the worldwide population of Foc, sometimes yielding results that were not always consistent. In this study, the high-resolution genotyping method of AFLP is introduced as a potentially effective molecular tool to investigate diversity in Foc at a genome-wide level. The population selected for this study included Foc isolates representing different VCGs and races, isolates of F. oxysporum f. sp. dianthi, a putatively non-pathogenic biological control strain F. oxysporum (Fo47), and F. circinatum. High-throughput AFLP analysis was attained using five different infrared dye-labelled primer combinations using a two-dye model 4200s LI-COR automated DNA analyser. An average of approx. 100 polymorphic loci were scored for each primer pair using the SAGA(MX) automated AFLP analysis software. Data generated from five primer pair combinations were combined and subjected to distance analysis, which included the use of neighbour-joining and a bootstrap of 1000 replicates. A tree inferred from AFLP distance analysis revealed the polyphyletic nature of the Foc isolates, and seven genotypic groups could be identified. The results indicate that AFLP is a powerful tool to perform detailed analysis of genetic diversity in the banana pathogen Foc. PMID:16483757

  7. Evaluation of 16S rRNA Gene Primer Pairs for Monitoring Microbial Community Structures Showed High Reproducibility within and Low Comparability between Datasets Generated with Multiple Archaeal and Bacterial Primer Pairs

    PubMed Central

    Fischer, Martin A.; Güllert, Simon; Neulinger, Sven C.; Streit, Wolfgang R.; Schmitz, Ruth A.

    2016-01-01

    The application of next-generation sequencing technology in microbial community analysis increased our knowledge and understanding of the complexity and diversity of a variety of ecosystems. In contrast to Bacteria, the archaeal domain was often not particularly addressed in the analysis of microbial communities. Consequently, established primers specifically amplifying the archaeal 16S ribosomal gene region are scarce compared to the variety of primers targeting bacterial sequences. In this study, we aimed to validate archaeal primers suitable for high throughput next generation sequencing. Three archaeal 16S primer pairs as well as two bacterial and one general microbial 16S primer pairs were comprehensively tested by in-silico evaluation and performing an experimental analysis of a complex microbial community of a biogas reactor. The results obtained clearly demonstrate that comparability of community profiles established using different primer pairs is difficult. 16S rRNA gene data derived from a shotgun metagenome of the same reactor sample added an additional perspective on the community structure. Furthermore, in-silico evaluation of primers, especially those for amplification of archaeal 16S rRNA gene regions, does not necessarily reflect the results obtained in experimental approaches. In the latter, archaeal primer pair ArchV34 showed the highest similarity to the archaeal community structure compared to observed by the metagenomic approach and thus appears to be the appropriate for analyzing archaeal communities in biogas reactors. However, a disadvantage of this primer pair was its low specificity for the archaeal domain in the experimental application leading to high amounts of bacterial sequences within the dataset. Overall our results indicate a rather limited comparability between community structures investigated and determined using different primer pairs as well as between metagenome and 16S rRNA gene amplicon based community structure analysis

  8. Evaluation of 16S rRNA Gene Primer Pairs for Monitoring Microbial Community Structures Showed High Reproducibility within and Low Comparability between Datasets Generated with Multiple Archaeal and Bacterial Primer Pairs.

    PubMed

    Fischer, Martin A; Güllert, Simon; Neulinger, Sven C; Streit, Wolfgang R; Schmitz, Ruth A

    2016-01-01

    The application of next-generation sequencing technology in microbial community analysis increased our knowledge and understanding of the complexity and diversity of a variety of ecosystems. In contrast to Bacteria, the archaeal domain was often not particularly addressed in the analysis of microbial communities. Consequently, established primers specifically amplifying the archaeal 16S ribosomal gene region are scarce compared to the variety of primers targeting bacterial sequences. In this study, we aimed to validate archaeal primers suitable for high throughput next generation sequencing. Three archaeal 16S primer pairs as well as two bacterial and one general microbial 16S primer pairs were comprehensively tested by in-silico evaluation and performing an experimental analysis of a complex microbial community of a biogas reactor. The results obtained clearly demonstrate that comparability of community profiles established using different primer pairs is difficult. 16S rRNA gene data derived from a shotgun metagenome of the same reactor sample added an additional perspective on the community structure. Furthermore, in-silico evaluation of primers, especially those for amplification of archaeal 16S rRNA gene regions, does not necessarily reflect the results obtained in experimental approaches. In the latter, archaeal primer pair ArchV34 showed the highest similarity to the archaeal community structure compared to observed by the metagenomic approach and thus appears to be the appropriate for analyzing archaeal communities in biogas reactors. However, a disadvantage of this primer pair was its low specificity for the archaeal domain in the experimental application leading to high amounts of bacterial sequences within the dataset. Overall our results indicate a rather limited comparability between community structures investigated and determined using different primer pairs as well as between metagenome and 16S rRNA gene amplicon based community structure analysis

  9. A Set of 100 Chloroplast DNA Primer Pairs to Study Population Genetics and Phylogeny in Monocotyledons

    PubMed Central

    Scarcelli, Nora; Barnaud, Adeline; Eiserhardt, Wolf; Treier, Urs A.; Seveno, Marie; d'Anfray, Amélie; Vigouroux, Yves; Pintaud, Jean-Christophe

    2011-01-01

    Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of markers are commonly used. Most of them have been designed for amplification in a large range of Angiosperms and are located in the Large Single Copy (LSC). Here we developed a new set of 100 primer pairs optimized for amplification in Monocotyledons. Primer pairs amplify coding (exon) and non-coding regions (intron and intergenic spacer). They span the different chloroplast regions: 72 are located in the LSC, 13 in the Small Single Copy (SSC) and 15 in the Inverted Repeat region (IR). Amplification and sequencing were tested in 13 species of Monocotyledons: Dioscorea abyssinica, D. praehensilis, D. rotundata, D. dumetorum, D. bulbifera, Trichopus sempervirens (Dioscoreaceae), Phoenix canariensis, P. dactylifera, Astrocaryum scopatum, A. murumuru, Ceroxylon echinulatum (Arecaceae), Digitaria excilis and Pennisetum glaucum (Poaceae). The diversity found in Dioscorea, Digitaria and Pennisetum mainly corresponded to Single Nucleotide Polymorphism (SNP) while the diversity found in Arecaceae also comprises Variable Number Tandem Repeat (VNTR). We observed that the most variable loci (rps15-ycf1, rpl32-ccsA, ndhF-rpl32, ndhG-ndhI and ccsA) are located in the SSC. Through the analysis of the genetic structure of a wild-cultivated species complex in Dioscorea, we demonstrated that this new set of primers is of great interest for population genetics and we anticipate that it will also be useful for phylogeny and bar-coding studies. PMID:21637837

  10. Genetic diversity of Aquilegia (Ranunculaceae) species and cultivars assessed by AFLPs.

    PubMed

    Zhu, R R; Gao, Y K; Xu, L J; Zhang, Q X

    2011-01-01

    Species of the genus Aquilegia are exceptionally diverse in their floral morphology and color, commonly known as columbine. They are widely planted ornamentals and are highly attractive for hummingbirds. However, little is known about their genetic diversity. We examined the genetic diversity of the species and cultivars using amplified fragment length polymorphism (AFLP) markers. Sixteen EcoRI/MseI AFLP primer combinations produced 327 informative polymorphic bands, with a mean of 20.4 bands scored per primer. Jaccard's coefficient of similarity varied from 0.61 to 0.93, indicative of high levels of genetic variation. Cluster analysis using the unweighted pair group method with arithmetic mean algorithm placed the 64 accessions into two main clusters, each divided into two sub-clusters. The AFLP variability was significantly associated with the geographic origins, as the Asian species and the North American species grouped into two distinct clusters. The genetic diversity found among Aquilegia demonstrated the potential value of Chinese germplasm for cultivar improvement and for widening the genetic basis of breeding programs and breeding material selection. We concluded that AFLPs are informative and can provide significant insights for genetic diversity research in columbine species. PMID:21574138

  11. An RT-PCR primer pair for the detection of Pospiviroid and its application in surveying ornamental plants for viroids.

    PubMed

    Bostan, Hidayet; Nie, Xianzhou; Singh, Rudra P

    2004-03-15

    A primer pair for reverse transcription-polymerase chain reaction (RT-PCR), based on the conserved sequences of the members of genus Pospiviroid was designed to yield a fragment of about 200 base pairs (bp). Since pospiviroids infect a large number of plants species and a few members of the genus Pospiviroid have been already detected in some ornamental plants, the primer pair was evaluated for its efficacy using ornamental plants. The method of return-polyacrylamide gel electrophoresis (R-PAGE) was used to determine the general presence of viroids in the test samples. Efficacy of the primer pair for members of genus Pospiviroid was demonstrated by the detection of Potato spindle tuber viroid (PSTVd) and Tomato chlorotic dwarf viroid (TCDVd) in potato, Chrysanthemum stunt viroid and Iresine viroid in Verbena and Vinca species, and Citrus exocortis viroid in Impatiens species. Specificity of the primer pair became evident, where additional viroids were detected by R-PAGE in Coleus and Magilla species, but they were not amplified by the Pospiviroid primer. This primer pair would be of benefit in indexing ornamental plants in quarantine samples or in viroid-free certification schemes, irrespective of their actual identity. PMID:14738987

  12. Species-specific AFLP markers for identification of Zingiber officinale, Z. montanum and Z. zerumbet (Zingiberaceae).

    PubMed

    Ghosh, S; Majumder, P B; Sen Mandi, S

    2011-01-01

    The Zingiber genus, which includes the herbs known as gingers, commonly used in cooking, is well known for its medicinal properties, as described in the Indian pharmacopoeia. Different members of this genus, although somewhat similar in morphology, differ widely in their pharmacological and therapeutic properties. The most important species of this genus, with maximal therapeutic properties, is Zingiber officinale (garden ginger), which is often adulterated with other less-potent Zingiber sp. There is an existing demand in the herbal drug industry for an authentication system for the Zingiber sp in order to facilitate their commercial use as genuine phytoceuticals. To this end, we used amplified fragment length polymorphism (AFLP) to produce DNA fingerprints for three Zingiber species. Sixteen collections (six of Z. officinale, five of Z. montanum, and five of Z. zerumbet) were used in the study. Seven selective primer pairs were found to be useful for all the accessions. A total of 837 fragments were produced by these primer pairs. Species-specific markers were identified for all three Zingiber species (91 for Z. officinale, 82 for Z. montanum, and 55 for Z. zerumbet). The dendogram analysis generated from AFLP patterns showed that Z. montanum and Z. zerumbet are phylogenetically closer to each other than to Z. officinale. The AFLP fingerprints of the Zingiber species could be used to authenticate Zingiber sp-derived drugs and to resolve adulteration-related problems faced by the commercial users of these herbs. PMID:21341214

  13. Determination of genetic relationships between evergreen azalea cultivars in China using AFLP markers*

    PubMed Central

    Zhou, Hong; Liao, Jin; Xia, Yi-ping; Teng, Yuan-wen

    2013-01-01

    Evergreen azaleas are among the most important ornamental shrubs in China. Today, there are probably over 300 cultivars preserved in different nurseries, but with little information available on the cultivar itself or relationships between cultivars. Amplified fragment length polymorphism (AFLP) markers were employed to determine the genetic relationships between evergreen azalea cultivars in China. One hundred and thirty genotypes collected from gardens and nurseries, including cultivars classified in the groups East, West, Hairy, and Summer, unknown cultivars, and close species, were analyzed using three primer pairs. A total of 408 polymorphic fragments were generated by AFLP reactions with an average of 136 fragments per primer pair. The average values of expected heterozygosity and Shannon’s information index were 0.3395 and 0.5153, respectively. Genetic similarities were generated based on Dice coefficients, used to construct a neighbor joining tree, and bootstrapped for 100 replicates in Treecon V1.3b. Principal coordinate analysis (PCO) was performed based on Dice distances using NTSYS-pc software. The AFLP technique was useful for analyzing genetic diversity in evergreen azaleas. Cluster analysis revealed that cultivars in the West and Summer groups were quite distinct from other groups in the four-group classification system and that the East and Hairy groups should be redefined. PMID:23549847

  14. Genetic structure of Pilosocereus gounellei (Cactaceae) as revealed by AFLP marker to guide proposals for improvement and restoration of degraded areas in Caatinga biome.

    PubMed

    Monteiro, E R; Strioto, D K; Meirelles, A C S; Mangolin, C A; Machado, M F P S

    2015-01-01

    Amplified fragment length polymorphism (AFLP) analysis was used to evaluate DNA polymorphism in Pilosocereus gounellei with the aim of differentiating samples grown in different Brazilian semiarid regions. Seven primer pairs were used to amplify 703 AFLP markers, of which 700 (99.21%) markers were polymorphic. The percentage of polymorphic markers ranged from 95.3% for the primer combination E-AAG/M-CTT to 100% for E-ACC/M-CAT, E-ACC/M-CAA, E-AGC/M-CAG, E-ACT/M-CTA, and E-AGG/M-CTG. The largest number of informative markers (126) was detected using the primer combination E-AAC/M-CTA. Polymorphism of the amplified DNA fragments ranged from 72.55% (in sample from Piauí State) to 82.79% (in samples from Rio Grande Norte State), with an average of 75.39%. Despite the high genetic diversity of AFLP markers in xiquexique, analysis using the STRUCTURE software identified relatively homogeneous clusters of xiquexique from the same location, indicating a differentiation at the molecular level, among the plant samples from different regions of the Caatinga biome. The AFLP methodology identified genetically homogeneous and contrasting plants, as well as plants from different regions with common DNA markers. Seeds from such plants can be used for further propagation of plants for establishment of biodiversity conservation units and restoration of degraded areas of the Caatinga biome. PMID:26681043

  15. Assessment of genetic diversity in Chinese eared pheasant using fluorescent-AFLP markers.

    PubMed

    Li, Xiujuan; Zhu, Yaohong; Liu, Panqi; Zhuge, Zengyu; Su, Guosheng; Wang, Jiufeng

    2010-10-01

    The eared pheasant consists of four species: white eared pheasant (Crossoptilon crossoptilon), Tibetan eared pheasant (Crossoptilon harmani), blue eared pheasant (Crossoptilon auritum), and brown eared pheasant (Crossoptilon mantchuricum). These species are found only in China, and are also on the list of the world's threatened species. In this paper, 74 individuals from the four eared pheasant species were assessed for population genetic diversity by means of fluorescent-AFLP markers. A total of 429 AFLP peaks were amplified by 11 pairs of fluorescent EcoRI/TaqI primer combinations. Out of all markers, 329 AFLPs were polymorphic. Each primer combination produced in reactions from 19 to 72 fragments and the polymorphic peaks percentage ranged from 53.33% to 86.11% with an average of 74.36% polymorphic bands. Genetic distance between species and genetic diversity within species were evaluated using Jaccard's similarity coefficients (SC) and the corresponding dendrogram. It was found that there was a moderate genetic distance between the four species (SC=0.674-0.832). Brown eared pheasant was genetically closely related to blue eared pheasant (SC=0.832), while white eared pheasant was more closely related to Tibetan eared pheasant (SC=0.812). Genetic diversity was lower in brown eared pheasant (SC=0.913) and Tibetan eared pheasant (SC=0.903) than in white eared pheasant (SC=0.832) and blue eared pheasant (SC=0.853). PMID:20595068

  16. Bacterial Diversity Dynamics Associated with Different Diets and Different Primer Pairs in the Rumen of Kankrej Cattle

    PubMed Central

    Pitta, Dipti W.; Parmar, Nidhi; Patel, Amrut K.; Indugu, Nagaraju; Kumar, Sanjay; Prajapathi, Karsanbhai B.; Patel, Anand B.; Reddy, Bhaskar; Joshi, Chaitanya

    2014-01-01

    The ruminal microbiome in herbivores plays a dominant role in the digestion of lignocellulose and has potential to improve animal productivity. Kankrej cattle, a popular native breed of the Indian subcontinent, were used to investigate the effect of different dietary treatments on the bacterial diversity in ruminal fractions using different primer pairs. Two groups of four cows were assigned to two primary diets of either dry or green forages. Each group was fed one of three dietary treatments for six weeks each. Dietary treatments were; K1 (50% dry/green roughage: 50% concentrate), K2 (75% dry/green roughage: 25% concentrate) and K3 (100% dry/green roughage). Rumen samples were collected using stomach tube at the end of each dietary period and separated into solid and liquid fractions. The DNA was extracted and amplified for V1–V3, V4–V5 and V6–V8 hypervariable regions using P1, P2 and P3 primer pairs, sequenced on a 454 Roche platform and analyzed using QIIME. Community compositions and the abundance of most bacterial lineages were driven by interactions between primer pair, dietary treatment and fraction. The most abundant bacterial phyla identified were Bacteroidetes and Firmicutes however, the abundance of these phyla varied between different primer pairs; in each primer pair the abundance was dependent on the dietary treatment and fraction. The abundance of Bacteroidetes in cattle receiving K1 treatment indicate their diverse functional capabilities in the digestion of both carbohydrate and protein while the predominance of Firmicutes in the K2 and K3 treatments signifies their metabolic role in fibre digestion. It is apparent that both liquid and solid fractions had distinct bacterial community patterns (P<0.001) congruent to changes in the dietary treatments. It can be concluded that the P1 primer pair flanking the V1–V3 hyper-variable region provided greater species richness and diversity of bacterial populations in the rumen of Kankrej cattle

  17. Optimization of AFLP for extremely large genomes over 70 Gb.

    PubMed

    Veselá, Petra; Volařík, Daniel; Mráček, Jaroslav

    2016-07-01

    Here, we present an improved amplified fragment length polymorphism (AFLP) protocol using restriction enzymes (AscI and SbfI) that recognize 8-base pair sequences to provide alternative optimization suitable for species with a genome size over 70 Gb. This cost-effective optimization massively reduces the number of amplified fragments using only +3 selective bases per primer during selective amplification. We demonstrate the effects of the number of fragments and genome size on the appearance of nonidentical comigrating fragments (size homoplasy), which has a negative impact on the informative value of AFLP genotypes. We also present various reaction conditions and their effects on reproducibility and the band intensity of the extremely large genome of Viscum album. The reproducibility of this octo-cutter protocol was calculated using several species with genome sizes ranging from 1 Gb (Carex panicea) to 76 Gb (V. album). The improved protocol also succeeded in detecting high intraspecific variability in species with large genomes (V. album, Galanthus nivalis and Pinus pumila). PMID:26849414

  18. AFLP: a new technique for DNA fingerprinting.

    PubMed Central

    Vos, P; Hogers, R; Bleeker, M; Reijans, M; van de Lee, T; Hornes, M; Frijters, A; Pot, J; Peleman, J; Kuiper, M

    1995-01-01

    A novel DNA fingerprinting technique called AFLP is described. The AFLP technique is based on the selective PCR amplification of restriction fragments from a total digest of genomic DNA. The technique involves three steps: (i) restriction of the DNA and ligation of oligonucleotide adapters, (ii) selective amplification of sets of restriction fragments, and (iii) gel analysis of the amplified fragments. PCR amplification of restriction fragments is achieved by using the adapter and restriction site sequence as target sites for primer annealing. The selective amplification is achieved by the use of primers that extend into the restriction fragments, amplifying only those fragments in which the primer extensions match the nucleotides flanking the restriction sites. Using this method, sets of restriction fragments may be visualized by PCR without knowledge of nucleotide sequence. The method allows the specific co-amplification of high numbers of restriction fragments. The number of fragments that can be analyzed simultaneously, however, is dependent on the resolution of the detection system. Typically 50-100 restriction fragments are amplified and detected on denaturing polyacrylamide gels. The AFLP technique provides a novel and very powerful DNA fingerprinting technique for DNAs of any origin or complexity. Images PMID:7501463

  19. Performance of 16s rDNA Primer Pairs in the Study of Rhizosphere and Endosphere Bacterial Microbiomes in Metabarcoding Studies

    PubMed Central

    Beckers, Bram; Op De Beeck, Michiel; Thijs, Sofie; Truyens, Sascha; Weyens, Nele; Boerjan, Wout; Vangronsveld, Jaco

    2016-01-01

    Next-generation sequencing technologies have revolutionized the methods for studying microbial ecology by enabling high-resolution community profiling. However, the use of these technologies in unraveling the plant microbiome remains challenging. Many bacterial 16S rDNA primer pairs also exhibit high affinity for non-target DNA such as plastid (mostly chloroplast) DNA and mitochondrial DNA. Therefore, we experimentally tested a series of commonly used primers for the analysis of plant-associated bacterial communities using 454 pyrosequencing. We evaluated the performance of all selected primer pairs in the study of the bacterial microbiomes present in the rhizosphere soil, root, stem and leaf endosphere of field-grown poplar trees (Populus tremula × Populus alba) based on (a) co-amplification of non-target DNA, (b) low amplification efficiency for pure chloroplast DNA (real-time PCR), (c) high retrieval of bacterial 16S rDNA, (d) high operational taxonomic unit (OTU) richness and Inverse Simpson diversity and (e) taxonomic assignment of reads. Results indicate that experimental evaluation of primers provide valuable information that could contribute in the selection of suitable primer pairs for 16S rDNA metabarcoding studies in plant-microbiota research. Furthermore, we show that primer pair 799F-1391R outperforms all other primer pairs in our study in the elimination of non-target DNA and retrieval of bacterial OTUs. PMID:27242686

  20. Performance of 16s rDNA Primer Pairs in the Study of Rhizosphere and Endosphere Bacterial Microbiomes in Metabarcoding Studies.

    PubMed

    Beckers, Bram; Op De Beeck, Michiel; Thijs, Sofie; Truyens, Sascha; Weyens, Nele; Boerjan, Wout; Vangronsveld, Jaco

    2016-01-01

    Next-generation sequencing technologies have revolutionized the methods for studying microbial ecology by enabling high-resolution community profiling. However, the use of these technologies in unraveling the plant microbiome remains challenging. Many bacterial 16S rDNA primer pairs also exhibit high affinity for non-target DNA such as plastid (mostly chloroplast) DNA and mitochondrial DNA. Therefore, we experimentally tested a series of commonly used primers for the analysis of plant-associated bacterial communities using 454 pyrosequencing. We evaluated the performance of all selected primer pairs in the study of the bacterial microbiomes present in the rhizosphere soil, root, stem and leaf endosphere of field-grown poplar trees (Populus tremula × Populus alba) based on (a) co-amplification of non-target DNA, (b) low amplification efficiency for pure chloroplast DNA (real-time PCR), (c) high retrieval of bacterial 16S rDNA, (d) high operational taxonomic unit (OTU) richness and Inverse Simpson diversity and (e) taxonomic assignment of reads. Results indicate that experimental evaluation of primers provide valuable information that could contribute in the selection of suitable primer pairs for 16S rDNA metabarcoding studies in plant-microbiota research. Furthermore, we show that primer pair 799F-1391R outperforms all other primer pairs in our study in the elimination of non-target DNA and retrieval of bacterial OTUs. PMID:27242686

  1. ATG-anchored AFLP (ATG-AFLP) Analysis in Cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Amplified fragment length polymorphism (AFLP) marker system has had broad applications in biology, genetics, breeding, evolution, and ecology due to its no requirement for prior sequence information, high reproducibility, robustness, and high throughput nature. However, the anonymous AFLP markers ar...

  2. Biodiversity of Asian rice gall midge (Orseolia oryzae Wood Mason) from five countries examined by AFLP analysis.

    PubMed

    Katiyar, S K; Chandel, G; Tan, Y; Zhang, Y; Huang, B; Nugaliyadde, L; Fernando, K; Bentur, J S; Inthavong, S; Constantino, S; Bennett, J

    2000-04-01

    Amplified fragment length polymorphism (AFLP) analysis was used to assess the biodiversity of one of the most important dipteran pests of cereals, the Asian rice gall midge (Orseolia oryzae Wood Mason). Larvae and pupae were collected at 15 locations in five Asian countries and preserved in 95% ethanol for storage, shipment, and DNA extraction using cetyltrimethylammonium bromide (CTAB). Although only approximately 1 microg of DNA was extracted from a single pupa or larva, the use of several AFLP primers in various combinations meant that this amount of DNA was sufficient to allow many DNA fingerprints to be made per individual. Fingerprints were sufficiently reproducible, especially during selective amplification, to allow the genetic diversity within a field population to be characterized. Extraction of DNA from a pool of 20 insects yielded AFLP fingerprints in which variation among individuals was sacrificed in favor of detecting differences among populations. For each location, pooled DNA was amplified with three primer pairs. A total of 261 distinct AFLP bands were identified for the 45 fingerprints. Cluster analysis, performed by the unweighted pair-group method (UPGMA), separated the populations into two distinct groups. Group I included two populations from Guangdong province of southern China and one each from Laos and Imphal in northeastern India, while group II was comprised of eleven populations from elsewhere in India (Assam, Orissa, Madhya Pradesh, Andhra Pradesh, and Kerala) and from Nepal and Sri Lanka. AFLP analysis provided insight into the origins of gall midge biotypes. In 1992, the prevailing biotype in Imphal changed from Indian biotype 3 to a new biotype 3M. Our data show that biotype 3M belongs to group I and did not arise by a recent mutation from biotype 3, which belongs to group II. By contrast, Indian biotypes 2 and 4 are likely to have diverged through recent mutation and selection, as are Chinese biotypes 1 and 4. The almost

  3. Molecular identification of the economically important freshwater mussels (Mollusca-Bivalvia-Unionoida) of Thailand: developing species-specific markers from AFLPs.

    PubMed

    Vannarattanarat, S; Zieritz, A; Kanchanaketu, T; Kovitvadhi, U; Kovitvadhi, S; Hongtrakul, V

    2014-04-01

    Shells of certain freshwater mussel (Unionoida) species are highly demanded and serve as raw material for a range of decorative and pharmaceutical products. In Thailand, most animals for this purpose are currently harvested from wild populations, with unionoid culture still being in its infancy. Whilst reliable species identification is a prerequisite for developing a large-scale industry, identification by morphological means is hampered by extensive phenotypic plasticity and poor knowledge of species delimitations. To facilitate alternative molecular identification, we developed species-specific markers for the three Thai unionoids with considerable economic potential (CEP): that is, Chamberlainia hainesiana, Hyriopsis desowitzi and Hyriopsis myersiana. For this purpose, amplified fragment length polymorphism (AFLP) fingerprints using 24 specific primer pairs were generated for eight samples of each CEP species and four samples of the closely related, non-CEP species Contradens contradens. Cloning and sequencing of 13 CEP species-specific AFLP bands revealed fragment collision at three occasions. In total, 16 species-specific primer pairs were designed and tested on 92 Thai specimens spanning seven species and four genera. Thereby, specificity of (1) three primers to C. hainesiana, (2) one primer to H. desowitzi + Hyriopsis bialata, (3) one primer to H. myersiana + H. bialata and (4) four primers to all three Hyriopsis species tested was confirmed. Respective multiplex PCR protocols are provided. The developed primers enable cheap, quick and reliable identification of the Thai CEP species by one to three PCRs and offer a tool for a range of additional applications within mussel culture and ecological and evolutionary research on these important organisms. PMID:24313464

  4. AFLP marking and polymorphism among progenies of Gymnema sylvestre: an important medicinal plant of India.

    PubMed

    Osman, Magda Abbaker; Dhawan, Sunita Singh; Bahl, Janak Raj; Darokar, Mahendra P; Khanuja, Suman P S

    2011-11-01

    The level of polymorphism among twelve selected progenies of Gymnema sylvestre was investigated through AFLP markers by multiplexing PCR reactions using 64 (8x8) primer combinations. Fourteen primer combinations were selected as the most suitable combination for G. sylvestre. Analysis of the 12 progenies with these 14 primer pairs produced 1689 fragments of which 972 (57.5%) were polymorphic and 485 (28.7%) were unique to a particular genotype. The number of fragments produced by individual primer pairs was in the range of 55 to 225. Out of these, polymorphic fragments were in the range of 34 (E-ACC/M-CAC) to 157 (E-AGG/M-CAG) and unique bands observed were 8 (E-ACC / M-CAC) to 69 (E-AGG/M-CAC). Different primer combinations detected different levels of polymorphism, ranging from 33% (E-AGG/ M-CAC) to 69.8% (E-AGG/ M-CAC). From the observations, it appears that the primer combinations E-AGG/M-CAC, E-AGG/CTG, E-AGG/CAG and E-ACA/CAT were the most informative for the detection of polymorphism among the progenies compared with others, since they produced a high number of unique fragments. The similarity coefficient ranged from 0.212 to 0.731. High similarity was observed between progeny S8 and S9 (73%) and high divergence between progenies S3 and S11. Among the selected progeny, S9 was found to be the most similar to the parent (63%), while genotype S11 was the most distant (36.9%). PMID:22224288

  5. Genetic Diversity in Musa acuminata Colla and Musa balbisiana Colla and some of their natural hybrids using AFLP Markers.

    PubMed

    Ude, G.; Pillay, M.; Nwakanma, D.; Tenkouano, A.

    2002-06-01

    Genetic diversity and relationships were assessed in 28 accessions of Musa acuminata (AA) Colla and Musa balbisiana (BB) Colla, and some of their natural hybrids, using the amplified fragment length polymorphisms (AFLP) technique. Fifteen AFLP +3 primer pairs produced 527 polymorphic bands among the accessions. Neighbor-joining and principal co-ordinate (PCO) analyses using Jaccard's similarity coefficient produced four major clusters that closely corresponded with the genome composition of the accessions (AA, BB, AAB and ABB). The AFLP data distinguished between the wild diploid accessions and suggested new subspecies relationships in the M. acuminata complex that are different from those based on morphological data. The data suggested that there are three subspecies within the M. acuminata complex (ssp. burmannica Simmonds, malaccensis Simmonds, and microcarpa Simmonds). 'Tjau Lagada' (ssp. microcarpa), 'Truncata' [ssp truncata (Ridl.) Shepherd] and 'SF247' [ssp. banksii (F.Muell) Simmonds] clustered very closely with 'Gros Michel' and 'Km 5', indicating that more than one M. acuminata subspecies may be involved in the origin of triploid AAA bananas. 'Calcutta 4' (ssp. burmannicoides De Langhe & Devreux) and 'Long Tavoy' (ssp. burmannica) were closely related and could be together in the same subspecies. This study also showed that there is much more genetic diversity within M. balbisiana that was split into two groups: (1) 'I-63' and 'HND' and (2) 'Los Banos', 'MPL' (Montpellier), '10852', 'Singapuri', 'Etikehel', and 'Butohan 1' as the other. PMID:12582577

  6. Data supporting the design and evaluation of a universal primer pair for pseudogene-free amplification of HPRT1 in real-time PCR

    PubMed Central

    Valadan, Reza; Hedayatizadeh-Omran, Akbar; Alhosseini-Abyazani, Mahdyieh Naghavi; Amjadi, Omolbanin; Rafiei, Alireza; Tehrani, Mohsen; Alizadeh-Navaei, Reza

    2015-01-01

    Hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1) is a common housekeeping gene for sample normalization in the quantitative reverse transcriptase polymerase chain (qRT-PCR). However, co-amplification of HPRT1 pseudogenes may affect accurate results obtained in qRT-PCR. We designed a primer pair (HPSF) for pseudogene-free amplification of HPRT1 in qRT-PCR [1]. We showed specific amplification of HPRT1 mRNA in some common laboratory cell lines, including HeLa, NIH/3T3, CHO, BHK, COS-7 and VERO. This article provides data supporting the presence and location of HPRT1 pseudogenes within human and mouse genome, and the strategies used for designing primers that avoid the co-amplification of contaminating pseudogenes in qRT-PCR. In silico analysis of human genome showed three homologous sequences for HPRT1 on chromosomes 4, 5 and 11. The mRNA sequence of HPRT1 was aligned with the pseudogenes, and the primers were designed toward 5′ end of HPRT1 mRNA that was only specific to HPRT1 mRNA not to the pseudogenes. The standard curve plot generated by HPSF primers showed the correlation coefficient of 0.999 and the reaction efficiency of 99.5%. Our findings suggest that HPSF primers can be recommended as a candidate primer pair for accurate and reproducible qRT-PCR assays. PMID:26217821

  7. A High-throughput AFLP-based Method for Constructing Integrated Genetic and Physical Maps: Progress Toward a Sorghum Genome Map

    PubMed Central

    Klein, Patricia E.; Klein, Robert R.; Cartinhour, Samuel W.; Ulanch, Paul E.; Dong, Jianmin; Obert, Jacque A.; Morishige, Daryl T.; Schlueter, Shannon D.; Childs, Kevin L.; Ale, Melissa; Mullet, John E.

    2000-01-01

    Sorghum is an important target for plant genomic mapping because of its adaptation to harsh environments, diverse germplasm collection, and value for comparing the genomes of grass species such as corn and rice. The construction of an integrated genetic and physical map of the sorghum genome (750 Mbp) is a primary goal of our sorghum genome project. To help accomplish this task, we have developed a new high-throughput PCR-based method for building BAC contigs and locating BAC clones on the sorghum genetic map. This task involved pooling 24,576 sorghum BAC clones (∼4× genome equivalents) in six different matrices to create 184 pools of BAC DNA. DNA fragments from each pool were amplified using amplified fragment length polymorphism (AFLP) technology, resolved on a LI-COR dual-dye DNA sequencing system, and analyzed using Bionumerics software. On average, each set of AFLP primers amplified 28 single-copy DNA markers that were useful for identifying overlapping BAC clones. Data from 32 different AFLP primer combinations identified ∼2400 BACs and ordered ∼700 BAC contigs. Analysis of a sorghum RIL mapping population using the same primer pairs located ∼200 of the BAC contigs on the sorghum genetic map. Restriction endonuclease fingerprinting of the entire collection of sorghum BAC clones was applied to test and extend the contigs constructed using this PCR-based methodology. Analysis of the fingerprint data allowed for the identification of 3366 contigs each containing an average of 5 BACs. BACs in ∼65% of the contigs aligned by AFLP analysis had sufficient overlap to be confirmed by DNA fingerprint analysis. In addition, 30% of the overlapping BACs aligned by AFLP analysis provided information for merging contigs and singletons that could not be joined using fingerprint data alone. Thus, the combination of fingerprinting and AFLP-based contig assembly and mapping provides a reliable, high-throughput method for building an integrated genetic and physical map

  8. BatchPrimer3: A high throughput web application for PCR and sequencing primer design

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A new web primer design program, BatchPrimer3, is developed based on Primer3. BatchPrimer3 adopted the Primer3 core program as a major primer design engine to choose the best primer pairs. A new score-based primer picking module is incorporated into BatchPrimer3 and used to pick position-restricte...

  9. [Morphology and AFLP analysis of tetraploid plantlets of Atractylodes macrocephala].

    PubMed

    Wang, Hong-juan; Li, Ya-ting; Xiang, Zeng-xu

    2015-02-01

    In order to investigate the genetic basis of morphological variation of tetraploid plantlets of Atractylodes macrocephala, diploid plantlets were taken as experimental material, sterile filtration colchicine was used to soak 0.5-1.0 cm long buds. The difference between morphology and stomatal of diploid and tetraploid of A. macrocephala was compared, and genome polymorphism was explored by AFLP. The results showed that the buds dipped in 0.1% colchicine solution for 36 h was optimal conditions to induce tetraploid of A. macrocephala with induction rate of 32.0%. Morphological indexes such as leaf area index, leaf length and width, the density of stomas and the number of chloroplast of tetraploid were distinctly different from diploid. Four hundred and fifty-one bands ranging with 80-500 bp were amplified with 24 pairs of primers, the rate of polymorphism was 32.59%. These amplification sites of diploid were different from tetraploid of A. macrocephala, and the differences in morphology of them were reflected in the DNA polymorphism. PMID:26084160

  10. Genetic Diversity of Hibiscus tiliaceus (Malvaceae) in China Assessed using AFLP Markers

    PubMed Central

    TANG, TIAN; ZHONG, YANG; JIAN, SHUGUANG; SHI, SUHUA

    2003-01-01

    Amplified fragment length polymorphism (AFLP) markers were used to investigate the genetic variations within and among nine natural populations of Hibiscus tiliaceus in China. DNA from 145 individuals was amplified with eight primer pairs. No polymorphisms were found among the 20 samples of a marginal population of recent origin probably due to a founder effect. Across the other 125 individuals, 501 of 566 bands (88·5 %) were polymorphic, and 125 unique AFLP phenotypes were observed. Estimates of genetic diversity agreed with life history traits of H. tiliaceus and geographical distribution. AMOVA analysis revealed that most genetic diversity resided within populations (84·8 %), which corresponded to results reported for outcrossing plants. The indirect estimate of gene flow based on ϕST was moderate (Nm = 1·395). Long-distance dispersal of floating seeds and local environments may play an important role in shaping the genetic diversity of the population and the genetic structure of this species. PMID:12930729

  11. Construction of an AFLP genetic map with nearly complete genome coverage in Pinus taeda.

    PubMed

    Remington, D L; Whetten, R W; Liu, B H; O'Malley, D M

    1999-06-01

    De novo construction of complete genetic linkage maps requires large mapping populations, large numbers of genetic markers, and efficient algorithms for ordering markers and evaluating order confidence. We constructed a complete genetic map of an individual loblolly pine (Pinus taeda L.) using amplified fragment length polymorphism (AFLP) markers segregating in haploid megagametophytes and PGRI mapping software. We generated 521 polymorphic fragments from 21 AFLP primer pairs. A total of 508 fragments mapped to 12 linkage groups, which is equal to the Pinus haploid chromosome number. Bootstrap locus order matrices and recombination matrices generated by PGRI were used to select 184 framework markers that could be ordered confidently. Order support was also evaluated using log likelihood criteria in MAPMAKER. Optimal marker orders from PGRI and MAPMAKER were identical, but the implied reliability of orders differed greatly. The framework map provides nearly complete coverage of the genome, estimated at approximately 1700 cM in length using a modified estimator. This map should provide a useful framework for merging existing loblolly pine maps and adding multiallelic markers as they become available. Map coverage with dominant markers in both linkage phases will make the map useful for subsequent quantitative trait locus mapping in families derived by self-pollination. PMID:12238515

  12. Analysis of the genetic diversity and differentiation of Fenneropenaeus penicillatus populations using AFLP technology

    NASA Astrophysics Data System (ADS)

    Zhang, Guiling; Cao, Yuanyu; Li, Zhongbao; Chen, Jin; Zhao, Binli; Lei, Guanggao; Wang, Zhanlin

    2012-05-01

    Fenneropenaeus penicillatus (redtail shrimp) is an important marine commercial animal in China. Recently, its resources have been depleted rapidly as a result of, for example, over-exploitation and environmental degradation of spawning grounds. Therefore, we analyzed the genetic diversity and differentiation of nine wild populations of F. penicillatus of China (Ningde, Lianjiang, Putian, Xiamen, Quanzhou, Zhangpu, Dongshan, Nanao, and Shenzhen populations) by amplified fragment length polymorphism (AFLP) technology, to provide genetic information necessary for resource protection, rejuvenation, artificial breeding, and sustainable use of the resource. Eight AFLP primer pairs were used for amplification, and 508 bands were detected among the populations. The results show that the percentage of polymorphic loci ( P) ranged from 41.34% to 63.58%; the Nei's gene diversity ( H) of the populations was 0.119 4-0.230 5; and Shannon's Information Index ( I) was 0.184 1-0.342 5. These genetic data indicate that the genetic diversity of F. penicillatus was high. The genetic differentiation coefficient ( G ST=0.216 2) and gene flow ( N m=1.812 4) show that there was a high level of genetic differentiation and a moderate level of gene flow among populations. More studies on the genetic differentiation mechanism of F. penicillatus along the south-eastern coast of China need to be conducted to find more effective scientific protection strategies for the conservation of F. penicillatus genetic resources.

  13. Genetic Relationships of Aglaonema Species and Cultivars Inferred from AFLP Markers

    PubMed Central

    CHEN, JIANJUN; DEVANAND, PACHANOOR S.; NORMAN, DAVID J.; HENNY, RICHARD J.; CHAO, CHIH‐CHENG T.

    2004-01-01

    • Background and Aims Aglaonema is an important ornamental foliage plant genus, but genetic relationships among its species and cultivars have not been reported. This study analysed genetic relatedness of 54 cultivars derived from nine species using amplified fragment length polymorphism (AFLP) markers. • Methods Initially, 48 EcoRI + 2/MseI + 3 primer set combinations were screened, from which six primer sets that showed clear scoreable and highly polymorphic fragments were selected and used for AFLP reactions. AFLP fragments were scored and entered into a binary data matrix as discrete variables. Jaccard’s coefficient of similarity was calculated for all pair‐wise comparisons among the 54 cultivars, and a dendrogram was constructed by the unweighted pair‐group method using the arithmetic average (UPGMA). • Key Results The number of AFLP fragments generated per primer set ranged from 59 to 112 with fragment sizes varying from 50 to 565 bp. A total of 449 AFLP fragments was detected, of which 314 were polymorphic (70 %). All cultivars were clearly differentiated by their AFLP fingerprints. The 54 cultivars were divided into seven clusters; cultivars within each cluster generally share similar morphological characteristics. Cluster I contains 35 cultivars, most of them are interspecific hybrids developed mainly from A. commutatum, A. crispum or A. nitidum. However, Jaccard’s similarity coefficients among these hybrids are 0·84 or higher, suggesting that these popular hybrid cultivars are genetically much closer than previously thought. This genetic similarity may imply that A. nitidum and A. crispum are likely progenitors of A. commutatum. • Conclusions Results of this study demonstrate the efficiency and ease of using AFLP markers for investigating genetic relationships of ornamental foliage plants, a group usually propagated vegetatively. The AFLP markers developed will help future Aglaonema cultivar identification, germplasm conservation and

  14. Population genetic structure in apricot (Prunus armeniaca L.) cultivars revealed by fluorescent-AFLP markers in southern Xinjiang, China.

    PubMed

    Yuan, Zhaohe; Chen, Xuesen; He, Tianming; Feng, Jianrong; Feng, Tao; Zhang, Chunyu

    2007-11-01

    Population-wide genetic structure was studied using fluorescent-AFLP markers on 85 apricot (Prunus armeniaca L.) cultivars collected from Kuche, Kashi, Hetian in the Tarim Basin, southern Xinjiang Uygur Autonomous Region of China. The purpose of this study was to determine the genetic structure and genotypic diversity among the different eco-geographical populations. Based on the results from this study, 8 pairs of fluorescent-AFLP primers showed clear electrophoregram and high polymorphism amongst the 64 pairs of EcoR|/Mse|(Mse|--a FAM fluorescent marked primer) primers screened. There was a significant polymorphic difference for the same primer pair in different populations and for the same population with different primer pairs. The percentage of polymorphic loci (P) at species level was higher than Kuche, Hetian, Kashi population levels, respectively. The Nei's gene diversity index (H) and Shannon's information index (I) at species level were higher than those of Kuche, Hetian, and Kashi at population level, respectively. H and I of Kuche population were the highest amongst the three populations. Apricot population genetic diversity was found mainly within the population. Genetic differentiation coefficient between populations (G(ST)) was 0.0882. Gene flow Nm between the populations was 5.1689. Population genetic identity was between 0.9772-0.9811 and genetic distance was between 0.0191-0.0232. These results further indicated that the similarity between populations was higher and the genetic distance between populations was smaller. The UPGMA cluster analysis indicates that the geographical populations at Kuche, Kashi, Hetian were relatively independent Mendelian populations. Concurrently, there was also partial gene exchange between the populations. All the evidences indicated that the genetic diversity in Kuche population was the highest, suggesting that it could be a transition population from wild apricot to cultivated apricot. There were abundant genetic

  15. Identification on commercialized products of AFLP markers able to discriminate slow- from fast-growing chicken strains.

    PubMed

    Fumière, Olivier; Dubois, Marc; Grégoire, Dimitrie; Théwis, André; Berben, Gilbert

    2003-02-26

    The European chicken meat market is characterized by numerous quality marks: "Label de Qualité Wallon" in Belgium, "Label Rouge" in France, denominations of geographical origin, organic agriculture, etc. Most of those certified productions have specifications requiring the use of slow-growing chicken strains. The amplified fragment length polymorphism (AFLP) technique has been used to search molecular markers able to discriminate slow-growing chicken strains from fast-growing ones and to authenticate certified products. Two pairs of restriction enzymes (EcoRI/MseI and EcoRI/TaqI) and 121 selective primer combinations were tested on individual DNA samples from chicken products essentially in carcass form that were ascribed as belonging to either slow- or fast-growing strains. Within the resulting fingerprints, two fragments were identified as type-strains specific markers. One primer combination gives a band (333 bp) that is specific for slow-growing chickens, and another primer pair generates a band (372 bp) that was found to be characteristic of fast-growing chickens. The two markers were isolated, cloned, and sequenced. The effectiveness and the specificity of the two interesting determinants were assessed on individuals of two well-known strains (ISA 657 and Cobb 500) and on commercialized products coming from various origins. PMID:12590443

  16. Analysis of genetic relationships among Rosa damascena plants grown in Turkey by using AFLP and microsatellite markers.

    PubMed

    Baydar, Nilgün Göktürk; Baydar, Hasan; Debener, Thomas

    2004-08-01

    Rosa damascena Mill. is the most important rose species for rose oil production. The main rose oil producers in the world are Turkey and Bulgaria and they obtain the rose oil almost exclusively from R. damascena. In spite of coming from the same original populations, R. damascena plants grown in Turkey show some morphological differences. In this study, it was aimed to investigate the genetic relationships among R. damascena plants grown in Turkey by using microsatellite and AFLP markers. Twenty three AFLP and nine microsatellite primer pairs were used for this aim. No polymorphism could be detected among the plants, as the marker patterns obtained from different plants are identical. The conclusion from these data is that all R. damascena plants under study are derived from the same original genotype by vegetative propagation. Furthermore, the observed morphological differences originate from point mutations not detectable by molecular markers. Therefore, they are equivalent to sport mutations frequently observed in cut and garden rose varieties. PMID:15246662

  17. AFLP analysis of genetic variation among three natural populations of horseshoe crab Tachypleus tridentatus along Chinese coast

    NASA Astrophysics Data System (ADS)

    Xu, Qian; Chen, Fei; Shin, Paul K. S.; Cheung, S. G.; Chen, Yan; Ke, Caihuan

    2011-03-01

    The AFLP (amplified fragment length polymorphism) technique was used to analyze and compare the genetic diversity of Tachypleus tridentatus from three south-eastern coastal sites of China (Pingtan, Hong Kong and Beihai). Eight pairs of primers generated 361 loci, including 285 polymorphic loci. The ratio of polymorphic loci was 96.97%. Nei's genetic diversity index was 0.420 8 and the Shannon information index was 0.607 5, both of which were higher than that reported for many other arthropods. These results show that the genetic diversity detected was mainly caused by individual differences within a population. Genetic distance showed that the rational division of the three geographic populations of T. tridentatus along the south-eastern coast of China was not significant, in which the genetic distance was not proportional to the geographic distance. All three horseshoe crab populations may belong to a large group, and had a high degree of genetic similarity. The high level of genetic diversity obtained from the present AFLP analysis may be due to the large effective population size of the species in Chinese waters.

  18. Genetic variation in wild populations of the tuber crop Amorphophallus konjac (Araceae) in central China as revealed by AFLP markers.

    PubMed

    Pan, C; Gichira, A W; Chen, J M

    2015-01-01

    Amorphophallus konjac is an economically important crop. In order to provide baseline information for sustainable development and conservation of the wild plant resources of A. konjac, we studied the genetic diversity and population structure of this species using amplified fragment length polymorphism (AFLP) molecular markers. We sampled 139 individuals from 10 wild populations of A. konjac in central China. Using five AFLP primer combinations, we scored a total of 270 DNA fragments, most of which were polymorphic (98.2%). Percentage of polymorphic loci, Nei's genetic diversity index, and Shannon's information index showed high levels of genetic variation within A. konjac populations. Analysis of molecular variance indicated that most of the variance (68%) resided within populations. The coefficient of genetic differentiation between populations was 0.348 and the estimated gene flow was 0.469, indicating that there was limited gene flow among the populations. Unweighted pair group method with arithmetic mean cluster analysis and principal coordinates analysis indicated that geographically close populations were more likely to cluster together. The Mantel test revealed a significant correlation between geographic and genetic distances (R2 = 0.2521, P < 0.05). The special insect-pollination system of A. konjac and the complex geography of central China are likely to have contributed to the current pattern of genetic variation of this species. In the present study, we provide several suggestions on the future protection of the wild plant genetic resources of A. konjac. PMID:26782525

  19. Genetic Differentiation between Natural and Hatchery Stocks of Japanese Scallop (Mizuhopecten yessoensis) as Revealed by AFLP Analysis

    PubMed Central

    Liu, Wei-Dong; Li, Hong-Jun; Bao, Xiang-Bo; Gao, Xiang-gang; Li, Yun-feng; He, Chong-Bo; Liu, Zhan-Jiang

    2010-01-01

    Japanese scallop (Mizuhopecten yessoensis) is a cold-tolerant bivalve that was introduced to China for aquaculture in 1982. In this study, amplified fragment length polymorphism (AFLP) markers were used to investigate levels of genetic diversity within M. yessoensis cultured stocks and compare them with wild populations. Six pairs of primer combinations generated 368 loci among 332 individuals, in four cultured and three wild populations. High polymorphism at AFLP markers was found within both cultured and wild M. yessoensis populations. The percentage of polymorphic loci ranged from 61.04% to 72.08%, while the mean heterozygosity ranged from 0.2116 to 0.2596. Compared with wild populations, the four hatchery populations showed significant genetic changes, such as lower expected heterozygosity and percentage of polymorphic loci, and smaller frequency of private alleles, all indicative of a reduction in genetic diversity. Some genetic structures were associated with the geographical distribution of samples; with all samples from Dalian and Japan being closely related, while the population from Russia fell into a distinct clade in the phylogenetic analysis. The genetic information derived from this study indicated that intentional or accidental release of selected Japanese scallops into natural sea areas might result in disturbance of local gene pools and loss of genetic variability. We recommend monitoring the genetic variability of selected hatchery populations to enhance conservation of natural Japanese scallop resources. PMID:21152310

  20. Application of PCR amplicon sequencing using a single primer pair in PCR amplification to assess variations in Helicobacter pylori CagA EPIYA tyrosine phosphorylation motifs

    PubMed Central

    2010-01-01

    Background The presence of various EPIYA tyrosine phosphorylation motifs in the CagA protein of Helicobacter pylori has been suggested to contribute to pathogenesis in adults. In this study, a unique PCR assay and sequencing strategy was developed to establish the number and variation of cagA EPIYA motifs. Findings MDA-DNA derived from gastric biopsy specimens from eleven subjects with gastritis was used with M13- and T7-sequence-tagged primers for amplification of the cagA EPIYA motif region. Automated capillary electrophoresis using a high resolution kit and amplicon sequencing confirmed variations in the cagA EPIYA motif region. In nine cases, sequencing revealed the presence of AB, ABC, or ABCC (Western type) cagA EPIYA motif, respectively. In two cases, double cagA EPIYA motifs were detected (ABC/ABCC or ABC/AB), indicating the presence of two H. pylori strains in the same biopsy. Conclusion Automated capillary electrophoresis and Amplicon sequencing using a single, M13- and T7-sequence-tagged primer pair in PCR amplification enabled a rapid molecular typing of cagA EPIYA motifs. Moreover, the techniques described allowed for a rapid detection of mixed H. pylori strains present in the same biopsy specimen. PMID:20181142

  1. Genetic diversity of Chilean and Brazilian alstroemeria species assessed by AFLP analysis.

    PubMed

    Han, T H; de Jeu, M; van Eck, H; Jacobsen, E

    2000-05-01

    One to three accessions of 22 Alstroemeria species, an interspecific hybrid (A. aurea x A. inodora), and single accessions of Bomarea salsilla and Leontochir ovallei were evaluated using the AFLP-marker technique to estimate the genetic diversity within the genus Alstroemeria. Three primer combinations generated 716 markers and discriminated all Alstroemeria species. The dendrogram inferred from the AFLP fingerprints supported the conjecture of the generic separation of the Chilean and Brazilian Alstroemeria species. The principal co-ordinate plot showed the separate allocation of the A. ligtu group and the allocation of A. aurea, which has a wide range of geographical distribution and genetic variation, in the middle of other Alstroemeria species. The genetic distances, based on AFLP markers, determined the genomic contribution of the parents to the interspecific hybrid. PMID:10849081

  2. Identification of molecular markers associated with fruit traits in olive and assessment of olive core collection with AFLP markers and fruit traits.

    PubMed

    Ipek, M; Seker, M; Ipek, A; Gul, M K

    2015-01-01

    The purpose of this study was to characterize olive core collection with amplified fragment length polymorphism (AFLP) markers and fruit traits and to determine AFLP markers significantly associated with these fruit characters in olive. A total of 168 polymorphic AFLP markers generated by five primer combinations and nine fruit traits were used to characterize relationships between 18 olive cultivars. Although all olive cultivars were discriminated from each other by either AFLP markers (<0.75 similarity level) or fruit traits, clustering based on the AFLP markers and fruit traits was not significantly correlated (r = 0.13). Partial clustering of olive cultivars by AFLP markers according to their geographical origin was observed. Associations of AFLP markers with fruits were determined using a multiple-regression analysis with stepwise addition of AFLP markers. Significant associations between eight AFLP markers and fruit traits were identified. While five AFLP markers demonstrated significant negative correlation with fruit and stone weight, width and length and total polyphenols (P < 0.05), three AFLP markers displayed significant positive correlation with α-tocopherol and γ-tocopherol (P < 0.01). This is the first report on the association of molecular markers with fruit traits in olive. Molecular markers associated with morphological and agronomic traits could be utilized for the breeding of olive cultivars. However, the association power of these markers needs to be confirmed in larger populations, and highly correlated markers should then be converted to PCR-based DNA markers such as sequence-characterized amplified region markers for better utilization. PMID:25867425

  3. Designing Polymerase Chain Reaction Primers Using Primer3Plus.

    PubMed

    Hung, Jui-Hung; Weng, Zhiping

    2016-01-01

    Designing oligonucleotide primers is a crucial step for successful molecular biology experiments that require the use of the polymerase chain reaction (PCR). PCR involves cycles of three steps: denaturation, annealing, and extension. During denaturation, double-stranded DNA (dsDNA) molecules (templates) are separated into single strands. During annealing, a pair of primers is annealed to the complementary regions of the single-stranded molecules. In the extension step, DNA polymerase extends the primers to produce DNA molecules that correspond to the region bracketed by the primers (the amplicons). All of these steps are temperature sensitive, and the common choice of temperatures is 94°C, 60°C, and 70°C, respectively. Poorly designed primers may lead to no amplification product or additional undesired amplified fragments. The goals of primer design include good primer specificity, high annealing efficiency, appropriate melting temperature, proper GC content, and the prevention of primer hairpins or primer dimers. PMID:27574202

  4. An AFLP-based genetic linkage map of channel catfish (Ictalurus punctatus) constructed by using an interspecific hybrid resource family.

    PubMed Central

    Liu, Zhanjiang; Karsi, Attila; Li, Ping; Cao, Dongfeng; Dunham, R

    2003-01-01

    Catfish is the major aquaculture species in the United States. The hybrid catfish produced by crossing channel catfish females with blue catfish males exhibit a number of desirable production traits, but their mass production has been difficult. To introduce desirable genes from blue catfish into channel catfish through introgression, a genetic linkage map is helpful. In this project, a genetic linkage map was constructed using amplified fragment length polymorphism (AFLP). A total of 607 AFLP markers were analyzed using 65 primer combinations and an interspecific backcross resource family. A total of 418 AFLP markers were assigned to 44 linkage groups. Among the remaining 189 markers, 101 were not used because of significant segregation distortion, 29 were unlinked, and 59 were eliminated because they span very large distances. The 418 AFLP markers covered 1593 cM Kosambi. The AFLP markers showed a high level of clustering that appears to be related to certain primer combinations. This linkage map will serve as the basis for mapping a greater number of markers to provide a map with high enough resolution for it to be useful for selective breeding programs using introgression. PMID:14573480

  5. AFLP-Based Analysis of Genetic Diversity, Population Structure, and Relationships with Agronomic Traits in Rice Germplasm from North Region of Iran and World Core Germplasm Set.

    PubMed

    Sorkheh, Karim; Masaeli, Mohammad; Chaleshtori, Maryam Hosseini; Adugna, Asfaw; Ercisli, Sezai

    2016-04-01

    Analysis of the genetic diversity and population structure of crops is very important for use in breeding programs and for genetic resources conservation. We analyzed the genetic diversity and population structure of 47 rice genotypes from diverse origins using amplified fragment length polymorphism (AFLP) markers and morphological characters. The 47 genotypes, which were composed of four populations: Iranian native varieties, Iranian improved varieties, International Rice Research Institute (IRRI) rice varieties, and world rice collections, were analyzed using ten primer combinations. A total of 221 scorable bands were produced with an average of 22.1 alleles per pair of primers, of which 120 (54.30%) were polymorphic. The polymorphism information content (PIC) values varied from 0.32 to 0.41 with an average of 0.35. The high percentage of polymorphic bands (%PB) was found to be 64.71 and the resolving power (R p) collections were 63.36. UPGMA clustering based on numerical data from AFLP patterns clustered all 47 genotypes into three large groups. The genetic similarity between individuals ranged from 0.54 to 0.94 with an average of 0.74. Population genetic tree showed that Iranian native cultivars formed far distant cluster from the other populations, which may indicate that these varieties had minimal genetic change over time. Analysis of molecular variance (AMOVA) revealed that the largest proportion of the variation (84%) to be within populations showing the inbreeding nature of rice. Therefore, Iranian native varieties (landraces) may have unique genes, which can be used for future breeding programs and there is a need to conserve this unique diversity. Furthermore, crossing of Iranian genotypes with the genetically distant genotypes in the other three populations may result in useful combinations, which can be used as varieties and/or lines for future rice breeding programs. PMID:26762294

  6. Phylogenetic relationships in the genus Leontopodium (Asteraceae: Gnaphalieae) based on AFLP data

    PubMed Central

    SAFER, STEFAN; TREMETSBERGER, KARIN; GUO, YAN-PING; KOHL, GUDRUN; SAMUEL, MARY R.; STUESSY, TOD F.; STUPPNER, HERMANN

    2012-01-01

    The genus Leontopodium comprises 30–41 species. The centre of diversity is the Sino-Himalayan region in south-western China, where about 15 species occur. The two species native to Europe, L. alpinum (known as the common ‘Edelweiss’) and L. nivale, are part of the cultural heritage of the people living there. Despite its importance, very little is known about the systematics of the genus. Because recent molecular studies have shown that species within this genus are closely related and difficult to distinguish with rDNA and cpDNA data, we used AFLPs to obtain a more detailed understanding of the phylogeny of the genus. Our main aims were as follows: (1) to clarify species relationships within the genus; and (2) to reveal information about the biogeography of the genus. We used AFLPs with six primer combinations to investigate 216 individuals in 38 populations of 16 different species. With AFLPs, we were able to recognize 10 different groups, all of which had strong bootstrap support. These results were also congruent with the morphology-based taxonomy of the genus. Most private and rare fragments were found in the Yunnan region (south-western China) relative to Europe and Mongolia/central China, suggesting a long-lasting in situ history of populations in the centre of diversity of the genus. Our results illustrate the utility of AFLPs to resolve phylogenetic relationships between these closely related species. PMID:23258943

  7. Genetic changes in grapevine genomes after stress induced by in vitro cultivation, thermotherapy and virus infection, as revealed by AFLP

    PubMed Central

    2009-01-01

    The Amplification Fragment Length Polymorphism (AFLP) technique was employed to study genetic variations which can be induced in vines by the stress occurring during different aspects of viticulture (in vitro cultivation, in vitro thermotherapy and virus infection). Analysis of AFLP banding patterns, generated by using 15 primer combinations, pointed to negligible genetic variation among plants exposed to individual stress. The average of similarity coefficients between differently stressed plants of the cultivars Müller Thurgau and Riesling were 0.984 and 0.991, respectively, as revealed by AFLP analysis. The low incidence of observed polymorphism demonstrates the high level of genome uniformity in plants reproduced by in vitro micropropagation via nodes, those subjected to in vitro thermotherapy and virus-infected plants. PMID:21637461

  8. Genomic distribution of AFLP markers relative to gene locations for different eukaryotic species

    PubMed Central

    2013-01-01

    Background Amplified fragment length polymorphism (AFLP) markers are frequently used for a wide range of studies, such as genome-wide mapping, population genetic diversity estimation, hybridization and introgression studies, phylogenetic analyses, and detection of signatures of selection. An important issue to be addressed for some of these fields is the distribution of the markers across the genome, particularly in relation to gene sequences. Results Using in-silico restriction fragment analysis of the genomes of nine eukaryotic species we characterise the distribution of AFLP fragments across the genome and, particularly, in relation to gene locations. First, we identify the physical position of markers across the chromosomes of all species. An observed accumulation of fragments around (peri) centromeric regions in some species is produced by repeated sequences, and this accumulation disappears when AFLP bands rather than fragments are considered. Second, we calculate the percentage of AFLP markers positioned within gene sequences. For the typical EcoRI/MseI enzyme pair, this ranges between 28 and 87% and is usually larger than that expected by chance because of the higher GC content of gene sequences relative to intergenic ones. In agreement with this, the use of enzyme pairs with GC-rich restriction sites substantially increases the above percentages. For example, using the enzyme system SacI/HpaII, 86% of AFLP markers are located within gene sequences in A. thaliana, and 100% of markers in Plasmodium falciparun. We further find that for a typical trait controlled by 50 genes of average size, if 1000 AFLPs are used in a study, the number of those within 1 kb distance from any of the genes would be only about 1–2, and only about 50% of the genes would have markers within that distance. Conclusions The high coverage of AFLP markers across the genomes and the high proportion of markers within or close to gene sequences make them suitable for genome scans and

  9. Development of a SCAR marker for male gametophyte of Gracilariopsis lemaneiformis based on AFLP technique

    NASA Astrophysics Data System (ADS)

    Zhou, Wei; Ding, Hongye; Sui, Zhenghong; Wang, Zhongxia; Wang, Jinguo

    2014-05-01

    The red alga Gracilariopsis lemaneiformis (Bory) is an economically valuable macroalgae. As a means to identify the sex of immature Gracilariopsis lemaneiformis, the amplified fragment length polymorphism (AFLP) technique was used to search for possible sex- or phase-related markers in male gametophytes, female gametophytes, and tetrasporophytes, respectively. Seven AFLP selective amplification primers were used in this study. The primer combination E-TG/M-CCA detected a specific band linked to male gametophytes. The DNA fragment was recovered and a 402-bp fragment was sequenced. However, no DNA sequence match was found in public databases. Sequence characterized amplified region (SCAR) primers were designed from the sequence to test the repeatability of the relationship to the sex, using 69 male gametophytes, 139 female gametophytes, and 47 tetrasporophytes. The test results demonstrate a good linkage and repeatability of the SCAR marker to sex. The SCAR primers developed in this study could reduce the time required for sex identification of Gracilariopsis lemaneiformis by four to six months. This can reduce both the time investment and number of specimens required in breeding experiments.

  10. Genetic Comparison of B. Anthracis and its Close Relatives Using AFLP and PCR Analysis

    SciTech Connect

    Jackson, P.J.; Hill, K.K.; Laker, M.T.; Ticknor, L.O.; Keim, P.S.

    1999-02-01

    rapidly generated by other means. AFLP sample analysis quickly generates a very large amount of molecular information about microbial genomes. However, this information cannot be analyzed rapidly using manual methods. The authors are developing a large archive of electronic AFLP signatures that is being used to identify isolates collected from medical, veterinary, forensic and environmental samples. They are also developing the computational packages necessary to rapidly and unambiguously analyze the AFLP profiles and conduct a phylogenetic comparison of these data relative to information already in the database. They will use this archive and the associated algorithms to determine the species identity of previously uncharacterized isolates and place them phylogenetically relative to other microbes based on their AFLP signatures. This study provides significant new information about microbes with environmental, veterinary and medical significance. This information can be used in further studies to understand the relationships among these species and the factors that distinguish them from one another. It should also allow identification of unique factors that contribute to important microbial traits including pathogenicity and virulence. They are also using AFLP data to identify, isolate and sequence DNA fragments that are unique to particular microbial species and strains. The fragment patterns and sequence information provide insights into the complexity and organization of bacterial genomes relative to one another. They also provide the information necessary for development of species-specific PCR primers that can be used to interrogate complex samples for the presence of B. anthracis, other microbial pathogens or their remnants.

  11. Comparison of Flavivirus Universal Primer Pairs and Development of a Rapid, Highly Sensitive Heminested Reverse Transcription-PCR Assay for Detection of Flaviviruses Targeted to a Conserved Region of the NS5 Gene Sequences

    PubMed Central

    Scaramozzino, Natale; Crance, Jean-Marc; Jouan, Alain; DeBriel, Dominique A.; Stoll, Françoise; Garin, Daniel

    2001-01-01

    Arthropod-transmitted flaviviruses are responsible for considerable morbidity and mortality, causing severe encephalitic, hemorrhagic, and febrile illnesses in humans. Because there are no specific clinical symptoms for infection by a determined virus and because different arboviruses could be present in the same area, a genus diagnosis by PCR would be a useful first-line diagnostic method. The six published Flavivirus genus primer pairs localized in the NS1, NS3, NS5, and 3′ NC regions were evaluated in terms of specificity and sensitivity with flaviviruses (including the main viruses pathogenic for humans) at a titer of 105 50% tissue culture infectious doses (TCID50s) ml−1 with a common identification step by agarose gel electrophoresis. Only one NS5 primer pair allowed the detection of all tested flaviviruses with the sensitivity limit of 105 TCID50s ml−1. Using a heminested PCR with new primers designed in the same region after an alignment of 30 different flaviviruses, the sensitivity of reverse transcription-PCR was improved and allowed the detection of about 200 infectious doses ml−1 with all of the tick- and mosquito-borne flaviviruses tested. It was confirmed that the sequenced amplified products in the NS5 region allowed predictability of flavivirus species by dendrogram, including the New York 99 West Nile strain. This technique was successfully performed with a cerebrospinal fluid sample from a patient hospitalized with West Nile virus encephalitis. PMID:11326014

  12. Genetic diversity of populations and clones of Rhopilema esculentum in China based on AFLP analysis

    NASA Astrophysics Data System (ADS)

    Qiao, Hongjin; Liu, Xiangquan; Zhang, Xijia; Jiang, Haibin; Wang, Jiying; Zhang, Limin

    2013-03-01

    Amplified fragment length polymorphisms (AFLP) markers were developed to assess the genetic variation of populations and clones of Rhopilema esculentum Kishinouye (Scyphozoa, Rhizostomatidae). One hundred and seventy-nine loci from 56 individuals of two hatchery populations and two wild populations were genotyped with five primer combinations. The polymorphic ratio, Shannon's diversity index and average heterozygosity were 70.3%, 0.346 and 0.228 for the white hatchery population, 74.3%, 0.313, and 0.201 for the red hatchery population, 79.3%, 0.349, and 0.224 for the Jiangsu wild population, and 74.9%, 0.328 and 0.210 for the Penglai wild population, respectively. Thus, all populations had a relatively high level of genetic diversity. A specific band was identified that could separate the white from the red hatchery population. There was 84.85% genetic differentiation within populations. Individual cluster analysis using unweighted pair-group method with arithmetic mean (UPGMA) suggested that hatchery populations and wild populations could be divided. For the hatchery populations, the white and red populations clustered separately; however, for the wild populations, Penglai and Jiangsu populations clustered together. The genetic diversity at the clone level was also determined. Our data suggest that there are relatively high genetic diversities within populations but low genetic differentiation between populations, which may be related to the long-term use of germplasm resources from Jiangsu Province for artificial seeding and releasing. These findings will benefit the artificial seeding and conservation of the germplasm resources.

  13. Challenges and pitfalls in the characterization of anonymous outlier AFLP markers in non-model species: lessons from an ocellated lizard genome scan

    PubMed Central

    Nunes, V L; Beaumont, M A; Butlin, R K; Paulo, O S

    2012-01-01

    In the last few years, dozens of studies have documented the detection of loci influenced by selection from genome scans in a wide range of non-model species. Many of those studies used amplified fragment length polymorphism (AFLP) markers, which became popular for being easily applicable to any organism. However, because they are anonymous markers, AFLPs impose many challenges for their isolation and identification. Most recent AFLP genome scans used capillary electrophoresis (CE), which adds even more obstacles to the isolation of bands with a specific size for sequencing. These caveats might explain the extremely low number of studies that moved from the detection of outlier AFLP markers to their actual isolation and characterization. We document our efforts to characterize a set of outlier AFLP markers from a previous genome scan with CE in ocellated lizards (Lacerta lepida). Seven outliers were successfully isolated, cloned and sequenced. Their sequences are noncoding and show internal indels or polymorphic repetitive elements (microsatellites). Three outliers were converted into codominant markers by using specific internal primers to sequence and screen population variability from undigested DNA. Amplification in closely related lizard species was also achieved, revealing remarkable interspecific conservation in outlier loci sequences. We stress the importance of following up AFLP genome scans to validate selection signatures of outlier loci, but also report the main challenges and pitfalls that may be faced during the process. PMID:22892639

  14. Characterizing Safflower Germplasm with AFLP Molecular Markers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Safflower (Carthamus tinctorius L.) accessions from the U.S. germplasm collection were characterized using AFLP (Amplified Length Polymorphisms) markers. Separation and scoring of 392 markers was completed using the Beckman CEQ8000 capillary electrophoresis system. Twelve plants from each of eight...

  15. Comparison of RAPD, ISSR, and AFLP Molecular Markers to Reveal and Classify Orchardgrass (Dactylis glomerata L.) Germplasm Variations

    PubMed Central

    Costa, Rita; Pereira, Graça; Garrido, Inmaculada; Tavares-de-Sousa, Manuel María; Espinosa, Francisco

    2016-01-01

    Three different DNA-based techniques, Random Amplified Polymorphic DNA (RAPD), Inter Simple Sequence Repeat (ISSR) and Amplified Fragment Length Polymorphism (AFLP) markers, were used for fingerprinting Dactylis glomerata genotypes and for detecting genetic variation between the three different subspecies. In this study, RAPD assays produced 97 bands, of which 40 were polymorphic (41.2%). The ISSR primers amplified 91 bands, and 54 showed polymorphism (59.3%). Finally, the AFLP showed 100 bands, of which 92 were polymorphic (92%). The fragments were scored as present (1) or absent (0), and those readings were entered in a computer file as a binary matrix (one for each marker). Three cluster analyses were performed to express–in the form of dendrograms–the relationships among the genotypes and the genetic variability detected. All DNA-based techniques used were able to amplify all of the genotypes. There were highly significant correlation coefficients between cophenetic matrices based on the genetic distance for the RAPD, ISSR, AFLP, and combined RAPD-ISSR-AFLP data (0.68, 0.78, 0.70, and 0.70, respectively). Two hypotheses were formulated to explain these results; both of them are in agreement with the results obtained using these three types of molecular markers. We conclude that when we study genotypes close related, the analysis of variability could require more than one DNA-based technique; in fact, the genetic variation present in different sources could interfere or combine with the more or less polymorphic ability, as our results showed for RAPD, ISSR and AFLP markers. Our results indicate that AFLP seemed to be the best-suited molecular assay for fingerprinting and assessing genetic relationship among genotypes of Dactylis glomerata. PMID:27070939

  16. Comparison of RAPD, ISSR, and AFLP Molecular Markers to Reveal and Classify Orchardgrass (Dactylis glomerata L.) Germplasm Variations.

    PubMed

    Costa, Rita; Pereira, Graça; Garrido, Inmaculada; Tavares-de-Sousa, Manuel María; Espinosa, Francisco

    2016-01-01

    Three different DNA-based techniques, Random Amplified Polymorphic DNA (RAPD), Inter Simple Sequence Repeat (ISSR) and Amplified Fragment Length Polymorphism (AFLP) markers, were used for fingerprinting Dactylis glomerata genotypes and for detecting genetic variation between the three different subspecies. In this study, RAPD assays produced 97 bands, of which 40 were polymorphic (41.2%). The ISSR primers amplified 91 bands, and 54 showed polymorphism (59.3%). Finally, the AFLP showed 100 bands, of which 92 were polymorphic (92%). The fragments were scored as present (1) or absent (0), and those readings were entered in a computer file as a binary matrix (one for each marker). Three cluster analyses were performed to express--in the form of dendrograms--the relationships among the genotypes and the genetic variability detected. All DNA-based techniques used were able to amplify all of the genotypes. There were highly significant correlation coefficients between cophenetic matrices based on the genetic distance for the RAPD, ISSR, AFLP, and combined RAPD-ISSR-AFLP data (0.68, 0.78, 0.70, and 0.70, respectively). Two hypotheses were formulated to explain these results; both of them are in agreement with the results obtained using these three types of molecular markers. We conclude that when we study genotypes close related, the analysis of variability could require more than one DNA-based technique; in fact, the genetic variation present in different sources could interfere or combine with the more or less polymorphic ability, as our results showed for RAPD, ISSR and AFLP markers. Our results indicate that AFLP seemed to be the best-suited molecular assay for fingerprinting and assessing genetic relationship among genotypes of Dactylis glomerata. PMID:27070939

  17. Identification of Lactobacillus brevis using a species-specific AFLP-derived marker.

    PubMed

    Fusco, Vincenzina; Quero, Grazia Marina; Chieffi, Daniele; Franz, Charles M A P

    2016-09-01

    A simple and specific method for the rapid detection and identification of Lactobacillus brevis was developed. A fAFLP (Fluorescent Amplified Fragment Length Polymorphisms) marker for L. brevis was used to design oligonucleotide primers for a species-specific PCR assay, targeting a 125bp fragment of the gene encoding the aldo/keto reductase of the diketogulonate-reductase family of L. brevis. This assay resulted in 100% inclusivity and exclusivity of assignment of strains to the species L. brevis. The analytical specificity of this assay was successfully tested to identify L. brevis isolates from sourdoughs. PMID:27289191

  18. Genetic diversity of the Chinese traditional herb Blumea balsamifera (Asteraceae) based on AFLP markers.

    PubMed

    Pang, Y X; Wang, W Q; Zhang, Y B; Yuan, Y; Yu, J B; Zhu, M; Chen, Y Y

    2014-01-01

    Blumea balsamifera is a commercially important medicinal herb in China and other parts of Asia. It is used to produce borneol. This plant grows in the wild, but resources have diminished greatly in recent years. We examined the genetic diversity of this species to help develop conservation strategies; 35 plants from five provinces were analyzed using AFLPs. Eight AFLP primer combinations generated 1367 fragments, giving a mean of 172 fragments per primer combination. Polymorphism in the germplasm analysis was found for 1360 (99.48%) of the fragments, of which 264 (19.27%) fragments were unique (accession specific) and 423 (25.33%) of the fragments were rare (present in less than 10% of the accessions). The polymorphic fragments were used to group the accessions in a UPGMA phenogram. Most grouping was geographical. In general, accessions coming from Guizhou and Guangxi showed higher diversities as these accessions were scattered in different groups. The genetic distance estimated by Jaccard similarity coefficient index showed low variability among genotypes (coefficient value ranged from 0.60 to 0.95). More attention should be given to the study and conservation of the biodiversity of this economically important genus. PMID:24782086

  19. Assessment of genetic diversity of landraces of Dendrocalamus hamiltonii using AFLP markers and association with biochemical traits.

    PubMed

    Waikhom, S D; Ghosh, S; Talukdar, N C; Mandi, S S

    2012-01-01

    Fermented bamboo shoots are popular traditional food items of various ethnic groups of the northeastern India, especially in Manipur State. Dendrocalamus hamiltonii is an economically important bamboo species used to produce fermented bamboo shoots. We studied genetic variability of this bamboo species in Chandel and Imphal-East (commercial production districts), using AFLP molecular markers. Each of the selected primers detected polymorphisms and 1614 (95.8%) were found to be polymorphic. Cluster analysis based on Dice similarity coefficients using UPGMA differentiated the populations into two major groups. Principal coordinate analysis based on the AFLP data clearly separated the populations according to their genetic diversity and antioxidant activity. Four primers were tested through multiple regression analysis to identify marker-trait association between AFLP data and biochemical attributes, i.e., antioxidant activity and total cyanide content. The 273 bp generated by EcoRI-AAG(Joe)/MseI-CTC showed high positive correlation with antioxidant activity (r = 0.729, P < 0.01). The 396 bp generated by EcoRI-AAC(Ned)/MseI-CTG were negatively correlated with cyanide content (r = -0.694, P < 0.01). Thus, we found association of DNA markers with antioxidant activities and total cyanide content. These results could be of use for the identification of superior genotypes with desirable traits. PMID:22782634

  20. Phonics Primer

    ERIC Educational Resources Information Center

    Elam, Sandra

    2007-01-01

    This primer lists the 44 sounds in the English language and then gives steps for teaching those 44 sounds and their most common spelling patterns. In addition to learning sounds and spellings, each day the student must read lists of phonetically related words and spell these words from dictation. Phonics instruction must be reinforced by having…

  1. AFLP Polymorphisms Allow High Resolution Genetic Analysis of American Tegumentary Leishmaniasis Agents Circulating in Panama and Other Members of the Leishmania Genus

    PubMed Central

    Restrepo, Carlos M.; De La Guardia, Carolina; Sousa, Octavio E.; Calzada, José E.; Fernández, Patricia L.; Lleonart, Ricardo

    2013-01-01

    American Tegumentary Leishmaniasis is caused by parasites of the genus Leishmania, and causes significant health problems throughout the Americas. In Panama, Leishmania parasites are endemic, causing thousands of new cases every year, mostly of the cutaneous form. In the last years, the burden of the disease has increased, coincident with increasing disturbances in its natural sylvatic environments. The study of genetic variation in parasites is important for a better understanding of the biology, population genetics, and ultimately the evolution and epidemiology of these organisms. Very few attempts have been made to characterize genetic polymorphisms of parasites isolated from Panamanian patients of cutaneous leishmaniasis. Here we present data on the genetic variability of local isolates of Leishmania, as well as specimens from several other species, by means of Amplified Fragment Length Polymorphisms (AFLP), a technique seldom used to study genetic makeup of parasites. We demonstrate that this technique allows detection of very high levels of genetic variability in local isolates of Leishmania panamensis in a highly reproducible manner. The analysis of AFLP fingerprints generated by unique selective primer combinations in L. panamensis suggests a predominant clonal mode of reproduction. Using fluorescently labeled primers, many taxon-specific fragments were identified which may show potential as species diagnostic fragments. The AFLP permitted a high resolution genetic analysis of the Leishmania genus, clearly separating certain groups among L. panamensis specimens and highly related species such as L. panamensis and L. guyanensis. The phylogenetic networks reconstructed from our AFLP data are congruent with established taxonomy for the genus Leishmania, even when using single selective primer combinations. Results of this study demonstrate that AFLP polymorphisms can be informative for genetic characterization in Leishmania parasites, at both intra and inter

  2. Significance tests and weighted values for AFLP similarities, based on Arabidopsis in silico AFLP fragment length distributions.

    PubMed Central

    Koopman, Wim J M; Gort, Gerrit

    2004-01-01

    Many AFLP studies include relatively unrelated genotypes that contribute noise to data sets instead of signal. We developed: (1) estimates of expected AFLP similarities between unrelated genotypes, (2) significance tests for AFLP similarities, enabling the detection of unrelated genotypes, and (3) weighted similarity coefficients, including band position information. Detection of unrelated genotypes and use of weighted similarity coefficients will make the analysis of AFLP data sets more informative and more reliable. Test statistics and weighted coefficients were developed for total numbers of shared bands and for Dice, Jaccard, Nei and Li, and simple matching (dis)similarity coefficients. Theoretical and in silico AFLP fragment length distributions (FLDs) were examined as a basis for the tests. The in silico AFLP FLD based on the Arabidopsis thaliana genome sequence was the most appropriate for angiosperms. The G + C content of the selective nucleotides in the in silico AFLP procedure significantly influenced the FLD. Therefore, separate test statistics were calculated for AFLP procedures with high, average, and low G + C contents in the selective nucleotides. The test statistics are generally applicable for angiosperms with a G + C content of approximately 35-40%, but represent conservative estimates for genotypes with higher G + C contents. For the latter, test statistics based on a rice genome sequence are more appropriate. PMID:15342529

  3. AFLP analysis of nephthytis (Syngonium podophyllum Schott) selected from somaclonal variants.

    PubMed

    Chen, J; Henny, R J; Devanand, P S; Chao, C T

    2006-01-01

    This study analyzed genetic differences of 19 cultivars selected from somaclonal variants of Syngonium podophyllum Schott along with their parents as well as seven additional Syngonium species and six other aroids using amplified fragment length polymorphism (AFLP) markers generated by 12 primer sets. Among the 19 somaclonal cultivars, 'Pink Allusion' was selected from 'White Butterfly'. Tissue culture of 'Pink Allusion' through organogenesis resulted in the development of 13 additional cultivars. Self-pollination of 'Pink Allusion' obtained a cultivar, 'Regina Red Allusion', and tissue culture propagation of 'Regina Red Allusion' led to the release of five other cultivars. The 12 primer sets generated a total of 1,583 scorable fragments from all accessions, of which 1,284 were polymorphic (81.9%). The percentages of polymorphic fragments within 'White Butterfly' and 'Regina Red Allusion' groups, however, were only 1.2% and 0.4%, respectively. Jaccard's similarity coefficients among somaclonal cultivars derived from 'White Butterfly' and 'Regina Red Allusion', on average, were 0.98 and 0.99, respectively. Seven out of the 15 cultivars from the 'White Butterfly' group and three out of six from the 'Regina Red Allusion' group were clearly distinguished by AFLP analysis as unique fragments were associated with respective cultivars. The unsuccessful attempt to distinguish the remaining eight cultivars from the 'White Butterfly' group and three from the 'Regina Red Allusion' group was not attributed to experimental errors or the number of primer sets used; rather it is hypothesized to be caused by DNA methylation and/or some rare mutations. This study also calls for increased genetic diversity of cultivated Syngonium as they are largely derived from somaclonal variants. PMID:16133347

  4. RATMAC PRIMER

    SciTech Connect

    Munn, R. J.; Stewart, J. M.; Norden, A. P.; Pagoaga, M. Katherine

    1980-10-01

    The language RATMAC is a direct descendant of one of the most successful structured FORTRAN languages, rational FORTRAN, RATFOR. RATMAC has all of the characteristics of RATFOR, but is augmented by a powerful recursive macro processor which is extremely useful in generating transportable FORTRAN programs. A macro is a collection of programming steps which are associated with a keyword. This keyword uniquely identifies the macro, and whenever it appears in a RATMAC program it is replaced by the collection of steps. This primer covers the language's control and decision structures, macros, file inclusion, symbolic constants, and error messages.

  5. Salinas primer.

    SciTech Connect

    Walsh, Timothy Francis; Reese, Garth M.; Bhardwaj, Manoj Kumar

    2004-08-01

    Salinas provides a massively parallel implementation of structural dynamics finite element analysis. This capability is required for high fidelity, validated models used in modal, vibration, static and shock analysis of weapons systems. General capabilities for modal, statics and transient dynamics are provided. Salinas is similar to commercial codes like Nastran or Abaqus. It has some nonlinear capability, but excels in linear computation. It is different than the above commercial codes in that it is designed to operate efficiently in a massively parallel environment. Even for an experienced analyst, running a new finite element package can be a challenge. This little primer is intended to make part of this task easier by presenting the basic steps in a simple way. The analyst is referred to the theory manual for details of the mathematics behind the work. The User's Notes should be used for more complex inputs, and will have more details about the process (as well as many more examples). More information can be found on our web pages, 3 or 4. Finite element analysis can be deceptive. Any software can give the wrong answers if used improperly, and occasionally even when used properly. Certainly a solid background in structural mechanics is necessary to build an adequate finite element model and interpret the results. This primer should provide a quick start in answering some of the more common questions that come up in using Salinas.

  6. AFLP analysis of genetic diversity and phylogenetic relationships of Brassica oleracea in Ireland.

    PubMed

    El-Esawi, Mohamed A; Germaine, Kieran; Bourke, Paula; Malone, Renee

    2016-01-01

    Brassica oleracea L. is one of the most economically important vegetable crop species of the genus Brassica L. This species is threatened in Ireland, without any prior reported genetic studies. The use of this species is being very limited due to its imprecise phylogeny and uncompleted genetic characterisation. The main objective of this study was to assess the genetic diversity and phylogenetic relationships of a set of 25 Irish B. oleracea accessions using the powerful amplified fragment length polymorphism (AFLP) technique. A total of 471 fragments were scored across all the 11 AFLP primer sets used, out of which 423 (89.8%) were polymorphic and could differentiate the accessions analysed. The dendrogram showed that cauliflowers were more closely related to cabbages than kales were, and accessions of some cabbage types were distributed among different clusters within cabbage subgroups. Approximately 33.7% of the total genetic variation was found among accessions, and 66.3% of the variation resided within accessions. The total genetic diversity (HT) and the intra-accessional genetic diversity (HS) were 0.251 and 0.156, respectively. This high level of variation demonstrates that the Irish B. oleracea accessions studied should be managed and conserved for future utilisation and exploitation in food and agriculture. In conclusion, this study addressed important phylogenetic questions within this species, and provided a new insight into the inclusion of four accessions of cabbages and kales in future breeding programs for improving varieties. AFLP markers were efficient for assessing genetic diversity and phylogenetic relationships in Irish B. oleracea species. PMID:27156498

  7. Differentiation of species of the family Acetobacteraceae by AFLP DNA fingerprinting: Gluconacetobacter kombuchae is a later heterotypic synonym of Gluconacetobacter hansenii.

    PubMed

    Cleenwerck, Ilse; De Wachter, Marjan; González, Angel; De Vuyst, Luc; De Vos, Paul

    2009-07-01

    Amplified fragment length polymorphism (AFLP) DNA fingerprinting was investigated as a tool for fast and accurate identification of acetic acid bacteria (AAB) to the species level. One hundred and thirty five reference strains and 15 additional strains, representing 50 recognized species of the family Acetobacteraceae, were subjected to AFLP analysis using the restriction enzyme combination ApaI/TaqI and the primer combination A03/T03. The reference strains had been previously subjected to either DNA-DNA hybridization or 16S-23S rRNA spacer region gene sequence analysis and were regarded as being accurately classified at the species level. The present study revealed that six of these strains should be reclassified, namely Gluconacetobacter europaeus LMG 1518 and Gluconacetobacter xylinus LMG 1510 as Gluconacetobacter xylinus and Gluconacetobacter europaeus, respectively; Gluconacetobacter kombuchae LMG 23726(T) as Gluconacetobacter hansenii; and Acetobacter orleanensis strains LMG 1545, LMG 1592 and LMG 1608 as Acetobacter cerevisiae. Cluster analysis of the AFLP DNA fingerprints of the reference strains revealed one cluster for each species, showing a linkage level below 50 % with other clusters, except for Acetobacter pasteurianus, Acetobacter indonesiensis and Acetobacter cerevisiae. These three species were separated into two, two, and three clusters, respectively. At present, confusion exists regarding the taxonomic status of Gluconacetobacter oboediens and Gluconacetobacter intermedius; the AFLP data from this study supported their classification as separate taxa. The 15 additional strains could all be identified at the species level. AFLP analysis further revealed that some species harboured genetically diverse strains, whereas other species consisted of strains showing similar banding patterns, indicating a more limited genetic diversity. It can be concluded that AFLP DNA fingerprinting is suitable for accurate identification and classification of a broad

  8. AFLP and MS-AFLP analysis of the variation within saffron crocus (Crocus sativus L.) germplasm.

    PubMed

    Busconi, Matteo; Colli, Licia; Sánchez, Rosa Ana; Santaella, Marcela; De-Los-Mozos Pascual, Marcelino; Santana, Omar; Roldán, Marta; Fernández, José-Antonio

    2015-01-01

    The presence and extent of genetic variation in saffron crocus are still debated, as testified by several contradictory articles providing contrasting results about the monomorphism or less of the species. Remarkably, phenotypic variations have been frequently observed in the field, such variations are usually unstable and can change from one growing season to another. Considering that gene expression can be influenced both by genetic and epigenetic changes, epigenetics could be a plausible cause of the alternative phenotypes. In order to obtain new insights into this issue, we carried out a molecular marker analysis of 112 accessions from the World Saffron and Crocus Collection. The accessions were grown for at least three years in the same open field conditions. The same samples were analysed using Amplified Fragment Length Polymorphism (AFLP) and Methyl Sensitive AFLP in order to search for variation at the genetic (DNA sequence) and epigenetic (cytosine methylation) level. While the genetic variability was low (4.23% polymorphic peaks and twelve (12) effective different genotypes), the methyl sensitive analysis showed the presence of high epigenetic variability (33.57% polymorphic peaks and twenty eight (28) different effective epigenotypes). The pattern obtained by Factorial Correspondence Analysis of AFLP and, in particular, of MS-AFLP data was consistent with the geographical provenance of the accessions. Very interestingly, by focusing on Spanish accessions, it was observed that the distribution of the accessions in the Factorial Correspondence Analysis is not random but tends to reflect the geographical origin. Two clearly defined clusters grouping accessions from the West (Toledo and Ciudad Real) and accessions from the East (Cuenca and Teruel) were clearly recognised. PMID:25885113

  9. AFLP and MS-AFLP Analysis of the Variation within Saffron Crocus (Crocus sativus L.) Germplasm

    PubMed Central

    Busconi, Matteo; Colli, Licia; Sánchez, Rosa Ana; Santaella, Marcela; De-Los-Mozos Pascual, Marcelino; Santana, Omar; Roldán, Marta; Fernández, José-Antonio

    2015-01-01

    The presence and extent of genetic variation in saffron crocus are still debated, as testified by several contradictory articles providing contrasting results about the monomorphism or less of the species. Remarkably, phenotypic variations have been frequently observed in the field, such variations are usually unstable and can change from one growing season to another. Considering that gene expression can be influenced both by genetic and epigenetic changes, epigenetics could be a plausible cause of the alternative phenotypes. In order to obtain new insights into this issue, we carried out a molecular marker analysis of 112 accessions from the World Saffron and Crocus Collection. The accessions were grown for at least three years in the same open field conditions. The same samples were analysed using Amplified Fragment Length Polymorphism (AFLP) and Methyl Sensitive AFLP in order to search for variation at the genetic (DNA sequence) and epigenetic (cytosine methylation) level. While the genetic variability was low (4.23% polymorphic peaks and twelve (12) effective different genotypes), the methyl sensitive analysis showed the presence of high epigenetic variability (33.57% polymorphic peaks and twenty eight (28) different effective epigenotypes). The pattern obtained by Factorial Correspondence Analysis of AFLP and, in particular, of MS-AFLP data was consistent with the geographical provenance of the accessions. Very interestingly, by focusing on Spanish accessions, it was observed that the distribution of the accessions in the Factorial Correspondence Analysis is not random but tends to reflect the geographical origin. Two clearly defined clusters grouping accessions from the West (Toledo and Ciudad Real) and accessions from the East (Cuenca and Teruel) were clearly recognised. PMID:25885113

  10. Association between the p73 gene G4C14-to-A4T14 single nucleotide polymorphism and risk of cervical cancer by high resolution melting and PCR with confronting two-pair primers in a Chinese population

    PubMed Central

    GUO, HAIYAN; YANG, SHAODI; XU, LIJIAN; LI, DING; TANG, JIANXIN; WANG, SHUANGSHAUNG; WEI, BENJIE; LIU, ZHENGCHUN

    2016-01-01

    As a member of the p53 gene family, the p73 gene can affect an individual's susceptibility to cancer through a p53-like manner. DNA sequence variation in the p73 gene has been reported to be associated with cancer risk. The present study aimed to identify whether the p73 gene G4C14-to-A4T14 single nucleotide polymorphism (SNP) is associated with risk of cervical cancer in a Chinese population. The p73 G4C14-to-A4T14 polymorphism was genotyped in 175 cervical cancer and 189 healthy control peripheral blood DNA samples using high resolution melting, polymerase chain reaction with confronting two-pair primers and direct DNA sequencing. The results demonstrated that carriers of the AT/AT genotype were associated with a significantly increased risk of cervical cancer (P=0.042; χ2=4.122; odds ratio = 2.241; 95% confidence interval = 1.013–4.956) compared with the GC/GC genotype carriers. In addition, there was a significant association between p73 genotypes and tumor size in patients with cervical cancer (P=0.014; χ2=8.607). However, no association was identified between p73 genotypes and tumor stage, histological type or lymph node metastasis in patients with cervical cancer. These results suggest that the p73 G4C14-to-A4T14 SNP may function as a marker of genetic susceptibility to cervical cancer in the Chinese population. PMID:27347206

  11. URPD: a specific product primer design tool

    PubMed Central

    2012-01-01

    Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312

  12. DNA Methylation and Methylation Polymorphism in Genetically Stable In vitro Regenerates of Jatropha curcas L. Using Methylation-Sensitive AFLP Markers.

    PubMed

    Rathore, Mangal S; Jha, Bhavanath

    2016-03-01

    The present investigation aimed to evaluate the degree and pattern of DNA methylation using methylation-sensitive AFLP (MS-AFLP) markers in genetically stable in vitro regenerates of Jatropha curcas L.. The genetically stable in vitro regenerates were raised through direct organogenesis via enhanced axillary shoot bud proliferation (Protocol-1) and in vitro-derived leaf regeneration (Protocol-2). Ten selective combinations of MS-AFLP primers produced 462 and 477 MS-AFLP bands in Protocol-1 (P-1) and Protocol-2 (P-2) regenerates, respectively. In P-1 regenerates, 15.8-31.17 % DNA was found methylated with an average of 25.24 %. In P-2 regenerates, 15.93-32.7 % DNA was found methylated with an average of 24.11 %. Using MS-AFLP in P-1 and P-2 regenerates, 11.52-25.53 % and 13.33-25.47 % polymorphism in methylated DNA was reported, respectively. Compared to the mother plant, P-1 regenerates showed hyper-methylation while P-2 showed hypo-methylation. The results clearly indicated alternation in degree and pattern of DNA methylation; hence, epigenetic instability in the genetically stable in vitro regenerates of J. curcas, developed so far using two different regeneration systems and explants of two different origins. The homologous nucleotide fragments in genomes of P-1 and P-2 regenerates showing methylation re-patterning might be involved in immediate adaptive responses and developmental processes through differential regulation of transcriptome under in vitro conditions. PMID:26588922

  13. Genomic scanning using AFLP to detect loci under selection in the moss Funaria hygrometrica along a climate gradient in the Sierra Nevada Mountains, Spain.

    PubMed

    Magdy, M; Werner, O; McDaniel, S F; Goffinet, B; Ros, R M

    2016-03-01

    The common cord moss Funaria hygrometrica has a worldwide distribution and thrives in a wide variety of environments. Here, we studied the genetic diversity in F. hygrometrica along an abiotic gradient in the Mediterranean high mountain of Sierra Nevada (Spain) using a genome scan method. Eighty-four samples from 17 locations from 24 to 2700 m were fingerprinted based on their amplified fragment length polymorphism (AFLP) banding pattern. Using PCA and Bayesian inference we found that the genetic diversity was structured in three or four clusters, respectively. Using a genome scan method we identified 13 outlier loci, which showed a signature of positive selection. Partial Mantel tests were performed between the Euclidean distance matrices of geographic and climatic variables, versus the pair-wise genetic distance of the AFLP dataset and AFLP-positive outliers dataset. AFLP-positive outlier data were significantly correlated with the gradient of the climatic variables, suggesting adaptive variation among populations of F. hygrometrica along the Sierra Nevada Mountains. We highlight the additional analyses necessary to identify the nature of these loci, and their biological role in the adaptation process. PMID:26284822

  14. AFLP Markers Identify Cornus florida Cultivars and Line

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Flowering dogwood (Cornus florida) is an important tree of forests and urban landscapes in the eastern United States. Amplified fragment length polymorphism (AFLP) markers were generated from genomic DNA of 17 cultivars and lines and four duplicate samples. Cultivar specific markers were identified...

  15. SBE primer : multiplexing minisequencing-based genotyping

    SciTech Connect

    Kaderali, L.; Deshpande, A.; Uribe-Romeo, F. J.; Schliep, A.; Torney, D. C.

    2002-01-01

    Single-nucleotide polymorphism (SNP) analysis is a powerful tool for mapping and diagnosing disease-related alleles. Most of the known genetic diseases are caused by point mutations, and a growing number of SNPs will be routinely analyzed to diagnose genetic disorders. Mutation analysis by polymerase mediated single-base primer extension (minisequencing) can be massively parallelized using for example DNA microchips or flow cytometry with microspheres as solid support. By adding a unique oligonucleotide tag to the 5-inch end of the minisequencing primer and attaching the complementary anti-tag to the array or bead surface, the assay can be 'demultiplexed'. However, such high-throughput scoring of SNPs requires a high level of primer multiplexing in order to analyze multiple loci in one assay, thus enabling inexpensive and fast polymorphism scoring. Primers can be chosen from either the plus or the minus strand, and primers used in the same experiment must not bind to one another. To genotype a given number of polymorphic sites, the question is which primer to use for each SNP, and which primers to group into the same experiment. Furthermore, a crosshybridization-free tag/anti-tag code is required in order to sort the extended primers to the corresponding microspheres or chip spots. These problems pose challenging algorithmic questions. We present a computer program lo automate the design process for the assay. Oligonucleotide primers for the reaction are automatically selected by the software, a unique DNA tag/anti-tag system is generated, and the pairing of primers and DNA-Tags is automatically done in a way to avoid any crossreactivity. We report first results on a 45-plex genotyping assay, indicating that minisequencing can be adapted to be a powerful tool for high-throughput, massively parallel genotyping.

  16. Identification of Amplified Fragment Length Polymorphism (AFLP) Markers Tightly Associated with Drought Stress Gene in Male Sterile and Fertile Salvia miltiorrhiza Bunge

    PubMed Central

    Zhang, Yuejin; Guo, Lijun; Shu, Zhiming; Sun, Yiyue; Chen, Yuanyuan; Liang, Zongsuo; Guo, Hongbo

    2013-01-01

    Consistent grain yield in drought environment has attracted wide attention due to global climate change. However, the important drought-related traits/genes in crops have been rarely reported. Many near-isogenic lines (NILs) of male sterile and fertile Salvia miltiorrhiza have been obtained in our previous work through testcross and backcross in continuous field experiments conducted in 2006–2009. Both segregating sterile and fertile populations were subjected to bulked segregant analysis (BSA) and amplified fragment length polymorphism (AFLP) with 384 and 170 primer combinations, respectively. One out of 14 AFLP markers (E9/M3246) was identified in treated fertile population as tightly linked to the drought stress gene with a recombination frequency of 6.98% and at a distance of 7.02 cM. One of 15 other markers (E2/M5357) was identified in a treated sterile population that is closely associated with the drought stress gene. It had a recombination frequency of 4.65% and at a distance of 4.66 cM. Interestingly, the E9/M3246 fragment was found to be identical to another AFLP fragment E11/M4208 that was tightly linked to the male sterile gene of S. miltiorrhiza with 95% identity and e-value 4 × 10−93. Blastn analysis suggested that the drought stress gene sequence showed higher identity with nucleotides in Arabidopsis chromosome 1–5. PMID:23525049

  17. ConservedPrimers 2.0: A high-throughput pipeline for comparative genome referenced intron-flanking PCR primer design and its application in wheat SNP discovery

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In some genomic applications it is necessary to design large numbers of PCR primers in exons flanking one or several introns on the basis of orthologous gene sequences in related species. The primer pairs designed by this target gene approach are called "intron-flanking primers" or because they ar...

  18. Microsatellite primers for red drum (Sciaenops ocellatus)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In this note, we document polymerase-chain-reaction (PCR) primer pairs for 101, nuclear-encoded microsatellites designed and developed from a red drum (Sciaenops ocellatus) genomic library. The 101 microsatellites (Genbank Accession Numbers EU015882-EU015982) were amplified successfully and used to...

  19. Polyacid macromolecule primers

    DOEpatents

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  20. Polyacid macromolecule primers

    DOEpatents

    Sugama, Toshifumi

    1989-01-01

    Hydrophylic polyacids, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests.

  1. An AFLP genetic linkage map of pacific abalone ( Haliotis discus hannai)

    NASA Astrophysics Data System (ADS)

    Qi, Li; Yanhong, Xu; Ruihai, Yu; Akihiro, Kijima

    2007-07-01

    A genetic linkage map of Pacific abalone ( Haliotis discus hannai) was constructed using AFLP markers based on a two-way pseudo-testeross strategy in a full-sib family. With 33 primer combinations, a total of 455 markers (225 from the female parent and 230 from the male parent) segregated in a 1:1 ratio, corresponding to DNA polymorphism: heterozygous in one parent and null in the other. The female framework map consisted of 174 markers distributed in 18 linkage groups, equivalent to the H. discus hannai haploid chromosome number, and spanning a total length of 2031.4 cM, with an average interval of 13.0 cM between adjacent markers. The male framework map consisted of 195 markers mapped on 19 linkage groups, spanning a total length of 2273.4 cM, with an average spacing of 12.9 cM between adjacent markers. The estimated coverage for the framework linkage maps was 81.2% for the female and 82.1% for the male, on the basis of two estimates of genome length. Fifty-two markers (11.4%) remained unlinked. The level of segregation distortion observed in this cross was 20.4%. These linkage maps will serve as a starting point for linkage studies in the Pacific abalone with potential application for marker-assisted selection in breeding programs.

  2. Education Vouchers. A Primer.

    ERIC Educational Resources Information Center

    Richter, Philip C.; Hollender, Mary Jo

    This document is intended to serve both as a primer and as an annotated bibliography about educational vouchers. As a primer, it introduces the reader to the concept of vouchers and to the variety of issues--including political, economic, legal, and educational issues--associated with vouchers. As an annotated bibliography, it provides a summary…

  3. PrecisePrimer: an easy-to-use web server for designing PCR primers for DNA library cloning and DNA shuffling.

    PubMed

    Pauthenier, Cyrille; Faulon, Jean-Loup

    2014-07-01

    PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. PMID:24829457

  4. Microsatellite primer resource for Populus developed from

    SciTech Connect

    Yin, Tongming; Yang, Xiaohan; Gunter, Lee E; Tuskan, Gerald A; Wullschleger, Stan D; Huang, Prof. Minren; Li, Shuxian; Zhang, Xinye

    2008-01-01

    In this study, 148 428 simple sequence repeat (SSR) primer pairs were designed from the unambiguously mapped sequence scaffolds of the Nisqually-1 genome. The physical position of the priming sites were identified along each of the 19 Populus chromosomes, and it was specified whether the priming sequences belong to intronic, intergenic, exonic or UTR regions. A subset of 150 SSR loci were amplified and a high amplification success rate (72%) was obtained in P. tremuloides, which belongs to a divergent subgenus of Populus relative to Nisqually-1. PCR reactions showed that the amplification success rate of exonic primer pairs was much higher than that of the intronic/intergenic primer pairs. Applying ANOVA and regression analyses to the flanking sequences of microsatellites, the repeat lengths, the GC contents of the repeats, the repeat motif numbers, the repeat motif length and the base composition of the repeat motif, it was determined that only the base composition of the repeat motif and the repeat motif length significantly affect the microsatellite variability in P. tremuloides samples. The SSR primer resource developed in this study provides a database for selecting highly transferable SSR markers with known physical position in the Populus genome and provides a comprehensive genetic tool to extend the genome sequence of Nisqually-1 to genetic studies in different Populus species.

  5. Better primer design for metagenomics applications by increasing taxonomic distinguishability

    PubMed Central

    2013-01-01

    Current methods of understanding microbiome composition and structure rely on accurately estimating the number of distinct species and their relative abundance. Most of these methods require an efficient PCR whose forward and reverse primers bind well to the same, large number of identifiable species, and produce amplicons that are unique. It is therefore not surprising that currently used universal primers designed many years ago are not as efficient and fail to bind to recently cataloged species. We propose an automated general method of designing PCR primer pairs that abide by primer design rules and uses current sequence database as input. Since the method is automated, primers can be designed for targeted microbial species or updated as species are added or deleted from the database. In silico experiments and laboratory experiments confirm the efficacy of the newly designed primers for metagenomics applications. PMID:24564926

  6. Predicting Offspring Performance in Hop (Humulus lupulus L.) Using AFLP Markers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pedigree and combining ability information for male and female hop accessions is limited and choice of breeding parents remains guesswork. This studies’ objective was to determine if AFLP markers could be used to predict offspring performance in hop. AFLP assays were used to estimate genetic dista...

  7. Technical advances: genome-wide cDNA-AFLP analysis of the Arabidopsis transcriptome.

    PubMed

    Volkmuth, Wayne; Turk, Stefan; Shapiro, Amy; Fang, Yiwen; Kiegle, Ed; van Haaren, Mark; Donson, Jonathan

    2003-01-01

    cDNA-AFLP, a technology historically used to identify small numbers of differentially expressed genes, was adapted as a genome-wide transcript profiling method. mRNA levels were assayed in a diverse range of tissues from Arabidopsis thaliana plants grown under a variety of environmental conditions. The resulting cDNA-AFLP fragments were sequenced. By linking cDNA-AFLP fragments to their corresponding mRNAs via these sequences, a database was generated that contained quantitative expression information for up to two-thirds of gene loci in A. thaliana, ecotype Ws. Using this resource, the expression levels of genes, including those with high nucleotide sequence similarity, could be determined in a high-throughput manner merely by comparing cDNA-AFLP profiles with the database. The lengths of cDNA-AFLP fragments inferred from their electrophoretic mobilities correlated well with actual fragment lengths determined by sequencing. In addition, the concentrations of AFLP fragments from single cDNAs were highly correlated, illustrating the validity of cDNA-AFLP as a quantitative, genome-wide, transcript profiling method. cDNA-AFLP profiles were also qualitatively consistent with mRNA profiles obtained from parallel microarray analysis, and with data from previous studies. PMID:14506844

  8. Quick spacecraft charging primer

    SciTech Connect

    Larsen, Brian Arthur

    2014-03-12

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  9. AFLPs support deep relationships among darters (Percidae: Etheostomatinae) consistent with morphological hypotheses

    PubMed Central

    Smith, T A; Mendelson, T C; Page, L M

    2011-01-01

    Recent attention has focused on the efficacy of amplified fragment length polymorphisms (AFLPs) for resolving deep evolutionary relationships. Here we show that AFLPs provide resolution of deep relationships within the family Percidae that are more consistent with previous morphological hypotheses than are relationships proposed by previous molecular analyses. Despite in silico predictions, we were able to resolve relatively ancient divergences, estimated at >25 MA. We show that the most distantly related species share the fewest fragments, but suggest that large data sets and extensive taxon sampling are sufficient to overcome this obstacle of the AFLP technique for deep divergences. We compare genetic distances estimated from mitochondrial DNA with those from AFLPs and contrast traditional PAUP* Nei–Li AFLP genetic distances with a recently proposed method utilizing the Dice equation with constraining nucleotides. PMID:21712845

  10. Plastid primers for angiosperm phylogenetics and phylogeography1

    PubMed Central

    Prince, Linda M.

    2015-01-01

    Premise of the study: PCR primers are available for virtually every region of the plastid genome. Selection of which primer pairs to use is second only to selection of the genic region. This is particularly true for research at the species/population interface. Methods: Primer pairs for 130 regions of the chloroplast genome were evaluated in 12 species distributed across the angiosperms. Likelihood of amplification success was inferred based upon number and location of mismatches to target sequence. Intraspecific sequence variability was evaluated under three different criteria in four species. Results: Many published primer pairs should work across all taxa sampled, with the exception of failure due to genomic reorganization events. Universal barcoding primers were the least likely to work (65% success). The list of most variable regions for use within species has little in common with the lists identified in prior studies. Discussion: Published primer sequences should amplify a diversity of flowering plant DNAs, even those designed for specific taxonomic groups. “Universal” primers may have extremely limited utility. There was little consistency in likelihood of amplification success for any given publication across lineages or within lineage across publications. PMID:26082876

  11. Alterations of leaf cell ultrastructures and AFLP DNA profiles in Earth-grown tomato plants propagated from long-term six years Mir-flown seeds

    NASA Astrophysics Data System (ADS)

    Liu, Min; Xue, Huai; Pan, Yi; Zhang, Chunhua; Lu, Jinying

    Leaf cell ultrastructures and DNA variations in the firstand the second-generation of Earthgrown tomato (Lycopersicon esculentun Mill) plants that had been endured a long-term six years spaceflight in the Mir were compared to their ground-based control plants, under observations with a Transmission Electron Microscope and the Amplification Fragment Length Polymorphism (AFLP) analysis. For alterations in the morphological ultrastructures, one plant among the 11 first-generation plants generated from 30 Mir-flown seeds had a three-layered palisade cell structure, while other 10 first-generation plants and all ground-based controls had one-layered palisade cell structure in leaves. Starch grains were larger and in clusters, numbers of starch grains increased in the chloroplasts in the Mir-flown plants. Leaf cells became contracted and deformed, and cell shape patterns were different in the Mir-flown plants. For the leaf genomic DNA alterations, 34 DNA bands were polymorphic with a 1.32% polymorphism among 2582 DNA bands in the first-generation Mir-flown plants. Band types in the spaceflight treated plants were also different from those in the ground-based control. Of 11 survived first-generation plants, 7 spaceflight treated plants (Plant Nos. 1-6 and No. 9) had a same 7 polymorphic bands and a same 0.27%DNA mutation. The DNA mutation rate was greatest in Plants No.10 and No.7 (0.90% and 0.94%), less in Plant No.11 (0.31%) and least in Plant No.8 (0.20%). For the 38 send-generation plants propagated from the No. 5 Mir-flown seed, 6 DNA bands were polymorphic with a 0.23% polymorphism among 2564 amplified DNA bands. Among those 38 second-generation plants amplified by primer pair (E4: ACC, M8: CTT), one DNA band disappeared in 29 second-generation plants and in the original Mir-flown No. 5 plant, compared to the ground-base controls. Among the 38 second-generation plants generated from the Mir-flown No. 5 seed, the DNA band types of 29 second-generation plants were

  12. First environmental isolation of Cryptococcus gattii, genotype AFLP5, from India and a global review.

    PubMed

    Chowdhary, A; Prakash, A; Randhawa, H S; Kathuria, S; Hagen, F; Klaassen, C H; Meis, J F

    2013-05-01

    We report the first environmental isolation from India of Cryptococcus gattii, genotype amplified fragment length polymorphism 5 (AFLP5), which is one of the rarely reported genotypes of this pathogen. It originated from decayed wood inside a trunk hollow of Manilkara hexandra, a native tree in Delhi. We investigated 101 isolates of C. gattii, originating from 556 samples of decayed wood inside trunk hollows of 311 heterogeneous tree species and their surrounding soil. Of these, only a solitary isolate proved to be AFLP5, the remainder belonged to AFLP4. Antifungal susceptibility testing showed a low MIC90 (0.25 μg ml(-1) ) of the new azoles posaconazole and isavuconazole for these environmental isolates. Genotype AFLP5 has been mainly reported from environmental sources in Colombia and from clinical sources in California (USA), where it seems to be endemic. Phylogenetic analysis of multi-locus sequence typing data showed that the Indian AFLP5 C. gattii isolate had a distinct profile compared with a cluster of mainly Colombian and Californian C. gattii AFLP5 isolates. As molecular typing of human pathogenic fungi is still in its infancy and not accessible to many countries, our current knowledge cannot be taken as reflective of the true geographic distribution of C. gattii AFLP5 or its other rarely reported molecular types. PMID:23336629

  13. China Energy Primer

    SciTech Connect

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  14. Sex-linked AFLP markers indicate a pseudoautosomal region in hemp ( Cannabis sativa L.).

    PubMed

    Peil, A; Flachowsky, H; Schumann, E; Weber, W E

    2003-06-01

    In dioecious plants of hemp ( Cannabis sativa L.), males are regarded as heterogametic XY and females as homogametic XX, although it is difficult to discriminate the X cytologically from the Y. The Y chromosome is somewhat larger than the X. Our aim was to analyse AFLP markers on X and Y, and to use them to gain some insight into the structure of the sex chromosomes. Markers located on the sex chromosomes can be grouped into different classes, depending on the presence or absence of a fragment on the X and/or the Y. They are detected by separately analysing male and female progenies of a single cross. Five markers were found to be located on both chromosomes. A few recombinants were observed for marker pairs of this class in the male progenies. Two completely linked markers located on the Y chromosome in the male parent show a recombination rate of r = 0.25 with sex. Recombination must have occurred between the sex chromosomes in the male parent. The recombination analysis led to the conclusion that there is a pseudoautosomal region (PAR) on the sex chromosomes, allowing recombination between the X and the Y chromosome. The other regions of the sex chromosomes show only a few recombination events, for the Y as well as for the X. These results are discussed in comparison to other dioecious plants. PMID:12835935

  15. Primer on Social Economics.

    ERIC Educational Resources Information Center

    Darcy, Robert L.

    An elaboration of the author's booklet entitled "First Steps Toward Economic Understanding," this primer is designed to help the reader develop a functional understanding of the economic process so that he can make wiser decisions on issues of social policy and on matters affecting his economic well-being. The document is not "economics in one…

  16. Nulcear materials production: Primer

    SciTech Connect

    Not Available

    1988-09-01

    The US Department of Energy's (DOE's) Office of Nuclear Materials Production (NMP) is responsible for managing the production and recovery of nuclear materials for national defense. NMP oversees the production of radioactive materials for government, commercial, industrial, and medical applications. This Primer is a general introduction to NMP's major activities.

  17. An SAT® Validity Primer

    ERIC Educational Resources Information Center

    Shaw, Emily J.

    2015-01-01

    This primer should provide the reader with a deeper understanding of the concept of test validity and will present the recent available validity evidence on the relationship between SAT® scores and important college outcomes. In addition, the content examined on the SAT will be discussed as well as the fundamental attention paid to the fairness of…

  18. Universal COI primers for DNA barcoding amphibians.

    PubMed

    Che, Jing; Chen, Hong-Man; Yang, Jun-Xiao; Jin, Jie-Qiong; Jiang, Ke; Yuan, Zhi-Yong; Murphy, Robert W; Zhang, Ya-Ping

    2012-03-01

    DNA barcoding is a proven tool for the rapid and unambiguous identification of species, which is essential for many activities including the vouchering tissue samples in the genome 10K initiative, genealogical reconstructions, forensics and biodiversity surveys, among many other applications. A large-scale effort is underway to barcode all amphibian species using the universally sequenced DNA region, a partial fragment of mitochondrial cytochrome oxidase subunit I COI. This fragment is desirable because it appears to be superior to 16S for barcoding, at least for some groups of salamanders. The barcoding of amphibians is essential in part because many species are now endangered. Unfortunately, existing primers for COI often fail to achieve this goal. Herein, we report two new pairs of primers (➀, ➁) that in combination serve to universally amplify and sequence all three orders of Chinese amphibians as represented by 36 genera. This taxonomic diversity, which includes caecilians, salamanders and frogs, suggests that the new primer pairs will universally amplify COI for the vast majority species of amphibians. PMID:22145866

  19. Crystalline Silica Primer

    USGS Publications Warehouse

    Staff- Branch of Industrial Minerals

    1992-01-01

    substance and will present a nontechnical overview of the techniques used to measure crystalline silica. Because this primer is meant to be a starting point for anyone interested in learning more about crystalline silica, a list of selected readings and other resources is included. The detailed glossary, which defines many terms that are beyond the scope of this publication, is designed to help the reader move from this presentation to a more technical one, the inevitable next step.

  20. Primer on molecular genetics

    SciTech Connect

    Not Available

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  1. Coal Bed Methane Primer

    SciTech Connect

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  2. Caries inhibition by fluoride-releasing primers.

    PubMed

    Kerber, L J; Donly, K J

    1993-10-01

    This study evaluated the caries inhibition of dentin primers with the addition of fluoride. Two standardized Class V preparations were placed in 20 molars, the gingival margin placed below the cementoenamel junction and the occlusal margin placed in enamel. Two dentin primers (Syntac and ScotchPrep) were placed in equal numbers of 20 preparations, according to manufacturer's instructions. Ammonium fluoride (10% by weight) was then added to these primers and they were placed in the remaining 20 preparations, opposing the non-fluoridated primer of the same system. All teeth were then restored with a non-fluoridated resin composite. All teeth were subjected to an artificial caries challenge (pH 4.2) for 5 days. Sections of 100 microns were obtained, photographed under polarized light microscopy, then demineralized areas were quantitated by digitization. Results demonstrated the mean areas (mm2 +/- S.D.) demineralization at 0.25 mm, 0.5 mm and 1.0 mm from the restoration margin to be: Syntac/fluoride (1.44 +/- 0.49, 1.68 +/- 0.54, 3.72 +/- 0.74); Syntac (1.99 +/- 0.58, 1.50 +/- 0.35, 2.98 +/- 1.26); ScotchPrep/fluoride (1.23 +/- 0.68, 1.55 +/- 0.64, 3.08 +/- 1.16); ScotchPrep (1.90 +/- 0.83, 1.71 +/- .038, 3.36 +/- 0.62). A paired t-test indicated primers with fluoride to demonstrate significantly less demineralization 0.25 mm from the restoration margin (P < 0.07). PMID:7880460

  3. Genetic variation and differentiation in wide ranging populations of razor clam ( Sinonovacula constricta) inferred from AFLP markers

    NASA Astrophysics Data System (ADS)

    Wang, Jingbo; Li, Qi; Kong, Lingfeng

    2010-09-01

    The genetic variation and differentiation of the razor clam Sinonovacula constricta distributed along the coast of China were studied through amplified fragment length polymorphism (AFLP) analysis. Six primer combinations generated 193 fragments. The H e values varied from 0.322 to 0.463 and the percentage of polymorphic loci ranged from 74.1% to 98.4%, which indicates a high level of genetic diversity. Cluster analysis by Nei’s pairwise distance grouped all specimens by geographical origins. AMOVA consistently showed that genetic variation among populations was 8.71%, and most of the variation came from the genetic variation within populations (91.29%). Genetic differentiation among the six populations was moderate; pairwise F ST ranged from 0.0282 to 0.1480, which indicated that S. constricta populations along the coast of China are genetically connected. Among all the six populations, the Beihai population is the mostly differentiated from the others, suggesting that Hainan Island and Leizhou Peninsula act as barriers to gene flow. All populations abide isolation by distance model as indicated by Mantel test, except for ZS (Zhoushan) and YQ (Yueqing) populations. Information obtained in this study will provide guidelines for conservation and fishery management of this species in the future.

  4. Differential Gene Expression for Curvularia eragrostidis Pathogenic Incidence in Crabgrass (Digitaria sanguinalis) Revealed by cDNA-AFLP Analysis

    PubMed Central

    Wang, Jianshu; Wang, Xuemin; Yuan, Bohua; Qiang, Sheng

    2013-01-01

    Gene expression profiles of Digitaria sanguinalis infected by Curvularia eragrostidis strain QZ-2000 at two concentrations of conidia and two dew durations were analyzed by cDNA amplified fragment length polymorphisms (cDNA-AFLP). Inoculum strength was more determinant of gene expression than dew duration. A total of 256 primer combinations were used for selective amplification and 1214 transcript-derived fragments (TDFs) were selected for their differential expression. Of these, 518 up-regulated differentially expressed TDFs were identified. Forty-six differential cDNA fragments were chosen to be cloned and 35 of them were successfully cloned and sequenced, of which 25 were homologous to genes of known function according to the GenBank database. Only 6 genes were up-regulated in Curvularia eragrostidis-inoculated D. sanguinalis, with functions involved in signal transduction, energy metabolism, cell growth and development, stress responses, abscisic acid biosynthesis and response. It appears that a few pathways may be important parts of the pathogenic strategy of C. eragrostidis strain QZ-2000 on D. sanguinalis. Our study provides the fundamentals to further study the pathogenic mechanism, screen for optimal C. eragrostidis strains as potential mycoherbicide and apply this product to control D. sanguinalis. PMID:24116044

  5. Universal primers that amplify RNA from all three flavivirus subgroups

    PubMed Central

    Maher-Sturgess, Sheryl L; Forrester, Naomi L; Wayper, Paul J; Gould, Ernest A; Hall, Roy A; Barnard, Ross T; Gibbs, Mark J

    2008-01-01

    Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5) coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers. PMID:18218114

  6. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    USGS Publications Warehouse

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  7. A Quantum Groups Primer

    NASA Astrophysics Data System (ADS)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  8. Laser Doppler velocimetry primer

    NASA Technical Reports Server (NTRS)

    Bachalo, William D.

    1985-01-01

    Advanced research in experimental fluid dynamics required a familiarity with sophisticated measurement techniques. In some cases, the development and application of new techniques is required for difficult measurements. Optical methods and in particular, the laser Doppler velocimeter (LDV) are now recognized as the most reliable means for performing measurements in complex turbulent flows. And such, the experimental fluid dynamicist should be familiar with the principles of operation of the method and the details associated with its application. Thus, the goals of this primer are to efficiently transmit the basic concepts of the LDV method to potential users and to provide references that describe the specific areas in greater detail.

  9. Phylogeny of bovine species based on AFLP fingerprinting.

    PubMed

    Buntjer, J B; Otsen, M; Nijman, I J; Kuiper, M T R; Lenstra, J A

    2002-01-01

    The Bovini species comprise both domestic and wild cattle species. Published phylogenies of this tribe based on mitochondrial DNA contain anomalies, while nuclear sequences show only low variation. We have used amplified fragment length polymorphism (AFLP) fingerprinting in order to detect variation in loci distributed over the nuclear genome. Computer-assisted scoring of electrophoretic fingerprinting patterns yielded 361 markers, which provided sufficient redundancy to suppress stochastic effects of intraspecies polymorphisms and length homoplasies (comigration of non-homologous fragments). Tree reconstructions reveal three clusters: African buffalo with water buffalo, ox with zebu, and bison with wisent. Similarity values suggest a clustering of gaur and banteng, but bifurcating clustering algorithms did not assign consistent positions to these species and yak. We propose that because of shared polymorphisms and reticulations, tree topologies are only partially adequate to represent the phylogeny of the Bovini. Principal-coordinate analysis positions zebu between a gaur/banteng cluster and taurine cattle. This correlates with the region of origin of these species and suggests that genomic distances between the cattle species have been influenced by genetic exchange between neighbouring ancestral populations. PMID:11813106

  10. Multiplexed Primer Prediction for PCR

    2007-07-23

    MPP predicts sets of multiplex-compatible primers for Polymerase Chain Reaction (PCR), finding a near minimal set of primers such that at least one amplicon will be generated from every target sequence in the input file. The code finds highly conserved oligos that are suitable as primers, according to user-specified desired primer characteristics such as length, melting temperature, and amplicon length. The primers are predicted not to form unwanted dimer or hairpin structures. The target sequencesmore » used as input can be diverse, since no multiple sequence alighment is required. The code is scalable, taking up to tens of thousands of sequences as input, and works, for example, to find a "universal primer set" for all viral genomes provided as a single input file. The code generates a periodic check-point file, thus in the event of premature execution termination, the application can be restarted from the last check-point file.« less

  11. Limited-life cartridge primers

    DOEpatents

    Makowiecki, D.M.; Rosen, R.S.

    1998-06-30

    A cartridge primer is described which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML`s would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers. 10 figs.

  12. Limited-life cartridge primers

    DOEpatents

    Makowiecki, Daniel M.; Rosen, Robert S.

    1998-01-01

    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  13. Limited-life cartridge primers

    DOEpatents

    Makowiecki, Daniel M.; Rosen, Robert S.

    2005-04-19

    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  14. An economical method of indirect labeling of microsatellite primers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In order to reduce the cost of labeling and detection of microsatellite markers for QTL research, an economical method of indirect labeling reported for catfish was modified to work with honey bees. The forward primer of each pair is modified by adding a 19-base sequence at the 5’ end. This same 1...

  15. Large-scale Gene Ontology analysis of plant transcriptome-derived sequences retrieved by AFLP technology

    PubMed Central

    Botton, Alessandro; Galla, Giulio; Conesa, Ana; Bachem, Christian; Ramina, Angelo; Barcaccia, Gianni

    2008-01-01

    Background After 10-year-use of AFLP (Amplified Fragment Length Polymorphism) technology for DNA fingerprinting and mRNA profiling, large repertories of genome- and transcriptome-derived sequences are available in public databases for model, crop and tree species. AFLP marker systems have been and are being extensively exploited for genome scanning and gene mapping, as well as cDNA-AFLP for transcriptome profiling and differentially expressed gene cloning. The evaluation, annotation and classification of genomic markers and expressed transcripts would be of great utility for both functional genomics and systems biology research in plants. This may be achieved by means of the Gene Ontology (GO), consisting in three structured vocabularies (i.e. ontologies) describing genes, transcripts and proteins of any organism in terms of their associated cellular component, biological process and molecular function in a species-independent manner. In this paper, the functional annotation of about 8,000 AFLP-derived ESTs retrieved in the NCBI databases was carried out by using GO terminology. Results Descriptive statistics on the type, size and nature of gene sequences obtained by means of AFLP technology were calculated. The gene products associated with mRNA transcripts were then classified according to the three main GO vocabularies. A comparison of the functional content of cDNA-AFLP records was also performed by splitting the sequence dataset into monocots and dicots and by comparing them to all annotated ESTs of Arabidopsis and rice, respectively. On the whole, the statistical parameters adopted for the in silico AFLP-derived transcriptome-anchored sequence analysis proved to be critical for obtaining reliable GO results. Such an exhaustive annotation may offer a suitable platform for functional genomics, particularly useful in non-model species. Conclusion Reliable GO annotations of AFLP-derived sequences can be gathered through the optimization of the experimental steps

  16. A Brief Taxometrics Primer

    PubMed Central

    Beauchaine, Theodore P.

    2009-01-01

    Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

  17. STR primer concordance study.

    PubMed

    Budowle, B; Masibay, A; Anderson, S J; Barna, C; Biega, L; Brenneke, S; Brown, B L; Cramer, J; DeGroot, G A; Douglas, D; Duceman, B; Eastman, A; Giles, R; Hamill, J; Haase, D J; Janssen, D W; Kupferschmid, T D; Lawton, T; Lemire, C; Llewellyn, B; Moretti, T; Neves, J; Palaski, C; Schueler, S; Sgueglia, J; Sprecher, C; Tomsey, C; Yet, D

    2001-12-15

    Over 1500 population database samples comprising African Americans, Caucasians, Hispanics, Native Americans, Chamorros and Filipinos were typed using the PowerPlex 16 and the Profiler Plus/COfiler kits. Except for the D8S1179 locus in Chamorros and Filipinos from Guam, there were eight examples in which a typing difference due to allele dropout was observed. At the D8S1179 locus in the population samples from Guam, there were 13 examples of allele dropout observed when using the Profiler Plus kit. The data support that the primers used in the PowerPlex 16, Profiler Plus, and COfiler kits are reliable for typing reference samples that are for use in CODIS. In addition, allele frequency databases have been established for the STR loci Penta D and Penta E. Both loci are highly polymorphic. PMID:11741760

  18. MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR

    PubMed Central

    Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

    2015-01-01

    Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. PMID:26109350

  19. SNP Discovery by Illumina-Based Transcriptome Sequencing of the Olive and the Genetic Characterization of Turkish Olive Genotypes Revealed by AFLP, SSR and SNP Markers

    PubMed Central

    Kaya, Hilal Betul; Cetin, Oznur; Kaya, Hulya; Sahin, Mustafa; Sefer, Filiz; Kahraman, Abdullah; Tanyolac, Bahattin

    2013-01-01

    Background The olive tree (Olea europaea L.) is a diploid (2n = 2x = 46) outcrossing species mainly grown in the Mediterranean area, where it is the most important oil-producing crop. Because of its economic, cultural and ecological importance, various DNA markers have been used in the olive to characterize and elucidate homonyms, synonyms and unknown accessions. However, a comprehensive characterization and a full sequence of its transcriptome are unavailable, leading to the importance of an efficient large-scale single nucleotide polymorphism (SNP) discovery in olive. The objectives of this study were (1) to discover olive SNPs using next-generation sequencing and to identify SNP primers for cultivar identification and (2) to characterize 96 olive genotypes originating from different regions of Turkey. Methodology/Principal Findings Next-generation sequencing technology was used with five distinct olive genotypes and generated cDNA, producing 126,542,413 reads using an Illumina Genome Analyzer IIx. Following quality and size trimming, the high-quality reads were assembled into 22,052 contigs with an average length of 1,321 bases and 45 singletons. The SNPs were filtered and 2,987 high-quality putative SNP primers were identified. The assembled sequences and singletons were subjected to BLAST similarity searches and annotated with a Gene Ontology identifier. To identify the 96 olive genotypes, these SNP primers were applied to the genotypes in combination with amplified fragment length polymorphism (AFLP) and simple sequence repeats (SSR) markers. Conclusions/Significance This study marks the highest number of SNP markers discovered to date from olive genotypes using transcriptome sequencing. The developed SNP markers will provide a useful source for molecular genetic studies, such as genetic diversity and characterization, high density quantitative trait locus (QTL) analysis, association mapping and map-based gene cloning in the olive. High levels of

  20. Modification of the aggregation behaviour of the environmental Ralstonia eutropha-like strain AE815 is reflected by both surface hydrophobicity and amplified fragment length polymorphism (AFLP) patterns.

    PubMed

    Bossier, P; Top, E M; Huys, G; Kersters, K; Boonaert, C J; Rouxhet, P G; Verstraete, W

    2000-02-01

    After inoculation of the plasmid-free non-aggregative Ralstonia eutropha-like strain AE815 in activated sludge, followed by reisolation on a selective medium, a mutant strain A3 was obtained, which was characterized by an autoaggregative behaviour. Strain A3 had also acquired an IncP1 plasmid, pLME1, co-aggregated with yeast cells when co-cultured, and stained better with Congo red than did the AE815 strain. Contact angle measurements showed that the mutant strain was considerably more hydrophobic than the parent strain AE815, and scanning electron microscopy (SEM) revealed the production of an extracellular substance. A similar hydrophobic mutant (AE176R) could be isolated from the AE815-isogenic R. eutropha-like strain AE176. With the DNA fingerprinting technique repetitive extragenic palindromic-polymerase chain reaction (REP-PCR), no differences between these four strains, AE815, A3, AE176 and AE176R, could be revealed. However, using the amplified fragment length polymorphism (AFLP) DNA fingerprinting technique with three different primer combinations, small but clear reproducible differences between the banding patterns of the autoaggregative mutants and their non-autoaggregative parent strains were observed for each primer set. These studies demonstrate that, upon introduction of a strain in an activated sludge microbial community, minor genetic changes readily occur, which can nevertheless have major consequences for the phenotype of the strain and its aggregation behaviour. PMID:11243262

  1. Amplification of human papillomavirus DNA sequences by using conserved primers.

    PubMed Central

    Gregoire, L; Arella, M; Campione-Piccardo, J; Lancaster, W D

    1989-01-01

    The polymerase chain reaction has potential for use in the detection of small amounts of human papillomavirus (HPV) viral nucleic acids present in clinical specimens. However, new HPV types for which no probes exist would remain undetected by using type-specific primers for the polymerase chain reaction before hybridization. Primers corresponding to highly conserved HPV sequences may be useful for detecting low amounts of known HPV DNA as well as new HPV types. Here we analyze a pair of primers derived from conserved sequences within the E1 open reading frame for HPV sequence amplification by using the polymerase chain reaction. The longest perfect homology among HPV sequences is a 12-mer within the first exon of E1M. A region of conserved amino acids coded by the E1 open reading frame allowed the detection of another highly conserved region about 850 base pairs downstream. Two 21-mers derived from these conserved regions were used to amplify sequences from all HPV DNAs used as templates. The amplified DNA was shown to be specific for HPV sequences within the E1 open reading frame. DNA from HPVs whose sequences were not available were amplified by using these two primers. HPV DNA sequences in clinical specimens could also be amplified with the primers. Images PMID:2556429

  2. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  3. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  4. Express Primer Tool for high-throughput gene cloning and expression

    2002-12-01

    A tool to assist in the design of primers for DNA amplification. The Express Primer web-based tool generates primer sequences specifically for the generation of expression clones for both lab scale and high-throughput projects. The application is designed not only to allow the user complete flexibility to specify primer design parameters but also to minimize the amount of manual intervention needed to generate a large number of primers for simultaneous amplification of multiple target genes.more » The Express Primer Tool enables the user to specify various experimental parameters (e.g. optimal Tm, Tm range, maximum Tm difference) for single or multiple candidate sequence(s) in FASTA format input as a flat text (ASCII) file. The application generates condidate primers, selects optimal primer pairs, and writes the forward and reverse primers pairs to an Excel file that is suitable for electronic submission to a synthesis facility. The program parameters emphasize high-throughput but allow for target atrition at various stages of the project.« less

  5. The PCR-SSP Manager computer program: a tool for maintaining sequence alignments and automatically updating the specificities of PCR-SSP primers and primer mixes.

    PubMed

    Bunce, M; Barnardo, M C; Welsh, K I

    1998-08-01

    An emerging problem of molecular typing methods such as PCR amplification using sequence-specific primers (PCR-SSP) is that they frequently require updating as new alleles are constantly being described which potentially affect the specificity of every PCR-SSP reaction. PCR-SSP uses pairs of primers to detect cis-linked polymorphisms and thus each new allele described must be compared to each individual primer pair. Furthermore, sequence homology between the various loci for class I and class II means that, for example, new HLA-A sequences have to be compared with HLA-B and HLA-C primer mixes to rule out cross-locus amplification. We have developed a computer program known as SSP Manager which is capable of aligning HLA class I and class II sequences obtained from Internet-accessible databases such as GenBank. The program then updates all individual primer specificities held in its database before updating the specificities of all primer mixes. Sets of primer mixes can then be combined from the primer mix directory to create PCR-SSP typing trays which are subsequently analysed by the program. A report is generated which stipulates whether all known sequences are amplified and the reason for apparent failure to test for individual alleles, e.g. a lack of relevant sequence information. SSP Manager has the flexibility to cope with unusual sequences (deletions and insertions), primers with internal mismatches and primers with a deliberate mismatch. The program also has many tools for developing new primer mixes, such as the facility to search for novel reactions using Boolean operators. The organisation and operational use of the SSP Manager program is described and its uses are illustrated with an updated allele list for our previously described Phototyping PCR-SSP class I and class II typing set. The SSP Manager is available on request from the authors. PMID:9756405

  6. Analysis of genetic diversity in crocuses with Carpathian Basin origin using AFLP-markers.

    PubMed

    Surányi, G; Máthé, C; Mosolygó, Agnes; Borbély, G; Vasas, G

    2010-01-01

    Crocus taxonomy has until now been based primarily on morphology, taking chromosome numbers into consideration. The genetics and genome structure of the genus, the relationships and diversity within the genus are not well known. Amplified fragment length polymorphism (AFLP) is a whole genome approach to study genetic variation that is gaining in popularity for lower-level systematics. The present study employed the AFLP technique for analyzing relationships among taxa of the Crocus genus (particularly the Crocus vernus aggregate) with Carpathian Basin origin. The molecular variance obtained was based on amplification, separation and detection of EcoRI and Tru1I double-digested Crocus spp. genomic DNAs. Our results confirm the relatedness of C. tommasinianus, C. vittatus and C. heuffelianus at the Verni series of the Crocus genus. C. banaticus is taxonomically isolated as the sole member of the subgenus Crociris based on unique morphological features, but the difference is not convincing from AFLP data. The second interesting AFLP analysis result is the position of C. scepusiensis which separated it from the Crocus vernus aggregate. PMID:21565773

  7. Relationship of European Persimmon (Diospyros kaki Thunb.) Cultivars to Asian Cultivars, Characterized Using AFLPs.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Sixty one persimmon (Diospyros kaki Thunb.) selections, including 17 Italian, 11 Spanish, 13 Japanese, six Korean, five Chinese, one Israeli, and eight of unknown origin, were evaluated for genetic differences by AFLP analysis. Relationships among cultivars were evaluated by UPGMA clustering, Neigh...

  8. Molecular Phylogeny of Citrullus Species as Inferred from AFLPs and SSRs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Thirty-one accessions of Citrullus spp. belonging to C. lanatus var. lanatus, C. lanatus var. citroids and Citrullus colocynthis were subjected to phylogenetic analysis using combined data sets of AFLPs and SSRs. Tree topologies inferred by Neighbor Joining analysis have resolved the phylogenic rel...

  9. Genetic diversity in conventional and synthetic wheats with drought and salinity tolerance based on AFLP

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genetic diversity, among fourteen drought and twenty-seven salinity tolerant conventional and synthetic wheat (Triticum sp.) accessions containing different sources of the D genome, was assessed using amplified fragment length polymorphism (AFLP). The wheat accessions were analyzed with 20 EcoRI/Mse...

  10. Bootsie: estimation of coefficient of variation of AFLP data by bootstrap analysis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Bootsie is an English-native replacement for ASG Coelho’s “DBOOT” utility for estimating coefficient of variation of a population of AFLP marker data using bootstrapping. Bootsie improves on DBOOT by supporting batch processing, time-to-completion estimation, built-in graphs, and a suite of export t...

  11. Developing AFLP Markers to study genetic differentiation of the Cotton Fleahopper, Pseudatomoscelis seriatus (Reuter) (Hemiptera: Miridae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genetic comparisons of fleahopper populations in cotton and weed hosts may be useful for identifying the weed sources contributing the majority of fleahoppers in cotton. Molecular markers such as amplified fragment length polymorphisms (AFLP) are useful to identify genetic similarities and differen...

  12. Genetic diversity of sweet sorghum germplasm in Mexico using AFLP and SSR markers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The objective of this work was to evaluate the diversity and genetic relationships between lines and varieties of the sweet sorghum (Sorghum bicolor) germplasm bank of the National Institute for Forestry, Agriculture and Livestock Research, Mexico, using AFLP and SSR markers. The molecular markers ...

  13. Bayesian statistical treatment of the fluorescence of AFLP bands leads to accurate genetic structure inference.

    PubMed

    Gaggiotti, Oscar E

    2010-11-01

    Ever since the introduction of allozymes in the 1960s, evolutionary biologists and ecologists have continued to search for more powerful molecular markers to estimate important parameters such as effective population size and migration rates and to make inferences about the demographic history of populations, the relationships between individuals and the genetic architecture of phenotypic variation (Bensch & Akesson 2005; Bonin et al. 2007). Choosing a marker requires a thorough consideration of the trade-offs associated with the different techniques and the type of data obtained from them. Some markers can be very informative but require substantial amounts of start-up time (e.g. microsatellites), while others require very little time but are much less polymorphic. Amplified fragment length polymorphism (AFLP) is a firmly established molecular marker technique that falls in this latter category. AFLPs are widely distributed throughout the genome and can be used on organisms for which there is no a priori sequence information (Meudt & Clarke 2007). These properties together with their moderate cost and short start-up time have made them the method of choice for many molecular ecology studies of wild species (Bensch & Akesson 2005). However, they have a major disadvantage, they are dominant. This represents a very important limitation because many statistical genetics methods appropriate for molecular ecology studies require the use of codominant markers. In this issue, Foll et al. (2010) present an innovative hierarchical Bayesian method that overcomes this limitation. The proposed approach represents a comprehensive statistical treatment of the fluorescence of AFLP bands and leads to accurate inferences about the genetic structure of natural populations. Besides allowing a quasi-codominant treatment of AFLPs, this new method also solves the difficult problems posed by subjectivity in the scoring of AFLP bands. PMID:20958811

  14. New cyt b gene universal primer set for forensic analysis.

    PubMed

    Lopez-Oceja, A; Gamarra, D; Borragan, S; Jiménez-Moreno, S; de Pancorbo, M M

    2016-07-01

    Analysis of mitochondrial DNA, and in particular the cytochrome b gene (cyt b), has become an essential tool for species identification in routine forensic practice. In cases of degraded samples, where the DNA is fractionated, universal primers that are highly efficient for the amplification of the target region are necessary. Therefore, in the present study a new universal cyt b primer set with high species identification capabilities, even in samples with highly degraded DNA, has been developed. In order to achieve this objective, the primers were designed following the alignment of complete sequences of the cyt b from 751 species from the Class of Mammalia listed in GenBank. A highly variable region of 148bp flanked by highly conserved sequences was chosen for placing the primers. The effectiveness of the new pair of primers was examined in 63 animal species belonging to 38 Families from 14 Orders and 5 Classes (Mammalia, Aves, Reptilia, Actinopterygii, and Malacostraca). Species determination was possible in all cases, which shows that the fragment analyzed provided a high capability for species identification. Furthermore, to ensure the efficiency of the 148bp fragment, the intraspecific variability was analyzed by calculating the concordance between individuals with the BLAST tool from the NCBI (National Center for Biotechnological Information). The intraspecific concordance levels were superior to 97% in all species. Likewise, the phylogenetic information from the selected fragment was confirmed by obtaining the phylogenetic tree from the sequences of the species analyzed. Evidence of the high power of phylogenetic discrimination of the analyzed fragment of the cyt b was obtained, as 93.75% of the species were grouped within their corresponding Orders. Finally, the analysis of 40 degraded samples with small-size DNA fragments showed that the new pair of primers permits identifying the species, even when the DNA is highly degraded as it is very common in

  15. A LISA Interferometry Primer

    NASA Technical Reports Server (NTRS)

    Thorpe, James Ira

    2010-01-01

    A key challenge for all gravitational wave detectors in the detection of changes in the fractional difference between pairs of test masses with sufficient precision to measure astrophysical strains with amplitudes on the order of approx.10(exp -21). ln the case of the five million km arms of LISA, this equates to distance measurements on the ten picometer level. LISA interferometry utilizes a decentralized topology, in which each of the sciencecraft houses its own light sources, detectors, and electronics. The measurements made at each of the sciencecraft are then telemetered to ground and combined to extract the strain experienced by the constellation as a whole. I will present an overview of LISA interferometry and highlight some of the key components and technologies that make it possible.

  16. Sequence-specific DNA primer effects on telomerase polymerization activity.

    PubMed Central

    Lee, M S; Blackburn, E H

    1993-01-01

    The ribonucleoprotein enzyme telomerase synthesizes one strand of telomeric DNA by copying a template sequence within the RNA moiety of the enzyme. Kinetic studies of this polymerization reaction were used to analyze the mechanism and properties of the telomerase from Tetrahymena thermophila. This enzyme synthesizes TTGGGG repeats, the telomeric DNA sequence of this species, by elongating a DNA primer whose 3' end base pairs with the template-forming domain of the RNA. The enzyme was found to act nonprocessively with short (10- to 12-nucleotide) primers but to become processive as TTGGGG repeats were added. Variation of the 5' sequences of short primers with a common 3' end identified sequence-specific effects which are distinct from those involving base pairing of the 3' end of the primer with the RNA template and which can markedly induce enzyme activity by increasing the catalytic rate of the telomerase polymerization reaction. These results identify an additional mechanistic basis for telomere and DNA end recognition by telomerase in vivo. Images PMID:8413255

  17. PCR Primers for Metazoan Mitochondrial 12S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Kweskin, Matthew; Knowlton, Nancy

    2012-01-01

    Background Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. Methodology/Principal Findings A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These regions were used to design a primer pair that flanks a more variable region in the gene. Then all of the complete metazoan mitochondrial genomes available in NCBI's Organelle Genome Resources database were used to determine the percentage of taxa that would likely be amplified using these primers. Results suggest that these primers will amplify target sequences for many metazoans. Conclusions/Significance Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis because of their ability to amplify sequences from many metazoans. PMID:22536450

  18. Pick a Pair. Pancake Pairs

    ERIC Educational Resources Information Center

    Miller, Pat

    2005-01-01

    Cold February weather and pancakes are a traditional pairing. Pancake Day began as a way to eat up the foods that were abstained from in Lent--traditionally meat, fat, eggs and dairy products. The best-known pancake event is The Pancake Day Race in Buckinghamshire, England, which has been run since 1445. This column describes pairs of books that…

  19. [Screening of peafowl microsatellite primers and analysis of genetic diversity].

    PubMed

    Bao, Wen-Bin; Chen, Guo-Hong; Shu, Jing-Ting; Xu, Qi; Li, Hui-Fang

    2006-10-01

    The applicability of chicken microsatellite primers to peafowl population was analyzed in the present paper, and the results showed 14 of 29 pairs of microsatellite primers from chicken could amplify peafowl DNA and produce specific allele patterns. A mean of 1.71 alleles was found for each locus. Seven pairs were highly polymorphic, and MCW0080 and MCW0098 were ideal markers for peafowl. Genetic diversity analysis within and between the green peafowl and the blue peafowl populations demonstrated that the expected heterozygosity of two peafowl populations were 0.2482 and 0.2744, respectively. The inbreeding index (FST), Reynolds' genetic distance and gene flow between the two populations were 0.078, 0.0603 and 3.896 respectively. These results indicate that the heterozygosity and the genetic diversity of these two peafowl populations were very low, and suggest a tendency towards intermixing. PMID:17035182

  20. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    PubMed

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics. PMID:25229098

  1. Vygotsky on Education Primer. Peter Lang Primer. Volume 30

    ERIC Educational Resources Information Center

    Lake, Robert

    2012-01-01

    The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…

  2. Charter School Primer. Peter Lang Primer. Volume 34

    ERIC Educational Resources Information Center

    Tryjankowski, Anne Marie

    2012-01-01

    The "Charter School Primer" presents an overview of public charter schools in the United States. The book discusses what charter schools are; the history of public charter school choice in the United States; the role of teachers, parents, boards, and unions in the charter school movement; and gives examples of innovations in education made…

  3. Genetic and physical mapping of sex-linked AFLP markers in Nile tilapia (Oreochromis niloticus).

    PubMed

    Lee, Bo-Young; Coutanceau, Jean-Pierre; Ozouf-Costaz, Catherine; D'Cotta, Helena; Baroiller, Jean-Francois; Kocher, Thomas D

    2011-06-01

    Identification of the sex-determining genes of the Nile tilapia (Oreochromis niloticus) has important implications for commercial aquaculture. We previously identified an XX/XY sex-determining locus in this species within a 10-cM interval between markers GM201 and UNH995 on linkage group one (LG1). In order to refine this region, we developed new AFLP markers using bulked segregant analysis of the mapping families. We identified three AFLP markers that showed a sex-specific pattern of segregation. All three mapped near, but just outside, the previously identified sex-determining region on LG1. Hybridization of BAC clones containing these markers to chromosome spreads confirmed that the XX/XY sex-determining locus is on one of the small chromosomes in O. niloticus. PMID:20953654

  4. Improved Bacterial 16S rRNA Gene (V4 and V4-5) and Fungal Internal Transcribed Spacer Marker Gene Primers for Microbial Community Surveys

    SciTech Connect

    Walters , William; Hyde, Embriette R.; Berg-Lyons, Donna; Ackermann, Gail; Humphrey, Greg; Parada , Alma; Gilbert, Jack A.; Jansson, Janet K.; Caporaso, Greg; Fuhrman, Jed A.; Apprill, Amy; Knight, Rob

    2015-12-22

    Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of datasets amplified with varied primers requires attention. Here we examine the performance of modified 16S rRNA gene and ITS primers for archaea/bacteria and fungi, respectively, with non-aquatic samples. We moved primer barcodes to the 5’-end, allowing for a range of different 3’ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4-5 of the 16S rRNA gene. We additionally demonstrate that modifications to the 515f/806r (variable region 4) 16S primer pair, which improves detection of Thaumarchaeota and SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies.

  5. Extended metAFLP approach in studies of tissue culture induced variation (TCIV) in triticale.

    PubMed

    Machczyńska, Joanna; Orłowska, Renata; Zimny, Janusz; Bednarek, Piotr Tomasz

    2014-01-01

    We present the development of the theoretical background of the metAFLP approach which allows for partition of complex variation into sequence changes, de novo methylation and demethylation of the regenerants derived via in vitro tissue culture methods in the case of triticale. It was demonstrated that, independent of whether andro- or embryogenesis was used for plant regeneration, the level of sequence changes identified between regenerants is about 10 %. Moreover, DNA demethylation prevails over de novo methylation of the regenerants compared to the donor plant. The metAFLP approach allows for the evaluation of numerous quantitative characteristics. For instance, one may quantify the number of sites unaffected by tissue culture approaches, global site DNA methylation etc. It is suggested that the approach could be useful for breeders in order to control plant material uniformity or for the evaluation of modified in vitro tissue culture approaches allowing for control of the (epi)mutation level. The extended metAFLP approach presented here delivers sufficient background for the evaluation of software that could facilitate analyses of the tissue culture induced variation. PMID:25242884

  6. AFLPs and Mitochondrial Haplotypes Reveal Local Adaptation to Extreme Thermal Environments in a Freshwater Gastropod

    PubMed Central

    Quintela, María; Johansson, Magnus P.; Kristjánsson, Bjarni K.; Barreiro, Rodolfo; Laurila, Anssi

    2014-01-01

    The way environmental variation shapes neutral and adaptive genetic variation in natural populations is a key issue in evolutionary biology. Genome scans allow the identification of the genetic basis of local adaptation without previous knowledge of genetic variation or traits under selection. Candidate loci for divergent adaptation are expected to show higher FST than neutral loci influenced solely by random genetic drift, migration and mutation. The comparison of spatial patterns of neutral markers and loci under selection may help disentangle the effects of gene flow, genetic drift and selection among populations living in contrasting environments. Using the gastropod Radix balthica as a system, we analyzed 376 AFLP markers and 25 mtDNA COI haplotypes for candidate loci and associations with local adaptation among contrasting thermal environments in Lake Mývatn, a volcanic lake in northern Iceland. We found that 2% of the analysed AFLP markers were under directional selection and 12% of the mitochondrial haplotypes correlated with differing thermal habitats. The genetic networks were concordant for AFLP markers and mitochondrial haplotypes, depicting distinct topologies at neutral and candidate loci. Neutral topologies were characterized by intense gene flow revealed by dense nets with edges connecting contrasting thermal habitats, whereas the connections at candidate loci were mostly restricted to populations within each thermal habitat and the number of edges decreased with temperature. Our results suggest microgeographic adaptation within Lake Mývatn and highlight the utility of genome scans in detecting adaptive divergence. PMID:25007329

  7. GOGOT: a method for the identification of differentially expressed fragments from cDNA-AFLP data

    PubMed Central

    2007-01-01

    Background One-dimensional (1-D) electrophoretic data obtained using the cDNA-AFLP method have attracted great interest for the identification of differentially expressed transcript-derived fragments (TDFs). However, high-throughput analysis of the cDNA-AFLP data is currently limited by the need for labor-intensive visual evaluation of multiple electropherograms. We would like to have high-throughput ways of identifying such TDFs. Results We describe a method, GOGOT, which automatically detects the differentially expressed TDFs in a set of time-course electropherograms. Analysis by GOGOT is conducted as follows: correction of fragment lengths of TDFs, alignment of identical TDFs across different electropherograms, normalization of peak heights, and identification of differentially expressed TDFs using a special statistic. The output of the analysis is a highly reduced list of differentially expressed TDFs. Visual evaluation confirmed that the peak alignment was performed perfectly for the TDFs by virtue of the correction of peak fragment lengths before alignment in step 1. The validity of the automated ranking of TDFs by the special statistic was confirmed by the visual evaluation of a third party. Conclusion GOGOT is useful for the automated detection of differentially expressed TDFs from cDNA-AFLP temporal electrophoretic data. The current algorithm may be applied to other electrophoretic data and temporal microarray data. PMID:17535446

  8. Genetic variability of Brazilian isolates of Alternaria alternata detected by AFLP and RAPD techniques

    PubMed Central

    Dini-Andreote, Francisco; Pietrobon, Vivian Cristina; Andreote, Fernando Dini; Romão, Aline Silva; Spósito, Marcel Bellato; Araújo, Welington Luiz

    2009-01-01

    The Alternaria brown spot (ABS) is a disease caused in tangerine plants and its hybrids by the fungus Alternaria alternata f. sp. citri which has been found in Brazil since 2001. Due to the recent occurrence in Brazilian orchards, the epidemiology and genetic variability of this pathogen is still an issue to be addressed. Here it is presented a survey about the genetic variability of this fungus by the characterization of twenty four pathogenic isolates of A. alternata f. sp. citri from citrus plants and four endophytic isolates from mango (one Alternaria tenuissima and three Alternaria arborescens). The application of two molecular markers Random Amplified Polymorphic DNA (RAPD) and Amplified Fragment Length Polymorphism (AFLP) had revealed the isolates clustering in distinct groups when fingerprintings were analyzed by Principal Components Analysis (PCA). Despite the better assessment of the genetic variability through the AFLP, significant modifications in clusters components were not observed, and only slight shifts in the positioning of isolates LRS 39/3 and 25M were observed in PCA plots. Furthermore, in both analyses, only the isolates from lemon plants revealed to be clustered, differently from the absence of clustering for other hosts or plant tissues. Summarizing, both RAPD and AFLP analyses were both efficient to detect the genetic variability within the population of the pathogenic fungus Alternaria spp., supplying information on the genetic variability of this species as a basis for further studies aiming the disease control. PMID:24031413

  9. AFLP marker analysis revealing genetic structure of the tree Parapiptadenia rigida (Benth.) Brenan (Leguminosae-Mimosoideae) in the southern Brazilian Tropical Rainforest.

    PubMed

    de Souza, Laís Bérgamo; Ruas, Eduardo A; Rodrigues, Luana A; Ruas, Claudete F; Ruas, Paulo M

    2013-12-01

    Parapiptadenia rigida is a tropical early secondary succession tree characteristic of the Tropical Atlantic Rainforest. This species is of great ecological importance in the recovery of degraded areas. In this study we investigated the variability and population genetic structure of eight populations of P. rigida. Five AFLP primer combinations were used in a sample of 159 individuals representing these eight populations, rendering a total of 126 polymorphic fragments. The averages of percentage of polymorphic loci, gene diversity, and Shannon index were 60.45%, 0.217, and 0.322, respectively. A significant correlation between the population genetic variability and the population sizes was observed. The genetic variability within populations (72.20%) was higher than between these (22.80%). No perfect correlation was observed between geographic and genetic distances, which might be explained by differences in deforestation intensities that occurred in these areas. A dendrogram constructed by the UPGMA method revealed the formation of two clusters, these also confirmed by Bayesian analysis for the number of K cluster. These results show that it is necessary to develop urgent management strategies for the conservation of certain populations of P. rigida, while other populations still preserve reasonably high levels of genetic variability. PMID:24385857

  10. A Hearing Aid Primer 1

    ERIC Educational Resources Information Center

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  11. Postsecondary Data Connections: A Primer

    ERIC Educational Resources Information Center

    Data Quality Campaign, 2011

    2011-01-01

    There is an increasing focus at the state and federal levels on linking data across the P-20/Workforce spectrum to help inform policies and practices. This primer is intended to provide policymakers with: (1) An overview of the status of states vis-a-vis the linking of postsecondary data to K-12 and workforce data; (2) A subset of questions…

  12. A Primer on Multilevel Modeling

    ERIC Educational Resources Information Center

    Hayes, Andrew F.

    2006-01-01

    Multilevel modeling (MLM) is growing in use throughout the social sciences. Although daunting from a mathematical perspective, MLM is relatively easy to employ once some basic concepts are understood. In this article, I present a primer on MLM, describing some of these principles and applying them to the analysis of a multilevel data set on…

  13. Freshwater Wetlands: A Citizen's Primer.

    ERIC Educational Resources Information Center

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of wetland…

  14. Primer vector theory and applications

    NASA Technical Reports Server (NTRS)

    Jezewski, D. J.

    1975-01-01

    A method developed to compute two-body, optimal, N-impulse trajectories was presented. The necessary conditions established define the gradient structure of the primer vector and its derivative for any set of boundary conditions and any number of impulses. Inequality constraints, a conjugate gradient iterator technique, and the use of a penalty function were also discussed.

  15. Universal primers for the amplification and sequence analysis of actin-1 from diverse mosquito species.

    PubMed

    Staley, Molly; Dorman, Karin S; Bartholomay, Lyric C; Fernández-Salas, Ildefonso; Farfan-Ale, Jose A; Loroño-Pino, Maria A; Garcia-Rejon, Julian E; Ibarra-Juarez, Luis; Blitvich, Bradley J

    2010-06-01

    We report the development of universal primers for the reverse-transcription polymerase chain reaction (RT-PCR) amplification and nucleotide sequence analysis of actin cDNAs from taxonomically diverse mosquito species. Primers specific to conserved regions of the invertebrate actin-1 gene were designed after actin cDNA sequences of Anopheles gambiae, Bombyx mori, Drosophila melanogaster, and Caenorhabditis elegans. The efficacy of these primers was determined by RT-PCR with the use of total RNA from mosquitoes belonging to 30 species and 8 genera (Aedes, Anopheles, Culex, Deinocerites, Mansonia, Psorophora, Toxorhynchites, and Wyeomyia). The RT-PCR products were sequenced, and sequence data were used to design additional primers. One primer pair, denoted as Act-2F (5'-ATGGTCGGYATGGGNCAGAAGGACTC-3') and Act-8R (5'-GATTCCATACCCAGGAAGGADGG-3'), successfully amplified an RT-PCR product of the expected size (683-nt) in all mosquito spp. tested. We propose that this primer pair can be used as an internal control to test the quality of RNA from mosquitoes collected in vector surveillance studies. These primers can also be used in molecular experiments in which the detection, amplification or silencing of a ubiquitously expressed mosquito housekeeping gene is necessary. Sequence and phylogenetic data are also presented in this report. PMID:20649132

  16. Streamlining DNA Barcoding Protocols: Automated DNA Extraction and a New cox1 Primer in Arachnid Systematics

    PubMed Central

    Vidergar, Nina; Toplak, Nataša; Kuntner, Matjaž

    2014-01-01

    Background DNA barcoding is a popular tool in taxonomic and phylogenetic studies, but for most animal lineages protocols for obtaining the barcoding sequences—mitochondrial cytochrome C oxidase subunit I (cox1 AKA CO1)—are not standardized. Our aim was to explore an optimal strategy for arachnids, focusing on the species-richest lineage, spiders by (1) improving an automated DNA extraction protocol, (2) testing the performance of commonly used primer combinations, and (3) developing a new cox1 primer suitable for more efficient alignment and phylogenetic analyses. Methodology We used exemplars of 15 species from all major spider clades, processed a range of spider tissues of varying size and quality, optimized genomic DNA extraction using the MagMAX Express magnetic particle processor—an automated high throughput DNA extraction system—and tested cox1 amplification protocols emphasizing the standard barcoding region using ten routinely employed primer pairs. Results The best results were obtained with the commonly used Folmer primers (LCO1490/HCO2198) that capture the standard barcode region, and with the C1-J-2183/C1-N-2776 primer pair that amplifies its extension. However, C1-J-2183 is designed too close to HCO2198 for well-interpreted, continuous sequence data, and in practice the resulting sequences from the two primer pairs rarely overlap. We therefore designed a new forward primer C1-J-2123 60 base pairs upstream of the C1-J-2183 binding site. The success rate of this new primer (93%) matched that of C1-J-2183. Conclusions The use of C1-J-2123 allows full, indel-free overlap of sequences obtained with the standard Folmer primers and with C1-J-2123 primer pair. Our preliminary tests suggest that in addition to spiders, C1-J-2123 will also perform in other arachnids and several other invertebrates. We provide optimal PCR protocols for these primer sets, and recommend using them for systematic efforts beyond DNA barcoding. PMID:25415202

  17. Winning Pairs.

    ERIC Educational Resources Information Center

    Monsour, Florence

    2000-01-01

    Mentoring programs that pair experienced and first-time teachers are gaining prominence in supporting, developing, and retaining new teachers. The successful Beginning Teacher Assistance program at University of Wisconsin-River Falls was designed to give new K-12 teachers the opportunity for yearlong, structured support from mentor teachers. (MLH)

  18. Design and evaluation of universal 16S rRNA gene primers for high-throughput sequencing to simultaneously detect DAMO microbes and anammox bacteria.

    PubMed

    Lu, Yong-Ze; Ding, Zhao-Wei; Ding, Jing; Fu, Liang; Zeng, Raymond J

    2015-12-15

    To develop universal 16S rRNA gene primers for high-throughput sequencing for the simultaneous detection of denitrifying anaerobic methane oxidation (DAMO) archaea, DAMO bacteria, and anaerobic ammonium oxidation (anammox) bacteria, four published primer sets (PS2-PS5) were modified. The overall coverage of the four primer pairs was evaluated in silico with the Silva SSU r119 dataset. Based on the virtual evaluation, the two best primer pairs (PS4 and PS5) were selected for further verification. Illumina MiSeq sequencing of a freshwater sediment and a culture from a DAMO-anammox reactor using these two primer pairs revealed that PS5 (341b4F-806R) was the most promising universal primer pair. This pair of primers detected both archaea and bacteria with less bias than PS4. Furthermore, an anaerobic fermentation culture and a wastewater treatment plant culture were used to verify the accuracy of PS5. More importantly, it detected DAMO archaea, DAMO bacteria, and anammox bacteria simultaneously with no false positives appeared. This universal 16S rRNA gene primer pair extends the existing molecular tools for studying the community structures and distributions of DAMO microbes and their potential interactions with anammox bacteria in different environments. PMID:26454634

  19. Development of SCAR Primers for PCR Assay to Detect Diplodia seriata

    PubMed Central

    Martín, M. T.; Cuesta, M. J.; Martín, L.

    2014-01-01

    The aim of this study was to develop primer pairs for Diplodia seriata identification, one of the most common fungal species associated with grapevine decline in Castilla y León (Spain). Genetic variability of selected isolates of D. seriata was estimated. A molecular marker was generated from a random amplified polymorphic DNA (RAPD) fragment. PCR products of around 1200 bp were obtained with OPE20 primer. The PCR products were cloned and sequenced. The sequences were compared and a fragment of 1207 bp was used to design primer pairs. Two primer pairs were selected (DS3.8 S3-DS3.8 R6 and DS3.8 S3-DS3.8 R4) that amplified a single DNA product of 634 bp and 233 bp, respectively, with D. seriata isolates. No amplification was obtained for any of the 57 isolates of other species. The designed SCAR primer pairs allowed a rapid detection of D. seriata, and were able to detect 0.1 pg of the target DNA. Detection was specific and sensitive for D. seriata. The established protocols detected these fungi in naturally infected grapevines after DNA purification. Diplodia seriata was detectable without DNA purification and isolation in 62.5% to 75% of reactions. The detection of this pathogen in wood samples has great potential for use in pathogen-free certification schemes. PMID:27437468

  20. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  1. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters)...

  2. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  3. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Primer protection. 57.6304 Section 57.6304... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters)...

  4. Using Primers to Motivate Your Students

    ERIC Educational Resources Information Center

    Graff, Dan

    2002-01-01

    Primers are used to motivate and uplift your class. They come in many different styles and can be used in a variety of ways. Making primers relevant to students helps them to learn and makes them feel appreciated and knowledgeable when they participate. Using primers in the classroom to make students feel valued brings much success.

  5. Primer residues deposited by handguns.

    PubMed

    Cooper, R; Guileyardo, J M; Stone, I C; Hall, V; Fletcher, L

    1994-12-01

    There is much anecdotal information being disseminated, even offered in expert witness testimony, concerning the deposit of primer residues on the hands of persons in front of the muzzle of handguns. We present data for 9 mm and 380 Auto pistols and for a 38 caliber revolver depicting the procedure for obtaining wipings taken from targets representing the hands of a gunshot victim. These wipings from pork tissue were then analyzed for the primer residue metals antimony, barium, and lead. The data show that the two primary metals, antimony and barium, are deposited on the targets out to 4 feet for the pistols and out to three feet for the 38-caliber revolver. Testing will continue in actual cases with the gun and ammunition involved in the shooting. PMID:7879775

  6. Widespread utility of highly informative AFLP molecular markers across divergent shark species.

    PubMed

    Zenger, Kyall R; Stow, Adam J; Peddemors, Victor; Briscoe, David A; Harcourt, Robert G

    2006-01-01

    Population numbers of many shark species are declining rapidly around the world. Despite the commercial and conservation significance, little is known on even the most fundamental aspects of their population biology. Data collection that relies on direct observation can be logistically challenging with sharks. Consequently, molecular methods are becoming increasingly important to obtain knowledge that is critical for conservation and management. Here we describe an amplified fragment length polymorphism method that can be applied universally to sharks to identify highly informative genome-wide polymorphisms from 12 primer pairs. We demonstrate the value of our method on 15 divergent shark species within the superorder Galeomorphii, including endangered species which are notorious for low levels of genetic diversity. Both the endangered sand tiger shark (Carcharodon taurus, N = 18) and the great white shark (Carcharodon carcharias, N = 7) displayed relatively high levels of allelic diversity. A total of 59 polymorphic loci (H(e) = 0.373) and 78 polymorphic loci (H(e) = 0.316) were resolved in C. taurus and C. carcharias, respectively. Results from other sharks (e.g., Orectolobus ornatus, Orectolobus sp., and Galeocerdo cuvier) produced remarkably high numbers of polymorphic loci (106, 94, and 86, respectively) from a limited sample size of only 2. A major constraint to obtaining much needed genetic data from sharks is the time-consuming process of developing molecular markers. Here we demonstrate the general utility of a technique that provides large numbers of informative loci in sharks. PMID:17150982

  7. Template-directed primer extension catalyzed by the Tetrahymena ribozyme.

    PubMed Central

    Bartel, D P; Doudna, J A; Usman, N; Szostak, J W

    1991-01-01

    The Tetrahymena ribozyme has been shown to catalyze an RNA polymerase-like reaction in which an RNA primer is extended by the sequential addition of pN nucleotides derived from GpN dinucleotides, where N = A, C, or U. Here, we show that this reaction is influenced by the presence of a template; bases that can form Watson-Crick base pairs with a template add as much as 25-fold more efficiently than mismatched bases. A mutant enzyme with an altered guanosine binding site can catalyze template-directed primer extension with all four bases when supplied with dinucleotides of the form 2-aminopurine-pN. Images PMID:2038341

  8. Water based adhesive primers on aluminum substrates

    SciTech Connect

    Wightman, J.P.; Mori, S.

    1996-12-31

    The number of aluminum alloy bonding applications has been increasing recently in the automobile industry. Primer coating of aluminum substrates is one of the main processes used to promote bond performance. Solvent based organic primers have been used for a long time but environmental regulations now require the substitution of volatile organic compounds (VOC) by alternate materials such as water based adhesive primers. However, the bond strengths obtained with many water based primers are generally lower than for solvent based ones. Water based primers which have some reactive functional groups have been proposed recently but such primers require special treatment. This paper describes a study conducted to optimize bond strength using a water based adhesive as a primer in the adhesive bonding of anodized aluminum.

  9. Characterization of the 18S rRNA Gene for Designing Universal Eukaryote Specific Primers

    PubMed Central

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M.; Troedsson, Christofer

    2014-01-01

    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies. PMID:24516555

  10. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    PubMed Central

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  11. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes.

    PubMed

    Batnyam, Nomin; Lee, Jimin; Lee, Jungnam; Hong, Seung Bok; Oh, Sejong; Han, Kyudong

    2012-01-01

    Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR) assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque) and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors. PMID:22693428

  12. Optimization of primer design for the detection of variable genomic lesions in cancer.

    PubMed

    Bashir, Ali; Liu, Yu-Tsueng; Raphael, Benjamin J; Carson, Dennis; Bafna, Vineet

    2007-11-01

    Primer approximation multiplex PCR (PAMP) is a new experimental protocol for efficiently assaying structural variation in genomes. PAMP is particularly suited to cancer genomes where the precise breakpoints of alterations such as deletions or translocations vary between patients. The design of PCR primer sets for PAMP is challenging because a large number of primer pairs are required to detect alterations in the hundreds of kilobases range that can occur in cancer. These sets of primers must achieve high coverage of the region of interest, while avoiding primer dimers and satisfying the physico-chemical constraints of good PCR primers. We describe a natural formulation of these constraints as a combinatorial optimization problem. We show that the PAMP primer design problem is NP-hard, and design algorithms based on simulated annealing and integer programming, that provide good solutions to this problem in practice. The algorithms are applied to a test region around the known CDKN2A deletion, which show excellent results even in a 1:49 mixture of mutated:wild-type cells. We use these test results to help set design parameters for larger problems. We can achieve near-optimal designs for regions close to 1 Mb. PMID:17766270

  13. Comparative in silico analysis of PCR primers suited for diagnostics and cloning of ammonia monooxygenase genes from ammonia-oxidizing bacteria.

    PubMed

    Junier, Pilar; Kim, Ok-Sun; Molina, Verónica; Limburg, Petra; Junier, Thomas; Imhoff, Johannes F; Witzel, Karl-Paul

    2008-04-01

    Over recent years, several PCR primers have been described to amplify genes encoding the structural subunits of ammonia monooxygenase (AMO) from ammonia-oxidizing bacteria (AOB). Most of them target amoA, while amoB and amoC have been neglected so far. This study compared the nucleotide sequence of 33 primers that have been used to amplify different regions of the amoCAB operon with alignments of all available sequences in public databases. The advantages and disadvantages of these primers are discussed based on the original description and the spectrum of matching sequences obtained. Additionally, new primers to amplify the almost complete amoCAB operon of AOB belonging to Betaproteobacteria (betaproteobacterial AOB), a primer pair for DGGE analysis of amoA and specific primers for gammaproteobacterial AOB, are also described. The specificity of these new primers was also evaluated using the databases of the sequences created during this study. PMID:18248438

  14. New primers for detecting and quantifying denitrifying anaerobic methane oxidation archaea in different ecological niches.

    PubMed

    Ding, Jing; Ding, Zhao-Wei; Fu, Liang; Lu, Yong-Ze; Cheng, Shuk H; Zeng, Raymond J

    2015-11-01

    The significance of ANME-2d in methane sink in the environment has been overlooked, and there was no any study evaluating the distribution of ANME-2d in the environment. New primers were thus needed to be designed for following research. In this paper, a pair of primers (DP397F and DP569R) was designed to quantify ANME-2d. The specificity and amplification efficiency of this primer pair were acceptable. PCR amplification of another pair of primers (DP142F and DP779R) generated a single, bright targeted band from the enrichment sample, but yielded faint, multiple bands from the environmental samples. Nested PCR was conducted using the primers DP142F/DP779R in the first round and DP142F/DP569R in the second round, which generated a bright targeted band. Further phylogenetic analysis showed that these targeted bands were ANME-2d-related sequences. Real-time PCR showed that the copies of the 16s ribosomal RNA gene of ANME-2d in these samples ranged from 3.72 × 10(4) to 2.30 × 10(5) copies μg(-1) DNA, indicating that the percentage of ANME-2d was greatest in a polluted river sample and least in a rice paddy sample. These results demonstrate that the newly developed real-time PCR primers could sufficiently quantify ANME-2d and that nested PCR with an appropriate combination of the new primers could successfully detect ANME-2d in environmental samples; the latter finding suggests that ANME-2d may spread in environments. PMID:26300291

  15. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae)1

    PubMed Central

    Glennon, Kelsey L.; Cron, Glynis V.

    2016-01-01

    Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125

  16. Primers for low-copy nuclear genes in the Melastomataceae1

    PubMed Central

    Reginato, Marcelo; Michelangeli, Fabián A.

    2016-01-01

    Premise of the study: Low-copy nuclear gene primers were developed for phylogenetic studies across the Melastomataceae. Methods and Results: Total genomic libraries from eight species in the Melastomataceae along with one transcriptome were used for marker identification and primer design. Eight exon-primed intron-crossing markers were amplified with success in taxa of nine tribes in the Melastomataceae. The new markers were directly sequenced for eight samples of closely related species of Miconia (Chaenanthera clade) in the tribe Miconieae. The DNA sequences for the eight loci ranged from 660 to 818 aligned base pairs. Compared with four commonly used markers in other studies, the loci developed here had a higher number of variable sites than plastid spacers (7–16 vs. 26–45) and comparable variation to the ribosomal spacers (28–39). Conclusions: The novel primer pairs should be useful for a broad range of studies of systematics and evolution in the diverse Melastomataceae. PMID:26819862

  17. First genetic linkage map for the mud crab (Scylla paramamosain) constructed using microsatellite and AFLP markers.

    PubMed

    Ma, H Y; Li, S J; Feng, N N; Ma, C Y; Wang, W; Chen, W; Ma, L B

    2016-01-01

    The mud crab (Scylla paramamosain) is of economic importance for the fisheries and aquaculture industry in China. In this study, we constructed the first genetic linkage map for this species using microsatellite and amplified fragment length polymorphism (AFLP) markers. The map consisted of 65 linkage groups, including 34 triplets and 9 doublets. A total of 212 molecular markers were mapped, including 60 microsatellites and 152 AFLP markers. The linkage groups ranged from 7 to 102.5 cM and covered 2746.4 cM in length. The mean length was 42.3 cM per linkage group, and the mean spacing was 18.68 cM. The genome size was estimated to be 5539.62 cM, with 50% coverage by the present map. Moreover, we reported 5 transcriptome-derived polymorphic microsatellite markers and characterized their polymorphism in a first-generation family. This study will facilitate studies on high-density maps and molecular marker-assisted selection in S. paramamosain and related crustacean species. PMID:27323059

  18. Identification of Genes Related to Paulownia Witches’ Broom by AFLP and MSAP

    PubMed Central

    Cao, Xibing; Fan, Guoqiang; Deng, Minjie; Zhao, Zhenli; Dong, Yanpeng

    2014-01-01

    DNA methylation is believed to play important roles in regulating gene expression in plant growth and development. Paulownia witches’ broom (PaWB) infection has been reported to be related to gene expression changes in paulownia plantlets. To determine whether DNA methylation is associated with gene expression changes in response to phytoplasma, we investigated variations in genomic DNA sequence and methylation in PaWB plantlets treated with methyl methane sulfonate (MMS) using amplified fragment length polymorphism (AFLP) and methylation-sensitive amplification polymorphism (MSAP) techniques, respectively. The results indicated that PaWB seedings recovered a normal morphology after treatment with more than 15 mg·L−1 MMS. PaWB infection did not cause changes of the paulownia DNA sequence at the AFLP level; However, DNA methylation levels and patterns were altered. Quantitative real-time PCR (qRT-PCR) showed that three of the methylated genes were up-regulated and three were down-regulated in the MMS-treated PaWB plantlets that had regained healthy morphology. These six genes might be involved in transcriptional regulation, plant defense, signal transduction and energy. The possible roles of these genes in PaWB are discussed. The results showed that changes of DNA methylation altered gene expression levels, and that MSAP might help identify genes related to PaWB. PMID:25196603

  19. Molecular characterisation of Aspergillus flavus isolates from peanut fields in India using AFLP

    PubMed Central

    Singh, Diwakar; Radhakrishnan, T.; Kumar, Vinod; Bagwan, N.B.; Basu, M.S.; Dobaria, J.R.; Mishra, Gyan P.; Chanda, S.V.

    2015-01-01

    Aflatoxin contamination of peanut, due to infection by Aspergillus flavus, is a major problem of rain-fed agriculture in India. In the present study, molecular characterisation of 187 Aspergillus flavus isolates, which were sampled from the peanut fields of Gujarat state in India, was performed using AFLP markers. On a pooled cluster analysis, the markers could successfully discriminate among the ‘A’, ‘B’ and ‘G’ group A. flavus isolates. PCoA analysis also showed equivalent results to the cluster analysis. Most of the isolates from one district could be clustered together, which indicated genetic similarity among the isolates. Further, a lot of genetic variability was observed within a district and within a group. The results of AMOVA test revealed that the variance within a population (84%) was more than that between two populations (16%). The isolates, when tested by indirect competitive ELISA, showed about 68.5% of them to be atoxigenic. Composite analysis between the aflatoxin production and AFLP data was found to be ineffective in separating the isolate types by aflatoxigenicity. Certain unique fragments, with respect to individual isolates, were also identified that may be used for development of SCAR marker to aid in rapid and precise identification of isolates. PMID:26413047

  20. [AFLP Analysis of Genetic Diversity in the Genus Mallus Mill. (Apple)].

    PubMed

    Savelyeva, E N; Kudryavtsev, A M

    2015-10-01

    The first molecular genetic analysis of the apple species and varieties from Russian collections with the AFLP marker system was performed in order to study the genetic diversity of the genus Malus, as well as to clarify the phylogeny and solve some systematic issues of the genus. Nienty-one apple accessions, including species from five sections of the genus Malus and hybrid species, were examined. The level of polymorphism constituted 90.2%. It was demonstrated that the classical taxonomy of the genus Malus, which identifies five sections based on differences in their morphological characters, is valid and may be used to classify apple species. The species assignment of the Antonovka landraces was established. All of them belonged to the species M. domestica. It was demonstrated that the Yakutskaya apple variety was a domesticated species of the section Gymnomeles, presumably, M. baccata. AFLP analysis confirmed the hybrid nature of many species. The relationships between apple varieties of the Golden group with American wild species were demonstrated. The data suggest that the species M. sieversii was the ancestor of not only the domestic apple but also of other species of the Malus sections. PMID:27169227

  1. Key Processes for Cheirolophus (Asteraceae) Diversification on Oceanic Islands Inferred from AFLP Data

    PubMed Central

    Vitales, Daniel; García-Fernández, Alfredo; Pellicer, Jaume; Vallès, Joan; Santos-Guerra, Arnoldo; Cowan, Robyn S.; Fay, Michael F.; Hidalgo, Oriane; Garnatje, Teresa

    2014-01-01

    The radiation of the genus Cheirolophus (Asteraceae) in Macaronesia constitutes a spectacular case of rapid diversification on oceanic islands. Twenty species – nine of them included in the IUCN Red List of Threatened Species – have been described to date inhabiting the Madeiran and Canarian archipelagos. A previous phylogenetic study revealed that the diversification of Cheirolophus in Macaronesia started less than 2 Ma. As a result of such an explosive speciation process, limited phylogenetic resolution was reported, mainly due to the low variability of the employed molecular markers. In the present study, we used highly polymorphic AFLP markers to i) evaluate species' boundaries, ii) infer their evolutionary relationships and iii) investigate the patterns of genetic diversity in relation to the potential processes likely involved in the radiation of Cheirolophus. One hundred and seventy-two individuals representing all Macaronesian Cheirolophus species were analysed using 249 AFLP loci. Our results suggest that geographic isolation played an important role in this radiation process. This was likely driven by the combination of poor gene flow capacity and a good ability for sporadic long-distance colonisations. In addition, we also found some traces of introgression and incipient ecological adaptation, which could have further enhanced the extraordinary diversification of Cheirolophus in Macaronesia. Last, we hypothesize that current threat categories assigned to Macaronesian Cheirolophus species do not reflect their respective evolutionary relevance, so future evaluations of their conservation status should take into account the results presented here. PMID:25412495

  2. In silico PCR primer designing and validation.

    PubMed

    Kumar, Anil; Chordia, Nikita

    2015-01-01

    Polymerase chain reaction (PCR) is an enzymatic reaction whose efficiency and sensitivity largely depend on the efficiency of the primers that are used for the amplification of a concerned gene/DNA fragment. Selective amplification of nucleic acid molecules initially present in minute quantities provides a powerful tool for analyzing nucleic acids. In silico method helps in designing primers. There are various programs available for PCR primer design. Here we described designing of primers using web-based tools like "Primer3" and "Web Primer". For designing the primer, DNA template sequence is required that can be taken from any of the available sequence databases, e.g., RefSeq database. The in silico validation can be carried out using BLAST tool and Gene Runner software, which check their efficiency and specificity. Thereafter, the primers designed in silico can be validated in the wet lab. After that, these validated primers can be synthesized for use in the amplification of concerned gene/DNA fragment. PMID:25697657

  3. Nucleic acid amplification using modular branched primers

    DOEpatents

    Ulanovsky, Levy; Raja, Mugasimangalam C.

    2001-01-01

    Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.

  4. PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Knowlton, Nancy

    2012-01-01

    Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets

  5. First genetic linkage map of Taraxacum koksaghyz Rodin based on AFLP, SSR, COS and EST-SSR markers.

    PubMed

    Arias, Marina; Hernandez, Monica; Remondegui, Naroa; Huvenaars, Koen; van Dijk, Peter; Ritter, Enrique

    2016-01-01

    Taraxacum koksaghyz Rodin (TKS) has been studied in many occasions as a possible alternative source for natural rubber production of good quality and for inulin production. Some tire companies are already testing TKS tire prototypes. There are also many investigations on the production of bio-fuels from inulin and inulin applications for health improvement and in the food industry. A limited amount of genomic resources exist for TKS and particularly no genetic linkage map is available in this species. We have constructed the first TKS genetic linkage map based on AFLP, COS, SSR and EST-SSR markers. The integrated linkage map with eight linkage groups (LG), representing the eight chromosomes of Russian dandelion, has 185 individual AFLP markers from parent 1, 188 individual AFLP markers from parent 2, 75 common AFLP markers and 6 COS, 1 SSR and 63 EST-SSR loci. Blasting the EST-SSR sequences against known sequences from lettuce allowed a partial alignment of our TKS map with a lettuce map. Blast searches against plant gene databases revealed some homologies with useful genes for downstream applications in the future. PMID:27488242

  6. DETECTION OF GENETIC VARIATION IN WILD POPULATIONS OF THREE ALLIUM SPECIES USING AMPLIFIED FRAGMENT LENGTH POLYMORPHISMS (AFLP)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The genus Allium is distributed worldwide and includes about 80 North American species, with at least 13 occurring in Utah. This study examines amplified fragment length polymorphism (AFLP) variation within and among wild populations of three Allium species varying in abundance and distribution, na...

  7. First genetic linkage map of Taraxacum koksaghyz Rodin based on AFLP, SSR, COS and EST-SSR markers

    PubMed Central

    Arias, Marina; Hernandez, Monica; Remondegui, Naroa; Huvenaars, Koen; van Dijk, Peter; Ritter, Enrique

    2016-01-01

    Taraxacum koksaghyz Rodin (TKS) has been studied in many occasions as a possible alternative source for natural rubber production of good quality and for inulin production. Some tire companies are already testing TKS tire prototypes. There are also many investigations on the production of bio-fuels from inulin and inulin applications for health improvement and in the food industry. A limited amount of genomic resources exist for TKS and particularly no genetic linkage map is available in this species. We have constructed the first TKS genetic linkage map based on AFLP, COS, SSR and EST-SSR markers. The integrated linkage map with eight linkage groups (LG), representing the eight chromosomes of Russian dandelion, has 185 individual AFLP markers from parent 1, 188 individual AFLP markers from parent 2, 75 common AFLP markers and 6 COS, 1 SSR and 63 EST-SSR loci. Blasting the EST-SSR sequences against known sequences from lettuce allowed a partial alignment of our TKS map with a lettuce map. Blast searches against plant gene databases revealed some homologies with useful genes for downstream applications in the future. PMID:27488242

  8. REDUCTION OF SPECIES IN THE WILD POTATO SOLANUM SECTION PETOTA SERIES LONGIPEDICELLATA: AFLP, RAPD AND CHLOROPLAST SSR DATA.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Species boundaries were assessed with three molecular markers (AFLPs, RAPDs, chloroplast microsatellites, also known as chloroplast single sequence repeats [cpSSRs]) for all six species of wild potatoes (Solanum L. section Petota Dumort.) assigned to ser. Longipedicellata: S. fendleri, S. hjertingii...

  9. Impact of deep coalescence and recombination on the estimation of phylogenetic relationships among species using AFLP markers.

    PubMed

    García-Pereira, María Jesús; Carvajal-Rodríguez, Antonio; Whelan, Simon; Caballero, Armando; Quesada, Humberto

    2014-07-01

    Deep coalescence and the nongenealogical pattern of descent caused by recombination have emerged as a common problem for phylogenetic inference at the species level. Here we use computer simulations to assess whether AFLP-based phylogenies are robust to the uncertainties introduced by these factors. Our results indicate that phylogenetic signal can prevail even in the face of extensive deep coalescence allowing recovering the correct species tree topology. The impact of recombination on tree accuracy was related to total tree depth and species effective population size. The correct tree topology could be recovered upon many simulation settings due to a trade-off between the conflicting signals resulting from intra-locus recombination and the benefits of the joint consideration of unlinked loci that better matched overall the true species tree. Errors in tree topology were not only determined by deep coalescence, but also by the timing of divergence and the tree-building errors arising from an insufficient number of characters. DNA sequences generally outperformed AFLPs upon any simulated scenario, but this difference in performance was nearly negligible when a sufficient number of AFLP characters were sampled. Our simulations suggest that the impact of deep coalescence and intra-locus recombination on the reliability of AFLP trees could be minimal for effective population sizes equal to or lower than 10,000 (typical of many vertebrates and tree plants) given tree depths above 0.02 substitutions per site. PMID:24631855

  10. AFLP Genome Scanning Reveals Divergent Selection in Natural Populations of Liriodendron chinense (Magnoliaceae) along a Latitudinal Transect.

    PubMed

    Yang, Ai-Hong; Wei, Na; Fritsch, Peter W; Yao, Xiao-Hong

    2016-01-01

    Understanding adaptive genetic variation and its relation to environmental factors are important for understanding how plants adapt to climate change and for managing genetic resources. Genome scans for the loci exhibiting either notably high or low levels of population differentiation (outlier loci) provide one means of identifying genomic regions possibly associated with convergent or divergent selection. In this study, we combined Amplified Fragment Length Polymorphism (AFLP) genome scan and environmental association analysis to test for signals of natural selection in natural populations of Liriodendron chinense (Chinese Tulip Tree; Magnoliaceae) along a latitudinal transect. We genotyped 276 individuals from 11 populations of L. chinense using 987 AFLP markers. Both frequency-based (Dfdist and BayeScan) and correlation-based (MLM) methods were applied to detect outlier loci. Our analyses recovered both neutral and potentially adaptive genetic differentiation among populations of L. chinense. We found moderate genetic diversity within populations and high genetic differentiation among populations with reduced genetic diversity toward the periphery of the species ranges. Nine AFLP marker loci showed evidence of being outliers for population differentiation for both detection methods. Of these, six were strongly associated with at least one climate factor. Temperature, precipitation, and radiation were found to be three important factors influencing local adaptation of L. chinense. The outlier AFLP loci are likely not the target of natural selection, but the neighboring genes of these loci might be involved in local adaptation. Hence, these candidates should be validated by further studies. PMID:27303414

  11. AFLP Genome Scanning Reveals Divergent Selection in Natural Populations of Liriodendron chinense (Magnoliaceae) along a Latitudinal Transect

    PubMed Central

    Yang, Ai-Hong; Wei, Na; Fritsch, Peter W.; Yao, Xiao-Hong

    2016-01-01

    Understanding adaptive genetic variation and its relation to environmental factors are important for understanding how plants adapt to climate change and for managing genetic resources. Genome scans for the loci exhibiting either notably high or low levels of population differentiation (outlier loci) provide one means of identifying genomic regions possibly associated with convergent or divergent selection. In this study, we combined Amplified Fragment Length Polymorphism (AFLP) genome scan and environmental association analysis to test for signals of natural selection in natural populations of Liriodendron chinense (Chinese Tulip Tree; Magnoliaceae) along a latitudinal transect. We genotyped 276 individuals from 11 populations of L. chinense using 987 AFLP markers. Both frequency-based (Dfdist and BayeScan) and correlation-based (MLM) methods were applied to detect outlier loci. Our analyses recovered both neutral and potentially adaptive genetic differentiation among populations of L. chinense. We found moderate genetic diversity within populations and high genetic differentiation among populations with reduced genetic diversity toward the periphery of the species ranges. Nine AFLP marker loci showed evidence of being outliers for population differentiation for both detection methods. Of these, six were strongly associated with at least one climate factor. Temperature, precipitation, and radiation were found to be three important factors influencing local adaptation of L. chinense. The outlier AFLP loci are likely not the target of natural selection, but the neighboring genes of these loci might be involved in local adaptation. Hence, these candidates should be validated by further studies. PMID:27303414

  12. Transcriptome response of the Pacific oyster (Crassostrea gigas) to infection with Vibrio tubiashii using cDNA AFLP differential display

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We used qualitative complementary DNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) differential display analysis and real-time, quantitative PCR (RT-qPCR) to identify genes in the Pacific oyster Crassostrea gigas whose transcription either changes in response to exposure to a pathogenic bacter...

  13. Prediction of single-cross hybrid performance for grain yield and grain dry matter content in maize using AFLP markers associated with QTL.

    PubMed

    Schrag, T A; Melchinger, A E; Sørensen, A P; Frisch, M

    2006-10-01

    Prediction methods to identify single-cross hybrids with superior yield performance have the potential to greatly improve the efficiency of commercial maize (Zea mays L.) hybrid breeding programs. Our objectives were to (1) identify marker loci associated with quantitative trait loci for hybrid performance or specific combining ability (SCA) in maize, (2) compare hybrid performance prediction by genotypic value estimates with that based on general combining ability (GCA) estimates, and (3) investigate a newly proposed combination of the GCA model with SCA predictions from genotypic value estimates. A total of 270 hybrids was evaluated for grain yield and grain dry matter content in four Dent x Flint factorial mating experiments, their parental inbred lines were genotyped with 20 AFLP primer-enzyme combinations. Markers associated significantly with hybrid performance and SCA were identified, genotypic values and SCA effects were estimated, and four hybrid performance prediction approaches were evaluated. For grain yield, between 38 and 98 significant markers were identified for hybrid performance and between zero and five for SCA. Estimates of prediction efficiency (R (2)) ranged from 0.46 to 0.86 for grain yield and from 0.59 to 0.96 for grain dry matter content. Models enhancing the GCA approach with SCA estimates resulted in the highest prediction efficiency if the SCA to GCA ratio was high. We conclude that it is advantageous for prediction of single-cross hybrids to enhance a GCA-based model with SCA effects estimated from molecular marker data, if SCA variances are of similar or larger importance as GCA variances. PMID:16896712

  14. The possible physical barrier and coastal dispersal strategy for Japanese grenadier anchovy, Coilia nasus in the East China Sea and Yellow Sea: evidence from AFLP markers.

    PubMed

    Han, Zhi-Qiang; Han, Gang; Wang, Zhi-Yong; Gao, Tian-Xiang

    2015-01-01

    In order to ascertain the taxonomic status of the Ariake Sea population of Japanese grenadier anchovy, Coilia nasus, and assess the contemporary possible genetic barrier between the west and east coastal waters of the East China Sea, we used amplified fragment length polymorphism (AFLP) markers to detect the genetic structure of C. nasus, in the East China Sea and Yellow Sea. Eighty-one individuals of C. nasus were collected from five locations and 12 individuals of Coilia mystus were sampled from the Yangtze River Estuary. A total of 371 loci were detected by five primer combinations, 310 of which were polymorphic (83.56%). Analysis of molecular variation (AMOVA) and pairwise fixation index (FST) revealed significant genetic differentiation among five samples, indicating limited gene flow among populations. The dendrogram for populations by neighbor-joining (NJ) cluster analysis provided evidence of a clear relationship between genetic and geographic patterns, supporting significant genetic differentiation between China coastal populations and Ariake Sea populations. Compared to the genetic divergence between C. nasus and C. mystus, the level of genetic differentiation between China and the Ariake Sea populations of C. nasus is obvious below the species level, indicating isolated populations of C. nasus in the Ariake Sea. Isolation by distance analysis revealed that direct ocean distance with deep-water at the continental slope and high salinity between west and east coastal waters of the East China Sea served as major physical barrier to C. nasus, supporting the coastal dispersal pattern in this estuarine species, and rejecting offshore dispersal strategy. PMID:25654225

  15. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection.

    PubMed

    O'Halloran, Damien M

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  16. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection

    PubMed Central

    O’Halloran, Damien M.

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  17. Linear elastic fracture mechanics primer

    NASA Astrophysics Data System (ADS)

    Wilson, Christopher D.

    1992-07-01

    This primer is intended to remove the blackbox perception of fracture mechanics computer software by structural engineers. The fundamental concepts of linear elastic fracture mechanics are presented with emphasis on the practical application of fracture mechanics to real problems. Numerous rules of thumb are provided. Recommended texts for additional reading, and a discussion of the significance of fracture mechanics in structural design are given. Griffith's criterion for crack extension, Irwin's elastic stress field near the crack tip, and the influence of small-scale plasticity are discussed. Common stress intensities factor solutions and methods for determining them are included. Fracture toughness and subcritical crack growth are discussed. The application of fracture mechanics to damage tolerance and fracture control is discussed. Several example problems and a practice set of problems are given.

  18. Linear elastic fracture mechanics primer

    NASA Technical Reports Server (NTRS)

    Wilson, Christopher D.

    1992-01-01

    This primer is intended to remove the blackbox perception of fracture mechanics computer software by structural engineers. The fundamental concepts of linear elastic fracture mechanics are presented with emphasis on the practical application of fracture mechanics to real problems. Numerous rules of thumb are provided. Recommended texts for additional reading, and a discussion of the significance of fracture mechanics in structural design are given. Griffith's criterion for crack extension, Irwin's elastic stress field near the crack tip, and the influence of small-scale plasticity are discussed. Common stress intensities factor solutions and methods for determining them are included. Fracture toughness and subcritical crack growth are discussed. The application of fracture mechanics to damage tolerance and fracture control is discussed. Several example problems and a practice set of problems are given.

  19. A primer on gadolinium chemistry

    PubMed Central

    Sherry, A. Dean; Caravan, Peter; Lenkinski, Robert E.

    2010-01-01

    Gadolinium is widely known by all practitioners of MRI but few appreciate the basic solution chemistry of this trivalent lanthanide ion. Given the recent linkage between gadolinium contrast agents and nephrogenic systemic fibrosis, some basic chemistry of this ion must be more widely understood. This short primer on gadolinium chemistry is intended to provide the reader the background principles necessary to understand the basics of chelation chemistry, water hydration numbers, and the differences between thermodynamic stability and kinetic stability or inertness. We illustrate the fundamental importance of kinetic dissociation rates in determining gadolinium toxicity in vivo by presenting new data for a novel europium DOTA-tetraamide complex that is relatively unstable thermodynamically yet extraordinarily inert kinetically and also quite non-toxic. This, plus other literature evidence forms the basis of the fundamental axiom that it is the kinetic stability of a gadolinium complex, not its thermodynamic stability, that determines its in vivo toxicity. PMID:19938036

  20. A Practical Primer on Geostatistics

    USGS Publications Warehouse

    Olea, Ricardo A.

    2009-01-01

    significant methodological implications. HISTORICAL REMARKS As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields. PIONEERS Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorology CALCULATIONS Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations. SOFTWARE For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics. ORGANIZATION OF THE PRIMER The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of th

  1. Primer on Special Education in Charter Schools

    ERIC Educational Resources Information Center

    Luna, Tom

    2007-01-01

    This section of the Idaho Primer on Special Education in Charter Schools is divided into two parts: (1) a discussion of the legal status of charter schools and their linkage to other local education agencies (LEAs), and (2) a synopsis of federal laws that are most relevant to special education in charter schools. The Primer on Special Education in…

  2. Electrostatic Discharge testing of propellants and primers

    SciTech Connect

    Berry, R.B.

    1994-02-01

    This report presents the results of testing of selected propellants and primers to Electrostatic Discharge (ESD) characteristic of the human body. It describes the tests and the fixturing built to accommodate loose material (propellants) and the packed energetic material of the primer. The results indicate that all powders passed and some primers, especially the electric primers, failed to pass established requirements which delineate insensitive energetic components. This report details the testing of components and materials to four ESD environments (Standard ESD, Severe ESD, Modified Standard ESD, and Modified Severe ESD). The purpose of this study was to collect data based on the customer requirements as defined in the Sandia Environmental Safety & Health (ES&H) Manual, Chapter 9, and to define static sensitive and insensitive propellants and primers.

  3. Primer and platform effects on 16S rRNA tag sequencing

    SciTech Connect

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; Kirton, Edward S.; He, Shaomei; Woyke, Tanja; Lee, Janey; Chen, Feng; Dangl, Jeffery L.; Tringe, Susannah G.

    2015-08-04

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as well as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.

  4. Primer and platform effects on 16S rRNA tag sequencing

    PubMed Central

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; Kirton, Edward S.; He, Shaomei; Woyke, Tanja; Lee, Janey; Chen, Feng; Dangl, Jeffery L.; Tringe, Susannah G.

    2015-01-01

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as well as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. Beta diversity metrics are surprisingly robust to both primer and sequencing platform biases. PMID:26300854

  5. Primer and platform effects on 16S rRNA tag sequencing

    DOE PAGESBeta

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; Kirton, Edward S.; He, Shaomei; Woyke, Tanja; Lee, Janey; Chen, Feng; Dangl, Jeffery L.; Tringe, Susannah G.

    2015-08-04

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

  6. Species-specific PCR primers for the rapid identification of yeasts of the genus Zygosaccharomyces.

    PubMed

    Harrison, Elizabeth; Muir, Alastair; Stratford, Malcolm; Wheals, Alan

    2011-06-01

    Species-specific primer pairs that produce a single band of known product size have been developed for members of the Zygosaccharomyces clade including Zygosaccharomyces bailii, Zygosaccharomyces bisporus, Zygosaccharomyces kombuchaensis, Zygosaccharomyces lentus, Zygosaccharomyces machadoi, Zygosaccharomyces mellis and Zygosaccharomyces rouxii. An existing primer pair for the provisional new species Zygosaccharomyces pseudorouxii has been confirmed as specific. The HIS3 gene, encoding imidazole-glycerolphosphate dehydratase, was used as the target gene. This housekeeping gene evolves slowly and is thus well conserved among different isolates, but shows a significant number of base pair changes between even closely related species, sufficient for species-specific primer design. The primers were tested on type and wild strains of the genus Zygosaccharomyces and on members of the Saccharomycetaceae. Sequencing of the D1/D2 region of rDNA was used to confirm the identification of all nonculture collection isolates. This approach used extracted genomic DNA, but in practice, it can be used efficiently with a rapid colony PCR protocol. The method also successfully detected known and new hybrid strains of Z. rouxii and Z. pseudorouxii. The method is rapid, robust and inexpensive. It requires little expertise by the user and is thus useful for preliminary, large-scale screens. PMID:21332639

  7. AFLP-based genetic mapping of the “bud-flowering” trait in heather (Calluna vulgaris)

    PubMed Central

    2013-01-01

    Background Calluna vulgaris is one of the most important landscaping plants produced in Germany. Its enormous economic success is due to the prolonged flower attractiveness of mutants in flower morphology, the so-called bud-bloomers. In this study, we present the first genetic linkage map of C. vulgaris in which we mapped a locus of the economically highly desired trait “flower type”. Results The map was constructed in JoinMap 4.1. using 535 AFLP markers from a single mapping population. A large fraction (40%) of markers showed distorted segregation. To test the effect of segregation distortion on linkage estimation, these markers were sorted regarding their segregation ratio and added in groups to the data set. The plausibility of group formation was evaluated by comparison of the “two-way pseudo-testcross” and the “integrated” mapping approach. Furthermore, regression mapping was compared to the multipoint-likelihood algorithm. The majority of maps constructed by different combinations of these methods consisted of eight linkage groups corresponding to the chromosome number of C. vulgaris. Conclusions All maps confirmed the independent inheritance of the most important horticultural traits “flower type”, “flower colour”, and “leaf colour”. An AFLP marker for the most important breeding target “flower type” was identified. The presented genetic map of C. vulgaris can now serve as a basis for further molecular marker selection and map-based cloning of the candidate gene encoding the unique flower architecture of C. vulgaris bud-bloomers. PMID:23915059

  8. A first linkage map of pecan cultivars based on RAPD and AFLP markers.

    PubMed

    Beedanagari, Sudheer R; Dove, Sue K; Wood, Bruce W; Conner, Patrick J

    2005-04-01

    We report here the first genetic linkage maps of pecan [Carya illinoinensis (Wangenh.) K. Koch], using random amplified polymorphic DNA (RAPD) and amplified fragment length polymorphism (AFLP) markers. Independent maps were constructed for the cultivars 'Pawnee' and 'Elliot' using the double pseudo-testcross mapping strategy and 120 F1 seedlings from a full-sib family. A total of 477 markers, including 217 RAPD, 258 AFLP, and two morphological markers were used in linkage analysis. The 'Pawnee' linkage map has 218 markers, comprising 176 testcross and 42 intercross markers placed in 16 major and 13 minor (doublets and triplets) linkage groups. The 'Pawnee' linkage map covered 2,227 cM with an average map distance of 12.7 cM between adjacent markers. The 'Elliot' linkage map has 174 markers comprising 150 testcross and 22 intercross markers placed in 17 major and nine minor linkage groups. The 'Elliot' map covered 1,698 cM with an average map distance of 11.2 cM between adjacent markers. Segregation ratios for dichogamy type and stigma color were not significantly different from 1:1, suggesting that both traits are controlled by single loci with protogyny and green stigmas dominant to protandry and red stigmas. These loci were tightly linked (1.9 cM) and were placed in 'Elliot' linkage group 16. These linkage maps are an important first step towards the detection of genes controlling horticulturally important traits such as nut size, nut maturity date, kernel quality, and disease resistance. PMID:15782296

  9. Climate change primer for respirologists.

    PubMed

    Takaro, Tim K; Henderson, Sarah B

    2015-01-01

    Climate change is already affecting the cardiorespiratory health of populations around the world, and these impacts are expected to increase. The present overview serves as a primer for respirologists who are concerned about how these profound environmental changes may affect their patients. The authors consider recent peer-reviewed literature with a focus on climate interactions with air pollution. They do not discuss in detail cardiorespiratory health effects for which the potential link to climate change is poorly understood. For example, pneumonia and influenza, which affect >500 million people per year, are not addressed, although clear seasonal variation suggests climate-related effects. Additionally, large global health impacts in low-resource countries, including migration precipitated by environmental change, are omitted. The major cardiorespiratory health impacts addressed are due to heat, air pollution and wildfires, shifts in allergens and infectious diseases along with respiratory impacts from flooding. Personal and societal choices about carbon use and fossil energy infrastructure should be informed by their impacts on health, and respirologists can play an important role in this discussion. PMID:25664458

  10. MRI Biosensors: A Short Primer

    PubMed Central

    Louie, Angelique

    2013-01-01

    Interest in Magnetic Resonance Imaging (MRI) contrast agents for molecular imaging of biological function experienced a surge of excitement approximately 20 years ago with the development of the first activatable contrast agents that could act as biosensors and turn “on” in response to a specific biological activity. This brief tutorial, based on a short course lecture from the 2011 ISMRM meeting, provides an overview of underlying principles governing the design of biosensing contrast agents. We describe mechanisms by which a magnetic resonance imaging (MRI) contrast agent can be made into a sensor for both T1 and T2 types contrast agents. Examples of biological activities that can interact with a contrast agent are discussed using specific examples from the recent literature to illustrate the primary mechanisms of action that have been utilized to achieve activation. MRI sensors for pH, ion binding, enzyme cleavage, and oxidation-reduction are presented. This article is not meant to be an exhaustive review, but an illustrative primer to explain how activation can be achieved for an MRI contrast agent. Chemical exchange saturation transfer (CEST) is not covered as these agents were covered in a separate lecture. PMID:23996662

  11. Significant population genetic structure detected in the rock bream Oplegnathus fasciatus (Temminck & Schlegel, 1844) inferred from fluorescent-AFLP analysis

    NASA Astrophysics Data System (ADS)

    Xiao, Yongshuang; Ma, Daoyuan; Xu, Shihong; Liu, Qinghua; Wang, Yanfeng; Xiao, Zhizhong; Li, Jun

    2016-05-01

    Oplegnathus fasciatus (rock bream) is a commercial rocky reef fish species in East Asia that has been considered for aquaculture. We estimated the population genetic diversity and population structure of the species along the coastal waters of China using fluorescent-amplified fragment length polymorphisms technology. Using 53 individuals from three populations and four pairs of selective primers, we amplified 1 264 bands, 98.73% of which were polymorphic. The Zhoushan population showed the highest Nei's genetic diversity and Shannon genetic diversity. The results of analysis of molecular variance (AMOVA) showed that 59.55% of genetic variation existed among populations and 40.45% occurred within populations, which indicated that a significant population genetic structure existed in the species. The pairwise fixation index F st ranged from 0.20 to 0.63 and were significant after sequential Bonferroni correction. The topology of an unweighted pair group method with arithmetic mean tree showed two significant genealogical branches corresponding to the sampling locations of North and South China. The AMOVA and STRUCTURE analyses suggested that the O. fasciatus populations examined should comprise two stocks.

  12. Primer on spontaneous heating and pyrophoricity

    SciTech Connect

    Not Available

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  13. Comparative analysis of oligonucleotide primers for high-throughput screening of genes encoding adenylation domains of nonribosomal peptide synthetases in actinomycetes.

    PubMed

    Bakal, Tomas; Goo, Kian-Sim; Najmanova, Lucie; Plhackova, Kamila; Kadlcik, Stanislav; Ulanova, Dana

    2015-11-01

    In the biosynthesis of diverse natural bioactive products the adenylation domains (ADs) of nonribosomal peptide synthetases select specific precursors from the cellular pool and activate them for further incorporation into the scaffold of the final compound. Therefore, the drug discovery programs employing PCR-based screening studies of microbial collections or metagenomic libraries often use AD-coding genes as markers of relevant biosynthetic gene clusters. However, due to significant sequence diversity of ADs, the conventional approach using only one primer pair in a single screening experiment could be insufficient for maximal coverage of AD abundance. In this study, the widely used primer pair A3F/A7R was compared with the newly designed aa194F/aa413R one by 454 pyrosequencing of two sets of actinomycete strains from highly dissimilar environments: subseafloor sediments and forest soil. Individually, none of the primer pairs was able to cover the overall diversity of ADs. However, due to slightly shifted specificity of the primer pairs, the total number and diversity of identified ADs were noticeably extended when both primer pairs were used in a single assay. Additionally, the efficiency of AD detection by different primer combinations was confirmed on the model of Salinispora tropica genomic DNA of known sequence. PMID:26296377

  14. Design and Validation of Four New Primers for Next-Generation Sequencing To Target the 18S rRNA Genes of Gastrointestinal Ciliate Protozoa

    PubMed Central

    Wright, André-Denis G.

    2014-01-01

    Four new primers and one published primer were used to PCR amplify hypervariable regions within the protozoal 18S rRNA gene to determine which primer pair provided the best identification and statistical analysis. PCR amplicons of 394 to 498 bases were generated from three primer sets, sequenced using Roche 454 pyrosequencing with Titanium, and analyzed using the BLAST database (NCBI) and MOTHUR version 1.29. The protozoal diversity of rumen contents from moose in Alaska was assessed. In the present study, primer set 1, P-SSU-316F and GIC758R (amplicon of 482 bases), gave the best representation of diversity using BLAST classification, and the set amplified Entodinium simplex and Ostracodinium spp., which were not amplified by the other two primer sets. Primer set 2, GIC1080F and GIC1578R (amplicon of 498 bases), had similar BLAST results and a slightly higher percentage of sequences that were identified with a higher sequence identity. Primer sets 1 and 2 are recommended for use in ruminants. However, primer set 1 may be inadequate to determine protozoal diversity in nonruminants. The amplicons created by primer set 1 were indistinguishable for certain species within the genera Bandia, Blepharocorys, Polycosta, and Tetratoxum and between Hemiprorodon gymnoprosthium and Prorodonopsis coli, none of which are normally found in the rumen. PMID:24973070

  15. Improving AFLP analysis of large-scale patterns of genetic variation--a case study with the Central African lianas Haumania spp (Marantaceae) showing interspecific gene flow.

    PubMed

    Ley, A C; Hardy, O J

    2013-04-01

    AFLP markers are often used to study patterns of population genetic variation and gene flow because they offer a good coverage of the nuclear genome, but the reliability of AFLP scoring is critical. To assess interspecific gene flow in two African rainforest liana species (Haumania danckelmaniana, H. liebrechtsiana) where previous evidence of chloroplast captures questioned the importance of hybridization and species boundaries, we developed new AFLP markers and a novel approach to select reliable bands from their degree of reproducibility. The latter is based on the estimation of the broad-sense heritability of AFLP phenotypes, an improvement over classical scoring error rates, which showed that the polymorphism of most AFLP bands was affected by a substantial nongenetic component. Therefore, using a quantitative genetics framework, we also modified an existing estimator of pairwise kinship coefficient between individuals correcting for the limited heritability of markers. Bayesian clustering confirms the recognition of the two Haumania species. Nevertheless, the decay of the relatedness between individuals of distinct species with geographic distance demonstrates that hybridization affects the nuclear genome. In conclusion, although we showed that AFLP markers might be substantially affected by nongenetic factors, their analysis using the new methods developed considerably advanced our understanding of the pattern of gene flow in our model species. PMID:23398575

  16. Use of labeled primers for differential display

    SciTech Connect

    Paunesku, T.; Woloschak, G.E.

    1995-01-01

    Two artifacts introduced in using differential display technology are (1) random priming from dT present from affinity purification of PolyA+ RNA and (2) hybridization of the arbitrary primer to template target sequences on both cDNA strands. We have developed a method eliminating both problems. By separately using 5`-end-labeled (T){sub 12}XY and arbitrary primers to label bands and comparing two differential display patterns, we can detect only those products incorporating the (T){sub 12}XY primer on the 3` ends and the arbitrary primer on 5` ends. Those bands that are generated randomly in the PCR are readily detectable and can be ignored.

  17. Multiplexing Short Primers for Viral Family PCR

    SciTech Connect

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  18. Searching for Beta-Haemolysin hlb Gene in Staphylococcus pseudintermedius with Species-Specific Primers.

    PubMed

    Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin

    2016-07-01

    The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification. PMID:27086303

  19. PCR primers for 30 novel gene regions in the nuclear genomes of Lepidoptera

    PubMed Central

    Wahlberg, Niklas; Peña, Carlos; Ahola, Milla; Wheat, Christopher W.; Rota, Jadranka

    2016-01-01

    Abstract We report primer pairs for 30 new gene regions in the nuclear genomes of Lepidoptera that can be amplified using a standard PCR protocol. The new primers were tested across diverse Lepidoptera, including nonditrysians and a wide selection of ditrysians. These new gene regions give a total of 11,043 bp of DNA sequence data and they show similar variability to traditionally used nuclear gene regions in studies of Lepidoptera. We feel that a PCR-based approach still has its place in molecular systematic studies of Lepidoptera, particularly at the intrafamilial level, and our new set of primers now provides a route to generating phylogenomic datasets using traditional methods. PMID:27408580

  20. A Dozen Primers on Important Information Standards

    ERIC Educational Resources Information Center

    Dempsey, Kathy, Comp.

    2007-01-01

    This is a compilation of 12 primers on important information standards and protocols. These primers are: (1) Atom; (2) COinS; (3) MADS; (4) MARC 21/MARCXML; (5) MIX; (6) MXG; (7) OpenSearch; (8) PREMIS; (9) RESTful HTTP; (10) unAPI; (11) XMPP (aka Jabber); and (12) ZeeRex. The Atom Syndication Format defines a new XML-based syndication format for…

  1. Protective Coats For Zinc-Rich Primers

    NASA Technical Reports Server (NTRS)

    Macdowell, Louis G, III

    1993-01-01

    Report describes tests of topcoats for inorganic zinc-rich primers on carbon steel. Topcoats intended to provide additional protection against corrosion in acidic, salty seacoast-air/rocket-engine-exhaust environment of Space Shuttle launch site. Tests focused on polyurethane topcoats on epoxy tie coats on primers. Part of study involved comparison between "high-build" coating materials and thin-film coating materials.

  2. Estimation of outcrossing rates in interspecific backcross plants of Jatropha curcas (L.) using AFLP and SSR markers.

    PubMed

    Sinha, Pratima; Islam, Md Aminul; Negi, Madan Singh; Tripathi, Shashi Bhushan

    2015-10-01

    In this paper, we report the estimates of outcrossing rates using open-pollinated progeny arrays of 40 BC1 individuals of Jatropha developed as a result of interspecific hybridization between J. curcas and J. integerrima. For analysis PCR-based dominant AFLP and codominant SSR markers were used. The multilocus outcrossing rate (tm) estimated from AFLP markers (0.892 ± 0.112) are almost in the same range with SSR (0.884 ± 0.293) markers which indicate a high level of heterozygosity. A low value of inbreeding coefficient (F) also points out to the fact that outcrossing was the prevalent mode of reproduction in Jatropha and suggests maintenance of adequate genetic variability within families. PMID:26600687

  3. Use of labeled primers for differential display

    SciTech Connect

    Paunesku, T.; Woloschak, G.E.

    1995-02-01

    The differential display of eukaryotic cDNAs using PCR allows for determination of mRNA species differentially expressed when comparing two similar cell populations. This procedure uses a (T){sub 12}XY oligonucleotide as the 3 ft primer and an arbitrary 8-10-mer as the 5 ft primer. Labeling occurs by inclusion of {alpha}[{sup 33}P]-dATP in the PCR reaction. Two artifacts caused by this approach are (1) random printing from dT present from affinity purification of PolyA+RNA and (2) hybridization of the arbitrary primer to template target sequences on both cDNA strands. In this work, we have developed an approach for both eliminating smearing and identifying nonspecific bands on sequencing gels. By separately using 5 ft-end-labeled (T){sub 12}XY and arbitrary primers to label bands and comparing two differential display patterns rather than including labeled nucleotides in the PCR reaction itself, we can detect only those products incorporating the M{sub 12}XY primer on the 3 ft ends and the arbitrary primer on 5 ft ends. Those bands that are generated randomly in the PCR reaction are readily detectable and can be ignored. If on the other hand, one is interested only in a diagnostic banding pattern for differential display, benefit can be derived from the simplicity of the pattern obtained when labeled (T){sub 12}XY is used.

  4. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design.

    PubMed

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads Tvillinggaard; Genee, Hans Jasper; Holm, Dorte Koefoed; Carlsen, Simon; Hansen, Bjarne Gram; Patil, Kiran Raosaheb; Mortensen, Uffe Hasbro; Wernersson, Rasmus

    2011-07-01

    Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. However, designing primers for USER fusion is both tedious and time consuming. Here, we present the Primer Help for USER (PHUSER) software, a novel tool for designing primers specifically for USER fusion and USER cloning applications. We also present proof-of-concept experimental validation of its functionality. PHUSER offers quick and easy design of PCR optimized primers ensuring directionally correct fusion of fragments into a plasmid containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (T(m)), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers are individually analysed in terms of GC content, presence of GC clamp at 3'-end, the risk of primer dimer formation, the risk of intra-primer complementarity (secondary structures) and the presence of polyN stretches. Furthermore, PHUSER offers the option to insert linkers between DNA fragments, as well as highly flexible cassette options. PHUSER is publicly available at http://www.cbs.dtu.dk/services/phuser/. PMID:21622660

  5. Design and Implementation of Degenerate Microsatellite Primers for the Mammalian Clade

    PubMed Central

    Buschiazzo, Emmanuel; Beck, Josephine S.; Gemmell, Neil J.

    2011-01-01

    Microsatellites are popular genetic markers in molecular ecology, genetic mapping and forensics. Unfortunately, despite recent advances, the isolation of de novo polymorphic microsatellite loci often requires expensive and intensive groundwork. Primers developed for a focal species are commonly tested in a related, non-focal species of interest for the amplification of orthologous polymorphic loci; when successful, this approach significantly reduces cost and time of microsatellite development. However, transferability of polymorphic microsatellite loci decreases rapidly with increasing evolutionary distance, and this approach has shown its limits. Whole genome sequences represent an under-exploited resource to develop cross-species primers for microsatellites. Here we describe a three-step method that combines a novel in silico pipeline that we use to (1) identify conserved microsatellite loci from a multiple genome alignments, (2) design degenerate primer pairs, with (3) a simple PCR protocol used to implement these primers across species. Using this approach we developed a set of primers for the mammalian clade. We found 126,306 human microsatellites conserved in mammalian aligned sequences, and isolated 5,596 loci using criteria based on wide conservation. From a random subset of ∼1000 dinucleotide repeats, we designed degenerate primer pairs for 19 loci, of which five produced polymorphic fragments in up to 18 mammalian species, including the distinctly related marsupials and monotremes, groups that diverged from other mammals 120–160 million years ago. Using our method, many more cross-clade microsatellite loci can be harvested from the currently available genomic data, and this ability is set to improve exponentially as further genomes are sequenced. PMID:22216321

  6. DegePrime, a program for degenerate primer design for broad-taxonomic-range PCR in microbial ecology studies.

    PubMed

    Hugerth, Luisa W; Wefer, Hugo A; Lundin, Sverker; Jakobsson, Hedvig E; Lindberg, Mathilda; Rodin, Sandra; Engstrand, Lars; Andersson, Anders F

    2014-08-01

    The taxonomic composition of a microbial community can be deduced by analyzing its rRNA gene content by, e.g., high-throughput DNA sequencing or DNA chips. Such methods typically are based on PCR amplification of rRNA gene sequences using broad-taxonomic-range PCR primers. In these analyses, the use of optimal primers is crucial for achieving an unbiased representation of community composition. Here, we present the computer program DegePrime that, for each position of a multiple sequence alignment, finds a degenerate oligomer of as high coverage as possible and outputs its coverage among taxonomic divisions. We show that our novel heuristic, which we call weighted randomized combination, performs better than previously described algorithms for solving the maximum coverage degenerate primer design problem. We previously used DegePrime to design a broad-taxonomic-range primer pair that targets the bacterial V3-V4 region (341F-805R) (D. P. Herlemann, M. Labrenz, K. Jurgens, S. Bertilsson, J. J. Waniek, and A. F. Andersson, ISME J. 5:1571-1579, 2011, http://dx.doi.org/10.1038/ismej.2011.41), and here we use the program to significantly increase the coverage of a primer pair (515F-806R) widely used for Illumina-based surveys of bacterial and archaeal diversity. By comparison with shotgun metagenomics, we show that the primers give an accurate representation of microbial diversity in natural samples. PMID:24928874

  7. Genomospecies identification and phylogenomic relevance of AFLP analysis of isolated and non-isolated strains of Frankia spp.

    PubMed

    Bautista, G H H; Cruz, H A; Nesme, X; Valdés, M; Mendoza, H A; Fernandez, M P

    2011-05-01

    Amplified fragment length polymorphism (AFLP) was tested as an alternative to the DNA-DNA hybridization technique (DDH) to delineate genomospecies and the phylogenetic structure within the genus Frankia. Forty Frankia strains, including representatives of seven DDH genomospecies, were typed in order to infer current genome mispairing (CGM) and evolutionary genomic distance (EGD). The constructed phylogeny revealed the presence of three main clusters corresponding to the previously identified host-infecting groups. In all instances, strains previously assigned to the same genomospecies were grouped in coherent clusters. A highly significant correlation was found between DDH values and CGM computed from AFLP data. The species definition threshold was found to range from 0.071 to 0.098 mismatches per site, according to host-infecting groups, presumably as a result of large genome size differences. Genomic distances allowed new Frankia strains to be assigned to nine genomospecies previously determined by DDH. The applicability of AFLP for the characterization of uncultured endophytic strains was tested on experimentally inoculated plants and then applied to Alnus incana and A. viridis field nodules hosting culture refractory spore-positive (Sp+, that sporulate in planta) strains. Only 1.3% of all AFLP fragments were shown to be generated by the contaminant plant DNA and did not interfere with accurate genomospecies identification of strains. When applied to field nodules, the procedure revealed that Alnus Sp+ strains were bona fide members of the Alnus-Myrica host infecting group. They displayed significant genomic divergence from genomospecies G1 of Alnus infecting strains (i.e. Frankia alni) and thus may belong to another subspecies or genomospecies. PMID:21310572

  8. PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes

    SciTech Connect

    Yoon, Hyejin; Leitner, Thomas

    2014-12-17

    Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-M finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.

  9. PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes

    DOE PAGESBeta

    Yoon, Hyejin; Leitner, Thomas

    2014-12-17

    Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-Mmore » finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.« less

  10. Outgroup effects on root position and tree topology in the AFLP phylogeny of a rapidly radiating lineage of cichlid fish☆

    PubMed Central

    Kirchberger, Paul C.; Sefc, Kristina M.; Sturmbauer, Christian; Koblmüller, Stephan

    2014-01-01

    Phylogenetic analyses of rapid radiations are particularly challenging as short basal branches and incomplete lineage sorting complicate phylogenetic inference. Multilocus data of presence-absence polymorphisms such as obtained by AFLP genotyping overcome some of the difficulties, but also present their own intricacies. Here we analyze >1000 AFLP markers to address the evolutionary history of the Limnochromini, a cichlid fish lineage endemic to Lake Tanganyika, and to test for potential effects of outgroup composition on tree topology. The data support previous mitochondrial evidence on the tribe’s taxonomy by confirming the polyphyly of the genus Limnochromis and – in contradiction to a recent taxonomic revision – nesting the genus Greenwoodochromis within the Limnochromini. Species relationships suggest that ecological segregation occurred during the rapid basal radiation of the Limnochromini. The large phylogenetic distance between candidate outgroup taxa and the Limnochromini radiation caused random outgroup effects. Bootstrap support for ingroup nodes was lower in outgroup-rooted than in midpoint-rooted trees, and root positions and ingroup tree topologies varied in response to the composition of the outgroup. These observations suggest that the predisposition for homoplastic evolution makes AFLP-based phylogenetic analyses particularly susceptible to random biases introduced by too-distant outgroup taxa. PMID:24055738

  11. AFLP fingerprinting as a tool to study the genetic diversity of Rhizobium galegae isolated from Galega orientalis and Galega officinalis.

    PubMed

    Terefework, Z; Kaijalainen, S; Lindström, K

    2001-10-01

    AFLP fingerprints of Rhizobium galegae strains that infect Galega orientalis and Galega officinalis obtained from different geographical sources, and of taxonomically diverse rhizobia representing the recognized species, were generated. Comparisons of the fingerprints from fluorescent labeled AFLP products using capillary electrophoresis on ABI prism 310, slab gel electrophoresis on ABI prism 377 genetic analyzers and silver staining were in good agreement. All methods delineated the G. orientalis strains from G. officinalis strains, the G. orientalis strains formed a tight cluster whereas the G. officinalis strains seem to show a greater level of genetic diversity. Comparison of fluorescent AFLP with other detection methods revealed that fluorescent labeling is more sensitive and practical, in addition, the deleterious effect of radioactivity associated with 32P-labeling, the delicate process of blotting polyacrylamide gels or the tedious procedure of silver staining can be avoided. The automated system facilitated a large number of runs at a time and the subsequent analysis of the data by generating exportable raw data. The congruency of the experiments was analyzed using the Bionumerics software. PMID:11566388

  12. Analysis of genetic variation within clonal lineages of grape phylloxera (Daktulosphaira vitifoliae Fitch) using AFLP fingerprinting and DNA sequencing.

    PubMed

    Vorwerk, S; Forneck, A

    2007-07-01

    Two AFLP fingerprinting methods were employed to estimate the potential of AFLP fingerprints for the detection of genetic diversity within single founder lineages of grape phylloxera (Daktulosphaira vitifoliae Fitch). Eight clonal lineages, reared under controlled conditions in a greenhouse and reproducing asexually throughout a minimum of 15 generations, were monitored and mutations were scored as polymorphisms between the founder individual and individuals of succeeding generations. Genetic variation was detected within all lineages, from early generations on. Six to 15 polymorphic loci (from a total of 141 loci) were detected within the lineages, making up 4.3% of the total amount of genetic variation. The presence of contaminating extra-genomic sequences (e.g., viral material, bacteria, or ingested chloroplast DNA) was excluded as a source of intraclonal variation. Sequencing of 37 selected polymorphic bands confirmed their origin in mostly noncoding regions of the grape phylloxera genome. AFLP techniques were revealed to be powerful for the identification of reproducible banding patterns within clonal lineages. PMID:17893744

  13. Mapping a stripe rust resistance gene YrC591 in wheat variety C591 with SSR and AFLP markers.

    PubMed

    Li, Y; Niu, Y C; Chen, X M

    2009-01-01

    Stripe rust, caused by Puccinia striiformis Westend. f. sp. tritici (PST), is one of the most destructive diseases of common wheat (Triticum aestivum L.). To determine inheritance of stripe rust resistance and map the resistance gene(s) in wheat variety C591, F(1), F(2,) and F(3) progenies derived from the Taichung 29 x C591 cross were inoculated with Chinese PST race CY32 in the greenhouse. Genetic analysis identified a single dominant gene, temporarily designated YrC591. A total of 178 SSR and 130 AFLP markers were used to test the parents and resistant and susceptible bulks. From the bulk segregant analysis, seven polymorphic SSR and two AFLP markers were selected for genotyping the F(2) population. SSR marker Xcfa2040-7B, and SCAR marker SC-P35M48 derived from AFLP marker P35M48 ( 373 ) were identified to be closely linked to the resistance gene with genetic distances of 8.0 and 11.7 cM, respectively. The SSR markers mapped the resistance gene on chromosome arm 7BL. In the seedling test with five PST races, the reaction patterns of C591 were different from wheat cultivars or lines carrying Yr2 or Yr6 that also are found on chromosome 7B. The results indicate that YrC591 is probably a novel stripe rust resistance gene. PMID:18946654

  14. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    NASA Astrophysics Data System (ADS)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  15. A new fungal large subunit ribosomal RNA primer for high-throughput sequencing surveys.

    PubMed

    Mueller, Rebecca C; Gallegos-Graves, La Verne; Kuske, Cheryl R

    2016-02-01

    The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300-400 bp region of the D2 hypervariable region of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R-LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Together, these findings show that the LR22R-LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods. PMID:26656064

  16. Degenerate PCR primers for detecting putative priming glycosyltransferase genes in Bifidobacterium strains.

    PubMed

    Hidalgo-Cantabrana, C; Ordoñez, I; Ruas-Madiedo, P; Margolles, A

    2015-01-01

    A new PCR-based method to detect putative exopolysaccharide (EPS) producers from the genus Bifidobacterium was developed based on the detection of two priming glycosyltransferase genes: rfbP (undecaprenyl-phosphate sugar phospho-transferase) and cpsD (galactosyl-transferase). An in silico analysis of the genomes of 28 bifidobacterial strains, belonging to 8 different species, allowed us to detect rfbP, cpsD, or both, in the large majority of the genomes. Based on DNA sequence homology studies, 24 degenerated primers were synthesised in order to select the primer pairs with the broadest capacity to detect the presence of these genes. Four primer pairs targeting internal regions of rfbP and cpsD were selected, allowing the detection of at least one of the two genes in 63 out of 99 bifidobacterial strains analysed, whereas control strains from other genera yielded negative results, suggesting that these genes are widely spread in this genus. The use of these primers is recommended to screen for the potential of Bifidobacterium strains to produce EPS. PMID:25653152

  17. A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

    SciTech Connect

    Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

    2015-12-09

    The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable region of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.

  18. A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

    DOE PAGESBeta

    Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

    2015-12-09

    The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less

  19. Enhanced primers for amplification of DNA barcodes from a broad range of marine metazoans

    PubMed Central

    2013-01-01

    Background Building reference libraries of DNA barcodes is relatively straightforward when specifically designed primers are available to amplify the COI-5P region from a relatively narrow taxonomic group (e.g. single class or single order). DNA barcoding marine communities have been comparatively harder to accomplish due to the broad taxonomic diversity and lack of consistently efficient primers. Although some of the so-called “universal” primers have been relatively successful, they still fail to amplify COI-5P of many marine animal groups, while displaying random success even among species within each group. Here we propose a new pair of primers designed to enhance amplification of the COI-5P region in a wide range of marine organisms. Results Amplification tests conducted on a wide range of marine animal taxa, rendered possible the first–time sequencing of DNA barcodes from eight separated phyla (Annelida, Arthropoda, Chordata, Cnidaria, Echinodermata, Mollusca, Nemertea and Platyhelminthes), comprising a total of 14 classes, 28 orders, 57 families, 68 genus and 76 species. Conclusions These primers demonstrated to be highly cost-effective, which is of key importance for DNA barcoding procedures, such as for building comprehensive DNA barcode libraries of marine communities, where the processing of a large numbers of specimens from a wide variety of marine taxa is compulsory. PMID:24020880

  20. Effect of single mismatches at 3′–end of primers on polymerase chain reaction

    PubMed Central

    Simsek, M; Adnan, H

    2000-01-01

    Objective and Method To investigate the effect of three different mismatches (G/T, G/A or G/G) at the 3′–end of a primer to amplify a 268 bp (base pair) region of the human β–globin gene using different annealing temperatures (45 to 65°C). Results The primer with the G/T mismatch was as efficient as the normal primer (G/C match) in the amplification of a 268 bp product at all temperatures tested. However, the primers having G/A or G/G mismatches at the 3′-end did not produce any specific polymerase chain reaction (PCR) fragment at all the annealing temperatures used, except a barely detectable 268 bp product for the G/G mismatch at 45 and 50°C. Conclusion We conclude that our PCR system was refractory to amplification when one of the primers contained a G/A or G/G mismatch at the 3′–end with template DNA. PMID:24019700

  1. Beam shaping for laser initiated optical primers

    NASA Astrophysics Data System (ADS)

    Lizotte, Todd E.

    2008-08-01

    Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.

  2. Development and characterization of 11 microsatellite primers for the sedge Trichophorum planifolium (Cyperaceae)1

    PubMed Central

    Nowell, Victoria J.; Wang, Song; Smith, Tyler W.

    2015-01-01

    Premise of the study: Microsatellite loci were developed for Trichophorum planifolium (Cyperaceae), an endangered woodland sedge protected under federal and provincial legislation in Canada, to explore patterns of population genetic diversity and differentiation in the species. Methods and Results: Sixty-three primer pairs were evaluated for amplification consistency and screened for polymorphisms in 96 samples collected from 12 populations of T. planifolium distributed through the range of the species. Of these, 11 loci were shown to be polymorphic, displaying two to six alleles. Mean observed heterozygosity across loci ranged from 0.00 to 0.06 among populations tested. Conclusions: The results suggest that the 11 primer pairs developed in this study will be useful for future studies of broad-scale genetic variation in T. planifolium and in guiding management protocols for the species in Canada. PMID:26421254

  3. Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

    PubMed

    Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

    2015-05-01

    Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics. PMID:25678350

  4. Evaluating the impact of scoring parameters on the structure of intra-specific genetic variation using RawGeno, an R package for automating AFLP scoring

    PubMed Central

    Arrigo, Nils; Tuszynski, Jarek W; Ehrich, Dorothee; Gerdes, Tommy; Alvarez, Nadir

    2009-01-01

    Background Since the transfer and application of modern sequencing technologies to the analysis of amplified fragment-length polymorphisms (AFLP), evolutionary biologists have included an increasing number of samples and markers in their studies. Although justified in this context, the use of automated scoring procedures may result in technical biases that weaken the power and reliability of further analyses. Results Using a new scoring algorithm, RawGeno, we show that scoring errors – in particular "bin oversplitting" (i.e. when variant sizes of the same AFLP marker are not considered as homologous) and "technical homoplasy" (i.e. when two AFLP markers that differ slightly in size are mistakenly considered as being homologous) – induce a loss of discriminatory power, decrease the robustness of results and, in extreme cases, introduce erroneous information in genetic structure analyses. In the present study, we evaluate several descriptive statistics that can be used to optimize the scoring of the AFLP analysis, and we describe a new statistic, the information content per bin (Ibin) that represents a valuable estimator during the optimization process. This statistic can be computed at any stage of the AFLP analysis without requiring the inclusion of replicated samples. Finally, we show that downstream analyses are not equally sensitive to scoring errors. Indeed, although a reasonable amount of flexibility is allowed during the optimization of the scoring procedure without causing considerable changes in the detection of genetic structure patterns, notable discrepancies are observed when estimating genetic diversities from differently scored datasets. Conclusion Our algorithm appears to perform as well as a commercial program in automating AFLP scoring, at least in the context of population genetics or phylogeographic studies. To our knowledge, RawGeno is the only freely available public-domain software for fully automated AFLP scoring, from electropherogram

  5. Strain-Specific Identification of Probiotic Lactobacillus rhamnosus with Randomly Amplified Polymorphic DNA-Derived PCR Primers

    PubMed Central

    Tilsala-Timisjärvi, Anu; Alatossava, Tapani

    1998-01-01

    In the present work, strain-specific PCR primers for Lactobacillus rhamnosus Lc 1/3 are described. The randomly amplified polymorphic DNA (RAPD) technique was used to produce potential strain-specific markers. They were screened for specificity by hybridization with DNA from 11 L. rhamnosus strains. A 613-bp RAPD marker found to be strain-specific was sequenced, and a primer pair specific to L. rhamnosus Lc 1/3 was constructed based on the sequence. The primer pair was tested with 11 Lactobacillus species and 11 L. rhamnosus strains and was found to be strain specific. The nucleotide sequence of the specific RAPD marker was found to contain part of a protein encoding region which showed significant similarity to several transposases for insertion sequence elements of various bacteria, including other lactic acid bacterium species. PMID:9835567

  6. Primers on Special Education and Charter Schools: Compilation of Full Primer Set

    ERIC Educational Resources Information Center

    Ahearn, Eileen M.; Giovannetti, Elizabeth A.; Lange, Cheryl M.; Rhim, Lauren Morando; Warren, Sandra Hopfengardner

    2004-01-01

    This set of primers for charter school authorizers; charter school operators and state-level administrators has been developed to provide background information and resources for the "builders" of charter schools and policymakers to facilitate the successful inclusion of students with disabilities in charter schools. The primers open with a…

  7. Exquisite allele discrimination by toehold hairpin primers

    PubMed Central

    Byrom, Michelle; Bhadra, Sanchita; Jiang, Yu Sherry; Ellington, Andrew D.

    2014-01-01

    The ability to detect and monitor single nucleotide polymorphisms (SNPs) in biological samples is an enabling research and clinical tool. We have developed a surprising, inexpensive primer design method that provides exquisite discrimination between SNPs. The field of DNA computation is largely reliant on using so-called toeholds to initiate strand displacement reactions, leading to the execution of kinetically trapped circuits. We have now similarly found that the short toehold sequence to a target of interest can initiate both strand displacement within the hairpin and extension of the primer by a polymerase, both of which will further stabilize the primer:template complex. However, if the short toehold does not bind, neither of these events can readily occur and thus amplification should not occur. Toehold hairpin primers were used to detect drug resistance alleles in two genes, rpoB and katG, in the Mycobacterium tuberculosis genome, and ten alleles in the Escherichia coli genome. During real-time PCR, the primers discriminate between mismatched templates with Cq delays that are frequently so large that the presence or absence of mismatches is essentially a ‘yes/no’ answer. PMID:24990378

  8. Primerize: automated primer assembly for transcribing non-coding RNA domains.

    PubMed

    Tian, Siqi; Yesselman, Joseph D; Cordero, Pablo; Das, Rhiju

    2015-07-01

    Customized RNA synthesis is in demand for biological and biotechnological research. While chemical synthesis and gel or chromatographic purification of RNA is costly and difficult for sequences longer than tens of nucleotides, a pipeline of primer assembly of DNA templates, in vitro transcription by T7 RNA polymerase and kit-based purification provides a cost-effective and fast alternative for preparing RNA molecules. Nevertheless, designing template primers that optimize cost and avoid mispriming during polymerase chain reaction currently requires expert inspection, downloading specialized software or both. Online servers are currently not available or maintained for the task. We report here a server named Primerize that makes available an efficient algorithm for primer design developed and experimentally tested in our laboratory for RNA domains with lengths up to 300 nucleotides. Free access: http://primerize.stanford.edu. PMID:25999345

  9. Primerize: automated primer assembly for transcribing non-coding RNA domains

    PubMed Central

    Tian, Siqi; Yesselman, Joseph D.; Cordero, Pablo; Das, Rhiju

    2015-01-01

    Customized RNA synthesis is in demand for biological and biotechnological research. While chemical synthesis and gel or chromatographic purification of RNA is costly and difficult for sequences longer than tens of nucleotides, a pipeline of primer assembly of DNA templates, in vitro transcription by T7 RNA polymerase and kit-based purification provides a cost-effective and fast alternative for preparing RNA molecules. Nevertheless, designing template primers that optimize cost and avoid mispriming during polymerase chain reaction currently requires expert inspection, downloading specialized software or both. Online servers are currently not available or maintained for the task. We report here a server named Primerize that makes available an efficient algorithm for primer design developed and experimentally tested in our laboratory for RNA domains with lengths up to 300 nucleotides. Free access: http://primerize.stanford.edu. PMID:25999345

  10. AFLPs Reveal Different Population Genetic Structure under Contrasting Environments in the Marine Snail Nucella lapillus L.

    PubMed Central

    Carro, Belén; Quintela, María; Ruiz, José Miguel; Barreiro, Rodolfo

    2012-01-01

    Dispersal has received growing attention in marine ecology, particularly since evidence obtained with up-to-date techniques challenged the traditional view. The dogwhelk Nucella lapillus L., a sedentary gastropod with direct development, is a good example: dispersal was traditionally assumed to be limited until studies with microsatellites disputed this idea. To shed some light on this controversy, the genetic structure of dogwhelk populations in northwest Spain was investigated with highly polymorphic AFLP markers giving special attention to the influence of hydrodynamic stress. In agreement with the expectations for a poor disperser, our results show a significant genetic structure at regional (<200 km) and areal scales (<15 km). However, the spatial genetic structure varied with wave-exposure in the present case study: IBD was evident under sheltered conditions but absent from the exposed area where genetic differentiation was stronger. Our results provide evidence that differences in wave-exposure can exert a detectable influence on the genetic structure of coastal organisms, even in species without a planktonic larva. PMID:23185435

  11. Genetic diversity analysis of Croton antisyphiliticus Mart. using AFLP molecular markers.

    PubMed

    Oliveira, T G; Pereira, A M S; Coppede, J S; França, S C; Ming, L C; Bertoni, B W

    2016-01-01

    Croton antisyphiliticus Mart. is a medicinal plant native to Cerrado vegetation in Brazil, and it is popularly used to treat urogenital tract infections. The objective of the present study was to assess the genetic variability of natural C. antisyphiliticus populations using AFLP molecular markers. Accessions were collected in the states of Minas Gerais, São Paulo, and Goiás. The genotyping of individuals was performed using a LI-COR® DNA Analyzer 4300. The variability within populations was found to be greater than the variability between them. The F(ST) value was 0.3830, which indicated that the populations were highly structured. A higher percentage of polymorphic loci (92.16%) and greater genetic diversity were found in the population accessions from Pratinha-MG. Gene flow was considered restricted (N(m) = 1.18), and there was no correlation between genetic and geographic distances. The populations of C. antisyphiliticus exhibited an island-model structure, which demonstrates the vulnerability of the species. PMID:26909989

  12. Climate Change, Health, and Communication: A Primer.

    PubMed

    Chadwick, Amy E

    2016-06-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects. PMID:26580230

  13. Barcoding the kingdom Plantae: new PCR primers for ITS regions of plants with improved universality and specificity.

    PubMed

    Cheng, Tao; Xu, Chao; Lei, Li; Li, Changhao; Zhang, Yu; Zhou, Shiliang

    2016-01-01

    The internal transcribed spacer (ITS) of nuclear ribosomal DNA is one of the most commonly used DNA markers in plant phylogenetic and DNA barcoding analyses, and it has been recommended as a core plant DNA barcode. Despite this popularity, the universality and specificity of PCR primers for the ITS region are not satisfactory, resulting in amplification and sequencing difficulties. By thoroughly surveying and analysing the 18S, 5.8S and 26S sequences of Plantae and Fungi from GenBank, we designed new universal and plant-specific PCR primers for amplifying the whole ITS region and a part of it (ITS1 or ITS2) of plants. In silico analyses of the new and the existing ITS primers based on these highly representative data sets indicated that (i) the newly designed universal primers are suitable for over 95% of plants in most groups; and (ii) the plant-specific primers are suitable for over 85% of plants in most groups without amplification of fungi. A total of 335 samples from 219 angiosperm families, 11 gymnosperm families, 24 fern and lycophyte families, 16 moss families and 17 fungus families were used to test the performances of these primers. In vitro PCR produced similar results to those from the in silico analyses. Our new primer pairs gave PCR improvements up to 30% compared with common-used ones. The new universal ITS primers will find wide application in both plant and fungal biology, and the new plant-specific ITS primers will, by eliminating PCR amplification of nonplant templates, significantly improve the quality of ITS sequence information collections in plant molecular systematics and DNA barcoding. PMID:26084789

  14. A Primer for Objective Structured Teaching Exercises

    PubMed Central

    Schaivone, Kathryn A.

    2014-01-01

    The objective structured teaching exercise (OSTE) is a high-fidelity training method for advancing the teaching and interpersonal communication skills of faculty members and preceptors. This paper is a primer for implementation of OSTEs as part of a comprehensive faculty development program. This primer addresses teaching and precepting skills that can be most effectively enhanced and assessed by the OSTE method. Development of case scenarios, recruitment and training of standardized students, OSTE session implementation processes, and OSTE evaluation methods are discussed. The experience of the authors as well as recommendations from a review of the literature and discussions with educators with OSTE experience are included. PMID:24954944

  15. Primer: Office of Science and Technology

    SciTech Connect

    Not Available

    1992-08-01

    The OST primer is to inform new OST employees, other EPA offices, and outside agencies of the mission of the OST program as well as the functions of the OST divisions. It also provides information to OST employees on office policy and procedures.

  16. A Primer on Simulation and Gaming.

    ERIC Educational Resources Information Center

    Barton, Richard F.

    In a primer intended for the administrative professions, for the behavioral sciences, and for education, simulation and its various aspects are defined, illustrated, and explained. Man-model simulation, man-computer simulation, all-computer simulation, and analysis are discussed as techniques for studying object systems (parts of the "real…

  17. Chemically modified primers for improved multiplex PCR

    PubMed Central

    Shum, Jonathan; Paul, Natasha

    2009-01-01

    Multiplexed PCR, the amplification of multiple targets in a single reaction, presents a new set of challenges that further complicate more traditional PCR set-ups. These complications include a greater probability for non-specific amplicon formation and for imbalanced amplification of different targets, each of which can compromise quantification and detection of multiple targets. Despite these difficulties, multiplex PCR is frequently used in such applications as pathogen detection, RNA quantification, mutation analysis and now, next generation DNA sequencing. Herein, we investigate the utility of primers with one or two thermolabile 4-oxo-1-pentyl phosphotriester modifications in improving multiplex PCR performance. Initial endpoint and real-time analyses reveal a decrease in off-target amplification and subsequent increase in amplicon yield. Furthermore, the use of modified primers in multiplex set-ups revealed a greater limit of detection and more uniform amplification of each target as compared to unmodified primers. Overall, the thermolabile modified primers present a novel and exciting avenue in improving multiplex PCR performance. PMID:19258004

  18. Internet Primer: Workshop Design and Objectives.

    ERIC Educational Resources Information Center

    Laverty, Corinne Y. C.

    1996-01-01

    Outlines the design, objectives, and evaluation of an introductory Internet workshop offered with library instruction classes in an electronic classroom at Queens University (Kingston, Ontario, Canada). Presents teaching tips and frequently-asked questions. The Internet primer handouts are appended. (AEF)

  19. School Safety & Youth Violence: A Legal Primer.

    ERIC Educational Resources Information Center

    Bailey, Kirk A.; Ross, Catherine J.

    This legal primer on violence in schools addresses the responsibility of school officials to respond to undisciplined youths whose behavior threatens the welfare and safety of other children in attendance. It is broken down into sections that provide a brief overview of the key rules and guidelines for school officials and teachers in each topic…

  20. Forest Interpreter's Primer on Fire Management.

    ERIC Educational Resources Information Center

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  1. Deconstructing the Polymerase Chain Reaction: Understanding and Correcting Bias Associated with Primer Degeneracies and Primer-Template Mismatches

    PubMed Central

    Green, Stefan J.; Venkatramanan, Raghavee; Naqib, Ankur

    2015-01-01

    The polymerase chain reaction (PCR) is sensitive to mismatches between primer and template, and mismatches can lead to inefficient amplification of targeted regions of DNA template. In PCRs in which a degenerate primer pool is employed, each primer can behave differently. Therefore, inefficiencies due to different primer melting temperatures within a degenerate primer pool, in addition to mismatches between primer binding sites and primers, can lead to a distortion of the true relative abundance of targets in the original DNA pool. A theoretical analysis indicated that a combination of primer-template and primer-amplicon interactions during PCR cycles 3–12 is potentially responsible for this distortion. To test this hypothesis, we developed a novel amplification strategy, entitled “Polymerase-exonuclease (PEX) PCR”, in which primer-template interactions and primer-amplicon interactions are separated. The PEX PCR method substantially and significantly improved the evenness of recovery of sequences from a mock community of known composition, and allowed for amplification of templates with introduced mismatches near the 3’ end of the primer annealing sites. When the PEX PCR method was applied to genomic DNA extracted from complex environmental samples, a significant shift in the observed microbial community was detected. Furthermore, the PEX PCR method provides a mechanism to identify which primers in a primer pool are annealing to target gDNA. Primer utilization patterns revealed that at high annealing temperatures in the PEX PCR method, perfect match annealing predominates, while at lower annealing temperatures, primers with up to four mismatches with templates can contribute substantially to amplification. The PEX PCR method is simple to perform, is limited to PCR mixes and a single exonuclease step which can be performed without reaction cleanup, and is recommended for reactions in which degenerate primer pools are used or when mismatches between primers

  2. Species phylogeny and diversification process of Northeast Asian Pungitius revealed by AFLP and mtDNA markers.

    PubMed

    Takahashi, Hiroshi; Møller, Peter R; Shedko, Sergei V; Ramatulla, Temirbekov; Joen, Sang-Rin; Zhang, Chun-Guang; Sideleva, Valentina G; Takata, Keisuke; Sakai, Harumi; Goto, Akira; Nishida, Mutsumi

    2016-06-01

    Pungitius is a highly diversified genus of sticklebacks (Gasterosteidae) occurring widely in northern parts of the Northern Hemisphere. Several ecologically and genetically divergent types that are largely isolated reproductively but occasionally hybridize in sympatry have been discovered in Northeast Asia, although the taxonomy and evolutionary relationships among them remain unclear. We used amplified fragment length polymorphism (AFLP) and mitochondrial DNA (mtDNA) markers to infer phylogenies among individuals collected from sympatric and allopatric populations, including the type localities of the described species. Phylogenetic analyses based on 2683 polymorphic AFLP loci confirmed seven species, each of which (except for one entirely allopatric species P. platygaster) was clearly differentiated from one or two other sympatric species and constituted a highly supported monophyletic clade with conspecific allopatric populations. The phylogeny showed that two lineages arose early; one gave rise to two species (circumpolar species P. pungitius and Paratethys species P. platygaster) and the other to five species endemic to Northeast Asia (P. sinensis, P. tymensis, P. polyakovi, P. kaibarae, and P. bussei). The brackish-water, freshwater, and Omono types previously discovered in Japan were reidentified as P. pungitius, P. sinensis, and P. kaibarae, respectively. A marked incongruence was noted between the phylogenies of AFLP and mtDNA markers, suggesting the occasional occurrence of hybridization and mtDNA introgression among distinct species. Our results highlight that the marginal seas of Northeast Asia played a key role as barriers to or facilitators of gene flow in the evolution of species diversity of Pungitius concentrated in this region. PMID:26997522

  3. Comparison of MALDI-TOF MS and AFLP for strain typing of ESBL-producing Escherichia coli.

    PubMed

    Veenemans, J; Welker, M; van Belkum, A; Saccomani, M C; Girard, V; Pettersson, A; Verhulst, C; Kluytmans-Vandenbergh, M; Kluytmans, J

    2016-05-01

    Typing of bacterial isolates using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) potentially provides an efficient on-site method to monitor the spread of antibiotic-resistant bacteria and rapidly detect outbreaks. We compared MALDI-MS typing results to those of amplified fragment length polymorphism (AFLP) in a collection of 52 ESBL-producing Escherichia coli, isolated in a Dutch nursing home with an on-going outbreak of ST131 E. coli. Specific MALDI types were defined based on spectral data from four replicate colony samples of isolates grown on Columbia agar using multivariate statistical procedures. Type-specific superspectra were computed for four E .coli MALDI-types and tested for the potential of rapid and automated typing. The effect of different incubation conditions on typing performance was tested by analysing five isolates incubated for 24 h and 48 h on five different media. Types defined based on MALDI spectra were largely in agreement with the AFLP results, although some MALDI types comprised of more than one AFLP type. In particular, isolates belonging to ST131 showed distinct mass patterns. The proportion of isolates correctly assigned was substantially lower for isolates incubated on Sabouraud-dextrose and Drigalski agars for 24 h, and for those incubated for 48 h (all media). Our results show that the identification of type-specific peaks potentially allows direct typing of isolates belonging to specific clonal lineages. Both incubation time and media affected type assignment, suggesting that there is a need for a careful standardization of incubation time and culturing conditions when developing MALDI-typing schemes for E. coli. PMID:26922068

  4. Loop-mediated amplification accelerated by stem primers.

    PubMed

    Gandelman, Olga; Jackson, Rebecca; Kiddle, Guy; Tisi, Laurence

    2011-01-01

    Isothermal nucleic acid amplifications (iNAATs) have become an important alternative to PCR for in vitro molecular diagnostics in all fields. Amongst iNAATs Loop-mediated amplification (LAMP) has gained much attention over the last decade because of the simplicity of hardware requirements. LAMP demonstrates performance equivalent to that of PCR, but its application has been limited by the challenging primer design. The design of six primers in LAMP requires a selection of eight priming sites with significant restrictions imposed on their respective positioning and orientation. In order to relieve primer design constraints we propose an alternative approach which uses Stem primers instead of Loop primers and demonstrate the application of STEM-LAMP in assaying for Clostridium difficile, Listeria monocytogenes and HIV. Stem primers used in LAMP in combination with loop-generating and displacement primers gave significant benefits in speed and sensitivity, similar to those offered by Loop primers, while offering additional options of forward and reverse orientations, multiplexing, use in conjunction with Loop primers or even omission of one or two displacement primers, where necessary. Stem primers represent a valuable alternative to Loop primers and an additional tool for IVD assay development by offering more choices for primer design at the same time increasing assay speed, sensitivity, and reproducibility. PMID:22272122

  5. Rust transformation/rust compatible primers

    NASA Technical Reports Server (NTRS)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  6. Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

    PubMed

    Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

    2009-10-28

    GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree. PMID:19778057

  7. Comparative analyses of plastid and AFLP data suggest different colonization history and asymmetric hybridization between Betula pubescens and B. nana.

    PubMed

    Eidesen, Pernille Bronken; Alsos, Inger Greve; Brochmann, Christian

    2015-08-01

    Birches (Betula spp.) hybridize readily, confounding genetic signatures of refugial isolation and postglacial migration. We aimed to distinguish hybridization from range-shift processes in the two widespread and cold-adapted species B. nana and B. pubescens, previously shown to share a similarly east-west-structured variation in plastid DNA (pDNA). We sampled the two species throughout their ranges and included reference samples of five other Betula species and putative hybrids. We analysed 901 individual plants using mainly nuclear high-resolution markers (amplified fragment length polymorphisms; AFLPs); a subset of 64 plants was also sequenced for two pDNA regions. Whereas the pDNA variation as expected was largely shared between B. nana and B. pubescens, the two species were distinctly differentiated at AFLP loci. In B. nana, both the AFLP and pDNA results corroborated the former pDNA-based hypothesis that it expanded from at least two major refugia in Eurasia, one south of and one east of the North European ice sheets. In contrast, B. pubescens showed a striking lack of geographic structuring of its AFLP variation. We identified a weak but significant increase in nuclear (AFLP) gene flow from B. nana into B. pubescens with increasing latitude, suggesting hybridization has been most frequent at the postglacial expansion front of B. pubescens and that hybrids mainly backcrossed to B. pubescens. Incongruence between pDNA and AFLP variation in B. pubescens can be explained by efficient expansion from a single large refugium combined with leading-edge hybridization and plastid capture from B. nana during colonization of new territory already occupied by this more cold-tolerant species. PMID:26113148

  8. GST-PRIME: a genome-wide primer design software for the generation of gene sequence tags.

    PubMed

    Varotto, C; Richly, E; Salamini, F; Leister, D

    2001-11-01

    The availability of sequenced genomes has generated a need for experimental approaches that allow the simultaneous analysis of large, or even complete, sets of genes. To facilitate such analyses, we have developed GST-PRIME, a software package for retrieving and assembling gene sequences, even from complex genomes, using the NCBI public database, and then designing sets of primer pairs for use in gene amplification. Primers were designed by the program for the direct amplification of gene sequence tags (GSTs) from either genomic DNA or cDNA. Test runs of GST-PRIME on 2000 randomly selected Arabidopsis and Drosophila genes demonstrate that 93 and 88% of resulting GSTs, respectively, fulfilled imposed length criteria. GST-PRIME primer pairs were tested on a set of 1900 Arabidopsis genes coding for chloroplast-targeted proteins: 95% of the primer pairs used in PCRs with genomic DNA generated the correct amplicons. GST-PRIME can thus be reliably used for large-scale or specific amplification of intron-containing genes of multicellular eukaryotes. PMID:11691924

  9. GST-PRIME: a genome-wide primer design software for the generation of gene sequence tags

    PubMed Central

    Varotto, Claudio; Richly, Erik; Salamini, Francesco; Leister, Dario

    2001-01-01

    The availability of sequenced genomes has generated a need for experimental approaches that allow the simultaneous analysis of large, or even complete, sets of genes. To facilitate such analyses, we have developed GST-PRIME, a software package for retrieving and assembling gene sequences, even from complex genomes, using the NCBI public database, and then designing sets of primer pairs for use in gene amplification. Primers were designed by the program for the direct amplification of gene sequence tags (GSTs) from either genomic DNA or cDNA. Test runs of GST-PRIME on 2000 randomly selected Arabidopsis and Drosophila genes demonstrate that 93 and 88% of resulting GSTs, respectively, fulfilled imposed length criteria. GST-PRIME primer pairs were tested on a set of 1900 Arabidopsis genes coding for chloroplast-targeted proteins: 95% of the primer pairs used in PCRs with genomic DNA generated the correct amplicons. GST-PRIME can thus be reliably used for large-scale or specific amplification of intron-containing genes of multicellular eukaryotes. PMID:11691924

  10. Microsatellite primers resource developed from the mapped sequence scaffolds of Nisqually-1 genome. Submitted to New Phytologist

    SciTech Connect

    Yin, Tongming; ZHANG, Dr. XINYE; Gunter, Lee E; Li, Shuxian; Wullschleger, Stan D; Huang, Prof. Minren; Tuskan, Gerald A

    2009-01-01

    In this study, 148 428 simple sequence repeat (SSR) primer pairs were designed from the unambiguously mapped sequence scaffolds of the Nisqually-1 genome. The physical position of the priming sites were identified along each of the 19 Populus chromosomes, and it was specified whether the priming sequences belong to intronic, intergenic, exonic or UTR regions. A subset of 150 SSR loci were amplified and a high amplification success rate (72%) was obtained in P. tremuloides, which belongs to a divergent subgenus of Populus relative to Nisqually-1. PCR reactions showed that the amplification success rate of exonic primer pairs was much higher than that of the intronic/intergenic primer pairs. Applying ANOVA and regression analyses to the flanking sequences of microsatellites, the repeat lengths, the GC contents of the repeats, the repeat motif numbers, the repeat motif length and the base composition of the repeat motif, it was determined that only the base composition of the repeat motif and the repeat motif length significantly affect the microsatellite variability in P. tremuloides samples. The SSR primer resource developed in this study provides a database for selecting highly transferable SSR markers with known physical position in the Populus genome and provides a comprehensive genetic tool to extend the genome sequence of Nisqually-1 to genetic studies in different Populus species.

  11. New primers for adhesive bonding of aluminum alloys

    NASA Technical Reports Server (NTRS)

    Burrell, B. W.; Port, W. S.

    1971-01-01

    Synthetic polypeptide adhesive primers are effective, with high temperature epoxy resins, at temperatures from 100 deg to 300 deg C. Lap-shear failure loads and lap-shear strength of both primers are discussed.

  12. Multiplexing with three-primer PCR for rapid and economical microsatellite validation.

    PubMed

    Vartia, Salla; Collins, Patrick C; Cross, Thomas F; Fitzgerald, Richard D; Gauthier, David T; McGinnity, Philip; Mirimin, Luca; Carlsson, Jens

    2014-06-01

    The next generation sequencing revolution has enabled rapid discovery of genetic markers, however, development of fully functioning new markers still requires a long and costly process of marker validation. This study reports a rapid and economical approach for the validation and deployment of polymorphic microsatellite markers obtained from a 454 pyrosequencing library of Atlantic cod, Gadus morhua, Linnaeus 1758. Primers were designed from raw reads to amplify specific amplicon size ranges, allowing effective PCR multiplexing. Multiplexing was combined with a three-primer PCR approach using four universal tails to label amplicons with separate fluorochromes. A total of 192 primer pairs were tested, resulting in 73 polymorphic markers. Of these, 55 loci were combined in six multiplex panels each containing between six and eleven markers. Variability of the loci was assessed on G. morhua from the Celtic Sea (n = 46) and the Scotian Shelf (n = 46), two locations that have shown genetic differentiation in previous studies. Multilocus F(ST) between the two samples was estimated at 0.067 (P = 0.001). After three loci potentially under selection were excluded, the global F(ST) was estimated at 0.043 (P = 0.001). Our technique combines three-primer and multiplex PCR techniques, allowing simultaneous screening and validation of relatively large numbers of microsatellite loci. PMID:25041267

  13. The Interaction between tRNALys3 and the Primer Activation Signal Deciphered by NMR Spectroscopy

    PubMed Central

    Brachet, Franck; Tisne, Carine

    2013-01-01

    The initiation of reverse transcription of the human immunodeficiency virus type 1 (HIV-1) requires the opening of the three-dimensional structure of the primer tRNALys3 for its annealing to the viral RNA at the primer binding site (PBS). Despite the fact that the result of this rearrangement is thermodynamically more stable, there is a high-energy barrier that requires the chaperoning activity of the viral nucleocapsid protein. In addition to the nucleotide complementarity to the PBS, several regions of tRNALys3 have been described as interacting with the viral genomic RNA. Among these sequences, a sequence of the viral genome called PAS for “primer activation signal” was proposed to interact with the T-arm of tRNALys3, this interaction stimulating the initiation of reverse transcription. In this report, we investigate the formation of this additional interaction with NMR spectroscopy, using a simple system composed of the primer tRNALys3, the 18 nucleotides of the PBS, the PAS (8 nucleotides) encompassed or not in a hairpin structure, and the nucleocapsid protein. Our NMR study provides molecular evidence of the existence of this interaction and highlights the role of the nucleocapsid protein in promoting this additional RNA-RNA annealing. This study presents the first direct observation at a single base-pair resolution of the PAS/anti-PAS association, which has been proposed to be involved in the chronological regulation of the reverse transcription. PMID:23762248

  14. Diversity of Methane-Cycling Archaea in Hydrothermal Sediment Investigated by General and Group-Specific PCR Primers

    PubMed Central

    Teske, Andreas P.

    2014-01-01

    The zonation of anaerobic methane-cycling Archaea in hydrothermal sediment of Guaymas Basin was studied by general primer pairs (mcrI, ME1/ME2, mcrIRD) targeting the alpha subunit of methyl coenzyme M reductase gene (mcrA) and by new group-specific mcrA and 16S rRNA gene primer pairs. The mcrIRD primer pair outperformed the other general mcrA primer pairs in detection sensitivity and phylogenetic coverage. Methanotrophic ANME-1 Archaea were the only group detected with group-specific primers only. The detection of 14 mcrA lineages surpasses the diversity previously found in this location. Most phylotypes have high sequence similarities to hydrogenotrophs, methylotrophs, and anaerobic methanotrophs previously detected at Guaymas Basin or at hydrothermal vents, cold seeps, and oil reservoirs worldwide. Additionally, five mcrA phylotypes belonging to newly defined lineages are detected. Two of these belong to deeply branching new orders, while the others are new species or genera of Methanopyraceae and Methermicoccaceae. Downcore diversity decreases from all groups detected in the upper 6 cm (∼2 to 40°C, sulfate measurable to 4 cm) to only two groups below 6 cm (>40°C). Despite the presence of hyperthermophilic genera (Methanopyrus, Methanocaldococcus) in cooler surface strata, no genes were detected below 10 cm (≥60°C). While mcrA-based and 16S rRNA gene-based community compositions are generally congruent, the deeply branching mcrA cannot be assigned to specific 16S rRNA gene lineages. Our study indicates that even among well-studied metabolic groups and in previously characterized model environments, major evolutionary branches are overlooked. Detecting these groups by improved molecular biological methods is a crucial first step toward understanding their roles in nature. PMID:25527539

  15. Pairing forces in nuclei

    SciTech Connect

    Chasman, R.R.

    1996-12-31

    In this contribution, the author mentions some features of pairing forces that are unique to nuclei and cover some areas of major interest in nuclear structure research, that involve pairing. At the level of most nuclear structure studies, nuclei are treated as consisting of two kinds of fermions (protons and neutrons) in a valence space with rather few levels. These features give rise to unique aspects of pairing forces in nuclei: (1) n-p pairing in T = 0 as well as the usual T = 1 pairing that is characteristic of like fermions; (2) a need to correct pairing calculations for the (1/N) effects that can typically be neglected in superconducting solids. An issue of current concern is the nature of the pairing interaction: several recent studies suggest a need for a density dependent form of the pairing interaction. There is a good deal of feedback between the questions of accurate calculations of pairing interactions and the form and magnitude of the pairing interaction. Finally, the authors discuss some many-body wave functions that are a generalization of the BCS wave function form, and apply them to a calculation of energy level spacings in superdeformed rotational bands.

  16. Instrumented drop ball tester for percussion primers

    SciTech Connect

    Woods, C.M.; Robinson, M.A.; Merten, C.W.; Robbins, V.E. ); Begeal, D.R. )

    1991-01-01

    The drop ball tester has historically been used for determining the threshold characteristics of percussion primers. Typically, the data obtained from such a tester show a wide variation with significantly large standard deviations. This requires that the acceptance specifications for primers be fairly lax. To determine how much of the data scatter was due to the tester alone, a drop ball tester was instrumented with a force monitoring gage, velocity capabilities, deflection gages, and a pressure time output measuring system. This paper deals with the basic fundamental physics involved with the tester and presents results of improvements to the tester geometry. Threshold test results are presented, correlating all of the variables measured. 8 refs., 10 figs.

  17. Morphological Changes of Paulownia Seedlings Infected Phytoplasmas Reveal the Genes Associated with Witches' Broom through AFLP and MSAP

    PubMed Central

    Cao, Xibing; Fan, Guoqiang; Zhao, Zhenli; Deng, Minjie; Dong, Yanpeng

    2014-01-01

    Paulownia witches' broom (PaWB) caused by phytoplasma might result in devastating damage to the growth and wood production of Paulownia. To study the effect of phytoplasma on DNA sequence and to discover the genes related to PaWB occurrence, DNA polymorphisms and DNA methylation levels and patterns in PaWB seedlings, the ones treated with various concentration of methyl methane sulfonate (MMS) and healthy seedlings were investigated with amplified fragment length polymorphism (AFLP) and methylation-sensitive amplification polymorphism (MSAP). Our results indicated that PaWB seedlings recovered a normal morphology, similar to healthy seedlings, after treatment with more than 20 mg·L−1 MMS; Phytoplasma infection did not change the Paulownia genomic DNA sequence at AFLP level, but changed the global DNA methylation levels and patterns; Genes related to PaWB were discovered through MSAP and validated using quantitative real-time PCR (qRT-PCR). These results implied that changes of DNA methylation levels and patterns were closely related to the morphological changes of seedlings infected with phytoplasmas. PMID:25427154

  18. Differential Gene Expression in Sugarcane in Response to Challenge by Fungal Pathogen Ustilago scitaminea Revealed by cDNA-AFLP

    PubMed Central

    You-Xiong, Que; Jian-Wei, Lin; Xian-Xian, Song; Li-Ping, Xu; Ru-Kai, Chen

    2011-01-01

    Differential gene expression in sugarcane during sugarcane-Ustilago scitaminea interaction was conducted in a smut-resistant genotype. Using cDNA-AFLP along with silver staining, a total of 136 transcript-derived fragments (TDFs) were found to be differentially expressed in response to challenge by U. scitaminea. Forty TDFs, 34 newly induced plus six with obvious upregulated expression after infection, were sequenced and validated by RT-PCR analysis. These results demonstrated that the expression of 37 out of these TDFs in RT-PCR analysis was consistent with that in cDNA-AFLP analysis. Based on BlastX in NCBI, 28 TDFs were assumed to function in sugarcane under U. scitaminea stress. Analysis of expression profile of three TDFs revealed that they responded differently after infection with U. scitaminea, and the transcription was significantly enhanced. The response of two TDFs, SUC06 and SUC09, occurred before that of SUC10. This study enriches our knowledge of the molecular basis for sugarcane response to U. scitaminea infection. PMID:21792273

  19. Non PCR-amplified Transcripts and AFLP fragments as reduced representations of the quail genome for 454 Titanium sequencing

    PubMed Central

    2010-01-01

    Background SNP (Single Nucleotide Polymorphism) discovery is now routinely performed using high-throughput sequencing of reduced representation libraries. Our objective was to adapt 454 GS FLX based sequencing methodologies in order to obtain the largest possible dataset from two reduced representations libraries, produced by AFLP (Amplified Fragment Length Polymorphism) for genomic DNA, and EST (Expressed Sequence Tag) for the transcribed fraction of the genome. Findings The expressed fraction was obtained by preparing cDNA libraries without PCR amplification from quail embryo and brain. To optimize the information content for SNP analyses, libraries were prepared from individuals selected in three quail lines and each individual in the AFLP library was tagged. Sequencing runs produced 399,189 sequence reads from cDNA and 373,484 from genomic fragments, covering close to 250 Mb of sequence in total. Conclusions Both methods used to obtain reduced representations for high-throughput sequencing were successful after several improvements. The protocols may be used for several sequencing applications, such as de novo sequencing, tagged PCR fragments or long fragment sequencing of cDNA. PMID:20667075

  20. AFLP markers resolve intra-specific relationships and infer genetic structure among lineages of the canyon treefrog, Hyla arenicolor.

    PubMed

    Klymus, Katy E; Carl Gerhardt, H

    2012-11-01

    The canyon treefrog, Hyla arenicolor, is a wide-ranging hylid found from southwestern US into southern Mexico. Recent studies have shown this species to have a complex evolutionary history, with several phylogeographically distinct lineages, a probable cryptic species, and multiple episodes of mitochondrial introgression with the sister group, the H. eximia complex. We aimed to use genome wide AFLP markers to better resolve relationships within this group. As in other studies, our inferred phylogeny not only provides evidence for repeated mitochondrial introgression between H. arenicolor lineages and H. eximia/H. wrightorum, but it also affords more resolution within the main H. arenicolor clade than was previously achieved with sequence data. However, as with a previous study, the placement of a lineage of H. arenicolor whose distribution is centered in the Balsas Basin of Mexico remains poorly resolved, perhaps due to past hybridization with the H. eximia complex. Furthermore, the AFLP data set shows no differentiation among lineages from the Grand Canyon and Colorado Plateau despite their large mitochondrial sequence divergence. Finally, our results infer a well-supported sister relationship between this combined Colorado Plateau/Grand Canyon lineage and the Sonoran Desert lineage, a relationship that strongly contradicts conclusions drawn from the mtDNA evidence. Our study provides a basis for further behavioral and ecological speciation studies of this system and highlights the importance of multi-taxon (species) sampling in phylogenetic and phylogeographic studies. PMID:22898531

  1. Matched-pair classification

    SciTech Connect

    Theiler, James P

    2009-01-01

    Following an analogous distinction in statistical hypothesis testing, we investigate variants of machine learning where the training set comes in matched pairs. We demonstrate that even conventional classifiers can exhibit improved performance when the input data has a matched-pair structure. Online algorithms, in particular, converge quicker when the data is presented in pairs. In some scenarios (such as the weak signal detection problem), matched pairs can be generated from independent samples, with the effect not only doubling the nominal size of the training set, but of providing the structure that leads to better learning. A family of 'dipole' algorithms is introduced that explicitly takes advantage of matched-pair structure in the input data and leads to further performance gains. Finally, we illustrate the application of matched-pair learning to chemical plume detection in hyperspectral imagery.

  2. A primer for criticality calculations with DANTSYS

    SciTech Connect

    Busch, R.D.

    1997-08-01

    With the closure of many experimental facilities, the nuclear safety analyst has to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. Although deterministic methods often do not provide exact models of a system, a substantial amount of reliable information on nuclear systems can be obtained using these methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico (UNM) in cooperation with the Radiation Transport Group at Los Alamos National Laboratory (LANL) has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. DANTSYS is the new name of the group of codes formerly known as: ONEDANT, TWODANT, TWOHEX, TWOGQ, and THREEDANT. The primer is designed to teach bu example, with each example illustrating two or three DANTSYS features useful in criticality analyses. Starting with a Quickstart chapter, the primer gives an overview of the basic requirements for DANTSYS input and allows the user to quickly run a simple criticality problem with DANTSYS. Each chapter has a list of basic objectives at the beginning identifying the goal of the chapter and the individual DANTSYS features covered in detail in the chapter example problems. On completion of the primer, it is expected that the user will be comfortable doing criticality calculations with DANTSYS and can handle 60--80% of the situations that normally arise in a facility. The primary provides a set of input files that can be selective modified by the user to fit each particular problem.

  3. Modified Primers for the Identification of Nonpathogenic Fusarium oxysporum Isolates That Have Biological Control Potential against Fusarium Wilt of Cucumber in Taiwan

    PubMed Central

    Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin

    2013-01-01

    Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289

  4. Vortex pairs on surfaces

    SciTech Connect

    Koiller, Jair

    2009-05-06

    A pair of infinitesimally close opposite vortices moving on a curved surface moves along a geodesic, according to a conjecture by Kimura. We outline a proof. Numerical simulations are presented for a pair of opposite vortices at a close but nonzero distance on a surface of revolution, the catenoid. We conjecture that the vortex pair system on a triaxial ellipsoid is a KAM perturbation of Jacobi's geodesic problem. We outline some preliminary calculations required for this study. Finding the surfaces for which the vortex pair system is integrable is in order.

  5. Primers for low-copy nuclear genes in Metrosideros and cross-amplification in Myrtaceae1

    PubMed Central

    Pillon, Yohan; Johansen, Jennifer; Sakishima, Tomoko; Chamala, Srikar; Barbazuk, W. Brad; Stacy, Elizabeth A.

    2014-01-01

    • Premise of the study: Primers were developed to amplify low-copy nuclear genes in Hawaiian Metrosideros (Myrtaceae). • Methods and Results: Data from a pooled 454 Titanium run of the partial transcriptomes of four Metrosideros taxa were used to identify the loci of interest. Ten exon-primed intron-crossing (EPIC) markers were amplified and sequenced directly with success in Metrosideros, as well as in a representative selection of Myrtaceae, including Syzygium, Psidium, and Melaleuca for most of the markers. The loci amplified ranged between 500 and 1100 bp, and up to 117 polymorphic sites were observed within an individual gene alignment. Two introns contained microsatellites in some of the species. • Conclusions: These novel primer pairs should be useful for phylogenetic analysis and population genetics of a broad range of Myrtaceae, particularly the diverse fleshy-fruited tribes Syzygieae and Myrteae. PMID:25309837

  6. Microsatellite primers for Camissoniopsis cheiranthifolia (Onagraceae) and cross-amplification in related species1

    PubMed Central

    López-Villalobos, Adriana; Samis, Karen E.; Eckert, Christopher G.

    2014-01-01

    • Premise of the study: We developed 24 nuclear microsatellite primers from an enriched genomic library for the Pacific coastal dune endemic Camissoniopsis cheiranthifolia to study the consequences of mating system differentiation, the genetics of species’ range limits, and hybridization with its closest sister taxon, C. bistorta. • Methods and Results: Twenty-four primer pairs were developed and characterized in four populations of C. cheiranthifolia and one population of C. bistorta. We also tested eight additional taxa for cross-amplification. The average number of alleles per locus per species was 4.3 and 6.0, respectively. The number of loci that amplified and were variable within the eight related taxa ranged from six to 17. • Conclusions: These markers will be useful in studying mating system evolution, the genetic structure of species’ ranges, hybridization, and the provenance of material used for habitat restoration in C. cheiranthifolia, C. bistorta, and related species. PMID:25309839

  7. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    PubMed

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. PMID:25319067

  8. A Degenerate Primer MOB Typing (DPMT) Method to Classify Gamma-Proteobacterial Plasmids in Clinical and Environmental Settings

    PubMed Central

    de la Cruz, Fernando

    2012-01-01

    Transmissible plasmids are responsible for the spread of genetic determinants, such as antibiotic resistance or virulence traits, causing a large ecological and epidemiological impact. Transmissible plasmids, either conjugative or mobilizable, have in common the presence of a relaxase gene. Relaxases were previously classified in six protein families according to their phylogeny. Degenerate primers hybridizing to coding sequences of conserved amino acid motifs were designed to amplify related relaxase genes from γ-Proteobacterial plasmids. Specificity and sensitivity of a selected set of 19 primer pairs were first tested using a collection of 33 reference relaxases, representing the diversity of γ-Proteobacterial plasmids. The validated set was then applied to the analysis of two plasmid collections obtained from clinical isolates. The relaxase screening method, which we call “Degenerate Primer MOB Typing” or DPMT, detected not only most known Inc/Rep groups, but also a plethora of plasmids not previously assigned to any Inc group or Rep-type. PMID:22792321

  9. Microsatellite primers for Parkia biglobosa (Fabaceae: Mimosoideae) reveal that a single plant sires all seeds per pod1

    PubMed Central

    Lassen, Kristin Marie; Kjær, Erik Dahl; Ouédraogo, Moussa; Nielsen, Lene Rostgaard

    2014-01-01

    • Premise of the study: Microsatellite primers were developed for an indigenous fruit tree, Parkia biglobosa, as a tool to study reproductive biology and population structure. Here we use the primers to determine the number of fathers per pod. • Methods and Results: Microsatellite loci were enriched in a genomic sample and isolated using pyrosequencing. Eleven primer pairs were characterized in two populations of P. biglobosa in Burkina Faso (each with 40 trees). The number of alleles per locus ranged from eight to 15, and one locus had null alleles. We genotyped seeds from 24 open-pollinated pods. The genotypic profiles of seeds per pod suggest that all seeds are outcrossed and that only one pollen donor sires all ovules in a single fruit. • Conclusions: Ten microsatellite markers were highly polymorphic. All seeds per pod of P. biglobosa were full siblings. The markers will be useful for reproductive and population genetic studies. PMID:25202634

  10. Differentially expressed genes in Populus simonii x P. nigra in respnse to NaCl stress using cDNA-AFLP

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Salinity is an important environmental factor limiting growth and productivity of plants, and affects almost every aspect of the plant physiology and biochemistry. The objective of this study was to apply cDNA-AFLP and to identify differentially expressed genes in response to NaCl stress vs. no-stre...

  11. PCR primer pairs for 100 microsatellites in red drum (Sciaenops ocellatus)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    One hundred nuclear-encoded microsatellites from a genomic DNA library of red drum (Sciaenops ocellatus) were isolated and characterized. Eight of the microsatellites had tetra-nucleotide motifs, while 92 had di-nucleotide motifs. The average number of alleles at the 100 microsatellites among a sa...

  12. ISOLATE SPECIFIC DETECTION OF MYCORRHIZAL FUNGI USING GENOME SPECIFIC PRIMER PAIRS. (R825549C047)

    EPA Science Inventory

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  13. MPprimer: a program for reliable multiplex PCR primer design

    PubMed Central

    2010-01-01

    Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer) in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs) for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy), which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays. PMID:20298595

  14. Critical Schwinger Pair Production

    NASA Astrophysics Data System (ADS)

    Gies, Holger; Torgrimsson, Greger

    2016-03-01

    We investigate Schwinger pair production in spatially inhomogeneous electric backgrounds. A critical point for the onset of pair production can be approached by fields that marginally provide sufficient electrostatic energy for an off-shell long-range electron-positron fluctuation to become a real pair. Close to this critical point, we observe features of universality which are analogous to continuous phase transitions in critical phenomena with the pair-production rate serving as an order parameter: electric backgrounds can be subdivided into universality classes and the onset of pair production exhibits characteristic scaling laws. An appropriate design of the electric background field can interpolate between power-law scaling, essential Berezinskii-Kosterlitz-Thouless-type scaling, and a power-law scaling with log corrections. The corresponding critical exponents only depend on the large-scale features of the electric background, whereas the microscopic details of the background play the role of irrelevant perturbations not affecting criticality.

  15. Critical Schwinger Pair Production.

    PubMed

    Gies, Holger; Torgrimsson, Greger

    2016-03-01

    We investigate Schwinger pair production in spatially inhomogeneous electric backgrounds. A critical point for the onset of pair production can be approached by fields that marginally provide sufficient electrostatic energy for an off-shell long-range electron-positron fluctuation to become a real pair. Close to this critical point, we observe features of universality which are analogous to continuous phase transitions in critical phenomena with the pair-production rate serving as an order parameter: electric backgrounds can be subdivided into universality classes and the onset of pair production exhibits characteristic scaling laws. An appropriate design of the electric background field can interpolate between power-law scaling, essential Berezinskii-Kosterlitz-Thouless-type scaling, and a power-law scaling with log corrections. The corresponding critical exponents only depend on the large-scale features of the electric background, whereas the microscopic details of the background play the role of irrelevant perturbations not affecting criticality. PMID:26991162

  16. Cooper Pairs in Insulators?!

    ScienceCinema

    James Valles

    2010-01-08

    Nearly 50 years elapsed between the discovery of superconductivity and the emergence of the microscopic theory describing this zero resistance state. The explanation required a novel phase of matter in which conduction electrons joined in weakly bound pairs and condensed with other pairs into a single quantum state. Surprisingly, this Cooper pair formation has also been invoked to account for recently uncovered high-resistance or insulating phases of matter. To address this possibility, we have used nanotechnology to create an insulating system that we can probe directly for Cooper pairs. I will present the evidence that Cooper pairs exist and dominate the electrical transport in these insulators and I will discuss how these findings provide new insight into superconductor to insulator quantum phase transitions. 

  17. Pair contact process with diffusion of pairs

    NASA Astrophysics Data System (ADS)

    Santos, F. L.; Dickman, Ronald; Fulco, U. L.

    2011-03-01

    The pair contact process (PCP) is a nonequilibrium stochastic model which, like the basic contact process (CP), exhibits a phase transition to an absorbing state. The two models belong to the directed percolation (DP) universality class, despite the fact that the PCP possesses infinitely many absorbing configurations whereas the CP has but one. The critical behavior of the PCP with hopping by particles (PCPD) is as yet unclear. Here we study a version of the PCP in which nearest-neighbor particle pairs can hop but individual particles cannot. Using quasistationary simulations for three values of the diffusion probability (D = 0.1, 0.5 and 0.9), we find convincing evidence of DP-like critical behavior.

  18. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

    PubMed Central

    Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

    2016-01-01

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity. PMID:26965911

  19. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

    NASA Astrophysics Data System (ADS)

    Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

    2016-03-01

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.

  20. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River.

    PubMed

    Cannon, M V; Hester, J; Shalkhauser, A; Chan, E R; Logue, K; Small, S T; Serre, D

    2016-01-01

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity. PMID:26965911

  1. Development of universal primers for detection of potato carlaviruses by RT-PCR.

    PubMed

    Nie, Xianzhou; Bai, Yanju; Molen, Teresa A; Desjardins, David C

    2008-05-01

    To facilitate efficient and accurate detection of potato-infecting carlaviruses, degenerated universal primers were designed based on conserved amino acid and nucleotide sequences. Two sense primers, Car-F1 and Car-F2, were based on the amino acid sequences "SNNMA" and "GLGVPTE", respectively, in the coat protein. The reverse primer, Car-R, which was located at the border of the nucleic acid binding protein gene and the 3' untranslated region, and dT-B, which was derived from the oligo-dT targeting the poly(A) tail, were selected. Successful application of fragments within the predicted size range of carlaviruses was obtained using Car-F1 paired with either Car-R or dT-B from tested carlaviruses (Potato virus S, M and latent) by RT-PCR. The Car-F2 failed to yield clear-cut fragments within the predicted size range when paired with either Car-R or dT-B in RT-PCR. However, a less degenerated version of the primer, Car-F2b, resulted in amplicons within the predicted size range when paired with either Car-R or dT-B. Sequencing of the tentative carlavirus-fragments resulting from Car-F1/Car-R and Car-F2b/dT-B proved their carlavirus-origin, thus indicating the high specificity of these primers. The sensitivity of Car-F1/Car-R or Car-F2b/Car-R mediated RT-PCR for the detection of carlavirus-infected potato tubers were assessed using composite samples containing one carlavirus-infected-potato-tuber RNA sample with up to 49 virus-free-potato-tuber RNA samples under the optimal annealing temperature. The target carlaviruses were detected readily from all composites, demonstrating a high sensitivity. The method was further evaluated using presumed virus-free or carlavirus-infected potatoes of several cultivars, and reliable results were obtained. PMID:18353450

  2. Binary electrokinetic separation of target DNA from background DNA primers.

    SciTech Connect

    James, Conrad D.; Derzon, Mark Steven

    2005-10-01

    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  3. Don't put all your eggs in one basket: a cost-effective and powerful method to optimize primer choice for rRNA environmental community analyses using the Fluidigm Access Array.

    PubMed

    Brown, Shawn P; Ferrer, Astrid; Dalling, James W; Heath, Katy D

    2016-07-01

    With the increasing democratization of high-throughput sequencing (HTS) technologies, along with the concomitant increase in sequence yield per dollar, many researchers are exploring HTS for microbial community ecology. Many elements of experimental design can drastically affect the final observed community structure, notably the choice of primers for amplification prior to sequencing. Some targeted microbes can fail to amplify due to primer-targeted sequence divergence and be omitted from obtained sequences, leading to differences among primer pairs in the sequenced organisms even when targeting the same community. This potential source of taxonomic bias in HTS makes it prudent to investigate how primer choice will affect the sequenced community prior to investing in a costly community-wide sequencing effort. Here, we use Fluidigm's microfluidic Access Arrays (IFC) followed by Illumina(®) MiSeq Nano sequencing on a culture-derived local mock community to demonstrate how this approach allows for a low-cost combinatorial investigation of primer pairs and experimental samples (up to 48 primer pairs and 48 samples) to determine the most effective primers that maximize obtained communities whilst minimizing taxonomic biases. PMID:26849494

  4. AFLP analysis reveals high genetic diversity but low population structure in Coccidioides posadasii isolates from Mexico and Argentina

    PubMed Central

    2013-01-01

    Background Coccidioides immitis and C. posadasii cause coccidioidomycosis, a disease that is endemic to North and South America, but for Central America, the incidence of coccidioidomycosis has not been clearly established. Several studies suggest genetic variability in these fungi; however, little definitive information has been discovered about the variability of Coccidioides fungi in Mexico (MX) and Argentina (AR). Thus, the goals for this work were to study 32 Coccidioides spp. isolates from MX and AR, identify the species of these Coccidioides spp. isolates, analyse their phenotypic variability, examine their genetic variability and investigate the Coccidioides reproductive system and its level of genetic differentiation. Methods Coccidioides spp. isolates from MX and AR were taxonomically identified by phylogenetic inference analysis using partial sequences of the Ag2/PRA gene and their phenotypic characteristics analysed. The genetic variability, reproductive system and level of differentiation were estimated using AFLP markers. The level of genetic variability was assessed measuring the percentage of polymorphic loci, number of effective allele, expected heterocygosity and Index of Association (IA). The degree of genetic differentiation was determined by AMOVA. Genetic similarities among isolates were estimated using Jaccard index. The UPGMA was used to contsruct the corresponding dendrogram. Finally, a network of haplotypes was built to evaluate the genealogical relationships among AFLP haplotypes. Results All isolates of Coccidioides spp. from MX and AR were identified as C. posadasii. No phenotypic variability was observed among the C. posadasii isolates from MX and AR. Analyses of genetic diversity and population structure were conducted using AFLP markers. Different estimators of genetic variability indicated that the C. posadasii isolates from MX and AR had high genetic variability. Furthermore, AMOVA, dendrogram and haplotype network showed a small

  5. Hydrology of Central Florida Lakes - A Primer

    USGS Publications Warehouse

    Schiffer, Donna M.

    1998-01-01

    INTRODUCTION Lakes are among the most valued natural resources of central Florida. The landscape of central Florida is riddled with lakeswhen viewed from the air, it almost seems there is more water than land. Florida has more naturally formed lakes than other southeastern States, where many lakes are created by building dams across streams. The abundance of lakes on the Florida peninsula is a result of the geology and geologic history of the State. An estimated 7,800 lakes in Florida are greater than 1 acre in surface area. Of these, 35 percent are located in just four counties (fig. 1): Lake, Orange, Osceola, and Polk (Hughes, 1974b). Lakes add to the aesthetic and commercial value of the area and are used by many residents and visitors for fishing, boating, swimming, and other types of outdoor recreation. Lakes also are used for other purposes such as irrigation, flood control, water supply, and navigation. Residents and visitors commonly ask questions such as Whyare there so many lakes here?, Why is my lake drying up (or flooding)?, or Is my lake spring-fed? These questions indicate that the basic hydrology of lakes and the interaction of lakes with ground water and surface water are not well understood by the general population. Because of the importance of lakes to residents of central Florida and the many questions and misconceptions about lakes, this primer was prepared by the U.S. Geological Survey (USGS) in cooperation with the St. Johns River Water Management District and the South Florida Water Management District. The USGS has been collecting hydrologic data in central Florida since the 1920s, obtaining valuable information that has been used to better understand the hydrology of the water resources of central Florida, including lakes. In addition to data collection, as of 1994, the USGS had published 66 reports and maps on central Florida lakes (Garcia and Hoy, 1995). The main purpose of this primer is to describe the hydrology of lakes in central

  6. The Use of a Combination of alkB Primers to Better Characterize the Distribution of Alkane-Degrading Bacteria

    PubMed Central

    Jurelevicius, Diogo; Alvarez, Vanessa Marques; Peixoto, Raquel; Rosado, Alexandre S.; Seldin, Lucy

    2013-01-01

    The alkane monooxygenase AlkB, which is encoded by the alkB gene, is a key enzyme involved in bacterial alkane degradation. To study the alkB gene within bacterial communities, researchers need to be aware of the variations in alkB nucleotide sequences; a failure to consider the sequence variations results in the low representation of the diversity and richness of alkane-degrading bacteria. To minimize this shortcoming, the use of a combination of three alkB-targeting primers to enhance the detection of the alkB gene in previously isolated alkane-degrading bacteria was proposed. Using this approach, alkB-related PCR products were detected in 79% of the strains tested. Furthermore, the chosen set of primers was used to study alkB richness and diversity in different soils sampled in Carmópolis, Brazil and King George Island, Antarctica. The DNA extracted from the different soils was PCR amplified with each set of alkB-targeting primers, and clone libraries were constructed, sequenced and analyzed. A total of 255 alkB phylotypes were detected. Venn diagram analyses revealed that only low numbers of alkB phylotypes were shared among the different libraries derived from each primer pair. Therefore, the combination of three alkB-targeting primers enhanced the richness of alkB phylotypes detected in the different soils by 45% to 139%, when compared to the use of a single alkB-targeting primer. In addition, a dendrogram analysis and beta diversity comparison of the alkB composition showed that each of the sampling sites studied had a particular set of alkane-degrading bacteria. The use of a combination of alkB primers was an efficient strategy for enhancing the detection of the alkB gene in cultivable bacteria and for better characterizing the distribution of alkane-degrading bacteria in different soil environments. PMID:23825163

  7. The availability of the primer activation signal (PAS) affects the efficiency of HIV-1 reverse transcription initiation

    PubMed Central

    Ooms, Marcel; Cupac, Daniel; Abbink, Truus E. M.; Huthoff, Hendrik; Berkhout, Ben

    2007-01-01

    Initiation of reverse transcription of a retroviral RNA genome is strictly regulated. The tRNA primer binds to the primer binding site (PBS), and subsequent priming is triggered by the primer activation signal (PAS) that also pairs with the tRNA. We observed that in vitro reverse transcription initiation of the HIV-1 leader RNA varies in efficiency among 3′-end truncated transcripts, despite the presence of both PBS and PAS motifs. As the HIV-1 leader RNA can adopt two different foldings, we investigated if the conformational state of the transcripts did influence the efficiency of reverse transcription initiation. However, mutant transcripts that exclusively fold one or the other structure were similarly active, thereby excluding the possibility of regulation of reverse transcription initiation by the structure riboswitch. We next set out to determine the availability of the PAS element. This sequence motif enhances the efficiency of reverse transcription initiation, but its activity is regulated because the PAS motif is initially base paired within the wild-type template. We measured that the initiation efficiency on different templates correlates directly with accessibility of the PAS motif. Furthermore, changes in PAS are critical to facilitate a primer-switch to a new tRNA species, demonstrating the importance of this enhancer element. PMID:17308346

  8. SDM-Assist software to design site-directed mutagenesis primers introducing “silent” restriction sites

    PubMed Central

    2013-01-01

    Background Over the past decades site-directed mutagenesis (SDM) has become an indispensable tool for biological structure-function studies. In principle, SDM uses modified primer pairs in a PCR reaction to introduce a mutation in a cDNA insert. DpnI digestion of the reaction mixture is used to eliminate template copies before amplification in E. coli; however, this process is inefficient resulting in un-mutated clones which can only be distinguished from mutant clones by sequencing. Results We have developed a program – ‘SDM-Assist’ which creates SDM primers adding a specific identifier: through additional silent mutations a restriction site is included or a previous one removed which allows for highly efficient identification of ‘mutated clones’ by a simple restriction digest. Conclusions The direct identification of SDM clones will save time and money for researchers. SDM-Assist also scores the primers based on factors such as Tm, GC content and secondary structure allowing for simplified selection of optimal primer pairs. PMID:23522286

  9. Relaxed Primer Specificity Associated with Reverse Transcriptases Encoded by the pFOXC Retroplasmids of Fusarium oxysporum

    PubMed Central

    Simpson, E. Barry; Ross, Shannon L.; Marchetti, Sarah E.; Kennell, John C.

    2004-01-01

    The pFOXC mitochondrial retroplasmids are small, autonomously replicating linear DNAs that have a telomere-like repeat of a 5-bp sequence at their termini. The plasmids are possible evolutionary precursors of the ribonucleoprotein complex telomerase, as they encode an active reverse transcriptase (RT) that is involved in plasmid replication. Using an in vitro system to study reverse transcription, we show that the pFOXC RT is capable of copying in vitro-synthesized RNAs by use of cDNA primers or extension of snapped-back RNA templates. The ability of the pFOXC RT to use base-paired primers distinguishes it from the closely related RTs encoded by the Mauriceville and Varkud mitochondrial retroplasmids of Neurospora spp. Reaction products are similar, but not identical, to those obtained with conventional RTs, and differences reflect the ability of the pFOXC RT to initiate cDNA synthesis with loosely associated primers. The pFOXC RT can also copy DNA templates and extend 3′ mismatched DNA oligonucleotide primers. Analysis of pFOXC in vivo replication intermediates suggests that telomeric repeats are added during reverse transcription, and the ability to extend loosely associated primers could play a role in repeat formation by mechanisms similar to those associated with telomerase and certain non-long-terminal-repeat retrotransposons. PMID:15590832

  10. Electron pairing without superconductivity.

    PubMed

    Cheng, Guanglei; Tomczyk, Michelle; Lu, Shicheng; Veazey, Joshua P; Huang, Mengchen; Irvin, Patrick; Ryu, Sangwoo; Lee, Hyungwoo; Eom, Chang-Beom; Hellberg, C Stephen; Levy, Jeremy

    2015-05-14

    Strontium titanate (SrTiO3) is the first and best known superconducting semiconductor. It exhibits an extremely low carrier density threshold for superconductivity, and possesses a phase diagram similar to that of high-temperature superconductors--two factors that suggest an unconventional pairing mechanism. Despite sustained interest for 50 years, direct experimental insight into the nature of electron pairing in SrTiO3 has remained elusive. Here we perform transport experiments with nanowire-based single-electron transistors at the interface between SrTiO3 and a thin layer of lanthanum aluminate, LaAlO3. Electrostatic gating reveals a series of two-electron conductance resonances-paired electron states--that bifurcate above a critical pairing field Bp of about 1-4 tesla, an order of magnitude larger than the superconducting critical magnetic field. For magnetic fields below Bp, these resonances are insensitive to the applied magnetic field; for fields in excess of Bp, the resonances exhibit a linear Zeeman-like energy splitting. Electron pairing is stable at temperatures as high as 900 millikelvin, well above the superconducting transition temperature (about 300 millikelvin). These experiments demonstrate the existence of a robust electronic phase in which electrons pair without forming a superconducting state. Key experimental signatures are captured by a model involving an attractive Hubbard interaction that describes real-space electron pairing as a precursor to superconductivity. PMID:25971511

  11. Electron pairing without superconductivity

    NASA Astrophysics Data System (ADS)

    Cheng, Guanglei; Tomczyk, Michelle; Lu, Shicheng; Veazey, Joshua P.; Huang, Mengchen; Irvin, Patrick; Ryu, Sangwoo; Lee, Hyungwoo; Eom, Chang-Beom; Hellberg, C. Stephen; Levy, Jeremy

    2015-05-01

    Strontium titanate (SrTiO3) is the first and best known superconducting semiconductor. It exhibits an extremely low carrier density threshold for superconductivity, and possesses a phase diagram similar to that of high-temperature superconductors--two factors that suggest an unconventional pairing mechanism. Despite sustained interest for 50 years, direct experimental insight into the nature of electron pairing in SrTiO3 has remained elusive. Here we perform transport experiments with nanowire-based single-electron transistors at the interface between SrTiO3 and a thin layer of lanthanum aluminate, LaAlO3. Electrostatic gating reveals a series of two-electron conductance resonances--paired electron states--that bifurcate above a critical pairing field Bp of about 1-4 tesla, an order of magnitude larger than the superconducting critical magnetic field. For magnetic fields below Bp, these resonances are insensitive to the applied magnetic field; for fields in excess of Bp, the resonances exhibit a linear Zeeman-like energy splitting. Electron pairing is stable at temperatures as high as 900 millikelvin, well above the superconducting transition temperature (about 300 millikelvin). These experiments demonstrate the existence of a robust electronic phase in which electrons pair without forming a superconducting state. Key experimental signatures are captured by a model involving an attractive Hubbard interaction that describes real-space electron pairing as a precursor to superconductivity.

  12. Electron pairing without superconductivity

    NASA Astrophysics Data System (ADS)

    Levy, Jeremy

    Strontium titanate (SrTiO3) is the first and best known superconducting semiconductor. It exhibits an extremely low carrier density threshold for superconductivity, and possesses a phase diagram similar to that of high-temperature superconductors--two factors that suggest an unconventional pairing mechanism. Despite sustained interest for 50 years, direct experimental insight into the nature of electron pairing in SrTiO3 has remained elusive. Here we perform transport experiments with nanowire-based single-electron transistors at the interface between SrTiO3 and a thin layer of lanthanum aluminate, LaAlO3. Electrostatic gating reveals a series of two-electron conductance resonances--paired electron states--that bifurcate above a critical pairing field Bp of about 1-4 tesla, an order of magnitude larger than the superconducting critical magnetic field. For magnetic fields below Bp, these resonances are insensitive to the applied magnetic field; for fields in excess of Bp, the resonances exhibit a linear Zeeman-like energy splitting. Electron pairing is stable at temperatures as high as 900 millikelvin, well above the superconducting transition temperature (about 300 millikelvin). These experiments demonstrate the existence of a robust electronic phase in which electrons pair without forming a superconducting state. Key experimental signatures are captured by a model involving an attractive Hubbard interaction that describes real-space electron pairing as a precursor to superconductivity. Support from AFOSR, ONR, ARO, NSF, DOE and NSSEFF is gratefully acknowledged.

  13. Hubble Space Telescope Primer for Cycle 21

    NASA Astrophysics Data System (ADS)

    Gonzaga, S.; et al.

    2012-12-01

    The Hubble Space Telescope Primer for Cycle 21 is a companion document to the HST Call for Proposals1. It provides an overview of the Hubble Space Telescope (HST), with basic information about telescope operations, instrument capabilities, and technical aspects of the proposal preparation process. A thorough understanding of the material in this document is essential for the preparation of a competitive proposal. This document is available as an online HTML document and a PDF file. The HTML version, optimized for online browsing, contains many links to additional information. The PDF version is optimized for printing, but online PDF readers have search capabilities for quick retrieval of specific information.

  14. Genome-Wide Association Studies: A Primer

    PubMed Central

    Corvin, Aiden; Craddock, Nick; Sullivan, Patrick F.

    2014-01-01

    There have been nearly 400genome-wide association studies published since 2005. The GWAS approach has been exceptionally successful in identifying common genetic variants that predispose to a variety of complex human diseases and biochemical and anthropometric traits. Although this approach is relatively new, there are many excellent reviews of different aspects of the GWAS method. Here, we provide a primer, an annotated overview of the GWAS method with particular reference to psychiatric genetics. We dissect the GWAS methodology into its components and provide a brief description with citations and links to reviews that cover the topic in detail. PMID:19895722

  15. Primer on electric-utility deregulation

    SciTech Connect

    Not Available

    1982-08-01

    This primer on deregulation of the electric utility industry presents material on various subjects that are important for assessing the merits and weaknesses of alternative proposals and for generally understanding the meaning and implications of deregulation. It reviews: (a) the structure of the utility industry, its operation and its technology, with an emphasis placed on economies of scale and the benefits/problems of increased competition; (b) economic regulation, its criticisms and its prospects for improvement; and (c) the host of deregulation proposals and the few analytic studies of deregulation.

  16. Species-specific polymerase chain reaction primer sets for the diagnosis of Tenacibaculum maritimum infection.

    PubMed

    Avendaño-Herrera, Rubén; Magariños, Beatriz; Toranzo, Alicia E; Beaz, Roxana; Romalde, Jesús L

    2004-11-23

    In this study the specificity and sensitivity of 2 primer pairs, MAR1-MAR2 and Mar1-Mar2, for the detection of Tenacibaculum maritimum were evaluated in parallel using 79 T. maritimum strains isolated from different fish species, as well as 53 representatives of related and unrelated bacterial species. Both primer pairs were species-specific for T. maritimum, since no amplification products were obtained from chromosomal DNA of the non-T. maritimum bacteria tested. However, whereas MAR1-MAR2 identified all the T. maritimum strains studied, producing a unique and clear PCR band of the expected 1088 bp length, the Marl-Mar2 primer pair failed to amplify the 400 bp specific band in 3 sole isolates. To verify if these strains belonged to T. maritimum species, 2 endonucleases (PvuI and SacII) were selected as the most adequate enzymes to confirm the specificity of the MAR1-MAR2 amplified fragment. The digestion patterns obtained with both endonucleases supported the assignation of all the strains to T. maritimum. The sensitivity of both PCR detection methods was also different, showing a reduction of sensitivity in at least one order of magnitude of the Marl-Mar2 primer pair in comparison with MAR1-MAR2. When the MAR-MAR2 PCR protocol was applied to different seeded turbot tissues, the detection limit was 10(2) to 10(4) T. maritimum cells per reaction. In addition, a nested PCR protocol for detection of this pathogens based on MAR1-MAR2 was developed, which increased the sensitivity by approximately 2 orders of magnitude, ranging from 1 to 250 T. maritimum cells per reaction depending on the tissue employed. The tissues that allowed the most easy detection of T. maritimum were the skin and mucus. Based on the findings reported here, we propose the nested PCR protocol as the most adequate for an accurate detection of T. maritimum in diagnostic pathology as well as in epidemiological studies of gliding bacterial disease of marine fish. PMID:15648833

  17. Use of conserved genomic regions and degenerate primers in a PCR-based assay for the detection of members of the genus Caulimovirus.

    PubMed

    Pappu, H R; Druffel, K L

    2009-04-01

    The genus Caulimovirus consists of several distinct virus species with a double-stranded DNA genome that infect diverse plant species. A comparative analysis of the sequences of known Caulimovirus species revealed two regions that are conserved in all Caulimovirus species with the exception of Strawberry vein banding virus. Degenerate primers based on these two regions were designed and tested in a polymerase chain reaction-based assay for broad spectrum detection of members of this genus. Cauliflower mosaic virus, Figwort mosaic virus and three distinct caulimoviruses associated with dahlia (Dahlia variabilis) were used to show the utility of this test in detecting diverse caulimoviruses. The primer pair gave an amplicon of expected size (840bp). Amplicons from each virus were cloned and sequenced to verify their identity. The primer pair and the PCR assay provide approach for the broad spectrum detection of several members of the genus Caulimovirus. PMID:19100290

  18. Cryptococcal meningitis due to Cryptococcus neoformans genotype AFLP1/VNI in Iran: a review of the literature.

    PubMed

    Badali, Hamid; Alian, Shahriar; Fakhim, Hamed; Falahatinejad, Mahsa; Moradi, Ali; Mohammad Davoudi, Mehrnaz; Hagen, Ferry; Meis, Jacques F

    2015-12-01

    Cryptococcal meningitis is the most important opportunistic fungal infection with a high mortality in HIV-patients in less developed regions. Here, we report a case of cryptococcal meningitis in a 49-year-old HIV-positive female due to Cryptococcus neoformans (serotype A, mating-type alpha, genotype AFLP1/VNI) in Sari, Iran. In vitro antifungal susceptibility tests showed MICs of isavuconazole (0.016 μg ml(-1) ), voriconazole (0.031 μg ml(-1) ), posaconazole (0.031 μg ml(-1) ), itraconazole (0.063 μg ml(-1) ), amphotericin B (0.125 μg ml(-1) ) and fluconazole (8 μg ml(-1) ). Despite immediate antifungal therapy, the patient died 4 days later due to respiratory failure. Cryptococcal infections have been infrequently reported from Iran and therefore we analysed all published cases of cryptococcosis in Iran since the first reported case from 1969. PMID:26444438

  19. Census Tracts (PHC80-2). Census '80 Product Primers: Primer Number 10.

    ERIC Educational Resources Information Center

    Bureau of the Census (DOC), Washington, DC. Data User Services Div.

    This primer is designed to teach about the concept of census tracts. Census tracts are relatively small statistical subdivisons that vary in population from about 2,500 to 8,000 and are designed to include fairly homogeneous populations. They are most often found in cities and counties of metropolitan areas of the nation. In all, there are over…

  20. Paired Straight Hearth Furnace

    SciTech Connect

    2009-04-01

    This factsheet describes a research project whose goals are to design, develop, and evaluate the scalability and commercial feasibility of the PSH Paired Straight Hearth Furnace alternative ironmaking process.

  1. Fuel primer for float type carburetors

    SciTech Connect

    Scott, W.A.

    1988-04-19

    A fuel primer for float type carburetors having a fuel bowl, the fuel bowl coupled with a fuel inlet, an outlet vent, and a nozzle, the fuel inlet coupled with a fuel source and the nozzle coupled with an intake path, the primer is described comprising: means coupled with the outlet for introducing a pressurized fluid flow in the fuel bowl and means associated with the fuel bowl and ambient air for automatically enabling ambient air flow to enter into the fuel bowl upon start up and for enabling fuel flow to enter into the intake path from the fuel bowl during pressurization of the fluid while preventing the fuel flow from exiting the air flow means during pressurization of the fluid such that air enters an engine through the means associated with the fuel bowl and the engine begins to run and continues to run during start up enabling an operator to move a choke from a closed to an open position for continuous operation of the engine.

  2. Formaldehyde as hypothetical primer of biohomochirality

    NASA Astrophysics Data System (ADS)

    Goldanskii, Vitalii I.

    1996-07-01

    One of the most intriguing and crucial problems of the prebiotic evolution and the origin of life is the explanation of the origin of biohomochirality. A scheme of conversions originated by formaldehyde (FA) as hypothetical primer of biohomochirality is proposed. The merit of FA as executor of this function is based -inter alia - on the distinguished role of FA as one of the earliest and simplest molecules in both warm, terrestrial and cold, extraterrestrial scenarios of the origin of life. The confirmation of the role of FA as primer of biohomochirality would support the option of an RNA world as an alternative to the protein world. The suggested hypothesis puts forward for the first time a concrete sequence of chemical reactions which can lead to biohomochirality. The spontaneous breaking of the mirror symmetry is secured by the application of the well-known Frank scheme (combination of autocatalysis and ``annihilation'' of L and D enantiomers) to the series of interactions of FA ``trimers'' (i.e. C3H6O3 compounds) of (aaa), (apa) and (app) types, where the monomeric groups (a) means ``achirons'' (a=CHn, n>=2 and C=M, M=C,O) and (p) mean ``prochirons'' (p=HC*OM, M=H,C).

  3. Global Health in Family Medicine Summer Primer

    PubMed Central

    Rouleau, Katherine; Janakiram, Praseedha; Nicolle, Eileen; Godoy-Ruiz, Paula; Pakes, Barry N.

    2015-01-01

    Abstract Problem addressed Despite the rapid emergence of global health training across North American universities, there remains a gap in educational programs focusing on the unique role of family medicine and primary care in global health. Objective of program The objective of the Global Health in Family Medicine Summer Primer, developed in 2013 by the Department of Family and Community Medicine at the University of Toronto in Ontario, is to strengthen global health competencies among family medicine residents and faculty. Program description The course covers the meaning of global health; global health ethics; the place of family medicine, primary care, and primary health care in the global health context; epidemiology; infectious diseases; the social determinants of health; and care of vulnerable populations locally and globally. The course is delivered in an intensive 5-day format with didactic lectures, group discussions, interactive workshops, and lived-experience panels. Conclusion The Global Health in Family Medicine Summer Primer has proven to be a successful educational initiative and provides valuable lessons learned for other academic science centres in developing global health training programs for family medicine residents and faculty. PMID:26380854

  4. Alanylated lipoteichoic acid primer in Bacillus subtilis

    PubMed Central

    Luo, Yu

    2016-01-01

    Lipoteichoic acid is a major lipid-anchored polymer in Gram-positive bacteria such as Bacillus subtilis. This polymer typically consists of repeating phosphate-containing units and therefore has a predominant negative charge. The repeating units are attached to a glycolipid anchor which has a diacylglycerol (DAG) moiety attached to a dihexopyranose head group. D-alanylation is known as the major modification of type I and type IV lipoteichoic acids, which partially neutralizes the polymer and plays important roles in bacterial survival and resistance to the host immune system. The biosynthesis pathways of the glycolipid anchor and lipoteichoic acid have been fully characterized. However, the exact mechanism of D-alanyl transfer from the cytosol to cell surface lipoteichoic acid remains unclear. Here I report the use of mass spectrometry in the identification of possible intermediate species in the biosynthesis and D-alanylation of lipoteichoic acid: the glycolipid anchor, nascent lipoteichoic acid primer with one phosphoglycerol unit, as well as mono- and di-alanylated forms of the lipoteichoic acid primer. Monitoring these species as well as the recently reported D-alanyl-phosphatidyl glycerol should aid in shedding light on the mechanism of the D-alanylation pathway of lipoteichoic acid. PMID:27134729

  5. DNA methylation and methylation polymorphism in ecotypes of Jatropha curcas L. using methylation-sensitive AFLP markers.

    PubMed

    Mastan, Shaik G; Rathore, Mangal S; Bhatt, Vacha D; Chikara, J; Ghosh, A

    2014-12-01

    We investigated DNA methylation and polymorphism in the methylated DNA using AFLP based methylation-sensitive amplification polymorphism (MS-AFLP) markers in ecotypes of Jatropha curcas L. growing in similar and different geo-ecological conditions. Three ecotypes growing in different geo-ecological conditions with environmental heterogeneity (Group-1) and five ecotypes growing in similar environmental conditions (Group-2) were assessed. In ecotypes growing in group-1, 44.32 % DNA was methylated and of which 93.59 % DNA was polymorphic. While in group-2, 32.27 % DNA was methylated, of which 51.64 % DNA was polymorphic. In site 1 and site 2 of group-1, overall methylation was 18.94 and 22.44 % respectively with difference of 3.5 %, while overall polymorphism was 41.14 and 39.23 % with a difference of 1.91 %. In site 1 and site 2 of group-2, overall methylation was 24.68 and 24.18 % respectively with difference of 0.5 %, while overall polymorphism was 12.19 and 12.65 % with a difference of 0.46 %. The difference of methylation percentage and percentage of methylation polymorphism throughout the genome of J. curcas at site 1 and 2 of group-1 is higher than that of J. curcas at site 1 and 2 of group-2. These results correlated the physico-chemical properties of soil at these sites. The variations of physico-chemical properties of soil at Chorwadla (site 1 in group-1 and site 2 in group-2) compared to the soil at Brahmapur (site 2 in group-1) is higher than that of soil at Neswad (site 1 in group-2). The study suggests that these homologous nucleotide sequences probably play important role in ecotype adaptation to environmental heterogeneity by creating epiallelic variations hence in evolution of ecotypes/clines or forms of species showing phenotypic/genotypic differences in different geographical areas. PMID:25227523

  6. Revisiting AFLP fingerprinting for an unbiased assessment of genetic structure and differentiation of taurine and zebu cattle

    PubMed Central

    2014-01-01

    Background Descendants from the extinct aurochs (Bos primigenius), taurine (Bos taurus) and zebu cattle (Bos indicus) were domesticated 10,000 years ago in Southwestern and Southern Asia, respectively, and colonized the world undergoing complex events of admixture and selection. Molecular data, in particular genome-wide single nucleotide polymorphism (SNP) markers, can complement historic and archaeological records to elucidate these past events. However, SNP ascertainment in cattle has been optimized for taurine breeds, imposing limitations to the study of diversity in zebu cattle. As amplified fragment length polymorphism (AFLP) markers are discovered and genotyped as the samples are assayed, this type of marker is free of ascertainment bias. In order to obtain unbiased assessments of genetic differentiation and structure in taurine and zebu cattle, we analyzed a dataset of 135 AFLP markers in 1,593 samples from 13 zebu and 58 taurine breeds, representing nine continental areas. Results We found a geographical pattern of expected heterozygosity in European taurine breeds decreasing with the distance from the domestication centre, arguing against a large-scale introgression from European or African aurochs. Zebu cattle were found to be at least as diverse as taurine cattle. Western African zebu cattle were found to have diverged more from Indian zebu than South American zebu. Model-based clustering and ancestry informative markers analyses suggested that this is due to taurine introgression. Although a large part of South American zebu cattle also descend from taurine cows, we did not detect significant levels of taurine ancestry in these breeds, probably because of systematic backcrossing with zebu bulls. Furthermore, limited zebu introgression was found in Podolian taurine breeds in Italy. Conclusions The assessment of cattle diversity reported here contributes an unbiased global view to genetic differentiation and structure of taurine and zebu cattle

  7. Cooper Pair Insulators

    NASA Astrophysics Data System (ADS)

    Valles, James

    One of the recent advances in the field of the Superconductor to Insulator Transition (SIT) has been the discovery and characterization of the Cooper Pair Insulator phase. This bosonic insulator, which consists of localized Cooper pairs, exhibits activated transport and a giant magneto-resistance peak. These features differ markedly from the weakly localized transport that emerges as pairs break at a ``fermionic'' SIT. I will describe how our experiments on films nano-patterned with a nearly triangular array of holes have enabled us to 1) distinguish bosonic insulators from fermionic insulators, 2) show that Cooper pairs, rather than quasi-particles dominate the transport in the Cooper Pair insulator phase, 3) demonstrate that very weak, sub nano-meter thickness inhomogeneities control whether a bosonic or fermionic insulator forms at an SIT and 4) reveal that Cooper pairs disintegrate rather than becoming more tightly bound deep in the localized phase. We have also developed a method, using a magnetic field, to tune flux disorder reversibly in these films. I will present our latest results on the influence of magnetic flux disorder and random gauge fields on phenomena near bosonic SITs. This work was performed in collaboration with M. D. Stewart, Jr., Hung Q. Nguyen, Shawna M. Hollen, Jimmy Joy, Xue Zhang, Gustavo Fernandez, Jeffrey Shainline and Jimmy Xu. It was supported by NSF Grants DMR 1307290 and DMR-0907357.

  8. pmoA Primers for Detection of Anaerobic Methanotrophs▿

    PubMed Central

    Luesken, Francisca A.; Zhu, Baoli; van Alen, Theo A.; Butler, Margaret K.; Diaz, Marina Rodriguez; Song, Bongkeun; Op den Camp, Huub J. M.; Jetten, Mike S. M.; Ettwig, Katharina F.

    2011-01-01

    Published pmoA primers do not match the pmoA sequence of “Candidatus Methylomirabilis oxyfera,” a bacterium that performs nitrite-dependent anaerobic methane oxidation. Therefore, new pmoA primers for the detection of “Ca. Methylomirabilis oxyfera”-like methanotrophs were developed and successfully tested on freshwater samples from different habitats. These primers expand existing molecular tools for the study of methanotrophs in the environment. PMID:21460105

  9. Rapid sizing of short tandem repeat alleles using capillary array electrophoresis and energy-transfer fluorescent primers

    SciTech Connect

    Wang, Y.; Ju, J.; Carpenter, B.A.; Atherton, J.M.; Sensabaugh, G.F.; Mathies, R.A.

    1995-04-01

    Genetic typing of the short tandem repeat (STR) polymorphism HUMTHO1 has been performed using capillary array electroporesis and energy-transfer fluorescent dye-labeled polymerase chain reaction primers. Target alleles were amplified by use of primers labeled with one fluorescein at the 5` end and another fluorescein at the position of the 15th (modified) base to produce fragments that fluoresce in the green ({lambda}{sub max} = 525 nm). Unknown alleles were electrophoretically separated together with a standard ladder made up of alleles having 6, 7, 8, and 9 four-base pair repeats, each of which was amplified with an energy-transfer primer having a donor fluorescein at the 5` end and a rhodamine acceptor at the position of the 7th (modified) base to produce standard fragments fluorescing in the red (>590 nm). Separations are complete in less than 20 min and allow sizing with an absolute error or accuracy of less than 0.4 base pair and an average standard deviation of nearly 0.5 base pair with no correction for mobility shift and cross-talk between the fluorescence channels. This work establishes feasibility of high-speed, high-throughput STR typing of double-stranded DNA fragments using capillary array electrophoresis. 27 refs., 7 figs., 1 tab.

  10. Partially overlapping primer-based PCR for genome walking.

    PubMed

    Li, Haixing; Ding, Dongqin; Cao, Yusheng; Yu, Bo; Guo, Liang; Liu, Xiaohua

    2015-01-01

    Current genome walking methods are cumbersome to perform and can result in non-specific products. Here, we demonstrate the use of partially overlapping primer-based PCR (POP-PCR), a direct genome walking technique for the isolation of unknown flanking regions. This method exploits the partially overlapping characteristic at the 3' ends of a set of POP primers (walking primers), which guarantees that the POP primer only anneals to the POP site of the preceding PCR product at relatively low temperatures. POP primer adaptation priming at the genomic DNA/POP site occurs only once due to one low-/reduced-stringency cycle in each nested PCR, resulting in the synthesis of a pool of single-stranded DNA molecules. Of this pool, the target single-stranded DNA is replicated to the double-stranded form bound by the specific primer and the POP primer in the subsequent high-stringency cycle due to the presence of the specific primer-binding site. The non-target single stranded DNA does not become double stranded due to the absence of a binding site for any of the primers. Therefore, the POP-PCR enriches target DNA while suppressing non-target products. We successfully used POP-PCR to retrieve flanking regions bordering the gadA locus in Lactobacillus brevis NCL912, malQ in Pichia pastoris GS115, the human aldolase A gene, and hyg in rice. PMID:25811779

  11. Development and characterization of DNA microsatellite primers for buriti (Mauritia flexuosa L.f.).

    PubMed

    Menezes, E V; Souto, W F S; Ciampi, A Y; Azevedo, V C R; Valério, H M; Pimenta, M A S

    2012-01-01

    Mauritia flexuosa L. (Arecaceae) is a palm tree species known as buriti that occurs in the Cerrado biome. It is characteristic of the vereda, a typical ecosystem of central Brazil. In this phytophysiognomy, M. flexuosa and other groups of arboreal-herbaceous species develop in open fields with very humid soils. M. flexuosa can be found in forest borders and is a palm tree with a wide distribution in South America (Brazil, Colombia, Venezuela, French Guyana Ecuador, Peru, and Bolivia). The main objectives of this study were to develop simple sequence repeat marker-enriched libraries and to characterize these loci in buriti palm to facilitate future population studies. A total of 40 sequences derived from the microsatellite-enriched libraries were selected for primer design. The optimization results showed that 9 primer pairs could successfully amplify polymorphic target fragments of the expected sizes. The data also show that the described primers can be used in population genetic studies in M. flexuosa to obtain information that will inform conservation and management strategies. PMID:23079977

  12. Development of species-specific primers for detection of Streptococcus mutans in mixed bacterial samples

    PubMed Central

    Chen, Zhou; Saxena, Deepak; Caufield, Page W.; Ge, Yao; Wang, Minqi; Li, Yihong

    2009-01-01

    Streptococcus mutans is the major microbial pathogen associated with dental caries in children. The objectives of this study were to design and evaluate species-specific primers for the identification of S. mutans. Validation of the best primer set, Sm479F/R, was performed using 7 S. mutans reference strains, 48 ATCC non-S. mutans strains, 92 S. mutans clinical isolates, DNA samples of S. mutans-S. sobrinus or S. mutans-S. sanguinis, and mixed bacterial DNA of saliva samples from 33 18-month-old children. All of the S. mutans samples tested positive, and no PCR products were amplified from members of the other streptococci or non-streptococci strains examined. The lowest detection level for PCR was 10−2 nanograms of S. mutans DNA (approximately 4.6 × 103 copies) in the test samples. The results of our study suggest that the Sm479F/R primer pair is highly specific and sensitive for identification of S. mutans in either purified or mixed DNA samples. PMID:17521362

  13. Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

    SciTech Connect

    Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J.

    2012-08-01

    The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

  14. Great Lakes rivermouths: a primer for managers

    USGS Publications Warehouse

    Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  15. Electron Pairing Without Superconductivity

    NASA Astrophysics Data System (ADS)

    Levy, Jeremy; Cheng, G.; Tomczyk, M.; Lu, S.; Veazey, J. P.; Huang, M.; Irvin, P.; Ryu, S.; Lee, H.; Eom, C.-B.; Hellberg, C. S.

    2015-03-01

    Strontium titanate (SrTiO3) exhibits an extremely low carrier density threshold for superconductivity, and possesses a phase diagram similar to high-temperature superconductors--two factors that suggest an unconventional pairing mechanism. We describe transport experiments with nanowire-based quantum dots localized at the interface between SrTiO3 and LaAlO3. Electrostatic gating of the quantum dot reveals a series of two-electron conductance resonances--paired electron states--that bifurcate above a critical magnetic field Bp 1-4 Tesla, an order of magnitude larger than the superconducting critical magnetic field. For B Bp, the resonances exhibit a linear Zeeman-like energy splitting. Electron pairing is stable at temperatures as high as T = 900 mK, far above the superconducting transition temperature (Tc 300 mK). These experiments demonstrate the existence of a robust electronic phase in which electrons pair without forming a superconducting state. Key experimental signatures are captured by an attractive-U Hubbard model that describes real-space electron pairing as a precursor to superconductivity. This work was supported by ARO MURI W911NF-08-1-0317 (J.L.), AFOSR MURI FA9550-10-1-0524 (C.-B.E., J.L.) and FA9550-12-1-0342 (C.-B.E.), and grants from the National Science Foundation DMR-1104191 (J.L.), DMR.

  16. Primer on tritium safe handling practices

    SciTech Connect

    Not Available

    1994-12-01

    This Primer is designed for use by operations and maintenance personnel to improve their knowledge of tritium safe handling practices. It is applicable to many job classifications and can be used as a reference for classroom work or for self-study. It is presented in general terms for use throughout the DOE Complex. After reading it, one should be able to: describe methods of measuring airborne tritium concentration; list types of protective clothing effective against tritium uptake from surface and airborne contamination; name two methods of reducing the body dose after a tritium uptake; describe the most common method for determining amount of tritium uptake in the body; describe steps to take following an accidental release of airborne tritium; describe the damage to metals that results from absorption of tritium; explain how washing hands or showering in cold water helps reduce tritium uptake; and describe how tritium exchanges with normal hydrogen in water and hydrocarbons.

  17. HST archive primer, version 4.1

    NASA Technical Reports Server (NTRS)

    Fruchter, A. (Editor); Baum, S. (Editor)

    1994-01-01

    This version of the HST Archive Primer provides the basic information a user needs to know to access the HST archive via StarView the new user interface to the archive. Using StarView, users can search for observations interest, find calibration reference files, and retrieve data from the archive. Both the terminal version of StarView and the X-windows version feature a name resolver which simplifies searches of the HST archive based on target name. In addition, the X-windows version of StarView allows preview of all public HST data; compressed versions of public images are displayed via SAOIMAGE, while spectra are plotted using the public plotting package, XMGR. Finally, the version of StarView described here features screens designed for observers preparing Cycle 5 HST proposals.

  18. Yeast Ty1 retrotransposon: the minus-strand primer binding site and a cis-acting domain of the Ty1 RNA are both important for packaging of primer tRNA inside virus-like particles.

    PubMed Central

    Wilhelm, M; Wilhelm, F X; Keith, G; Agoutin, B; Heyman, T

    1994-01-01

    Reverse transcription of the yeast retrotransposon Ty1 is primed by the cytoplasmic initiator methionine tRNA (tRNA(iMet)). The primer tRNA(iMet) is packaged inside virus-like particles (VLPs) and binds to a 10 nucleotides minus-strand primer binding site, the (-)PBS, complementary to its 3' acceptor stem. We have found that three short sequences of the Ty1 RNA (box 1, box 2.1 and box 2.2) located 3' to the (-)PBS are complementary to other regions of the primer tRNA(iMet) (T psi C and DHU stems and loops). Reconstitution of reverse transcription in vitro with T7 transcribed Ty1 RNA species and tRNA(iMet) purified from yeast cells shows that the boxes do not affect the efficiency of reverse transcription. Thus the role of the boxes on packaging of the primer tRNA(iMet) into the VLPs was investigated by analysing the level of tRNA(iMet) packaged into mutant VLPs. Specific nucleotide changes in the (-)PBS or in the boxes that do not change the protein coding sequence but disrupt the complementarity with the primer tRNA(iMet) within the VLPs. We propose that base pairing between the primer tRNA(iMet) and the Ty1 RNA is of major importance for tRNA(iMet) packaging into the VLPs. Moreover the intactness of the boxes is essential for retrotransposition as shown by the transposition defect of a Ty1 element harboring an intact (-)PBS and mutated boxes. Images PMID:7527135

  19. Genetic Variability in Populations of the Southern Chinch Bug, Blissus insularis, Assessed using AFLP Analysis

    PubMed Central

    Chandra, Ambika; Reinert, James A.; LaMantia, Jonathan; Pond, J. Blake; Huff, David R.

    2011-01-01

    Southern chinch bug, Blissus insularis Barber (Heteroptera: Blissidae), is the most destructive insect pest of St. Augustine grass, Stenotaphrum secundatum Waltz (Kuntze), in the southern United States. The present study is focused on assessing genetic variability in five populations of B. insularis collected from Texas and Florida where St. Augustine grass is widely grown. The amplified fragment length polymorphism technique was used to DNA fingerprint individuals from each population (a total of 46 individuals) using five primer combinations (EcoRI/MSeI). Analysis of molecular variance results show no evidence to support significant genetic variability among Texas and Florida populations of B. insularis. Nearly all genetic variation was found to reside within populations (95%), with only approximately 3% residing among populations between regions. Low GST values obtained from POPGENE and low FST values obtained from the analysis of molecular variance both support the conclusion for high levels of gene flow resulting from interbreeding and/or migratory events among the populations. A Mantel test of Euclidean squared distances showed no correlation between the genetic distance and geographic distance matrices of tested populations of B. insularis. The results of the present study suggests that gene flow is occurring among populations of B. insularis and, therefore, breeders need to be aware that this resistance will most likely not remain localized, and it has the potential to spread as a result of migratory events. PMID:22957773

  20. Supernovae in paired galaxies

    NASA Astrophysics Data System (ADS)

    Nazaryan, T. A.; Petrosian, A. R.; Hakobyan, A. A.; Adibekyan, V. Zh.; Kunth, D.; Mamon, G. A.; Turatto, M.; Aramyan, L. S.

    2014-07-01

    We investigate the influence of close neighbor galaxies on the properties of supernovae (SNe) and their host galaxies using 56 SNe located in pairs of galaxies with different levels of star formation (SF) and nuclear activity. The mean distance of type II SNe from nuclei of hosts is greater by about a factor of 2 than that of type Ibc SNe. The distributions and mean distances of SNe are consistent with previous results compiled with the larger sample. For the first time it is shown that SNe Ibc are located in pairs with significantly smaller difference of radial velocities between components than pairs containing SNe Ia and II. We consider this as a result of higher star formation rate (SFR) of these closer systems of galaxies.

  1. Applications of balanced pairs

    NASA Astrophysics Data System (ADS)

    Li, HuanHuan; Wang, JunFu; Huang, ZhaoYong

    2016-05-01

    Let $(\\mathscr{X}$, $\\mathscr{Y})$ be a balanced pair in an abelian category. We first introduce the notion of cotorsion pairs relative to $(\\mathscr{X}$, $\\mathscr{Y})$, and then give some equivalent characterizations when a relative cotorsion pair is hereditary or perfect. We prove that if the $\\mathscr{X}$-resolution dimension of $\\mathscr{Y}$ (resp. $\\mathscr{Y}$-coresolution dimension of $\\mathscr{X}$) is finite, then the bounded homotopy category of $\\mathscr{Y}$ (resp. $\\mathscr{X}$) is contained in that of $\\mathscr{X}$ (resp. $\\mathscr{Y}$). As a consequence, we get that the right $\\mathscr{X}$-singularity category coincides with the left $\\mathscr{Y}$-singularity category if the $\\mathscr{X}$-resolution dimension of $\\mathscr{Y}$ and the $\\mathscr{Y}$-coresolution dimension of $\\mathscr{X}$ are finite.

  2. Replacing Uridine with 2-Thiouridine Enhances the Rate and Fidelity of Nonenzymatic RNA Primer Extension

    PubMed Central

    2015-01-01

    The nonenzymatic replication of RNA oligonucleotides is thought to have played a key role in the origin of life prior to the evolution of ribozyme-catalyzed RNA replication. Although the copying of oligo-C templates by 2-methylimidazole-activated G monomers can be quite efficient, the copying of mixed sequence templates, especially those containing A and U, is particularly slow and error-prone. The greater thermodynamic stability of the 2-thio-U(s2U):A base pair, relative to the canonical U:A base pair, suggests that replacing U with s2U might enhance the rate and fidelity of the nonenzymatic copying of RNA templates. Here we report that this single atom substitution in the activated monomer improves both the kinetics and the fidelity of nonenzymatic primer extension on mixed-sequence RNA templates. In addition, the mean lengths of primer extension products obtained with s2U is greater than those obtained with U, augmenting the potential for nonenzymatic replication of heritable function-rich sequences. We suggest that noncanonical nucleotides such as s2U may have played a role during the infancy of the RNA world by facilitating the nonenzymatic replication of genomic RNA oligonucleotides. PMID:25654265

  3. Automotive body primers: Their application in vehicle identification.

    PubMed

    Deaken, D

    1975-04-01

    An approach to vehicle identification based on the varied primer color combinations used by the automobile manufacturers is outlined. A description is given of the primer color combinations found on a number of domestic and foreign cars. The expediency of this system of vehicle identification by successive elimation is discussed. PMID:1123598

  4. Kentucky State Primer. A Primer on Developing Kentucky's Landfill Gas-to-Energy Potential

    NASA Astrophysics Data System (ADS)

    2000-05-01

    Throughout the country, the number of landfill gas-to-energy (LFGTE) projects is growing. Recovering methane gas at solid waste landfills provides significant environmental and economic benefits by eliminating methane emissions while capturing the emissions energy value. The methane captured from landfills can be transformed into a cost-effective fuel source for generating electricity and heat, firing boilers, or even powering vehicles. Permits, incentive programs, and policies for LFGTE project development vary greatly from state to state. To guide LFGTE project developers through the state permitting process and to help them to take advantage of state incentive programs, the U.S. Environmental Protection Agencys (EPAs) Landfill Methane Outreach Program (LMOP) has worked with state agencies to develop individual primers for states participating in the State Ally Program. By presenting the latest information on federal and state regulations and incentives affecting LFGTE projects in this primer, the LMOP and Kentucky state officials hope to facilitate development of many of the landfills listed in Table A. To develop this primer, the Commonwealth of Kentucky identified all the permits and funding programs that could apply to LFGTE projects developed in Kentucky. It should be noted, however, that the regulations, agencies, and policies described are subject to change. Changes are likely to occur whenever a state legislature meets, or when the federal government imposes new directions on state and local governments. LFGTE project developers should verify and continuously monitor the status of laws and rules that might affect their plans or the operations of their projects.

  5. Uncoupling primer and releaser responses to pheromone in honey bees

    NASA Astrophysics Data System (ADS)

    Grozinger, Christina M.; Fischer, Patrick; Hampton, Jacob E.

    2007-05-01

    Pheromones produce dramatic behavioral and physiological responses in a wide variety of species. Releaser pheromones elicit rapid responses within seconds or minutes, while primer pheromones produce long-term changes which may take days to manifest. Honeybee queen mandibular pheromone (QMP) elicits multiple distinct behavioral and physiological responses in worker bees, as both a releaser and primer, and thus produces responses on vastly different time scales. In this study, we demonstrate that releaser and primer responses to QMP can be uncoupled. First, treatment with the juvenile hormone analog methoprene leaves a releaser response (attraction to QMP) intact, but modulates QMP’s primer effects on sucrose responsiveness. Secondly, two components of QMP (9-ODA and 9-HDA) do not elicit a releaser response (attraction) but are as effective as QMP at modulating a primer response, downregulation of foraging-related brain gene expression. These results suggest that different responses to a single pheromone may be produced via distinct pathways.

  6. Multi-pair states in electron-positron pair creation

    NASA Astrophysics Data System (ADS)

    Wöllert, Anton; Bauke, Heiko; Keitel, Christoph H.

    2016-09-01

    Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron-positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron-positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron-positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron-positron pairs.

  7. Specific primer sets used to amplify by PCR the hepatitis B virus overlapping S/Pol region select different viral variants.

    PubMed

    Cuestas, M L; Mathet, V L; Oubiña, J R

    2012-10-01

    PCR detection of viral genomes has provided new insights into viral diagnosis. Nowadays, it is the most frequently used nucleic acid testing (qualitative and quantitative) technique. The aim of this study was to analyse the major circulating hepatitis B virus (HBV) variants PCR-amplified by three sets of primers in a patient infected with genotype E. The HBV S/Pol overlapping genomic region was amplified from the serum of an infected child using three primer sets previously described. Sequence analysis corresponding to the HBV S/Pol region revealed the presence of different viral populations depending on the set of primers used. D144A S-escape mutant was detected with two of the primer sets, while the rtL217R mutant within the Pol - conferring resistance to Adefovir - could be picked up with a different pair of primer sets. This study undoubtedly implies that the description of viral polymorphisms should be stated together with the sequence of the primers used for PCR amplification when studies of escape and/or antiviral-resistant HBV mutants are carried out. PMID:22967107

  8. Primer on electricity futures and other derivatives

    SciTech Connect

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  9. Protected Flux Pairing Qubit

    NASA Astrophysics Data System (ADS)

    Bell, Matthew; Zhang, Wenyuan; Ioffe, Lev; Gershenson, Michael

    2014-03-01

    We have studied the coherent flux tunneling in a qubit containing two submicron Josephson junctions shunted by a superinductor (a dissipationless inductor with an impedance much greater than the resistance quantum). The two low energy quantum states of this device, 0 and 1, are represented by even and odd number of fluxes in the loop, respectively. This device is dual to the charge pairing Josephson rhombi qubit. The spectrum of the device, studied by microwave spectroscopy, reflects the interference between coherent quantum phase slips in the two junctions (the Aharonov-Casher effect). The time domain measurements demonstrate the suppression of the qubit's energy relaxation in the protected regime, which illustrates the potential of this flux pairing device as a protected quantum circuit. Templeton Foundation, NSF, and ARO.

  10. PD5: A General Purpose Library for Primer Design Software

    PubMed Central

    Riley, Michael C.; Aubrey, Wayne; Young, Michael; Clare, Amanda

    2013-01-01

    Background Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. Results The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C++ with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. Conclusions The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: http://code.google.com/p/primer-design PMID:24278254

  11. Comparison between Mt-DNA D-Loop and Cyt B primers for porcine DNA detection in meat products

    NASA Astrophysics Data System (ADS)

    Hamzah, Azhana; Mutalib, Sahilah Abd.; Babji, Abdul Salam

    2013-11-01

    This study was conducted to detect the presence of porcine DNA in meat products in the market using conventional polymerase chain reaction (PCR) and commercial PCR-southern hybridization analysis. Porcine DNA detection in meat products was tested due to some issues associated with the adulteration of food products in Malaysia. This is an important issue especially for Halal authentication which is required for some religious practices such as in Islam and Hinduisms. Many techniques have been developed for determining the Halal status of food products. In this paper, mt-DNA D-loop primer and cytochrome (cyt) b were used to detect the presence of porcine DNA in meat products. Positive and negative controls were always present for each batch of extraction. DNA of raw pork meat was used as a positive control while nucleus free water is used as negative control. A pair of oligonucleotide primer was used namely Pork1 and Pork2 which produced amplicon of 531 base pair (bp) in size. While, PCR-southern hybridization was conducted using primers readily supplied by commercial PCR-Southern hybridization and produced amplicon with 276 bp in size. In the present study, demonstrated that none of the samples were contaminated with porcine residuals but selected samples with pork meat were positive. The species-specific PCR amplification yielded excellent results for identification of pork derivatives in food products and it is a potentially reliable and suitable technique in routine food analysis for Halal certification.

  12. A multiplex set of species-specific primers for rapid identification of members of the genus Saccharomyces.

    PubMed

    Muir, Alastair; Harrison, Elizabeth; Wheals, Alan

    2011-11-01

    The Saccharomyces genus (previously Saccharomyces sensu stricto) formally comprises Saccharomyces arboricola, Saccharomyces bayanus, Saccharomyces cariocanus, Saccharomyces cerevisiae, Saccharomyces kudriavzevii, Saccharomyces mikatae, Saccharomyces paradoxus and Saccharomyces pastorianus. Species-specific primer pairs that produce a single band of known and different product size have been developed for each member of the clade with the exception of S. pastorianus, which is a polyphyletic allopolyploid hybrid only found in lager breweries, and for which signature sequences could not be reliably created. Saccharomyces cariocanus is now regarded as an American variant of S. paradoxus, and accordingly a single primer pair that recognizes both species was developed. A different orthologous and essential housekeeping gene was used to detect each species, potentially avoiding competition between PCR primers and overlap between amplicons. In multiplex format, two or more different species could be identified in a single reaction; double and triple hybrids could not always be correctly identified. Forty-two unidentified yeasts from sugar cane juice fermentations were correctly identified as S. cerevisiae. A colony PCR method was developed that is rapid, robust, inexpensive and capable of automation, requires no mycological expertise on the part of the user and is thus useful for large-scale preliminary screens. PMID:22093682

  13. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

    SciTech Connect

    Gardner, S. N.

    2013-08-08

    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

  14. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

    2013-08-08

    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether theremore » are also TaqMan/Luminex probe matches within predicted amplicons.« less

  15. A genetic linkage map of marine shrimp Penaeus ( Fenneropenaeus) chinensis based on AFLP, SSR, and RAPD markers

    NASA Astrophysics Data System (ADS)

    Liu, Bo; Wang, Qingyin; Li, Jian; Liu, Ping; He, Yuying

    2010-07-01

    The Chinese shrimp Penaeus ( Fenneropaeneus) chinensis is an important species in marine fishery and aquaculture in China. A female Chinese shrimp Penaeus ( Fenneropaeneus) chinensis was captured from west coast of the Korean peninsula and mated with a “Yellow Sea No. 1” male to produce the first filial generation (F1) 100 F2 full-sib progeny from brother-sister crosses between F1 families was used for the mapping study. A genetic linkage map of the Chinese shrimp was constructed, based on 354 markers, including 300 amplified fragment length polymorphism (AFLP) markers, 42 microsatellite (SSR) markers, and 12 randomly amplified polymorphism (RAPD) markers. Forty-seven linkage groups (LGs) were identified. The total map length was 4 580.5 cM, with an average spacing of 11.3 cM, covering 75.8% of the estimated genome size. The construction of this genetic linkage map was part of a genetic breeding program. This linkage map will contribute to the discovery of genes and quantitative trait loci (QTLs) in Chinese shrimp.

  16. Towards an optimal sampling strategy for assessing genetic variation within and among white clover (Trifolium repens L.) cultivars using AFLP.

    PubMed

    Khanlou, Khosro Mehdi; Vandepitte, Katrien; Asl, Leila Kheibarshekan; Van Bockstaele, Erik

    2011-04-01

    Cost reduction in plant breeding and conservation programs depends largely on correctly defining the minimal sample size required for the trustworthy assessment of intra- and inter-cultivar genetic variation. White clover, an important pasture legume, was chosen for studying this aspect. In clonal plants, such as the aforementioned, an appropriate sampling scheme eliminates the redundant analysis of identical genotypes. The aim was to define an optimal sampling strategy, i.e., the minimum sample size and appropriate sampling scheme for white clover cultivars, by using AFLP data (283 loci) from three popular types. A grid-based sampling scheme, with an interplant distance of at least 40 cm, was sufficient to avoid any excess in replicates. Simulations revealed that the number of samples substantially influenced genetic diversity parameters. When using less than 15 per cultivar, the expected heterozygosity (He) and Shannon diversity index (I) were greatly underestimated, whereas with 20, more than 95% of total intra-cultivar genetic variation was covered. Based on AMOVA, a 20-cultivar sample was apparently sufficient to accurately quantify individual genetic structuring. The recommended sampling strategy facilitates the efficient characterization of diversity in white clover, for both conservation and exploitation. PMID:21734826

  17. Genetic differentiation in the winter pine processionary moth (Thaumetopoea pityocampa--wilkinsoni complex), inferred by AFLP and mitochondrial DNA markers.

    PubMed

    Salvato, Paola; Battisti, Andrea; Concato, Silvia; Masutti, Luigi; Patarnello, Tomaso; Zane, Lorenzo

    2002-11-01

    The winter pine processionary moth has become an important pine pest in the last century, as a consequence of the spread of pine cultivation in the Mediterranean region. The pattern of genetic differentiation of this group, that includes two sibling species (Thaumetopoea pityocampa and Th. wilkinsoni), has been studied in nine populations using amplified fragment length polymorphism (AFLP) and single strand conformation polymorphism-sequence analysis (SSCP) of the mitochondrial cytochrome oxidase 1 (COI) and cytochrome oxydase 2 (COII). Results indicate the existence of strong genetic differentiation between the two species that became separated before the Quaternary ice ages. Moreover data indicate that Th. pityocampa has a strong geographical structure, particularly evident at the nuclear level, where all pairwise phiST resulted to be highly significant and individuals from the same population resulted to be strongly clustered when an individual tree was reconstructed. The estimates of the absolute number of migrants between populations (Nm), obtained from mitochondrial and nuclear DNA markers, suggest that gene flow is low and that a gender-related dispersal could occur in this species. The males appear to disperse more than females, contributing to the genetic diversity of populations on a relatively wide range, reducing the risks of inbreeding and the genetic loss associated with bottlenecks occurring in isolated populations. PMID:12406253

  18. Assessing The Spatial Dependence of Adaptive Loci in 43 European and Western Asian Goat Breeds Using AFLP Markers

    PubMed Central

    Negrini, Riccardo; Nicoloso, Letizia; Crepaldi, Paola; Ajmone-Marsan, Paolo

    2014-01-01

    Background During the past decades, neutral DNA markers have been extensively employed to study demography, population genetics and structure in livestock, but less interest has been devoted to the evaluation of livestock adaptive potential through the identification of genomic regions likely to be under natural selection. Methodology/Principal findings Landscape genomics can greatly benefit the entire livestock system through the identification of genotypes better adapted to specific or extreme environmental conditions. Therefore we analyzed 101 AFLP markers in 43 European and Western Asian goat breeds both with Matsam software, based on a correlative approach (SAM), and with Mcheza and Bayescan, two FST based software able to detect markers carrying signatures of natural selection. Matsam identified four loci possibly under natural selection – also confirmed by FST-outlier methods – and significantly associated with environmental variables such as diurnal temperature range, frequency of precipitation, relative humidity and solar radiation. Conclusions/Significance These results show that landscape genomics can provide useful information on the environmental factors affecting the adaptive potential of livestock living in specific climatic conditions. Besides adding conservation value to livestock genetic resources, this knowledge may lead to the development of novel molecular tools useful to preserve the adaptive potential of local breeds during genetic improvement programs, and to increase the adaptability of industrial breeds to changing environments. PMID:24497965

  19. Rapid Microsatellite Isolation from a Butterfly by De Novo Transcriptome Sequencing: Performance and a Comparison with AFLP-Derived Distances

    PubMed Central

    Mikheyev, Alexander S.; Vo, Tanya; Wee, Brian; Singer, Michael C.; Parmesan, Camille

    2010-01-01

    Background The isolation of microsatellite markers remains laborious and expensive. For some taxa, such as Lepidoptera, development of microsatellite markers has been particularly difficult, as many markers appear to be located in repetitive DNA and have nearly identical flanking regions. We attempted to circumvent this problem by bioinformatic mining of microsatellite sequences from a de novo-sequenced transcriptome of a butterfly (Euphydryas editha). Principal Findings By searching the assembled sequence data for perfect microsatellite repeats we found 10 polymorphic loci. Although, like many expressed sequence tag-derived microsatellites, our markers show strong deviations from Hardy-Weinberg equilibrium in many populations, and, in some cases, a high incidence of null alleles, we show that they nonetheless provide measures of population differentiation consistent with those obtained by amplified fragment length polymorphism analysis. Estimates of pairwise population differentiation between 23 populations were concordant between microsatellite-derived data and AFLP analysis of the same samples (r = 0.71, p<0.00001, 425 individuals from 23 populations). Significance De novo transcriptional sequencing appears to be a rapid and cost-effective tool for developing microsatellite markers for difficult genomes. PMID:20585453

  20. Regulated incorporation of two different metal ions into programmed sites in a duplex by DNA polymerase catalyzed primer extension.

    PubMed

    Funai, Tatsuya; Nakamura, Junko; Miyazaki, Yuki; Kiriu, Risa; Nakagawa, Osamu; Wada, Shun-ichi; Ono, Akira; Urata, Hidehito

    2014-06-23

    Metal-mediated base pairs formed by the coordination of metal ions to natural or artificial bases impart unique chemical and physical properties to nucleic acids and have attracted considerable interest in the field of nanodevices. Ag(I) ions were found to mediate DNA polymerase catalyzed primer extension through the formation of a C-Ag(I)-T base pair, as well as the previously reported C-Ag(I)-A base pair. The comparative susceptibility of dNTPs to Ag(I)-mediated enzymatic incorporation into the site opposite cytosine in the template was shown to be dATP>dTTP≫dCTP. Furthermore, two kinds of metal ions, Ag(I) and Hg(II), selectively mediate the incorporation of thymidine 5'-triphosphate into sites opposite cytosine and thymine in the template, respectively. In other words, the regulated incorporation of different metal ions into programmed sites in the duplex by DNA polymerase was successfully achieved. PMID:24719384

  1. Existence of best proximity pairs and equilibrium pairs

    NASA Astrophysics Data System (ADS)

    Kim, Won Kyu; Lee, Kyoung Hee

    2006-04-01

    In this paper, using the fixed point theorem for Kakutani factorizable multifunctions, we shall prove new existence theorems of best proximity pairs and equilibrium pairs for free abstract economies, which include the previous fixed point theorems and equilibrium existence theorems.

  2. BTSC VAPOR INSTRUSION PRIMER "VAPOR INTRUSION CONSIDERATION FOR REDEVELOPMENT"

    EPA Science Inventory

    This primer is designed for brownfields stakeholders concerned about vapor intrusion, including property owners, real estate developers, and contractors performing environmental site investigations. It provides an overview of the vapor intrusion issue and how it can impact the ap...

  3. A Primer of Easy Pieces: Teaching through Typical Narrative.

    ERIC Educational Resources Information Center

    Waldman, Peter

    1982-01-01

    A "Form Primer," developed for and used in an introductory architectural design course at Princeton University, is explained and illustrated. The concept holds that architecture is made up of a typology of pieces that are composed into a whole. (MSE)

  4. A Pollen Primer | NIH MedlinePlus the Magazine

    MedlinePlus

    ... please turn Javascript on. Feature: Managing Allergies A Pollen Primer Past Issues / Summer 2011 Table of Contents ... National Institute of Environmental Health Sciences (NIEHS) . Plant Pollen Ragweed and other weeds, such as curly dock, ...

  5. PRIMER FOR FINANCIAL ANALYSIS OF POLLUTION PREVENTION PROJECTS

    EPA Science Inventory

    This primer will serve as a basic guide to pollution prevention investment -- specifically, the preparation of financial comparisons and justifications for such expenditures. he emphasis is on the basic analytical techniques needed to justify pollution prevention investments. onc...

  6. Development and characterization of microsatellite primers in Pogostemon cablin (Lamiaceae).

    PubMed

    Sandes, S S; Pinheiro, J B; Zucchi, M I; Monteiro, M; Arrigoni-Blank, M F; Blank, A F

    2013-01-01

    Microsatellite primers were developed and optimized for patchouli (Pogostemon cablin) to characterize the patchouli Active Germplasm Bank of Universidade Federal de Sergipe. Creation of a genomic library for patchouli enabled the design of 12 microsatellite primers. Six of these microsatellites were polymorphic, revealing two well-defined groups of individuals that possess exclusive alleles. The data allowed us to characterize the patchouli active Germplasm Bank, identify its genetic diversity, and provide new information for researching this species. PMID:24065640

  7. Molecular ecology of tetracycline resistance: development and validation of primers for detection of tetracycline resistance genes encoding ribosomal protection proteins.

    PubMed

    Aminov, R I; Garrigues-Jeanjean, N; Mackie, R I

    2001-01-01

    Phylogenetic analysis of tetracycline resistance genes encoding the ribosomal protection proteins (RPPs) revealed the monophyletic origin of these genes. The most deeply branching class, exemplified by tet and otrA, consisted of genes from the antibiotic-producing organisms Streptomyces rimosus and Streptomyces lividans. With a high degree of confidence, the corresponding genes of the other seven classes (Tet M, Tet S, Tet O, Tet W, Tet Q, Tet T, and TetB P) formed phylogenetically distinct separate clusters. Based on this phylogenetic analysis, a set of PCR primers for detection, retrieval, and sequence analysis of the corresponding gene fragments from a variety of bacterial and environmental sources was developed and characterized. A pair of degenerate primers targeted all tetracycline resistance genes encoding RPPs except otrA and tet, and seven other primer pairs were designed to target the specific classes. The primers were used to detect the circulation of these genes in the rumina of cows, in swine feed and feces, and in swine fecal streptococci. Classes Tet O and Tet W were found in the intestinal contents of both animals, while Tet M was confined to pigs and Tet Q was confined to the rumen. The tet(O) and tet(W) genes circulating in the microbiota of the rumen and the gastrointestinal tract of pigs were identical despite the differences in animal hosts and antibiotic use regimens. Swine fecal streptococci uniformly possessed the tet(O) gene, and 22% of them also carried tet(M). This population could be considered one of the main reservoirs of these two resistance genes in the pig gastrointestinal tract. All classes of RPPs except Tet T and TetB P were found in the commercial components of swine feed. This is the first demonstration of the applicability of molecular ecology techniques to estimation of the gene pool and the flux of antibiotic resistance genes in production animals. PMID:11133424

  8. Genetic affinities within the herring gull Larus argentatus assemblage revealed by AFLP genotyping.

    PubMed

    de Knijff P; Denkers, F; van Swelm, N D; Kuiper, M

    2001-01-01

    To date, the taxonomic status of circumpolar breeding populations of the Herring Gull Larus argentatus, the Lesser Black-backed Gull Larus fuscus, and the closely related Yellow-legged Gull Larus cachinnans has been based on differences or similarities in phenotype, morphology, and feeding and premating behavior. To shed some new light on the many taxonomic uncertainties surrounding these taxa, we describe the results of a large DNA study based on comparing the distribution of 209 biallelic markers among 109 gulls, representing 11 gull taxa of the Herring Gull assemblage and the Common Gull Larus canus. A detailed phylogenetic analysis failed to show clustering of individuals into groups representing either geographic origin or phenotype. Alternatively, birds were grouped into taxa defined on the basis of phenotype and geographic origin or phenotype alone. Genetic analyses revealed significantly different genetic distances between all pairs of taxa. However, based on these genetic distances, again no consistent phylogenetic tree could be constructed. Analysis of molecular variance indicated that about 77% of the total genetic variability among these gulls could be explained by within-taxon differences. Only 23% of the total genetic variability was due to genetic differences between taxa, irrespective of their species or subspecies status. Although this seems to challenge the current taxonomic treatment of the herring gull assemblage, our results are too premature and too incomplete to recommend a drastic change. PMID:11139298

  9. Mining for sensitive and reliable species-specific primers for PCR for detection of Cronobacter sakazakii by a bioinformatics approach.

    PubMed

    Qiming, Chen; Tingting, Tao; Xiaomei, Bie; Yingjian, Lu; Fengxia, Lu; Ligong, Zhai; Zhaoxin, Lu

    2015-08-01

    Although several studies have reported PCR assays for distinguishing Cronobacter sakazakii from other species in the genus, reports regarding assay sensitivity and specificity, as well as applications for food testing, are lacking. Hence, the objective of this study was to develop a sensitive and reliable PCR-based method for detection of C. sakazakii by screening for specific target genes. The genome sequence of C. sakazakii in the GenBank database was compared with that of other organisms using BLAST. Thirty-eight DNA fragments unique to C. sakazakii were identified, and primers targeting these sequences were designed. Finally, 3 primer sets (CS14, CS21, and CS38) were found to be specific for C. sakazakii by PCR verification. The detection limit of PCR assays using the 3 pairs of primers was 1.35 pg/μL, 135 fg/μL, and 135 fg/μL, respectively, for genomic DNA, and 5.5×10(5), 5.5×10(3), 5.5×10(3) cfu/mL, respectively, using pure cultures of the bacteria, compared with 13.5 pg/μLand 5.5×10(5) cfu/mLfor primer set SpeCronsaka, which has been previously described. Cronobacter sakazakii were detected in artificially contaminated powdered infant formula (PIF) by PCR using primer sets CS21 and CS38 after 8h of enrichment. The detection limit was 5.5×10(-1) cfu/10g of PIF. Thus, the PCR assay can be used for rapid and sensitive detection of C. sakazakii in PIF. PMID:26074237

  10. Diversity Measures in Environmental Sequences Are Highly Dependent on Alignment Quality—Data from ITS and New LSU Primers Targeting Basidiomycetes

    PubMed Central

    Fischer, Christiane; Daniel, Rolf; Wubet, Tesfaye

    2012-01-01

    The ribosomal DNA comprised of the ITS1-5.8S-ITS2 regions is widely used as a fungal marker in molecular ecology and systematics but cannot be aligned with confidence across genetically distant taxa. In order to study the diversity of Agaricomycotina in forest soils, we designed primers targeting the more alignable 28S (LSU) gene, which should be more useful for phylogenetic analyses of the detected taxa. This paper compares the performance of the established ITS1F/4B primer pair, which targets basidiomycetes, to that of two new pairs. Key factors in the comparison were the diversity covered, off-target amplification, rarefaction at different Operational Taxonomic Unit (OTU) cutoff levels, sensitivity of the method used to process the alignment to missing data and insecure positional homology, and the congruence of monophyletic clades with OTU assignments and BLAST-derived OTU names. The ITS primer pair yielded no off-target amplification but also exhibited the least fidelity to the expected phylogenetic groups. The LSU primers give complementary pictures of diversity, but were more sensitive to modifications of the alignment such as the removal of difficult-to align stretches. The LSU primers also yielded greater numbers of singletons but also had a greater tendency to produce OTUs containing sequences from a wider variety of species as judged by BLAST similarity. We introduced some new parameters to describe alignment heterogeneity based on Shannon entropy and the extent and contents of the OTUs in a phylogenetic tree space. Our results suggest that ITS should not be used when calculating phylogenetic trees from genetically distant sequences obtained from environmental DNA extractions and that it is inadvisable to define OTUs on the basis of very heterogeneous alignments. PMID:22363808

  11. Effects of DNA extraction and universal primers on 16S rRNA gene-based DGGE analysis of a bacterial community from fish farming water

    NASA Astrophysics Data System (ADS)

    Luo, Peng; Hu, Chaoqun; Zhang, Lüping; Ren, Chunhua; Shen, Qi

    2007-07-01

    Among many reports investigating microbial diversity from environmental samples with denaturing gradient gel electrophoresis (DGGE), limited attention has been given to the effects of universal primers and DNA extraction on the outcome of DGGE analysis. In this study, these effects were tested with 16S rRNA gene-based DGGE on a bacterial community from farming water samples. The results indicate that the number of discernable bands in the DGGE fingerprint differed with the primer pairs used; the bands produced by 63f/518r, 341f/926r and 933f/1387r primer pairs were obviously fewer than those by 968f/1401r. Also, we found that each DNA extraction method resulted in different community profiles, reflected by the number and intensity of bands in the DGGE fingerprint. Furthermore, the main bands (theoretically representing dominant bacteria) differed with the extraction methods applied. It is therefore believed that the effects of universal primers and DNA extraction should be given more attention and carefully chosen before performing an investigation into a new environment with DGGE.

  12. A genetic linkage map of the Durum x Triticum dicoccoides backcross population based on SSRs and AFLP markers, and QTL analysis for milling traits.

    PubMed

    Elouafi, I; Nachit, M M

    2004-02-01

    Durum wheat ( Triticum turgidum L. var durum) is mainly produced and consumed in the Mediterranean region; it is used to produce several specific end-products; such as local pasta, couscous and burghul. To study the genetics of grain-milling quality traits, chromosomal locations, and interaction with the environment, a genetic linkage map of durum was constructed and the quantitative trait loci QTLs for the milling-related traits, test weight (TW) and thousand-kernel weight (TKW), were identified. The population constituted 114 recombinant inbred lines derived from the cross: Omrabi 5 /Triticum dicoccoides 600545// Omrabi 5. TW and TKW were analyzed over 18 environments (sites x years). Single-sequence-repeat markers (SSRs), Amplified-fragment-length-polymorphism markers (AFLPs), and seed storage proteins (SSPs) showed a high level of polymorphism (>60%). The map was constructed with 124 SSRs, 149 AFLPs and 6 SSPs; its length covered 2,288.8 cM (8.2 cM/marker). The map showed high synteny with previous wheat maps, and both SSRs and AFLPs mapped evenly across the genome, with more markers in the B genome. However, some rearrangements were observed. For TW, a high genotypic effect was detected and two QTLs with epistasic effect were identified on 7AS and 6BS, explaining 30% of the total variation. The TKW showed a significant transgressive inheritance and five QTLs were identified, explaining 32% of the total variation, out of which 25% was of a genetic nature, and showing QTLxE interaction. The major TKW-QTLs were around the centromere region of 6B. For both traits, Omrabi 5 alleles had a significant positive effect. This population will be used to determine other QTLs of interest, as its parents are likely to harbor different genes for diseases and drought tolerance. PMID:14676946

  13. Evolution of the polyploid north-west Iberian Leucanthemum pluriflorum clan (Compositae, Anthemideae) based on plastid DNA sequence variation and AFLP fingerprinting

    PubMed Central

    Greiner, Roland; Vogt, Robert; Oberprieler, Christoph

    2013-01-01

    Background and Aims The genus Leucanthemum is a species-rich polyploid complex from southern and central Europe, comprising 41 species with ploidy ranging from 2x to 22x. The present contribution aims at reconstructing the evolutionary history of a geographically isolated species group (the L. pluriflorum clan) from the north-west Iberian Peninsula comprising the diploid L. pluriflorum, the tetraploids L. ircutianum subsp. pseudosylvaticum and L. × corunnense (a putative hybrid taxon based on crossing between L. pluriflorum and L. merinoi), and the hexaploids L. sylvaticum and L. merinoi. Methods Chromosome number variation (determined flow cytometrically) and sequence variation were analysed for two intergenic spacer regions on the plastid genome (psbA-trnH and trnC-petN) for individuals from 54 populations in combination with amplified fragment length polymorphism (AFLP) fingerprinting of 246 representative individuals from these populations. Key Results Plastid sequence data revealed that all surveyed members of the L. pluriflorum clan possess plastid haplotypes that are closely related to each other and distinctly separated from other Leucanthemum species. AFLP fingerprinting resulted in allopolyploid fragment patterns for most of the polyploid populations, except for the tetraploid L. × corunnense and a further tetraploid population in northern Galicia, which cluster with the diploids rather than with the other polyploids. In silico modelling of (auto)tetraploid AFLP genotypes further corroborates the allopolyploid nature of L. ircutianum subsp. pseudosylvaticum, L. sylvaticum and L. merinoi. Conclusions The present study provides evidence for recognizing one diploid (L. pluriflorum), one autotetraploid (L. corunnense), one allotetraploid (L. pseudosylvaticum) and one allohexaploid (L. sylvaticum with the two geographically and ecologically differentiated subspecies subsp. sylvaticum and subsp. merinoi) in the L. pluriflorum clan. It also has implications

  14. AFLP Genome Scan to Detect Genetic Structure and Candidate Loci under Selection for Local Adaptation of the Invasive Weed Mikania micrantha

    PubMed Central

    Wang, Ting; Chen, Guopei; Zan, Qijie; Wang, Chunbo; Su, Ying-juan

    2012-01-01

    Why some species become successful invaders is an important issue in invasive biology. However, limited genomic resources make it very difficult for identifying candidate genes involved in invasiveness. Mikania micrantha H.B.K. (Asteraceae), one of the world's most invasive weeds, has adapted rapidly in response to novel environments since its introduction to southern China. In its genome, we expect to find outlier loci under selection for local adaptation, critical to dissecting the molecular mechanisms of invasiveness. An explorative amplified fragment length polymorphism (AFLP) genome scan was used to detect candidate loci under selection in 28 M. micrantha populations across its entire introduced range in southern China. We also estimated population genetic parameters, bottleneck signatures, and linkage disequilibrium. In binary characters, such as presence or absence of AFLP bands, if all four character combinations are present, it is referred to as a character incompatibility. Since character incompatibility is deemed to be rare in populations with extensive asexual reproduction, a character incompatibility analysis was also performed in order to infer the predominant mating system in the introduced M. micrantha populations. Out of 483 AFLP loci examined using stringent significance criteria, 14 highly credible outlier loci were identified by Dfdist and Bayescan. Moreover, remarkable genetic variation, multiple introductions, substantial bottlenecks and character compatibility were found to occur in M. micrantha. Thus local adaptation at the genome level indeed exists in M. micrantha, and may represent a major evolutionary mechanism of successful invasion. Interactions between genetic diversity, multiple introductions, and reproductive modes contribute to increase the capacity of adaptive evolution. PMID:22829939

  15. cDNA-AFLP analysis reveals differential gene expression in incompatible interaction between infected non-heading Chinese cabbage and Hyaloperonospora parasitica.

    PubMed

    Xiao, Dong; Liu, Shi-Tuo; Wei, Yan-Ping; Zhou, Dao-Yun; Hou, Xi-Lin; Li, Ying; Hu, Chun-Mei

    2016-01-01

    Non-heading Chinese cabbage (Brassica rapa ssp. chinensis) is one of the main green leafy vegetables in the world, especially in China, with significant economic value. Hyaloperonospora parasitica is a fungal pathogen responsible for causing downy mildew disease in Chinese cabbage, which greatly affects its production. The objective of this study was to identify transcriptionally regulated genes during incompatible interactions between non-heading Chinese cabbage and H. parasitica using complementary DNA-amplified fragment length polymorphism (cDNA-AFLP). We obtained 129 reliable differential transcript-derived fragments (TDFs) in a resistant line 'Suzhou Qing'. Among them, 121 upregulated TDFs displayed an expression peak at 24-48 h post inoculation (h.p.i.). Fifteen genes were further selected for validation of cDNA-AFLP expression patterns using quantitative reverse transcription PCR. Results confirmed the altered expression patterns of 13 genes (86.7%) revealed by the cDNA-AFLP. We identified four TDFs related to fungal resistance among the 15 TDFs. Furthermore, comparative analysis of four TDFs between resistant line 'Suzhou Qing' and susceptible line 'Aijiao Huang' showed that transcript levels of TDF14 (BcLIK1_A01) peaked at 48 h.p.i. and 25.1-fold increased in the resistant line compared with the susceptible line. Similarly, transcript levels of the other three genes, TDF42 (BcCAT3_A07), TDF75 (BcAAE3_A06) and TDF88 (BcAMT2_A05) peaked at 24, 48 and 24 h.p.i. with 25.1-, 100- and 15.8-fold increases, respectively. The results suggested that the resistance genes tended to transcribe at higher levels in the resistance line than in the susceptible line, which may provide resistance against pathogen infections. The present study might facilitate elucidating the molecular basis of the infection process and identifying candidate genes for resistance improvement of susceptible cultivars. PMID:27602230

  16. The attractiveness fragment—AFLP analysis of local adaptation and sexual selection in a caeliferan grasshopper, Chorthippus biguttulus

    NASA Astrophysics Data System (ADS)

    Klappert, Kirsten; Butlin, Roger K.; Reinhold, Klaus

    2007-08-01

    Genetic variability among males is a necessary precondition for the evolution of female choice based on indirect genetic benefits. In addition to mutations and host parasite cycles, migration of locally adapted individuals offers an explanation for the maintenance of genetic variability. In a previous study, conducting a reciprocal transplant experiment on a grasshopper, Chorthippus biguttulus, we found that environmental conditions significantly influenced not only body condition but also an important trait of male calling song, the amplitude of song. Although not significant, all other analysed physical and courtship song traits and attractiveness were superior in native than in transferred males. Thus, we concluded that local adaptation has a slight but consistent influence on a range of traits in our study populations, including male acoustic attractiveness. In our present study, we scanned male grasshoppers from the same two populations for amplification fragment length polymorphism (AFLP) loci connected with acoustic attractiveness to conspecific females. We found greater differences in allele frequencies between the two populations, for some loci, than are expected from a balance between drift and gene flow. These loci are potentially connected with locally adapted traits. We examined whether these alleles show the proposed genotype environment interaction by having different associations with attractiveness in the two populations. One locus was significantly related to sexual attractiveness; however, this was independent of the males’ population affiliation. Future research on the evolution of female choice will benefit from knowledge of the underlying genetic architecture of male traits under intraspecific sexual selection, and the ‘population genomics’ approach can be a powerful tool for revealing this structure.

  17. Analyses of amplified fragment length polymorphisms (AFLP) indicate rapid radiation of Diospyros species (Ebenaceae) endemic to New Caledonia

    PubMed Central

    2013-01-01

    Background Radiation in some plant groups has occurred on islands and due to the characteristic rapid pace of phenotypic evolution, standard molecular markers often provide insufficient variation for phylogenetic reconstruction. To resolve relationships within a clade of 21 closely related New Caledonian Diospyros species and evaluate species boundaries we analysed genome-wide DNA variation via amplified fragment length polymorphisms (AFLP). Results A neighbour-joining (NJ) dendrogram based on Dice distances shows all species except D. minimifolia, D. parviflora and D. vieillardii to form unique clusters of genetically similar accessions. However, there was little variation between these species clusters, resulting in unresolved species relationships and a star-like general NJ topology. Correspondingly, analyses of molecular variance showed more variation within species than between them. A Bayesian analysis with BEAST produced a similar result. Another Bayesian method, this time a clustering method, Structure, demonstrated the presence of two groups, highly congruent with those observed in a principal coordinate analysis (PCO). Molecular divergence between the two groups is low and does not correspond to any hypothesised taxonomic, ecological or geographical patterns. Conclusions We hypothesise that such a pattern could have been produced by rapid and complex evolution involving a widespread progenitor for which an initial split into two groups was followed by subsequent fragmentation into many diverging populations, which was followed by range expansion of then divergent entities. Overall, this process resulted in an opportunistic pattern of phenotypic diversification. The time since divergence was probably insufficient for some species to become genetically well-differentiated, resulting in progenitor/derivative relationships being exhibited in a few cases. In other cases, our analyses may have revealed evidence for the existence of cryptic species, for which

  18. Multiprocessor switch with selective pairing

    SciTech Connect

    Gara, Alan; Gschwind, Michael K; Salapura, Valentina

    2014-03-11

    System, method and computer program product for a multiprocessing system to offer selective pairing of processor cores for increased processing reliability. A selective pairing facility is provided that selectively connects, i.e., pairs, multiple microprocessor or processor cores to provide one highly reliable thread (or thread group). Each paired microprocessor or processor cores that provide one highly reliable thread for high-reliability connect with a system components such as a memory "nest" (or memory hierarchy), an optional system controller, and optional interrupt controller, optional I/O or peripheral devices, etc. The memory nest is attached to a selective pairing facility via a switch or a bus

  19. TSUNAMI Primer: A Primer for Sensitivity/Uncertainty Calculations with SCALE

    SciTech Connect

    Rearden, Bradley T; Mueller, Don; Bowman, Stephen M; Busch, Robert D.; Emerson, Scott

    2009-01-01

    This primer presents examples in the application of the SCALE/TSUNAMI tools to generate k{sub eff} sensitivity data for one- and three-dimensional models using TSUNAMI-1D and -3D and to examine uncertainties in the computed k{sub eff} values due to uncertainties in the cross-section data used in their calculation. The proper use of unit cell data and need for confirming the appropriate selection of input parameters through direct perturbations are described. The uses of sensitivity and uncertainty data to identify and rank potential sources of computational bias in an application system and TSUNAMI tools for assessment of system similarity using sensitivity and uncertainty criteria are demonstrated. Uses of these criteria in trending analyses to assess computational biases, bias uncertainties, and gap analyses are also described. Additionally, an application of the data adjustment tool TSURFER is provided, including identification of specific details of sources of computational bias.

  20. Semi-quantitative differences in gene transcription profiles between sexes of a marine snail by a new variant of cDNA-AFLP analysis.

    PubMed

    Martínez-Fernández, M; Bernatchez, L; Rolán-Alvarez, E; Quesada, H

    2010-03-01

    A variant of the cDNA-AFLP method coupled to an automated sequencer was used to quantify transcripts differentially expressed between sexes of the marine snail Littorina saxatilis. First, we conducted a validation study of the technique using known concentrations of a commercial marker. Second, we analysed six replicates of males and females from a population showing no apparent sexual dimorphism. The results confirm that the method can be properly used within the range of DNA concentrations utilized. In addition, we detected a small percentage of spots (1.8%) differentially expressed between sexes, as expected from a low to moderately sexual dimorphic species. PMID:21565027

  1. Complex hybridization dynamics between golden-winged and blue-winged warblers (Vermivora chrysoptera and Vermivora pinus) revealed by AFLP, microsatellite, intron and mtDNA markers.

    PubMed

    Vallender, R; Robertson, R J; Friesen, V L; Lovette, I J

    2007-05-01

    Blue-winged (Vermivora pinus) and golden-winged warblers (Vermivora chrysoptera) have an extensive mosaic hybrid zone in eastern North America. Over the past century, the general trajectory has been a rapid replacement of chrysoptera by pinus in a broad, northwardly moving area of contact. Previous mtDNA-based studies on these species' hybridization dynamics have yielded variable results: asymmetric and rapid introgression from pinus into chrysoptera in some areas and bidirectional maternal gene flow in others. To further explore the hybridization genetics of this otherwise well-studied complex, we surveyed variation in three nuclear DNA marker types--microsatellites, introns, and a panel of amplified fragment length polymorphisms (AFLPs)--with the goal of generating a multilocus assay of hybrid introgression. All markers were first tested on birds from phenotypically and mitochondrially pure parental-type populations from outside the hybrid zone. Searches for private alleles and assignment test approaches found no combination of microsatellite or intron markers that could separate the parental populations, but seven AFLP characters exhibited significant frequency differences among them. We then used the AFLP markers to examine the extent and pattern of introgression in a population where pinus-phenotype individuals have recently invaded a region that previously supported only a chrysoptera-phenotype population. Despite the low frequency of phenotypic hybrids at this location, the AFLP data suggest that almost a third of the phenotypically pure chrysoptera have introgressed genotypes, indicating the presence of substantial cryptic hybridization in the history of this species. The evidence for extensive cryptic introgression, combined with the lack of differentiation at other nuclear loci, cautions against hybrid assessments based on single markers or on phenotypic traits that are likely to be determined by a small number of loci. Considered in concert, these

  2. Multiple origins of asteroid pairs

    NASA Astrophysics Data System (ADS)

    Jacobson, Seth A.

    2016-01-01

    Rotationally fissioned asteroids produce unbound asteroid pairs that have very similar heliocentric orbits. Backward integration of their current heliocentric orbits provides an age of closest proximity that can be used to date the rotational fission event. Most asteroid pairs follow a predicted theoretical relationship between the primary spin period and the mass ratio of the two pair members that is a direct consequence of the YORP-induced rotational fission hypothesis. If the progenitor asteroid has strength, asteroid pairs may have higher mass ratios or faster rotating primaries. However, the process of secondary fission leaves the originally predicted trend unaltered. We also describe the characteristics of pair members produced by four alternative routes from a rotational fission event to an asteroid pair. Unlike direct formation from the event itself, the age of closest proximity of these pairs cannot generally be used to date the rotational fission event since considerable time may have passed.

  3. The Neurobiologist's Guide to Structural Biology: A Primer on Why Macromolecular Structure Matters and How to Evaluate Structural Data

    PubMed Central

    Minor, Daniel L.

    2010-01-01

    Structural biology now plays a prominent role in addressing questions central to understanding how excitable cells function. Although interest in the insights gained from the definition and dissection of macromolecular anatomy is high, many neurobiologists remain unfamiliar with the methods employed. This primer aims to help neurobiologists understand approaches for probing macromolecular structure and where the limits and challenges remain. Using examples of macromolecules with neurobiological importance, the review covers X-ray crystallography, electron microscopy (EM), small-angle X-ray scattering (SAXS), and nuclear magnetic resonance (NMR) and biophysical methods with which these approaches are often paired: isothermal titration calorimetry (ITC), equilibrium analytical ultracentifugation, and molecular dynamics (MD). PMID:17521566

  4. Stereo Pair, Honolulu, Oahu

    NASA Technical Reports Server (NTRS)

    2000-01-01

    Honolulu, on the island of Oahu, is a large and growing urban area. This stereoscopic image pair, combining a Landsat image with topography measured by the Shuttle Radar Topography Mission (SRTM), shows how topography controls the urban pattern. This color image can be viewed in 3-D by viewing the left image with the right eye and the right image with the left eye (cross-eyed viewing), or by downloading and printing the image pair, and viewing them with a stereoscope.

    Features of interest in this scene include Diamond Head (an extinct volcano near the bottom of the image), Waikiki Beach (just above Diamond Head), the Punchbowl National Cemetary (another extinct volcano, near the image center), downtown Honolulu and Honolulu harbor (image left-center), and offshore reef patterns. The slopes of the Koolau mountain range are seen in the right half of the image. Clouds commonly hang above ridges and peaks of the Hawaiian Islands, but in this synthesized stereo rendition appear draped directly on the mountains. The clouds are actually about 1000 meters (3300 feet) above sea level.

    This stereoscopic image pair was generated using topographic data from the Shuttle Radar Topography Mission, combined with a Landsat 7 Thematic Mapper image collected at the same time as the SRTM flight. The topography data were used to create two differing perspectives, one for each eye. When stereoscopically merged, the result is a vertically exaggerated view of the Earth's surface in its full three dimensions. The United States Geological Survey's Earth Resources Observations Systems (EROS) Data Center, Sioux Falls, South Dakota, provided the Landsat data.

    The Shuttle Radar Topography Mission (SRTM), launched on February 11, 2000, used the same radar instrument that comprised the Spaceborne Imaging Radar-C/X-Band Synthetic Aperture Radar (SIR-C/X-SAR) that flew twice on the Space Shuttle Endeavour in 1994. The mission was designed to collect three-dimensional measurements of the

  5. Initialization of Formation Flying Using Primer Vector Theory

    NASA Technical Reports Server (NTRS)

    Mailhe, Laurie; Schiff, Conrad; Folta, David

    2002-01-01

    In this paper, we extend primer vector analysis to formation flying. Optimization of the classical rendezvous or free-time transfer problem between two orbits using primer vector theory has been extensively studied for one spacecraft. However, an increasing number of missions are now considering flying a set of spacecraft in close formation. Missions such as the Magnetospheric MultiScale (MMS) and Leonardo-BRDF (Bidirectional Reflectance Distribution Function) need to determine strategies to transfer each spacecraft from the common launch orbit to their respective operational orbit. In addition, all the spacecraft must synchronize their states so that they achieve the same desired formation geometry over each orbit. This periodicity requirement imposes constraints on the boundary conditions that can be used for the primer vector algorithm. In this work we explore the impact of the periodicity requirement in optimizing each spacecraft transfer trajectory using primer vector theory. We first present our adaptation of primer vector theory to formation flying. Using this method, we then compute the AV budget for each spacecraft subject to different formation endpoint constraints.

  6. Stereo Pair, Pasadena, California

    NASA Technical Reports Server (NTRS)

    2000-01-01

    This stereoscopic image pair is a perspective view that shows the western part of the city of Pasadena, California, looking north toward the San Gabriel Mountains. Portions of the cities of Altadena and La Canada Flintridge are also shown. The cluster of large buildings left of center, at the base of the mountains, is the Jet Propulsion Laboratory. This image shows the power of combining data from different sources to create planning tools to study problems that affect large urban areas. In addition to the well-known earthquake hazards, Southern California is affected by a natural cycle of fire and mudflows. Data shown in this image can be used to predict both how wildfires spread over the terrain and how mudflows are channeled down the canyons.

    The image was created from three datasets: the Shuttle Radar Topography Mission (SRTM) supplied the elevation, U. S. Geological Survey digital aerial photography provided the image detail, and the Landsat Thematic Mapper provided the color. The United States Geological Survey's Earth Resources Observations Systems (EROS) Data Center, Sioux Falls, South Dakota, provided the Landsat data and the aerial photography. The image can be viewed in 3-D by viewing the left image with the right eye and the right image with the left eye (cross-eyed viewing), or by downloading and printing the image pair, and viewing them with a stereoscope.

    The Shuttle Radar Topography Mission (SRTM), launched on February 11, 2000, used the same radar instrument that comprised the Spaceborne Imaging Radar-C/X-Band Synthetic Aperture Radar (SIR-C/X-SAR) that flew twice on the Space Shuttle Endeavour in 1994. The mission was designed to collect three-dimensional measurements of the Earth's surface. To collect the 3-D data, engineers added a 60-meter-long (200-foot) mast, an additional C-band imaging antenna and improved tracking and navigation devices. The mission is a cooperative project between the National Aeronautics and Space Administration

  7. Frustrated Lewis Pairs.

    PubMed

    Stephan, Douglas W

    2015-08-19

    The articulation of the notion of "frustrated Lewis pairs" (FLPs), which emerged from the discovery that H2 can be reversibly activated by combinations of sterically encumbered Lewis acids and bases, has prompted a great deal of recent activity. Perhaps the most remarkable consequence has been the development of FLP catalysts for the hydrogenation of a range of organic substrates. In the past 9 years, the substrate scope has evolved from bulky polar species to include a wide range of unsaturated organic molecules. In addition, effective stereoselective metal-free hydrogenation catalysts have begun to emerge. The mechanism of this activation of H2 has been explored, and the nature and range of Lewis acid/base combinations capable of effecting such activation have also expanded to include a variety of non-metal species. The reactivity of FLPs with a variety of other small molecules, including olefins, alkynes, and a range of element oxides, has also been developed. Although much of this latter chemistry has uncovered unique stoichiometric transformations, metal-free catalytic hydroamination, CO2 reduction chemistry, and applications in polymerization have also been achieved. The concept is also beginning to find applications in bioinorganic and materials chemistry as well as heterogeneous catalysis. This Perspective highlights many of these developments and discusses the relationship between FLPs and established chemistry. Some of the directions and developments that are likely to emerge from FLP chemistry in the future are also presented. PMID:26214241

  8. Pygmy stars: first pair.

    PubMed

    Zwicky, F

    1966-07-01

    The binary LP 101-15/16 having the proper motion of 1.62 seconds of arc per year has been studied with the prime-focus spectrograph of the 200-inch (508 cm) telescope. Indications are that LP 101-15/16 is the first pair of pygmy stars ever discovered. One of its components, LP 101-16, is probably a blue pygmy star which is at least four magnitudes fainter than the ordinary white dwarfs. Also, two of the Balmer lines in absorption appear to be displaced toward the red by amounts which indicate the existence of an Einstein gravitational red shift corresponding to about 1000 km sec-1. On the other hand LP 101-15 is red and shows an entirely new type of spectrum, which suggests that it may be a first representative of a type of red pygmy star which is 2.5 magnitudes fainter than the M-type dwarf stars of the main sequence. PMID:17730606

  9. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    SciTech Connect

    Bowman, Stephen M

    2008-09-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  10. Intrageneric primer design: Bringing bioinformatics tools to the class.

    PubMed

    Lima, André O S; Garcês, Sérgio P S

    2006-09-01

    Bioinformatics is one of the fastest growing scientific areas over the last decade. It focuses on the use of informatics tools for the organization and analysis of biological data. An example of their importance is the availability nowadays of dozens of software programs for genomic and proteomic studies. Thus, there is a growing field (private and academic) with a need for bachelor of science students with bioinformatics skills. In consideration of this need, described here is a problem-based class in which students are asked to design a set of intrageneric primers for PCR. The exercise is divided into five classes of 1 h each, in which students use freeware bioinformatics tools and data bases available through the Internet. Besides designing the set of primers, the students will consequently learn the significance and use of the major bioinformatics procedures, such as searching a data base, conducting and analyzing sequence multialignment, comparing sequences with a data base, and selecting primers. PMID:21638710

  11. Connector Inversion Probe Technology: A Powerful One-Primer Multiplex DNA Amplification System for Numerous Scientific Applications

    PubMed Central

    Akhras, Michael S.; Unemo, Magnus; Thiyagarajan, Sreedevi; Nyrén, Pål; Davis, Ronald W.; Fire, Andrew Z.; Pourmand, Nader

    2007-01-01

    We combined components of a previous assay referred to as Molecular Inversion Probe (MIP) with a complete gap filling strategy, creating a versatile powerful one-primer multiplex amplification system. As a proof-of-concept, this novel method, which employs a Connector Inversion Probe (CIPer), was tested as a genetic tool for pathogen diagnosis, typing, and antibiotic resistance screening with two distinct systems: i) a conserved sequence primer system for genotyping Human Papillomavirus (HPV), a cancer-associated viral agent and ii) screening for antibiotic resistance mutations in the bacterial pathogen Neisseria gonorrhoeae. We also discuss future applications and advances of the CIPer technology such as integration with digital amplification and next-generation sequencing methods. Furthermore, we introduce the concept of two-dimension informational barcodes, i.e. “multiplex multiplexing padlocks” (MMPs). For the readers' convenience, we also provide an on-line tutorial with user-interface software application CIP creator 1.0.1, for custom probe generation from virtually any new or established primer-pairs. PMID:17878950

  12. A first AFLP-Based Genetic Linkage Map for Brine Shrimp Artemia franciscana and Its Application in Mapping the Sex Locus

    PubMed Central

    De Vos, Stephanie; Bossier, Peter; Van Stappen, Gilbert; Vercauteren, Ilse; Sorgeloos, Patrick; Vuylsteke, Marnik

    2013-01-01

    We report on the construction of sex-specific linkage maps, the identification of sex-linked markers and the genome size estimation for the brine shrimp Artemia franciscana. Overall, from the analysis of 433 AFLP markers segregating in a 112 full-sib family we identified 21 male and 22 female linkage groups (2n = 42), covering 1,041 and 1,313 cM respectively. Fifteen putatively homologous linkage groups, including the sex linkage groups, were identified between the female and male linkage map. Eight sex-linked AFLP marker alleles were inherited from the female parent, supporting the hypothesis of a WZ–ZZ sex-determining system. The haploid Artemia genome size was estimated to 0.93 Gb by flow cytometry. The produced Artemia linkage maps provide the basis for further fine mapping and exploring of the sex-determining region and are a possible marker resource for mapping genomic loci underlying phenotypic differences among Artemia species. PMID:23469207

  13. Dense genetic linkage maps of three Populus species (Populus deltoides, P. nigra and P. trichocarpa) based on AFLP and microsatellite markers.

    PubMed Central

    Cervera, M T; Storme, V; Ivens, B; Gusmão, J; Liu, B H; Hostyn, V; Van Slycken, J; Van Montagu, M; Boerjan, W

    2001-01-01

    Populus deltoides, P. nigra, and P. trichocarpa are the most important species for poplar breeding programs worldwide. In addition, Populus has become a model for fundamental research on trees. Linkage maps were constructed for these three species by analyzing progeny of two controlled crosses sharing the same female parent, Populus deltoides cv. S9-2 x P. nigra cv. Ghoy and P. deltoides cv. S9-2 x P. trichocarpa cv. V24. The two-way pseudotestcross mapping strategy was used to construct the maps. Amplified fragment length polymorphism (AFLP) markers that segregated 1:1 were used to form the four parental maps. Microsatellites and sequence-tagged sites were used to align homoeologous groups between the maps and to merge linkage groups within the individual maps. Linkage analysis and alignment of the homoeologous groups resulted in 566 markers distributed over 19 groups for P. deltoides covering 86% of the genome, 339 markers distributed over 19 groups for P. trichocarpa covering 73%, and 369 markers distributed over 28 groups for P. nigra covering 61%. Several tests for randomness showed that the AFLP markers were randomly distributed over the genome. PMID:11404342

  14. Profiling of Leptospira interrogans, L. santarosai, L. meyeri and L. borgpetersenii by SE-AFLP, PFGE and susceptibility testing--a continuous attempt at species and serovar differentiation.

    PubMed

    Moreno, Luisa Z; Miraglia, Fabiana; Lilenbaum, Walter; Neto, José S F; Freitas, Julio C; Morais, Zenaide M; Hartskeerl, Rudy A; da Costa, Barbara L P; Vasconcellos, Silvio A; Moreno, Andrea M

    2016-01-01

    Leptospirosis is a widespread systemic zoonosis, considered as reemerging in certain developing countries. Although the cross agglutinin absorption test is still considered the standard method for Leptospira identification, it presents several disadvantages. The aim of this study was to characterize Leptospira spp. isolated from various hosts by genotyping and broth microdilution susceptibility testing in an attempt to differentiate Leptospira species, serogroups and serovars. Forty-seven isolates were studied. They were previously serotyped, and species confirmation was performed by 16S rRNA sequencing. Single-enzyme amplified fragment length polymorphism (SE-AFLP) and pulsed-field gel electrophoresis (PFGE) analysis enabled the distinction of L. interrogans from L. santarosai, L. meyeri and L. borgpetersenii in two main clusters. Among L. interrogans, it was possible to differentiate into two new clusters the serogroup Icterohaemorrhagiae from the serogroups Canicola and Pomona. L. santarosai isolates presented higher genetic variation than the other species in both techniques. Interestingly, the minimum inhibitory concentration (MIC) cluster analysis also provided Leptospira serogroup differentiation. Further studies are necessary regarding serovar Bananal isolates, as they presented the highest MIC values for most of the antimicrobials tested. All studied techniques successfully distinguished Leptospira species and serogroups. Despite being library-dependent methods, these approaches are less labor intensive and more economically viable, particularly SE-AFLP, and can be implemented in most reference laboratories worldwide to enable faster Leptospira typing. PMID:26956446

  15. Profiling of Leptospira interrogans, L. santarosai, L. meyeri and L. borgpetersenii by SE-AFLP, PFGE and susceptibility testing—a continuous attempt at species and serovar differentiation

    PubMed Central

    Moreno, Luisa Z; Miraglia, Fabiana; Lilenbaum, Walter; Neto, José SF; Freitas, Julio C; Morais, Zenaide M; Hartskeerl, Rudy A; da Costa, Barbara LP; Vasconcellos, Silvio A; Moreno, Andrea M

    2016-01-01

    Leptospirosis is a widespread systemic zoonosis, considered as reemerging in certain developing countries. Although the cross agglutinin absorption test is still considered the standard method for Leptospira identification, it presents several disadvantages. The aim of this study was to characterize Leptospira spp. isolated from various hosts by genotyping and broth microdilution susceptibility testing in an attempt to differentiate Leptospira species, serogroups and serovars. Forty-seven isolates were studied. They were previously serotyped, and species confirmation was performed by 16S rRNA sequencing. Single-enzyme amplified fragment length polymorphism (SE-AFLP) and pulsed-field gel electrophoresis (PFGE) analysis enabled the distinction of L. interrogans from L. santarosai, L. meyeri and L. borgpetersenii in two main clusters. Among L. interrogans, it was possible to differentiate into two new clusters the serogroup Icterohaemorrhagiae from the serogroups Canicola and Pomona. L. santarosai isolates presented higher genetic variation than the other species in both techniques. Interestingly, the minimum inhibitory concentration (MIC) cluster analysis also provided Leptospira serogroup differentiation. Further studies are necessary regarding serovar Bananal isolates, as they presented the highest MIC values for most of the antimicrobials tested. All studied techniques successfully distinguished Leptospira species and serogroups. Despite being library-dependent methods, these approaches are less labor intensive and more economically viable, particularly SE-AFLP, and can be implemented in most reference laboratories worldwide to enable faster Leptospira typing. PMID:26956446

  16. A High Temperature Hermetic Primer and a Variable Spring Tester

    SciTech Connect

    Begeal, D.R.

    1994-05-01

    Percussion primers are used at Sandia to ignite energetic components such as pyrotechnic actuators and thermal batteries. This report describes a High Temperature Hermetic Primer (HTHP) that was developed to replace a previous G16 Percussion Primer Subassembly (Gl6PPS). The ignition mix in these primers is the same as in the discontinued Remington 44G16 (KC1O{sub 3}, SbS{sub 3}, and Ca{sub 2}Si). The HTHP has nearly the same sensitivity as the 44G16 and a significantly lower sensitivity than the G16PPS. In parallel with the HTHP development, we also designed a Variable Spring Tester (VST) to determine percussion primer ignition sensitivity with firing pins that have the same mass as those used in field applications. The tester is capable of accelerating firing pins over a velocity range of 100 to 600 inches per second for pins weighing up to 6 grams. The desired impulse can be preselected with an accuracy of better than {plus_minus}1%. The actual impulse is measured on every shot. The VST was characterized using the WW42Cl primer, as well as with the G16PPS and the HTHP. Compared to data from conventional ball drop testers, we found that ignition sensitivities were lower and there was less scatter in the sensitivity data. Our experiments indicate that ignition sensitivity is not strictly energy dependent, but also depends on the rate of deposition, or firing pin velocity in this case. Development results for the HTHP and Variable Spring Tester are discussed and design details are shown.

  17. Controversies in kidney paired donation.

    PubMed

    Gentry, Sommer E; Montgomery, Robert A; Segev, Dorry L

    2012-07-01

    Kidney paired donation represented 10% of living kidney donation in the United States in 2011. National registries around the world and several separate registries in the United States arrange paired donations, although with significant variations in their practices. Concerns about ethical considerations, clinical advisability, and the quantitative effectiveness of these approaches in paired donation result in these variations. For instance, although donor travel can be burdensome and might discourage paired donation, it was nearly universal until convincing analysis showed that living donor kidneys can sustain many hours of cold ischemia time without adverse consequences. Opinions also differ about whether the last donor in a chain of paired donation transplants initiated by a nondirected donor should donate immediately to someone on the deceased donor wait-list (a domino or closed chain) or should be asked to wait some length of time and donate to start another sequence of paired donations later (an open chain); some argue that asking the donor to donate later may be coercive, and others focus on balancing the probability that the waiting donor withdraws versus the number of additional transplants if the chain can be continued. Other controversies in paired donation include simultaneous versus nonsimultaneous donor operations, whether to enroll compatible pairs, and interactions with desensitization protocols. Efforts to expand public awareness of and participation in paired donation are needed to generate more transplant opportunities. PMID:22732046

  18. Lone pairs: an electrostatic viewpoint.

    PubMed

    Kumar, Anmol; Gadre, Shridhar R; Mohan, Neetha; Suresh, Cherumuttathu H

    2014-01-16

    A clear-cut definition of lone pairs has been offered in terms of characteristics of minima in molecular electrostatic potential (MESP). The largest eigenvalue and corresponding eigenvector of the Hessian at the minima are shown to distinguish lone pair regions from the other types of electron localization (such as π bonds). A comparative study of lone pairs as depicted by various other scalar fields such as the Laplacian of electron density and electron localization function is made. Further, an attempt has been made to generalize the definition of lone pairs to the case of cations. PMID:24372481

  19. Methods for Identifying Pair Halos

    NASA Astrophysics Data System (ADS)

    Wells, Brendan; Caputo, Regina; Atwood, William; Ritz, Steven M.

    2016-01-01

    The flux of very high energy gamma rays from active galactic nuclei (AGN) is attenuated via interactions with extragalactic background photons and is converted into e+e- pairs. With non-zero intergalactic magnetic fields, the electrons and positrons will deflect as they propagate and simultaneously lose energy by upscattering cosmic microwave background photons. "Pair halos," the visible consequences of these electromagnetic cascades, are faint and difficult to observe against their AGN counterparts. We investigate three methods for indirectly identifying pair halos, using a two-component approach to model the AGN core/halo image. We estimate each method's sensitivity by utilizing a new, detailed Monte Carlo pair-halo simulation.

  20. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    SciTech Connect

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  1. Environmental testing of a unique polyurethane primer/topcoat

    SciTech Connect

    Novak, H.L.; Klotz, J.M.

    1993-12-31

    High strength aluminum aerospace flight hardware exposed to harsh seacoast environments and seawater immersion presently requires high volatile organic compound (VOC) chromated primers and epoxy topcoats. Epoxy paint tends to be brittle and has low Ultraviolet (UV) exposure resistance. A unique non-leaded/non-chromated polyurethane single coat (primer/topcoat) tradenamed BOOSTERCOAT(c) has been developed for excellent corrosion protection, flexibility, adhesion, chemical and solvent resistance. In addition, coating formulation has been optimized for electrostatic spray capability and extended potlife. This report will discuss the environmental testing of BOOSTERCOAT(c) using neutral salt spray (ASTM B-117), beach exposure, Electrochemical Impedance Spectroscopy (EIS) and Prohesion apparatus.

  2. Pairs of promoter pairs in a web of transcription.

    PubMed

    Kaplan, Craig D

    2016-08-30

    A new analysis has characterized a fundamental building block of complex transcribed loci. Constellations of core promoters can generally be reduced to pairs of divergent transcription units, where the distance between the pairs of transcription units correlates with constraints on genomic context, which in turn contribute to transcript fate. PMID:27573684

  3. Changes in Rous Sarcoma Virus RNA Secondary Structure near the Primer Binding Site upon tRNATrp Primer Annealing

    PubMed Central

    Morris, Shannon; Leis, Jonathan

    1999-01-01

    Predicted secondary-structure elements encompassing the primer binding site in the 5′ untranslated region of Rous sarcoma virus (RSV) RNA play an integral role in multiple viral replications steps including reverse transcription, DNA integration, and RNA packaging (A. Aiyar, D. Cobrinik, Z. Ge, H. J. Kung, and J. Leis, J. Virol. 66:2464–2472, 1992; D. Cobrinik, A. Aiyar, Z. Ge, M. Katzman, H. Huang, and J. Leis, J. Virol. 65:3864–3872, 1991; J. T. Miller, Z. Ge, S. Morris, K. Das, and J. Leis, J. Virol. 71:7648–7656, 1997). These elements include the U5-Leader stem, U5-IR stem-loop, and U5-TΨC interaction region. Limited digestion of the 5′ untranslated region of wild-type and mutant RSV RNAs with structure- and/or sequence-specific RNases detects the presence of the U5-Leader stem and the U5-IR stem-loop. When a tRNATrp primer is annealed to wild-type RNAs in vitro, limited nuclease mapping indicates that the U5-IR stem becomes partially unwound. This is not observed when mutant RNAs with altered U5-IR stem-loop structures are substituted for wild-type RNAs. The U5-Leader stem also becomes destabilized when the tRNA primer is annealed to either wild-type or mutant RNA fragments. Nuclease mapping studies of tRNATrp, as well as the viral RNA, indicate that the U5-TΨC helix does form in vitro upon primer annealing. Collectively, these data suggest that the various structural elements near the RSV primer binding site undergo significant changes during the process of primer annealing. PMID:10400722

  4. Pair Programming: Issues and Challenges

    NASA Astrophysics Data System (ADS)

    Lui, Kim Man; Barnes, Kyle Atikus; Chan, Keith C. C.

    Pair programming, two programmers collaborating on design, coding and testing, has been a controversial focus of interest as Agile Software Development continues to grow in popularity both among academics and practitioners. As a result of the many investigations into the effectiveness of pair programming in the last decade, many have come to realize that there are many hard-to-control factors in pair programming in particular and in empirical software engineering in general. Because of these factors, the results of many pair programming experiments are not easy to replicate and the relative productivity of pair and solo programming are still not fully understood. So far, it has been concluded by previous studies that pair programming productivity can vary, but few have shown how and why this is the case. In this chapter, we discuss a number of challenging factors in the adoption of pair programming and present an approach to deal with them. We discuss how different factors may affect our experimental outcomes and improve experiment design to reveal how and why pair programming can be made productive, at least, in controlled situations.

  5. Assessment Strategies for Pair Programming

    ERIC Educational Resources Information Center

    Hahn, Jan Hendrik; Mentz, Elsa; Meyer, Lukas

    2009-01-01

    Although pair programming has proved its usefulness in teaching and learning programming skills, it is difficult to assess the individual roles and abilities of students whilst programming in pairs. (Note that within this manuscript, the term assessment refers to evaluating individual student performance.) Assessing only the outcomes of a pair…

  6. Supernovae in paired host galaxies

    NASA Astrophysics Data System (ADS)

    Nazaryan, T. A.; Petrosian, A. R.; Hakobyan, A. A.; Adibekyan, V. Zh.; Kunth, D.; Mamon, G. A.; Turatto, M.; Aramyan, L. S.

    2014-12-01

    We investigate the influence of close neighbor galaxies on the properties of supernovae (SNe) and their host galaxies using 56 SNe located in pairs of galaxies with different levels of star formation (SF) and nuclear activity. The mean distance of type II SNe from nuclei of hosts is greater by about a factor of 2 than that of type Ibc SNe. For the first time it is shown that SNe Ibc are located in pairs with significantly smaller difference of radial velocities between components than pairs containing SNe Ia and II. We consider this as a result of higher star formation rate (SFR) of these closer systems of galaxies. SN types are not correlated with the luminosity ratio of host and neighbor galaxies in pairs. The orientation of SNe with respect to the preferred direction toward neighbor galaxy is found to be isotropic and independent of kinematical properties of the galaxy pair.

  7. Property (RD) for Hecke Pairs

    NASA Astrophysics Data System (ADS)

    Shirbisheh, Vahid

    2012-06-01

    As the first step towards developing noncommutative geometry over Hecke C ∗-algebras, we study property (RD) (Rapid Decay) for Hecke pairs. When the subgroup H in a Hecke pair ( G, H) is finite, we show that the Hecke pair ( G, H) has (RD) if and only if G has (RD). This provides us with a family of examples of Hecke pairs with property (RD). We also adapt Paul Jolissant's works in Jolissaint (J K-Theory 2:723-735, 1989; Trans Amer Math Soc 317(1):167-196, 1990) to the setting of Hecke C ∗-algebras and show that when a Hecke pair ( G, H) has property (RD), the algebra of rapidly decreasing functions on the set of double cosets is closed under holomorphic functional calculus of the associated (reduced) Hecke C ∗-algebra. Hence they have the same K 0-groups.

  8. Design and testing of multiplex RT-PCR primers for the rapid detection of influenza A virus genomic segments: Application to equine influenza virus.

    PubMed

    Lee, EunJung; Kim, Eun-Ju; Shin, Yeun-Kyung; Song, Jae-Young

    2016-02-01

    The avian influenza A virus causes respiratory infections in animal species. It can undergo genomic recombination with newly obtained genetic material through an interspecies transmission. However, the process is an unpredictable event, making it difficult to predict the emergence of a new pandemic virus and distinguish its origin, especially when the virus is the result of multiple infections. Therefore, identifying a novel influenza is entirely dependent on sequencing its whole genome. Occasionally, however, it can be time-consuming, costly, and labor-intensive when sequencing many influenza viruses. To compensate for the difficulty, we developed a rapid, cost-effective, and simple multiplex RT-PCR to identify the viral genomic segments. As an example to evaluate its performance, H3N8 equine influenza virus (EIV) was studied for the purpose. In developing this protocol to amplify the EIV eight-segments, a series of processes, including phylogenetic analysis based on different influenza hosts, in silico analyses to estimate primer specificity, coverage, and variation scores, and investigation of host-specific amino acids, were progressively conducted to reduce or eliminate the negative factors that might affect PCR amplification. Selectively, EIV specific primers were synthesized with dual priming oligonucleotides (DPO) system to increase primer specificity. As a result, 16 primer pairs were selected to screen the dominantly circulating H3N8 EIV 8 genome segments: PA (3), PB2 (1), PA (3), NP (3), NA8 (2), HA3 (1), NS (1), and M (2). The diagnostic performance of the primers was evaluated with eight sets composing of four segment combinations using viral samples from various influenza hosts. The PCR results suggest that the multiplex RT-PCR has a wide range of applications in detection and diagnosis of newly emerging EIVs. Further, the proposed procedures of designing multiplex primers are expected to be used for detecting other animal influenza A viruses. PMID

  9. Sensitive and specific detection of Xanthomonas campestris pv. pelargonii with DNA primers and probes identified by random amplified polymorphic DNA analysis.

    PubMed Central

    Manulis, S; Valinsky, L; Lichter, A; Gabriel, D W

    1994-01-01

    The random amplified polymorphic DNA method was used to distinguish strains of Xanthomonas campestris pv. pelargonii from 21 other Xanthomonas species and/or pathovars. Among the 42 arbitrarily chosen primers evaluated, 3 were found to reveal diagnostic polymorphisms when purified DNAs from compared strains were amplified by the PCR. The three primers revealed DNA amplification patterns which were conserved among all 53 strains tested of X. campestris pv. pelargonii isolated from various locations worldwide. The distinctive X. compestris pv. pelargonii patterns were clearly different from those obtained with any of 46 other Xanthomonas strains tested. An amplified 1.2-kb DNA fragment, apparently unique to X. campestris pv. pelargonii by these random amplified polymorphic DNA tests, was cloned and evaluated as a diagnostic DNA probe. It hybridized with total DNA from all 53 X. campestris pv. pelargonii strains tested and not with any of the 46 other Xanthomonas strains tested. The DNA sequence of the terminal ends of this 1.2-kb fragment was obtained and used to design a pair of 18-mer oligonucleotide primers specific for X. campestris pv. pelargonii. The custom-synthesized primers amplified the same 1.2-kb DNA fragment from all 53 X. campestris pv. pelargonii strains tested and failed to amplify DNA from any of the 46 other Xanthomonas strains tested. DNA isolated from saprophytes associated with the geranium plant also did not produce amplified DNA with these primers. The sensitivity of the PCR assay using the custom-synthesized primers was between 10 and 50 cells.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:7993095

  10. PCR Detection of Salmonella enterica Serotype Montevideo in and on Raw Tomatoes Using Primers Derived from hilA

    PubMed Central

    Guo, Xuan; Chen, Jinru; Beuchat, Larry R.; Brackett, Robert E.

    2000-01-01

    Salmonellae have been some of the most frequently reported etiological agents in fresh-produce-associated outbreaks of human infections in recent years. PCR assays using four innovative pairs of primers derived from hilA and sirA, positive regulators of Salmonella invasive genes, were developed to identify Salmonella enterica serotype Montevideo on and in tomatoes. Based on examination of 83 Salmonella strains and 22 non-Salmonella strains, we concluded that a pair of hilA primers detects Salmonella specifically. The detection limits of the PCR assay were 101 and 100 CFU/ml after enrichment at 37°C for 6 and 9 h, respectively. When the assay was validated by detecting S. enterica serotype Montevideo in and on artificially inoculated tomatoes, 102 and 101 CFU/g were detected, respectively, after enrichment for 6 h at 37°C. Our results suggest that the hilA-based PCR assay is sensitive and specific, and can be used for rapid detection of Salmonellae in or on fresh produce. PMID:11097898

  11. Base pairing and base mis-pairing in nucleic acids

    NASA Technical Reports Server (NTRS)

    Wang, A. H. J.; Rich, A.

    1986-01-01

    In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.

  12. Blood Donation and Transfusion: A Primer for Health Educators.

    ERIC Educational Resources Information Center

    Felts, W. Michael; Glascoff, Mary A.

    1991-01-01

    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  13. A Primer on Fresh Water: The Environmental Citizenship Series.

    ERIC Educational Resources Information Center

    Environment Canada, Ottawa (Ontario).

    Water is the lifeblood of the environment as no organisms can survive without it. This reference booklet is designed to help people make environmentally responsible decisions. The primer is targeted at the general public (grade 8 to post-secondary) to be used by educators, communities and organizations as well as individuals, as part of a learning…

  14. Adolescence, School Transitions, and Prevention: A Research-Based Primer.

    ERIC Educational Resources Information Center

    Berliner, BethAnn

    Preventionists have long recognized that the transition from elementary to secondary school represents a period of uncertainty and profound change in young adolescents' lives. This paper offers a research-based primer for teachers and other preventionists. It builds upon the prevention literature that focuses on protective factors as well as the…

  15. Depth profiles and free volume in aircraft primer films

    NASA Astrophysics Data System (ADS)

    Van Horn, J. D.; Chen, H.; Jean, Y. C.; Zhang, W.; Jaworowski, M. R.

    2015-06-01

    Positron annihilation lifetime spectroscopy (PALS) and associated techniques provide non-destructive methods to study the free volume inside polymeric materials, and to study material characteristics over a depth profile. Cast free films of organic- or aqueous-based, non-chromated aerospace primers, when cured for about one week, had very different water vapour transport (through-plane) behaviour. In addition, both types of primer films showed strong anisotropic behaviour in in-plane versus through-plane water vapour transport rates. We report the differences between the organic- and aqueous-based aircraft primer films samples and their surface depth profiles. In bulk PALS measurements, an aged, organic-based film exhibited typical lifetimes and intensities for a particulate-containing polymer film on both faces. In contrast, aqueous-based films exhibited face oriented-dependent differences. In all aqueous- based samples, the I3 value of the back of the sample was smaller. The primer film samples were also evaluated with mono-energetic positron beam techniques to generate depth profile information. The heterogeneity in the samples was verified by Doppler broadening of energy spectroscopy (DBES). A model for the differences in the faces of the films, and their layered structure is discussed.

  16. Criticality calculations with MCNP{sup TM}: A primer

    SciTech Connect

    Mendius, P.W.; Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-08-01

    The purpose of this Primer is to assist the nuclear criticality safety analyst to perform computer calculations using the Monte Carlo code MCNP. Because of the closure of many experimental facilities, reliance on computer simulation is increasing. Often the analyst has little experience with specific codes available at his/her facility. This Primer helps the analyst understand and use the MCNP Monte Carlo code for nuclear criticality analyses. It assumes no knowledge of or particular experience with Monte Carlo codes in general or with MCNP in particular. The document begins with a Quickstart chapter that introduces the basic concepts of using MCNP. The following chapters expand on those ideas, presenting a range of problems from simple cylinders to 3-dimensional lattices for calculating keff confidence intervals. Input files and results for all problems are included. The Primer can be used alone, but its best use is in conjunction with the MCNP4A manual. After completing the Primer, a criticality analyst should be capable of performing and understanding a majority of the calculations that will arise in the field of nuclear criticality safety.

  17. Deeper Learning: A Primer for State Legislators. ECS Education Trends

    ERIC Educational Resources Information Center

    Aragon, Stephanie

    2015-01-01

    A growing number of schools across the country are working hard to provide a "deeper" learning experience for their students, and state legislators are being asked to create policies that support wide-scale implementation of 21st century learning practices. This primer is created for state policymakers seeking to modify instruction and…

  18. A Primer on Economics for Financial Aid Professionals.

    ERIC Educational Resources Information Center

    Baum, Sandy

    This primer is intended to provide college financial aid professionals with a background in fundamental areas of economics. Its goal is to provide a stronger understanding of the key principles that shape need analysis systems. Part 1 presents basic economic concepts and discusses their application to college enrollment and student aid. These…

  19. Children on Medication: A Primer for School Personnel.

    ERIC Educational Resources Information Center

    Gadow, Kenneth D.

    Intended as a primer for school personnel, the book discusses children whose various disorders require them to be on medication, and describes the behavioral effects of these drugs along with their major side effects. Fundamental concepts in pharmacotherapy are reviewed, including dosage adjustment and side effects, and a brief introduction to the…

  20. Method to amplify variable sequences without imposing primer sequences

    DOEpatents

    Bradbury, Andrew M.; Zeytun, Ahmet

    2006-11-14

    The present invention provides methods of amplifying target sequences without including regions flanking the target sequence in the amplified product or imposing amplification primer sequences on the amplified product. Also provided are methods of preparing a library from such amplified target sequences.

  1. Zip Pak for Pre-Primer Reading Level (Teacher's Manual).

    ERIC Educational Resources Information Center

    Scott, Norval C., Comp.

    The Zip Pak for the pre-primer reading level was developed for use with migrant Mexican American children with reading deficiencies. Its goals are to: (1) increase and widen the child's ability to be selective in choosing his information and selecting information pertinent to a purpose; and (2) improve the child's ability to make decisions,…

  2. Zip Pak for Pre-Primer Reading Level.

    ERIC Educational Resources Information Center

    Scott, Norval C., Comp.

    The Zip Pak for the pre-primer reading level was developed for use with migrant Mexican American children who have reading deficiencies. The area of failure with these children has not been with the visual discrimination involved in decoding, but with the interpretation of the material to be decoded. Therefore, the 5 lessons in this student…

  3. Improved primer for bonding polyurethane adhesives to metals

    NASA Technical Reports Server (NTRS)

    Constanza, L. J.

    1969-01-01

    Primer ensures effective bonding integrity of polyurethane adhesives on metal surfaces at temperatures ranging from minus 423 degrees to plus 120 degrees F. It provides greater metal surface protection and bond strengths over this temperature range than could be attained with other adhesive systems.

  4. Philosophical Foundations: A Primer for Adult Continuing Education.

    ERIC Educational Resources Information Center

    Rampp, Lary C., Ed.; Guffey, J. Stephen, Ed.

    This document, which is intended as a primer for adult continuing education, contains 11 chapters examining the philosophical foundations of adult and continuing education. The chapter titles and authors are as follows: "Progressivism and Adult Continuing Education" (Michael Day); "Progressivism: An Anthology" (Andrea Reeve); "Progressivism;…

  5. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    ERIC Educational Resources Information Center

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  6. 5. LOOKING NORTH TOWARD BARRICADES AROUND BUILDING NO. 230, PRIMER ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. LOOKING NORTH TOWARD BARRICADES AROUND BUILDING NO. 230, PRIMER AND DETONATOR LOADING BUILDING. BARRICADES DIRECT FORCE OF BLAST UPWARD IN THE EVENT OF AN EXPLOSION. - Picatinny Arsenal, 200 Area, Shell Component Loading, State Route 15 near I-80, Dover, Morris County, NJ

  7. Factor Scores, Structure and Communality Coefficients: A Primer

    ERIC Educational Resources Information Center

    Odum, Mary

    2011-01-01

    (Purpose) The purpose of this paper is to present an easy-to-understand primer on three important concepts of factor analysis: Factor scores, structure coefficients, and communality coefficients. Given that statistical analyses are a part of a global general linear model (GLM), and utilize weights as an integral part of analyses (Thompson, 2006;…

  8. Specific primers for the detection of freshwater alphaproteobacterial magnetotactic cocci.

    PubMed

    Lin, Wei; Pan, Yongxin

    2009-12-01

    Freshwater magnetotactic cocci within Alphaproteobacteria are of ecological interest due to their ubiquitous distribution in aquatic environments as well as their potential roles in iron cycling and the bulk magnetism of sediment. To effectively investigate the diversity and distribution of these cocci, specific primers (FMTCf and FMTCr) were developed. Their specificity, applicability, and effectiveness were then evaluated theoretically and empirically. PMID:20112228

  9. The development, characterization and testing of magnesium-rich primers

    NASA Astrophysics Data System (ADS)

    Battocchi, Dante

    Aluminum alloys are widely used in aircraft industry for their strength and light weight. Those alloys that are hardened by precipitation, especially the Copper-rich of the 2000 series, are prone to corrosion and are protected against it using chromate containing coatings. The primary component of these coating systems is Chromium 6+ (CrVI) that has been found to be very toxic in the environment and carcinogenic, toxic and mutagenic in humans. The Mg-rich primer development is the result of a successful multi-year project funded by the US Air-force with its objective the replacement of coatings based on CrVI with a class of coatings less toxic and with comparable protective performances. The Mg rich primer fulfilled the USAF requirements and it is currently undergoing commercial and military qualifications testing. The use of Mg as one of the active pigments in coatings allows the primer to protect the underlying Al sacrificially, not considered possible for this substrate until now. Mg is anodic to most of the other structural metals and when particulate Mg became available commercially, the concept of the primer was first developed by analogy to Zn-rich coatings for steel. When Mg and Al are in contact and immersed in a corrosive environment, magnesium corrodes preferentially and protects the aluminum.

  10. A Primer on Individualized Education Programs for Handicapped Children.

    ERIC Educational Resources Information Center

    Torres, Scottie, Ed.

    Intended to be a practical guide for administrators, teachers, and parents on how to meet the individualized education program (IEP) requirements of Public Law 94-142, the primer provides 10 author contributed chapters to aid the reader in developing, implementing, and monitoring an IEP for every handicapped child. Chapters have the following…

  11. Stereo Pair, Patagonia, Argentina

    NASA Technical Reports Server (NTRS)

    2000-01-01

    This view of northern Patagonia, at Los Menucos, Argentina shows remnants of relatively young volcanoes built upon an eroded plain of much older and contorted volcanic, granitic, and sedimentary rocks. The large purple, brown, and green 'butterfly' pattern is a single volcano that has been deeply eroded. Large holes on the volcano's flanks indicate that they may have collapsed soon after eruption, as fluid molten rock drained out from under its cooled and solidified outer shell. At the upper left, a more recent eruption occurred and produced a small volcanic cone and a long stream of lava, which flowed down a gully. At the top of the image, volcanic intrusions permeated the older rocks resulting in a chain of small dark volcanic peaks. At the top center of the image, two halves of a tan ellipse pattern are offset from each other. This feature is an old igneous intrusion that has been split by a right-lateral fault. The apparent offset is about 6.6 kilometers (4 miles). Color, tonal, and topographic discontinuities reveal the fault trace as it extends across the image to the lower left. However, young unbroken basalt flows show that the fault has not been active recently.

    This cross-eyed stereoscopic image pair was generated using topographic data from the Shuttle Radar Topography Mission, combined with an enhanced Landsat 7satellite color image. The topography data are used to create two differing perspectives of a single image, one perspective for each eye. In doing so, each point in the image is shifted slightly, depending on its elevation. When stereoscopically merged, the result is a vertically exaggerated view of the Earth's surface in its full three dimensions.

    Landsat satellites have provided visible light and infrared images of the Earth continuously since 1972. SRTM topographic data match the 30-meter (99-foot) spatial resolution of most Landsat images and provide a valuable complement for studying the historic and growing Landsat data archive

  12. Stereo Pair: Patagonia, Argentina

    NASA Technical Reports Server (NTRS)

    2000-01-01

    This view of northern Patagonia, near El Cain, Argentina shows complexly eroded volcanic terrain, with basalt mesas, sinkholes, landslide debris, playas, and relatively few integrated drainage channels. Surrounding this site (but also extending far to the east) is a broad plateau capped by basalt, the Meseta de Somuncura. Here, near the western edge of the plateau, erosion has broken through the basalt cap in a variety of ways. On the mesas, water-filled sinkholes (lower left) are most likely the result of the collapse of old lava tubes. Along the edges of the mesas (several locations) the basalt seems to be sliding away from the plateau in a series of slices. Water erosion by overland flow is also evident, particularly in canyons where vegetation blankets the drainage channels (green patterns, bottom of image). However, overland water flow does not extend very far at any location. This entire site drains to local playas, some of which are seen here (blue). While the water can reach the playas and then evaporate, what becomes of the eroded rock debris? Wind might excavate some of the finer eroded debris, but the fate of much of the missing bedrock remains mysterious.

    This cross-eyed stereoscopic image pair was generated using topographic data from the Shuttle Radar Topography Mission, combined with an enhanced Landsat 7 satellite color image. The topography data are used to create two differing perspectives of a single image, one perspective for each eye. In doing so, each point in the image is shifted slightly, depending on its elevation. When stereoscopically merged, the result is a vertically exaggerated view of the Earth's surface in its full three dimensions.

    Landsat satellites have provided visible light and infrared images of the Earth continuously since 1972. SRTM topographic data match the 30-meter (99-foot) spatial resolution of most Landsat images and provide a valuable complement for studying the historic and growing Landsat data archive. The

  13. Criticality calculations with MCNP{trademark}: A primer

    SciTech Connect

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-06-06

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand.

  14. An Efficient Approach for the Development of Locus Specific Primers in Bread Wheat (Triticum aestivum L.) and Its Application to Re-Sequencing of Genes Involved in Frost Tolerance

    PubMed Central

    Babben, Steve; Perovic, Dragan; Koch, Michael; Ordon, Frank

    2015-01-01

    Recent declines in costs accelerated sequencing of many species with large genomes, including hexaploid wheat (Triticum aestivum L.). Although the draft sequence of bread wheat is known, it is still one of the major challenges to developlocus specific primers suitable to be used in marker assisted selection procedures, due to the high homology of the three genomes. In this study we describe an efficient approach for the development of locus specific primers comprising four steps, i.e. (i) identification of genomic and coding sequences (CDS) of candidate genes, (ii) intron- and exon-structure reconstruction, (iii) identification of wheat A, B and D sub-genome sequences and primer development based on sequence differences between the three sub-genomes, and (iv); testing of primers for functionality, correct size and localisation. This approach was applied to single, low and high copy genes involved in frost tolerance in wheat. In summary for 27 of these genes for which sequences were derived from Triticum aestivum, Triticum monococcum and Hordeum vulgare, a set of 119 primer pairs was developed and after testing on Nulli-tetrasomic (NT) lines, a set of 65 primer pairs (54.6%), corresponding to 19 candidate genes, turned out to be specific. Out of these a set of 35 fragments was selected for validation via Sanger's amplicon re-sequencing. All fragments, with the exception of one, could be assigned to the original reference sequence. The approach presented here showed a much higher specificity in primer development in comparison to techniques used so far in bread wheat and can be applied to other polyploid species with a known draft sequence. PMID:26565976

  15. cDNA-AFLP analysis reveals differential gene expression in incompatible interaction between infected non-heading Chinese cabbage and Hyaloperonospora parasitica

    PubMed Central

    Xiao, Dong; Liu, Shi-Tuo; Wei, Yan-Ping; Zhou, Dao-Yun; Hou, Xi-Lin; Li, Ying; Hu, Chun-Mei

    2016-01-01

    Non-heading Chinese cabbage (Brassica rapa ssp. chinensis) is one of the main green leafy vegetables in the world, especially in China, with significant economic value. Hyaloperonospora parasitica is a fungal pathogen responsible for causing downy mildew disease in Chinese cabbage, which greatly affects its production. The objective of this study was to identify transcriptionally regulated genes during incompatible interactions between non-heading Chinese cabbage and H. parasitica using complementary DNA-amplified fragment length polymorphism (cDNA-AFLP). We obtained 129 reliable differential transcript-derived fragments (TDFs) in a resistant line ‘Suzhou Qing’. Among them, 121 upregulated TDFs displayed an expression peak at 24–48 h post inoculation (h.p.i.). Fifteen genes were further selected for validation of cDNA-AFLP expression patterns using quantitative reverse transcription PCR. Results confirmed the altered expression patterns of 13 genes (86.7%) revealed by the cDNA-AFLP. We identified four TDFs related to fungal resistance among the 15 TDFs. Furthermore, comparative analysis of four TDFs between resistant line ‘Suzhou Qing’ and susceptible line ‘Aijiao Huang’ showed that transcript levels of TDF14 (BcLIK1_A01) peaked at 48 h.p.i. and 25.1-fold increased in the resistant line compared with the susceptible line. Similarly, transcript levels of the other three genes, TDF42 (BcCAT3_A07), TDF75 (BcAAE3_A06) and TDF88 (BcAMT2_A05) peaked at 24, 48 and 24 h.p.i. with 25.1-, 100- and 15.8-fold increases, respectively. The results suggested that the resistance genes tended to transcribe at higher levels in the resistance line than in the susceptible line, which may provide resistance against pathogen infections. The present study might facilitate elucidating the molecular basis of the infection process and identifying candidate genes for resistance improvement of susceptible cultivars. PMID:27602230

  16. Ion Pair-π Interactions.

    PubMed

    Fujisawa, Kaori; Humbert-Droz, Marie; Letrun, Romain; Vauthey, Eric; Wesolowski, Tomasz A; Sakai, Naomi; Matile, Stefan

    2015-09-01

    We report that anion-π and cation-π interactions can occur on the same aromatic surface. Interactions of this type are referred to as ion pair-π interactions. Their existence, nature, and significance are elaborated in the context of spectral tuning, ion binding in solution, and activation of cell-penetrating peptides. The origin of spectral tuning by ion pair-π interactions is unraveled with energy-minimized excited-state structures: The solvent- and pH-independent red shift of absorption and emission of push-pull fluorophores originates from antiparallel ion pair-π attraction to their polarized excited state. In contrast, the complementary parallel ion pair-π repulsion is spectroscopically irrelevant, in part because of charge neutralization by intriguing proton and electron transfers on excited push-pull surfaces. With time-resolved fluorescence measurements, very important differences between antiparallel and parallel ion pair-π interactions are identified and quantitatively dissected from interference by aggregation and ion pair dissociation. Contributions from hydrogen bonding, proton transfer, π-π interactions, chromophore twisting, ion pairing, and self-assembly are systematically addressed and eliminated by concise structural modifications. Ion-exchange studies in solution, activation of cell-penetrating peptides in vesicles, and computational analysis all imply that the situation in the ground state is complementary to spectral tuning in the excited state; i.e., parallel rather than antiparallel ion pair-π interactions are preferred, despite repulsion from the push-pull dipole. The overall quite complete picture of ion pair-π interactions provided by these remarkably coherent yet complex results is expected to attract attention throughout the multiple disciplines of chemistry involved. PMID:26291550

  17. Pairing Properties of Superheavy Nuclei

    SciTech Connect

    Staszczak, A.; Dobaczewski, J.; Nazarewicz, Witold

    2007-01-01

    Pairing properties of even-even superheavy N=184 isotones are studied within the Skyrme-Hartree-Fock+BCS approach. In the particle-hole channel we take the Skyrme energy density functional SLy4, while in the particle-particle channel we employ the seniority pairing force and zero-range delta-interactions with different forms of density dependence. We conclude that the calculated static fission trajectories weakly depend on the specific form of the delta-pairing interaction. We also investigate the impact of triaxiality on the inner fission barrier and find a rather strong Z dependence of the effect.

  18. Pairing Correlations at High Spins

    NASA Astrophysics Data System (ADS)

    Ma, Hai-Liang; Dong, Bao-Guo; Zhang, Yan; Fan, Ping; Yuan, Da-Qing; Zhu, Shen-Yun; Zhang, Huan-Qiao; Petrache, C. M.; Ragnarsson, I.; Carlsson, B. G.

    The pairing correcting energies at high spins in 161Lu and 138Nd are studied by comparing the results of the cranked-Nilsson-Strutinsky (CNS) and cranked-Nilsson-Strutinsky-Bogoliubov (CNSB) models. It is concluded that the Coriolis effect rather than the rotational alignment effect plays a major role in the reduction of the pairing correlations in the high spin region. Then we proposed an average pairing correction method which not only better reproduces the experimental data comparing with the CNS model but also enables a clean-cut tracing of the configurations thus the full-spin-range discussion on the various rotating bands.

  19. White primer permits a corrosion-resistant coating of minimum weight

    NASA Technical Reports Server (NTRS)

    Albrecht, R. H.; Jensen, D. P.; Schnake, P.

    1966-01-01

    White primer for coating 2219 aluminum alloy supplies a base for a top coating of enamel. A formulation of pigments and vehicle results in a primer with high corrosion resistance and minimum film thickness.

  20. [Choice of primers: a determining element in molecular diagnosis of cutaneous leishmaniasis].

    PubMed

    Neffati, A; Kallel, K; Anene, S; Kaouech, E; Belhadj, S; Ennigrou, S; Chaker, E

    2011-12-01

    The cutaneous leishmaniasis (CL) is a parasitic disease which represents a serious problem for the public health not only in Tunisia but also all over the world. Its diagnosis is based on the techniques which are usually used, direct examination and in vitro culture. Because of several factors, these techniques lack sensitivity. The molecular biology, which is indeed more rapid and more sensitive, has proved its effectiveness in diagnosis of the CL. There are two main aims for our research work. First, to show the contribution of the Polymerase Chain Reaction (PCR) during the diagnosis of CL (of course by comparing the results obtained when using this technique with those found through the direct examination); second, to compare the two pairs of primers which amplify the leishmanien gene coding for the 18s ribosomal sub-unit: the pair R221/R332 (PCR1) and the pair Lei70L/Lei70R (PCR2). Our work was carried out upon 299 samples. One hundred and eighty-eight of them were positive using the direct examination and/or the PCR and 111 were negative. Only two samples were positive using of course the direct examination in comparison with 74 which were positive when using only the PCR (PCR1 and/or PCR2). Among these 74 samples, 64 where positive using only PCR2 in comparison with two samples which were positive using only PCR1. The eight remaining samples were at once positive for the PCR1 and the PCR2. The PCR (notably the PCR2) has proved a more significant percentage of positivity in comparison with direct examination: 98.98% for the PCR and 60.6% for direct examination. PMID:19896289

  1. Mitochondrial D-loop {open_quotes}signatures{close_quotes} produced by low-stringency single specific primer PCR constitute a simple comparative human identity test

    SciTech Connect

    Barreto, G.; Vago, A.R.; Pena, S.D.J.

    1996-03-01

    We have developed a technique called {open_quotes}LSSP-PCR{close_quotes} (low-stringency single specific primer PCR) that detects single or multiple mutations in DNA. A purified DNA fragment is submitted to PCR by using a single primer specific for one of the extremities of the fragment, under conditions of very low stringency. The primer hybridizes specifically to its complementary extremity and nonspecifically to multiple sites within the fragment, in a sequence-dependent manner. A complex set of reaction products is thus created that, when separated by electrophoresis, constitutes a unique {open_quotes}gene signature.{close_quotes} We here report the application of LSSP-PCR to the detection of sequence variation in the control (D-loop) region of human mtDNA, which is known to differ significantly between unrelated individuals. We prepared human DNA samples from blood and amplified a 1,024-bp portion of the mtDNA control region, using primers L15996 and H408. The amplified mtDNA fragments were then reamplified under LSSP-PCR conditions by using L15996 or H408 as drivers to produce complex signatures that always differed between unrelated individuals and yet were highly reproducible. In contrast, all mother-child pairs tested were identical, as expected from the matrilineal inheritance of mtDNA. Thus, the use of LSSP-PCR to produce D-loop signatures constitutes a powerful new technique for mtDNA-based comparative identity testing. 18 refs., 7 figs.

  2. Pairing in hot rotating nuclei

    SciTech Connect

    Hung, N. Quang; Dang, N. Dinh

    2008-12-15

    Nuclear pairing properties are studied within an approach that includes the quasiparticle-number fluctuation (QNF) and coupling to the quasiparticle-pair vibrations at finite temperature and angular momentum. The formalism is developed to describe noncollective rotations about the symmetry axis. The numerical calculations are performed within a doubly folded equidistant multilevel model as well as several realistic nuclei. The results obtained for the pairing gap, total energy, and heat capacity show that the QNF smoothes out the sharp SN phase transition and leads to the appearance of a thermally assisted pairing gap in rotating nuclei at finite temperature. The corrections due to the dynamic coupling to SCQRPA vibrations and particle-number projection are analyzed. The effect of backbending of the momentum of inertia as a function of squared angular velocity is also discussed.

  3. Dynamical interactions of galaxy pairs

    NASA Technical Reports Server (NTRS)

    Athanassoula, E.

    1990-01-01

    Here the author briefly reviews the dynamics of sinking satellites and the effect of companions on elliptical galaxies. The author then discusses recent work on interacting disk systems, and finally focuses on a favorite interacting pair, NGC 5194/5195.

  4. Comparative cDNA-AFLP analysis of Cd-tolerant and -sensitive genotypes derived from crosses between the Cd hyperaccumulator Arabidopsis halleri and Arabidopsis lyrata ssp. petraea.

    PubMed

    Craciun, Adrian Radu; Courbot, Mikael; Bourgis, Fabienne; Salis, Pietrino; Saumitou-Laprade, Pierre; Verbruggen, Nathalie

    2006-01-01

    Cadmium (Cd) tolerance seems to be a constitutive species-level trait in Arabidopsis halleri. In order to identify genes potentially implicated in Cd tolerance, a backcross (BC1) segregating population was produced from crosses between A. halleri ssp. halleri and its closest non-tolerant relative A. lyrata ssp. petraea. The most sensitive and tolerant genotypes of the BC1 were analysed on a transcriptome-wide scale by cDNA-amplified fragment length polymorphism (AFLP). A hundred and thirty-four genes expressed more in the root of tolerant genotypes than in sensitive genotypes were identified. Most of the identified genes showed no regulation in their expression when exposed to Cd in a hydroponic culture medium and belonged to diverse functional classes, including reactive oxygen species (ROS) detoxification, cellular repair, metal sequestration, water transport, signal transduction, transcription regulation, and protein degradation, which are discussed. PMID:16916885

  5. Fluorescence energy transfer dye-labeled primers for DNA sequencing and analysis.

    PubMed Central

    Ju, J; Ruan, C; Fuller, C W; Glazer, A N; Mathies, R A

    1995-01-01

    Fluorescent dye-labeled DNA primers have been developed that exploit fluorescence energy transfer (ET) to optimize the absorption and emission properties of the label. These primers carry a fluorescein derivative at the 5' end as a common donor and other fluorescein and rhodamine derivatives attached to a modified thymidine residue within the primer sequence as acceptors. Adjustment of the donor-acceptor spacing through the placement of the modified thymidine in the primer sequence allowed generation of four primers, all having strong absorption at a common excitation wavelength (488 nm) and fluorescence emission maxima of 525, 555, 580, and 605 nm. The ET efficiency of these primers ranges from 65% to 97%, and they exhibit similar electrophoretic mobilities by gel electrophoresis. With argon-ion laser excitation, the fluorescence of the ET primers and of the DNA sequencing fragments generated with ET primers is 2- to 6-fold greater than that of the corresponding primers or fragments labeled with single dyes. The higher fluorescence intensity of the ET primers allows DNA sequencing with one-fourth of the DNA template typically required when using T7 DNA polymerase. With single-stranded M13mp18 DNA as the template, a typical sequencing reaction with ET primers on a commercial sequencer provided DNA sequences with 99.8% accuracy in the first 500 bases. ET primers should be generally useful in the development of other multiplex DNA sequencing and analysis methods. Images Fig. 4 Fig. 5 PMID:7753809

  6. Characterization of the Complete Genome of Chikungunya in Zhejiang, China, Using a Modified Virus Discovery Method Based on cDNA-AFLP

    PubMed Central

    Sun, Yi; Yan, JuYing; Mao, HaiYan; Zhang, Lei; Lyu, QinFeng; Wu, ZhongHua; Zheng, Wei; Feng, Cen; Zhang, YanJun

    2013-01-01

    Background Chikungunya (CHIK) virus is a mosquito-borne emerging pathogen presenting great health challenges worldwide, particularly in tropical zones. Here we report a newly detected strain of CHIK, Zhejiang/chik-sy/2012, in China, a nonindigenous region for CHIK, using a modified approach based on the classic cDNA-AFLP. We then performed etiological and phylogenetic analyses to better understand its molecular characterization and phylogenetic pattern, and also to aid in further evaluating its persistence in Southeast Asia. Methods By using this modified procedure, we determined for the first time the complete genome sequence of the chikungunya virus strain, Zhejiang/chik-sy/2012, isolated in 2012 from a patient in Zhejiang, China. Sequence analyses revealed that this positive single strand of RNA is 12,017 bp long. We found no single amino acid mutation in A226V, D284E and A316V. Phylogenetic analysis showed that our strain shared the greatest homology with a strain isolated in Taiwan, which was derived from a strain from Indonesia. Chik-sy/2012 is in a different clade from other CHIK viruses found in China previously. Conclusions A modified cDNA-AFLP in virus discovery was used to isolate the first CHIK and the first complete genome sequence of virus strain chik-sy/2012 in 2012 from a patient with CHIK fever in Zhejiang, China. The infection displayed great phylogenetic distance from viruses detected in Guangdong, China, in 2008 and 2010, since they were derived from another evolutionary lineage. Additional molecular epidemiology data are needed to further understand, monitor and evaluate CHIK in China. PMID:24367579

  7. Spatial patterns of AFLP diversity in Bulbophyllum occultum (Orchidaceae) indicate long-term refugial isolation in Madagascar and long-distance colonization effects in La Réunion.

    PubMed

    Jaros, U; Fischer, G A; Pailler, T; Comes, H P

    2016-05-01

    Bulbophyllum occultum, an epiphytic orchid mainly distributed in the rainforests of (north)eastern Madagascar and La Réunion, represents an interesting model case for testing the effects of anthropogenic vs historical (e.g., climate induced) habitat isolation and long-distance colonization on the genetic structure of plant species with disjunct distributions in the Madagascan region. To this aim, we surveyed amplified fragment length polymorphisms (AFLPs) across 13 populations in Madagascar and nine in La Réunion (206 individuals in total). We found overall high levels of population subdivision (Φ(PT)=0.387) and low within-population diversity (H(E), range: 0.026-0.124), indicating non-equilibrium conditions in a mainly selfing species. There was no impact of recent deforestation (Madagascar) or habitat disturbance (La Réunion) detectable on AFLP diversity. K-means clustering and BARRIER analyses identified multiple gene pools and several genetic breaks, both within and among islands. Inter-island levels of population genetic diversity and subdivision were similar, whereby inter-individual divergence in flower colour explained a significant part of gene pool divergence in La Réunion. Our results suggest that (i) B. occultum persisted across multiple isolated ('refugial') regions along the eastern rainforest corridor of Madagascar over recent climatic cycles and (ii) populations in La Réunion arose from either single or few independent introductions from Madagascar. High selfing rates and sufficient time for genetic drift likely promoted unexpectedly high population genetic and phenotypic (flower colour) differentiation in La Réunion. Overall, this study highlights a strong imprint of history on the genetic structure of a low-gene-dispersing epiphytic orchid from the Madagascan region. PMID:26883184

  8. Genetic differentiation and admixture among Eurasian and North American Leymus (Triticeae) wildryes detected using chloroplast DNA sequences and AFLP profiles

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Leymus is a genomically defined group of allopolyploid Triticeae taxa that show homologous chromosome pairing when hybridized and contain the Ns and Xm subgenomes. Recent investigations showed that Leymus chloroplast DNA sequences are polyphyletic with most Eurasian taxa similar to the Psathyrostac...

  9. Structure of the 2-Aminopurine-Cytosine Base Pair Formed in the Polymerase Active Site of the RB69 Y567A-DNA Polymerase

    SciTech Connect

    Reha-Krantz, Linda J.; Hariharan, Chithra; Subuddhi, Usharani; Xia, Shuangluo; Zhao, Chao; Beckman, Jeff; Christian, Thomas; Konigsberg, William

    2011-11-21

    The adenine base analogue 2-aminopurine (2AP) is a potent base substitution mutagen in prokaryotes because of its enhanceed ability to form a mutagenic base pair with an incoming dCTP. Despite more than 50 years of research, the structure of the 2AP-C base pair remains unclear. We report the structure of the 2AP-dCTP base pair formed within the polymerase active site of the RB69 Y567A-DNA polymerase. A modified wobble 2AP-C base pair was detected with one H-bond between N1 of 2AP and a proton from the C4 amino group of cytosine and an apparent bifurcated H-bond between a proton on the 2-amino group of 2-aminopurine and the ring N3 and O2 atoms of cytosine. Interestingly, a primer-terminal region rich in AT base pairs, compared to GC base pairs, facilitated dCTP binding opposite template 2AP. We propose that the increased flexibility of the nucleotide binding pocket formed in the Y567A-DNA polymerase and increased 'breathing' at the primer-terminal junction of A+T-rich DNA facilitate dCTP binding opposite template 2AP. Thus, interactions between DNA polymerase residues with a dynamic primer-terminal junction play a role in determining base selectivity within the polymerase active site of RB69 DNA polymerase.

  10. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    SciTech Connect

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  11. Multiplex primer-extension assay for identification of Yersinia species.

    PubMed

    Dalmasso, Alessandra; Civera, Tiziana; Filipello, Virginia; Bottero, Maria Teresa

    2014-10-01

    A multiplex primer-extension reaction (PER) assay, was specifically designed for the identification of ten Yersinia species. The assay, directed towards the tufA (elongation factor Tu) gene, was tested on a total of 42 samples representing Yersinia species and non-Yersinia species. The primers used in the preliminary PCR, designed in highly conserved regions upstream and downstream of the diagnosis sites, successfully amplified a 587 bp fragment. The diagnosis sites were simultaneously interrogated using a multiplex PER and the results were confirmed by fragment sequencing. The proposed test provides an appropriate tool to monitor the presence of Yersinia spp. in food samples and to evaluate the potential hazard for consumers. PMID:24985982

  12. Recombination of polynucleotide sequences using random or defined primers

    DOEpatents

    Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin H; Giver, Lorraine J.

    2000-01-01

    A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

  13. Recombination of polynucleotide sequences using random or defined primers

    DOEpatents

    Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin; Giver, Lorraine J.

    2001-01-01

    A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

  14. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    SciTech Connect

    Bilyard, Gordon R.; Word, Charlotte J.; Weber, James R.; Harding, Anna K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  15. Primer on Molecular Genetics; DOE Human Genome Program

    DOE R&D Accomplishments Database

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  16. Primer on molecular genetics. DOE Human Genome Program

    SciTech Connect

    Not Available

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  17. Small Commercial Building Re-tuning: A Primer

    SciTech Connect

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  18. Sensory reception of the primer pheromone ethyl oleate

    NASA Astrophysics Data System (ADS)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  19. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    SciTech Connect

    D. S. Lucas

    2004-10-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

  20. Pair extended coupled cluster doubles

    SciTech Connect

    Henderson, Thomas M.; Scuseria, Gustavo E.; Bulik, Ireneusz W.

    2015-06-07

    The accurate and efficient description of strongly correlated systems remains an important challenge for computational methods. Doubly occupied configuration interaction (DOCI), in which all electrons are paired and no correlations which break these pairs are permitted, can in many cases provide an accurate account of strong correlations, albeit at combinatorial computational cost. Recently, there has been significant interest in a method we refer to as pair coupled cluster doubles (pCCD), a variant of coupled cluster doubles in which the electrons are paired. This is simply because pCCD provides energies nearly identical to those of DOCI, but at mean-field computational cost (disregarding the cost of the two-electron integral transformation). Here, we introduce the more complete pair extended coupled cluster doubles (pECCD) approach which, like pCCD, has mean-field cost and reproduces DOCI energetically. We show that unlike pCCD, pECCD also reproduces the DOCI wave function with high accuracy. Moreover, pECCD yields sensible albeit inexact results even for attractive interactions where pCCD breaks down.

  1. Mass of Galaxies in Pairs

    NASA Astrophysics Data System (ADS)

    Junqueira, S.; Chan, R.

    We have compared the frequency distribution of the dynamical observed quantity log (V r), for a sample of 46 pairs of elliptical galaxies, to the distribution of this quantity obtained from numerical simulations of pairs of galaxies. From such an analysis, where we have considered the structure of the galaxies and its influence in the orbital evolution of the system, we have obtained the characteristic mass and the mass-luminosity ratio for the sample. Our results show that the hypothesis of point-mass in elliptical orbits is, for this sample, an approximation as good as the model that takes into account the structure of the galaxies. The statistical method used here gives an estimate of a more reliable mass, it minimizes the contamination of spurious pairs and it considers adequately the contribution of the physical pairs. We have obtained a characteristic mass to the 46 elliptical pairs of 1.68 × 10^12 +/- 7.01 × 10^11 M_solar with M/L = 17.6 +/- 7.3 (H_0 = 60 km s^-1 Mpc^-1).

  2. Development of oligonucleotide primers and probes against structural and regulatory genes of human immunodeficiency virus type 1 (HIV-1) and their use for amplification of HIV-1 provirus by using polymerase chain reaction.

    PubMed Central

    Dawood, M R; Allan, R; Fowke, K; Embree, J; Hammond, G W

    1992-01-01

    The polymerase chain reaction is a powerful technique for amplifying a few copies of double-stranded genetic material to millions of copies in a few hours. The sensitivity and specificity of the polymerase chain reaction technique depend to some extent on the nucleotide sequences of the oligonucleotide primer pair used in the amplification. We report new oligonucleotide primers and probes which can be used for the amplification and detection of human immunodeficiency virus type 1 provirus sequences of not only structural but also regulatory genes. These primers are very sensitive and specific and can be used for the detection of African and North American strains of human immunodeficiency virus type 1. Images PMID:1400991

  3. Species-specific ITS primers for the identification of Picoa juniperi and Picoa lefebvrei and using nested-PCR for detection of P. juniperi in planta.

    PubMed

    Jamali, Samad; Banihashemi, Zia

    2013-10-01

    Desert truffles, hypogeous Pezizales (Ascomycota), are difficult to identify due to evolutionary convergence of morphological characters among taxa that share a similar habitat and mode of spore dispersal. Also, during their symbiotic phase, these are barely distinguishable morphologically, and molecular probes are needed for their identification. We have developed a PCR-based method for the identification of Picoa juniperi and Picoa lefebvrei based on internal transcribed spacers of rDNA. Two PCR primers specific for P. lefebvrei (FLE/RLE) and two specific for P. juniperi (FJU/RJU) were designed. A collection of samples from different geographical areas representing diversity of these species were examined for unique regions of internal transcribed spacers 1, 2 and 5.8S gene of rDNA (ITS) compared to other closely related species. Annealing temperatures and extension times were optimized for each set of primers for maximum specificity and efficiency. They proved to be efficient to specifically detect the presence of P. juniperi and P. lefebvrei by PCR and neither set amplified purified DNA from other truffle species as well as some ascomycetous fungi. The partial small subunit of ribosomal DNA genes of P. juniperi were amplified with the genomic DNA extracted from Helianthemum ledifolium var. ledifolium roots by nested polymerase chain reaction (PCR) using the universal fungal primer pair ITS1/ITS4 and specific primer pair FTC/RTC, which was designed based on internal transcribed spacer 1, 2 and 5.8S gene of rDNA sequences of P juniperi. The nested-PCR was sensitive enough to re-amplify the direct-PCR product, resulting in a DNA fragment of 426 bp. The efficacy of nested-PCR showed that it could re-amplify the direct-PCR product and detect 200 fg genomic DNA. PMID:24065525

  4. Stereo pairs from linear morphing

    NASA Astrophysics Data System (ADS)

    McAllister, David F.

    1998-04-01

    Several authors have recently investigated the ability to compute intermediate views of a scene using given 2D images from arbitrary camera positions. The methods fall under the topic of image based rendering. In the case we give here, linear morphing between two parallel views of a scene produces intermediate views that would have been produced by parallel movement of a camera. Hence, the technique produces images computed in a way that is consistent with the standard off-axis perspective projection method for computing stereo pairs. Using available commercial 2D morphing software, linear morphing can be used to produce stereo pairs from a single image with bilateral symmetry such as a human face. In our case, the second image is produced by horizontal reflection. We describe morphing and show how it can be used to provide stereo pairs from single images.

  5. Pair-Starved Pulsar Magnetospheres

    NASA Technical Reports Server (NTRS)

    Muslimov, Alex G.; Harding, Alice K.

    2009-01-01

    We propose a simple analytic model for the innermost (within the light cylinder of canonical radius, approx. c/Omega) structure of open-magnetic-field lines of a rotating neutron star (NS) with relativistic outflow of charged particles (electrons/positrons) and arbitrary angle between the NS spin and magnetic axes. We present the self-consistent solution of Maxwell's equations for the magnetic field and electric current in the pair-starved regime where the density of electron-positron plasma generated above the pulsar polar cap is not sufficient to completely screen the accelerating electric field and thus establish thee E . B = 0 condition above the pair-formation front up to the very high altitudes within the light cylinder. The proposed mode1 may provide a theoretical framework for developing the refined model of the global pair-starved pulsar magnetosphere.

  6. Pairing effects in nuclear dynamic

    NASA Astrophysics Data System (ADS)

    Lacroix, Denis; Scamps, Guillaume; Tanimura, Yusuke

    2016-05-01

    In recent years, efforts have been made to account for super-fluidity in time-dependent mean-field description of nuclear dynamic [1-5]. Inclusion of pairing is important to achieve a realistic description of static properties of nuclei. Here,we show that pairing can also affect the nuclear motion. State of the art TDHF approach can describe from small to large amplitude collective motion as well as the collision between nuclei. Very recently, this microscopic approach has been improved to include pairing either in the BCS or HFB framework. Recent applications of the 3D TDHF + BCS (TDHF+BCS) model introduced in [4] will be presented. The role of super-fluidity on collective motion [6, 7], on one- and two-particle transfer [8] and on fission [9, 10] will be illustrated.

  7. C. Y. Chao, Pair Creation and Pair Annihilation

    NASA Astrophysics Data System (ADS)

    Li, Bing An; Yang, C. N.

    C. Y. Chao's contribution to physicists' acceptance of QED in 1933-1934 through his experiments of 1930 is analyzed. It is pointed out that Blackett and Occhialini's key suggestion of 1933 about hole theory was based on identifying Chao's "additional scattered rays" (1930) as due to pair annihilation.

  8. C. Y. Chao, Pair Creation and Pair Annihilation

    NASA Astrophysics Data System (ADS)

    Li, Bing An; Yang, C. N.

    2013-05-01

    C. Y. Chao's contribution to physicists' acceptance of QED in 1933-1934 through his experiments of 1930 is analyzed. It is pointed out that Blackett and Occhialini's key suggestion of 1933 about hole theory was based on identifying Chao's "additional scattered rays" (1930) as due to pair annihilation.

  9. Invisibly Sanitizable Signature without Pairings

    NASA Astrophysics Data System (ADS)

    Yum, Dae Hyun; Lee, Pil Joong

    Sanitizable signatures allow sanitizers to delete some pre-determined parts of a signed document without invalidating the signature. While ordinary sanitizable signatures allow verifiers to know how many subdocuments have been sanitized, invisibly sanitizable signatures do not leave any clue to the sanitized subdocuments; verifiers do not know whether or not sanitizing has been performed. Previous invisibly sanitizable signature scheme was constructed based on aggregate signature with pairings. In this article, we present the first invisibly sanitizable signature without using pairings. Our proposed scheme is secure under the RSA assumption.

  10. Nucleon pairing in Sn isotopes

    NASA Astrophysics Data System (ADS)

    Imasheva, L.; Ishkhanov, B.; Stepanov, M.; Tretyakova, T.

    2016-01-01

    The systematics of excited states in Sn isotopes are discussed on basis of pairing interaction in nuclei. Nucleon paring leads to formation of excited states multiplets. The estimation of multiplet splitting based on experimental nuclear masses allows one to calculate the position of excited states with different seniority in δ-approximation. The wide systematics of the spectra of Sn isotopes gives a possibility to check the pairing interaction for different subshells and consider the multiplets of excited states in the neutron-rich isotopes far from stability.

  11. Orbiting pairs of walking droplets

    NASA Astrophysics Data System (ADS)

    Siefert, Emmanuel; Bush, John W. M.; Oza, Anand

    2015-11-01

    Droplets may self-propel on the surface of a vibrating fluid bath, pushed forward by their own Faraday pilot-wave field. We present the results of a combined experimental and theoretical investigation of the interaction of pairs of such droplets. Particular attention is given to characterizing the system's dependence on the vibrational forcing of the bath and the impact parameter of the walking droplets. Observed criteria for the capture and stability of orbital pairs are rationalized by accompanying theoretical developments. Thanks to the NSF.

  12. Genetic diversity and variability in populations of the white wax insect Ericerus pela, assessed by AFLP analysis.

    PubMed

    Chen, H; He, R; Wang, Z L; Wang, S Y; Chen, Y; Zhu, Z C; Chen, X M

    2015-01-01

    The white wax insect Ericerus pela Chavannes (Hemiptera: Coccoidea) is an economically valuable insect species that has been used for over a thousand years in China. The present study focuses on assessing the genetic variability in different populations of E. pela collected from seven Chinese provinces. The amplified fragment length polymorphism technique was used to generate DNA fingerprints of individuals from each population using nine primer combinations (EcoRI-MseI). A total of 435 polymorphic loci were generated; fragment sizes ranged from 200 to 1000 bp. The percentage of polymorphic loci was 85.29%. Nei's genetic diversity and Shannon index indicated consistency in the results, which showed that the Sichuan population had the highest diversity, followed by Yunnan and Zhejiang populations. Dendrogram analysis showed the shortest genetic distance between the Sichuan and Yunnan populations, suggesting that they probably form sister groups. High genetic differentiation between population values among all sampled populations indicated a low degree of genetic variability within each population (40.85%) and higher variation among populations (59.15%). Gene flow estimate values were low in all samples, suggesting low gene flow from events such as interbreeding and migration. Low gene flow values also suggested that populations among species of E. pela might become genetically heterogeneous, due to counteracting forces such as strong differential selection. Our data support the probability that E. pela will remain localized, and has a low potential to spread beyond current habitats. PMID:26782427

  13. Missing energies at pair creation

    NASA Technical Reports Server (NTRS)

    El-Ela, A. A.; Bagge, E. R.; Hassan, S.

    1985-01-01

    Wilson cloud chamber measurements of the separated spectra of positrons and electrons produced by gamma quanta of 6.14 MeV differ considerably from the theoretically predicted spectra by BETHE and HEITLER, but are in good agreement with those of a modified theory of pair creation.

  14. Pairing Linguistic and Music Intelligences

    ERIC Educational Resources Information Center

    DiEdwardo, MaryAnn Pasda

    2005-01-01

    This article describes how music in the language classroom setting can be a catalyst for developing reading, writing, and understanding skills. Studies suggest that pairing music and linguistic intelligences in the college classroom improves students' grades and abilities to compose theses statements for research papers in courses that emphasize…

  15. Pick a Pair. Being Bony

    ERIC Educational Resources Information Center

    Miller, Pat

    2004-01-01

    This column suggests pairings of fiction and nonfiction books to meet curricular needs and help students to compare/contrast the texts as they may be asked on state tests. The author of this paper focuses on activities surrounding Halloween. Since many schools are discouraged from teaching about Halloween, this can be a great time to investigate…

  16. Paired Reading: Psycholinguistics in Practice.

    ERIC Educational Resources Information Center

    Barrett, James Martin

    1987-01-01

    Contends that children need to learn phonic skills, not necessarily through early direct teaching, but through reading experience. Suggests using Paired Reading, which is validated by psycholinguistic reading theory and provides opportunities to learn to read from context and use innate syntactic and semantic knowledge. (SKC)

  17. Robust Detection of Rare Species Using Environmental DNA: The Importance of Primer Specificity

    PubMed Central

    Wilcox, Taylor M.; McKelvey, Kevin S.; Young, Michael K.; Jane, Stephen F.; Lowe, Winsor H.; Whiteley, Andrew R.; Schwartz, Michael K.

    2013-01-01

    Environmental DNA (eDNA) is being rapidly adopted as a tool to detect rare animals. Quantitative PCR (qPCR) using probe-based chemistries may represent a particularly powerful tool because of the method’s sensitivity, specificity, and potential to quantify target DNA. However, there has been little work understanding the performance of these assays in the presence of closely related, sympatric taxa. If related species cause any cross-amplification or interference, false positives and negatives may be generated. These errors can be disastrous if false positives lead to overestimate the abundance of an endangered species or if false negatives prevent detection of an invasive species. In this study we test factors that influence the specificity and sensitivity of TaqMan MGB assays using co-occurring, closely related brook trout (Salvelinus fontinalis) and bull trout (S. confluentus) as a case study. We found qPCR to be substantially more sensitive than traditional PCR, with a high probability of detection at concentrations as low as 0.5 target copies/µl. We also found that number and placement of base pair mismatches between the Taqman MGB assay and non-target templates was important to target specificity, and that specificity was most influenced by base pair mismatches in the primers, rather than in the probe. We found that insufficient specificity can result in both false positive and false negative results, particularly in the presence of abundant related species. Our results highlight the utility of qPCR as a highly sensitive eDNA tool, and underscore the importance of careful assay design. PMID:23555689

  18. Robust detection of rare species using environmental DNA: the importance of primer specificity.

    PubMed

    Wilcox, Taylor M; McKelvey, Kevin S; Young, Michael K; Jane, Stephen F; Lowe, Winsor H; Whiteley, Andrew R; Schwartz, Michael K

    2013-01-01

    Environmental DNA (eDNA) is being rapidly adopted as a tool to detect rare animals. Quantitative PCR (qPCR) using probe-based chemistries may represent a particularly powerful tool because of the method's sensitivity, specificity, and potential to quantify target DNA. However, there has been little work understanding the performance of these assays in the presence of closely related, sympatric taxa. If related species cause any cross-amplification or interference, false positives and negatives may be generated. These errors can be disastrous if false positives lead to overestimate the abundance of an endangered species or if false negatives prevent detection of an invasive species. In this study we test factors that influence the specificity and sensitivity of TaqMan MGB assays using co-occurring, closely related brook trout (Salvelinus fontinalis) and bull trout (S. confluentus) as a case study. We found qPCR to be substantially more sensitive than traditional PCR, with a high probability of detection at concentrations as low as 0.5 target copies/µl. We also found that number and placement of base pair mismatches between the Taqman MGB assay and non-target templates was important to target specificity, and that specificity was most influenced by base pair mismatches in the primers, rather than in the probe. We found that insufficient specificity can result in both false positive and false negative results, particularly in the presence of abundant related species. Our results highlight the utility of qPCR as a highly sensitive eDNA tool, and underscore the importance of careful assay design. PMID:23555689

  19. Sliding over the Blocks in Enzyme-Free RNA Copying – One-Pot Primer Extension in Ice

    PubMed Central

    Löffler, Philipp M. G.; Groen, Joost; Dörr, Mark; Monnard, Pierre-Alain

    2013-01-01

    Template-directed polymerization of RNA in the absence of enzymes is the basis for an information transfer in the ‘RNA-world’ hypothesis and in novel nucleic acid based technology. Previous investigations established that only cytidine rich strands are efficient templates in bulk aqueous solutions while a few specific sequences completely block the extension of hybridized primers. We show that a eutectic water/ice system can support Pb2+/Mg2+-ion catalyzed extension of a primer across such sequences, i.e. AA, AU and AG, in a one-pot synthesis. Using mixtures of imidazole activated nucleotide 5′-monophosphates, the two first “blocking” residues could be passed during template-directed polymerization, i.e., formation of triply extended products containing a high fraction of faithful copies was demonstrated. Across the AG sequence, a mismatch sequence was formed in similar amounts to the correct product due to U·G wobble pairing. Thus, the template-directed extension occurs both across pyrimidine and purine rich sequences and insertions of pyrimidines did not inhibit the subsequent insertions. Products were mainly formed with 2′-5′-phosphodiester linkages, however, the abundance of 3′–5′-linkages was higher than previously reported for pyrimidine insertions. When enzyme-free, template-directed RNA polymerization is performed in a eutectic water ice environment, various intrinsic reaction limitations observed in bulk solution can then be overcome. PMID:24058695

  20. DNA barcode based wildlife forensics for resolving the origin of claw samples using a novel primer cocktail.

    PubMed

    Khedkar, Gulab D; Abhayankar, Shil Bapurao; Nalage, Dinesh; Ahmed, Shaikh Nadeem; Khedkar, Chandraprakash D

    2014-12-10

    Abstract Excessive wildlife hunting for commercial purposes can have negative impacts on biodiversity and may result in species extinction. To ensure compliance with legal statutes, forensic identification approaches relying on molecular markers may be used to identify the species of origin of animal material from hairs, claw, blood, bone, or meat. Using this approach, DNA sequences from the COI "barcoding" gene have been used to identify material from a number of domesticated animal species. However, many wild species of carnivores still present great challenges in generating COI barcodes using standard "universal" primer pairs. In the work presented here, the mitochondrial COI gene was successfully amplified using a novel primer cocktail, and the products were sequenced to determine the species of twenty one unknown samples of claw material collected as part of forensic wildlife case investigations. Sixteen of the unknown samples were recognized to have originated from either Panthera leo or P. pardus individuals. The remaining five samples could be identified only to the family level due to the absence of reference animal sequences. This is the first report on the use of COI sequences for the identification of P. pardus and P. leo from claw samples as part of forensic investigations in India. The study also highlights the need for adequate reference material to aid in the resolution of suspected cases of illegal wildlife harvesting. PMID:25492536

  1. Relatedness of Indian flax genotypes (Linum usitatissimum L.): an inter-simple sequence repeat (ISSR) primer assay.

    PubMed

    Rajwade, Ashwini V; Arora, Ritu S; Kadoo, Narendra Y; Harsulkar, Abhay M; Ghorpade, Prakash B; Gupta, Vidya S

    2010-06-01

    The objective of this study was to analyze the genetic relationships, using PCR-based ISSR markers, among 70 Indian flax (Linum usitatissimum L.) genotypes actively utilized in flax breeding programs. Twelve ISSR primers were used for the analysis yielding 136 loci, of which 87 were polymorphic. The average number of amplified loci and the average number of polymorphic loci per primer were 11.3 and 7.25, respectively, while the percent loci polymorphism ranged from 11.1 to 81.8 with an average of 63.9 across all the genotypes. The range of polymorphism information content scores was 0.03-0.49, with an average of 0.18. A dendrogram was generated based on the similarity matrix by the Unweighted Pair Group Method with Arithmetic Mean (UPGMA), wherein the flax genotypes were grouped in five clusters. The Jaccard's similarity coefficient among the genotypes ranged from 0.60 to 0.97. When the omega-3 alpha linolenic acid (ALA) contents of the individual genotypes were correlated with the clusters in the dendrogram, the high ALA containing genotypes were grouped in two clusters. This study identified SLS 50, Ayogi, and Sheetal to be the most diverse genotypes and suggested their use in breeding programs and for developing mapping populations. PMID:20195799

  2. Identification of Mycobacterium bovis in bovine clinical samples by PCR species-specific primers.

    PubMed Central

    Romero, R E; Garzón, D L; Mejía, G A; Monroy, W; Patarroyo, M E; Murillo, L A

    1999-01-01

    Tuberculosis, caused by Mycobacterium bovis is emerging as the most important disease affecting cattle. Furthermore, it results in a major public health problem when transmitted to humans. Due to its difficult and non-specific diagnosis, M. bovis has been declared to be one of the etiologic agents causing significant economic loss in the cattle industry. Our group evaluated a more rapid and specific method, based on a new polymerase chain reaction species-specific primers, which amplifies a 470-base pair fragment of the M. bovis genome. A total of 275 milk-producing cows were studied by intradermal tuberculin test (ITT) which gave 184 positive and 91 negative cases. From them, 50 animals were taken from a cattle ranch free of tuberculosis. Three different samples were collected from each animal (blood, nasal mucus, and milk). Positive results were obtained from 26 animals by PCR (11.4%), 1 by bacteriological culturing (0.4%) and 1 by bacilloscopy (0.4%). This finding suggests, as in previous reports, that ITT, normally used for bovine tuberculosis detection, has the inconvenience of having a broad range of specificity and sensitivity, and the PCR technique is a more specific and sensitive test to detect infection associated with M. bovis. Therefore, we propose this PCR assay as a useful tool in the epidemiological characterization of infected animals in areas considered to be at high risk of transmission. Images Figure 1. PMID:10369566

  3. Rapid identification of Zygosaccharomyces with genus-specific primers.

    PubMed

    Hulin, Michelle; Wheals, Alan

    2014-03-01

    There has been a recent and rapid increase in the number of species of the genus Zygosaccharomyces which now comprises Z. bailii, Z. bisporus, Z. gambellarensis, Z. kombuchaensis, Z. lentus, Z. machadoi, Z. mellis, Z. parabaillii, Z. pseudobailii, Z. pseudorouxii, Z. rouxii, Z. sapae, and Z. siamensis. Z. pseudorouxii is an unofficial name given to isolates closely related to the newly-described species Z. sapae. The Zygosaccharomyces genus contains species that are important as food and beverage spoilage organisms and others are associated with fermentations and sweet foodstuffs, such as honey. Their economic significance means that the ability to identify them rapidly is of significant importance. Although Z. rouxii and Z. bailii have been genome-sequenced the extent of sequence data for the others, especially the newly-discovered species, is sometimes extremely limited which makes identification slow. However, parts of the ITS1/5.8S/ITS2 rDNA region contain sequences of sufficient similarity within the genus and of sufficient difference with outgroups, to be potential regions for the design of genus-wide specific primers. We report here the development of genus-specific primers that can detect all the major Zygosaccharomyces species including all those associated with foods; the rare and localised species Z. machadoi and Z. gambellarensis are not detected. The size of the single amplicon produced varies between species and in some cases is sufficiently different to assign provisional species identification. Sequence data from rDNA regions are available for virtually all described yeast species in all genera, thus, prior to having sufficient sequence data from structural genes, rDNA regions may provide more generally suitable candidates for both genus-specific and species-specific primer design. PMID:24382328

  4. Environmental DNA sequencing primers for eutardigrades and bdelloid rotifers

    PubMed Central

    2009-01-01

    Background The time it takes to isolate individuals from environmental samples and then extract DNA from each individual is one of the problems with generating molecular data from meiofauna such as eutardigrades and bdelloid rotifers. The lack of consistent morphological information and the extreme abundance of these classes makes morphological identification of rare, or even common cryptic taxa a large and unwieldy task. This limits the ability to perform large-scale surveys of the diversity of these organisms. Here we demonstrate a culture-independent molecular survey approach that enables the generation of large amounts of eutardigrade and bdelloid rotifer sequence data directly from soil. Our PCR primers, specific to the 18s small-subunit rRNA gene, were developed for both eutardigrades and bdelloid rotifers. Results The developed primers successfully amplified DNA of their target organism from various soil DNA extracts. This was confirmed by both the BLAST similarity searches and phylogenetic analyses. Tardigrades showed much better phylogenetic resolution than bdelloids. Both groups of organisms exhibited varying levels of endemism. Conclusion The development of clade-specific primers for characterizing eutardigrades and bdelloid rotifers from environmental samples should greatly increase our ability to characterize the composition of these taxa in environmental samples. Environmental sequencing as shown here differs from other molecular survey methods in that there is no need to pre-isolate the organisms of interest from soil in order to amplify their DNA. The DNA sequences obtained from methods that do not require culturing can be identified post-hoc and placed phylogenetically as additional closely related sequences are obtained from morphologically identified conspecifics. Our non-cultured environmental sequence based approach will be able to provide a rapid and large-scale screening of the presence, absence and diversity of Bdelloidea and Eutardigrada in

  5. Design and in vitro evaluation of new rpoB-DGGE primers for ruminants.

    PubMed

    Perumbakkam, Sudeep; Craig, A Morrie

    2011-04-01

    Two new primer sets based on the rpoB gene were designed and evaluated with bovine and ovine rumen samples. The newly developed rpoB-DGGE primer set was used along with the 16S rRNA gene-V3, and another (old) rpoB-DGGE-based primer set from a previous study to in vitro compare the bovine and ovine rumen ecosystems. The results indicate a significant (P<0.001) difference in the microbial population between the two ruminants irrespective of the primers used in the analysis. Qualitative comparison of the data provides evidence for the presence of similar phyla profiles between the 16S rRNA gene and the newly developed rpoB primers. A comparison between the two rpoB-based primer sets (old and new) showed that the old rpoB-based primers failed to amplify phylum Bacteroidetes (a common phylum in the rumen) in both bovine and ovine rumen samples. The old and new rpoB-DGGE-based primers amplified a large number of clones belonging to phylum Proteobacteria, providing a useful insight into the microbial structure of the rumen. ChaoI, ACE, Simpson, and Shannon-Weaver index analysis estimated the bovine rumen to be more diverse than the ovine rumen for all three primer sets. These results provide a new insight into the community structure among ruminants using the newly developed primers in this study. PMID:21223335

  6. Fluorescence energy transfer dye-labeled primers for DNA sequencing and analysis

    SciTech Connect

    Ju, J.; Glazer, A.N.; Mathies, R.A.; Ruan, C.; Fuller, C.W.

    1995-05-09

    Fluorescent dye-labeled DNA primers have been developed that exploit fluorescence energy transfer (ET) to optimize the absorption and emission properties of the label. These primers carry a fluorescein derivative at the 5{prime} end as a common donor and other fluorescein and rhodamine derivatives attached to a modified thymidine residue within the primer sequence as acceptors. Adjustment of the donor-acceptor spacing through the placement of the modified thymidine residue within the primer sequence as acceptors. Adjustment of the donor-acceptor spacing through the placement of the modified thymidine in the primer sequence allowed generation of four primers, all having strong absorption at a common excitation wavelength (488 nm) and fluorescence emission maxima of 525,555,580, and 605 nm. The ET efficiency of these primers ranges from 65% to 97%, and they exhibit similar electrophoretic mobilities by gel electrophoresis. With argon-ion laser excitation, the fluorescence of the ET primers and of the DNA sequencing fragments generated with ET primers is 2- to 6-fold greater than that of the corresponding primers or fragments labeled with single dyes. The higher fluorescence intensity of the ET primers allows DNA sequencing with one-fourth of the DNA template typically required when using T7 DNA polymerase. With single-stranded M13mp18 DNA as the template, a typical sequencing reaction with ET primers on a commercial sequencer provided DNA sequences with 99.8% accuracy in the first 500 bases. ET primers should be generally useful in the development of other multiplex DNA sequencing and analysis methods. 29 refs., 5 figs.

  7. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    SciTech Connect

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  8. A primer on liquid hydrocarbon storage in salt formations

    SciTech Connect

    Halfast, T.G.

    1996-09-01

    Storage caverns leached in both domal and bedded salt formations have been an economical, safe and environmentally sound method of storing large quantities of liquid hydrocarbons since the late 1940`s and today these formations are utilized throughout the world to store many different liquid hydrocarbons. This paper addresses some of the many factors that should be considered in the design and operation of a liquid hydrocarbon storage well. For anyone interested in a more thorough primer the author recommends obtaining copies of either API-RP-1114, Titled ``Leached Underground Storage Design`` or API-RP-1115, Titled ``Operation of Solution Mined Storage.``

  9. The Primer for Sports Medicine Professionals on Imaging

    PubMed Central

    Farshad-Amacker, Nadja A.; Jain Palrecha, Sapna; Farshad, Mazda

    2013-01-01

    Because of its inherent superior soft tissue contrast and lack of ionizing radiation, magnetic resonance imaging (MRI) is highly suited to study the complex anatomy of the shoulder joint, particularly when assessing the relatively high incidence of shoulder injuries in young, athletic patients. This review aims to serve as a primer for understanding shoulder MRI in an algorithmical approach, including MRI protocol and technique, normal anatomy and anatomical variations of the shoulder, pathologic conditions of the rotator cuff tendons and muscles, the long head of the biceps tendon, shoulder impingement, labral and glenohumeral ligament pathology, MR findings in shoulder instability, adhesive capsulitis, and osteoarthritis. PMID:24381700

  10. Steel Primer Chamber Assemblies for Dual Initiated Pyrovalves

    NASA Technical Reports Server (NTRS)

    Guemsey, Carl S.; Mizukami, Masashi; Zenz, Zac; Pender, Adam A.

    2009-01-01

    A solution was developed to mitigate the potential risk of ignition failures and burn-through in aluminum primer chamber assemblies on pyrovalves. This was accomplished by changing the assembly material from aluminum to steel, and reconfiguration of flame channels to provide more direct paths from initiators to boosters. With the geometric configuration of the channels changed, energy is more efficiently transferred from the initiators to the boosters. With the alloy change to steel, the initiator flame channels do not erode upon firing, eliminating the possibility of burn-through. Flight qualification tests have been successfully passed.

  11. The primer for sports medicine professionals on imaging: the shoulder.

    PubMed

    Farshad-Amacker, Nadja A; Jain Palrecha, Sapna; Farshad, Mazda

    2013-01-01

    Because of its inherent superior soft tissue contrast and lack of ionizing radiation, magnetic resonance imaging (MRI) is highly suited to study the complex anatomy of the shoulder joint, particularly when assessing the relatively high incidence of shoulder injuries in young, athletic patients. This review aims to serve as a primer for understanding shoulder MRI in an algorithmical approach, including MRI protocol and technique, normal anatomy and anatomical variations of the shoulder, pathologic conditions of the rotator cuff tendons and muscles, the long head of the biceps tendon, shoulder impingement, labral and glenohumeral ligament pathology, MR findings in shoulder instability, adhesive capsulitis, and osteoarthritis. PMID:24381700

  12. A NASTRAN primer for the analysis of rotating flexible blades

    NASA Technical Reports Server (NTRS)

    Lawrence, Charles; Aiello, Robert A.; Ernst, Michael A.; Mcgee, Oliver G.

    1987-01-01

    This primer provides documentation for using MSC NASTRAN in analyzing rotating flexible blades. The analysis of these blades includes geometrically nonlinear (large displacement) analysis under centrifugal loading, and frequency and mode shape (normal modes) determination. The geometrically nonlinear analysis using NASTRAN Solution sequence 64 is discussed along with the determination of frequencies and mode shapes using Solution Sequence 63. A sample problem with the complete NASTRAN input data is included. Items unique to rotating blade analyses, such as setting angle and centrifugal softening effects are emphasized.

  13. Distinct colonization patterns and cDNA-AFLP transcriptome profiles in compatible and incompatible interactions between melon and different races of Fusarium oxysporum f. sp. melonis

    PubMed Central

    2011-01-01

    Background Fusarium oxysporum f. sp. melonis Snyd. & Hans. (FOM) causes Fusarium wilt, the most important infectious disease of melon (Cucumis melo L.). The four known races of this pathogen can be distinguished only by infection on appropriate cultivars. No molecular tools are available that can discriminate among the races, and the molecular basis of compatibility and disease progression are poorly understood. Resistance to races 1 and 2 is controlled by a single dominant gene, whereas only partial polygenic resistance to race 1,2 has been described. We carried out a large-scale cDNA-AFLP analysis to identify host genes potentially related to resistance and susceptibility as well as fungal genes associated with the infection process. At the same time, a systematic reisolation procedure on infected stems allowed us to monitor fungal colonization in compatible and incompatible host-pathogen combinations. Results Melon plants (cv. Charentais Fom-2), which are susceptible to race 1,2 and resistant to race 1, were artificially infected with a race 1 strain of FOM or one of two race 1,2 w strains. Host colonization of stems was assessed at 1, 2, 4, 8, 14, 16, 18 and 21 days post inoculation (dpi), and the fungus was reisolated from infected plants. Markedly different colonization patterns were observed in compatible and incompatible host-pathogen combinations. Five time points from the symptomless early stage (2 dpi) to obvious wilting symptoms (21 dpi) were considered for cDNA-AFLP analysis. After successful sequencing of 627 transcript-derived fragments (TDFs) differentially expressed in infected plants, homology searching retrieved 305 melon transcripts, 195 FOM transcripts expressed in planta and 127 orphan TDFs. RNA samples from FOM colonies of the three strains grown in vitro were also included in the analysis to facilitate the detection of in planta-specific transcripts and to identify TDFs differentially expressed among races/strains. Conclusion Our data

  14. Somatic Embryogenesis in Peach Palm Using the Thin Cell Layer Technique: Induction, Morpho-histological Aspects and AFLP Analysis of Somaclonal Variation

    PubMed Central

    Steinmacher, D. A.; Krohn, N. G.; Dantas, A. C. M.; Stefenon, V. M.; Clement, C. R.; Guerra, M. P.

    2007-01-01

    Background and Aims The thin cell layer (TCL) technique is based on the use of very small explants and has allowed enhanced in vitro morphogenesis in several plant species. The present study evaluated the TCL technique as a procedure for somatic embryo production and plantlet regeneration of peach palm. Methods TCL explants from different positions in the shoot apex and leaf sheath of peach palm were cultivated in MS culture medium supplemented with 0–600 µm Picloram in the presence of activated charcoal. The production of primary calli and embryogenic calli was evaluated in these different conditions. Histological and amplified fragment length polymorphism (AFLP) analyses were conducted to study in vitro morphogenetic responses and genetic stability, respectively, of the regenerated plantlets. Key Results Abundant primary callus induction was observed from TCLs of the shoot meristem in culture media supplemented with 150–600 µm Picloram (83–97 %, respectively). The production of embryogenic calli depends on Picloram concentration and explant position. The best response observed was 43 % embryogenic callus production from shoot meristem TCL on 300 µm Picloram. In maturation conditions, 34 ± 4 somatic embryos per embryogenic callus were obtained, and 45·0 ± 3·4 % of these fully developed somatic embryos were converted, resulting in plantlets ready for acclimatization, of which 80 % survived. Histological studies revealed that the first cellular division events occurred in cells adjacent to vascular tissue, resulting in primary calli, whose growth was ensured by a meristematic zone. A multicellular origin of the resulting somatic embryos arising from the meristematic zone is suggested. During maturation, histological analyses revealed bipolarization of the somatic embryos, as well as the development of new somatic embryos. AFLP analyses revealed that 92 % of the regenerated plantlets were true to type. The use of TCL explants considerably improves the

  15. The unstable 'clone': evidence from monitoring AFLP-based mutations for short-term clonal genetic variation in two asexual lineages of the grain aphid, Sitobion avenae (F.).

    PubMed

    Loxdale, H D; Vorwerk, S; Forneck, A

    2013-02-01

    Clones have been in the forefront of biological interest for many years. Even so, open discussions continue to surround the concept of clonality, which has been recently much debated in the scientific literature, both in terms of philosophical meaning as well as empirical determination. Philosophically, the clone is the horizontally produced lineage from a single fertlized egg (e.g. mammals by division of the fertilized egg and representing a single generation) or vertically produced offspring (e.g. aphids representing different successive generations) from a single asexual stem mother (originally for a particular lineage, following hatching of the overwintering sexual egg in the spring); empirically, the aspect of genetic fidelity is also considered important, so-called clones being assumed to have an identical genome among clone mates. In reality of course, such members of a clonal lineage must differ at various regions of the genome, since mutation is a fundamental property of the DNA itself. Yet few studies have so far set out to show this empirically in eukaryotic organisms, which indulge in periods of asexual reproduction, sometimes, as in aphids, over many generations. In the present study, we have investigated asexual lineages of the grain aphid, Sitobion avenae (F.), a global pest of cereals, over five successive generations employing AFLP-PCR molecular techniques. Our main interest was to see how much variation was present in the early generations and if this variation was transmitted through the asexual lineages. By monitoring AFLP-based polymorphisms, we show that, in this aphid species, of a total of 110 individuals from two lineages tested (termed SA and SB), random mutations (band deletions, more rarely additions) were apparent from the third generation onwards, and although some mutations were found to be transmitted transgenerationally, others were rarely transmitted through the particular lineages they were detected in. Using Arlequin v. 2

  16. New Primers for Discovering Fungal Diversity Using Nuclear Large Ribosomal DNA

    PubMed Central

    Gloor, Gregory B.; Lindo, Zoë

    2016-01-01

    Metabarcoding has become an important tool in the discovery of biodiversity, including fungi, which are the second most speciose group of eukaryotes, with diverse and important ecological roles in terrestrial ecosystems. We have designed and tested new PCR primers that target the D1 variable region of nuclear large subunit (LSU) ribosomal DNA; one set that targets the phylum Ascomycota and another that recovers all other fungal phyla. The primers yield amplicons compatible with the Illumina MiSeq platform, which is cost-effective and has a lower error rate than other high throughput sequencing platforms. The new primer set LSU200A-F/LSU476A-R (Ascomycota) yielded 95–98% of reads of target taxa from environmental samples, and primers LSU200-F/LSU481-R (all other fungi) yielded 72–80% of target reads. Both primer sets have fairly low rates of data loss, and together they cover a wide variety of fungal taxa. We compared our results with these primers by amplifying and sequencing a subset of samples using the previously described ITS3_KYO2/ITS4_KYO3 primers, which amplify the internal transcribed spacer 2 (ITS2) of Ascomycota and Basidiomycota. With approximately equivalent read depth, our LSU primers recovered a greater number and phylogenetic diversity of sequences than the ITS2 primers. For instance, ITS3_KYO2/ITS4_KYO3 primers failed to pick up any members of Eurotiales, Mytilinidiales, Pezizales, Saccharomycetales, or Venturiales within Ascomycota, or members of Exobasidiomycetes, Microbotryomycetes, Pucciniomycetes, or Tremellomycetes within Basidiomycota, which were retrieved in good numbers from the same samples by our LSU primers. Among the OTUs recovered using the LSU primers were 127 genera and 28 species that were not obtained using the ITS2 primers, although the ITS2 primers recovered 10 unique genera and 16 species that were not obtained using either of the LSU primers These features identify the new primer sets developed in this study as useful

  17. FullSSR: Microsatellite Finder and Primer Designer

    PubMed Central

    Metz, Sebastián; Cabrera, Juan Manuel; Rueda, Eva; Giri, Federico; Amavet, Patricia

    2016-01-01

    Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR) loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user. PMID:27366148

  18. Primer for evaluating ecological risk at petroleum release sites.

    PubMed

    Claff, R

    1999-02-01

    Increasingly, risk-based approaches are being used to guide decision making at sites such as service stations and petroleum product terminals, where petroleum products have been inadvertently released to the soil. For example, the API Decision Support System software, DSS, evaluates site human health risk along six different routes of exposure. The American Society for Testing and Materials' Risk-Based Corrective Action (RBCA) standard, ASTM 1739, establishes a tiered framework for evaluating petroleum release sites on the basis of human health risk. Though much of the risk assessment focus has been on human health risk, regulatory agencies recognize that protection of human health may not fully protect the environment; and EPA has developed guidance on identifying ecological resources to be protected through risk-based decision making. Not every service station or petroleum product terminal site warrants a detailed ecological risk assessment. In some cases, a simple preliminary assessment will provide sufficient information for decision making. Accordingly, the American Petroleum Institute (API) is developing a primer for site managers, to assist them in conducting this preliminary assessment, and in deciding whether more detailed ecological risk assessments are warranted. The primer assists the site manager in identifying relevant ecological receptors and habitats, in identifying chemicals and exposure pathways of concern, in developing a conceptual model of the site to guide subsequent actions, and in identifying conditions that may warrant immediate response. PMID:10189585

  19. FullSSR: Microsatellite Finder and Primer Designer.

    PubMed

    Metz, Sebastián; Cabrera, Juan Manuel; Rueda, Eva; Giri, Federico; Amavet, Patricia

    2016-01-01

    Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR) loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user. PMID:27366148

  20. Development of a unique polyurethane primer/topcoat

    NASA Technical Reports Server (NTRS)

    Novak, Howard L.; Klotz, James M.

    1994-01-01

    USBI Company, a Division of Pratt & Whitney Government Engines and Space Propulsion, is involved in corrosion and environmental research and development activities both at their headquarters in Huntsville, Alabama and their Florida Operations at Kennedy Space Center, Florida. The programs involve the development of environmentally compatible materials that improve the corrosion protection of expensive Solid Rocket Boosters (SRB) that are part of the Space Shuttle systems developed and managed by Marshall Space Flight Center in Huntsville, Alabama. Coatings For Industry, a paint manufacturer in Souderton, PA helped formulate and produce the first lot of BOOSTERCOAT paint. High strength aluminum aerospace flight hardware exposed to harsh seacoast environments and seawater immersion presently uses high volatile organic compound (VOC) chromated and lead bearing primers and epoxy topcoats for corrosion protection. Epoxy paint tends to be brittle and has relatively low ultraviolet (UV) exposure resistance. A unique, environmentally compatible, non-leaded/non-chromated, low VOC polyurethane single coat (primer/topcoat) trade named BOOSTERCOAT has been developed for excellent corrosion protection, flexibility, adhesion, chemical and solvent resistance properties. This report will discuss the development of BOOSTERCOAT and the potential opportunities for commercial use in the energy, transportation, chemical, maritime, structural fields.