Science.gov

Sample records for aflp primer pairs

  1. Marker production by PCR amplification with primer pairs from conserved sequences of WRKY genes in chili pepper.

    PubMed

    Kim, Hyoun-Joung; Lee, Heung-Ryul; Han, Jung-Heon; Yeom, Seon-In; Harn, Chee-Hark; Kim, Byung-Dong

    2008-04-30

    Despite increasing awareness of the importance of WRKY genes in plant defense signaling, the locations of these genes in the Capsicum genome have not been established. To develop WRKY-based markers, primer sequences were deduced from the conserved sequences of the DNA binding motif within the WRKY domains of tomato and pepper genes. These primers were derived from upstream and downstream parts of the conserved sequences of the three WRKY groups. Six primer combinations of each WRKY group were tested for polymorphisms between the mapping parents, C. annuum 'CM334' and C. annuum 'Chilsungcho'. DNA fragments amplified by primer pairs deduced from WRKY Group II genes revealed high levels of polymorphism. Using 32 primer pairs to amplify upstream and downstream parts of the WRKY domain of WRKY group II genes, 60 polymorphic bands were detected. Polymorphisms were not detected with primer pairs from downstream parts of WRKY group II genes. Half of these primers were subjected to F2 genotyping to construct a linkage map. Thirty of 41 markers were located evenly spaced on 20 of the 28 linkage groups, without clustering. This linkage map also consisted of 199 AFLP and 26 SSR markers. This WRKY-based marker system is a rapid and simple method for generating sequence-specific markers for plant gene families.

  2. AFLP variation in 25 Avena species.

    PubMed

    Fu, Yong-Bi; Williams, David J

    2008-08-01

    Current molecular characterization of ex situ plant germplasm has placed more emphasis on cultivated gene pools and less on exotic gene pools representing wild relative species. This study attempted to characterize a selected set of germplasm accessions representing various Avena species with the hope to establish a reference set of exotic oat germplasm for oat breeding and research. The amplified fragment length polymorphism (AFLP) technique was applied to screen 163 accessions of 25 Avena species with diverse geographic origins. For each accession, 413 AFLP polymorphic bands detected by five AFLP primer pairs were scored. The frequencies of polymorphic bands ranged from 0.006 to 0.994 and averaged 0.468. Analysis of molecular variance revealed 59.5% of the total AFLP variation resided among 25 oat species, 45.9% among six assessed sections of the genus, 36.1% among three existing ploidy levels, and 50.8% among eight defined genome types. All the species were clustered together according to their ploidy levels. The C genome diploids appeared to be the most distinct, followed by the Ac genome diploid A. canariensis. The Ac genome seemed to be the oldest in all the A genomes, followed by the As, Al and Ad genomes. The AC genome tetraploids were more related to the ACD genome hexaploids than the AB genome tetraploids. Analysis of AFLP similarity suggested that the AC genome tetraploid A. maroccana was likely derived from the Cp genome diploid A. eriantha and the As genome diploid A. wiestii, and might be the progenitor of the ACD genome hexaploids. These AFLP patterns are significant for our understanding of the evolutionary pathways of Avena species and genomes, for establishing reference sets of exotic oat germplasm, and for exploring new exotic sources of genes for oat improvement.

  3. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.

    PubMed

    Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.

  4. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

    PubMed Central

    Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666

  5. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.

    PubMed

    Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666

  6. Use of AFLP for differentiation of Metschnikowia pulcherrima strains for postharvest disease biological control.

    PubMed

    Spadaro, D; Sabetta, W; Acquadro, A; Portis, E; Garibaldi, A; Gullino, M L

    2008-01-01

    Metschnikowia pulcherrima occurs naturally on fruits, buds and floral parts of apple trees. Some strains are effective as biocontrol agents against postharvest decay of apples and other fruits. The usefulness of the amplified fragment length polymorphism (AFLP) technique was evaluated for the genetic analysis of 26 strains of M. pulcherrima, isolated from different sources in different geographical regions. With six AFLP primer pairs, 729 polymorphic bands were scored. The technique showed a high discriminatory power. Genetic relationships between strains were also estimated using AFLP. All the isolates from the carposphere of apple, previously tested as biocontrol agents, were grouped in a single cluster with a high bootstrap value (97), indicating robustness and reproducibility. AFLP patterns could clearly distinguish the different strains and research is in progress to use some putative specific bands for single tag sequence (STS) conversion to develop isolate-specific markers.

  7. Highly effective sequencing whole chloroplast genomes of angiosperms by nine novel universal primer pairs.

    PubMed

    Yang, Jun-Bo; Li, De-Zhu; Li, Hong-Tao

    2014-09-01

    Chloroplast genomes supply indispensable information that helps improve the phylogenetic resolution and even as organelle-scale barcodes. Next-generation sequencing technologies have helped promote sequencing of complete chloroplast genomes, but compared with the number of angiosperms, relatively few chloroplast genomes have been sequenced. There are two major reasons for the paucity of completely sequenced chloroplast genomes: (i) massive amounts of fresh leaves are needed for chloroplast sequencing and (ii) there are considerable gaps in the sequenced chloroplast genomes of many plants because of the difficulty of isolating high-quality chloroplast DNA, preventing complete chloroplast genomes from being assembled. To overcome these obstacles, all known angiosperm chloroplast genomes available to date were analysed, and then we designed nine universal primer pairs corresponding to the highly conserved regions. Using these primers, angiosperm whole chloroplast genomes can be amplified using long-range PCR and sequenced using next-generation sequencing methods. The primers showed high universality, which was tested using 24 species representing major clades of angiosperms. To validate the functionality of the primers, eight species representing major groups of angiosperms, that is, early-diverging angiosperms, magnoliids, monocots, Saxifragales, fabids, malvids and asterids, were sequenced and assembled their complete chloroplast genomes. In our trials, only 100 mg of fresh leaves was used. The results show that the universal primer set provided an easy, effective and feasible approach for sequencing whole chloroplast genomes in angiosperms. The designed universal primer pairs provide a possibility to accelerate genome-scale data acquisition and will therefore magnify the phylogenetic resolution and species identification in angiosperms.

  8. SP-Designer: a user-friendly program for designing species-specific primer pairs from DNA sequence alignments.

    PubMed

    Villard, Pierre; Malausa, Thibaut

    2013-07-01

    SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php.

  9. Selection of more appropriate PCR primer pairs for improved efficiency in detecting Norwalk-like virus (NLV) RNA.

    PubMed

    Naitou, Hirotaka; Morita, Tamotsu

    2001-10-01

    A pair of primers, NV35 and NV36, and another pair of primers, NV81 and NV82/SM82, are commonly used for polymerase chain reaction (PCR) detection of Norwalk-like virus (NLV) genome RNA sequences in authorized test laboratories in Japan. However, the efficiency of NLV genome RNA detection with these primer pairs has been less than satisfactory. In the present study, we attempted to establish more appropriately matched primer pairs for improved detection of NLV genome RNA sequences using a combination of primers including NV35, NV36, NV81, NV82/SM82, SR33, and SRs (a mixture of 4 primers SR46, SR48, SR50, and SR52). We also evaluated appropriate primers for improved reverse transcription of NLV genome RNA. Stool samples used for detection of NLV included 18 samples collected from NLV-infected patients who ingested oysters (group 1) and 13 samples collected from those who did not ingest oysters (group 2). Reverse transcription of RNA genome with primer NV35 was less efficient compared with that with primer SR33 or NV81. When PCR products obtained with NV35 and NV36 as a pair of primers were subjected to gel electrophoresis, a strong extra band was detected compared with those obtained with other primer pairs. Since this extra band may represent heterodimeric or homodimeric hybrids, or intramolecular hybrids derived from these primers, this template-independent hybridization could lower the efficiency of primer-dependent polymerase reaction. Of 18 primer pairs, a pair of NV81 and SRs provided the best detection of PCR products following reverse transcription of NLV RNA with SR33 or NV81. The detection rate was 61% for both reverse transcription with SR33 and that with NV81. After reverse transcription using SR33 as a primer, nested PCR using a pair of NV81 and SRs following primary PCR using a pair of NV81 and NV82/SM82 increased the detection rate to 89% in group 1 and 100% in group 2.

  10. Evaluation of 16S rRNA Gene Primer Pairs for Monitoring Microbial Community Structures Showed High Reproducibility within and Low Comparability between Datasets Generated with Multiple Archaeal and Bacterial Primer Pairs

    PubMed Central

    Fischer, Martin A.; Güllert, Simon; Neulinger, Sven C.; Streit, Wolfgang R.; Schmitz, Ruth A.

    2016-01-01

    The application of next-generation sequencing technology in microbial community analysis increased our knowledge and understanding of the complexity and diversity of a variety of ecosystems. In contrast to Bacteria, the archaeal domain was often not particularly addressed in the analysis of microbial communities. Consequently, established primers specifically amplifying the archaeal 16S ribosomal gene region are scarce compared to the variety of primers targeting bacterial sequences. In this study, we aimed to validate archaeal primers suitable for high throughput next generation sequencing. Three archaeal 16S primer pairs as well as two bacterial and one general microbial 16S primer pairs were comprehensively tested by in-silico evaluation and performing an experimental analysis of a complex microbial community of a biogas reactor. The results obtained clearly demonstrate that comparability of community profiles established using different primer pairs is difficult. 16S rRNA gene data derived from a shotgun metagenome of the same reactor sample added an additional perspective on the community structure. Furthermore, in-silico evaluation of primers, especially those for amplification of archaeal 16S rRNA gene regions, does not necessarily reflect the results obtained in experimental approaches. In the latter, archaeal primer pair ArchV34 showed the highest similarity to the archaeal community structure compared to observed by the metagenomic approach and thus appears to be the appropriate for analyzing archaeal communities in biogas reactors. However, a disadvantage of this primer pair was its low specificity for the archaeal domain in the experimental application leading to high amounts of bacterial sequences within the dataset. Overall our results indicate a rather limited comparability between community structures investigated and determined using different primer pairs as well as between metagenome and 16S rRNA gene amplicon based community structure analysis

  11. Evaluation of 16S rRNA Gene Primer Pairs for Monitoring Microbial Community Structures Showed High Reproducibility within and Low Comparability between Datasets Generated with Multiple Archaeal and Bacterial Primer Pairs.

    PubMed

    Fischer, Martin A; Güllert, Simon; Neulinger, Sven C; Streit, Wolfgang R; Schmitz, Ruth A

    2016-01-01

    The application of next-generation sequencing technology in microbial community analysis increased our knowledge and understanding of the complexity and diversity of a variety of ecosystems. In contrast to Bacteria, the archaeal domain was often not particularly addressed in the analysis of microbial communities. Consequently, established primers specifically amplifying the archaeal 16S ribosomal gene region are scarce compared to the variety of primers targeting bacterial sequences. In this study, we aimed to validate archaeal primers suitable for high throughput next generation sequencing. Three archaeal 16S primer pairs as well as two bacterial and one general microbial 16S primer pairs were comprehensively tested by in-silico evaluation and performing an experimental analysis of a complex microbial community of a biogas reactor. The results obtained clearly demonstrate that comparability of community profiles established using different primer pairs is difficult. 16S rRNA gene data derived from a shotgun metagenome of the same reactor sample added an additional perspective on the community structure. Furthermore, in-silico evaluation of primers, especially those for amplification of archaeal 16S rRNA gene regions, does not necessarily reflect the results obtained in experimental approaches. In the latter, archaeal primer pair ArchV34 showed the highest similarity to the archaeal community structure compared to observed by the metagenomic approach and thus appears to be the appropriate for analyzing archaeal communities in biogas reactors. However, a disadvantage of this primer pair was its low specificity for the archaeal domain in the experimental application leading to high amounts of bacterial sequences within the dataset. Overall our results indicate a rather limited comparability between community structures investigated and determined using different primer pairs as well as between metagenome and 16S rRNA gene amplicon based community structure analysis

  12. Evaluation of 16S rRNA Gene Primer Pairs for Monitoring Microbial Community Structures Showed High Reproducibility within and Low Comparability between Datasets Generated with Multiple Archaeal and Bacterial Primer Pairs

    PubMed Central

    Fischer, Martin A.; Güllert, Simon; Neulinger, Sven C.; Streit, Wolfgang R.; Schmitz, Ruth A.

    2016-01-01

    The application of next-generation sequencing technology in microbial community analysis increased our knowledge and understanding of the complexity and diversity of a variety of ecosystems. In contrast to Bacteria, the archaeal domain was often not particularly addressed in the analysis of microbial communities. Consequently, established primers specifically amplifying the archaeal 16S ribosomal gene region are scarce compared to the variety of primers targeting bacterial sequences. In this study, we aimed to validate archaeal primers suitable for high throughput next generation sequencing. Three archaeal 16S primer pairs as well as two bacterial and one general microbial 16S primer pairs were comprehensively tested by in-silico evaluation and performing an experimental analysis of a complex microbial community of a biogas reactor. The results obtained clearly demonstrate that comparability of community profiles established using different primer pairs is difficult. 16S rRNA gene data derived from a shotgun metagenome of the same reactor sample added an additional perspective on the community structure. Furthermore, in-silico evaluation of primers, especially those for amplification of archaeal 16S rRNA gene regions, does not necessarily reflect the results obtained in experimental approaches. In the latter, archaeal primer pair ArchV34 showed the highest similarity to the archaeal community structure compared to observed by the metagenomic approach and thus appears to be the appropriate for analyzing archaeal communities in biogas reactors. However, a disadvantage of this primer pair was its low specificity for the archaeal domain in the experimental application leading to high amounts of bacterial sequences within the dataset. Overall our results indicate a rather limited comparability between community structures investigated and determined using different primer pairs as well as between metagenome and 16S rRNA gene amplicon based community structure analysis

  13. Evaluation of 16S rRNA Gene Primer Pairs for Monitoring Microbial Community Structures Showed High Reproducibility within and Low Comparability between Datasets Generated with Multiple Archaeal and Bacterial Primer Pairs.

    PubMed

    Fischer, Martin A; Güllert, Simon; Neulinger, Sven C; Streit, Wolfgang R; Schmitz, Ruth A

    2016-01-01

    The application of next-generation sequencing technology in microbial community analysis increased our knowledge and understanding of the complexity and diversity of a variety of ecosystems. In contrast to Bacteria, the archaeal domain was often not particularly addressed in the analysis of microbial communities. Consequently, established primers specifically amplifying the archaeal 16S ribosomal gene region are scarce compared to the variety of primers targeting bacterial sequences. In this study, we aimed to validate archaeal primers suitable for high throughput next generation sequencing. Three archaeal 16S primer pairs as well as two bacterial and one general microbial 16S primer pairs were comprehensively tested by in-silico evaluation and performing an experimental analysis of a complex microbial community of a biogas reactor. The results obtained clearly demonstrate that comparability of community profiles established using different primer pairs is difficult. 16S rRNA gene data derived from a shotgun metagenome of the same reactor sample added an additional perspective on the community structure. Furthermore, in-silico evaluation of primers, especially those for amplification of archaeal 16S rRNA gene regions, does not necessarily reflect the results obtained in experimental approaches. In the latter, archaeal primer pair ArchV34 showed the highest similarity to the archaeal community structure compared to observed by the metagenomic approach and thus appears to be the appropriate for analyzing archaeal communities in biogas reactors. However, a disadvantage of this primer pair was its low specificity for the archaeal domain in the experimental application leading to high amounts of bacterial sequences within the dataset. Overall our results indicate a rather limited comparability between community structures investigated and determined using different primer pairs as well as between metagenome and 16S rRNA gene amplicon based community structure analysis

  14. Musa genetic diversity revealed by SRAP and AFLP.

    PubMed

    Youssef, Muhammad; James, Andrew C; Rivera-Madrid, Renata; Ortiz, Rodomiro; Escobedo-GraciaMedrano, Rosa María

    2011-03-01

    The sequence-related amplified polymorphism (SRAP) technique, aimed for the amplification of open reading frames (ORFs), vis-â-vis that of the amplified fragment length polymorphisms (AFLP) were used to analyze the genetic variation and relationships among forty Musa accessions; which include commercial cultivars and wild species of interest for the genetic enhancement of Musa. A total of 403 SRAP and 837 AFLP amplicons were generated by 10 SRAP and 15 AFLP primer combinations, of which 353 and 787 bands were polymorphic, respectively. Both cluster analysis of unweighted pair-grouping method with arithmetic averages (UPGMA) and principal coordinate (PCO) analysis separated the forty accessions into their recognized sections (Eumusa, Australimusa, Callimusa and Rhodochlamys) and species. The percentage of polymorphism amongst sections and species and the relationships within Eumusa species and subspecies varied between the two marker systems. In addition to its practical simplicity, SRAP exhibited approximately threefold more specific and unique bands than AFLP, 37 and 13%, respectively. SRAP markers are demonstrated here to be proficient tools for discriminating amongst M. acuminata, M. balbisiana and M. schizocarpa in the Eumusa section, as well as between plantains and cooking bananas within triploid cultivars.

  15. Morphological and AFLP variation of Elymus repens (L.) Gould (Poaceae).

    PubMed

    Szczepaniak, Magdalena; Cieślak, Elzbieta; Bednarek, Piotr Tomasz

    2002-01-01

    Combined morphological and molecular techniques were used to characterize variation in Elymus repens. We studied the morphological variability of E. repens in relation to the degree of its genetic differentiation, in order to unravel the causes of conspicuous intraspecific morphological variation. Four populations of E. repens from different habitats were analyzed for 35 morphological characters, and their genetic differentiation was assessed by Amplified Fragment Length Polymorphism (AFLP). Four pairs of selective primers were used to detect a total of 279 AFLP bands, of which 104 (37.28%) were polymorphic between populations. Cluster analysis based on AFLP fingerprint data showed that individuals were arranged in population-specific groups. The analyses of variance (ANOVA and AMOVA) indicated significant morphological and genetic differentiation among populations (P<0.01). This study revealed low levels of AFLP variation, which suggests that conspicuous morphological variation of E. repens is caused by plasticity. E. repens is an evolutionarily young species, of hybrid origin, in which microevolutionary processes continue. This study showed that common analysis of genetic diversity and morphology is a powerful tool in low-level taxonomy.

  16. PCR identification of four medically important Candida species by using a single primer pair.

    PubMed Central

    Jordan, J A

    1994-01-01

    A single pair of primers was used in a PCR assay to amplify and identify the DNAs from four medically important Candida species: C. albicans, C. parapsilosis, C. tropicalis, and C. (Torulopsis) glabrata. The report describes the first successful amplification of a chitin synthase-specific fragment from the four Candida species responsible for more than 90% of all cases of neonatal candidemia. The primer pair sequence was based on that from the C. albicans chitin synthase gene, CHS1 (J. Au-Young and P.W. Robbins, Mol. Microbiol. 4:197-207, 1990). Each of the four amplified products is a single band of a different size. The DNA sequence of each PCR product was determined, and four species-specific probes were synthesized. The DNAs from as few as 10 organisms in 100 microliters of plasma could be detected after amplification and Southern blot analysis. In a retrospective study of 27 paired blood samples from 16 patients with culture-proven candidemia, PCR analysis was successful at detecting and correctly identifying to the species level 26 of the 27 Candida isolates. The speed and accuracy of this PCR-based technology make it a very powerful tool for detecting and diagnosing candidemia. Implementation of this assay for analyzing blood samples should result in the more timely treatment of neonatal candidemia, thereby reducing morbidity and mortality. Images PMID:7883883

  17. An RT-PCR primer pair for the detection of Pospiviroid and its application in surveying ornamental plants for viroids.

    PubMed

    Bostan, Hidayet; Nie, Xianzhou; Singh, Rudra P

    2004-03-15

    A primer pair for reverse transcription-polymerase chain reaction (RT-PCR), based on the conserved sequences of the members of genus Pospiviroid was designed to yield a fragment of about 200 base pairs (bp). Since pospiviroids infect a large number of plants species and a few members of the genus Pospiviroid have been already detected in some ornamental plants, the primer pair was evaluated for its efficacy using ornamental plants. The method of return-polyacrylamide gel electrophoresis (R-PAGE) was used to determine the general presence of viroids in the test samples. Efficacy of the primer pair for members of genus Pospiviroid was demonstrated by the detection of Potato spindle tuber viroid (PSTVd) and Tomato chlorotic dwarf viroid (TCDVd) in potato, Chrysanthemum stunt viroid and Iresine viroid in Verbena and Vinca species, and Citrus exocortis viroid in Impatiens species. Specificity of the primer pair became evident, where additional viroids were detected by R-PAGE in Coleus and Magilla species, but they were not amplified by the Pospiviroid primer. This primer pair would be of benefit in indexing ornamental plants in quarantine samples or in viroid-free certification schemes, irrespective of their actual identity.

  18. An RT-PCR primer pair for the detection of Pospiviroid and its application in surveying ornamental plants for viroids.

    PubMed

    Bostan, Hidayet; Nie, Xianzhou; Singh, Rudra P

    2004-03-15

    A primer pair for reverse transcription-polymerase chain reaction (RT-PCR), based on the conserved sequences of the members of genus Pospiviroid was designed to yield a fragment of about 200 base pairs (bp). Since pospiviroids infect a large number of plants species and a few members of the genus Pospiviroid have been already detected in some ornamental plants, the primer pair was evaluated for its efficacy using ornamental plants. The method of return-polyacrylamide gel electrophoresis (R-PAGE) was used to determine the general presence of viroids in the test samples. Efficacy of the primer pair for members of genus Pospiviroid was demonstrated by the detection of Potato spindle tuber viroid (PSTVd) and Tomato chlorotic dwarf viroid (TCDVd) in potato, Chrysanthemum stunt viroid and Iresine viroid in Verbena and Vinca species, and Citrus exocortis viroid in Impatiens species. Specificity of the primer pair became evident, where additional viroids were detected by R-PAGE in Coleus and Magilla species, but they were not amplified by the Pospiviroid primer. This primer pair would be of benefit in indexing ornamental plants in quarantine samples or in viroid-free certification schemes, irrespective of their actual identity. PMID:14738987

  19. A comparison of the variation in Indian populations of pigeonpea cyst nematode, Heterodera cajani revealed by morphometric and AFLP analysis

    PubMed Central

    Rao, Sashi Bhushan; Rathi, Anamika; Gothalwal, Ragini; Atkinson, Howard; Rao, Uma

    2011-01-01

    Abstract The cyst nematode Heterodera cajani is one of the major endemic diseases of pigeonpea, an important legume for food security and protein nutrition in India. It occurs in several pulse crops grown over a range of Indian agro climatic conditions but the extent of its intraspecific variation is inadequately defined. In view of this, 11 populations of Heterodera cajani were analyzed using morphometrics and the results correlated with those obtained from an AFLP approach using 24 primer pair combinations that amplified a total of 1278 AFLP markers. The cluster solution from this binary data indicated similarities for five populations that differed from those suggested by morphometrics. The differences obtained could not be related to geographic distance between populations. The data suggests that recent and long distance dispersal has occurred whose causes need to be defined to restrict further field introductions. Four AFLP primer pairs clustered the populations similarly to that generated using all 24 primer pairs. This simplified approach may provide a rapid basis for discriminating populations for their future management and help to check further distribution in agricultural trade. It may also have potential to determine differences in populations that relate to host range or virulence to resistance genes. PMID:22259298

  20. Determination of genetic relationships between evergreen azalea cultivars in China using AFLP markers*

    PubMed Central

    Zhou, Hong; Liao, Jin; Xia, Yi-ping; Teng, Yuan-wen

    2013-01-01

    Evergreen azaleas are among the most important ornamental shrubs in China. Today, there are probably over 300 cultivars preserved in different nurseries, but with little information available on the cultivar itself or relationships between cultivars. Amplified fragment length polymorphism (AFLP) markers were employed to determine the genetic relationships between evergreen azalea cultivars in China. One hundred and thirty genotypes collected from gardens and nurseries, including cultivars classified in the groups East, West, Hairy, and Summer, unknown cultivars, and close species, were analyzed using three primer pairs. A total of 408 polymorphic fragments were generated by AFLP reactions with an average of 136 fragments per primer pair. The average values of expected heterozygosity and Shannon’s information index were 0.3395 and 0.5153, respectively. Genetic similarities were generated based on Dice coefficients, used to construct a neighbor joining tree, and bootstrapped for 100 replicates in Treecon V1.3b. Principal coordinate analysis (PCO) was performed based on Dice distances using NTSYS-pc software. The AFLP technique was useful for analyzing genetic diversity in evergreen azaleas. Cluster analysis revealed that cultivars in the West and Summer groups were quite distinct from other groups in the four-group classification system and that the East and Hairy groups should be redefined. PMID:23549847

  1. Species-specific AFLP markers for identification of Zingiber officinale, Z. montanum and Z. zerumbet (Zingiberaceae).

    PubMed

    Ghosh, S; Majumder, P B; Sen Mandi, S

    2011-01-01

    The Zingiber genus, which includes the herbs known as gingers, commonly used in cooking, is well known for its medicinal properties, as described in the Indian pharmacopoeia. Different members of this genus, although somewhat similar in morphology, differ widely in their pharmacological and therapeutic properties. The most important species of this genus, with maximal therapeutic properties, is Zingiber officinale (garden ginger), which is often adulterated with other less-potent Zingiber sp. There is an existing demand in the herbal drug industry for an authentication system for the Zingiber sp in order to facilitate their commercial use as genuine phytoceuticals. To this end, we used amplified fragment length polymorphism (AFLP) to produce DNA fingerprints for three Zingiber species. Sixteen collections (six of Z. officinale, five of Z. montanum, and five of Z. zerumbet) were used in the study. Seven selective primer pairs were found to be useful for all the accessions. A total of 837 fragments were produced by these primer pairs. Species-specific markers were identified for all three Zingiber species (91 for Z. officinale, 82 for Z. montanum, and 55 for Z. zerumbet). The dendogram analysis generated from AFLP patterns showed that Z. montanum and Z. zerumbet are phylogenetically closer to each other than to Z. officinale. The AFLP fingerprints of the Zingiber species could be used to authenticate Zingiber sp-derived drugs and to resolve adulteration-related problems faced by the commercial users of these herbs. PMID:21341214

  2. Bacterial Diversity Dynamics Associated with Different Diets and Different Primer Pairs in the Rumen of Kankrej Cattle

    PubMed Central

    Pitta, Dipti W.; Parmar, Nidhi; Patel, Amrut K.; Indugu, Nagaraju; Kumar, Sanjay; Prajapathi, Karsanbhai B.; Patel, Anand B.; Reddy, Bhaskar; Joshi, Chaitanya

    2014-01-01

    The ruminal microbiome in herbivores plays a dominant role in the digestion of lignocellulose and has potential to improve animal productivity. Kankrej cattle, a popular native breed of the Indian subcontinent, were used to investigate the effect of different dietary treatments on the bacterial diversity in ruminal fractions using different primer pairs. Two groups of four cows were assigned to two primary diets of either dry or green forages. Each group was fed one of three dietary treatments for six weeks each. Dietary treatments were; K1 (50% dry/green roughage: 50% concentrate), K2 (75% dry/green roughage: 25% concentrate) and K3 (100% dry/green roughage). Rumen samples were collected using stomach tube at the end of each dietary period and separated into solid and liquid fractions. The DNA was extracted and amplified for V1–V3, V4–V5 and V6–V8 hypervariable regions using P1, P2 and P3 primer pairs, sequenced on a 454 Roche platform and analyzed using QIIME. Community compositions and the abundance of most bacterial lineages were driven by interactions between primer pair, dietary treatment and fraction. The most abundant bacterial phyla identified were Bacteroidetes and Firmicutes however, the abundance of these phyla varied between different primer pairs; in each primer pair the abundance was dependent on the dietary treatment and fraction. The abundance of Bacteroidetes in cattle receiving K1 treatment indicate their diverse functional capabilities in the digestion of both carbohydrate and protein while the predominance of Firmicutes in the K2 and K3 treatments signifies their metabolic role in fibre digestion. It is apparent that both liquid and solid fractions had distinct bacterial community patterns (P<0.001) congruent to changes in the dietary treatments. It can be concluded that the P1 primer pair flanking the V1–V3 hyper-variable region provided greater species richness and diversity of bacterial populations in the rumen of Kankrej cattle

  3. Efficacy of random primer-pair arrays in plant genome analysis: a case study of Cucumis (Cucurbitaceae) for identification of wild and cultivated species.

    PubMed

    Gatphoh, E M; Sharma, S K; Rajkumari, K; Rama Rao, S

    2011-01-01

    The efficacy of random primer-pair arrays compared to conventional RAPD method with a single decamer primer was evaluated using DNA from two species of Cucumis. The banding patterns of amplicons revealed enhanced utility of primer-pair arrays over conventional RAPDs, producing more bands and a higher degree of polymorphism, both at intra- and inter-specific levels. Amplification produced by both methods clearly distinguished a wild from a cultivated species of the genus Cucumis. The main advantage of the primer-pair RAPD over single-primer-based RAPD is the increase in the number of reactions and amplification products in the form of novel/unique bands with a limited number of primers. It also enables the generation of reliable amplicons with a large number of polymorphic bands, which can be linked to gene-governing traits, allowing sequence-characterized partial genome analysis. PMID:21823091

  4. Efficacy of random primer-pair arrays in plant genome analysis: a case study of Cucumis (Cucurbitaceae) for identification of wild and cultivated species.

    PubMed

    Gatphoh, E M; Sharma, S K; Rajkumari, K; Rama Rao, S

    2011-01-01

    The efficacy of random primer-pair arrays compared to conventional RAPD method with a single decamer primer was evaluated using DNA from two species of Cucumis. The banding patterns of amplicons revealed enhanced utility of primer-pair arrays over conventional RAPDs, producing more bands and a higher degree of polymorphism, both at intra- and inter-specific levels. Amplification produced by both methods clearly distinguished a wild from a cultivated species of the genus Cucumis. The main advantage of the primer-pair RAPD over single-primer-based RAPD is the increase in the number of reactions and amplification products in the form of novel/unique bands with a limited number of primers. It also enables the generation of reliable amplicons with a large number of polymorphic bands, which can be linked to gene-governing traits, allowing sequence-characterized partial genome analysis.

  5. Assessment of genetic diversity through RAPD, ISSR and AFLP markers in Podophyllum hexandrum: a medicinal herb from the Northwestern Himalayan region.

    PubMed

    Naik, Pradeep Kumar; Alam, Md Afroz; Singh, Harvinder; Goyal, Vinod; Parida, Swarup; Kalia, Sanjay; Mohapatra, T

    2010-04-01

    Total synthesis of podophyllotoxin is an expensive process and availability of the compound from the natural resources is an important issue for pharmaceutical companies that manufacture anticancer drugs. In order to facilitate reasoned scientific decisions on its management and conservation for selective breeding programme, genetic analysis of 28 populations was done with 19 random primers, 11 ISSR primers and 13 AFLP primer pairs. A total of 92.37 %, 83.82 % and 84.40 % genetic polymorphism among the populations of Podophyllum were detected using RAPD, ISSR and AFLP makers, respectively. Similarly the mean coefficient of gene differentiation (Gst) were 0.69, 0.63 and 0.51, indicating that 33.77 %, 29.44 % and 26 % of the genetic diversity resided within the population. Analysis of molecular variance (AMOVA) indicated that 53 %, 62 % and 64 % of the genetic diversity among the studied populations was attributed to geographical location while 47 %, 38 % and 36 % was attributed to differences in their habitats using RAPD, ISSR and AFLP markers. An overall value of mean estimated number of gene flow (Nm) were 0.110, 0.147 and 0.24 from RAPD, ISSR and AFLP markers indicating that there was limited gene flow among the sampled populations.

  6. Genetic structure of Pilosocereus gounellei (Cactaceae) as revealed by AFLP marker to guide proposals for improvement and restoration of degraded areas in Caatinga biome.

    PubMed

    Monteiro, E R; Strioto, D K; Meirelles, A C S; Mangolin, C A; Machado, M F P S

    2015-12-15

    Amplified fragment length polymorphism (AFLP) analysis was used to evaluate DNA polymorphism in Pilosocereus gounellei with the aim of differentiating samples grown in different Brazilian semiarid regions. Seven primer pairs were used to amplify 703 AFLP markers, of which 700 (99.21%) markers were polymorphic. The percentage of polymorphic markers ranged from 95.3% for the primer combination E-AAG/M-CTT to 100% for E-ACC/M-CAT, E-ACC/M-CAA, E-AGC/M-CAG, E-ACT/M-CTA, and E-AGG/M-CTG. The largest number of informative markers (126) was detected using the primer combination E-AAC/M-CTA. Polymorphism of the amplified DNA fragments ranged from 72.55% (in sample from Piauí State) to 82.79% (in samples from Rio Grande Norte State), with an average of 75.39%. Despite the high genetic diversity of AFLP markers in xiquexique, analysis using the STRUCTURE software identified relatively homogeneous clusters of xiquexique from the same location, indicating a differentiation at the molecular level, among the plant samples from different regions of the Caatinga biome. The AFLP methodology identified genetically homogeneous and contrasting plants, as well as plants from different regions with common DNA markers. Seeds from such plants can be used for further propagation of plants for establishment of biodiversity conservation units and restoration of degraded areas of the Caatinga biome.

  7. Genetic structure of Pilosocereus gounellei (Cactaceae) as revealed by AFLP marker to guide proposals for improvement and restoration of degraded areas in Caatinga biome.

    PubMed

    Monteiro, E R; Strioto, D K; Meirelles, A C S; Mangolin, C A; Machado, M F P S

    2015-01-01

    Amplified fragment length polymorphism (AFLP) analysis was used to evaluate DNA polymorphism in Pilosocereus gounellei with the aim of differentiating samples grown in different Brazilian semiarid regions. Seven primer pairs were used to amplify 703 AFLP markers, of which 700 (99.21%) markers were polymorphic. The percentage of polymorphic markers ranged from 95.3% for the primer combination E-AAG/M-CTT to 100% for E-ACC/M-CAT, E-ACC/M-CAA, E-AGC/M-CAG, E-ACT/M-CTA, and E-AGG/M-CTG. The largest number of informative markers (126) was detected using the primer combination E-AAC/M-CTA. Polymorphism of the amplified DNA fragments ranged from 72.55% (in sample from Piauí State) to 82.79% (in samples from Rio Grande Norte State), with an average of 75.39%. Despite the high genetic diversity of AFLP markers in xiquexique, analysis using the STRUCTURE software identified relatively homogeneous clusters of xiquexique from the same location, indicating a differentiation at the molecular level, among the plant samples from different regions of the Caatinga biome. The AFLP methodology identified genetically homogeneous and contrasting plants, as well as plants from different regions with common DNA markers. Seeds from such plants can be used for further propagation of plants for establishment of biodiversity conservation units and restoration of degraded areas of the Caatinga biome. PMID:26681043

  8. Assessment of genetic diversity in Chinese eared pheasant using fluorescent-AFLP markers.

    PubMed

    Li, Xiujuan; Zhu, Yaohong; Liu, Panqi; Zhuge, Zengyu; Su, Guosheng; Wang, Jiufeng

    2010-10-01

    The eared pheasant consists of four species: white eared pheasant (Crossoptilon crossoptilon), Tibetan eared pheasant (Crossoptilon harmani), blue eared pheasant (Crossoptilon auritum), and brown eared pheasant (Crossoptilon mantchuricum). These species are found only in China, and are also on the list of the world's threatened species. In this paper, 74 individuals from the four eared pheasant species were assessed for population genetic diversity by means of fluorescent-AFLP markers. A total of 429 AFLP peaks were amplified by 11 pairs of fluorescent EcoRI/TaqI primer combinations. Out of all markers, 329 AFLPs were polymorphic. Each primer combination produced in reactions from 19 to 72 fragments and the polymorphic peaks percentage ranged from 53.33% to 86.11% with an average of 74.36% polymorphic bands. Genetic distance between species and genetic diversity within species were evaluated using Jaccard's similarity coefficients (SC) and the corresponding dendrogram. It was found that there was a moderate genetic distance between the four species (SC=0.674-0.832). Brown eared pheasant was genetically closely related to blue eared pheasant (SC=0.832), while white eared pheasant was more closely related to Tibetan eared pheasant (SC=0.812). Genetic diversity was lower in brown eared pheasant (SC=0.913) and Tibetan eared pheasant (SC=0.903) than in white eared pheasant (SC=0.832) and blue eared pheasant (SC=0.853).

  9. A first linkage map of globe artichoke (Cynara cardunculus var. scolymus L.) based on AFLP, S-SAP, M-AFLP and microsatellite markers.

    PubMed

    Lanteri, S; Acquadro, A; Comino, C; Mauro, R; Mauromicale, G; Portis, E

    2006-05-01

    We present the first genetic maps of globe artichoke (Cynara cardunculus var. scolymus L. 2n=2x=34), constructed with a two-way pseudo-testcross strategy. A F1 mapping population of 94 individuals was generated between a late-maturing, non-spiny type and an early-maturing spiny type. The 30 AFLP, 13 M-AFLP and 9 S-SAP primer combinations chosen identified, respectively, 352, 38 and 41 polymorphic markers. Of 32 microsatellite primer pairs tested, 12 identified heterozygous loci in one or other parent, and 7 were fully informative as they segregated in both parents. The female parent map comprised 204 loci, spread over 18 linkage groups and spanned 1330.5 cM with a mean marker density of 6.5 cM. The equivalent figures for the male parent map were 180 loci, 17 linkage groups, 1239.4 and 6.9 cM. About 3% of the AFLP and AFLP-derived markers displayed segregation distortion with a P value below 0.01, and were not used for map construction. All the SSR loci were included in the linkage analysis, although one locus did show some segregation distortion. The presence of 78 markers in common to both maps allowed the alignment of 16 linkage groups. The maps generated provide a firm basis for the mapping of agriculturally relevant traits, which will then open the way for the application of a marker-assisted selection breeding strategy in this species.

  10. Primer pairs for the specific environmental detection and T-RFLP analysis of the ubiquitous flagellate taxa Chrysophyceae and Kinetoplastea.

    PubMed

    Glaser, Karin; Kuppardt, Anke; Krohn, Sandra; Heidtmann, Anett; Harms, Hauke; Chatzinotas, Antonis

    2014-05-01

    Bacterivorous protists play a key role in microbial soil food webs, however due to the lack of specific PCR protocols targeting selected protist taxa, knowledge on the diversity and dynamics of these groups is scarce. We developed specific PCR primers in combination with a T-RFLP protocol for the cultivation-independent analysis of two important taxa of bacterivorous flagellates, the Chrysophyceae and Kinetoplastea, in soil samples. Sequence analysis of clone libraries originating from two soils in temperate regions demonstrated the specificity of the respective primer pairs. Clone sequences affiliating to the Chrysophyceae mainly clustered within the clade C2, which has been known so far for its presence mainly in cold climatic regions, whereas Kinetoplastea sequences were mainly related to the Neobodonid clade. Based on an in silico restriction analysis of database sequence entries, suitable restriction enzymes for a T-RFLP approach were selected. This in silico approach revealed the necessity to use a combination of two restriction enzymes for T-RFLP analysis of the Chrysophyceae. Soil T-RFLP profiles reflected all T-RFs of the clone library sequences obtained from the same soils and allowed to distinguish flagellate communities from different sites. We propose to use these primer pairs for PCR detection and rapid fingerprint screening in environmental samples and envisage their use also for quantitative PCR or next generation sequencing approaches.

  11. Performance of 16s rDNA Primer Pairs in the Study of Rhizosphere and Endosphere Bacterial Microbiomes in Metabarcoding Studies

    PubMed Central

    Beckers, Bram; Op De Beeck, Michiel; Thijs, Sofie; Truyens, Sascha; Weyens, Nele; Boerjan, Wout; Vangronsveld, Jaco

    2016-01-01

    Next-generation sequencing technologies have revolutionized the methods for studying microbial ecology by enabling high-resolution community profiling. However, the use of these technologies in unraveling the plant microbiome remains challenging. Many bacterial 16S rDNA primer pairs also exhibit high affinity for non-target DNA such as plastid (mostly chloroplast) DNA and mitochondrial DNA. Therefore, we experimentally tested a series of commonly used primers for the analysis of plant-associated bacterial communities using 454 pyrosequencing. We evaluated the performance of all selected primer pairs in the study of the bacterial microbiomes present in the rhizosphere soil, root, stem and leaf endosphere of field-grown poplar trees (Populus tremula × Populus alba) based on (a) co-amplification of non-target DNA, (b) low amplification efficiency for pure chloroplast DNA (real-time PCR), (c) high retrieval of bacterial 16S rDNA, (d) high operational taxonomic unit (OTU) richness and Inverse Simpson diversity and (e) taxonomic assignment of reads. Results indicate that experimental evaluation of primers provide valuable information that could contribute in the selection of suitable primer pairs for 16S rDNA metabarcoding studies in plant-microbiota research. Furthermore, we show that primer pair 799F-1391R outperforms all other primer pairs in our study in the elimination of non-target DNA and retrieval of bacterial OTUs. PMID:27242686

  12. Performance of 16s rDNA Primer Pairs in the Study of Rhizosphere and Endosphere Bacterial Microbiomes in Metabarcoding Studies.

    PubMed

    Beckers, Bram; Op De Beeck, Michiel; Thijs, Sofie; Truyens, Sascha; Weyens, Nele; Boerjan, Wout; Vangronsveld, Jaco

    2016-01-01

    Next-generation sequencing technologies have revolutionized the methods for studying microbial ecology by enabling high-resolution community profiling. However, the use of these technologies in unraveling the plant microbiome remains challenging. Many bacterial 16S rDNA primer pairs also exhibit high affinity for non-target DNA such as plastid (mostly chloroplast) DNA and mitochondrial DNA. Therefore, we experimentally tested a series of commonly used primers for the analysis of plant-associated bacterial communities using 454 pyrosequencing. We evaluated the performance of all selected primer pairs in the study of the bacterial microbiomes present in the rhizosphere soil, root, stem and leaf endosphere of field-grown poplar trees (Populus tremula × Populus alba) based on (a) co-amplification of non-target DNA, (b) low amplification efficiency for pure chloroplast DNA (real-time PCR), (c) high retrieval of bacterial 16S rDNA, (d) high operational taxonomic unit (OTU) richness and Inverse Simpson diversity and (e) taxonomic assignment of reads. Results indicate that experimental evaluation of primers provide valuable information that could contribute in the selection of suitable primer pairs for 16S rDNA metabarcoding studies in plant-microbiota research. Furthermore, we show that primer pair 799F-1391R outperforms all other primer pairs in our study in the elimination of non-target DNA and retrieval of bacterial OTUs. PMID:27242686

  13. AFLP genetic polymorphism in wild barley (Hordeum spontaneum) populations in Israel.

    PubMed

    Turpeinen, T; Vanhala, T; Nevo, E; Nissilä, E

    2003-05-01

    The genetic diversity produced by the amplified fragment length polymorphism (AFLP) method was studied in 94 genotypes of wild barley, Hordeum spontaneum (C. Koch) Thell., originating from ten ecologically and geographically different locations in Israel. Eight primer pairs produced 204 discernible loci of which 189 (93%) were polymorphic. Each genotype had a unique banding profile and the genetic similarity coefficient varied between 0.74 and 0.98. The phenogram generated from these similarities by the UPGMA method did not group genotypes strictly according to their geographical origin, which pattern was also seen in the principal coordinate (PCO) plot. Genetic diversity was larger within (69%) than among (31%) populations. Associations between ecogeographical variables and the mean gene diversity were found at one primer pair. The results are discussed and compared with data obtained by the simple sequence repeat (SSR) method. PMID:12748785

  14. Insight into the genomic diversity and relationship of Astragalus glycyphyllos symbionts by RAPD, ERIC-PCR, and AFLP fingerprinting.

    PubMed

    Gnat, Sebastian; Małek, Wanda; Oleńska, Ewa; Trościańczyk, Aleksandra; Wdowiak-Wróbel, Sylwia; Kalita, Michał; Wójcik, Magdalena

    2015-11-01

    We assessed the genomic diversity and genomic relationship of 28 Astragalus glycyphyllos symbionts by three methodologies based on PCR reaction, i.e., RAPD, ERIC-PCR, and AFLP. The AFLP method with one PstI restriction enzyme and selective PstI-GC primer pair had a comparable discriminatory power as ERIC-PCR one and these fingerprinting techniques distinguished among the studied 28 A. glycyphyllos symbionts 18 and 17 genomotypes, respectively. RAPD method was less discriminatory in the genomotyping of rhizobia analyzed and it efficiently resolved nine genomotypes. The cluster analysis of RAPD, ERIC-PCR, and AFLP profiles resulted in a generally similar grouping of the test strains on generated dendrograms supporting a great potential of these DNA fingerprinting techniques for study of genomic polymorphism and evolutionary relationship of A. glycyphyllos nodulators. The RAPD, ERIC-PCR, and AFLP pattern similarity coefficients between A. glycyphyllos symbionts studied was in the ranges 8-100, 18-100, and 23-100%, respectively.

  15. Evaluation of six primer pairs targeting the nuclear rRNA operon for characterization of arbuscular mycorrhizal fungal (AMF) communities using 454 pyrosequencing.

    PubMed

    Van Geel, Maarten; Busschaert, Pieter; Honnay, Olivier; Lievens, Bart

    2014-11-01

    In the last few years, 454 pyrosequencing-based analysis of arbuscular mycorrhizal fungal (AMF; Glomeromycota) communities has tremendously increased our knowledge of the distribution and diversity of AMF. Nonetheless, comparing results between different studies is difficult, as different target genes (or regions thereof) and primer combinations, with potentially dissimilar specificities and efficacies, are being utilized. In this study we evaluated six primer pairs that have previously been used in AMF studies (NS31-AM1, AMV4.5NF-AMDGR, AML1-AML2, NS31-AML2, FLR3-LSUmBr and Glo454-NDL22) for their use in 454 pyrosequencing based on both an in silico approach and 454 pyrosequencing of AMF communities from apple tree roots. Primers were evaluated in terms of (i) in silico coverage of Glomeromycota fungi, (ii) the number of high-quality sequences obtained, (iii) selectivity for AMF species, (iv) reproducibility and (v) ability to accurately describe AMF communities. We show that primer pairs AMV4.5NF-AMDGR, AML1-AML2 and NS31-AML2 outperformed the other tested primer pairs in terms of number of Glomeromycota reads (AMF specificity and coverage). Additionally, these primer pairs were found to have no or only few mismatches to AMF sequences and were able to consistently describe AMF communities from apple roots. However, whereas most high-quality AMF sequences were obtained for AMV4.5NF-AMDGR, our results also suggest that this primer pair favored amplification of Glomeraceae sequences at the expense of Ambisporaceae, Claroideoglomeraceae and Paraglomeraceae sequences. Furthermore, we demonstrate the complementary specificity of AMV4.5NF-AMDGR with AML1-AML2, and of AMV4.5NF-AMDGR with NS31-AML2, making these primer combinations highly suitable for tandem use in covering the diversity of AMF communities.

  16. Preliminary analysis of population genetic diversity of cultivated Laminaria japonica sporophyte via AFLP technique

    NASA Astrophysics Data System (ADS)

    Yi, Heng; Sui, Zhenghong; Bao, Zhenmin

    2010-03-01

    The amplified fragment length polymorphic DNA (AFLP) technique was adopted to estimate the population genetic polymorphism among 30 sporophytes of Laminaria japonica collected from a cultivating farm in Rongcheng, China. Three methods were used for genomic DNA extraction from Laminaria japonica sporophyte and only the products obtained using the improved genomic DNA extraction kit method proved qualified for AFLP analysis. The parameters of the method were optimized. Samples of forty milligrams and the cell lysis time of 120 min were suggested to replace the parameters recommended by the manufacturer. Thirty individuals of Laminaria japonica from the same cultivating site were investigated using one pair of selective primers. A total of 21 loci were obtained and 17 of them were polymorphic. The mean percent age of polymorphic loci of this population was 80.95%. The Nei’s gene diversity (H) within this population was 0.3028 and the average Shannon’s Information index (I) was 0.4498. A genetic distance matrix among different individuals was constructed as well. Through this study, an applicable AFLP genetic analysis working system for Laminaria japonica sporophyte was established. The results of this research also revealed a high level of genetic diversity within the studied population.

  17. Data supporting the design and evaluation of a universal primer pair for pseudogene-free amplification of HPRT1 in real-time PCR

    PubMed Central

    Valadan, Reza; Hedayatizadeh-Omran, Akbar; Alhosseini-Abyazani, Mahdyieh Naghavi; Amjadi, Omolbanin; Rafiei, Alireza; Tehrani, Mohsen; Alizadeh-Navaei, Reza

    2015-01-01

    Hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1) is a common housekeeping gene for sample normalization in the quantitative reverse transcriptase polymerase chain (qRT-PCR). However, co-amplification of HPRT1 pseudogenes may affect accurate results obtained in qRT-PCR. We designed a primer pair (HPSF) for pseudogene-free amplification of HPRT1 in qRT-PCR [1]. We showed specific amplification of HPRT1 mRNA in some common laboratory cell lines, including HeLa, NIH/3T3, CHO, BHK, COS-7 and VERO. This article provides data supporting the presence and location of HPRT1 pseudogenes within human and mouse genome, and the strategies used for designing primers that avoid the co-amplification of contaminating pseudogenes in qRT-PCR. In silico analysis of human genome showed three homologous sequences for HPRT1 on chromosomes 4, 5 and 11. The mRNA sequence of HPRT1 was aligned with the pseudogenes, and the primers were designed toward 5′ end of HPRT1 mRNA that was only specific to HPRT1 mRNA not to the pseudogenes. The standard curve plot generated by HPSF primers showed the correlation coefficient of 0.999 and the reaction efficiency of 99.5%. Our findings suggest that HPSF primers can be recommended as a candidate primer pair for accurate and reproducible qRT-PCR assays. PMID:26217821

  18. Data supporting the design and evaluation of a universal primer pair for pseudogene-free amplification of HPRT1 in real-time PCR.

    PubMed

    Valadan, Reza; Hedayatizadeh-Omran, Akbar; Alhosseini-Abyazani, Mahdyieh Naghavi; Amjadi, Omolbanin; Rafiei, Alireza; Tehrani, Mohsen; Alizadeh-Navaei, Reza

    2015-09-01

    Hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1) is a common housekeeping gene for sample normalization in the quantitative reverse transcriptase polymerase chain (qRT-PCR). However, co-amplification of HPRT1 pseudogenes may affect accurate results obtained in qRT-PCR. We designed a primer pair (HPSF) for pseudogene-free amplification of HPRT1 in qRT-PCR [1]. We showed specific amplification of HPRT1 mRNA in some common laboratory cell lines, including HeLa, NIH/3T3, CHO, BHK, COS-7 and VERO. This article provides data supporting the presence and location of HPRT1 pseudogenes within human and mouse genome, and the strategies used for designing primers that avoid the co-amplification of contaminating pseudogenes in qRT-PCR. In silico analysis of human genome showed three homologous sequences for HPRT1 on chromosomes 4, 5 and 11. The mRNA sequence of HPRT1 was aligned with the pseudogenes, and the primers were designed toward 5' end of HPRT1 mRNA that was only specific to HPRT1 mRNA not to the pseudogenes. The standard curve plot generated by HPSF primers showed the correlation coefficient of 0.999 and the reaction efficiency of 99.5%. Our findings suggest that HPSF primers can be recommended as a candidate primer pair for accurate and reproducible qRT-PCR assays.

  19. Genetic diversity analysis in blackgram (Vigna mungo (L.) Hepper) using AFLP and transferable microsatellite markers from azuki bean (Vigna angularis (Willd.) Ohwi & Ohashi).

    PubMed

    Gupta, S K; Gopalakrishna, T

    2009-02-01

    Genetic diversity in 20 elite blackgram (Vigna mungo (L.) Hepper) genotypes was studied using microsatellite and AFLP markers. Thirty-six microsatellite markers from azuki bean (Vigna angularis (Willd.) Ohwi & Ohashi) were successfully amplified across the 20 blackgram genotypes and 33 microsatellite markers showed polymorphism. A total of 137 microsatellite alleles were generated with an average of 4.1 alleles per locus. The number of alleles ranged from two to nine and the polymorphic information content value for the microsatellite markers varied from 0.10 to 0.87 with an average of 0.49. Microsatellite markers were highly informative and a combination of only three microsatellite markers (CEDG264, CEDG173, and CEDG044) was sufficient to discriminate all 20 blackgram genotypes. In the case of AFLP, 11 primer pairs generated 324 polymorphic marker fragments. The polymorphic information content values for AFLP primer combinations ranged from 0.21 to 0.34 with an average of 0.29. Similarity measures and clustering analyses were made using microsatellite and AFLP data separately. The resulting dendrograms distributed the 20 blackgram genotypes into five main clusters. The dendrograms were comparable with each other with the Mantel test between the cophenetic matrices of microsatellite data and AFLP data showing moderate correlation (r = 0.64). The results of the principal components analysis were well congruent with the dendrograms. In the dendrograms as well as in the principal components analyses, genotype Trombay wild (Vigna mungo var. silvestris) was placed separately from rest of the genotypes. This study demonstrated that the azuki bean microsatellite markers are highly polymorphic and informative and can be successfully used for genome analysis in blackgram. Results indicate that sufficient variability is present in the blackgram genotypes and would be helpful in the selection of suitable parents for breeding purposes and gene mapping studies.

  20. [Morphology and AFLP analysis of tetraploid plantlets of Atractylodes macrocephala].

    PubMed

    Wang, Hong-juan; Li, Ya-ting; Xiang, Zeng-xu

    2015-02-01

    In order to investigate the genetic basis of morphological variation of tetraploid plantlets of Atractylodes macrocephala, diploid plantlets were taken as experimental material, sterile filtration colchicine was used to soak 0.5-1.0 cm long buds. The difference between morphology and stomatal of diploid and tetraploid of A. macrocephala was compared, and genome polymorphism was explored by AFLP. The results showed that the buds dipped in 0.1% colchicine solution for 36 h was optimal conditions to induce tetraploid of A. macrocephala with induction rate of 32.0%. Morphological indexes such as leaf area index, leaf length and width, the density of stomas and the number of chloroplast of tetraploid were distinctly different from diploid. Four hundred and fifty-one bands ranging with 80-500 bp were amplified with 24 pairs of primers, the rate of polymorphism was 32.59%. These amplification sites of diploid were different from tetraploid of A. macrocephala, and the differences in morphology of them were reflected in the DNA polymorphism. PMID:26084160

  1. Analysis of the genetic diversity and differentiation of Fenneropenaeus penicillatus populations using AFLP technology

    NASA Astrophysics Data System (ADS)

    Zhang, Guiling; Cao, Yuanyu; Li, Zhongbao; Chen, Jin; Zhao, Binli; Lei, Guanggao; Wang, Zhanlin

    2012-05-01

    Fenneropenaeus penicillatus (redtail shrimp) is an important marine commercial animal in China. Recently, its resources have been depleted rapidly as a result of, for example, over-exploitation and environmental degradation of spawning grounds. Therefore, we analyzed the genetic diversity and differentiation of nine wild populations of F. penicillatus of China (Ningde, Lianjiang, Putian, Xiamen, Quanzhou, Zhangpu, Dongshan, Nanao, and Shenzhen populations) by amplified fragment length polymorphism (AFLP) technology, to provide genetic information necessary for resource protection, rejuvenation, artificial breeding, and sustainable use of the resource. Eight AFLP primer pairs were used for amplification, and 508 bands were detected among the populations. The results show that the percentage of polymorphic loci ( P) ranged from 41.34% to 63.58%; the Nei's gene diversity ( H) of the populations was 0.119 4-0.230 5; and Shannon's Information Index ( I) was 0.184 1-0.342 5. These genetic data indicate that the genetic diversity of F. penicillatus was high. The genetic differentiation coefficient ( G ST=0.216 2) and gene flow ( N m=1.812 4) show that there was a high level of genetic differentiation and a moderate level of gene flow among populations. More studies on the genetic differentiation mechanism of F. penicillatus along the south-eastern coast of China need to be conducted to find more effective scientific protection strategies for the conservation of F. penicillatus genetic resources.

  2. [Morphologic and AFLP analysis of relationships between tulip species Tulipa biebersteiniana (Liliaceae)].

    PubMed

    Kutlunina, N A; Polezhaeva, M A; Permiakova, M V

    2013-04-01

    In populations of four species of tulips, (Tulipa biebersteiniana, T. patens, T. scytica and T. riparia) from the Volgograd, Kurgansk, Orenburg, and Chelyabinsk regions and the Republic of Bashkortostan, genetic diversity was studied by means of morphological and AFLP analysis. A morphological analysis of seven quantitative and two qualitative criteria was carried out. Three selective EcoRI/MseI primer pairs allowed one to genotype 81 individuals from 13 tulip populations with 87 loci. The low level of variability by AFLP loci were revealed in all species, including T. biebersteiniana (P = 20.41%, UH(e) = 0.075), T. patens (26.97%, 0.082), T. scytica (27.53%, 0.086), and T. riparia (27.72%, 0.096). According to the AMOVA results, the variability proportion that characterizes the differences between the four Tulip species was lower (F(CT) = 0.235) than between populations within species (F(ST) = 0.439). Tulipa patens is well differentiated by means of Nei's distances, coordination, and analysis in the STRUCTURE program. An analysis in the STRUCTURE revealed four genetic groups of tulips that are not completely in accordance with the analyzed species. This acknowledges the presence of complicated genetic process in the tulip population.

  3. Assessment of genetic variation and differentiation of hop genotypes by microsatellite and AFLP markers.

    PubMed

    Jakse, J; Kindlhofer, K; Javornik, B

    2001-10-01

    Microsatellites have many desirable marker properties and have been increasingly used in crop plants in genetic diversity studies. Here we report on the characterisation of microsatellite markers and on their use for the determination of genetic identities and the assessment of genetic variability among accessions from a germplasm collection of hop. Thirty-two polymorphic alleles were found in the 55 diploid genotypes, with an average number of eight alleles (3.4 effective alleles) for four microsatellite loci. Calculated polymorphic information content values classified three loci as informative markers and two loci as suitable for mapping. The average observed heterozygosity was 0.7 and the common probability of identical genotypes was 3.271 x 10(-4). An additional locus, amplified by one primer pair, was confirmed by segregation analysis of two crosses. The locus discovered was heterozygous, with a null allele in the segregating population. The same range of alleles was detected in nine triploid and five tetraploid hop genotypes. Cultivar heterozygosity varied among all 69 accessions, with only one cultivar being homozygous at four loci. Microsatellite allele polymorphisms distinguished 81% of all genotypes; the same allelic profile was found mainly in clonally selected cultivars. Cultivar-specific alleles were found in some genotypes, as well as a specific distribution of alleles in geographically distinct hop germplasms. The genetic relationship among 41 hop accessions was compared on the basis of microsatellite and AFLP polymorphisms. Genetic similarity dendrograms showed low correlation between the two marker systems. The microsatellite dendrogram grouped genetically related accessions reasonably well, while the AFLP dendrogram showed good clustering of closely related accessions and, additionally, separated two geographically distinct hop germplasms. The results of microsatellite and AFLP analysis are discussed from the point of view of the applicability of

  4. A species-specific primer pair for distinguishing between Paramisgurnus dabryanus and Misgurnus anguillicaudatus based on mitochondrial DNA polymorphisms.

    PubMed

    Liu, Yongfu; Hou, Jilun; Wang, Guixing; Zhang, Xiaoyan; Liu, Haijin

    2016-07-01

    Paramisgurnus dabryanus and Misgurnus anguillicaudatus (family Cobitidae) are loaches with high morphological similarity. In this study, we designed primers to distinguish between Paramisgurnus dabryanus and Misgurnus anguillicaudatus based on the length differences in the mitochondrial COXII to tRNA(Lys) gene region. Samples of P. dabryanus and M. anguillicaudatus from different geographical locations were collected and amplified to verify primer specificity. The results of electrophoresis revealed the successful amplification of all P. dabryanus and M. anguillicaudatus DNA samples, which had distinct, specific-specific sizes (214 bp for P. dabryanus and 285 bp for M. anguillicaudatus). In conclusion, the new primers provide fast, reliable, and accurate identification between P. dabryanus and M. anguillicaudatus.

  5. Genetic Relationships of Aglaonema Species and Cultivars Inferred from AFLP Markers

    PubMed Central

    CHEN, JIANJUN; DEVANAND, PACHANOOR S.; NORMAN, DAVID J.; HENNY, RICHARD J.; CHAO, CHIH‐CHENG T.

    2004-01-01

    • Background and Aims Aglaonema is an important ornamental foliage plant genus, but genetic relationships among its species and cultivars have not been reported. This study analysed genetic relatedness of 54 cultivars derived from nine species using amplified fragment length polymorphism (AFLP) markers. • Methods Initially, 48 EcoRI + 2/MseI + 3 primer set combinations were screened, from which six primer sets that showed clear scoreable and highly polymorphic fragments were selected and used for AFLP reactions. AFLP fragments were scored and entered into a binary data matrix as discrete variables. Jaccard’s coefficient of similarity was calculated for all pair‐wise comparisons among the 54 cultivars, and a dendrogram was constructed by the unweighted pair‐group method using the arithmetic average (UPGMA). • Key Results The number of AFLP fragments generated per primer set ranged from 59 to 112 with fragment sizes varying from 50 to 565 bp. A total of 449 AFLP fragments was detected, of which 314 were polymorphic (70 %). All cultivars were clearly differentiated by their AFLP fingerprints. The 54 cultivars were divided into seven clusters; cultivars within each cluster generally share similar morphological characteristics. Cluster I contains 35 cultivars, most of them are interspecific hybrids developed mainly from A. commutatum, A. crispum or A. nitidum. However, Jaccard’s similarity coefficients among these hybrids are 0·84 or higher, suggesting that these popular hybrid cultivars are genetically much closer than previously thought. This genetic similarity may imply that A. nitidum and A. crispum are likely progenitors of A. commutatum. • Conclusions Results of this study demonstrate the efficiency and ease of using AFLP markers for investigating genetic relationships of ornamental foliage plants, a group usually propagated vegetatively. The AFLP markers developed will help future Aglaonema cultivar identification, germplasm conservation and

  6. Population genetic structure in apricot (Prunus armeniaca L.) cultivars revealed by fluorescent-AFLP markers in southern Xinjiang, China.

    PubMed

    Yuan, Zhaohe; Chen, Xuesen; He, Tianming; Feng, Jianrong; Feng, Tao; Zhang, Chunyu

    2007-11-01

    Population-wide genetic structure was studied using fluorescent-AFLP markers on 85 apricot (Prunus armeniaca L.) cultivars collected from Kuche, Kashi, Hetian in the Tarim Basin, southern Xinjiang Uygur Autonomous Region of China. The purpose of this study was to determine the genetic structure and genotypic diversity among the different eco-geographical populations. Based on the results from this study, 8 pairs of fluorescent-AFLP primers showed clear electrophoregram and high polymorphism amongst the 64 pairs of EcoR|/Mse|(Mse|--a FAM fluorescent marked primer) primers screened. There was a significant polymorphic difference for the same primer pair in different populations and for the same population with different primer pairs. The percentage of polymorphic loci (P) at species level was higher than Kuche, Hetian, Kashi population levels, respectively. The Nei's gene diversity index (H) and Shannon's information index (I) at species level were higher than those of Kuche, Hetian, and Kashi at population level, respectively. H and I of Kuche population were the highest amongst the three populations. Apricot population genetic diversity was found mainly within the population. Genetic differentiation coefficient between populations (G(ST)) was 0.0882. Gene flow Nm between the populations was 5.1689. Population genetic identity was between 0.9772-0.9811 and genetic distance was between 0.0191-0.0232. These results further indicated that the similarity between populations was higher and the genetic distance between populations was smaller. The UPGMA cluster analysis indicates that the geographical populations at Kuche, Kashi, Hetian were relatively independent Mendelian populations. Concurrently, there was also partial gene exchange between the populations. All the evidences indicated that the genetic diversity in Kuche population was the highest, suggesting that it could be a transition population from wild apricot to cultivated apricot. There were abundant genetic

  7. A new and versatile method for the successful conversion of AFLP markers into simple single locus markers

    PubMed Central

    Brugmans, Bart; van der Hulst, Ron G. M.; Visser, Richard G. F.; Lindhout, Pim; van Eck, Herman J.

    2003-01-01

    Genetic markers can efficiently be obtained by using amplified fragment length polymorphism (AFLP) fingerprinting because no prior information on DNA sequence is required. However, the conversion of AFLP markers from complex fingerprints into simple single locus assays is perceived as problematic because DNA sequence information is required for the design of new locus-specific PCR primers. In addition, single locus polymorphism (SNP) information is required to design an allele-specific assay. This paper describes a new and versatile method for the conversion of AFLP markers into simple assays. The protocol presented in this paper offers solutions for frequently occurring pitfalls and describes a procedure for the identification of the SNP responsible for the AFLP. By following this approach, a high success rate for the conversion of AFLP markers into locus-specific markers was obtained. PMID:12736321

  8. RFLP and AFLP analysis of inter- and intraspecific variation of Brassica rapa and B. napus shows that B. rapa is an important genetic resource for B. napus improvement.

    PubMed

    Liu, Ren-Hu; Meng, Jin-Ling

    2006-09-01

    Fingerprinting of 29 accessions of oilseed rape, including seven accessions of Brassica napus, and 22 accessions of B. rapa (B. campestris) from Europe, North America, and China was analyzed using RFLP and AFLP markers. In total, 1,477 polymorphic RFLP bands and 183 polymorphic AFLP bands from 166 enzyme-probe combinations and two pairs of AFLP primers, respectively, were scored for the 29 accessions. On average, RFLP analysis showed that the Arabidopsis EST probe detected more polymorphic bands in Brassica than the random genomic probe performed. More polymorphic RFLP markers were detected with the digestion of EcoR I or BamH I than HindIII. According to the number of bands amplified from each accession, the copy numbers of each gene in the genomes of B. rapa and B. napus were estimated. The average copy numbers in B. rapa of China, B. rapa of Europe, and B. napus, were 3.2, 3.1, and 2.9, respectively. Genetic distance based on the AFLP data was well correlated with that based on the RFLP data (r = 0.72, P<0.001), but 0.39 smaller on average. Genetic diversity analysis showed that Chinese B. rapa was more polymorphic than Chinese B. napus and European materials. Some European B. napus accessions were clustered into European B. rapa, which were distinctly different from Chinese B. napus. The larger variations of Chinese accessions of B. rapa suggest that they are valuable in oilseed rape breeding. Novel strategies to use intersubgenomic heterosis between genome of B. rapa (A(r)A(r)) and genome of B. napus (A(n)A(n)C(n)C(n)) were elucidated.

  9. Genetic variation in wild populations of the tuber crop Amorphophallus konjac (Araceae) in central China as revealed by AFLP markers.

    PubMed

    Pan, C; Gichira, A W; Chen, J M

    2015-01-01

    Amorphophallus konjac is an economically important crop. In order to provide baseline information for sustainable development and conservation of the wild plant resources of A. konjac, we studied the genetic diversity and population structure of this species using amplified fragment length polymorphism (AFLP) molecular markers. We sampled 139 individuals from 10 wild populations of A. konjac in central China. Using five AFLP primer combinations, we scored a total of 270 DNA fragments, most of which were polymorphic (98.2%). Percentage of polymorphic loci, Nei's genetic diversity index, and Shannon's information index showed high levels of genetic variation within A. konjac populations. Analysis of molecular variance indicated that most of the variance (68%) resided within populations. The coefficient of genetic differentiation between populations was 0.348 and the estimated gene flow was 0.469, indicating that there was limited gene flow among the populations. Unweighted pair group method with arithmetic mean cluster analysis and principal coordinates analysis indicated that geographically close populations were more likely to cluster together. The Mantel test revealed a significant correlation between geographic and genetic distances (R2 = 0.2521, P < 0.05). The special insect-pollination system of A. konjac and the complex geography of central China are likely to have contributed to the current pattern of genetic variation of this species. In the present study, we provide several suggestions on the future protection of the wild plant genetic resources of A. konjac. PMID:26782525

  10. AFLP analysis of genetic variation among three natural populations of horseshoe crab Tachypleus tridentatus along Chinese coast

    NASA Astrophysics Data System (ADS)

    Xu, Qian; Chen, Fei; Shin, Paul K. S.; Cheung, S. G.; Chen, Yan; Ke, Caihuan

    2011-03-01

    The AFLP (amplified fragment length polymorphism) technique was used to analyze and compare the genetic diversity of Tachypleus tridentatus from three south-eastern coastal sites of China (Pingtan, Hong Kong and Beihai). Eight pairs of primers generated 361 loci, including 285 polymorphic loci. The ratio of polymorphic loci was 96.97%. Nei's genetic diversity index was 0.420 8 and the Shannon information index was 0.607 5, both of which were higher than that reported for many other arthropods. These results show that the genetic diversity detected was mainly caused by individual differences within a population. Genetic distance showed that the rational division of the three geographic populations of T. tridentatus along the south-eastern coast of China was not significant, in which the genetic distance was not proportional to the geographic distance. All three horseshoe crab populations may belong to a large group, and had a high degree of genetic similarity. The high level of genetic diversity obtained from the present AFLP analysis may be due to the large effective population size of the species in Chinese waters.

  11. Designing Polymerase Chain Reaction Primers Using Primer3Plus.

    PubMed

    Hung, Jui-Hung; Weng, Zhiping

    2016-01-01

    Designing oligonucleotide primers is a crucial step for successful molecular biology experiments that require the use of the polymerase chain reaction (PCR). PCR involves cycles of three steps: denaturation, annealing, and extension. During denaturation, double-stranded DNA (dsDNA) molecules (templates) are separated into single strands. During annealing, a pair of primers is annealed to the complementary regions of the single-stranded molecules. In the extension step, DNA polymerase extends the primers to produce DNA molecules that correspond to the region bracketed by the primers (the amplicons). All of these steps are temperature sensitive, and the common choice of temperatures is 94°C, 60°C, and 70°C, respectively. Poorly designed primers may lead to no amplification product or additional undesired amplified fragments. The goals of primer design include good primer specificity, high annealing efficiency, appropriate melting temperature, proper GC content, and the prevention of primer hairpins or primer dimers. PMID:27574202

  12. Genetic analyses of captive Alala (Corvus hawaiiensis) using AFLP analyses

    USGS Publications Warehouse

    Jarvi, Susan I.; Bianchi, Kiara R.

    2006-01-01

    affected by the mutation rate at microsatellite loci, thus introducing a bias. Also, the number of loci that can be studied is frequently limited to fewer than 10. This theoretically represents a maximum of one marker for each of 10 chromosomes. Dominant markers like AFLP allow a larger fraction of the genome to be screened. Large numbers of loci can be screened by AFLP to resolve very small individual differences that can be used for identification of individuals, estimates of pairwise relatedness and, in some cases, for parentage analyses. Since AFLP is a dominant marker (can not distinguish between +/+ homozygote versus +/- heterozygote), it has limitations for parentage analyses. Only when both parents are homozygous for the absence of alleles (-/-) and offspring show a presence (+/+ or +/-) can the parents be excluded. In this case, microsatellites become preferable as they have the potential to exclude individual parents when the other parent is unknown. Another limitation of AFLP is that the loci are generally less polymorphic (only two alleles/locus) than microsatellite loci (often >10 alleles/locus). While generally fewer than 10 highly polymorphic microsatellite loci are enough to exclude and assign parentage, it might require up to 100 or more AFLP loci. While there are pros and cons to different methodologies, the total number of loci evaluated by AFLP generally offsets the limitations imposed due to the dominant nature of this approach and end results between methods are generally comparable. Overall objectives of this study were to evaluate the level of genetic diversity in the captive population of Alala, to compare genetic data with currently available pedigree information, and to determine the extent of relatedness of mating pairs and among founding individuals.

  13. Improved coverage of cDNA-AFLP by sequential digestion of immobilized cDNA

    PubMed Central

    Weiberg, Arne; Pöhler, Dirk; Morgenstern, Burkhard; Karlovsky, Petr

    2008-01-01

    Background cDNA-AFLP is a transcriptomics technique which does not require prior sequence information and can therefore be used as a gene discovery tool. The method is based on selective amplification of cDNA fragments generated by restriction endonucleases, electrophoretic separation of the products and comparison of the band patterns between treated samples and controls. Unequal distribution of restriction sites used to generate cDNA fragments negatively affects the performance of cDNA-AFLP. Some transcripts are represented by more than one fragment while other escape detection, causing redundancy and reducing the coverage of the analysis, respectively. Results With the goal of improving the coverage of cDNA-AFLP without increasing its redundancy, we designed a modified cDNA-AFLP protocol. Immobilized cDNA is sequentially digested with several restriction endonucleases and the released DNA fragments are collected in mutually exclusive pools. To investigate the performance of the protocol, software tool MECS (Multiple Enzyme cDNA-AFLP Simulation) was written in Perl. cDNA-AFLP protocols described in the literatur and the new sequential digestion protocol were simulated on sets of cDNA sequences from mouse, human and Arabidopsis thaliana. The redundancy and coverage, the total number of PCR reactions, and the average fragment length were calculated for each protocol and cDNA set. Conclusion Simulation revealed that sequential digestion of immobilized cDNA followed by the partitioning of released fragments into mutually exclusive pools outperformed other cDNA-AFLP protocols in terms of coverage, redundancy, fragment length, and the total number of PCRs. Primers generating 30 to 70 amplicons per PCR provided the highest fraction of electrophoretically distinguishable fragments suitable for normalization. For A. thaliana, human and mice transcriptome, the use of two marking enzymes and three sequentially applied releasing enzymes for each of the marking enzymes is

  14. Fluorescence-based AFLPs occur as the most suitable marker system for oilseed rape cultivar identification.

    PubMed

    Sobotka, Roman; Dolanská, Lenka; Curn, Vladislav; Ovesná, Jaroslava

    2004-01-01

    Three different types of molecular markers, RAPD, SSR and fluorescence-based AFLP, were evaluated and compared for their ability to identify oilseed rape cultivars. The direct comparison of RAPD, SSR and AFLP approaches in cultivar identification showed that the AFLP methodology detected polymorphisms more efficiently than either RAPD or SSR methods. For the characterisation of six oilseed rape cultivars, 60 RAPD primers were tested and only eight of them (14%) detected sufficient levels of polymorphism. Five microsatellites out of fifteen tested were polymorphic, but in all loci, except one, only two different alleles were detected. This result indicated the limited degree of polymorphism found in Brassica napus. Each of the six tested AFLP combinations detected polymorphisms, the best combination (M-CAA/E-ACT) had 26% polymorphic peaks from a total of 90 peaks and could distinguish the analysed cultivars and 4 out of 5 core lines of cultivars. The results presented show that florescence-based AFLP is, for the purposes of oilseed rape cultivar fingerprinting, a more suitable approach than either RAPD or SSR.

  15. Selection of primers for polymerase chain reaction.

    PubMed

    Rychlik, W

    1995-04-01

    One of the most important factors affecting the quality of PCR is the choice of primers. In general, the longer the PCR product the more difficult it is to select efficient primers and set appropriate designing primers, and in general, the more DNA sequence information is available, the better the chance of finding an optimal primer pair. Efficient primers can be designed by avoiding the following flaws: primer-dimer formation, self-complementarity, too low Tm of the primers, and/or their incorrect internal stability profile. Tips on subcloning PCR products, calculating duplex stability (predicting dimer formation strength), and designing degenerate primers are given.

  16. AFLP diversity in the common vetch ( Vicia sativa L.) on the world scale.

    PubMed

    Potokina, E.; Blattner, R.; Alexandrova, T.; Bachmann, K.

    2002-07-01

    The Vavilov Institute of Plant Industry (VIR) keeps a living seed collection of about 700 accessions of landraces and local cultivars of common vetch ( Vicia sativa L.) that have been collected over a period of more than 50 years throughout the former USSR. Much of the material is available nowhere else. The collection of this economically important fodder crop is well adapted to the various growing regions of Russia and serves as a basis for the all domestic vetch breeding programs. Using AFLP as a DNA fingerprinting method we investigated 673 accessions from the VIR and compared their genetic variability with that of the worldwide vetch collection of the Institut für Pflanzengenetik und Kulturpflanzenforschung (IPK), 450 accessions. The analysis is a first assessment of the intra-specific diversity of V. sativa stored ex situ on a scale of more than 1,000 accessions. Six primer combinations, which gave clear polymorphic amplification products with 96 test samples, were chosen from 111 primer combinations tested. The selected AFLP primers used to analyse the V. sativa intra-specific diversity resulted in 70 unequivocally recognizable polymorphic fragments. We found that all of the AFLP fragments generated can be detected with varying frequency throughout the entire distribution area of V. sativa. The difference in frequency of some AFLP fragments between the regions may amount to 90%. The arrangement of most of the accessions in all dendrograms reflects their geographical origin, with a differentiation between Russia, Western Europe, Turkey and Bulgaria, and the Mediterranean. The "Russian" genepool stored at the IPK is a limited and biased sample of the available diversity when compared to the material stored at the VIR. Approximately 10-15% of the accessions in each geographical group showed AFLP patterns that clustered with members of other groups. This appreciable overlap raises several questions: (1) to which degree is an AFLP pattern representative of the

  17. Highly Informative Single-Copy Nuclear Microsatellite DNA Markers Developed Using an AFLP-SSR Approach in Black Spruce (Picea mariana) and Red Spruce (P. rubens)

    PubMed Central

    Shi, Yong-Zhong; Forneris, Natascha; Rajora, Om P.

    2014-01-01

    Background Microsatellites or simple sequence repeats (SSRs) are highly informative molecular markers for various biological studies in plants. In spruce (Picea) and other conifers, the development of single-copy polymorphic genomic microsatellite markers is quite difficult, owing primarily to the large genome size and predominance of repetitive DNA sequences throughout the genome. We have developed highly informative single-locus genomic microsatellite markers in black spruce (Picea mariana) and red spruce (Picea rubens) using a simple but efficient method based on a combination of AFLP and microsatellite technologies. Principal Findings A microsatellite-enriched library was constructed from genomic AFLP DNA fragments of black spruce. Sequencing of the 108 putative SSR-containing clones provided 94 unique sequences with microsatellites. Twenty-two of the designed 34 primer pairs yielded scorable amplicons, with single-locus patterns. Fourteen of these microsatellite markers were characterized in 30 black spruce and 30 red spruce individuals drawn from many populations. The number of alleles at a polymorphic locus ranged from 2 to 18, with a mean of 9.3 in black spruce, and from 3 to 15, with a mean of 6.2 alleles in red spruce. The polymorphic information content or expected heterozygosity ranged from 0.340 to 0.909 (mean = 0.67) in black spruce and from 0.161 to 0.851 (mean = 0.62) in red spruce. Ten SSR markers showing inter-parental polymorphism inherited in a single-locus Mendelian mode, with two cases of distorted segregation. Primer pairs for almost all polymorphic SSR loci resolved microsatellites of comparable size in Picea glauca, P. engelmannii, P. sitchensis, and P. abies. Significance The AFLP-based microsatellite-enriched library appears to be a rapid, cost-effective approach for isolating and developing single-locus informative genomic microsatellite markers in black spruce. The markers developed should be useful in black spruce, red spruce

  18. AFLP studies on downy-mildew-resistant and downy-mildew-susceptible genotypes of opium poppy.

    PubMed

    Dubey, Mukesh K; Shasany, Ajit K; Dhawan, Om P; Shukla, Ashutosh K; Khanuja, Suman P S

    2010-04-01

    Downy mildew (DM) caused by Peronospora arborescens, is a serious disease in opium poppy (Papaver somniferum), which has a world-wide spread. The establishment of DM-resistant cultivars appears to be a sustainable way to control the In this paper, we present the results of a study aimed at the identification of amplified fragment length polymorphism (AFLP) markers for DM-resistance in opium poppy. Three opium poppy genotypes (inbred over about 10 years): Pps-1 (DM-resistant), Jawahar-16 (DM-susceptible) and H-9 (DM-susceptible) were crossed in a diallel manner and the F(1) progeny along with the parents were subjected to AFLP analysis of chloroplast (cp) and nuclear DNA with seven and nine EcoRI / MseI primer combinations, respectively. cpDNA AFLP analysis identified 24 Pps-1 (DM-resistant)-specific unique fragments that were found to be maternally inherited in both the crosses, Pps-1 x Jawahar-16 and Pps-1 x H-9. In the case of nuclear DNA AFLP analysis, it was found that 17 fragments inherited from Pps-1 were common to the reciprocal crosses of both (i) Pps-1 and Jawahar-16 as well as (ii) Pps-1 and H-9. This is the first molecular investigation on the identification of polymorphism between DM-resistant and DM-susceptible opium poppy genotypes and development of DM-resistant opium poppy genotypespecific AFLP markers. These AFLP markers could be used in future genetic studies for analysis of linkage to the downy mildew resistance trait.

  19. BatchPrimer3: A high throughput web application for PCR and sequencing primer design

    PubMed Central

    You, Frank M; Huo, Naxin; Gu, Yong Qiang; Luo, Ming-cheng; Ma, Yaqin; Hane, Dave; Lazo, Gerard R; Dvorak, Jan; Anderson, Olin D

    2008-01-01

    Background Microsatellite (simple sequence repeat – SSR) and single nucleotide polymorphism (SNP) markers are two types of important genetic markers useful in genetic mapping and genotyping. Often, large-scale genomic research projects require high-throughput computer-assisted primer design. Numerous such web-based or standard-alone programs for PCR primer design are available but vary in quality and functionality. In particular, most programs lack batch primer design capability. Such a high-throughput software tool for designing SSR flanking primers and SNP genotyping primers is increasingly demanded. Results A new web primer design program, BatchPrimer3, is developed based on Primer3. BatchPrimer3 adopted the Primer3 core program as a major primer design engine to choose the best primer pairs. A new score-based primer picking module is incorporated into BatchPrimer3 and used to pick position-restricted primers. BatchPrimer3 v1.0 implements several types of primer designs including generic primers, SSR primers together with SSR detection, and SNP genotyping primers (including single-base extension primers, allele-specific primers, and tetra-primers for tetra-primer ARMS PCR), as well as DNA sequencing primers. DNA sequences in FASTA format can be batch read into the program. The basic information of input sequences, as a reference of parameter setting of primer design, can be obtained by pre-analysis of sequences. The input sequences can be pre-processed and masked to exclude and/or include specific regions, or set targets for different primer design purposes as in Primer3Web and primer3Plus. A tab-delimited or Excel-formatted primer output also greatly facilitates the subsequent primer-ordering process. Thousands of primers, including wheat conserved intron-flanking primers, wheat genome-specific SNP genotyping primers, and Brachypodium SSR flanking primers in several genome projects have been designed using the program and validated in several laboratories

  20. Comparison of Flavivirus Universal Primer Pairs and Development of a Rapid, Highly Sensitive Heminested Reverse Transcription-PCR Assay for Detection of Flaviviruses Targeted to a Conserved Region of the NS5 Gene Sequences

    PubMed Central

    Scaramozzino, Natale; Crance, Jean-Marc; Jouan, Alain; DeBriel, Dominique A.; Stoll, Françoise; Garin, Daniel

    2001-01-01

    Arthropod-transmitted flaviviruses are responsible for considerable morbidity and mortality, causing severe encephalitic, hemorrhagic, and febrile illnesses in humans. Because there are no specific clinical symptoms for infection by a determined virus and because different arboviruses could be present in the same area, a genus diagnosis by PCR would be a useful first-line diagnostic method. The six published Flavivirus genus primer pairs localized in the NS1, NS3, NS5, and 3′ NC regions were evaluated in terms of specificity and sensitivity with flaviviruses (including the main viruses pathogenic for humans) at a titer of 105 50% tissue culture infectious doses (TCID50s) ml−1 with a common identification step by agarose gel electrophoresis. Only one NS5 primer pair allowed the detection of all tested flaviviruses with the sensitivity limit of 105 TCID50s ml−1. Using a heminested PCR with new primers designed in the same region after an alignment of 30 different flaviviruses, the sensitivity of reverse transcription-PCR was improved and allowed the detection of about 200 infectious doses ml−1 with all of the tick- and mosquito-borne flaviviruses tested. It was confirmed that the sequenced amplified products in the NS5 region allowed predictability of flavivirus species by dendrogram, including the New York 99 West Nile strain. This technique was successfully performed with a cerebrospinal fluid sample from a patient hospitalized with West Nile virus encephalitis. PMID:11326014

  1. Genetic relationships among wild Felidae in Thailand using AFLP markers.

    PubMed

    Srisamoot, Nattapong; Chaveerach, Arunrat; Nuchadomrong, Suporn; Sattayasai, Nison; Chaveerach, Prapansak; Tanomtong, Alongkoad; Pinthong, Krit

    2007-08-15

    The cytogenetics of eight Felidae species in Thailand were investigated by the colchicines-hypotonic fixation-air drying technique followed by a conventional technique. All species studied have an identical number of 38 diploid chromosomes, indicating a close genetic relationship among species. At a deep study level, the genetic relationships of eight Felidae species were accessed by the AFLP method. Blood samples were collected from sources locating in their original regions for DNA extraction. With ten successful primer combinations, a total of 4208 scorable bands were generated. Of these bands, 18.91% are polymorphic. Percentages of Polymorphic Bands (PPB) for each primer combination range from 15.00 to 23.59%. The generating bands were used for dendrogram construction. The average genetic similarity values among all Felidae species are 68.20% (between Panthera tigris and Neofelis nebulosa) to 85.53% (between Prionailurus bengalensis and Prionailurus viverrinus). The dendrogram shows that the eight Felidae species were clustered together and the subfamily Pantherinae and Felinae with Neofelis nebulosa are distinguished. The Felinae, Prionailurus bengalensis, Prionailurus viverrinus, Catopuma temminckii, Felis chaus, Pardofelis marmorata and Neofelis nebulosa were clustered together with 91% bootstrap support and the Pantherinae, Panthera pardus is clustered with Panthera tigris with 92% bootstrap support. In summary, the ten successful primer combinations can be used to determine genetic differences among eight Thailand Felidae species. PMID:19070075

  2. Phylogenetic relationships in the genus Leontopodium (Asteraceae: Gnaphalieae) based on AFLP data

    PubMed Central

    SAFER, STEFAN; TREMETSBERGER, KARIN; GUO, YAN-PING; KOHL, GUDRUN; SAMUEL, MARY R.; STUESSY, TOD F.; STUPPNER, HERMANN

    2012-01-01

    The genus Leontopodium comprises 30–41 species. The centre of diversity is the Sino-Himalayan region in south-western China, where about 15 species occur. The two species native to Europe, L. alpinum (known as the common ‘Edelweiss’) and L. nivale, are part of the cultural heritage of the people living there. Despite its importance, very little is known about the systematics of the genus. Because recent molecular studies have shown that species within this genus are closely related and difficult to distinguish with rDNA and cpDNA data, we used AFLPs to obtain a more detailed understanding of the phylogeny of the genus. Our main aims were as follows: (1) to clarify species relationships within the genus; and (2) to reveal information about the biogeography of the genus. We used AFLPs with six primer combinations to investigate 216 individuals in 38 populations of 16 different species. With AFLPs, we were able to recognize 10 different groups, all of which had strong bootstrap support. These results were also congruent with the morphology-based taxonomy of the genus. Most private and rare fragments were found in the Yunnan region (south-western China) relative to Europe and Mongolia/central China, suggesting a long-lasting in situ history of populations in the centre of diversity of the genus. Our results illustrate the utility of AFLPs to resolve phylogenetic relationships between these closely related species. PMID:23258943

  3. AFLP fingerprinting of tartary buckwheat accessions (Fagopyrum tataricum) displaying rutin content variation.

    PubMed

    Gupta, Nidhi; Sharma, Sunil K; Rana, Jai C; Chauhan, Rajinder S

    2012-09-01

    In light of the economic importance of buckwheat as well as existence of enormous accessions of Fagopyrum species in the Himalayan regions of India, the characterization of tartary buckwheat for rutin content variation vis-à-vis DNA fingerprinting was undertaken so as to identify fingerprint profiles unique to high rutin content accessions. Rutin content analysis in mature seeds of 195 accessions of Fagopyrum tataricum showed a wide range of variation (6 μg/mg to 30 μg/mg D.W.) with most of the accessions (81%) containing 10-16 μg/mg of rutin followed by 14% accessions with significantly higher rutin content (17 μg/mg to 30 μg/mg) and 5% accessions with low rutin content (≤10 μg/mg). AFLP fingerprinting of 18 accessions having high (≥17 μg/mg) and low rutin content (≤10 μg/mg) with 19 EcoRI/MseI primer combinations yielded 136 polymorphic fragments out of total 907. The hierarchical and model-based cluster analyses of AFLP data strongly suggested that the 18 populations of F. tataricum were clustered into two separate groups. The high and low rutin content accessions were clustered into two separate groups based on AFLP fingerprinting. The AFLP fingerprints associated with high rutin content accessions of F. tataricum are expected to be useful for evaluation, conservation and genetic improvement of buckwheat.

  4. Genomic distribution of AFLP markers relative to gene locations for different eukaryotic species

    PubMed Central

    2013-01-01

    Background Amplified fragment length polymorphism (AFLP) markers are frequently used for a wide range of studies, such as genome-wide mapping, population genetic diversity estimation, hybridization and introgression studies, phylogenetic analyses, and detection of signatures of selection. An important issue to be addressed for some of these fields is the distribution of the markers across the genome, particularly in relation to gene sequences. Results Using in-silico restriction fragment analysis of the genomes of nine eukaryotic species we characterise the distribution of AFLP fragments across the genome and, particularly, in relation to gene locations. First, we identify the physical position of markers across the chromosomes of all species. An observed accumulation of fragments around (peri) centromeric regions in some species is produced by repeated sequences, and this accumulation disappears when AFLP bands rather than fragments are considered. Second, we calculate the percentage of AFLP markers positioned within gene sequences. For the typical EcoRI/MseI enzyme pair, this ranges between 28 and 87% and is usually larger than that expected by chance because of the higher GC content of gene sequences relative to intergenic ones. In agreement with this, the use of enzyme pairs with GC-rich restriction sites substantially increases the above percentages. For example, using the enzyme system SacI/HpaII, 86% of AFLP markers are located within gene sequences in A. thaliana, and 100% of markers in Plasmodium falciparun. We further find that for a typical trait controlled by 50 genes of average size, if 1000 AFLPs are used in a study, the number of those within 1 kb distance from any of the genes would be only about 1–2, and only about 50% of the genes would have markers within that distance. Conclusions The high coverage of AFLP markers across the genomes and the high proportion of markers within or close to gene sequences make them suitable for genome scans and

  5. Development of a SCAR marker for male gametophyte of Gracilariopsis lemaneiformis based on AFLP technique

    NASA Astrophysics Data System (ADS)

    Zhou, Wei; Ding, Hongye; Sui, Zhenghong; Wang, Zhongxia; Wang, Jinguo

    2014-05-01

    The red alga Gracilariopsis lemaneiformis (Bory) is an economically valuable macroalgae. As a means to identify the sex of immature Gracilariopsis lemaneiformis, the amplified fragment length polymorphism (AFLP) technique was used to search for possible sex- or phase-related markers in male gametophytes, female gametophytes, and tetrasporophytes, respectively. Seven AFLP selective amplification primers were used in this study. The primer combination E-TG/M-CCA detected a specific band linked to male gametophytes. The DNA fragment was recovered and a 402-bp fragment was sequenced. However, no DNA sequence match was found in public databases. Sequence characterized amplified region (SCAR) primers were designed from the sequence to test the repeatability of the relationship to the sex, using 69 male gametophytes, 139 female gametophytes, and 47 tetrasporophytes. The test results demonstrate a good linkage and repeatability of the SCAR marker to sex. The SCAR primers developed in this study could reduce the time required for sex identification of Gracilariopsis lemaneiformis by four to six months. This can reduce both the time investment and number of specimens required in breeding experiments.

  6. Genetic Comparison of B. Anthracis and its Close Relatives Using AFLP and PCR Analysis

    SciTech Connect

    Jackson, P.J.; Hill, K.K.; Laker, M.T.; Ticknor, L.O.; Keim, P.S.

    1999-02-01

    rapidly generated by other means. AFLP sample analysis quickly generates a very large amount of molecular information about microbial genomes. However, this information cannot be analyzed rapidly using manual methods. The authors are developing a large archive of electronic AFLP signatures that is being used to identify isolates collected from medical, veterinary, forensic and environmental samples. They are also developing the computational packages necessary to rapidly and unambiguously analyze the AFLP profiles and conduct a phylogenetic comparison of these data relative to information already in the database. They will use this archive and the associated algorithms to determine the species identity of previously uncharacterized isolates and place them phylogenetically relative to other microbes based on their AFLP signatures. This study provides significant new information about microbes with environmental, veterinary and medical significance. This information can be used in further studies to understand the relationships among these species and the factors that distinguish them from one another. It should also allow identification of unique factors that contribute to important microbial traits including pathogenicity and virulence. They are also using AFLP data to identify, isolate and sequence DNA fragments that are unique to particular microbial species and strains. The fragment patterns and sequence information provide insights into the complexity and organization of bacterial genomes relative to one another. They also provide the information necessary for development of species-specific PCR primers that can be used to interrogate complex samples for the presence of B. anthracis, other microbial pathogens or their remnants.

  7. Genetic diversity of populations and clones of Rhopilema esculentum in China based on AFLP analysis

    NASA Astrophysics Data System (ADS)

    Qiao, Hongjin; Liu, Xiangquan; Zhang, Xijia; Jiang, Haibin; Wang, Jiying; Zhang, Limin

    2013-03-01

    Amplified fragment length polymorphisms (AFLP) markers were developed to assess the genetic variation of populations and clones of Rhopilema esculentum Kishinouye (Scyphozoa, Rhizostomatidae). One hundred and seventy-nine loci from 56 individuals of two hatchery populations and two wild populations were genotyped with five primer combinations. The polymorphic ratio, Shannon's diversity index and average heterozygosity were 70.3%, 0.346 and 0.228 for the white hatchery population, 74.3%, 0.313, and 0.201 for the red hatchery population, 79.3%, 0.349, and 0.224 for the Jiangsu wild population, and 74.9%, 0.328 and 0.210 for the Penglai wild population, respectively. Thus, all populations had a relatively high level of genetic diversity. A specific band was identified that could separate the white from the red hatchery population. There was 84.85% genetic differentiation within populations. Individual cluster analysis using unweighted pair-group method with arithmetic mean (UPGMA) suggested that hatchery populations and wild populations could be divided. For the hatchery populations, the white and red populations clustered separately; however, for the wild populations, Penglai and Jiangsu populations clustered together. The genetic diversity at the clone level was also determined. Our data suggest that there are relatively high genetic diversities within populations but low genetic differentiation between populations, which may be related to the long-term use of germplasm resources from Jiangsu Province for artificial seeding and releasing. These findings will benefit the artificial seeding and conservation of the germplasm resources.

  8. Phonics Primer

    ERIC Educational Resources Information Center

    Elam, Sandra

    2007-01-01

    This primer lists the 44 sounds in the English language and then gives steps for teaching those 44 sounds and their most common spelling patterns. In addition to learning sounds and spellings, each day the student must read lists of phonetically related words and spell these words from dictation. Phonics instruction must be reinforced by having…

  9. Characterizing Safflower Germplasm with AFLP Molecular Markers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Safflower (Carthamus tinctorius L.) accessions from the U.S. germplasm collection were characterized using AFLP (Amplified Length Polymorphisms) markers. Separation and scoring of 392 markers was completed using the Beckman CEQ8000 capillary electrophoresis system. Twelve plants from each of eight...

  10. Comparison of RAPD, ISSR, and AFLP Molecular Markers to Reveal and Classify Orchardgrass (Dactylis glomerata L.) Germplasm Variations.

    PubMed

    Costa, Rita; Pereira, Graça; Garrido, Inmaculada; Tavares-de-Sousa, Manuel María; Espinosa, Francisco

    2016-01-01

    Three different DNA-based techniques, Random Amplified Polymorphic DNA (RAPD), Inter Simple Sequence Repeat (ISSR) and Amplified Fragment Length Polymorphism (AFLP) markers, were used for fingerprinting Dactylis glomerata genotypes and for detecting genetic variation between the three different subspecies. In this study, RAPD assays produced 97 bands, of which 40 were polymorphic (41.2%). The ISSR primers amplified 91 bands, and 54 showed polymorphism (59.3%). Finally, the AFLP showed 100 bands, of which 92 were polymorphic (92%). The fragments were scored as present (1) or absent (0), and those readings were entered in a computer file as a binary matrix (one for each marker). Three cluster analyses were performed to express--in the form of dendrograms--the relationships among the genotypes and the genetic variability detected. All DNA-based techniques used were able to amplify all of the genotypes. There were highly significant correlation coefficients between cophenetic matrices based on the genetic distance for the RAPD, ISSR, AFLP, and combined RAPD-ISSR-AFLP data (0.68, 0.78, 0.70, and 0.70, respectively). Two hypotheses were formulated to explain these results; both of them are in agreement with the results obtained using these three types of molecular markers. We conclude that when we study genotypes close related, the analysis of variability could require more than one DNA-based technique; in fact, the genetic variation present in different sources could interfere or combine with the more or less polymorphic ability, as our results showed for RAPD, ISSR and AFLP markers. Our results indicate that AFLP seemed to be the best-suited molecular assay for fingerprinting and assessing genetic relationship among genotypes of Dactylis glomerata.

  11. Comparison of RAPD, ISSR, and AFLP Molecular Markers to Reveal and Classify Orchardgrass (Dactylis glomerata L.) Germplasm Variations

    PubMed Central

    Costa, Rita; Pereira, Graça; Garrido, Inmaculada; Tavares-de-Sousa, Manuel María; Espinosa, Francisco

    2016-01-01

    Three different DNA-based techniques, Random Amplified Polymorphic DNA (RAPD), Inter Simple Sequence Repeat (ISSR) and Amplified Fragment Length Polymorphism (AFLP) markers, were used for fingerprinting Dactylis glomerata genotypes and for detecting genetic variation between the three different subspecies. In this study, RAPD assays produced 97 bands, of which 40 were polymorphic (41.2%). The ISSR primers amplified 91 bands, and 54 showed polymorphism (59.3%). Finally, the AFLP showed 100 bands, of which 92 were polymorphic (92%). The fragments were scored as present (1) or absent (0), and those readings were entered in a computer file as a binary matrix (one for each marker). Three cluster analyses were performed to express–in the form of dendrograms–the relationships among the genotypes and the genetic variability detected. All DNA-based techniques used were able to amplify all of the genotypes. There were highly significant correlation coefficients between cophenetic matrices based on the genetic distance for the RAPD, ISSR, AFLP, and combined RAPD-ISSR-AFLP data (0.68, 0.78, 0.70, and 0.70, respectively). Two hypotheses were formulated to explain these results; both of them are in agreement with the results obtained using these three types of molecular markers. We conclude that when we study genotypes close related, the analysis of variability could require more than one DNA-based technique; in fact, the genetic variation present in different sources could interfere or combine with the more or less polymorphic ability, as our results showed for RAPD, ISSR and AFLP markers. Our results indicate that AFLP seemed to be the best-suited molecular assay for fingerprinting and assessing genetic relationship among genotypes of Dactylis glomerata. PMID:27070939

  12. Comparison of RAPD, ISSR, and AFLP Molecular Markers to Reveal and Classify Orchardgrass (Dactylis glomerata L.) Germplasm Variations.

    PubMed

    Costa, Rita; Pereira, Graça; Garrido, Inmaculada; Tavares-de-Sousa, Manuel María; Espinosa, Francisco

    2016-01-01

    Three different DNA-based techniques, Random Amplified Polymorphic DNA (RAPD), Inter Simple Sequence Repeat (ISSR) and Amplified Fragment Length Polymorphism (AFLP) markers, were used for fingerprinting Dactylis glomerata genotypes and for detecting genetic variation between the three different subspecies. In this study, RAPD assays produced 97 bands, of which 40 were polymorphic (41.2%). The ISSR primers amplified 91 bands, and 54 showed polymorphism (59.3%). Finally, the AFLP showed 100 bands, of which 92 were polymorphic (92%). The fragments were scored as present (1) or absent (0), and those readings were entered in a computer file as a binary matrix (one for each marker). Three cluster analyses were performed to express--in the form of dendrograms--the relationships among the genotypes and the genetic variability detected. All DNA-based techniques used were able to amplify all of the genotypes. There were highly significant correlation coefficients between cophenetic matrices based on the genetic distance for the RAPD, ISSR, AFLP, and combined RAPD-ISSR-AFLP data (0.68, 0.78, 0.70, and 0.70, respectively). Two hypotheses were formulated to explain these results; both of them are in agreement with the results obtained using these three types of molecular markers. We conclude that when we study genotypes close related, the analysis of variability could require more than one DNA-based technique; in fact, the genetic variation present in different sources could interfere or combine with the more or less polymorphic ability, as our results showed for RAPD, ISSR and AFLP markers. Our results indicate that AFLP seemed to be the best-suited molecular assay for fingerprinting and assessing genetic relationship among genotypes of Dactylis glomerata. PMID:27070939

  13. RATMAC PRIMER

    SciTech Connect

    Munn, R. J.; Stewart, J. M.; Norden, A. P.; Pagoaga, M. Katherine

    1980-10-01

    The language RATMAC is a direct descendant of one of the most successful structured FORTRAN languages, rational FORTRAN, RATFOR. RATMAC has all of the characteristics of RATFOR, but is augmented by a powerful recursive macro processor which is extremely useful in generating transportable FORTRAN programs. A macro is a collection of programming steps which are associated with a keyword. This keyword uniquely identifies the macro, and whenever it appears in a RATMAC program it is replaced by the collection of steps. This primer covers the language's control and decision structures, macros, file inclusion, symbolic constants, and error messages.

  14. Salinas primer.

    SciTech Connect

    Walsh, Timothy Francis; Reese, Garth M.; Bhardwaj, Manoj Kumar

    2004-08-01

    Salinas provides a massively parallel implementation of structural dynamics finite element analysis. This capability is required for high fidelity, validated models used in modal, vibration, static and shock analysis of weapons systems. General capabilities for modal, statics and transient dynamics are provided. Salinas is similar to commercial codes like Nastran or Abaqus. It has some nonlinear capability, but excels in linear computation. It is different than the above commercial codes in that it is designed to operate efficiently in a massively parallel environment. Even for an experienced analyst, running a new finite element package can be a challenge. This little primer is intended to make part of this task easier by presenting the basic steps in a simple way. The analyst is referred to the theory manual for details of the mathematics behind the work. The User's Notes should be used for more complex inputs, and will have more details about the process (as well as many more examples). More information can be found on our web pages, 3 or 4. Finite element analysis can be deceptive. Any software can give the wrong answers if used improperly, and occasionally even when used properly. Certainly a solid background in structural mechanics is necessary to build an adequate finite element model and interpret the results. This primer should provide a quick start in answering some of the more common questions that come up in using Salinas.

  15. fAFLP analysis of Brazilian Bacillus thuringiensis isolates.

    PubMed

    Valicente, Fernando Hercos; da Silva, Rosane Bezerra

    2014-01-01

    A total of 65 Bacillus thuringiensis (Bt) isolates were subjected to analysis of genetic relationship using fAFLP (fluorescent Fragment Length Polymorphism), in order to determine the genetic diversity within a group of Bt strains. 26 strains from different subspecies were identified as it follows: 9 kindly provided by the USDA (United States Department of Agriculture), 9 kindly provided by the Institute Pasteur and eight from Embrapa Maize and Sorghum Bt Collection, and 39 strains with no subspecies information also from Embrapa's Bt Collection. DNA sample was double digested with restriction enzymes EcoRI and MseI, and the fragments were linked to adapters. Selective amplification reactions were performed using five primer combinations and the amplified fragments were separated by gel electrophoresis on an ABI377 sequencer. Genetic distances were obtained by the complement of the Jaccard coefficient and the groups were performed by the UPGMA method. Five primer combinations generated 495 scorable fragments and 483 were found to be polymorphic. Out of 26 subspecies, strains 344 and T09 (B. thuringiensis subsp. tolworthi) showed the highest similarity (15%), while isolates HD3 B. thuringiensis subsp finitimus and T24 B. thuringiensis subsp neoleonensis were the most genetically distant (92%). B. thuringiensis isolates with no subspecies identification, found in samples from Goiás State showed higher similarity forming a group with an average distance of 6%, and the closest subspecies to this group was B. thuringiensis subsp thuringiensis (HD2) with 52% of similarity. This similarity may be due to the fact that these organism exchange genetic material by conjugation, and it is relatively common to have evolutionary characteristics of their ancestors.

  16. Genetic diversity of the Chinese traditional herb Blumea balsamifera (Asteraceae) based on AFLP markers.

    PubMed

    Pang, Y X; Wang, W Q; Zhang, Y B; Yuan, Y; Yu, J B; Zhu, M; Chen, Y Y

    2014-01-01

    Blumea balsamifera is a commercially important medicinal herb in China and other parts of Asia. It is used to produce borneol. This plant grows in the wild, but resources have diminished greatly in recent years. We examined the genetic diversity of this species to help develop conservation strategies; 35 plants from five provinces were analyzed using AFLPs. Eight AFLP primer combinations generated 1367 fragments, giving a mean of 172 fragments per primer combination. Polymorphism in the germplasm analysis was found for 1360 (99.48%) of the fragments, of which 264 (19.27%) fragments were unique (accession specific) and 423 (25.33%) of the fragments were rare (present in less than 10% of the accessions). The polymorphic fragments were used to group the accessions in a UPGMA phenogram. Most grouping was geographical. In general, accessions coming from Guizhou and Guangxi showed higher diversities as these accessions were scattered in different groups. The genetic distance estimated by Jaccard similarity coefficient index showed low variability among genotypes (coefficient value ranged from 0.60 to 0.95). More attention should be given to the study and conservation of the biodiversity of this economically important genus. PMID:24782086

  17. Toxigenic profile and AFLP variability of Alternaria alternata and Alternaria infectoria occurring on wheat

    PubMed Central

    Oviedo, María Silvina; Sturm, María Elena; Reynoso, María Marta; Chulze, Sofia Noemi; Ramirez, María Laura

    2013-01-01

    The objectives of this study were to evaluate the ability to produce alternariol (AOH), alternariol monomethyl ether (AME) and tenuazonic acid (TA) by A. alternata and A. infectoria strains recovered from wheat kernels obtained from one of the main production area in Argentina; to confirm using AFLPs molecular markers the identify of the isolates up to species level, and to evaluate the intra and inter-specific genetic diversity of these two Alternaria species. Among all the Alternaria strains tested (254), 84% of them were able to produce mycotoxins. The most frequent profile of toxin production found was the co-production of AOH and AME in both species tested. TA was only produced by strains of A. alternata. Amplified fragment polymorphism (AFLPs) analysis was applied to a set of 89 isolates of Alternaria spp (40 were A. infectoria and 49 were A. alternata) in order to confirm the morphological identification. The results showed that AFLPs are powerful diagnostic tool for differentiating between A. alternata and A. infectoria. Indeed, in the current study the outgroup strains, A. tenuissima was consistently classified. Characteristic polymorphic bands separated these two species regardless of the primer combination used. Related to intraspecific variability, A. alternata and A. infectoria isolates evaluated seemed to form and homogeneous group with a high degree of similarity among the isolates within each species. However, there was more scoreable polymorphism within A. alternata than within A. infectoria isolates. There was a concordance between morphological identification and separation up to species level using molecular markers. Clear polymorphism both within and between species showed that AFLP can be used to asses genetic variation in A. alternata and A. infectoria. The most important finding of the present study was the report on AOH and AME production by A. infectoria strains isolated from wheat kernels in Argentina on a semisynthetic media for the

  18. Genetic analysis of the sugarcane (Saccharum spp.) cultivar 'LCP 85-384'. I. Linkage mapping using AFLP, SSR, and TRAP markers.

    PubMed

    Andru, Suman; Pan, Yong-Bao; Thongthawee, Songkran; Burner, David M; Kimbeng, Collins A

    2011-06-01

    Sugarcane hybrids are complex aneu-polyploids (2n = 100-130) derived from inter-specific hybridization between ancestral polyploid species, namely S. officinarum L. and S. spontaneum L. Efforts to understand the sugarcane genome have recently been enhanced through the use of new molecular marker technologies. A framework genetic linkage map of Louisiana's popular cultivar LCP 85-384 was constructed using the selfed progeny and based on polymorphism derived from 64 AFLP, 19 SSR and 12 TRAP primer pairs. Of 1,111 polymorphic markers detected, 773 simplex (segregated in 3:1 ratio) and 182 duplex (segregate in 77:4 ratio) markers were used to construct the map using a LOD value of ≥ 4.0 and recombination threshold of 0.44. The genetic distances between pairs of markers linked in the coupling phase was computed using the Kosambi mapping function. Of the 955 markers, 718 simplex and 66 duplex markers were assigned to 108 co-segregation groups (CGs) with a cumulative map length of 5,617 cM and a density of 7.16 cM per marker. Fifty-five simplex and 116 duplex markers remained unlinked. With an estimated genome size of 12,313 cM for LCP 85-384, the map covered approximately 45.6% of the genome. Forty-four of the 108 CGs were assigned into 9 homo(eo)logous groups (HGs) based on information from locus-specific SSR and duplex markers, and repulsion phase linkages detected between CGs. Meiotic behavior of chromosomes in cytogenetic studies and repulsion phase linkage analysis between CGs in this study inferred the existence of strong preferential chromosome pairing behavior in LCP 85-384. This framework map marks an important beginning for future mapping of QTLs associated with important agronomic traits in the Louisiana sugarcane breeding programs.

  19. Significance tests and weighted values for AFLP similarities, based on Arabidopsis in silico AFLP fragment length distributions.

    PubMed Central

    Koopman, Wim J M; Gort, Gerrit

    2004-01-01

    Many AFLP studies include relatively unrelated genotypes that contribute noise to data sets instead of signal. We developed: (1) estimates of expected AFLP similarities between unrelated genotypes, (2) significance tests for AFLP similarities, enabling the detection of unrelated genotypes, and (3) weighted similarity coefficients, including band position information. Detection of unrelated genotypes and use of weighted similarity coefficients will make the analysis of AFLP data sets more informative and more reliable. Test statistics and weighted coefficients were developed for total numbers of shared bands and for Dice, Jaccard, Nei and Li, and simple matching (dis)similarity coefficients. Theoretical and in silico AFLP fragment length distributions (FLDs) were examined as a basis for the tests. The in silico AFLP FLD based on the Arabidopsis thaliana genome sequence was the most appropriate for angiosperms. The G + C content of the selective nucleotides in the in silico AFLP procedure significantly influenced the FLD. Therefore, separate test statistics were calculated for AFLP procedures with high, average, and low G + C contents in the selective nucleotides. The test statistics are generally applicable for angiosperms with a G + C content of approximately 35-40%, but represent conservative estimates for genotypes with higher G + C contents. For the latter, test statistics based on a rice genome sequence are more appropriate. PMID:15342529

  20. AFLP analysis of nephthytis (Syngonium podophyllum Schott) selected from somaclonal variants.

    PubMed

    Chen, J; Henny, R J; Devanand, P S; Chao, C T

    2006-01-01

    This study analyzed genetic differences of 19 cultivars selected from somaclonal variants of Syngonium podophyllum Schott along with their parents as well as seven additional Syngonium species and six other aroids using amplified fragment length polymorphism (AFLP) markers generated by 12 primer sets. Among the 19 somaclonal cultivars, 'Pink Allusion' was selected from 'White Butterfly'. Tissue culture of 'Pink Allusion' through organogenesis resulted in the development of 13 additional cultivars. Self-pollination of 'Pink Allusion' obtained a cultivar, 'Regina Red Allusion', and tissue culture propagation of 'Regina Red Allusion' led to the release of five other cultivars. The 12 primer sets generated a total of 1,583 scorable fragments from all accessions, of which 1,284 were polymorphic (81.9%). The percentages of polymorphic fragments within 'White Butterfly' and 'Regina Red Allusion' groups, however, were only 1.2% and 0.4%, respectively. Jaccard's similarity coefficients among somaclonal cultivars derived from 'White Butterfly' and 'Regina Red Allusion', on average, were 0.98 and 0.99, respectively. Seven out of the 15 cultivars from the 'White Butterfly' group and three out of six from the 'Regina Red Allusion' group were clearly distinguished by AFLP analysis as unique fragments were associated with respective cultivars. The unsuccessful attempt to distinguish the remaining eight cultivars from the 'White Butterfly' group and three from the 'Regina Red Allusion' group was not attributed to experimental errors or the number of primer sets used; rather it is hypothesized to be caused by DNA methylation and/or some rare mutations. This study also calls for increased genetic diversity of cultivated Syngonium as they are largely derived from somaclonal variants.

  1. Association between the p73 gene G4C14-to-A4T14 single nucleotide polymorphism and risk of cervical cancer by high resolution melting and PCR with confronting two-pair primers in a Chinese population

    PubMed Central

    GUO, HAIYAN; YANG, SHAODI; XU, LIJIAN; LI, DING; TANG, JIANXIN; WANG, SHUANGSHAUNG; WEI, BENJIE; LIU, ZHENGCHUN

    2016-01-01

    As a member of the p53 gene family, the p73 gene can affect an individual's susceptibility to cancer through a p53-like manner. DNA sequence variation in the p73 gene has been reported to be associated with cancer risk. The present study aimed to identify whether the p73 gene G4C14-to-A4T14 single nucleotide polymorphism (SNP) is associated with risk of cervical cancer in a Chinese population. The p73 G4C14-to-A4T14 polymorphism was genotyped in 175 cervical cancer and 189 healthy control peripheral blood DNA samples using high resolution melting, polymerase chain reaction with confronting two-pair primers and direct DNA sequencing. The results demonstrated that carriers of the AT/AT genotype were associated with a significantly increased risk of cervical cancer (P=0.042; χ2=4.122; odds ratio = 2.241; 95% confidence interval = 1.013–4.956) compared with the GC/GC genotype carriers. In addition, there was a significant association between p73 genotypes and tumor size in patients with cervical cancer (P=0.014; χ2=8.607). However, no association was identified between p73 genotypes and tumor stage, histological type or lymph node metastasis in patients with cervical cancer. These results suggest that the p73 G4C14-to-A4T14 SNP may function as a marker of genetic susceptibility to cervical cancer in the Chinese population. PMID:27347206

  2. AFLP analysis of genetic diversity and phylogenetic relationships of Brassica oleracea in Ireland.

    PubMed

    El-Esawi, Mohamed A; Germaine, Kieran; Bourke, Paula; Malone, Renee

    2016-01-01

    Brassica oleracea L. is one of the most economically important vegetable crop species of the genus Brassica L. This species is threatened in Ireland, without any prior reported genetic studies. The use of this species is being very limited due to its imprecise phylogeny and uncompleted genetic characterisation. The main objective of this study was to assess the genetic diversity and phylogenetic relationships of a set of 25 Irish B. oleracea accessions using the powerful amplified fragment length polymorphism (AFLP) technique. A total of 471 fragments were scored across all the 11 AFLP primer sets used, out of which 423 (89.8%) were polymorphic and could differentiate the accessions analysed. The dendrogram showed that cauliflowers were more closely related to cabbages than kales were, and accessions of some cabbage types were distributed among different clusters within cabbage subgroups. Approximately 33.7% of the total genetic variation was found among accessions, and 66.3% of the variation resided within accessions. The total genetic diversity (HT) and the intra-accessional genetic diversity (HS) were 0.251 and 0.156, respectively. This high level of variation demonstrates that the Irish B. oleracea accessions studied should be managed and conserved for future utilisation and exploitation in food and agriculture. In conclusion, this study addressed important phylogenetic questions within this species, and provided a new insight into the inclusion of four accessions of cabbages and kales in future breeding programs for improving varieties. AFLP markers were efficient for assessing genetic diversity and phylogenetic relationships in Irish B. oleracea species. PMID:27156498

  3. Differentiation of species of the family Acetobacteraceae by AFLP DNA fingerprinting: Gluconacetobacter kombuchae is a later heterotypic synonym of Gluconacetobacter hansenii.

    PubMed

    Cleenwerck, Ilse; De Wachter, Marjan; González, Angel; De Vuyst, Luc; De Vos, Paul

    2009-07-01

    Amplified fragment length polymorphism (AFLP) DNA fingerprinting was investigated as a tool for fast and accurate identification of acetic acid bacteria (AAB) to the species level. One hundred and thirty five reference strains and 15 additional strains, representing 50 recognized species of the family Acetobacteraceae, were subjected to AFLP analysis using the restriction enzyme combination ApaI/TaqI and the primer combination A03/T03. The reference strains had been previously subjected to either DNA-DNA hybridization or 16S-23S rRNA spacer region gene sequence analysis and were regarded as being accurately classified at the species level. The present study revealed that six of these strains should be reclassified, namely Gluconacetobacter europaeus LMG 1518 and Gluconacetobacter xylinus LMG 1510 as Gluconacetobacter xylinus and Gluconacetobacter europaeus, respectively; Gluconacetobacter kombuchae LMG 23726(T) as Gluconacetobacter hansenii; and Acetobacter orleanensis strains LMG 1545, LMG 1592 and LMG 1608 as Acetobacter cerevisiae. Cluster analysis of the AFLP DNA fingerprints of the reference strains revealed one cluster for each species, showing a linkage level below 50 % with other clusters, except for Acetobacter pasteurianus, Acetobacter indonesiensis and Acetobacter cerevisiae. These three species were separated into two, two, and three clusters, respectively. At present, confusion exists regarding the taxonomic status of Gluconacetobacter oboediens and Gluconacetobacter intermedius; the AFLP data from this study supported their classification as separate taxa. The 15 additional strains could all be identified at the species level. AFLP analysis further revealed that some species harboured genetically diverse strains, whereas other species consisted of strains showing similar banding patterns, indicating a more limited genetic diversity. It can be concluded that AFLP DNA fingerprinting is suitable for accurate identification and classification of a broad

  4. Extraordinary AFLP fingerprint similarity despite strong assortative mating between reef fish color morphospecies.

    PubMed

    Barreto, Felipe S; McCartney, Michael A

    2008-01-01

    Recent theoretical models and empirical studies of fruit flies, birds, and fish indicate that assortative mating may initiate speciation when physical barriers to gene flow are absent, and before postzygotic barriers evolve. These are important results for marine animals like coral reef fish, where ocean currents can carry planktonic larvae over broad ranges, interconnecting populations and slowing genetic divergence. The Caribbean hamlets (genus Hypoplectrus) are a flock of reef fish morphospecies with highly distinct color pattern that mate like with like, but show little mitochondrial or microsatellite DNA differentiation. Here, we broadly screen genomic diversity using amplified fragment length polymorphisms (AFLP) and survey mating pair formation between two morphospecies in the Florida Keys, the butter hamlet (H. unicolor) and the blue hamlet (H. gemma). No AFLP was species-diagnostic (fixed), and neighbor-joining analyses revealed no clustering of individuals consistent with morphospecies boundaries. Assignment tests, however, placed most individuals within their morphospecies of origin. Field surveys showed that > 98% of mating pairs, including those of rare morphospecies, were of like color pattern. Spawning by a single mixed pair adds to earlier observations suggesting that infrequent hybridization may be a genetically homogenizing force in Hypoplectrus. This study provides a clear example of strong assortative mating in a system with limited genetic differentiation.

  5. AFLP and MS-AFLP Analysis of the Variation within Saffron Crocus (Crocus sativus L.) Germplasm

    PubMed Central

    Busconi, Matteo; Colli, Licia; Sánchez, Rosa Ana; Santaella, Marcela; De-Los-Mozos Pascual, Marcelino; Santana, Omar; Roldán, Marta; Fernández, José-Antonio

    2015-01-01

    The presence and extent of genetic variation in saffron crocus are still debated, as testified by several contradictory articles providing contrasting results about the monomorphism or less of the species. Remarkably, phenotypic variations have been frequently observed in the field, such variations are usually unstable and can change from one growing season to another. Considering that gene expression can be influenced both by genetic and epigenetic changes, epigenetics could be a plausible cause of the alternative phenotypes. In order to obtain new insights into this issue, we carried out a molecular marker analysis of 112 accessions from the World Saffron and Crocus Collection. The accessions were grown for at least three years in the same open field conditions. The same samples were analysed using Amplified Fragment Length Polymorphism (AFLP) and Methyl Sensitive AFLP in order to search for variation at the genetic (DNA sequence) and epigenetic (cytosine methylation) level. While the genetic variability was low (4.23% polymorphic peaks and twelve (12) effective different genotypes), the methyl sensitive analysis showed the presence of high epigenetic variability (33.57% polymorphic peaks and twenty eight (28) different effective epigenotypes). The pattern obtained by Factorial Correspondence Analysis of AFLP and, in particular, of MS-AFLP data was consistent with the geographical provenance of the accessions. Very interestingly, by focusing on Spanish accessions, it was observed that the distribution of the accessions in the Factorial Correspondence Analysis is not random but tends to reflect the geographical origin. Two clearly defined clusters grouping accessions from the West (Toledo and Ciudad Real) and accessions from the East (Cuenca and Teruel) were clearly recognised. PMID:25885113

  6. AFLP and MS-AFLP analysis of the variation within saffron crocus (Crocus sativus L.) germplasm.

    PubMed

    Busconi, Matteo; Colli, Licia; Sánchez, Rosa Ana; Santaella, Marcela; De-Los-Mozos Pascual, Marcelino; Santana, Omar; Roldán, Marta; Fernández, José-Antonio

    2015-01-01

    The presence and extent of genetic variation in saffron crocus are still debated, as testified by several contradictory articles providing contrasting results about the monomorphism or less of the species. Remarkably, phenotypic variations have been frequently observed in the field, such variations are usually unstable and can change from one growing season to another. Considering that gene expression can be influenced both by genetic and epigenetic changes, epigenetics could be a plausible cause of the alternative phenotypes. In order to obtain new insights into this issue, we carried out a molecular marker analysis of 112 accessions from the World Saffron and Crocus Collection. The accessions were grown for at least three years in the same open field conditions. The same samples were analysed using Amplified Fragment Length Polymorphism (AFLP) and Methyl Sensitive AFLP in order to search for variation at the genetic (DNA sequence) and epigenetic (cytosine methylation) level. While the genetic variability was low (4.23% polymorphic peaks and twelve (12) effective different genotypes), the methyl sensitive analysis showed the presence of high epigenetic variability (33.57% polymorphic peaks and twenty eight (28) different effective epigenotypes). The pattern obtained by Factorial Correspondence Analysis of AFLP and, in particular, of MS-AFLP data was consistent with the geographical provenance of the accessions. Very interestingly, by focusing on Spanish accessions, it was observed that the distribution of the accessions in the Factorial Correspondence Analysis is not random but tends to reflect the geographical origin. Two clearly defined clusters grouping accessions from the West (Toledo and Ciudad Real) and accessions from the East (Cuenca and Teruel) were clearly recognised.

  7. Genetic relationships among Aster species by multivariate analysis and AFLP markers.

    PubMed

    Cammareri, M; Errico, A; Sebastiano, A; Conicella, C

    2004-01-01

    Fourteen species of Aster were characterized for morphological traits of commercial interest, chromosome number and genetic diversity by AFLP markers to exploit this material not only for breeding purposes but also as source of pharmaceuticals. The variation observed among the Aster species for five morphological traits was summarized by means of discriminant analysis. Three significant canonical variables, accounting for about 96% of total variance, were mainly correlated with capitulum diameter, number of ligulae and leaf length. The morphological variation appeared related to ploidy level of the species. A diploid chromosome number ranging from 10 to 18 was evident in seven species whereas the other species are polyploids with variable chromosome numbers up to 52. The pollen production and stainability were quite variable among Aster species. Furthermore, seven species produced big pollen grains besides normally-sized ones, at a frequency ranging from 1 to 12%, possibly due to 2n pollen production. The possibility that evolution of Aster genus could be driven by 2n gametes and sexual polyploidization is discussed. Implications of 2n gametes for Aster breeding are also mentioned. AFLP analysis of the fourteen Aster species based on six primer combinations revealed a total number of 421 polymorphic amplified DNA fragments. The genetic similarities estimated between the Aster species, based on both shared and unique amplification products ranged from 0.335 to 0.604 across all species and revealed a geographically based clustering within the genus. The highest similarity was detected between A. alpinus and A. amellus with Eurasian origin.

  8. URPD: a specific product primer design tool

    PubMed Central

    2012-01-01

    Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312

  9. AFLP-based genetic diversity assessment of commercially important tea germplasm in India.

    PubMed

    Sharma, R K; Negi, M S; Sharma, S; Bhardwaj, P; Kumar, R; Bhattachrya, E; Tripathi, S B; Vijayan, D; Baruah, A R; Das, S C; Bera, B; Rajkumar, R; Thomas, J; Sud, R K; Muraleedharan, N; Hazarika, M; Lakshmikumaran, M; Raina, S N; Ahuja, P S

    2010-08-01

    India has a large repository of important tea accessions and, therefore, plays a major role in improving production and quality of tea across the world. Using seven AFLP primer combinations, we analyzed 123 commercially important tea accessions representing major populations in India. The overall genetic similarity recorded was 51%. No significant differences were recorded in average genetic similarity among tea populations cultivated in various geographic regions (northwest 0.60, northeast and south both 0.59). UPGMA cluster analysis grouped the tea accessions according to geographic locations, with a bias toward China or Assam/Cambod types. Cluster analysis results were congruent with principal component analysis. Further, analysis of molecular variance detected a high level of genetic variation (85%) within and limited genetic variation (15%) among the populations, suggesting their origin from a similar genetic pool.

  10. Identification of Upregulated Genes under Cold Stress in Cold-Tolerant Chickpea Using the cDNA-AFLP Approach

    PubMed Central

    Dinari, Ali; Niazi, Ali; Afsharifar, Ali Reza; Ramezani, Amin

    2013-01-01

    Low temperature injury is one of the most significant causes of crop damage worldwide. Cold acclimatization processes improve the freezing tolerance of plants. To identify genes of potential importance for acclimatzation to the cold and to elucidate the pathways that regulate this process, global transcriptome expression of the chickpea (Cicer arietinum L), a species of legume, was analyzed using the cDNA-AFLP technique. In total, we generated 4800 transcript-derived fragments (TDFs) using cDNA-AFLP in conjunction with 256 primer combinations. We only considered those cDNA fragments that seemed to be up-regulated during cold acclimatization. Of these, 102 TDFs with differential expression patterns were excised from gels and re-amplified by PCR. Fifty-four fragments were then cloned and sequenced. BLAST search of the GenBank non-redundant (nr) sequence database demonstrated that 77 percent of the TDFs belonged to known sequences with putative functions related to metabolism (31), transport (10), signal transduction pathways (15) and transcription factors (21). The last group of expressed transcripts showed homology to genes of unknown function (22). To further analyze and validate our cDNA-AFLP experiments, the expression of 9 TDFs during cold acclimatzatiion was confirmed using real time RT-PCR. The results of this research show that cDNA-AFLP is a powerful technique for investigating the expression pattern of chickpea genes under low-temperature stress. Moreover, our findings will help both to elucidate the molecular basis of low-temperature effects on the chickpea genome and to identify those genes that could increase the cold tolerance of the chickpea plant. PMID:23341906

  11. Transcriptional profiling by cDNA-AFLP analysis showed differential transcript abundance in response to water stress in Populus hopeiensis

    PubMed Central

    2012-01-01

    Background Drought is one of the main environmental factors limiting tree growth and productivity of plantation forests worldwide. Populus hopeiensis Hu et Chow is one of the most important commercial plantation tree species in China. However, the genes controlling drought tolerance in this species have not been identified or characterized. Here, we conducted differential expression analyses and identified a number of genes that were up- or downregulated in P. hopeiensis during water stress. To the best of our knowledge, this is the first comprehensive study of differentially expressed genes in water-stressed P. hopeiensis. Results Using the cDNA-AFLP detection technique, we used 256 primer combinations to identify differentially expressed genes in P. hopeiensis during water stress. In total, 415 transcript derived-fragments (TDFs) were obtained from 10× deep sequencing of 473 selected TDFs. Of the 415 TDFs, 412 were annotated by BLAST searches against various databases. The majority of these genes encoded products involved in ion transport and compartmentalization, cell division, metabolism, and protein synthesis. The TDFs were clustered into 12 groups on the basis of their expression patterns. Of the 415 reliable TDFs, the sequences of 35 were homologous to genes that play roles in short or long-term resistance to drought stress. Some genes were further selected for validation of cDNA-AFLP expression patterns using real-time PCR analyses. The results confirmed the expression patterns that were detected using the cDNA-AFLP technique. Conclusion The cDNA-AFLP technique is an effective and powerful tool for identifying candidate genes that are differentially expressed under water stress. We demonstrated that 415 TDFs were differentially expressed in water-stressed poplar. The products of these genes are involved in various biological processes in the drought response of poplar. The results of this study will aid in the identification of candidate genes of future

  12. Development of AFLP and RAPD markers linked to a locus associated with twisted growth in corkscrew willow (Salix matsudana 'Tortuosa').

    PubMed

    Lin, Juan; Gunter, Lee E; Harding, Scott A; Kopp, Richard F; McCord, Rachel P; Tsai, Chung-Jui; Tuskan, Gerald A; Smart, Lawrence B

    2007-11-01

    Salix matsudana Koidz. cultivar 'Tortuosa' (corkscrew willow) is characterized by extensive stem bending and curling of leaves. To investigate the genetic basis of this trait, controlled crosses were made between a corkscrew female (S. matsudana 'Tortuosa') and a straight-stemmed, wild-type male (Salix alba L. Clone 99010). Seventy-seven seedlings from this family (ID 99270) were grown in the field for phenotypic observation. Among the progeny, 39 had straight stems and leaves and 38 had bent stems and curled leaves, suggesting that a dominant allele at a single locus controls this phenotype. As a first step in characterizing the locus, we searched for amplified fragment length polymorphism (AFLP) and randomly amplified polymorphic DNA (RAPD) markers linked to the tortuosa allele using bulked segregant analysis. Samples of DNA from 10 corkscrew individuals were combined to produce a corkscrew pool, and DNA from 10 straight progeny was combined to make a wild-type pool. Sixty-four AFLP primer combinations and 640 RAPD primers were screened to identify marker bands amplified from the corkscrew parent and progeny pool, but not from the wild-type parent or progeny pool. An AFLP marker and a RAPD marker linked to and flanking the tortuosa locus were placed on a preliminary linkage map constructed based on segregation among the 77 progeny. Sectioning and analysis of shoot tips revealed that the corkscrew phenotype is associated with vascular cell collapse, smaller cell size in regions near the cambium and less developed phloem fibers than in wild-type progeny. Identification of a gene associated with this trait could lead to greater understanding of the control of normal stem development in woody plants.

  13. Analysis of genetic diversity through AFLP, SAMPL, ISSR and RAPD markers in Tribulus terrestris, a medicinal herb.

    PubMed

    Sarwat, Maryam; Das, S; Srivastava, P S

    2008-03-01

    Tribulus terrestris is well known for its medicinal importance in curing urino-genital disorders. Amplified fragment length polymorphism (AFLP), selective amplification of microsatellite polymorphic loci (SAMPL), inter-simple sequence repeat (ISSR) and randomly amplified polymorphic DNA (RAPD) markers were used for the first time for the detection of genetic polymorphism in this medicinal herb from samples collected from various geographical regions of India. Six assays each of AFLP and SAMPL markers and 21 each of ISSR and RAPD markers were utilized. AFLP yielded 500 scorable amplified products, of which 82.9% were polymorphic. SAMPL primers amplified 488 bands, 462 being polymorphic (94.7%). The range of amplified bands was 66 [(TC)(8)G + M-CAG] to 98 [(CA)(6)AG + M-CAC] and the percentage polymorphism, 89.9 [from (CT)(4)C (AC)(4)A + M-CTG] to 100 [from (GACA)(4) + M-CTA]. The ISSR primers amplified 239 bands of 0.4-2.5 kb, 73.6% showed polymorphism. The amplified products ranged from 5 to 16 and the percentage polymorphism 40-100. RAPD assays produced 276 bands, of which 163 were polymorphic (59%). Mantel test employed for detection of goodness of fit established cophenetic correlation values above 0.9 for all the four marker systems. The dendrograms and PCA plots derived from the binary data matrices of the four marker systems are highly concordant. High bootstrap values were obtained at major nodes of phenograms through WINBOOT software. The relative efficiency of the four molecular marker systems calculated on the basis of multiplex ratio, marker index and average heterozygosity revealed SAMPL to be the best. Distinct DNA fingerprinting profile, unique to every geographical region could be obtained with all the four molecular marker systems. Clustering can be a good indicator for clear separation of genotypes from different regions in well-defined groups that are supported by high bootstrap values.

  14. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    PubMed

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast

  15. [Analysis of effectiveness of cDNA synthesis, induced using complementary primers and primers containing a noncomplementary base matrix].

    PubMed

    D'iachenko, L B; Chenchik, A A; Khaspekov, G L; Tatarenko, A O; Bibilashvili, R Sh

    1994-01-01

    We have studied the efficiency of DNA synthesis catalyzed by M-MLV reverse transcriptase or Thermus aquaticus DNA polymerase for primers (4-17 nucleotides long) either completely matched or possessing a single mismatched base pair at all possible positions in the primer. It has been shown that DNA synthesis efficiency depends not only on the position of mismatched base pair but on the length and primary structure of the primer. The enzyme, template, and primer concentrations determine the relative level of mismatched DNA synthesis.

  16. Analysis of genetic diversity in banana cultivars (Musa cvs.) from the South of Oman using AFLP markers and classification by phylogenetic, hierarchical clustering and principal component analyses*

    PubMed Central

    Opara, Umezuruike Linus; Jacobson, Dan; Al-Saady, Nadiya Abubakar

    2010-01-01

    Banana is an important crop grown in Oman and there is a dearth of information on its genetic diversity to assist in crop breeding and improvement programs. This study employed amplified fragment length polymorphism (AFLP) to investigate the genetic variation in local banana cultivars from the southern region of Oman. Using 12 primer combinations, a total of 1094 bands were scored, of which 1012 were polymorphic. Eighty-two unique markers were identified, which revealed the distinct separation of the seven cultivars. The results obtained show that AFLP can be used to differentiate the banana cultivars. Further classification by phylogenetic, hierarchical clustering and principal component analyses showed significant differences between the clusters found with molecular markers and those clusters created by previous studies using morphological analysis. Based on the analytical results, a consensus dendrogram of the banana cultivars is presented. PMID:20443211

  17. DNA Methylation and Methylation Polymorphism in Genetically Stable In vitro Regenerates of Jatropha curcas L. Using Methylation-Sensitive AFLP Markers.

    PubMed

    Rathore, Mangal S; Jha, Bhavanath

    2016-03-01

    The present investigation aimed to evaluate the degree and pattern of DNA methylation using methylation-sensitive AFLP (MS-AFLP) markers in genetically stable in vitro regenerates of Jatropha curcas L.. The genetically stable in vitro regenerates were raised through direct organogenesis via enhanced axillary shoot bud proliferation (Protocol-1) and in vitro-derived leaf regeneration (Protocol-2). Ten selective combinations of MS-AFLP primers produced 462 and 477 MS-AFLP bands in Protocol-1 (P-1) and Protocol-2 (P-2) regenerates, respectively. In P-1 regenerates, 15.8-31.17 % DNA was found methylated with an average of 25.24 %. In P-2 regenerates, 15.93-32.7 % DNA was found methylated with an average of 24.11 %. Using MS-AFLP in P-1 and P-2 regenerates, 11.52-25.53 % and 13.33-25.47 % polymorphism in methylated DNA was reported, respectively. Compared to the mother plant, P-1 regenerates showed hyper-methylation while P-2 showed hypo-methylation. The results clearly indicated alternation in degree and pattern of DNA methylation; hence, epigenetic instability in the genetically stable in vitro regenerates of J. curcas, developed so far using two different regeneration systems and explants of two different origins. The homologous nucleotide fragments in genomes of P-1 and P-2 regenerates showing methylation re-patterning might be involved in immediate adaptive responses and developmental processes through differential regulation of transcriptome under in vitro conditions. PMID:26588922

  18. Homolog-specific PCR primer design for profiling splice variants

    PubMed Central

    Srivastava, Gyan Prakash; Hanumappa, Mamatha; Kushwaha, Garima; Nguyen, Henry T.; Xu, Dong

    2011-01-01

    To study functional diversity of proteins encoded from a single gene, it is important to distinguish the expression levels among the alternatively spliced variants. A variant-specific primer pair is required to amplify each alternatively spliced variant individually. For this purpose, we developed a new feature, homolog-specific primer design (HSPD), in our high-throughput primer and probe design software tool, PRIMEGENS-v2. The algorithm uses a de novo approach to design primers without any prior information of splice variants or close homologs for an input query sequence. It not only designs primer pairs but also finds potential isoforms and homologs of the input sequence. Efficiency of this algorithm was tested for several gene families in soybean. A total of 187 primer pairs were tested under five different abiotic stress conditions with three replications at three time points. Results indicate a high success rate of primer design. Some primer pairs designed were able to amplify all splice variants of a gene. Furthermore, by utilizing combinations within the same multiplex pool, we were able to uniquely amplify a specific variant or duplicate gene. Our method can also be used to design PCR primers to specifically amplify homologs in the same gene family. PRIMEGENS-v2 is available at: http://primegens.org. PMID:21415011

  19. SBE primer : multiplexing minisequencing-based genotyping

    SciTech Connect

    Kaderali, L.; Deshpande, A.; Uribe-Romeo, F. J.; Schliep, A.; Torney, D. C.

    2002-01-01

    Single-nucleotide polymorphism (SNP) analysis is a powerful tool for mapping and diagnosing disease-related alleles. Most of the known genetic diseases are caused by point mutations, and a growing number of SNPs will be routinely analyzed to diagnose genetic disorders. Mutation analysis by polymerase mediated single-base primer extension (minisequencing) can be massively parallelized using for example DNA microchips or flow cytometry with microspheres as solid support. By adding a unique oligonucleotide tag to the 5-inch end of the minisequencing primer and attaching the complementary anti-tag to the array or bead surface, the assay can be 'demultiplexed'. However, such high-throughput scoring of SNPs requires a high level of primer multiplexing in order to analyze multiple loci in one assay, thus enabling inexpensive and fast polymorphism scoring. Primers can be chosen from either the plus or the minus strand, and primers used in the same experiment must not bind to one another. To genotype a given number of polymorphic sites, the question is which primer to use for each SNP, and which primers to group into the same experiment. Furthermore, a crosshybridization-free tag/anti-tag code is required in order to sort the extended primers to the corresponding microspheres or chip spots. These problems pose challenging algorithmic questions. We present a computer program lo automate the design process for the assay. Oligonucleotide primers for the reaction are automatically selected by the software, a unique DNA tag/anti-tag system is generated, and the pairing of primers and DNA-Tags is automatically done in a way to avoid any crossreactivity. We report first results on a 45-plex genotyping assay, indicating that minisequencing can be adapted to be a powerful tool for high-throughput, massively parallel genotyping.

  20. Polyacid macromolecule primers

    DOEpatents

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  1. Polyacid macromolecule primers

    DOEpatents

    Sugama, Toshifumi

    1989-01-01

    Hydrophylic polyacids, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests.

  2. Microsatellite primers for red drum (Sciaenops ocellatus)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In this note, we document polymerase-chain-reaction (PCR) primer pairs for 101, nuclear-encoded microsatellites designed and developed from a red drum (Sciaenops ocellatus) genomic library. The 101 microsatellites (Genbank Accession Numbers EU015882-EU015982) were amplified successfully and used to...

  3. ConservedPrimers 2.0: A high-throughput pipeline for comparative genome referenced intron-flanking PCR primer design and its application in wheat SNP discovery

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In some genomic applications it is necessary to design large numbers of PCR primers in exons flanking one or several introns on the basis of orthologous gene sequences in related species. The primer pairs designed by this target gene approach are called "intron-flanking primers" or because they ar...

  4. Education Vouchers. A Primer.

    ERIC Educational Resources Information Center

    Richter, Philip C.; Hollender, Mary Jo

    This document is intended to serve both as a primer and as an annotated bibliography about educational vouchers. As a primer, it introduces the reader to the concept of vouchers and to the variety of issues--including political, economic, legal, and educational issues--associated with vouchers. As an annotated bibliography, it provides a summary…

  5. Population genetic structure in Phyla scaberrima from Mexico and Colombia assessed by AFLP markers and implications for conservation.

    PubMed

    Androcioli, L G; Ruas, E A; Rodrigues, L A; Ruas, C F; Perilla, H E R; Ruas, P M

    2015-12-02

    Phyla scaberrima (Verbenaceae) is a herbaceous perennial species that is distributed from Mexico (center of origin) to Colombia, growing in forest and swamp edges or grasslands from sea level up to an altitude of 1800 m. The chemical properties and uses in popular medicine have drastically affected the population size of this species. In this study, we investigated genetic variability in populations of P. scaberrima using AFLP markers. Three AFLP primer combinations rendered a total of 997 markers in a sample of 131 individuals from five populations, including two populations from Mexico and three from Colombia. The average percentage of polymorphic loci, gene diversity and Shannon-Wiener index were 46.62, 0.0695, and 0.119, respectively. Analysis of molecular variance showed that the distribution of the genetic variability within populations (85.41%) was higher than between groups (8.11%) and between populations (6.48%). Principal coordinate analysis and Bayesian analysis for the K number of clusters showed that the individuals were dispersed in five (K= 5) clusters. The low levels of genetic diversity observed in these populations demonstrated that the populations from Mexico and Colombia need urgent management to recover their genetic variability.

  6. AFLP-based analysis to study genetic variability and relationships in the Spanish species of the genus Aegilops.

    PubMed

    Monte, J V; De Nova, P J; Soler, C

    2001-01-01

    Amplified fragment length polymorphism (AFLP) DNA markers were used to characterize the genetic diversity and relationships in wild species of the genus Aegilops. Fifty populations, which included the species Aegilops biuncialis (UUMM), Ae. neglecta (UUMMNN), Ae. ovata (UUMM), Ae. ventricosa (DDNN) and Ae. triuncialis (UUCC) were selected. These populations are distributed in the Iberian peninsula and Balearic islands. Five AFLP selective primer combinations generated a total of 527 amplification products of which 517 (98.10%) detected polymorphisms. Aegilops neglecta showed the least variation in contrast with Ae. biuncialis that presented the highest degree of polymorphism. Genetic relationships within the populations were evaluated by generating a similarity matrix based on the Jaccard index. In the resulting phenogram Ae. ventricosa appears segregated from the other species, probably owing to the influence of the D genome. The species sharing the U genome are located in the main cluster. The branching pattern of the U genome group reflects the proximity of the species sharing the M genome. Ae. biuncialis and Ae. ovata are clearly separated suggesting that the super index system should be used to differentiate the M genomes of both species. The variation among populations within species in relation to their geographical origin and results previously obtained by the authors using biochemical and molecular markers are discussed.

  7. A preliminary study for identification of candidate AFLP markers under artificial selection for shell color in pearl oyster Pinctada fucata.

    PubMed

    Zou, Keshu; Zhang, Dianchang; Guo, Huayang; Zhu, Caiyan; Li, Min; Jiang, Shigui

    2014-05-25

    Pearl oyster Pinctada fucata is widely cultured to produce seawater pearl in South China, and the quality of pearl is significantly affected by its shell color. Thus the Pearl Oyster Selective Breeding Program (POSBP) was carried out for the shell color and growth traits. The black (B), gold (G), red (R) and white (W) shell strains with fast growth trait were achieved after five successive generation selection. In this study, AFLP technique was used to scan genome of four strains with different shell colors to identify the candidate markers under artificial selection. Eight AFLP primer combinations were screened and yielded 688 loci, 676 (98.26%) of which were polymorphic. In black, gold, red and white strains, the percentage of polymorphic loci was 90.41%, 87.79%, 93.60% and 93.31%, respectively, Nei's gene diversity was 0.3225, 0.2829, 0.3221 and 0.3292, Shannon's information index was 0.4801, 0.4271, 0.4825 and 0.4923, and the value of FST was 0.1805. These results suggested that the four different shell color strains had high genetic diversity and great genetic differentiation among strains, which had been subjected to the continuous selective pressures during the artificial selective breeding. Furthermore, six outlier loci were considered as the candidate markers under artificial selection for shell color. This study provides a molecular evidence for the inheritance of shell color of P. fucata.

  8. Microsatellite primer resource for Populus developed from

    SciTech Connect

    Yin, Tongming; Yang, Xiaohan; Gunter, Lee E; Tuskan, Gerald A; Wullschleger, Stan D; Huang, Prof. Minren; Li, Shuxian; Zhang, Xinye

    2008-01-01

    In this study, 148 428 simple sequence repeat (SSR) primer pairs were designed from the unambiguously mapped sequence scaffolds of the Nisqually-1 genome. The physical position of the priming sites were identified along each of the 19 Populus chromosomes, and it was specified whether the priming sequences belong to intronic, intergenic, exonic or UTR regions. A subset of 150 SSR loci were amplified and a high amplification success rate (72%) was obtained in P. tremuloides, which belongs to a divergent subgenus of Populus relative to Nisqually-1. PCR reactions showed that the amplification success rate of exonic primer pairs was much higher than that of the intronic/intergenic primer pairs. Applying ANOVA and regression analyses to the flanking sequences of microsatellites, the repeat lengths, the GC contents of the repeats, the repeat motif numbers, the repeat motif length and the base composition of the repeat motif, it was determined that only the base composition of the repeat motif and the repeat motif length significantly affect the microsatellite variability in P. tremuloides samples. The SSR primer resource developed in this study provides a database for selecting highly transferable SSR markers with known physical position in the Populus genome and provides a comprehensive genetic tool to extend the genome sequence of Nisqually-1 to genetic studies in different Populus species.

  9. Identification of Amplified Fragment Length Polymorphism (AFLP) Markers Tightly Associated with Drought Stress Gene in Male Sterile and Fertile Salvia miltiorrhiza Bunge

    PubMed Central

    Zhang, Yuejin; Guo, Lijun; Shu, Zhiming; Sun, Yiyue; Chen, Yuanyuan; Liang, Zongsuo; Guo, Hongbo

    2013-01-01

    Consistent grain yield in drought environment has attracted wide attention due to global climate change. However, the important drought-related traits/genes in crops have been rarely reported. Many near-isogenic lines (NILs) of male sterile and fertile Salvia miltiorrhiza have been obtained in our previous work through testcross and backcross in continuous field experiments conducted in 2006–2009. Both segregating sterile and fertile populations were subjected to bulked segregant analysis (BSA) and amplified fragment length polymorphism (AFLP) with 384 and 170 primer combinations, respectively. One out of 14 AFLP markers (E9/M3246) was identified in treated fertile population as tightly linked to the drought stress gene with a recombination frequency of 6.98% and at a distance of 7.02 cM. One of 15 other markers (E2/M5357) was identified in a treated sterile population that is closely associated with the drought stress gene. It had a recombination frequency of 4.65% and at a distance of 4.66 cM. Interestingly, the E9/M3246 fragment was found to be identical to another AFLP fragment E11/M4208 that was tightly linked to the male sterile gene of S. miltiorrhiza with 95% identity and e-value 4 × 10−93. Blastn analysis suggested that the drought stress gene sequence showed higher identity with nucleotides in Arabidopsis chromosome 1–5. PMID:23525049

  10. PrecisePrimer: an easy-to-use web server for designing PCR primers for DNA library cloning and DNA shuffling.

    PubMed

    Pauthenier, Cyrille; Faulon, Jean-Loup

    2014-07-01

    PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. PMID:24829457

  11. Quick spacecraft charging primer

    SciTech Connect

    Larsen, Brian Arthur

    2014-03-12

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  12. Mating type-correlated molecular markers and demonstration of heterokaryosis in the phytopathogenic fungus Thanatephorus cucumeris (Rhizoctonia solani) AG 1-IC by AFLP DNA fingerprinting analysis.

    PubMed

    Julián, M C; Acero, J; Salazar, O; Keijer, J; Rubio, V

    1999-01-01

    The destructive soil-borne plant pathogenic basidiomycetous fungus Thanatephorus cucumeris (Frank) Donk [anamorph: Rhizoctonia solani Kühn] is not a homogeneous species, but is composed of at least twelve anastomosis groups (AG), which seem to be genetically isolated. The genetics of several T. cucumeris anastomosis groups has been studied by analysis of heterokaryotic tuft formation in the area of contact between homokaryotic single-spore isolates, revealing that AG 1 is heterokaryotic and bipolar. To prove that tuft formation is due to heterokaryosis, AFLP DNA fingerprinting has been applied to a heterokaryotic T. cucumeris AG 1-IC isolate, its homokaryotic single spore-derived progeny, and newly formed heterokaryons. By means of AFLP markers, it is demonstrated that fluffy tufts formed upon pairing of homokaryons from different mating types are newly formed heterokaryons. Mating type-correlated markers have also been found, which will be useful for future studies of the genetics of this fungal species complex.

  13. [cDNA-AFLP analysis on transcripts associated with bolting in Brassica rapa L. ssp. pekinensis].

    PubMed

    Zou, Yan-Min; Yu, Shuan-Cang; Zhang, Feng-Lan; Yu, Yang-Jun; Zhao, Xiu-Yun; Zhang, De-Shuang

    2009-07-01

    Premature bolting, caused by low temperature in spring and summer cultivation in low land and high land respectively, leads to reduction of the yield and quality of the harvested products in Chinese cabbage. Therefore, exploring genes involved in vernalization response is important to the improvement of Chinese cabbage varieties. Here, one extremely early bolting line (DH-54) and one extremely late bolting line (DH-43) were employed, and the cDNA-AFLP approach was used to identify key components involved in the low-temperature required vernalization response. Of 256 primer recombinations screened, a total of 191 differential expressed transcript-derived fragments (TDFs) were identified, and 82 TDFs were sequenced. BLAST and alignments showed that 52 candidate TDFs shared high levels of similarity with genes of known function, 22 TDFs of unknown function and 8 novel ESTs. The TDFs of known function were involved in genes encoding enzymes working in metabolism, proteins related to stress and defense, signal transduction, and transcription regulation, etc.

  14. An AFLP genetic linkage map of pacific abalone ( Haliotis discus hannai)

    NASA Astrophysics Data System (ADS)

    Qi, Li; Yanhong, Xu; Ruihai, Yu; Akihiro, Kijima

    2007-07-01

    A genetic linkage map of Pacific abalone ( Haliotis discus hannai) was constructed using AFLP markers based on a two-way pseudo-testeross strategy in a full-sib family. With 33 primer combinations, a total of 455 markers (225 from the female parent and 230 from the male parent) segregated in a 1:1 ratio, corresponding to DNA polymorphism: heterozygous in one parent and null in the other. The female framework map consisted of 174 markers distributed in 18 linkage groups, equivalent to the H. discus hannai haploid chromosome number, and spanning a total length of 2031.4 cM, with an average interval of 13.0 cM between adjacent markers. The male framework map consisted of 195 markers mapped on 19 linkage groups, spanning a total length of 2273.4 cM, with an average spacing of 12.9 cM between adjacent markers. The estimated coverage for the framework linkage maps was 81.2% for the female and 82.1% for the male, on the basis of two estimates of genome length. Fifty-two markers (11.4%) remained unlinked. The level of segregation distortion observed in this cross was 20.4%. These linkage maps will serve as a starting point for linkage studies in the Pacific abalone with potential application for marker-assisted selection in breeding programs.

  15. Genetic diversity of wild and domesticated stocks of Thai abalone, Haliotis asinina (Haliotidae), analyzed by single-strand conformational polymorphism of AFLP-derived markers.

    PubMed

    Praipue, P; Klinbunga, S; Jarayabhand, P

    2010-01-01

    Amplified fragment length polymorphism (AFLP) analysis was carried out on representative individuals of wild Haliotis asinina using 64 primer combinations. Nine polymorphic AFLPs were cloned and sequenced. Sequence-specific primers were designed from six AFLP-derived fragments. Three sequence-characterized amplified region (SCAR) markers (HaSCAR(320), HaSCAR(295), HaSCAR(327)) were selected for genotyping of 8-month-old domesticated stocks of H. asinina cultured separately at Sichang Marine Science Research and Training Station (N = 95) and at a hatchery in Trang province (N = 40) using single-strand conformational polymorphism analysis. Genotypes of wild abalone originating from Talibong Island (N = 25), Cambodia (N = 22), and the P(0) progeny established from Samet Island founders (N = 20) were also investigated. Significant genetic differentiation (P<0.0001 for the exact test and F(ST) = 0.8759-0.8919, P<0.001) between abalone from the Gulf of Thailand (Cambodia and Samet Island--east) and the Andaman Sea (Talibong Island--west) were observed. This demonstrated the strong biogeographic structure of H. asinina in Thai waters. Non-overlapping composite genotypes for wild abalone from different coastal regions allow us to determine founder contributions in domesticated abalone stocks. Almost all Sichang Marine Science Research and Training Station and the Trang province hatchery stocks exhibited the east coast genotypes (97% of the 135 samples). We suggest that abalone from the east coast population have better survival rates under cultivated conditions than those from the west coast population.

  16. China Energy Primer

    SciTech Connect

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  17. Primer on Social Economics.

    ERIC Educational Resources Information Center

    Darcy, Robert L.

    An elaboration of the author's booklet entitled "First Steps Toward Economic Understanding," this primer is designed to help the reader develop a functional understanding of the economic process so that he can make wiser decisions on issues of social policy and on matters affecting his economic well-being. The document is not "economics in one…

  18. An SAT® Validity Primer

    ERIC Educational Resources Information Center

    Shaw, Emily J.

    2015-01-01

    This primer should provide the reader with a deeper understanding of the concept of test validity and will present the recent available validity evidence on the relationship between SAT® scores and important college outcomes. In addition, the content examined on the SAT will be discussed as well as the fundamental attention paid to the fairness of…

  19. Alterations of leaf cell ultrastructures and AFLP DNA profiles in Earth-grown tomato plants propagated from long-term six years Mir-flown seeds

    NASA Astrophysics Data System (ADS)

    Liu, Min; Xue, Huai; Pan, Yi; Zhang, Chunhua; Lu, Jinying

    Leaf cell ultrastructures and DNA variations in the firstand the second-generation of Earthgrown tomato (Lycopersicon esculentun Mill) plants that had been endured a long-term six years spaceflight in the Mir were compared to their ground-based control plants, under observations with a Transmission Electron Microscope and the Amplification Fragment Length Polymorphism (AFLP) analysis. For alterations in the morphological ultrastructures, one plant among the 11 first-generation plants generated from 30 Mir-flown seeds had a three-layered palisade cell structure, while other 10 first-generation plants and all ground-based controls had one-layered palisade cell structure in leaves. Starch grains were larger and in clusters, numbers of starch grains increased in the chloroplasts in the Mir-flown plants. Leaf cells became contracted and deformed, and cell shape patterns were different in the Mir-flown plants. For the leaf genomic DNA alterations, 34 DNA bands were polymorphic with a 1.32% polymorphism among 2582 DNA bands in the first-generation Mir-flown plants. Band types in the spaceflight treated plants were also different from those in the ground-based control. Of 11 survived first-generation plants, 7 spaceflight treated plants (Plant Nos. 1-6 and No. 9) had a same 7 polymorphic bands and a same 0.27%DNA mutation. The DNA mutation rate was greatest in Plants No.10 and No.7 (0.90% and 0.94%), less in Plant No.11 (0.31%) and least in Plant No.8 (0.20%). For the 38 send-generation plants propagated from the No. 5 Mir-flown seed, 6 DNA bands were polymorphic with a 0.23% polymorphism among 2564 amplified DNA bands. Among those 38 second-generation plants amplified by primer pair (E4: ACC, M8: CTT), one DNA band disappeared in 29 second-generation plants and in the original Mir-flown No. 5 plant, compared to the ground-base controls. Among the 38 second-generation plants generated from the Mir-flown No. 5 seed, the DNA band types of 29 second-generation plants were

  20. Universal COI primers for DNA barcoding amphibians.

    PubMed

    Che, Jing; Chen, Hong-Man; Yang, Jun-Xiao; Jin, Jie-Qiong; Jiang, Ke; Yuan, Zhi-Yong; Murphy, Robert W; Zhang, Ya-Ping

    2012-03-01

    DNA barcoding is a proven tool for the rapid and unambiguous identification of species, which is essential for many activities including the vouchering tissue samples in the genome 10K initiative, genealogical reconstructions, forensics and biodiversity surveys, among many other applications. A large-scale effort is underway to barcode all amphibian species using the universally sequenced DNA region, a partial fragment of mitochondrial cytochrome oxidase subunit I COI. This fragment is desirable because it appears to be superior to 16S for barcoding, at least for some groups of salamanders. The barcoding of amphibians is essential in part because many species are now endangered. Unfortunately, existing primers for COI often fail to achieve this goal. Herein, we report two new pairs of primers (➀, ➁) that in combination serve to universally amplify and sequence all three orders of Chinese amphibians as represented by 36 genera. This taxonomic diversity, which includes caecilians, salamanders and frogs, suggests that the new primer pairs will universally amplify COI for the vast majority species of amphibians.

  1. Universal COI primers for DNA barcoding amphibians.

    PubMed

    Che, Jing; Chen, Hong-Man; Yang, Jun-Xiao; Jin, Jie-Qiong; Jiang, Ke; Yuan, Zhi-Yong; Murphy, Robert W; Zhang, Ya-Ping

    2012-03-01

    DNA barcoding is a proven tool for the rapid and unambiguous identification of species, which is essential for many activities including the vouchering tissue samples in the genome 10K initiative, genealogical reconstructions, forensics and biodiversity surveys, among many other applications. A large-scale effort is underway to barcode all amphibian species using the universally sequenced DNA region, a partial fragment of mitochondrial cytochrome oxidase subunit I COI. This fragment is desirable because it appears to be superior to 16S for barcoding, at least for some groups of salamanders. The barcoding of amphibians is essential in part because many species are now endangered. Unfortunately, existing primers for COI often fail to achieve this goal. Herein, we report two new pairs of primers (➀, ➁) that in combination serve to universally amplify and sequence all three orders of Chinese amphibians as represented by 36 genera. This taxonomic diversity, which includes caecilians, salamanders and frogs, suggests that the new primer pairs will universally amplify COI for the vast majority species of amphibians. PMID:22145866

  2. Crystalline Silica Primer

    USGS Publications Warehouse

    ,

    1992-01-01

    substance and will present a nontechnical overview of the techniques used to measure crystalline silica. Because this primer is meant to be a starting point for anyone interested in learning more about crystalline silica, a list of selected readings and other resources is included. The detailed glossary, which defines many terms that are beyond the scope of this publication, is designed to help the reader move from this presentation to a more technical one, the inevitable next step.

  3. Coal Bed Methane Primer

    SciTech Connect

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  4. Primer on molecular genetics

    SciTech Connect

    Not Available

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  5. Genetic relationships within Brassica rapa as inferred from AFLP fingerprints.

    PubMed

    Zhao, Jianjun; Wang, Xiaowu; Deng, Bo; Lou, Ping; Wu, Jian; Sun, Rifei; Xu, Zeyong; Vromans, Jaap; Koornneef, Maarten; Bonnema, Guusje

    2005-05-01

    Amplified fragment length polymorphism (AFLP) markers were employed to assess the genetic diversity amongst two large collections of Brassica rapa accessions. Collection A consisted of 161 B. rapa accessions representing different morphotypes among the cultivated B. rapa, including traditional and modern cultivars and breeding materials from geographical locations from all over the world and two Brassica napus accessions. Collection B consisted of 96 accessions, representing mainly leafy vegetable types cultivated in China. On the basis of the AFLP data obtained, we constructed phenetic trees using MEGA 2.1: software. The level of polymorphism was very high, and it was evident that the amount of genetic variation present within the groups was often comparable to the variation between the different cultivar groups. Cluster analysis revealed groups, often with low bootstrap values, which coincided with cultivar groups. The most interesting information revealed by the phenetic trees was that different morphotypes are often more related to other morphotypes from the same region (East Asia vs. Europe) than to similar morphotypes from different regions, suggesting either an independent origin and or a long and separate domestication and breeding history in both regions.

  6. primers4clades: a web server that uses phylogenetic trees to design lineage-specific PCR primers for metagenomic and diversity studies

    PubMed Central

    Contreras-Moreira, Bruno; Sachman-Ruiz, Bernardo; Figueroa-Palacios, Iraís; Vinuesa, Pablo

    2009-01-01

    Primers4clades is an easy-to-use web server that implements a fully automatic PCR primer design pipeline for cross-species amplification of novel sequences from metagenomic DNA, or from uncharacterized organisms, belonging to user-specified phylogenetic clades or taxa. The server takes a set of non-aligned protein coding genes, with or without introns, aligns them and computes a neighbor-joining tree, which is displayed on screen for easy selection of species or sequence clusters to design lineage-specific PCR primers. Primers4clades implements an extended CODEHOP primer design strategy based on both DNA and protein multiple sequence alignments. It evaluates several thermodynamic properties of the oligonucleotide pairs, and computes the phylogenetic information content of the predicted amplicon sets from Shimodaira–Hasegawa-like branch support values of maximum likelihood phylogenies. A non-redundant set of primer formulations is returned, ranked according to their thermodynamic properties. An amplicon distribution map provides a convenient overview of the coverage of the target locus. Altogether these features greatly help the user in making an informed choice between alternative primer pair formulations. Primers4clades is available at two mirror sites: http://maya.ccg.unam.mx/primers4clades/and http://floresta.eead.csic.es/primers4clades/. Three demo data sets and a comprehensive documentation/tutorial page are provided for easy testing of the server's capabilities and interface. PMID:19465390

  7. primers4clades: a web server that uses phylogenetic trees to design lineage-specific PCR primers for metagenomic and diversity studies.

    PubMed

    Contreras-Moreira, Bruno; Sachman-Ruiz, Bernardo; Figueroa-Palacios, Iraís; Vinuesa, Pablo

    2009-07-01

    Primers4clades is an easy-to-use web server that implements a fully automatic PCR primer design pipeline for cross-species amplification of novel sequences from metagenomic DNA, or from uncharacterized organisms, belonging to user-specified phylogenetic clades or taxa. The server takes a set of non-aligned protein coding genes, with or without introns, aligns them and computes a neighbor-joining tree, which is displayed on screen for easy selection of species or sequence clusters to design lineage-specific PCR primers. Primers4clades implements an extended CODEHOP primer design strategy based on both DNA and protein multiple sequence alignments. It evaluates several thermodynamic properties of the oligonucleotide pairs, and computes the phylogenetic information content of the predicted amplicon sets from Shimodaira-Hasegawa-like branch support values of maximum likelihood phylogenies. A non-redundant set of primer formulations is returned, ranked according to their thermodynamic properties. An amplicon distribution map provides a convenient overview of the coverage of the target locus. Altogether these features greatly help the user in making an informed choice between alternative primer pair formulations. Primers4clades is available at two mirror sites: http://maya.ccg.unam.mx/primers4clades/and http://floresta.eead.csic.es/primers4clades/. Three demo data sets and a comprehensive documentation/tutorial page are provided for easy testing of the server's capabilities and interface.

  8. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    PubMed Central

    Spandidos, Athanasia; Wang, Xiaowei; Wang, Huajun; Dragnev, Stefan; Thurber, Tara; Seed, Brian

    2008-01-01

    Background Quantitative polymerase chain reaction (QPCR) is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays. PMID:19108745

  9. Application of AFLP fingerprint analysis for studying the biodiversity of Streptococcus thermophilus.

    PubMed

    Lazzi, Camilla; Bove, Claudio Giorgio; Sgarbi, Elisa; Gatti, Monica; Monica, Gatti; La Gioia, Federica; Torriani, Sandra; Sandra, Torriani; Neviani, Erasmo

    2009-10-01

    Streptococcus thermophilus is a lactic acid bacteria (LAB) widely used in milk fermentation processes as a starter culture. In this work the genetic diversity of S. thermophilus isolates from different sources was analyzed using Amplified Fragment Length Polymorphism fingerprinting (AFLP). Since this is the first report that indicates the application of AFLP in order to study genotypic polymorphism in S. thermophilus species, an optimization of experimental conditions was carried out to decide the optimal AFLP analysis protocol. Furthermore the fingerprinting resolutions of AFLP and RAPD (Random Amplified Polymorphic DNA) were evaluated and compared. The overall data suggest that genotypic characterization performed by AFLP provide a better view of microbial diversity of S. thermophilus, indicating that RAPD is less discriminating than AFLP. The successful use of AFLP analysis in the characterization of S. thermophilus strains reported in this study suggests the potential uses for this technique to define the whole-genome diversity of each specific strain, as an alternative to the fingerprinting methods used till now.

  10. Sex-linked AFLP markers indicate a pseudoautosomal region in hemp ( Cannabis sativa L.).

    PubMed

    Peil, A; Flachowsky, H; Schumann, E; Weber, W E

    2003-06-01

    In dioecious plants of hemp ( Cannabis sativa L.), males are regarded as heterogametic XY and females as homogametic XX, although it is difficult to discriminate the X cytologically from the Y. The Y chromosome is somewhat larger than the X. Our aim was to analyse AFLP markers on X and Y, and to use them to gain some insight into the structure of the sex chromosomes. Markers located on the sex chromosomes can be grouped into different classes, depending on the presence or absence of a fragment on the X and/or the Y. They are detected by separately analysing male and female progenies of a single cross. Five markers were found to be located on both chromosomes. A few recombinants were observed for marker pairs of this class in the male progenies. Two completely linked markers located on the Y chromosome in the male parent show a recombination rate of r = 0.25 with sex. Recombination must have occurred between the sex chromosomes in the male parent. The recombination analysis led to the conclusion that there is a pseudoautosomal region (PAR) on the sex chromosomes, allowing recombination between the X and the Y chromosome. The other regions of the sex chromosomes show only a few recombination events, for the Y as well as for the X. These results are discussed in comparison to other dioecious plants. PMID:12835935

  11. Laser Doppler velocimetry primer

    NASA Technical Reports Server (NTRS)

    Bachalo, William D.

    1985-01-01

    Advanced research in experimental fluid dynamics required a familiarity with sophisticated measurement techniques. In some cases, the development and application of new techniques is required for difficult measurements. Optical methods and in particular, the laser Doppler velocimeter (LDV) are now recognized as the most reliable means for performing measurements in complex turbulent flows. And such, the experimental fluid dynamicist should be familiar with the principles of operation of the method and the details associated with its application. Thus, the goals of this primer are to efficiently transmit the basic concepts of the LDV method to potential users and to provide references that describe the specific areas in greater detail.

  12. Universal primers that amplify RNA from all three flavivirus subgroups

    PubMed Central

    Maher-Sturgess, Sheryl L; Forrester, Naomi L; Wayper, Paul J; Gould, Ernest A; Hall, Roy A; Barnard, Ross T; Gibbs, Mark J

    2008-01-01

    Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5) coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers. PMID:18218114

  13. Multiplexed Primer Prediction for PCR

    SciTech Connect

    2007-07-23

    MPP predicts sets of multiplex-compatible primers for Polymerase Chain Reaction (PCR), finding a near minimal set of primers such that at least one amplicon will be generated from every target sequence in the input file. The code finds highly conserved oligos that are suitable as primers, according to user-specified desired primer characteristics such as length, melting temperature, and amplicon length. The primers are predicted not to form unwanted dimer or hairpin structures. The target sequences used as input can be diverse, since no multiple sequence alighment is required. The code is scalable, taking up to tens of thousands of sequences as input, and works, for example, to find a "universal primer set" for all viral genomes provided as a single input file. The code generates a periodic check-point file, thus in the event of premature execution termination, the application can be restarted from the last check-point file.

  14. Limited-life cartridge primers

    DOEpatents

    Makowiecki, Daniel M.; Rosen, Robert S.

    1998-01-01

    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  15. Limited-life cartridge primers

    DOEpatents

    Makowiecki, Daniel M.; Rosen, Robert S.

    2005-04-19

    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  16. Limited-life cartridge primers

    DOEpatents

    Makowiecki, D.M.; Rosen, R.S.

    1998-06-30

    A cartridge primer is described which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML`s would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers. 10 figs.

  17. Multiplexed Primer Prediction for PCR

    2007-07-23

    MPP predicts sets of multiplex-compatible primers for Polymerase Chain Reaction (PCR), finding a near minimal set of primers such that at least one amplicon will be generated from every target sequence in the input file. The code finds highly conserved oligos that are suitable as primers, according to user-specified desired primer characteristics such as length, melting temperature, and amplicon length. The primers are predicted not to form unwanted dimer or hairpin structures. The target sequencesmore » used as input can be diverse, since no multiple sequence alighment is required. The code is scalable, taking up to tens of thousands of sequences as input, and works, for example, to find a "universal primer set" for all viral genomes provided as a single input file. The code generates a periodic check-point file, thus in the event of premature execution termination, the application can be restarted from the last check-point file.« less

  18. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    USGS Publications Warehouse

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  19. Cloning of AFLP markers linked to resistance to Peronosclerospora sorghi in maize.

    PubMed

    Agrama, H A; Houssin, S F; Tarek, M A

    2002-08-01

    Genetic mapping of resistance genes for sorghum downy mildew (SDM) in maize revealed multiple-locus inheritance. A combination of AFLP (amplified fragment length polymorphism) technique with bulked segregant analysis (BSA) was applied to map the genes involved in the resistance to SDM (Peronosclerospora sorghi) in a recombinant inbred population. Three AFLP markers were identified and mapped to chromosomes 1 and 9, in regions previously associated with SDM resistance. One other AFLP marker was found to be associated with disease susceptibility but could not be linked to any chromosome. These four AFLP fragments were isolated, cloned and sequenced. A BLAST search of the GenBank database showed that none of these four sequences was closely related to resistance genes that have been reported previously. Sequence-characterized amplified regions (SCARs) were produced and used to assess the presence of SDM resistance genes and characterize specific genotypes. These markers may be useful in marker-assisted breeding programs.

  20. STR primer concordance study.

    PubMed

    Budowle, B; Masibay, A; Anderson, S J; Barna, C; Biega, L; Brenneke, S; Brown, B L; Cramer, J; DeGroot, G A; Douglas, D; Duceman, B; Eastman, A; Giles, R; Hamill, J; Haase, D J; Janssen, D W; Kupferschmid, T D; Lawton, T; Lemire, C; Llewellyn, B; Moretti, T; Neves, J; Palaski, C; Schueler, S; Sgueglia, J; Sprecher, C; Tomsey, C; Yet, D

    2001-12-15

    Over 1500 population database samples comprising African Americans, Caucasians, Hispanics, Native Americans, Chamorros and Filipinos were typed using the PowerPlex 16 and the Profiler Plus/COfiler kits. Except for the D8S1179 locus in Chamorros and Filipinos from Guam, there were eight examples in which a typing difference due to allele dropout was observed. At the D8S1179 locus in the population samples from Guam, there were 13 examples of allele dropout observed when using the Profiler Plus kit. The data support that the primers used in the PowerPlex 16, Profiler Plus, and COfiler kits are reliable for typing reference samples that are for use in CODIS. In addition, allele frequency databases have been established for the STR loci Penta D and Penta E. Both loci are highly polymorphic. PMID:11741760

  1. Identification of AFLP and STS markers closely linked to the def locus in pea.

    PubMed

    von Stackelberg, M; Lindemann, S; Menke, M; Riesselmann, S; Jacobsen, H-J

    2003-05-01

    The recessive mutation of the def gene of pea (Pisum sativum L.) leads to the loss of the hilum, the abscission zone between the seed and the pod. Thereby, it reduces the free dispersal of the seeds through pod shattering. As a prerequisite for a gene isolation via a map-based cloning approach, bulked segregant analysis followed by single plant analyses of over 200 homozygous individuals of a population of 476 F2 plants derived from a cross between 'DGV' (def wild-type) and 'PF' (def mutant), were used to detect markers closely linked to the def locus. The AFLP technique in combination with silver staining was used to maximize numbers of reproducible marker loci. Fifteen AFLP loci showed a genetic distance less than 5 and two of them less than 1 centiMorgans (cM) to the gene of interest. AFLPs were converted into sequence tagged sites (STSs) and into a newly refined AFLP-based single locus marker named the 'sequence specified AFLP' (ssAFLP).

  2. Explanatory chapter: PCR primer design.

    PubMed

    Álvarez-Fernández, Rubén

    2013-01-01

    This chapter is intended as a guide on polymerase chain reaction (PCR) primer design (for information on PCR, see General PCR and Explanatory Chapter: Troubleshooting PCR). In the next section, general guidelines will be provided, followed by a discussion on primer design for specific applications. A list of recommended software tools is shown at the end.

  3. MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR

    PubMed Central

    Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

    2015-01-01

    Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. PMID:26109350

  4. Differential gene expression for Curvularia eragrostidis pathogenic incidence in crabgrass (Digitaria sanguinalis) revealed by cDNA-AFLP analysis.

    PubMed

    Wang, Jianshu; Wang, Xuemin; Yuan, Bohua; Qiang, Sheng

    2013-01-01

    Gene expression profiles of Digitaria sanguinalis infected by Curvularia eragrostidis strain QZ-2000 at two concentrations of conidia and two dew durations were analyzed by cDNA amplified fragment length polymorphisms (cDNA-AFLP). Inoculum strength was more determinant of gene expression than dew duration. A total of 256 primer combinations were used for selective amplification and 1214 transcript-derived fragments (TDFs) were selected for their differential expression. Of these, 518 up-regulated differentially expressed TDFs were identified. Forty-six differential cDNA fragments were chosen to be cloned and 35 of them were successfully cloned and sequenced, of which 25 were homologous to genes of known function according to the GenBank database. Only 6 genes were up-regulated in Curvularia eragrostidis-inoculated D. sanguinalis, with functions involved in signal transduction, energy metabolism, cell growth and development, stress responses, abscisic acid biosynthesis and response. It appears that a few pathways may be important parts of the pathogenic strategy of C. eragrostidis strain QZ-2000 on D. sanguinalis. Our study provides the fundamentals to further study the pathogenic mechanism, screen for optimal C. eragrostidis strains as potential mycoherbicide and apply this product to control D. sanguinalis.

  5. A new PCR method: one primer amplification of PCR-CTPP products.

    PubMed

    Yin, Guang; Mitsuda, Yoko; Ezaki, Takayuki; Hamajima, Nobuyuki

    2012-10-01

    Polymerase chain reaction with confronting two-pair primers (PCR-CTPP) is a convenient method for genotyping single nucleotide polymorphisms, saving time, and costs. It uses four primers for PCR; F1 and R1 for one allele, and F2 and R2 for the other allele, by which three different sizes of DNA are amplified; between F1 and R1, between F2 and R2, and between F1 and R2. To date, we have applied PCR-CTPP successfully for genotyping more than 60 polymorphisms. However, it is not rare that PCR does not produce balanced amplification of allele specific bands. Accordingly, the method was modified by attaching a common sequence at the 5' end of two-pair primers and adding another primer with the common sequence in PCR, in total five different primers in a tube for PCR. The modification allowed one primer amplification for the products of initial PCR with confronting two-pair primers, named as one primer amplification of PCR-CTPP products (OPA-CTPP). This article demonstrates an example for an A/G polymorphism of paraoxonase 1 (PON1) Gln192Arg (rs662). PCR-CTPP failed clear genotyping for the polymorphism, while OPA-CTPP successfully produced PCR products corresponding to the allele. The present example indicated that the OPA-CTPP would be useful in the case that PCR-CTPP failed to produce balanced PCR products specific to each allele.

  6. Hermetic G-16 percussion primer

    SciTech Connect

    Durand, N.A.; Weinmaster, R.R.; Massis, T.M.

    1988-01-01

    Studies were conducted to optimize a Hermetic percussion primer capable of surviving temperatures of 200/degree/C for up to 48 hours. These studies included work with typical brass percussion primers and the pyrotechnic composition designed G-16. The G-16 mixture is composed of antimony sulfide, calcium silicide, and potassium. The hermetically sealed assembly consists of a brass cup and anvil loaded with G-16 pyrotechnic mixture and assembly includes a steel disc which is laser welded over the sealing mechanisms cause negligible changes. This assembly can be used with other primers and is capable of enhanced output for specialized applications. 4 refs., 8 figs., 4 tabs.

  7. Express Primer Tool for high-throughput gene cloning and expression

    2002-12-01

    A tool to assist in the design of primers for DNA amplification. The Express Primer web-based tool generates primer sequences specifically for the generation of expression clones for both lab scale and high-throughput projects. The application is designed not only to allow the user complete flexibility to specify primer design parameters but also to minimize the amount of manual intervention needed to generate a large number of primers for simultaneous amplification of multiple target genes.more » The Express Primer Tool enables the user to specify various experimental parameters (e.g. optimal Tm, Tm range, maximum Tm difference) for single or multiple candidate sequence(s) in FASTA format input as a flat text (ASCII) file. The application generates condidate primers, selects optimal primer pairs, and writes the forward and reverse primers pairs to an Excel file that is suitable for electronic submission to a synthesis facility. The program parameters emphasize high-throughput but allow for target atrition at various stages of the project.« less

  8. Phylogeny of bovine species based on AFLP fingerprinting.

    PubMed

    Buntjer, J B; Otsen, M; Nijman, I J; Kuiper, M T R; Lenstra, J A

    2002-01-01

    The Bovini species comprise both domestic and wild cattle species. Published phylogenies of this tribe based on mitochondrial DNA contain anomalies, while nuclear sequences show only low variation. We have used amplified fragment length polymorphism (AFLP) fingerprinting in order to detect variation in loci distributed over the nuclear genome. Computer-assisted scoring of electrophoretic fingerprinting patterns yielded 361 markers, which provided sufficient redundancy to suppress stochastic effects of intraspecies polymorphisms and length homoplasies (comigration of non-homologous fragments). Tree reconstructions reveal three clusters: African buffalo with water buffalo, ox with zebu, and bison with wisent. Similarity values suggest a clustering of gaur and banteng, but bifurcating clustering algorithms did not assign consistent positions to these species and yak. We propose that because of shared polymorphisms and reticulations, tree topologies are only partially adequate to represent the phylogeny of the Bovini. Principal-coordinate analysis positions zebu between a gaur/banteng cluster and taurine cattle. This correlates with the region of origin of these species and suggests that genomic distances between the cattle species have been influenced by genetic exchange between neighbouring ancestral populations.

  9. Pick a Pair. Pancake Pairs

    ERIC Educational Resources Information Center

    Miller, Pat

    2005-01-01

    Cold February weather and pancakes are a traditional pairing. Pancake Day began as a way to eat up the foods that were abstained from in Lent--traditionally meat, fat, eggs and dairy products. The best-known pancake event is The Pancake Day Race in Buckinghamshire, England, which has been run since 1445. This column describes pairs of books that…

  10. An AFLP estimation of the outcrossing rate of Spondias tuberosa (Anacardiaceae), an endemic species to the Brazilian semiarid region.

    PubMed

    Fernandes Santos, Carlos Antonio; de Souza Gama, Renata Natália Cândido

    2013-06-01

    The umbu tree (Spondias tuberosa) is one of the most important endemic species to the Brazilian tropical semiarid region. The umbu tree has edible fruits with a peculiar flavor that are consumed in natura or in a semi-industrialized form, such as jams, candies and juices. The majority of endemic species to Brazilian semiarid region have not been studied or sampled to form germ-plasm collections, which increases the risk of losing genetic variability of the adapted species to xerophytic conditions. The aim of this study was to estimate outcrossing rates in S. tuberosa using a multilocus mixed model in order to guide genetic resources and breeding programs of this species. DNA samples were extracted from 92 progenies of umbu trees, which were distributed among 12 families. These trees were planted by seed in 1991 in Petrolina, PE, Brazil. The experimental design was a randomized block, with a total of 42 progenies sampled in three regions. The experimental units were composed by five plants and five replications. The outcrossing rate was estimated by the multilocus model, which is available in the MLTR software, and was based on 17 polymorphic AFLP bands obtained from AAA_CTG and AAA_CTC primer combinations. The observed heterozygotes ranged from 0.147 to 0.499, with a maximum frequency estimated for the AAA_CTC 10 amplicon. The multilocus outcrossing estimation (t(m)) was 0.804 +/- 0.072, while the single-locus (t(s)) was 0.841 +/- 0.079, which suggests that S. tuberosa is predominantly an outcrossing species. The difference between t(m) and t(s) was -0.037 +/- 0.029, which indicates that biparental inbreeding was nearly absent. The mean inbreeding coefficient or fixation index (F) among maternal plants was--0.103 +/- 0.045, and the expected F was 0.108, which indicates that there was no excess of heterozygotes in the maternal population. The outcrossing estimates obtained in the present study indicate that S. tuberosa is an open-pollinated species. Biometrical

  11. A LISA Interferometry Primer

    NASA Technical Reports Server (NTRS)

    Thorpe, James Ira

    2010-01-01

    A key challenge for all gravitational wave detectors in the detection of changes in the fractional difference between pairs of test masses with sufficient precision to measure astrophysical strains with amplitudes on the order of approx.10(exp -21). ln the case of the five million km arms of LISA, this equates to distance measurements on the ten picometer level. LISA interferometry utilizes a decentralized topology, in which each of the sciencecraft houses its own light sources, detectors, and electronics. The measurements made at each of the sciencecraft are then telemetered to ground and combined to extract the strain experienced by the constellation as a whole. I will present an overview of LISA interferometry and highlight some of the key components and technologies that make it possible.

  12. New cyt b gene universal primer set for forensic analysis.

    PubMed

    Lopez-Oceja, A; Gamarra, D; Borragan, S; Jiménez-Moreno, S; de Pancorbo, M M

    2016-07-01

    Analysis of mitochondrial DNA, and in particular the cytochrome b gene (cyt b), has become an essential tool for species identification in routine forensic practice. In cases of degraded samples, where the DNA is fractionated, universal primers that are highly efficient for the amplification of the target region are necessary. Therefore, in the present study a new universal cyt b primer set with high species identification capabilities, even in samples with highly degraded DNA, has been developed. In order to achieve this objective, the primers were designed following the alignment of complete sequences of the cyt b from 751 species from the Class of Mammalia listed in GenBank. A highly variable region of 148bp flanked by highly conserved sequences was chosen for placing the primers. The effectiveness of the new pair of primers was examined in 63 animal species belonging to 38 Families from 14 Orders and 5 Classes (Mammalia, Aves, Reptilia, Actinopterygii, and Malacostraca). Species determination was possible in all cases, which shows that the fragment analyzed provided a high capability for species identification. Furthermore, to ensure the efficiency of the 148bp fragment, the intraspecific variability was analyzed by calculating the concordance between individuals with the BLAST tool from the NCBI (National Center for Biotechnological Information). The intraspecific concordance levels were superior to 97% in all species. Likewise, the phylogenetic information from the selected fragment was confirmed by obtaining the phylogenetic tree from the sequences of the species analyzed. Evidence of the high power of phylogenetic discrimination of the analyzed fragment of the cyt b was obtained, as 93.75% of the species were grouped within their corresponding Orders. Finally, the analysis of 40 degraded samples with small-size DNA fragments showed that the new pair of primers permits identifying the species, even when the DNA is highly degraded as it is very common in

  13. New cyt b gene universal primer set for forensic analysis.

    PubMed

    Lopez-Oceja, A; Gamarra, D; Borragan, S; Jiménez-Moreno, S; de Pancorbo, M M

    2016-07-01

    Analysis of mitochondrial DNA, and in particular the cytochrome b gene (cyt b), has become an essential tool for species identification in routine forensic practice. In cases of degraded samples, where the DNA is fractionated, universal primers that are highly efficient for the amplification of the target region are necessary. Therefore, in the present study a new universal cyt b primer set with high species identification capabilities, even in samples with highly degraded DNA, has been developed. In order to achieve this objective, the primers were designed following the alignment of complete sequences of the cyt b from 751 species from the Class of Mammalia listed in GenBank. A highly variable region of 148bp flanked by highly conserved sequences was chosen for placing the primers. The effectiveness of the new pair of primers was examined in 63 animal species belonging to 38 Families from 14 Orders and 5 Classes (Mammalia, Aves, Reptilia, Actinopterygii, and Malacostraca). Species determination was possible in all cases, which shows that the fragment analyzed provided a high capability for species identification. Furthermore, to ensure the efficiency of the 148bp fragment, the intraspecific variability was analyzed by calculating the concordance between individuals with the BLAST tool from the NCBI (National Center for Biotechnological Information). The intraspecific concordance levels were superior to 97% in all species. Likewise, the phylogenetic information from the selected fragment was confirmed by obtaining the phylogenetic tree from the sequences of the species analyzed. Evidence of the high power of phylogenetic discrimination of the analyzed fragment of the cyt b was obtained, as 93.75% of the species were grouped within their corresponding Orders. Finally, the analysis of 40 degraded samples with small-size DNA fragments showed that the new pair of primers permits identifying the species, even when the DNA is highly degraded as it is very common in

  14. Assessing genetic diversity in a sugarcane germplasm collection using an automated AFLP analysis.

    PubMed

    Besse, P; Taylor, G; Carroll, B; Berding, N; Burner, D; McIntyre, C L

    1998-10-01

    An assessment of genetic diversity within and between Saccharum, Old World Erianthus sect. Ripidium, and North American E.giganteus (S.giganteum) was conducted using Amplified Fragment Length Polymorphism (AFLP(TM)) markers. An automated gel scoring system (GelCompar(TM)) was successfully used to analyse the complex AFLP patterns obtained in sugarcane and its relatives. Similarity coefficient calculations and clustering revealed a genetic structure for Saccharum and Erianthus sect. Ripidium that was identical to the one previously obtained using other molecular marker types, showing the appropriateness of AFLP markers and the associated automated analysis in assessing genetic diversity in sugarcane. A genetic structure that correlated with cytotype (2n=30, 60, 90) was revealed within the North American species, E. giganteus (S.giganteum). Complex relationships among Saccharum, Erianthus sect. Ripidium, and North American E.giganteus were revealed and are discussed in the light of a similar study which involved RAPD markers.

  15. Amplified Fragment Length Polymorphism (AFLP) - an invaluable fingerprinting technique for genomic, transcriptomic and epigenetic studies

    PubMed Central

    Paun, Ovidiu; Schönswetter, Peter

    2012-01-01

    Summary Amplified fragment length polymorphism (AFLP) is a PCR-based technique that uses selective amplification of a subset of digested DNA fragments to generate and compare unique fingerprints for genomes of interest. The power of this method relies mainly in that it does not require prior information regarding the targeted genome, as well as in its high reproducibility and sensitivity for detecting polymorphism at the level of DNA sequence. Widely used for plant and microbial studies, AFLP is employed for a variety of applications, such as: to assess genetic diversity within species or among closely related species, to infer population-level phylogenies and biogeographic patterns, to generate genetic maps and to determine relatedness among cultivars. Variations of standard AFLP methodology have been also developed for targeting additional levels of diversity, like transcriptomic variation and DNA methylation polymorphism. PMID:22419490

  16. Application of ITS sequence analysis, RAPD and AFLP fingerprinting in characterising the yeast genus Fellomyces.

    PubMed

    Lopandic, Ksenija; Molnár, Orsolya; Prillinger, Hansjörg

    2005-01-01

    Three molecular techniques, ITS sequence analysis, random amplified polymorphic DNA (RAPD) and amplified fragment length polymorphism (AFLP) were used to study phylogenetic and genotypic relationships among strains of the genus Fellomyces. In the analyses were included strains isolated predominantly from epiphytic lichens collected in Indonesia, China and Mexico. The polyphasic approach indicated that the Fellomyces isolates are genotypically heterogeneous and that lichens represent a specific environment for selection of large number of the sterigmatoconidia producing species. The phylogenetic and genotypic analysis confirmed the existence of 11 currently accepted Fellomyces species and indicated that several species may be the new representatives of the genus. The RAPD and AFLP analyses demonstrated a higher potential in distinguishing the Fellomyces strains than the ITS regions. Since the sequence analysis showed low or no divergence among several strains, both RAPD and AFLP fingerprinting indicated that the strains may be discriminated at the species level.

  17. [Use of AFLP analysis for the molecular biological fine typing of Campylobacter jejuni strains from turkey flocks].

    PubMed

    Alter, Thomas; Fehlhaber, Karsten

    2003-01-01

    One of the most promising genotyping methods for microorganisms is the AFLP (amplified fragment length polymorphism)-analysis, originally developed to genotype plants. The AFLP method has a high discriminatory power and an excellent reproducibility. Thus it is suitable for solving taxonomic and epidemiological questions. AFLP analysis was used to reveal the genetic diversity of Campylobacter (C.) jejuni strains from turkeys. The aim was to detect and genotype C. jejuni strains on individual turkeys throughout the complete slaughter process. A broad spectrum of genotypes was detectable on the turkey skin at the beginning of the slaughter line. At the end of the slaughter process-after chilling, only a diminished spectrum of genotypes was detectable by AFLP-analysis, suggesting, that slaughter specific environmental stressors may exert a selective pressure on the strain diversity. Our results proved, that AFLP analysis is an excellent tool for subtyping large numbers of Campylobacter strains. PMID:14655622

  18. Sequence-specific DNA primer effects on telomerase polymerization activity.

    PubMed Central

    Lee, M S; Blackburn, E H

    1993-01-01

    The ribonucleoprotein enzyme telomerase synthesizes one strand of telomeric DNA by copying a template sequence within the RNA moiety of the enzyme. Kinetic studies of this polymerization reaction were used to analyze the mechanism and properties of the telomerase from Tetrahymena thermophila. This enzyme synthesizes TTGGGG repeats, the telomeric DNA sequence of this species, by elongating a DNA primer whose 3' end base pairs with the template-forming domain of the RNA. The enzyme was found to act nonprocessively with short (10- to 12-nucleotide) primers but to become processive as TTGGGG repeats were added. Variation of the 5' sequences of short primers with a common 3' end identified sequence-specific effects which are distinct from those involving base pairing of the 3' end of the primer with the RNA template and which can markedly induce enzyme activity by increasing the catalytic rate of the telomerase polymerization reaction. These results identify an additional mechanistic basis for telomere and DNA end recognition by telomerase in vivo. Images PMID:8413255

  19. Primer design for PCR reactions in forensic biology.

    PubMed

    Elkins, Kelly M

    2015-01-01

    The polymerase chain reaction (PCR) is a popular method to copy DNA in vitro. Its invention revolutionized fields ranging from clinical medicine to anthropology, molecular biology, and forensic biology. The method employs one of many available heat-stable DNA polymerases in a reaction that is repeated many times in situ. The DNA polymerase reads a template DNA strand and using the components of the reaction mix, catalyzes the addition of free 2'-deoxynucleotide triphosphate nitrogenous bases to short segment of DNA that forms a complement with the template via Watson-Crick base pairing. This short segment of DNA is referred to as a PCR primer and it is essential to the success of the reaction. The most widely used application of PCR in forensic labs is the amplification of short tandem repeat (STR) loci used in DNA typing. The STRs are routinely evaluated in concert with 16 or more reactions, a multiplex, run in one test tube simultaneously. In a multiplex, it is essential that the primers work specifically and accurately on the intended reactions without hindering the other reactions. The primers, which are very specific, also can be used to probe single nucleotide polymorphisms (SNPs) in a DNA sequence of interest by single base extension. Primers are often designed using one of many available automated software packages. Here the process of manually designing PCR primers for forensic biology using no-cost software is described.

  20. PCR Primers for Metazoan Mitochondrial 12S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Kweskin, Matthew; Knowlton, Nancy

    2012-01-01

    Background Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. Methodology/Principal Findings A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These regions were used to design a primer pair that flanks a more variable region in the gene. Then all of the complete metazoan mitochondrial genomes available in NCBI's Organelle Genome Resources database were used to determine the percentage of taxa that would likely be amplified using these primers. Results suggest that these primers will amplify target sequences for many metazoans. Conclusions/Significance Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis because of their ability to amplify sequences from many metazoans. PMID:22536450

  1. A new image of plantain diversity assessed by SSR, AFLP and MSAP markers.

    PubMed

    Noyer, J L; Causse, S; Tomekpe, K; Bouet, A; Baurens, F C

    2005-05-01

    Using both SSR and AFLP markers, the genetic diversity of 30 plantains constituting a representative sample of the phenotypic diversity was assessed. The results confirmed a very narrow genetic base of this cultivar group. SSR and AFLP data support the hypothesis that these cultivars may have arisen from vegetative multiplication of a single seed. MSAP were used to survey cytosine methylation status at CCGG sites in order to obtain an alternative source of diversity data. A higher degree of polymorphism was revealed allowing the classification of the samples into three clusters. No correlation was observed between the phenotypic classification and methylation diversity. Implications for breeding programs are discussed.

  2. [Screening of peafowl microsatellite primers and analysis of genetic diversity].

    PubMed

    Bao, Wen-Bin; Chen, Guo-Hong; Shu, Jing-Ting; Xu, Qi; Li, Hui-Fang

    2006-10-01

    The applicability of chicken microsatellite primers to peafowl population was analyzed in the present paper, and the results showed 14 of 29 pairs of microsatellite primers from chicken could amplify peafowl DNA and produce specific allele patterns. A mean of 1.71 alleles was found for each locus. Seven pairs were highly polymorphic, and MCW0080 and MCW0098 were ideal markers for peafowl. Genetic diversity analysis within and between the green peafowl and the blue peafowl populations demonstrated that the expected heterozygosity of two peafowl populations were 0.2482 and 0.2744, respectively. The inbreeding index (FST), Reynolds' genetic distance and gene flow between the two populations were 0.078, 0.0603 and 3.896 respectively. These results indicate that the heterozygosity and the genetic diversity of these two peafowl populations were very low, and suggest a tendency towards intermixing.

  3. [Screening of peafowl microsatellite primers and analysis of genetic diversity].

    PubMed

    Bao, Wen-Bin; Chen, Guo-Hong; Shu, Jing-Ting; Xu, Qi; Li, Hui-Fang

    2006-10-01

    The applicability of chicken microsatellite primers to peafowl population was analyzed in the present paper, and the results showed 14 of 29 pairs of microsatellite primers from chicken could amplify peafowl DNA and produce specific allele patterns. A mean of 1.71 alleles was found for each locus. Seven pairs were highly polymorphic, and MCW0080 and MCW0098 were ideal markers for peafowl. Genetic diversity analysis within and between the green peafowl and the blue peafowl populations demonstrated that the expected heterozygosity of two peafowl populations were 0.2482 and 0.2744, respectively. The inbreeding index (FST), Reynolds' genetic distance and gene flow between the two populations were 0.078, 0.0603 and 3.896 respectively. These results indicate that the heterozygosity and the genetic diversity of these two peafowl populations were very low, and suggest a tendency towards intermixing. PMID:17035182

  4. Charter School Primer. Peter Lang Primer. Volume 34

    ERIC Educational Resources Information Center

    Tryjankowski, Anne Marie

    2012-01-01

    The "Charter School Primer" presents an overview of public charter schools in the United States. The book discusses what charter schools are; the history of public charter school choice in the United States; the role of teachers, parents, boards, and unions in the charter school movement; and gives examples of innovations in education made…

  5. Vygotsky on Education Primer. Peter Lang Primer. Volume 30

    ERIC Educational Resources Information Center

    Lake, Robert

    2012-01-01

    The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…

  6. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    PubMed

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics. PMID:25229098

  7. Developing AFLP Markers to study genetic differentiation of the Cotton Fleahopper, Pseudatomoscelis seriatus (Reuter) (Hemiptera: Miridae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genetic comparisons of fleahopper populations in cotton and weed hosts may be useful for identifying the weed sources contributing the majority of fleahoppers in cotton. Molecular markers such as amplified fragment length polymorphisms (AFLP) are useful to identify genetic similarities and differen...

  8. AFLP fingerprinting shows that a single Prymnesium parvum harmful algal bloom consists of multiple clones.

    PubMed

    Barreto, Felipe S; Tomas, Carmelo R; McCartney, Michael A

    2011-01-01

    Due to slow rates of molecular evolution, DNA sequences used to identify and build phylogenies of algal species involved in harmful algal blooms (HABs) are generally invariant at the intraspecific level. This means that it is unknown whether HAB events result from the growth of a single clone, a few dominant clones, or multiple clones. This is true despite the fact that several physiological and demographic traits, as well as toxicity, are known to vary across clones. We generated AFLP fingerprints from a set of 6 clonal isolates, taken from a bloom of Prymnesium parvum at a striped bass mariculture facility. This new haptophyte bloom was recently implicated in fish kills at several sites in the United States. The AFLP fragments were highly reproducible and showed that all isolates were distinguishable due to abundant AFLPs unique to single isolates. These results demonstrate that blooms can be genetically diverse outbreaks and indicate that AFLP can be a powerful molecular tool for characterizing and monitoring this diversity. PMID:21885572

  9. Genetic diversity of sweet sorghum germplasm in Mexico using AFLP and SSR markers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The objective of this work was to evaluate the diversity and genetic relationships between lines and varieties of the sweet sorghum (Sorghum bicolor) germplasm bank of the National Institute for Forestry, Agriculture and Livestock Research, Mexico, using AFLP and SSR markers. The molecular markers ...

  10. An AFLP-based procedure for the efficient mapping of mutations and DNA probes in barley.

    PubMed Central

    Castiglioni, P; Pozzi, C; Heun, M; Terzi, V; Müller, K J; Rohde, W; Salamini, F

    1998-01-01

    A strategy based upon AFLP markers for high-efficiency mapping of morphological mutations and DNA probes to linkage groups in barley is presented. First, 511 AFLP markers were placed on the linkage map derived from the cross Proctor x Nudinka. Second, loci controlling phenotypic traits were assigned to linkage groups by AFLP analysis, using F2 populations consisting of 30-50 mutant plants derived from crosses of the type "mutant x Proctor" and "mutant x Nudinka." To map DNA probes, 67 different wild-type barley lines were selected to generate F2 populations by crossing with Proctor and Nudinka. F2 plants that were polymorphic for a given RFLP fragment were classified into genotypic classes. Linkage of the RFLP polymorphism to 1 of the 511 AFLP loci was indicated by cosegregation. The use of the strategy is exemplified by the mapping of the mutation branched-5 to chromosome 2 and of the DNA probes Bkn2 and BM-7 to chromosomes 5 and 1, respectively. Map expansion and marker order in map regions with dense clustering of markers represented a particular problem. A discussion considering the effect of noncanonical recombinant products on these two parameters is provided. PMID:9691056

  11. Relationship of European Persimmon (Diospyros kaki Thunb.) Cultivars to Asian Cultivars, Characterized Using AFLPs.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Sixty one persimmon (Diospyros kaki Thunb.) selections, including 17 Italian, 11 Spanish, 13 Japanese, six Korean, five Chinese, one Israeli, and eight of unknown origin, were evaluated for genetic differences by AFLP analysis. Relationships among cultivars were evaluated by UPGMA clustering, Neigh...

  12. Bootsie: estimation of coefficient of variation of AFLP data by bootstrap analysis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Bootsie is an English-native replacement for ASG Coelho’s “DBOOT” utility for estimating coefficient of variation of a population of AFLP marker data using bootstrapping. Bootsie improves on DBOOT by supporting batch processing, time-to-completion estimation, built-in graphs, and a suite of export t...

  13. Primer vector theory and applications

    NASA Technical Reports Server (NTRS)

    Jezewski, D. J.

    1975-01-01

    A method developed to compute two-body, optimal, N-impulse trajectories was presented. The necessary conditions established define the gradient structure of the primer vector and its derivative for any set of boundary conditions and any number of impulses. Inequality constraints, a conjugate gradient iterator technique, and the use of a penalty function were also discussed.

  14. A Hearing Aid Primer 1

    ERIC Educational Resources Information Center

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  15. Freshwater Wetlands: A Citizen's Primer.

    ERIC Educational Resources Information Center

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of wetland…

  16. Coal mining: A petex primer

    SciTech Connect

    Not Available

    1985-01-01

    This book is an introduction to the coal industry - from planning a mine to delivering coal to a power plant. The primer covers what coal is and how it is used, modern underground and surface mining practices, coal preparation and transport, and the relation between coal and the environment.

  17. Postsecondary Data Connections: A Primer

    ERIC Educational Resources Information Center

    Data Quality Campaign, 2011

    2011-01-01

    There is an increasing focus at the state and federal levels on linking data across the P-20/Workforce spectrum to help inform policies and practices. This primer is intended to provide policymakers with: (1) An overview of the status of states vis-a-vis the linking of postsecondary data to K-12 and workforce data; (2) A subset of questions…

  18. Comparative analysis of genetic diversity in sacred lotus (Nelumbo nucifera Gaertn.) using AFLP and SSR markers.

    PubMed

    Hu, Jihong; Pan, Lei; Liu, Honggao; Wang, Shuzhen; Wu, Zhihua; Ke, Weidong; Ding, Yi

    2012-04-01

    The sacred lotus (Nelumbo nucifera Gaertn.) is an aquatic plant of economic and ornamental importance in China. In this study, we developed twenty novel sacred lotus SSR markers, and used AFLP and SSR markers to investigate the genetic diversity and genetic relationships among 58 accessions of N. nucifera including 15 seed lotus, 12 rhizome lotus, 24 flower lotus and 7 wild lotus. Our results showed that sacred lotus exhibited a low level of genetic diversity, which may attribute to asexual reproduction and long-term artificial selection. A dendrogram based on both AFLP and SSR clustering data showed that: (1) the seed lotus accessions and rhizome lotus accessions were distinctly clustered into different groups, which indicated the significant genetic differentiation between them. This may be attributed to the two modes of reproduction and lack of genetic exchange; (2) the accessions of Thailand wild lotus were separated from other wild lotus accessions. This implied that the Thailand lotus might be genetically differentiated from other wild lotuses. In addition, Mantel test conducted gave highly significant correlation between AFLP-SSR data and each of the AFLP and SSR ones, with the values of r = 0.941 and r = 0.879, respectively, indicating the higher efficiency of the combination of these techniques (AFLP and SSR) in estimation and validation of the genetic diversity among the accession of sacred lotus. This knowledge of the genetic diversity and genetic relatedness of N. nucifera is potentially useful to improve the current strategies in breeding and germplasm conservation to enhance the ornamental and economic value of sacred lotus.

  19. Improved Bacterial 16S rRNA Gene (V4 and V4-5) and Fungal Internal Transcribed Spacer Marker Gene Primers for Microbial Community Surveys

    SciTech Connect

    Walters , William; Hyde, Embriette R.; Berg-Lyons, Donna; Ackermann, Gail; Humphrey, Greg; Parada , Alma; Gilbert, Jack A.; Jansson, Janet K.; Caporaso, Greg; Fuhrman, Jed A.; Apprill, Amy; Knight, Rob

    2015-12-22

    Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of datasets amplified with varied primers requires attention. Here we examine the performance of modified 16S rRNA gene and ITS primers for archaea/bacteria and fungi, respectively, with non-aquatic samples. We moved primer barcodes to the 5’-end, allowing for a range of different 3’ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4-5 of the 16S rRNA gene. We additionally demonstrate that modifications to the 515f/806r (variable region 4) 16S primer pair, which improves detection of Thaumarchaeota and SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies.

  20. Streamlining DNA Barcoding Protocols: Automated DNA Extraction and a New cox1 Primer in Arachnid Systematics

    PubMed Central

    Vidergar, Nina; Toplak, Nataša; Kuntner, Matjaž

    2014-01-01

    Background DNA barcoding is a popular tool in taxonomic and phylogenetic studies, but for most animal lineages protocols for obtaining the barcoding sequences—mitochondrial cytochrome C oxidase subunit I (cox1 AKA CO1)—are not standardized. Our aim was to explore an optimal strategy for arachnids, focusing on the species-richest lineage, spiders by (1) improving an automated DNA extraction protocol, (2) testing the performance of commonly used primer combinations, and (3) developing a new cox1 primer suitable for more efficient alignment and phylogenetic analyses. Methodology We used exemplars of 15 species from all major spider clades, processed a range of spider tissues of varying size and quality, optimized genomic DNA extraction using the MagMAX Express magnetic particle processor—an automated high throughput DNA extraction system—and tested cox1 amplification protocols emphasizing the standard barcoding region using ten routinely employed primer pairs. Results The best results were obtained with the commonly used Folmer primers (LCO1490/HCO2198) that capture the standard barcode region, and with the C1-J-2183/C1-N-2776 primer pair that amplifies its extension. However, C1-J-2183 is designed too close to HCO2198 for well-interpreted, continuous sequence data, and in practice the resulting sequences from the two primer pairs rarely overlap. We therefore designed a new forward primer C1-J-2123 60 base pairs upstream of the C1-J-2183 binding site. The success rate of this new primer (93%) matched that of C1-J-2183. Conclusions The use of C1-J-2123 allows full, indel-free overlap of sequences obtained with the standard Folmer primers and with C1-J-2123 primer pair. Our preliminary tests suggest that in addition to spiders, C1-J-2123 will also perform in other arachnids and several other invertebrates. We provide optimal PCR protocols for these primer sets, and recommend using them for systematic efforts beyond DNA barcoding. PMID:25415202

  1. Design and evaluation of universal 16S rRNA gene primers for high-throughput sequencing to simultaneously detect DAMO microbes and anammox bacteria.

    PubMed

    Lu, Yong-Ze; Ding, Zhao-Wei; Ding, Jing; Fu, Liang; Zeng, Raymond J

    2015-12-15

    To develop universal 16S rRNA gene primers for high-throughput sequencing for the simultaneous detection of denitrifying anaerobic methane oxidation (DAMO) archaea, DAMO bacteria, and anaerobic ammonium oxidation (anammox) bacteria, four published primer sets (PS2-PS5) were modified. The overall coverage of the four primer pairs was evaluated in silico with the Silva SSU r119 dataset. Based on the virtual evaluation, the two best primer pairs (PS4 and PS5) were selected for further verification. Illumina MiSeq sequencing of a freshwater sediment and a culture from a DAMO-anammox reactor using these two primer pairs revealed that PS5 (341b4F-806R) was the most promising universal primer pair. This pair of primers detected both archaea and bacteria with less bias than PS4. Furthermore, an anaerobic fermentation culture and a wastewater treatment plant culture were used to verify the accuracy of PS5. More importantly, it detected DAMO archaea, DAMO bacteria, and anammox bacteria simultaneously with no false positives appeared. This universal 16S rRNA gene primer pair extends the existing molecular tools for studying the community structures and distributions of DAMO microbes and their potential interactions with anammox bacteria in different environments. PMID:26454634

  2. Design and evaluation of universal 16S rRNA gene primers for high-throughput sequencing to simultaneously detect DAMO microbes and anammox bacteria.

    PubMed

    Lu, Yong-Ze; Ding, Zhao-Wei; Ding, Jing; Fu, Liang; Zeng, Raymond J

    2015-12-15

    To develop universal 16S rRNA gene primers for high-throughput sequencing for the simultaneous detection of denitrifying anaerobic methane oxidation (DAMO) archaea, DAMO bacteria, and anaerobic ammonium oxidation (anammox) bacteria, four published primer sets (PS2-PS5) were modified. The overall coverage of the four primer pairs was evaluated in silico with the Silva SSU r119 dataset. Based on the virtual evaluation, the two best primer pairs (PS4 and PS5) were selected for further verification. Illumina MiSeq sequencing of a freshwater sediment and a culture from a DAMO-anammox reactor using these two primer pairs revealed that PS5 (341b4F-806R) was the most promising universal primer pair. This pair of primers detected both archaea and bacteria with less bias than PS4. Furthermore, an anaerobic fermentation culture and a wastewater treatment plant culture were used to verify the accuracy of PS5. More importantly, it detected DAMO archaea, DAMO bacteria, and anammox bacteria simultaneously with no false positives appeared. This universal 16S rRNA gene primer pair extends the existing molecular tools for studying the community structures and distributions of DAMO microbes and their potential interactions with anammox bacteria in different environments.

  3. Validated primer set that prevents nuclear DNA sequences of mitochondrial origin co-amplification: a revision based on the New Human Genome Reference Sequence (GRCh37).

    PubMed

    Ramos, Amanda; Santos, Cristina; Barbena, Elena; Mateiu, Ligia; Alvarez, Luis; Nogués, Ramon; Aluja, Maria Pilar

    2011-03-01

    A new human genome reference sequence--GRCh37--was recently generated and made available by the Genome Reference Consortium. Since the prior disposable human reference sequence--hg18--was previously used for the mitochondrial DNA primer BLAST validation, a revision of those previously published primer pairs is required. Thus, the aim of this Short Communication is to perform an in silico BLAST test of the published disposable nine primer pairs using the new human reference sequence and to report the pertinent modifications. The new analysis showed that one of the tested primer pairs requires a revision. Therefore, a new validated primer pair, which specifically amplifies the mitochondrial region located between positions 6520 and 9184, is presented.

  4. Development of SCAR Primers for PCR Assay to Detect Diplodia seriata

    PubMed Central

    Martín, M. T.; Cuesta, M. J.; Martín, L.

    2014-01-01

    The aim of this study was to develop primer pairs for Diplodia seriata identification, one of the most common fungal species associated with grapevine decline in Castilla y León (Spain). Genetic variability of selected isolates of D. seriata was estimated. A molecular marker was generated from a random amplified polymorphic DNA (RAPD) fragment. PCR products of around 1200 bp were obtained with OPE20 primer. The PCR products were cloned and sequenced. The sequences were compared and a fragment of 1207 bp was used to design primer pairs. Two primer pairs were selected (DS3.8 S3-DS3.8 R6 and DS3.8 S3-DS3.8 R4) that amplified a single DNA product of 634 bp and 233 bp, respectively, with D. seriata isolates. No amplification was obtained for any of the 57 isolates of other species. The designed SCAR primer pairs allowed a rapid detection of D. seriata, and were able to detect 0.1 pg of the target DNA. Detection was specific and sensitive for D. seriata. The established protocols detected these fungi in naturally infected grapevines after DNA purification. Diplodia seriata was detectable without DNA purification and isolation in 62.5% to 75% of reactions. The detection of this pathogen in wood samples has great potential for use in pathogen-free certification schemes. PMID:27437468

  5. Development of SCAR Primers for PCR Assay to Detect Diplodia seriata.

    PubMed

    Martín, M T; Cuesta, M J; Martín, L

    2014-01-01

    The aim of this study was to develop primer pairs for Diplodia seriata identification, one of the most common fungal species associated with grapevine decline in Castilla y León (Spain). Genetic variability of selected isolates of D. seriata was estimated. A molecular marker was generated from a random amplified polymorphic DNA (RAPD) fragment. PCR products of around 1200 bp were obtained with OPE20 primer. The PCR products were cloned and sequenced. The sequences were compared and a fragment of 1207 bp was used to design primer pairs. Two primer pairs were selected (DS3.8 S3-DS3.8 R6 and DS3.8 S3-DS3.8 R4) that amplified a single DNA product of 634 bp and 233 bp, respectively, with D. seriata isolates. No amplification was obtained for any of the 57 isolates of other species. The designed SCAR primer pairs allowed a rapid detection of D. seriata, and were able to detect 0.1 pg of the target DNA. Detection was specific and sensitive for D. seriata. The established protocols detected these fungi in naturally infected grapevines after DNA purification. Diplodia seriata was detectable without DNA purification and isolation in 62.5% to 75% of reactions. The detection of this pathogen in wood samples has great potential for use in pathogen-free certification schemes.

  6. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of...

  7. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of...

  8. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of...

  9. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  10. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  11. Using Primers to Motivate Your Students

    ERIC Educational Resources Information Center

    Graff, Dan

    2002-01-01

    Primers are used to motivate and uplift your class. They come in many different styles and can be used in a variety of ways. Making primers relevant to students helps them to learn and makes them feel appreciated and knowledgeable when they participate. Using primers in the classroom to make students feel valued brings much success.

  12. Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.

    PubMed

    Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S

    2015-06-01

    Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed.

  13. Molecular analyses of the genus Ilex (Aquifoliaceae) in southern South America, evidence from AFLP and ITS sequence data.

    PubMed

    Gottlieb, Alexandra M; Giberti, Gustavo C; Poggio, Lidia

    2005-02-01

    In order to clarify the relationships among southern South American (sSA) representatives of the genus Ilex, an amplified fragment length polymorphism (AFLP) analysis was accomplished. In addition, the phylogenetic relationships of the species were studied using ribosomal internal transcribed spacer (ITS) sequence data alone and in combination with AFLP data, taking into account the possible existence of paralogous sequences and the influence of alignment parameters. To explore stability of phylogenetic hypotheses, a sensitivity analysis was performed using 15 indel-substitution models. Within each species assayed, the AFLPs allowed the recognition of several diagnostic bands. Furthermore, the AFLP analysis revealed that individuals belonging to the same morpho-species formed coherent clades. In addition, some cases of geographical association were noted. Studies on ITS sequences revealed divergence between data obtained herein and sequence data downloaded from GenBank. The sensitivity analyses yielded different interspecific hypotheses of relationships. Notwithstanding, analyses of the ITS data alone and in combination with AFLPs, rendered clades stable to variation in the analytical parameters. Topologies obtained for the AFLPs, the ITS data alone and the combined analyses, demonstrated the existence of a group formed by I. argentina, I. brasiliensis, I. brevicuspis, I. integerrima, and I. theezans, and that I. dumosa and I. paraguariensis were distantly related to the former. Incongruence with traditional taxonomical treatments was found.

  14. Biased Diversity Metrics Revealed by Bacterial 16S Pyrotags Derived from Different Primer Sets

    PubMed Central

    Cai, Lin; Ye, Lin; Tong, Amy Hin Yan; Lok, Si; Zhang, Tong

    2013-01-01

    In recent years, PCR-based pyrosequencing of 16S rRNA genes has continuously increased our understanding of complex microbial communities in various environments of the Earth. However, there is always concern on the potential biases of diversity determination using different 16S rRNA gene primer sets and covered regions. Here, we first report how bacterial 16S rRNA gene pyrotags derived from a series of different primer sets resulted in the biased diversity metrics. In total, 14 types of pyrotags were obtained from two-end pyrosequencing of 7 amplicon pools generated by 7 primer sets paired by 1 of 4 forward primers (V1F, V3F, V5F, and V7F) and 1 of 4 reverse primers (V2R, V4R, V6R, and V9R), respectively. The results revealed that: i) the activated sludge exhibited a large bacterial diversity that represented a broad range of bacterial populations and served as a good sample in this methodology research; ii) diversity metrics highly depended on the selected primer sets and covered regions; iii) paired pyrotags obtained from two-end pyrosequencing of each short amplicon displayed different diversity metrics; iv) relative abundance analysis indicated the sequencing depth affected the determination of rare bacteria but not abundant bacteria; v) the primer set of V1F and V2R significantly underestimated the diversity of activated sludge; and vi) the primer set of V3F and V4R was highly recommended for future studies due to its advantages over other primer sets. All of these findings highlight the significance of this methodology research and offer a valuable reference for peer researchers working on microbial diversity determination. PMID:23341963

  15. Systematic design of 18S rRNA gene primers for determining eukaryotic diversity in microbial consortia.

    PubMed

    Hugerth, Luisa W; Muller, Emilie E L; Hu, Yue O O; Lebrun, Laura A M; Roume, Hugo; Lundin, Daniel; Wilmes, Paul; Andersson, Anders F

    2014-01-01

    High-throughput sequencing of ribosomal RNA gene (rDNA) amplicons has opened up the door to large-scale comparative studies of microbial community structures. The short reads currently produced by massively parallel sequencing technologies make the choice of sequencing region crucial for accurate phylogenetic assignments. While for 16S rDNA, relevant regions have been well described, no truly systematic design of 18S rDNA primers aimed at resolving eukaryotic diversity has yet been reported. Here we used 31,862 18S rDNA sequences to design a set of broad-taxonomic range degenerate PCR primers. We simulated the phylogenetic information that each candidate primer pair would retrieve using paired- or single-end reads of various lengths, representing different sequencing technologies. Primer pairs targeting the V4 region performed best, allowing discrimination with paired-end reads as short as 150 bp (with 75% accuracy at genus level). The conditions for PCR amplification were optimised for one of these primer pairs and this was used to amplify 18S rDNA sequences from isolates as well as from a range of environmental samples which were then Illumina sequenced and analysed, revealing good concordance between expected and observed results. In summary, the reported primer sets will allow minimally biased assessment of eukaryotic diversity in different microbial ecosystems.

  16. Branched modular primers in DNA sequencing

    SciTech Connect

    Mugasimangalam, R.C.; Shmulevitz, M. |; Ramanathan, V.

    1997-08-01

    The need to synthesize new sequencing primers, such as in primer walking, can be eliminated by assembling modular primers from oligonucleotide modules selected from presynthesized libraries. Our earlier modular primers consisted of 5-mers, 6-mers or 7-mers, annealing to the template contiguously with each other. Here we introduce a novel {open_quotes}branched{close_quotes} type of modular primer with a distinctly different specificity mechanism. The concept of a {open_quotes}branched{close_quotes} primer involves modules that are physically linked by annealing to each other as well as to the target, forming a branched structure of the 3-way junction type. While contiguous modular primers are made specific by the preference of the polymerase for longer primer, branched primers, in contrast, owe their specificity to cooperative annealing of their modules to the intended site on the template. This cooperativity of annealing to the template is provided by mutually complementary segments in the two modules that bind each other. Thus the primer-template complex is no longer limited to linear sequences, but acquires another, second dimension giving the modular primer new functionality.

  17. Water based adhesive primers on aluminum substrates

    SciTech Connect

    Wightman, J.P.; Mori, S.

    1996-12-31

    The number of aluminum alloy bonding applications has been increasing recently in the automobile industry. Primer coating of aluminum substrates is one of the main processes used to promote bond performance. Solvent based organic primers have been used for a long time but environmental regulations now require the substitution of volatile organic compounds (VOC) by alternate materials such as water based adhesive primers. However, the bond strengths obtained with many water based primers are generally lower than for solvent based ones. Water based primers which have some reactive functional groups have been proposed recently but such primers require special treatment. This paper describes a study conducted to optimize bond strength using a water based adhesive as a primer in the adhesive bonding of anodized aluminum.

  18. AFLP analysis and zebra disease resistance identification of 40 sisal genotypes in China.

    PubMed

    Gao, Jianming; Luoping; Guo, Chaoming; Li, Jinzhi; Liu, Qiaolian; Chen, Helong; Zhang, Shiqing; Zheng, Jinlong; Jiang, Chenji; Dai, Zhenzhen; Yi, Kexian

    2012-05-01

    Sisal is the most important fiber crop in tropical and subtropical areas in China and the world. Zebra disease is a serious threat to the main cultivar Agave hybrid No.11648 (H.11648) worldwide. To select germplasm materials with zebra disease resistance for breeding, the fluorescent amplified fragment length polymorphism (AFLP) technique was used to make a cluster analysis of the genetic relationships of 40 sisal genotypes grown in China, and Phytophthora nicotianae was used to inoculate the 40 genotypes to identify their resistance to zebra disease. As a result, the similarity coefficient among 40 sisal genotypes was found to be 0.44-0.83 and the 40 genotypes show different levels of disease resistance. According to the AFLP analysis, the disease resistance and chromosomal ploidy, it can be reasoned that, A. attenuata var. marginata, Dong 109, Nan ya 1 and A. attenuata are suitable for hybridization with H.11648 to breed a new disease-resistant variety. PMID:22327644

  19. A simple DNA extraction method for marijuana samples used in amplified fragment length polymorphism (AFLP) analysis.

    PubMed

    Miller Coyle, Heather; Shutler, Gary; Abrams, Sharon; Hanniman, Janet; Neylon, Suzanne; Ladd, Carll; Palmbach, Timothy; Lee, Henry C

    2003-03-01

    As a first step in developing a molecular method for the individualization of marijuana samples, we evaluated a plant DNA extraction kit. The QIAGEN plant DNeasy method uses a spin column format for recovery of DNA and is effective for obtaining high molecular weight DNA from leaf, flower (bud), and seed samples of marijuana. The average DNA yield was 125-500 ng per 100 milligrams of fresh plant tissue. The recovered DNA was of polymerase chain reaction (PCR) quality as measured by the ability to generate reproducible amplified fragment length polymorphism (AFLP) profiles. AFLP is a technique used to create a DNA profile for plant varieties and is being applied to marijuana samples by the authors to link growers and distributors of clonal material. The QIAGEN plant DNeasy method was simple, efficient, and reproducible for processing small quantities of marijuana into DNA.

  20. AFLP analysis and zebra disease resistance identification of 40 sisal genotypes in China.

    PubMed

    Gao, Jianming; Luoping; Guo, Chaoming; Li, Jinzhi; Liu, Qiaolian; Chen, Helong; Zhang, Shiqing; Zheng, Jinlong; Jiang, Chenji; Dai, Zhenzhen; Yi, Kexian

    2012-05-01

    Sisal is the most important fiber crop in tropical and subtropical areas in China and the world. Zebra disease is a serious threat to the main cultivar Agave hybrid No.11648 (H.11648) worldwide. To select germplasm materials with zebra disease resistance for breeding, the fluorescent amplified fragment length polymorphism (AFLP) technique was used to make a cluster analysis of the genetic relationships of 40 sisal genotypes grown in China, and Phytophthora nicotianae was used to inoculate the 40 genotypes to identify their resistance to zebra disease. As a result, the similarity coefficient among 40 sisal genotypes was found to be 0.44-0.83 and the 40 genotypes show different levels of disease resistance. According to the AFLP analysis, the disease resistance and chromosomal ploidy, it can be reasoned that, A. attenuata var. marginata, Dong 109, Nan ya 1 and A. attenuata are suitable for hybridization with H.11648 to breed a new disease-resistant variety.

  1. Fatal Cryptococcus gattii genotype AFLP5 infection in an immunocompetent Cuban patient

    PubMed Central

    Illnait-Zaragozí, María T.; Ortega-Gonzalez, Lilia M.; Hagen, Ferry; Martínez-Machin, Gerardo F.; Meis, Jacques F.

    2013-01-01

    We describe the first clinical case of cryptococcosis due C. gattii in a Cuban immunocompetent patient who had a traveling history two years before to Central America. Molecular characterization of the isolate showed it to be genotype AFLP5 of which MLST sequences clustered with clinical and environmental strains from Colombia. The patient died one year after the diagnosis despite a prolonged treatment with (liposomal) amphotericin B, fluconazole, voriconazole and gamma interferon. PMID:24432215

  2. Genetic diversity among red swamp crayfish (Procambarus clarkii) populations in the middle and lower reaches of the Yangtze River based on AFLP markers.

    PubMed

    Zhu, B F; Huang, Y; Dai, Y G; Bi, C W; Hu, C Y

    2013-03-13

    The red swamp crayfish has become one of the most important freshwater aquaculture species in China. At present, although it is widely distributed in the middle and lower reaches of the Yangze River basin, little is known about its population genetics and geographic distribution in China. We estimated the genetic diversity among 6 crayfish populations from 4 lakes (Hongze Lake, Poyang Lake, Dongting Lake, and Yue Lake) using AFLPs. A total of 129 loci were generated with 5 EcoRI-MseI primer combinations and scored as binary data in 139 individuals. These data were analyzed by cluster methods with the NTSYSpc software package. The 6 populations were separated into 3 major clusters by principal coordinate analysis and cluster analysis. Among the 6 populations, the highest gene diversity was found within the Nanjing population. Analysis of molecular variance demonstrated that most variation occurred within populations (91.20%). The estimated average GST value across all loci was 0.4186, suggesting (very) low gene flow among the different localities. We conclude that there is high genetic differentiation among crayfish in the middle and lower reaches of the Yangze River. This information will help in the selection of high-quality individuals for artificial reproduction.

  3. AFLP marker analysis revealing genetic structure of the tree Parapiptadenia rigida (Benth.) Brenan (Leguminosae-Mimosoideae) in the southern Brazilian Tropical Rainforest.

    PubMed

    de Souza, Laís Bérgamo; Ruas, Eduardo A; Rodrigues, Luana A; Ruas, Claudete F; Ruas, Paulo M

    2013-12-01

    Parapiptadenia rigida is a tropical early secondary succession tree characteristic of the Tropical Atlantic Rainforest. This species is of great ecological importance in the recovery of degraded areas. In this study we investigated the variability and population genetic structure of eight populations of P. rigida. Five AFLP primer combinations were used in a sample of 159 individuals representing these eight populations, rendering a total of 126 polymorphic fragments. The averages of percentage of polymorphic loci, gene diversity, and Shannon index were 60.45%, 0.217, and 0.322, respectively. A significant correlation between the population genetic variability and the population sizes was observed. The genetic variability within populations (72.20%) was higher than between these (22.80%). No perfect correlation was observed between geographic and genetic distances, which might be explained by differences in deforestation intensities that occurred in these areas. A dendrogram constructed by the UPGMA method revealed the formation of two clusters, these also confirmed by Bayesian analysis for the number of K cluster. These results show that it is necessary to develop urgent management strategies for the conservation of certain populations of P. rigida, while other populations still preserve reasonably high levels of genetic variability. PMID:24385857

  4. AFLP marker analysis revealing genetic structure of the tree Parapiptadenia rigida (Benth.) Brenan (Leguminosae-Mimosoideae) in the southern Brazilian Tropical Rainforest.

    PubMed

    de Souza, Laís Bérgamo; Ruas, Eduardo A; Rodrigues, Luana A; Ruas, Claudete F; Ruas, Paulo M

    2013-12-01

    Parapiptadenia rigida is a tropical early secondary succession tree characteristic of the Tropical Atlantic Rainforest. This species is of great ecological importance in the recovery of degraded areas. In this study we investigated the variability and population genetic structure of eight populations of P. rigida. Five AFLP primer combinations were used in a sample of 159 individuals representing these eight populations, rendering a total of 126 polymorphic fragments. The averages of percentage of polymorphic loci, gene diversity, and Shannon index were 60.45%, 0.217, and 0.322, respectively. A significant correlation between the population genetic variability and the population sizes was observed. The genetic variability within populations (72.20%) was higher than between these (22.80%). No perfect correlation was observed between geographic and genetic distances, which might be explained by differences in deforestation intensities that occurred in these areas. A dendrogram constructed by the UPGMA method revealed the formation of two clusters, these also confirmed by Bayesian analysis for the number of K cluster. These results show that it is necessary to develop urgent management strategies for the conservation of certain populations of P. rigida, while other populations still preserve reasonably high levels of genetic variability.

  5. Sample Return Primer and Handbook

    NASA Technical Reports Server (NTRS)

    Barrow, Kirk; Cheuvront, Allan; Faris, Grant; Hirst, Edward; Mainland, Nora; McGee, Michael; Szalai, Christine; Vellinga, Joseph; Wahl, Thomas; Williams, Kenneth; Lee, Gentry; Duxbury, Thomas

    2007-01-01

    This three-part Sample Return Primer and Handbook provides a road map for conducting the terminal phase of a sample return mission. The main chapters describe element-by-element analyses and trade studies, as well as required operations plans, procedures, contingencies, interfaces, and corresponding documentation. Based on the experiences of the lead Stardust engineers, the topics include systems engineering (in particular range safety compliance), mission design and navigation, spacecraft hardware and entry, descent, and landing certification, flight and recovery operations, mission assurance and system safety, test and training, and the very important interactions with external support organizations (non-NASA tracking assets, landing site support, and science curation).

  6. AFLPs and Mitochondrial Haplotypes Reveal Local Adaptation to Extreme Thermal Environments in a Freshwater Gastropod

    PubMed Central

    Quintela, María; Johansson, Magnus P.; Kristjánsson, Bjarni K.; Barreiro, Rodolfo; Laurila, Anssi

    2014-01-01

    The way environmental variation shapes neutral and adaptive genetic variation in natural populations is a key issue in evolutionary biology. Genome scans allow the identification of the genetic basis of local adaptation without previous knowledge of genetic variation or traits under selection. Candidate loci for divergent adaptation are expected to show higher FST than neutral loci influenced solely by random genetic drift, migration and mutation. The comparison of spatial patterns of neutral markers and loci under selection may help disentangle the effects of gene flow, genetic drift and selection among populations living in contrasting environments. Using the gastropod Radix balthica as a system, we analyzed 376 AFLP markers and 25 mtDNA COI haplotypes for candidate loci and associations with local adaptation among contrasting thermal environments in Lake Mývatn, a volcanic lake in northern Iceland. We found that 2% of the analysed AFLP markers were under directional selection and 12% of the mitochondrial haplotypes correlated with differing thermal habitats. The genetic networks were concordant for AFLP markers and mitochondrial haplotypes, depicting distinct topologies at neutral and candidate loci. Neutral topologies were characterized by intense gene flow revealed by dense nets with edges connecting contrasting thermal habitats, whereas the connections at candidate loci were mostly restricted to populations within each thermal habitat and the number of edges decreased with temperature. Our results suggest microgeographic adaptation within Lake Mývatn and highlight the utility of genome scans in detecting adaptive divergence. PMID:25007329

  7. Extended metAFLP approach in studies of tissue culture induced variation (TCIV) in triticale.

    PubMed

    Machczyńska, Joanna; Orłowska, Renata; Zimny, Janusz; Bednarek, Piotr Tomasz

    2014-01-01

    We present the development of the theoretical background of the metAFLP approach which allows for partition of complex variation into sequence changes, de novo methylation and demethylation of the regenerants derived via in vitro tissue culture methods in the case of triticale. It was demonstrated that, independent of whether andro- or embryogenesis was used for plant regeneration, the level of sequence changes identified between regenerants is about 10 %. Moreover, DNA demethylation prevails over de novo methylation of the regenerants compared to the donor plant. The metAFLP approach allows for the evaluation of numerous quantitative characteristics. For instance, one may quantify the number of sites unaffected by tissue culture approaches, global site DNA methylation etc. It is suggested that the approach could be useful for breeders in order to control plant material uniformity or for the evaluation of modified in vitro tissue culture approaches allowing for control of the (epi)mutation level. The extended metAFLP approach presented here delivers sufficient background for the evaluation of software that could facilitate analyses of the tissue culture induced variation. PMID:25242884

  8. What is Comet assay not telling us: AFLP reveals wider aspects of genotoxicity.

    PubMed

    Šrut, Maja; Štambuk, Anamaria; Klobučar, Göran I V

    2013-06-01

    DNA damage detected by genotoxicity biomarkers such as the Comet assay is not always a reliable indicator of the consequences that genotoxic agents can have on the genome integrity of the exposed organisms. Therefore, to reveal the existence of more permanent alterations of DNA structure after genotoxic stress, the RTG-2 rainbow trout cell line was exposed for 3 days to benzo[a]pyrene (B[a]P, 0.1-10 μM) and ethyl methanesulfonate (EMS, 0.1-1mM) followed by 3 days of recovery period. Primary DNA damage was evaluated by the Comet assay and DNA alterations were assessed using AFLP (amplified fragment length polymorphism). Qualitative and quantitative modifications in AFLP profiles were analyzed in order to detect genetic alterations arising from mutation events and/or DNA damage. Significant induction in DNA damage measured by the Comet assay was noticed after B[a]P treatment at all concentrations but values returned to the control level after recovery. Exposure to EMS induced significant DNA damage only at the highest concentration and damage persisted after the recovery period. AFLP profiles detected DNA alterations even when Comet assay indicated complete DNA repair, revealing more persistent damage. Since such DNA damage can impair its structure and function, Comet assay results should preferably be supplemented with other methods in order to predict the consequences of genotoxic insult more accurately.

  9. Characterization of the 18S rRNA gene for designing universal eukaryote specific primers.

    PubMed

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M; Troedsson, Christofer

    2014-01-01

    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies.

  10. Characterization of the 18S rRNA Gene for Designing Universal Eukaryote Specific Primers

    PubMed Central

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M.; Troedsson, Christofer

    2014-01-01

    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies. PMID:24516555

  11. Effect of primers on bonding agent polymerization.

    PubMed

    Hotta, M; Kondoh, K; Kamemizu, H

    1998-10-01

    The aim of the present study was to evaluate the effect of primers on the polymerization of bonding agent. We measured the degree of conversion (radical production) and mechanical properties (surface hardness and direct tensile strength) of various adhesives/primers mixed at different ratios and the effect of varying the visible-light curing time. With and without primer treatment, the tensile bond strength of adhesive resin to micacious glass ceramic and human enamel was measured. After the tensile bond test, using the Image Capture System, the failure patterns of adhesive resin bonded to micacious glass-ceramic were analysed. The results show that the mixtures containing the higher amounts of primer yielded a lower degree of conversion and inferior mechanical properties when compared with the mixtures containing a lower proportion of primer, except in the experimental bonding system. The adhesive/primer mixtures inhibited free radical polymerization. The value for the Knoop hardness number and the direct tensile strength of the adhesive/primer mixtures were significantly decreased compared with those of the adhesive bonding agent alone with no primer added. The tensile bond strength of adhesive resin bonded to micacious glass-ceramic or human enamel without primer treatment was significantly greater than that of adhesive resin with primer treatment in certain cases. Most of the fractures of ceramic surfaces were cohesive (within resins) and/or interface (at the ceramic surface) failure.

  12. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    PubMed Central

    Batnyam, Nomin; Lee, Jimin; Lee, Jungnam; Hong, Seung Bok; Oh, Sejong; Han, Kyudong

    2012-01-01

    Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR) assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque) and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors. PMID:22693428

  13. Genus-Specific Primers for Study of Fusarium Communities in Field Samples.

    PubMed

    Karlsson, Ida; Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-10-30

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology.

  14. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    PubMed Central

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  15. Pairing Learners in Pair Work Activity

    ERIC Educational Resources Information Center

    Storch, Neomy; Aldosari, Ali

    2013-01-01

    Although pair work is advocated by major theories of second language (L2) learning and research findings suggest that pair work facilitates L2 learning, what is unclear is how to best pair students in L2 classes of mixed L2 proficiency. This study investigated the nature of pair work in an English as a Foreign Language (EFL) class in a college in…

  16. Optimization of primer design for the detection of variable genomic lesions in cancer.

    PubMed

    Bashir, Ali; Liu, Yu-Tsueng; Raphael, Benjamin J; Carson, Dennis; Bafna, Vineet

    2007-11-01

    Primer approximation multiplex PCR (PAMP) is a new experimental protocol for efficiently assaying structural variation in genomes. PAMP is particularly suited to cancer genomes where the precise breakpoints of alterations such as deletions or translocations vary between patients. The design of PCR primer sets for PAMP is challenging because a large number of primer pairs are required to detect alterations in the hundreds of kilobases range that can occur in cancer. These sets of primers must achieve high coverage of the region of interest, while avoiding primer dimers and satisfying the physico-chemical constraints of good PCR primers. We describe a natural formulation of these constraints as a combinatorial optimization problem. We show that the PAMP primer design problem is NP-hard, and design algorithms based on simulated annealing and integer programming, that provide good solutions to this problem in practice. The algorithms are applied to a test region around the known CDKN2A deletion, which show excellent results even in a 1:49 mixture of mutated:wild-type cells. We use these test results to help set design parameters for larger problems. We can achieve near-optimal designs for regions close to 1 Mb. PMID:17766270

  17. Primers for low-copy nuclear genes in the Melastomataceae1

    PubMed Central

    Reginato, Marcelo; Michelangeli, Fabián A.

    2016-01-01

    Premise of the study: Low-copy nuclear gene primers were developed for phylogenetic studies across the Melastomataceae. Methods and Results: Total genomic libraries from eight species in the Melastomataceae along with one transcriptome were used for marker identification and primer design. Eight exon-primed intron-crossing markers were amplified with success in taxa of nine tribes in the Melastomataceae. The new markers were directly sequenced for eight samples of closely related species of Miconia (Chaenanthera clade) in the tribe Miconieae. The DNA sequences for the eight loci ranged from 660 to 818 aligned base pairs. Compared with four commonly used markers in other studies, the loci developed here had a higher number of variable sites than plastid spacers (7–16 vs. 26–45) and comparable variation to the ribosomal spacers (28–39). Conclusions: The novel primer pairs should be useful for a broad range of studies of systematics and evolution in the diverse Melastomataceae. PMID:26819862

  18. New primers for detecting and quantifying denitrifying anaerobic methane oxidation archaea in different ecological niches.

    PubMed

    Ding, Jing; Ding, Zhao-Wei; Fu, Liang; Lu, Yong-Ze; Cheng, Shuk H; Zeng, Raymond J

    2015-11-01

    The significance of ANME-2d in methane sink in the environment has been overlooked, and there was no any study evaluating the distribution of ANME-2d in the environment. New primers were thus needed to be designed for following research. In this paper, a pair of primers (DP397F and DP569R) was designed to quantify ANME-2d. The specificity and amplification efficiency of this primer pair were acceptable. PCR amplification of another pair of primers (DP142F and DP779R) generated a single, bright targeted band from the enrichment sample, but yielded faint, multiple bands from the environmental samples. Nested PCR was conducted using the primers DP142F/DP779R in the first round and DP142F/DP569R in the second round, which generated a bright targeted band. Further phylogenetic analysis showed that these targeted bands were ANME-2d-related sequences. Real-time PCR showed that the copies of the 16s ribosomal RNA gene of ANME-2d in these samples ranged from 3.72 × 10(4) to 2.30 × 10(5) copies μg(-1) DNA, indicating that the percentage of ANME-2d was greatest in a polluted river sample and least in a rice paddy sample. These results demonstrate that the newly developed real-time PCR primers could sufficiently quantify ANME-2d and that nested PCR with an appropriate combination of the new primers could successfully detect ANME-2d in environmental samples; the latter finding suggests that ANME-2d may spread in environments.

  19. Moisture insensitive primer: A myth or truth

    PubMed Central

    Shukla, Chandresh; Maurya, Rajkumar; Jain, Upendra; Gupta, Ankur; Garg, Jayshree

    2014-01-01

    Objectives: To compare the mean shear bond strength (SBS) of moisture insensitive primer (MIP) used for orthodontic bonding in the presence and absence of saliva. Materials and Methods: A total of 60 human noncarious maxillary premolars with sound buccal surfaces, recently extracted were collected in two groups of each 30. Maxillary premolar brackets were bonded to the teeth using light cure (Transbond XT, 3M Unitek, Monrovia, CA, USA) and MIP (Transbond MIP 3M Unitek, Monrovia, CA, USA,) in the presence and absence of saliva. Operators’ saliva was used during the bonding under moist condition. After debonding, all the specimens were examined under a stereomicroscope (×40 magnification) for adhesive remnant using adhesive remnant index (ARI). The SBS tests were done using Instron universal testing machine at cross-head speed of 1 mm/min, force passing parallel to the buccal surface using custom rod and registered in Newtons later converted into Megapascals. Results: Light cure and MIP (Transbond MIP and Transbond XT, 3M Unitek, Monrovia, CA, USA) in the absence of saliva showed higher mean SBS than the presence of saliva. Group I (light cure and MIP) in the absence of saliva showed mean SBS of 9.65 ± 0.90 Mpa. Group II (light cure and MIP) with the presence of saliva showed mean SBS of 9.03 ± 1.14 Mpa. The difference between both the groups was statistically significant, as confirmed by paired t-test (P < 0.05). In-Group I, ARI scores showed that more than half of the adhesive was left over the tooth surface, and Group II showed that there was no or insignificant amount of adhesive left over the tooth surface. Chi-square test revealed significant difference in debonding characteristics among the test groups of ARI (P < 0.05). Failure occurred mainly in resin– bracket base and resin – adhesive interfaces (χ² = 10.04, df = 3, P = 0.031). Conclusion: Moisture insensitive primer is effective in the presence/absence of moisture and has shown SBS value of more

  20. Comparative in silico analysis of PCR primers suited for diagnostics and cloning of ammonia monooxygenase genes from ammonia-oxidizing bacteria.

    PubMed

    Junier, Pilar; Kim, Ok-Sun; Molina, Verónica; Limburg, Petra; Junier, Thomas; Imhoff, Johannes F; Witzel, Karl-Paul

    2008-04-01

    Over recent years, several PCR primers have been described to amplify genes encoding the structural subunits of ammonia monooxygenase (AMO) from ammonia-oxidizing bacteria (AOB). Most of them target amoA, while amoB and amoC have been neglected so far. This study compared the nucleotide sequence of 33 primers that have been used to amplify different regions of the amoCAB operon with alignments of all available sequences in public databases. The advantages and disadvantages of these primers are discussed based on the original description and the spectrum of matching sequences obtained. Additionally, new primers to amplify the almost complete amoCAB operon of AOB belonging to Betaproteobacteria (betaproteobacterial AOB), a primer pair for DGGE analysis of amoA and specific primers for gammaproteobacterial AOB, are also described. The specificity of these new primers was also evaluated using the databases of the sequences created during this study. PMID:18248438

  1. Nucleic acid amplification using modular branched primers

    SciTech Connect

    Ulanovsky, Levy; Raja, Mugasimangalam C.

    2001-01-01

    Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.

  2. Linear elastic fracture mechanics primer

    NASA Technical Reports Server (NTRS)

    Wilson, Christopher D.

    1992-01-01

    This primer is intended to remove the blackbox perception of fracture mechanics computer software by structural engineers. The fundamental concepts of linear elastic fracture mechanics are presented with emphasis on the practical application of fracture mechanics to real problems. Numerous rules of thumb are provided. Recommended texts for additional reading, and a discussion of the significance of fracture mechanics in structural design are given. Griffith's criterion for crack extension, Irwin's elastic stress field near the crack tip, and the influence of small-scale plasticity are discussed. Common stress intensities factor solutions and methods for determining them are included. Fracture toughness and subcritical crack growth are discussed. The application of fracture mechanics to damage tolerance and fracture control is discussed. Several example problems and a practice set of problems are given.

  3. A Practical Primer on Geostatistics

    USGS Publications Warehouse

    Olea, Ricardo A.

    2009-01-01

    significant methodological implications. HISTORICAL REMARKS As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields. PIONEERS Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorology CALCULATIONS Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations. SOFTWARE For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics. ORGANIZATION OF THE PRIMER The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of th

  4. PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Knowlton, Nancy

    2012-01-01

    Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets

  5. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection

    PubMed Central

    O’Halloran, Damien M.

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  6. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection.

    PubMed

    O'Halloran, Damien M

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  7. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection.

    PubMed

    O'Halloran, Damien M

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction.

  8. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on...

  9. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on...

  10. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on...

  11. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... SAFETY AND HEALTH SAFETY AND HEALTH STANDARDS-UNDERGROUND METAL AND NONMETAL MINES Explosives... primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters) in... of water to protect the primer from impact. Slit packages of prill, water gel, or emulsions are...

  12. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... SAFETY AND HEALTH SAFETY AND HEALTH STANDARDS-SURFACE METAL AND NONMETAL MINES Explosives Use § 56.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... impact. Slit packages of prill, water gel, or emulsions are not considered rigid cartridges and may...

  13. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... SAFETY AND HEALTH SAFETY AND HEALTH STANDARDS-SURFACE METAL AND NONMETAL MINES Explosives Use § 56.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... impact. Slit packages of prill, water gel, or emulsions are not considered rigid cartridges and may...

  14. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... SAFETY AND HEALTH SAFETY AND HEALTH STANDARDS-UNDERGROUND METAL AND NONMETAL MINES Explosives... primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters) in... of water to protect the primer from impact. Slit packages of prill, water gel, or emulsions are...

  15. [DNA amplification using PCR with abutting primers].

    PubMed

    Garafutdinov, R R; Galimova, A A; Sakhabutdinova, A R; Vakhitov, V A; Chemeris, A V

    2015-01-01

    DNA analysis of ñîmplex biological objects (wastewater, soil, archaeological and forensic samples, etc.) is currently of great interest. DNA of these objects is characterized by low suitability for research due to the violation of its integrity and chemical structure; thus, the detection of specific nucleic acid fragments can be achieved by PCR with contiguous primers. In this paper, we present the results that clarify the specific characteristics of PCR with abutting primers. The 3'-ends of these primers are annealed at adjacent nucleotides of complementary chains of DNA target. It has been shown that the proximity of primers enables the formation of specific reaction products with a higher sensitivity and less reaction time. Using artificially damaged DNA and DNA from the soil we demonstrated that the abutting primers provide assured detection of specific DNA fragments. The results of this work may be taken into account in PCR with degraded (fragmented) DNA.

  16. Electrostatic Discharge testing of propellants and primers

    SciTech Connect

    Berry, R.B.

    1994-02-01

    This report presents the results of testing of selected propellants and primers to Electrostatic Discharge (ESD) characteristic of the human body. It describes the tests and the fixturing built to accommodate loose material (propellants) and the packed energetic material of the primer. The results indicate that all powders passed and some primers, especially the electric primers, failed to pass established requirements which delineate insensitive energetic components. This report details the testing of components and materials to four ESD environments (Standard ESD, Severe ESD, Modified Standard ESD, and Modified Severe ESD). The purpose of this study was to collect data based on the customer requirements as defined in the Sandia Environmental Safety & Health (ES&H) Manual, Chapter 9, and to define static sensitive and insensitive propellants and primers.

  17. The novel primers for sex identification in the brown eared-pheasant and their application to other species.

    PubMed

    Wang, N; Zhang, Z-W

    2009-01-01

    We designed a pair of primers for sex identification in the brown eared-pheasant (Crossoptilon mantchuricum) based on the mechanism of PCR amplification of CHD fragments, and identified the number of products. The new primers were considered to have more sensitivity than P2/P8, and cross-species application indicated that they can also be used for sex identification in other species of Phasianidae and Passeriformes.

  18. A preliminary study of the population genetics of Aedes aegypti (Diptera: Culicidae) from Mexico using microsatellite and AFLP markers.

    PubMed

    Ravel, S; Monteny, N; Velasco Olmos, D; Escalante Verdugo, J; Cuny, G

    2001-03-30

    Dengue fever recently reemerged in the Americas. Because vaccines are still under development, dengue prevention depends entirely on vector control. Since Aedes aegypti (Linnaeus, 1762) is the principal vector of this arbovirus, knowledge of the genetic structure of the insect is therefore required to maintain effective vector control strategies and to estimate levels of gene flow from which movement can be inferred. This preliminary study uses microsatellite and amplified fragment length polymorphism (AFLP) markers, to provide insights into genetic diversity of A. aegypti populations from different districts of two towns, located in the north-west of Mexico, Hermosillo and Guaymas. Although the microsatellites used were found to display limited polymorphism, they allowed discrimination between mosquitoes from the northern and the southern districts of Hermosillo. Using AFLP markers, clustering of individuals from the same town and from the same district was observed. Data from microsatellite and AFLP markers analysis both suggest that reinvasion of A. aegypti probably occurs from Guaymas to Hermosillo.

  19. Use of AFLP, plasmid typing and phenotyping in a comparative study to assess genetic diversity of Shigella flexneri strains.

    PubMed

    Herrera, S; Cabrera, R; Ramirez, M M; Usera, M A; Echeita, M A

    2002-12-01

    Shigella flexneri infections are one of the main causes of acute diarrhoea in Cuba. Twenty strains isolated from sporadic cases in nine different Cuban provinces were characterized. Serotyping, antibiotic-resistance typing, plasmid-typing and AFLP-typing were used to determine their suitability for use in epidemiological studies of S. flexneri. The predominant serotypes were serotype 6 (35%) and serotype 2 (35%). Eleven different plasmid profiles were detected (Diversity Index = 0.92). AFLP-typing discriminated 12 different patterns (DI = 0.95), these patterns were not coincident with plasmid-typing patterns. Both techniques combined distinguished 14 patterns among the 20 studied strains (DI = 0.99). There was no consistent relationship between plasmid-typing and AFLP-typing patterns or antibiotic-resistance typing patterns. Ninety-five percent of S. flexneri strains were multiresistant.

  20. Use of AFLP, plasmid typing and phenotyping in a comparative study to assess genetic diversity of Shigella flexneri strains.

    PubMed Central

    Herrera, S.; Cabrera, R.; Ramirez, M. M.; Usera, M. A.; Echeita, M. A.

    2002-01-01

    Shigella flexneri infections are one of the main causes of acute diarrhoea in Cuba. Twenty strains isolated from sporadic cases in nine different Cuban provinces were characterized. Serotyping, antibiotic-resistance typing, plasmid-typing and AFLP-typing were used to determine their suitability for use in epidemiological studies of S. flexneri. The predominant serotypes were serotype 6 (35%) and serotype 2 (35%). Eleven different plasmid profiles were detected (Diversity Index = 0.92). AFLP-typing discriminated 12 different patterns (DI = 0.95), these patterns were not coincident with plasmid-typing patterns. Both techniques combined distinguished 14 patterns among the 20 studied strains (DI = 0.99). There was no consistent relationship between plasmid-typing and AFLP-typing patterns or antibiotic-resistance typing patterns. Ninety-five percent of S. flexneri strains were multiresistant. PMID:12558326

  1. Comparative ITS and AFLP Analysis of Diploid Cardamine (Brassicaceae) Taxa from Closely Related Polyploid Complexes

    PubMed Central

    MARHOLD, KAROL; LIHOVÁ, JUDITA; PERNÝ, MARIÁN; BLEEKER, WALTER

    2004-01-01

    • Background and Aims Diploid representatives from the related polyploid complexes of Cardamine amara, C. pratensis and C. raphanifolia (Brassicaceae), were studied to elucidate phylogenetic relationships among the complexes and among the individual taxa included. • Methods Two independent molecular data sets were used: nucleotide sequences from the internal transcribed spacers (ITS) of nrDNA, and amplified fragment length polymorphism (AFLP) markers. Seventeen diploid taxa from the studied groups were sampled. • Key Results Both ITS and AFLP analyses provided congruent results in inferred relationships, and revealed two main lineages. While the C. amara group, consisting of C. wiedemanniana and four subspecies of C. amara, was resolved as a well‐supported monophyletic group, taxa from the C. pratensis and C. tenera groups (the latter representing diploid taxa of the complex of C. raphanifolia) all appeared together in a single clade/cluster with no support for the recognition of either of the groups. Intra‐individual polymorphisms and patterns of nucleotide variation in the ITS region in C. uliginosa and C. tenera, together with the distribution of AFLP bands, indicate ancient hybridization and introgression among these Caucasian diploids. • Conclusions The lack of supported hierarchical structure suggests that extensive reticulate evolution between these groups, even at the diploid level, has occurred (although an alternative explanation, namely ancestral polymorphism in ITS data, cannot be completely excluded). Several implications for the investigation of the polyploid complexes of concern are drawn. When tracing origins of polyploid taxa, a much more complex scenario should be expected, taking into account all relatives as potential parents, irrespective of the group in which they are classified. PMID:15037449

  2. Beyond an AFLP genome scan towards the identification of immune genes involved in plague resistance in Rattus rattus from Madagascar.

    PubMed

    Tollenaere, C; Jacquet, S; Ivanova, S; Loiseau, A; Duplantier, J-M; Streiff, R; Brouat, C

    2013-01-01

    Genome scans using amplified fragment length polymorphism (AFLP) markers became popular in nonmodel species within the last 10 years, but few studies have tried to characterize the anonymous outliers identified. This study follows on from an AFLP genome scan in the black rat (Rattus rattus), the reservoir of plague (Yersinia pestis infection) in Madagascar. We successfully sequenced 17 of the 22 markers previously shown to be potentially affected by plague-mediated selection and associated with a plague resistance phenotype. Searching these sequences in the genome of the closely related species Rattus norvegicus assigned them to 14 genomic regions, revealing a random distribution of outliers in the genome (no clustering). We compared these results with those of an in silico AFLP study of the R. norvegicus genome, which showed that outlier sequences could not have been inferred by this method in R. rattus (only four of the 15 sequences were predicted). However, in silico analysis allowed the prediction of AFLP markers distribution and the estimation of homoplasy rates, confirming its potential utility for designing AFLP studies in nonmodel species. The 14 genomic regions surrounding AFLP outliers (less than 300 kb from the marker) contained 75 genes encoding proteins of known function, including nine involved in immune function and pathogen defence. We identified the two interleukin 1 genes (Il1a and Il1b) that share homology with an antigen of Y. pestis, as the best candidates for genes subject to plague-mediated natural selection. At least six other genes known to be involved in proinflammatory pathways may also be affected by plague-mediated selection.

  3. Genome-Wide Characterization of Simple Sequence Repeat (SSR) Loci in Chinese Jujube and Jujube SSR Primer Transferability

    PubMed Central

    Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui

    2015-01-01

    Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization. PMID:26000739

  4. Genome-Wide Characterization of Simple Sequence Repeat (SSR) Loci in Chinese Jujube and Jujube SSR Primer Transferability.

    PubMed

    Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui

    2015-01-01

    Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization.

  5. MRI Biosensors: A Short Primer

    PubMed Central

    Louie, Angelique

    2013-01-01

    Interest in Magnetic Resonance Imaging (MRI) contrast agents for molecular imaging of biological function experienced a surge of excitement approximately 20 years ago with the development of the first activatable contrast agents that could act as biosensors and turn “on” in response to a specific biological activity. This brief tutorial, based on a short course lecture from the 2011 ISMRM meeting, provides an overview of underlying principles governing the design of biosensing contrast agents. We describe mechanisms by which a magnetic resonance imaging (MRI) contrast agent can be made into a sensor for both T1 and T2 types contrast agents. Examples of biological activities that can interact with a contrast agent are discussed using specific examples from the recent literature to illustrate the primary mechanisms of action that have been utilized to achieve activation. MRI sensors for pH, ion binding, enzyme cleavage, and oxidation-reduction are presented. This article is not meant to be an exhaustive review, but an illustrative primer to explain how activation can be achieved for an MRI contrast agent. Chemical exchange saturation transfer (CEST) is not covered as these agents were covered in a separate lecture. PMID:23996662

  6. Climate change primer for respirologists.

    PubMed

    Takaro, Tim K; Henderson, Sarah B

    2015-01-01

    Climate change is already affecting the cardiorespiratory health of populations around the world, and these impacts are expected to increase. The present overview serves as a primer for respirologists who are concerned about how these profound environmental changes may affect their patients. The authors consider recent peer-reviewed literature with a focus on climate interactions with air pollution. They do not discuss in detail cardiorespiratory health effects for which the potential link to climate change is poorly understood. For example, pneumonia and influenza, which affect >500 million people per year, are not addressed, although clear seasonal variation suggests climate-related effects. Additionally, large global health impacts in low-resource countries, including migration precipitated by environmental change, are omitted. The major cardiorespiratory health impacts addressed are due to heat, air pollution and wildfires, shifts in allergens and infectious diseases along with respiratory impacts from flooding. Personal and societal choices about carbon use and fossil energy infrastructure should be informed by their impacts on health, and respirologists can play an important role in this discussion.

  7. Impact of primer choice on characterization of orchid mycorrhizal communities using 454 pyrosequencing.

    PubMed

    Waud, Michael; Busschaert, Pieter; Ruyters, Stefan; Jacquemyn, Hans; Lievens, Bart

    2014-07-01

    Although the number of studies investigating mycorrhizal associations in orchids has increased in recent years, the fungal communities associating with orchids and how they differ between species and sites remain unclear. Recent research has indicated that individual orchid plants may associate with several fungi concurrently, implying that to study mycorrhizal associations in orchids the fungal community should be assessed, rather than the presence of individual dominant fungal species or strains. High-throughput sequencing methods, such as 454 pyrosequencing, are increasingly used as the primary tool for such analyses. However, many studies combine universal primers from previous phylogenetic or ecological studies to generate amplicons suitable for 454 pyrosequencing without first critically evaluating their performance, potentially resulting in biased fungal community descriptions. Here, following in silico primer analysis we evaluated the performance of different combinations of existing PCR primers to characterize orchid mycorrhizal communities using 454 pyrosequencing by analysis of both an artificially assembled community of mycorrhizal fungi isolated from diverse orchid species and root samples from three different orchid species (Anacamptis morio, Ophrys tenthredinifera and Serapias lingua). Our results indicate that primer pairs ITS3/ITS4OF and ITS86F/ITS4, targeting the internal transcribed spacer-2 (ITS-2) region, outperformed other tested primer pairs in terms of number of reads, number of operational taxonomic units recovered from the artificial community and number of different orchid mycorrhizal associating families detected in the orchid samples. Additionally, we show the complementary specificity of both primer pairs, making them highly suitable for tandem use when studying the diversity of orchid mycorrhizal communities.

  8. Primer and platform effects on 16S rRNA tag sequencing

    DOE PAGES

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; Kirton, Edward S.; He, Shaomei; Woyke, Tanja; Lee, Janey; Chen, Feng; Dangl, Jeffery L.; Tringe, Susannah G.

    2015-08-04

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

  9. Primer and platform effects on 16S rRNA tag sequencing

    SciTech Connect

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; Kirton, Edward S.; He, Shaomei; Woyke, Tanja; Lee, Janey; Chen, Feng; Dangl, Jeffery L.; Tringe, Susannah G.

    2015-08-04

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as well as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.

  10. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

    PubMed

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

    2015-12-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail

  11. Primer on spontaneous heating and pyrophoricity

    SciTech Connect

    Not Available

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  12. Identification of genes related to Paulownia witches' broom by AFLP and MSAP.

    PubMed

    Cao, Xibing; Fan, Guoqiang; Deng, Minjie; Zhao, Zhenli; Dong, Yanpeng

    2014-08-21

    DNA methylation is believed to play important roles in regulating gene expression in plant growth and development. Paulownia witches' broom (PaWB) infection has been reported to be related to gene expression changes in paulownia plantlets. To determine whether DNA methylation is associated with gene expression changes in response to phytoplasma, we investigated variations in genomic DNA sequence and methylation in PaWB plantlets treated with methyl methane sulfonate (MMS) using amplified fragment length polymorphism (AFLP) and methylation-sensitive amplification polymorphism (MSAP) techniques, respectively. The results indicated that PaWB seedings recovered a normal morphology after treatment with more than 15 mg·L(-1) MMS. PaWB infection did not cause changes of the paulownia DNA sequence at the AFLP level; However, DNA methylation levels and patterns were altered. Quantitative real-time PCR (qRT-PCR) showed that three of the methylated genes were up-regulated and three were down-regulated in the MMS-treated PaWB plantlets that had regained healthy morphology. These six genes might be involved in transcriptional regulation, plant defense, signal transduction and energy. The possible roles of these genes in PaWB are discussed. The results showed that changes of DNA methylation altered gene expression levels, and that MSAP might help identify genes related to PaWB.

  13. Identification of genes related to Paulownia witches' broom by AFLP and MSAP.

    PubMed

    Cao, Xibing; Fan, Guoqiang; Deng, Minjie; Zhao, Zhenli; Dong, Yanpeng

    2014-01-01

    DNA methylation is believed to play important roles in regulating gene expression in plant growth and development. Paulownia witches' broom (PaWB) infection has been reported to be related to gene expression changes in paulownia plantlets. To determine whether DNA methylation is associated with gene expression changes in response to phytoplasma, we investigated variations in genomic DNA sequence and methylation in PaWB plantlets treated with methyl methane sulfonate (MMS) using amplified fragment length polymorphism (AFLP) and methylation-sensitive amplification polymorphism (MSAP) techniques, respectively. The results indicated that PaWB seedings recovered a normal morphology after treatment with more than 15 mg·L(-1) MMS. PaWB infection did not cause changes of the paulownia DNA sequence at the AFLP level; However, DNA methylation levels and patterns were altered. Quantitative real-time PCR (qRT-PCR) showed that three of the methylated genes were up-regulated and three were down-regulated in the MMS-treated PaWB plantlets that had regained healthy morphology. These six genes might be involved in transcriptional regulation, plant defense, signal transduction and energy. The possible roles of these genes in PaWB are discussed. The results showed that changes of DNA methylation altered gene expression levels, and that MSAP might help identify genes related to PaWB. PMID:25196603

  14. Molecular analysis of post-harvest withering in grape by AFLP transcriptional profiling

    PubMed Central

    Zamboni, Anita; Minoia, Leone; Ferrarini, Alberto; Tornielli, Giovanni Battista; Zago, Elisa; Delledonne, Massimo; Pezzotti, Mario

    2008-01-01

    Post-harvest withering of grape berries is used in the production of dessert and fortified wines to alter must quality characteristics and increase the concentration of simple sugars. The molecular processes that occur during withering are poorly understood, so a detailed transcriptomic analysis of post-harvest grape berries was carried out by AFLP-transcriptional profiling analysis. This will help to elucidate the molecular mechanisms of berry withering and will provide an opportunity to select markers that can be used to follow the drying process and evaluate different drying techniques. AFLP-TP identified 699 withering-specific genes, 167 and 86 of which were unique to off-plant and on-plant withering, respectively. Although similar molecular events were revealed in both withering processes, it was apparent that off-plant withering induced a stronger dehydration stress response resulting in the high level expression of genes involved in stress protection mechanisms, such as dehydrin and osmolite accumulation. Genes involved in hexose metabolism and transport, cell wall composition, and secondary metabolism (particularly the phenolic and terpene compound pathways) were similarly regulated in both processes. This work provides the first comprehensive analysis of the molecular events underpinning post-harvest withering and could help to define markers for different withering processes. PMID:19010774

  15. Identification of Genes Related to Paulownia Witches’ Broom by AFLP and MSAP

    PubMed Central

    Cao, Xibing; Fan, Guoqiang; Deng, Minjie; Zhao, Zhenli; Dong, Yanpeng

    2014-01-01

    DNA methylation is believed to play important roles in regulating gene expression in plant growth and development. Paulownia witches’ broom (PaWB) infection has been reported to be related to gene expression changes in paulownia plantlets. To determine whether DNA methylation is associated with gene expression changes in response to phytoplasma, we investigated variations in genomic DNA sequence and methylation in PaWB plantlets treated with methyl methane sulfonate (MMS) using amplified fragment length polymorphism (AFLP) and methylation-sensitive amplification polymorphism (MSAP) techniques, respectively. The results indicated that PaWB seedings recovered a normal morphology after treatment with more than 15 mg·L−1 MMS. PaWB infection did not cause changes of the paulownia DNA sequence at the AFLP level; However, DNA methylation levels and patterns were altered. Quantitative real-time PCR (qRT-PCR) showed that three of the methylated genes were up-regulated and three were down-regulated in the MMS-treated PaWB plantlets that had regained healthy morphology. These six genes might be involved in transcriptional regulation, plant defense, signal transduction and energy. The possible roles of these genes in PaWB are discussed. The results showed that changes of DNA methylation altered gene expression levels, and that MSAP might help identify genes related to PaWB. PMID:25196603

  16. [AFLP Analysis of Genetic Diversity in the Genus Mallus Mill. (Apple)].

    PubMed

    Savelyeva, E N; Kudryavtsev, A M

    2015-10-01

    The first molecular genetic analysis of the apple species and varieties from Russian collections with the AFLP marker system was performed in order to study the genetic diversity of the genus Malus, as well as to clarify the phylogeny and solve some systematic issues of the genus. Nienty-one apple accessions, including species from five sections of the genus Malus and hybrid species, were examined. The level of polymorphism constituted 90.2%. It was demonstrated that the classical taxonomy of the genus Malus, which identifies five sections based on differences in their morphological characters, is valid and may be used to classify apple species. The species assignment of the Antonovka landraces was established. All of them belonged to the species M. domestica. It was demonstrated that the Yakutskaya apple variety was a domesticated species of the section Gymnomeles, presumably, M. baccata. AFLP analysis confirmed the hybrid nature of many species. The relationships between apple varieties of the Golden group with American wild species were demonstrated. The data suggest that the species M. sieversii was the ancestor of not only the domestic apple but also of other species of the Malus sections. PMID:27169227

  17. Genetic diversity of a germplasm collection of Cucurbita pepo using SRAP and AFLP markers.

    PubMed

    Ferriol, M; Picó, B; Nuez, F

    2003-07-01

    Cucurbita pepo is a highly polymorphic species. The cultivars can be grouped into eight morphotypes in two subspecies, ssp. pepo and ssp. ovifera. A collection of 69 accessions representative of the morphotypes and some unclassified types was used for analysing the morphological and molecular diversity of this species. This collection includes commercial cultivars and Spanish landraces, which represent the great diversification of types that have arisen in Europe after this species arrived from America. For the molecular variability studies, two PCR-based systems were employed, AFLP and SRAP, which preferentially amplify ORFs. Principal coordinates analysis and cluster analysis using the UPGMA method clearly separate the accessions into the two subspecies through the use of both markers. However, the gene diversity and the genetic identity values among morphotypes and subspecies varied between the two marker systems. The information given by SRAP markers was more concordant to the morphological variability and to the evolutionary history of the morphotypes than that of AFLP markers. In ssp. ovifera, the accessions of the different morphotypes were basically grouped according to the fruit colour. This may indicate different times of development and also the extent of breeding in the accessions used. This study has allowed identification of new types that can be employed for the development of new cultivars. The landraces of the spp. ovifera, used as ornamental in Europe, have proved to be of great interest for preserving the diversity of C. pepo.

  18. Key Processes for Cheirolophus (Asteraceae) Diversification on Oceanic Islands Inferred from AFLP Data

    PubMed Central

    Vitales, Daniel; García-Fernández, Alfredo; Pellicer, Jaume; Vallès, Joan; Santos-Guerra, Arnoldo; Cowan, Robyn S.; Fay, Michael F.; Hidalgo, Oriane; Garnatje, Teresa

    2014-01-01

    The radiation of the genus Cheirolophus (Asteraceae) in Macaronesia constitutes a spectacular case of rapid diversification on oceanic islands. Twenty species – nine of them included in the IUCN Red List of Threatened Species – have been described to date inhabiting the Madeiran and Canarian archipelagos. A previous phylogenetic study revealed that the diversification of Cheirolophus in Macaronesia started less than 2 Ma. As a result of such an explosive speciation process, limited phylogenetic resolution was reported, mainly due to the low variability of the employed molecular markers. In the present study, we used highly polymorphic AFLP markers to i) evaluate species' boundaries, ii) infer their evolutionary relationships and iii) investigate the patterns of genetic diversity in relation to the potential processes likely involved in the radiation of Cheirolophus. One hundred and seventy-two individuals representing all Macaronesian Cheirolophus species were analysed using 249 AFLP loci. Our results suggest that geographic isolation played an important role in this radiation process. This was likely driven by the combination of poor gene flow capacity and a good ability for sporadic long-distance colonisations. In addition, we also found some traces of introgression and incipient ecological adaptation, which could have further enhanced the extraordinary diversification of Cheirolophus in Macaronesia. Last, we hypothesize that current threat categories assigned to Macaronesian Cheirolophus species do not reflect their respective evolutionary relevance, so future evaluations of their conservation status should take into account the results presented here. PMID:25412495

  19. Comprehensive genetic discrimination of Leonurus cardiaca populations by AFLP, ISSR, RAPD and IRAP molecular markers.

    PubMed

    Khadivi-Khub, Abdollah; Soorni, Aboozar

    2014-06-01

    Leonurus cardiaca is well known for its medicinal importance. In this investigation, genotypic characterization of this species from six eco-geographical regions of Iran was evaluated by four molecular techniques (AFLP, RAPD, ISSR and IRAP). A total of 899 polymorphic fragments were detected by used molecular markers (AFLP = 356, RAPD = 325, ISSR = 113 and IRAP = 105) with an overall average polymorphism of 81.24%. Genetic variation calculated using Shannon's Information index (I) and Nei's gene diversity index (H) showed high genetic diversity in studied germplasm. Also, analysis of molecular variance showed high genetic variation among (55%) and within populations (45%). UPGMA dendrogram constructed from combined data of molecular markers distinguished studied populations in accordance with the results obtained by each marker which all individuals were clearly differentiated into two major clusters. The correlation coefficients were statistically significant for all marker systems with the highest correlation between similarity matrixes of RAPD and ISSR markers (r = 0.82). The present results have an important implication for L. cardiaca germplasm characterization, improvement, and conservation. Furthermore, the characterized individuals exhibited a great deal of molecular variation and they seem to have a rich gene pool for breeding programs.

  20. Molecular characterisation of Aspergillus flavus isolates from peanut fields in India using AFLP.

    PubMed

    Singh, Diwakar; Radhakrishnan, T; Kumar, Vinod; Bagwan, N B; Basu, M S; Dobaria, J R; Mishra, Gyan P; Chanda, S V

    2015-01-01

    Aflatoxin contamination of peanut, due to infection by Aspergillus flavus, is a major problem of rain-fed agriculture in India. In the present study, molecular characterisation of 187 Aspergillus flavus isolates, which were sampled from the peanut fields of Gujarat state in India, was performed using AFLP markers. On a pooled cluster analysis, the markers could successfully discriminate among the 'A', 'B' and 'G' group A. flavus isolates. PCoA analysis also showed equivalent results to the cluster analysis. Most of the isolates from one district could be clustered together, which indicated genetic similarity among the isolates. Further, a lot of genetic variability was observed within a district and within a group. The results of AMOVA test revealed that the variance within a population (84%) was more than that between two populations (16%). The isolates, when tested by indirect competitive ELISA, showed about 68.5% of them to be atoxigenic. Composite analysis between the aflatoxin production and AFLP data was found to be ineffective in separating the isolate types by aflatoxigenicity. Certain unique fragments, with respect to individual isolates, were also identified that may be used for development of SCAR marker to aid in rapid and precise identification of isolates.

  1. Veronaea botryosa: molecular identification with amplified fragment length polymorphism (AFLP) and in vitro antifungal susceptibility.

    PubMed

    Badali, Hamid; Yazdanparast, Seyed Amir; Bonifaz, Alexandro; Mousavi, Bita; de Hoog, G Sybren; Klaassen, Corné H W; Meis, Jacques F

    2013-06-01

    Inter- and intraspecific genomic variability of 18 isolates of Veronaea botryosa originating from clinical and environmental sources was studied using amplified fragment length polymorphism (AFLP). The species was originally described from the environment, but several severe cases of disseminated infection in apparently healthy individuals have been reported worldwide. All tested strains of V. botryosa, identified on the basis of sequencing and phenotypic and physiological criteria prior to our study, were confirmed by AFLP analysis, yielding a clear separation of V. botryosa as a rather homogeneous group from related species. In vitro antifungal susceptibility testing resulted in MIC90s across all strains in increasing order posaconazole (0.25 μg/ml), itraconazole (1 μg/ml), voriconazole (4 μg/ml), terbinafine (4 μg/ml), caspofungin (8 μg/ml), anidulafungin (8 μg/ml), isavuconazole (16 μg/ml), amphotericin B (16 μg/ml), and fluconazole (32 μg/ml). Overall, the isolates showed a uniform pattern of low MICs of itraconazole and posaconazole, but high MICs for remaining agents. The echinocandins (caspofungin and anidulafungin) had no activity against V. botryosa. There was no statistically significant difference between susceptibilities of environmental (n = 11) and clinical (n = 7) isolates of V. botryosa (P > 0.05).

  2. [AFLP Analysis of Genetic Diversity in the Genus Mallus Mill. (Apple)].

    PubMed

    Savelyeva, E N; Kudryavtsev, A M

    2015-10-01

    The first molecular genetic analysis of the apple species and varieties from Russian collections with the AFLP marker system was performed in order to study the genetic diversity of the genus Malus, as well as to clarify the phylogeny and solve some systematic issues of the genus. Nienty-one apple accessions, including species from five sections of the genus Malus and hybrid species, were examined. The level of polymorphism constituted 90.2%. It was demonstrated that the classical taxonomy of the genus Malus, which identifies five sections based on differences in their morphological characters, is valid and may be used to classify apple species. The species assignment of the Antonovka landraces was established. All of them belonged to the species M. domestica. It was demonstrated that the Yakutskaya apple variety was a domesticated species of the section Gymnomeles, presumably, M. baccata. AFLP analysis confirmed the hybrid nature of many species. The relationships between apple varieties of the Golden group with American wild species were demonstrated. The data suggest that the species M. sieversii was the ancestor of not only the domestic apple but also of other species of the Malus sections.

  3. AFLP characterization of Southern Europe population of Aspergillus Section Nigri from grapes.

    PubMed

    Perrone, G; Susca, A; Epifani, F; Mulè, G

    2006-09-01

    Members of Aspergillus belonging to Section Nigri are distributed worldwide and are mainly responsible for the ochratoxin A accumulation in grapes and wine, particularly in Southern Europe. Limited information is available on the species composition and genetic variability of black Aspergilli strains occurring on grapes. We analyzed 283 representative strains from the main wine producing European countries collected in 2001-2002 (Italy, France, Spain, Portugal, Greece and Israel) using amplified fragment length polymorphisms (AFLP) technique. Four main groups were obtained by AFLP clustering analysis of these strains and three of them showed a well defined homogeneous population/species with intraspecific homology higher than 48%: Aspergillus carbonarius (105 strains), Aspergillus tubingensis (69 strains), and Aspergillus "uniseriate" (56 strains) with a similarity less than 20% to the Aspergillus japonicus type strain. The fourth cluster, that we called "A. niger like" (44 strains), showed low homology with A. niger type strain (35%) and high internal heterogeneity. Finally, nine strains could not be assigned readily to any of the type strain of the A. nigri Section. These findings indicate that the Aspergillus Section Nigri strains occurring on grapes in Southern Europe represent a complex of species, and some of these are peculiar to grapes. PMID:16682091

  4. Multiplexing Short Primers for Viral Family PCR

    SciTech Connect

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  5. Use of labeled primers for differential display

    SciTech Connect

    Paunesku, T.; Woloschak, G.E.

    1995-01-01

    Two artifacts introduced in using differential display technology are (1) random priming from dT present from affinity purification of PolyA+ RNA and (2) hybridization of the arbitrary primer to template target sequences on both cDNA strands. We have developed a method eliminating both problems. By separately using 5`-end-labeled (T){sub 12}XY and arbitrary primers to label bands and comparing two differential display patterns, we can detect only those products incorporating the (T){sub 12}XY primer on the 3` ends and the arbitrary primer on 5` ends. Those bands that are generated randomly in the PCR are readily detectable and can be ignored.

  6. Use of primer selection and restriction enzymes to assess bacterial community diversity in an agricultural soil used for potato production via terminal restriction fragment length polymorphism.

    PubMed

    Fortuna, Ann-Marie; Marsh, Terence L; Honeycutt, C Wayne; Halteman, William A

    2011-08-01

    Terminal restriction fragment length polymorphism (T-RFLP) can be used to assess how land use management changes the dominant members of bacterial communities. We compared T-RFLP profiles obtained via amplification with forward primers (27, 63F) each coupled with the fluorescently labeled reverse primer (1392R) and multiple restriction enzymes to determine the best combination for interrogating soil bacterial populations in an agricultural soil used for potato production. Both primer pairs provide nearly universal recognition of a 1,400-bp sequence of the bacterial domain in the V(1)-V(3) region of the 16S ribosomal RNA (rRNA) gene relative to known sequences. Labeling the reverse primer allowed for direct comparison of each forward primer and the terminal restriction fragments' relative migration units obtained with each primer pair and restriction enzyme. Redundancy analysis (RDA) and nested multivariate analysis of variance (MANOVA) were used to assess the effects of primer pair and choice of restriction enzyme on the measured relative migration units. Our research indicates that the 63F-1392R amplimer pair provides a more complete description with respect to the bacterial communities present in this potato (Solanum tuberosum L.)-barley (Hordeum vulgare L.) rotation over seeded to crimson clover (Trifolium praense L.). Domain-specific 16S rRNA gene primers are rigorously tested to determine their ability to amplify across a target region of the gene. Yet, variability within or between T-RFLP profiles can result from factors independent of the primer pair. Therefore, researchers should use RDA and MANOVA analyses to evaluate the effects that additional laboratory and environmental variables have on bacterial diversity.

  7. Powered Tate Pairing Computation

    NASA Astrophysics Data System (ADS)

    Kang, Bo Gyeong; Park, Je Hong

    In this letter, we provide a simple proof of bilinearity for the eta pairing. Based on it, we show an efficient method to compute the powered Tate pairing as well. Although efficiency of our method is equivalent to that of the Tate pairing on the eta pairing approach, but ours is more general in principle.

  8. Protective Coats For Zinc-Rich Primers

    NASA Technical Reports Server (NTRS)

    Macdowell, Louis G, III

    1993-01-01

    Report describes tests of topcoats for inorganic zinc-rich primers on carbon steel. Topcoats intended to provide additional protection against corrosion in acidic, salty seacoast-air/rocket-engine-exhaust environment of Space Shuttle launch site. Tests focused on polyurethane topcoats on epoxy tie coats on primers. Part of study involved comparison between "high-build" coating materials and thin-film coating materials.

  9. A Dozen Primers on Important Information Standards

    ERIC Educational Resources Information Center

    Dempsey, Kathy, Comp.

    2007-01-01

    This is a compilation of 12 primers on important information standards and protocols. These primers are: (1) Atom; (2) COinS; (3) MADS; (4) MARC 21/MARCXML; (5) MIX; (6) MXG; (7) OpenSearch; (8) PREMIS; (9) RESTful HTTP; (10) unAPI; (11) XMPP (aka Jabber); and (12) ZeeRex. The Atom Syndication Format defines a new XML-based syndication format for…

  10. The Possible Physical Barrier and Coastal Dispersal Strategy for Japanese Grenadier Anchovy, Coilia nasus in the East China Sea and Yellow Sea: Evidence from AFLP Markers

    PubMed Central

    Han, Zhi-Qiang; Han, Gang; Wang, Zhi-Yong; Gao, Tian-Xiang

    2015-01-01

    In order to ascertain the taxonomic status of the Ariake Sea population of Japanese grenadier anchovy, Coilia nasus, and assess the contemporary possible genetic barrier between the west and east coastal waters of the East China Sea, we used amplified fragment length polymorphism (AFLP) markers to detect the genetic structure of C. nasus, in the East China Sea and Yellow Sea. Eighty-one individuals of C. nasus were collected from five locations and 12 individuals of Coilia mystus were sampled from the Yangtze River Estuary. A total of 371 loci were detected by five primer combinations, 310 of which were polymorphic (83.56%). Analysis of molecular variation (AMOVA) and pairwise fixation index (FST) revealed significant genetic differentiation among five samples, indicating limited gene flow among populations. The dendrogram for populations by neighbor-joining (NJ) cluster analysis provided evidence of a clear relationship between genetic and geographic patterns, supporting significant genetic differentiation between China coastal populations and Ariake Sea populations. Compared to the genetic divergence between C. nasus and C. mystus, the level of genetic differentiation between China and the Ariake Sea populations of C. nasus is obvious below the species level, indicating isolated populations of C. nasus in the Ariake Sea. Isolation by distance analysis revealed that direct ocean distance with deep-water at the continental slope and high salinity between west and east coastal waters of the East China Sea served as major physical barrier to C. nasus, supporting the coastal dispersal pattern in this estuarine species, and rejecting offshore dispersal strategy. PMID:25654225

  11. First genetic linkage map of Taraxacum koksaghyz Rodin based on AFLP, SSR, COS and EST-SSR markers.

    PubMed

    Arias, Marina; Hernandez, Monica; Remondegui, Naroa; Huvenaars, Koen; van Dijk, Peter; Ritter, Enrique

    2016-01-01

    Taraxacum koksaghyz Rodin (TKS) has been studied in many occasions as a possible alternative source for natural rubber production of good quality and for inulin production. Some tire companies are already testing TKS tire prototypes. There are also many investigations on the production of bio-fuels from inulin and inulin applications for health improvement and in the food industry. A limited amount of genomic resources exist for TKS and particularly no genetic linkage map is available in this species. We have constructed the first TKS genetic linkage map based on AFLP, COS, SSR and EST-SSR markers. The integrated linkage map with eight linkage groups (LG), representing the eight chromosomes of Russian dandelion, has 185 individual AFLP markers from parent 1, 188 individual AFLP markers from parent 2, 75 common AFLP markers and 6 COS, 1 SSR and 63 EST-SSR loci. Blasting the EST-SSR sequences against known sequences from lettuce allowed a partial alignment of our TKS map with a lettuce map. Blast searches against plant gene databases revealed some homologies with useful genes for downstream applications in the future. PMID:27488242

  12. First genetic linkage map of Taraxacum koksaghyz Rodin based on AFLP, SSR, COS and EST-SSR markers

    PubMed Central

    Arias, Marina; Hernandez, Monica; Remondegui, Naroa; Huvenaars, Koen; van Dijk, Peter; Ritter, Enrique

    2016-01-01

    Taraxacum koksaghyz Rodin (TKS) has been studied in many occasions as a possible alternative source for natural rubber production of good quality and for inulin production. Some tire companies are already testing TKS tire prototypes. There are also many investigations on the production of bio-fuels from inulin and inulin applications for health improvement and in the food industry. A limited amount of genomic resources exist for TKS and particularly no genetic linkage map is available in this species. We have constructed the first TKS genetic linkage map based on AFLP, COS, SSR and EST-SSR markers. The integrated linkage map with eight linkage groups (LG), representing the eight chromosomes of Russian dandelion, has 185 individual AFLP markers from parent 1, 188 individual AFLP markers from parent 2, 75 common AFLP markers and 6 COS, 1 SSR and 63 EST-SSR loci. Blasting the EST-SSR sequences against known sequences from lettuce allowed a partial alignment of our TKS map with a lettuce map. Blast searches against plant gene databases revealed some homologies with useful genes for downstream applications in the future. PMID:27488242

  13. AFLP Genome Scanning Reveals Divergent Selection in Natural Populations of Liriodendron chinense (Magnoliaceae) along a Latitudinal Transect

    PubMed Central

    Yang, Ai-Hong; Wei, Na; Fritsch, Peter W.; Yao, Xiao-Hong

    2016-01-01

    Understanding adaptive genetic variation and its relation to environmental factors are important for understanding how plants adapt to climate change and for managing genetic resources. Genome scans for the loci exhibiting either notably high or low levels of population differentiation (outlier loci) provide one means of identifying genomic regions possibly associated with convergent or divergent selection. In this study, we combined Amplified Fragment Length Polymorphism (AFLP) genome scan and environmental association analysis to test for signals of natural selection in natural populations of Liriodendron chinense (Chinese Tulip Tree; Magnoliaceae) along a latitudinal transect. We genotyped 276 individuals from 11 populations of L. chinense using 987 AFLP markers. Both frequency-based (Dfdist and BayeScan) and correlation-based (MLM) methods were applied to detect outlier loci. Our analyses recovered both neutral and potentially adaptive genetic differentiation among populations of L. chinense. We found moderate genetic diversity within populations and high genetic differentiation among populations with reduced genetic diversity toward the periphery of the species ranges. Nine AFLP marker loci showed evidence of being outliers for population differentiation for both detection methods. Of these, six were strongly associated with at least one climate factor. Temperature, precipitation, and radiation were found to be three important factors influencing local adaptation of L. chinense. The outlier AFLP loci are likely not the target of natural selection, but the neighboring genes of these loci might be involved in local adaptation. Hence, these candidates should be validated by further studies. PMID:27303414

  14. AFLP Genome Scanning Reveals Divergent Selection in Natural Populations of Liriodendron chinense (Magnoliaceae) along a Latitudinal Transect.

    PubMed

    Yang, Ai-Hong; Wei, Na; Fritsch, Peter W; Yao, Xiao-Hong

    2016-01-01

    Understanding adaptive genetic variation and its relation to environmental factors are important for understanding how plants adapt to climate change and for managing genetic resources. Genome scans for the loci exhibiting either notably high or low levels of population differentiation (outlier loci) provide one means of identifying genomic regions possibly associated with convergent or divergent selection. In this study, we combined Amplified Fragment Length Polymorphism (AFLP) genome scan and environmental association analysis to test for signals of natural selection in natural populations of Liriodendron chinense (Chinese Tulip Tree; Magnoliaceae) along a latitudinal transect. We genotyped 276 individuals from 11 populations of L. chinense using 987 AFLP markers. Both frequency-based (Dfdist and BayeScan) and correlation-based (MLM) methods were applied to detect outlier loci. Our analyses recovered both neutral and potentially adaptive genetic differentiation among populations of L. chinense. We found moderate genetic diversity within populations and high genetic differentiation among populations with reduced genetic diversity toward the periphery of the species ranges. Nine AFLP marker loci showed evidence of being outliers for population differentiation for both detection methods. Of these, six were strongly associated with at least one climate factor. Temperature, precipitation, and radiation were found to be three important factors influencing local adaptation of L. chinense. The outlier AFLP loci are likely not the target of natural selection, but the neighboring genes of these loci might be involved in local adaptation. Hence, these candidates should be validated by further studies. PMID:27303414

  15. First genetic linkage map of Taraxacum koksaghyz Rodin based on AFLP, SSR, COS and EST-SSR markers.

    PubMed

    Arias, Marina; Hernandez, Monica; Remondegui, Naroa; Huvenaars, Koen; van Dijk, Peter; Ritter, Enrique

    2016-08-04

    Taraxacum koksaghyz Rodin (TKS) has been studied in many occasions as a possible alternative source for natural rubber production of good quality and for inulin production. Some tire companies are already testing TKS tire prototypes. There are also many investigations on the production of bio-fuels from inulin and inulin applications for health improvement and in the food industry. A limited amount of genomic resources exist for TKS and particularly no genetic linkage map is available in this species. We have constructed the first TKS genetic linkage map based on AFLP, COS, SSR and EST-SSR markers. The integrated linkage map with eight linkage groups (LG), representing the eight chromosomes of Russian dandelion, has 185 individual AFLP markers from parent 1, 188 individual AFLP markers from parent 2, 75 common AFLP markers and 6 COS, 1 SSR and 63 EST-SSR loci. Blasting the EST-SSR sequences against known sequences from lettuce allowed a partial alignment of our TKS map with a lettuce map. Blast searches against plant gene databases revealed some homologies with useful genes for downstream applications in the future.

  16. Impact of deep coalescence and recombination on the estimation of phylogenetic relationships among species using AFLP markers.

    PubMed

    García-Pereira, María Jesús; Carvajal-Rodríguez, Antonio; Whelan, Simon; Caballero, Armando; Quesada, Humberto

    2014-07-01

    Deep coalescence and the nongenealogical pattern of descent caused by recombination have emerged as a common problem for phylogenetic inference at the species level. Here we use computer simulations to assess whether AFLP-based phylogenies are robust to the uncertainties introduced by these factors. Our results indicate that phylogenetic signal can prevail even in the face of extensive deep coalescence allowing recovering the correct species tree topology. The impact of recombination on tree accuracy was related to total tree depth and species effective population size. The correct tree topology could be recovered upon many simulation settings due to a trade-off between the conflicting signals resulting from intra-locus recombination and the benefits of the joint consideration of unlinked loci that better matched overall the true species tree. Errors in tree topology were not only determined by deep coalescence, but also by the timing of divergence and the tree-building errors arising from an insufficient number of characters. DNA sequences generally outperformed AFLPs upon any simulated scenario, but this difference in performance was nearly negligible when a sufficient number of AFLP characters were sampled. Our simulations suggest that the impact of deep coalescence and intra-locus recombination on the reliability of AFLP trees could be minimal for effective population sizes equal to or lower than 10,000 (typical of many vertebrates and tree plants) given tree depths above 0.02 substitutions per site. PMID:24631855

  17. ANL supplement to the UNICOS primer

    SciTech Connect

    Wiley, M.S.; Karlovsky, S.R.

    1991-06-01

    The ANL Supplement to the UNICOS Primer (ANL/TM 460) introduces the Cray X-MP interactive and batch services available at Argonne National Laboratory. It serves as a companion to the UNICOS Primer (Cray publication SG-2010 6.0). Whereas the UNICOS Primer discusses standard Unix issues of Cray computing, this manual discusses those issues specific to Cray computing at ANL. If this is your first experience on a Unix-based system, we assume that you have read at least Chapters 1 through 3 of the UNICOS Primer. The Glossary at the back of the UNICOS Primer will also be useful to you. If you are already familiar with a Unix system, it should suffice to keep the UNICOS Primer handy as you use this document. To learn about Unix programming in greater detail, we recommend A Practical Guide to the Unix System, by Mark G. Sobell. This manual and all other sources referred to in this document are available for purchase at the Document Distribution Counter in Building 221, Room A-134. We assume that you have already read the Guide to Computing at ANL (ANL/TM 336) to get an overview of all the computing facilities and services available at Argonne National Laboratory. You should also refer to Recommended Documentation for Computer Users at ANL (ANL/TM 379) for additional guidance in selecting available documentation that will best fill your particular computing needs.

  18. Use of labeled primers for differential display

    SciTech Connect

    Paunesku, T.; Woloschak, G.E.

    1995-02-01

    The differential display of eukaryotic cDNAs using PCR allows for determination of mRNA species differentially expressed when comparing two similar cell populations. This procedure uses a (T){sub 12}XY oligonucleotide as the 3 ft primer and an arbitrary 8-10-mer as the 5 ft primer. Labeling occurs by inclusion of {alpha}[{sup 33}P]-dATP in the PCR reaction. Two artifacts caused by this approach are (1) random printing from dT present from affinity purification of PolyA+RNA and (2) hybridization of the arbitrary primer to template target sequences on both cDNA strands. In this work, we have developed an approach for both eliminating smearing and identifying nonspecific bands on sequencing gels. By separately using 5 ft-end-labeled (T){sub 12}XY and arbitrary primers to label bands and comparing two differential display patterns rather than including labeled nucleotides in the PCR reaction itself, we can detect only those products incorporating the M{sub 12}XY primer on the 3 ft ends and the arbitrary primer on 5 ft ends. Those bands that are generated randomly in the PCR reaction are readily detectable and can be ignored. If on the other hand, one is interested only in a diagnostic banding pattern for differential display, benefit can be derived from the simplicity of the pattern obtained when labeled (T){sub 12}XY is used.

  19. Searching for Beta-Haemolysin hlb Gene in Staphylococcus pseudintermedius with Species-Specific Primers.

    PubMed

    Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin

    2016-07-01

    The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification.

  20. PCR primers for 30 novel gene regions in the nuclear genomes of Lepidoptera

    PubMed Central

    Wahlberg, Niklas; Peña, Carlos; Ahola, Milla; Wheat, Christopher W.; Rota, Jadranka

    2016-01-01

    Abstract We report primer pairs for 30 new gene regions in the nuclear genomes of Lepidoptera that can be amplified using a standard PCR protocol. The new primers were tested across diverse Lepidoptera, including nonditrysians and a wide selection of ditrysians. These new gene regions give a total of 11,043 bp of DNA sequence data and they show similar variability to traditionally used nuclear gene regions in studies of Lepidoptera. We feel that a PCR-based approach still has its place in molecular systematic studies of Lepidoptera, particularly at the intrafamilial level, and our new set of primers now provides a route to generating phylogenomic datasets using traditional methods. PMID:27408580

  1. Searching for Beta-Haemolysin hlb Gene in Staphylococcus pseudintermedius with Species-Specific Primers.

    PubMed

    Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin

    2016-07-01

    The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification. PMID:27086303

  2. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design.

    PubMed

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads Tvillinggaard; Genee, Hans Jasper; Holm, Dorte Koefoed; Carlsen, Simon; Hansen, Bjarne Gram; Patil, Kiran Raosaheb; Mortensen, Uffe Hasbro; Wernersson, Rasmus

    2011-07-01

    Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. However, designing primers for USER fusion is both tedious and time consuming. Here, we present the Primer Help for USER (PHUSER) software, a novel tool for designing primers specifically for USER fusion and USER cloning applications. We also present proof-of-concept experimental validation of its functionality. PHUSER offers quick and easy design of PCR optimized primers ensuring directionally correct fusion of fragments into a plasmid containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (T(m)), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers are individually analysed in terms of GC content, presence of GC clamp at 3'-end, the risk of primer dimer formation, the risk of intra-primer complementarity (secondary structures) and the presence of polyN stretches. Furthermore, PHUSER offers the option to insert linkers between DNA fragments, as well as highly flexible cassette options. PHUSER is publicly available at http://www.cbs.dtu.dk/services/phuser/. PMID:21622660

  3. Design and Validation of Four New Primers for Next-Generation Sequencing To Target the 18S rRNA Genes of Gastrointestinal Ciliate Protozoa

    PubMed Central

    Wright, André-Denis G.

    2014-01-01

    Four new primers and one published primer were used to PCR amplify hypervariable regions within the protozoal 18S rRNA gene to determine which primer pair provided the best identification and statistical analysis. PCR amplicons of 394 to 498 bases were generated from three primer sets, sequenced using Roche 454 pyrosequencing with Titanium, and analyzed using the BLAST database (NCBI) and MOTHUR version 1.29. The protozoal diversity of rumen contents from moose in Alaska was assessed. In the present study, primer set 1, P-SSU-316F and GIC758R (amplicon of 482 bases), gave the best representation of diversity using BLAST classification, and the set amplified Entodinium simplex and Ostracodinium spp., which were not amplified by the other two primer sets. Primer set 2, GIC1080F and GIC1578R (amplicon of 498 bases), had similar BLAST results and a slightly higher percentage of sequences that were identified with a higher sequence identity. Primer sets 1 and 2 are recommended for use in ruminants. However, primer set 1 may be inadequate to determine protozoal diversity in nonruminants. The amplicons created by primer set 1 were indistinguishable for certain species within the genera Bandia, Blepharocorys, Polycosta, and Tetratoxum and between Hemiprorodon gymnoprosthium and Prorodonopsis coli, none of which are normally found in the rumen. PMID:24973070

  4. Design and validation of four new primers for next-generation sequencing to target the 18S rRNA genes of gastrointestinal ciliate protozoa.

    PubMed

    Ishaq, Suzanne L; Wright, André-Denis G

    2014-09-01

    Four new primers and one published primer were used to PCR amplify hypervariable regions within the protozoal 18S rRNA gene to determine which primer pair provided the best identification and statistical analysis. PCR amplicons of 394 to 498 bases were generated from three primer sets, sequenced using Roche 454 pyrosequencing with Titanium, and analyzed using the BLAST database (NCBI) and MOTHUR version 1.29. The protozoal diversity of rumen contents from moose in Alaska was assessed. In the present study, primer set 1, P-SSU-316F and GIC758R (amplicon of 482 bases), gave the best representation of diversity using BLAST classification, and the set amplified Entodinium simplex and Ostracodinium spp., which were not amplified by the other two primer sets. Primer set 2, GIC1080F and GIC1578R (amplicon of 498 bases), had similar BLAST results and a slightly higher percentage of sequences that were identified with a higher sequence identity. Primer sets 1 and 2 are recommended for use in ruminants. However, primer set 1 may be inadequate to determine protozoal diversity in nonruminants. The amplicons created by primer set 1 were indistinguishable for certain species within the genera Bandia, Blepharocorys, Polycosta, and Tetratoxum and between Hemiprorodon gymnoprosthium and Prorodonopsis coli, none of which are normally found in the rumen.

  5. AFLP variation in wild barley (Hordeum spontaneum C. Koch) with reference to salt tolerance and associated ecogeography.

    PubMed

    Pakniyat, H; Powell, W; Baird, E; Handley, L L; Robinson, D; Scrimgeour, C M; Hackett, C A; Forster, B P; Nevo, E; Caligari, P D

    1997-06-01

    Thirty-nine genotypes of Hordeum spontaneum were selected from three geographically separated areas (southwestern, northern, and southeastern) of the Fertile Crescent. The lines were subject to AFLP (amplified fragment length polymorphism) analysis from which a similarity matrix was produced. A dendrogram of the data showed, with two exceptions, that the genotypes grouped together according to area of origin. This was confirmed by principal coordinate analysis in which the first principal coordinate separated the genotypes of the southwestern area from the other two areas, which in turn could be separated by the second principal coordinate. While genotypes from the same site of origin can exhibit very similar AFLP profiles, sharp genetic differences were detected between genotypes separated by relatively short distances. Thirty of the 39 genotypes were subjected to hydroculture salt tolerance tests. These were analysed for shoot Na+ content and carbon isotope composition (δ13C) after 4 weeks of treatment (100 mol∙m−3 NaCl). Shoot Na+ content and δ13C were highly correlated. Twelve AFLP markers were found to be associated with both shoot Na+ content and shoot δ13C and were also associated with site of origin ecogeographic data, particularly longitude. The most salt tolerant genotype came from Ilam in the southeastern area and the most salt sensitive genotype originated in the southwestern area. The 12 markers were partitioned into groups that showed significant associations within groups but no significant association between groups. In a multiple regression analysis, three AFLP markers, from separate groups, accounted for more than 60% of the variation for shoot Na+ content and δ13C. The results demonstrate the effectiveness of AFLP fingerprinting in genetic studies of complex traits at the wild species and (or) population level. PMID:18464832

  6. Design and Implementation of Degenerate Microsatellite Primers for the Mammalian Clade

    PubMed Central

    Buschiazzo, Emmanuel; Beck, Josephine S.; Gemmell, Neil J.

    2011-01-01

    Microsatellites are popular genetic markers in molecular ecology, genetic mapping and forensics. Unfortunately, despite recent advances, the isolation of de novo polymorphic microsatellite loci often requires expensive and intensive groundwork. Primers developed for a focal species are commonly tested in a related, non-focal species of interest for the amplification of orthologous polymorphic loci; when successful, this approach significantly reduces cost and time of microsatellite development. However, transferability of polymorphic microsatellite loci decreases rapidly with increasing evolutionary distance, and this approach has shown its limits. Whole genome sequences represent an under-exploited resource to develop cross-species primers for microsatellites. Here we describe a three-step method that combines a novel in silico pipeline that we use to (1) identify conserved microsatellite loci from a multiple genome alignments, (2) design degenerate primer pairs, with (3) a simple PCR protocol used to implement these primers across species. Using this approach we developed a set of primers for the mammalian clade. We found 126,306 human microsatellites conserved in mammalian aligned sequences, and isolated 5,596 loci using criteria based on wide conservation. From a random subset of ∼1000 dinucleotide repeats, we designed degenerate primer pairs for 19 loci, of which five produced polymorphic fragments in up to 18 mammalian species, including the distinctly related marsupials and monotremes, groups that diverged from other mammals 120–160 million years ago. Using our method, many more cross-clade microsatellite loci can be harvested from the currently available genomic data, and this ability is set to improve exponentially as further genomes are sequenced. PMID:22216321

  7. PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes

    SciTech Connect

    Yoon, Hyejin; Leitner, Thomas

    2014-12-17

    Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-M finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.

  8. PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes

    DOE PAGES

    Yoon, Hyejin; Leitner, Thomas

    2014-12-17

    Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-Mmore » finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.« less

  9. DegePrime, a Program for Degenerate Primer Design for Broad-Taxonomic-Range PCR in Microbial Ecology Studies

    PubMed Central

    Hugerth, Luisa W.; Wefer, Hugo A.; Lundin, Sverker; Jakobsson, Hedvig E.; Lindberg, Mathilda; Rodin, Sandra; Engstrand, Lars

    2014-01-01

    The taxonomic composition of a microbial community can be deduced by analyzing its rRNA gene content by, e.g., high-throughput DNA sequencing or DNA chips. Such methods typically are based on PCR amplification of rRNA gene sequences using broad-taxonomic-range PCR primers. In these analyses, the use of optimal primers is crucial for achieving an unbiased representation of community composition. Here, we present the computer program DegePrime that, for each position of a multiple sequence alignment, finds a degenerate oligomer of as high coverage as possible and outputs its coverage among taxonomic divisions. We show that our novel heuristic, which we call weighted randomized combination, performs better than previously described algorithms for solving the maximum coverage degenerate primer design problem. We previously used DegePrime to design a broad-taxonomic-range primer pair that targets the bacterial V3-V4 region (341F-805R) (D. P. Herlemann, M. Labrenz, K. Jurgens, S. Bertilsson, J. J. Waniek, and A. F. Andersson, ISME J. 5:1571–1579, 2011, http://dx.doi.org/10.1038/ismej.2011.41), and here we use the program to significantly increase the coverage of a primer pair (515F-806R) widely used for Illumina-based surveys of bacterial and archaeal diversity. By comparison with shotgun metagenomics, we show that the primers give an accurate representation of microbial diversity in natural samples. PMID:24928874

  10. A method for genotype validation and primer assessment in heterozygote-deficient species, as demonstrated in the prosobranch mollusc Hydrobia ulvae

    PubMed Central

    Brownlow, Robert J; Dawson, Deborah A; Horsburgh, Gavin J; Bell, James J; Fish, John D

    2008-01-01

    Background In studies where microsatellite markers are employed, it is essential that the primers designed will reliably and consistently amplify target loci. In populations conforming to Hardy-Weinberg equilibrium (HWE), screening for unreliable markers often relies on the identification of heterozygote deficiencies and subsequent departures from HWE. However, since many populations naturally deviate from HWE, such as many marine invertebrates, it can be difficult to distinguish heterozygote deficiencies resulting from unreliable markers from natural processes. Thus, studies of populations that are suspected to deviate from HWE naturally would benefit from a method to validate genotype data-sets and test the reliability of the designed primers. Levels of heterozygosity are reported for the prosobranch mollusc Hydrobia ulvae (Pennant) together with a method of genotype validation and primer assessment that utilises two primer sets for each locus. Microsatellite loci presented are the first described for the species Hydrobia ulvae; the five loci presented will be of value in further study of populations of H. ulvae. Results We have developed a novel method of testing primer reliability in naturally heterozygote deficient populations. After the design of an initial primer set, genotyping in 48 Hydrobia ulvae specimens using a single primer set (Primer set_A) revealed heterozygote deficiency in six of the seven loci examined. Redesign of six of the primer pairs (Primer set_B), re-genotyping of the successful individuals from Primer set_A using Primer set_B, and comparison of genotypes between the two primer sets, enabled the identification of two loci (Hulv-06 & Hulv-07) that showed a high degree of discrepancy between primer sets A and B (0% & only 25% alleles matching, respectively), suggesting unreliability in these primers. The discrepancies included changes from heterozygotes to homozygotes or vice versa, and some individuals who also displayed new alleles of

  11. Beam shaping for laser initiated optical primers

    NASA Astrophysics Data System (ADS)

    Lizotte, Todd E.

    2008-08-01

    Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.

  12. A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

    DOE PAGES

    Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

    2015-12-09

    The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less

  13. A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

    SciTech Connect

    Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

    2015-12-09

    The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable region of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.

  14. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    NASA Astrophysics Data System (ADS)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  15. Enhanced primers for amplification of DNA barcodes from a broad range of marine metazoans

    PubMed Central

    2013-01-01

    Background Building reference libraries of DNA barcodes is relatively straightforward when specifically designed primers are available to amplify the COI-5P region from a relatively narrow taxonomic group (e.g. single class or single order). DNA barcoding marine communities have been comparatively harder to accomplish due to the broad taxonomic diversity and lack of consistently efficient primers. Although some of the so-called “universal” primers have been relatively successful, they still fail to amplify COI-5P of many marine animal groups, while displaying random success even among species within each group. Here we propose a new pair of primers designed to enhance amplification of the COI-5P region in a wide range of marine organisms. Results Amplification tests conducted on a wide range of marine animal taxa, rendered possible the first–time sequencing of DNA barcodes from eight separated phyla (Annelida, Arthropoda, Chordata, Cnidaria, Echinodermata, Mollusca, Nemertea and Platyhelminthes), comprising a total of 14 classes, 28 orders, 57 families, 68 genus and 76 species. Conclusions These primers demonstrated to be highly cost-effective, which is of key importance for DNA barcoding procedures, such as for building comprehensive DNA barcode libraries of marine communities, where the processing of a large numbers of specimens from a wide variety of marine taxa is compulsory. PMID:24020880

  16. A novel universal primer-multiplex-PCR method with sequencing gel electrophoresis analysis.

    PubMed

    Xu, Wentao; Zhai, Zhifang; Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo

    2012-01-01

    In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5'-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on.

  17. Development and characterization of 11 microsatellite primers for the sedge Trichophorum planifolium (Cyperaceae)1

    PubMed Central

    Nowell, Victoria J.; Wang, Song; Smith, Tyler W.

    2015-01-01

    Premise of the study: Microsatellite loci were developed for Trichophorum planifolium (Cyperaceae), an endangered woodland sedge protected under federal and provincial legislation in Canada, to explore patterns of population genetic diversity and differentiation in the species. Methods and Results: Sixty-three primer pairs were evaluated for amplification consistency and screened for polymorphisms in 96 samples collected from 12 populations of T. planifolium distributed through the range of the species. Of these, 11 loci were shown to be polymorphic, displaying two to six alleles. Mean observed heterozygosity across loci ranged from 0.00 to 0.06 among populations tested. Conclusions: The results suggest that the 11 primer pairs developed in this study will be useful for future studies of broad-scale genetic variation in T. planifolium and in guiding management protocols for the species in Canada. PMID:26421254

  18. Significant population genetic structure detected in the rock bream Oplegnathus fasciatus (Temminck & Schlegel, 1844) inferred from fluorescent-AFLP analysis

    NASA Astrophysics Data System (ADS)

    Xiao, Yongshuang; Ma, Daoyuan; Xu, Shihong; Liu, Qinghua; Wang, Yanfeng; Xiao, Zhizhong; Li, Jun

    2016-05-01

    Oplegnathus fasciatus (rock bream) is a commercial rocky reef fish species in East Asia that has been considered for aquaculture. We estimated the population genetic diversity and population structure of the species along the coastal waters of China using fluorescent-amplified fragment length polymorphisms technology. Using 53 individuals from three populations and four pairs of selective primers, we amplified 1 264 bands, 98.73% of which were polymorphic. The Zhoushan population showed the highest Nei's genetic diversity and Shannon genetic diversity. The results of analysis of molecular variance (AMOVA) showed that 59.55% of genetic variation existed among populations and 40.45% occurred within populations, which indicated that a significant population genetic structure existed in the species. The pairwise fixation index F st ranged from 0.20 to 0.63 and were significant after sequential Bonferroni correction. The topology of an unweighted pair group method with arithmetic mean tree showed two significant genealogical branches corresponding to the sampling locations of North and South China. The AMOVA and STRUCTURE analyses suggested that the O. fasciatus populations examined should comprise two stocks.

  19. Primers on Special Education and Charter Schools: Compilation of Full Primer Set

    ERIC Educational Resources Information Center

    Ahearn, Eileen M.; Giovannetti, Elizabeth A.; Lange, Cheryl M.; Rhim, Lauren Morando; Warren, Sandra Hopfengardner

    2004-01-01

    This set of primers for charter school authorizers; charter school operators and state-level administrators has been developed to provide background information and resources for the "builders" of charter schools and policymakers to facilitate the successful inclusion of students with disabilities in charter schools. The primers open with a…

  20. A first linkage map of pecan cultivars based on RAPD and AFLP markers.

    PubMed

    Beedanagari, Sudheer R; Dove, Sue K; Wood, Bruce W; Conner, Patrick J

    2005-04-01

    We report here the first genetic linkage maps of pecan [Carya illinoinensis (Wangenh.) K. Koch], using random amplified polymorphic DNA (RAPD) and amplified fragment length polymorphism (AFLP) markers. Independent maps were constructed for the cultivars 'Pawnee' and 'Elliot' using the double pseudo-testcross mapping strategy and 120 F1 seedlings from a full-sib family. A total of 477 markers, including 217 RAPD, 258 AFLP, and two morphological markers were used in linkage analysis. The 'Pawnee' linkage map has 218 markers, comprising 176 testcross and 42 intercross markers placed in 16 major and 13 minor (doublets and triplets) linkage groups. The 'Pawnee' linkage map covered 2,227 cM with an average map distance of 12.7 cM between adjacent markers. The 'Elliot' linkage map has 174 markers comprising 150 testcross and 22 intercross markers placed in 17 major and nine minor linkage groups. The 'Elliot' map covered 1,698 cM with an average map distance of 11.2 cM between adjacent markers. Segregation ratios for dichogamy type and stigma color were not significantly different from 1:1, suggesting that both traits are controlled by single loci with protogyny and green stigmas dominant to protandry and red stigmas. These loci were tightly linked (1.9 cM) and were placed in 'Elliot' linkage group 16. These linkage maps are an important first step towards the detection of genes controlling horticulturally important traits such as nut size, nut maturity date, kernel quality, and disease resistance. PMID:15782296

  1. Primerize: automated primer assembly for transcribing non-coding RNA domains

    PubMed Central

    Tian, Siqi; Yesselman, Joseph D.; Cordero, Pablo; Das, Rhiju

    2015-01-01

    Customized RNA synthesis is in demand for biological and biotechnological research. While chemical synthesis and gel or chromatographic purification of RNA is costly and difficult for sequences longer than tens of nucleotides, a pipeline of primer assembly of DNA templates, in vitro transcription by T7 RNA polymerase and kit-based purification provides a cost-effective and fast alternative for preparing RNA molecules. Nevertheless, designing template primers that optimize cost and avoid mispriming during polymerase chain reaction currently requires expert inspection, downloading specialized software or both. Online servers are currently not available or maintained for the task. We report here a server named Primerize that makes available an efficient algorithm for primer design developed and experimentally tested in our laboratory for RNA domains with lengths up to 300 nucleotides. Free access: http://primerize.stanford.edu. PMID:25999345

  2. PriFi: using a multiple alignment of related sequences to find primers for amplification of homologs.

    PubMed

    Fredslund, Jakob; Schauser, Leif; Madsen, Lene H; Sandal, Niels; Stougaard, Jens

    2005-07-01

    Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from phylogenetically related species and outputs a list of possibly degenerate primer pairs fulfilling a number of criteria, such that the primers have a maximal probability of amplifying orthologous sequences in other phylogenetically related species. Operating on a genome-wide scale, PriFi automates the first steps of a procedure for developing general markers serving as common anchor loci across species. To accommodate users with special preferences, configuration settings and criteria can be customized.

  3. Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies.

    PubMed

    Klindworth, Anna; Pruesse, Elmar; Schweer, Timmy; Peplies, Jörg; Quast, Christian; Horn, Matthias; Glöckner, Frank Oliver

    2013-01-01

    16S ribosomal RNA gene (rDNA) amplicon analysis remains the standard approach for the cultivation-independent investigation of microbial diversity. The accuracy of these analyses depends strongly on the choice of primers. The overall coverage and phylum spectrum of 175 primers and 512 primer pairs were evaluated in silico with respect to the SILVA 16S/18S rDNA non-redundant reference dataset (SSURef 108 NR). Based on this evaluation a selection of 'best available' primer pairs for Bacteria and Archaea for three amplicon size classes (100-400, 400-1000, ≥ 1000 bp) is provided. The most promising bacterial primer pair (S-D-Bact-0341-b-S-17/S-D-Bact-0785-a-A-21), with an amplicon size of 464 bp, was experimentally evaluated by comparing the taxonomic distribution of the 16S rDNA amplicons with 16S rDNA fragments from directly sequenced metagenomes. The results of this study may be used as a guideline for selecting primer pairs with the best overall coverage and phylum spectrum for specific applications, therefore reducing the bias in PCR-based microbial diversity studies.

  4. Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

    PubMed

    Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

    2015-05-01

    Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

  5. Climate Change, Health, and Communication: A Primer.

    PubMed

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  6. Climate Change, Health, and Communication: A Primer.

    PubMed

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects. PMID:26580230

  7. Improving AFLP analysis of large-scale patterns of genetic variation--a case study with the Central African lianas Haumania spp (Marantaceae) showing interspecific gene flow.

    PubMed

    Ley, A C; Hardy, O J

    2013-04-01

    AFLP markers are often used to study patterns of population genetic variation and gene flow because they offer a good coverage of the nuclear genome, but the reliability of AFLP scoring is critical. To assess interspecific gene flow in two African rainforest liana species (Haumania danckelmaniana, H. liebrechtsiana) where previous evidence of chloroplast captures questioned the importance of hybridization and species boundaries, we developed new AFLP markers and a novel approach to select reliable bands from their degree of reproducibility. The latter is based on the estimation of the broad-sense heritability of AFLP phenotypes, an improvement over classical scoring error rates, which showed that the polymorphism of most AFLP bands was affected by a substantial nongenetic component. Therefore, using a quantitative genetics framework, we also modified an existing estimator of pairwise kinship coefficient between individuals correcting for the limited heritability of markers. Bayesian clustering confirms the recognition of the two Haumania species. Nevertheless, the decay of the relatedness between individuals of distinct species with geographic distance demonstrates that hybridization affects the nuclear genome. In conclusion, although we showed that AFLP markers might be substantially affected by nongenetic factors, their analysis using the new methods developed considerably advanced our understanding of the pattern of gene flow in our model species. PMID:23398575

  8. Improving AFLP analysis of large-scale patterns of genetic variation--a case study with the Central African lianas Haumania spp (Marantaceae) showing interspecific gene flow.

    PubMed

    Ley, A C; Hardy, O J

    2013-04-01

    AFLP markers are often used to study patterns of population genetic variation and gene flow because they offer a good coverage of the nuclear genome, but the reliability of AFLP scoring is critical. To assess interspecific gene flow in two African rainforest liana species (Haumania danckelmaniana, H. liebrechtsiana) where previous evidence of chloroplast captures questioned the importance of hybridization and species boundaries, we developed new AFLP markers and a novel approach to select reliable bands from their degree of reproducibility. The latter is based on the estimation of the broad-sense heritability of AFLP phenotypes, an improvement over classical scoring error rates, which showed that the polymorphism of most AFLP bands was affected by a substantial nongenetic component. Therefore, using a quantitative genetics framework, we also modified an existing estimator of pairwise kinship coefficient between individuals correcting for the limited heritability of markers. Bayesian clustering confirms the recognition of the two Haumania species. Nevertheless, the decay of the relatedness between individuals of distinct species with geographic distance demonstrates that hybridization affects the nuclear genome. In conclusion, although we showed that AFLP markers might be substantially affected by nongenetic factors, their analysis using the new methods developed considerably advanced our understanding of the pattern of gene flow in our model species.

  9. PrimerIdent: A web based tool for conserved primer design

    PubMed Central

    Pessoa, Alberto M; Pereira, Susana; Teixeira, Jorge

    2010-01-01

    Conserved primers across multiple species and simultaneously specific for a certain isozyme can be rare and difficult to find. PrimerIdent was developed aiming to automate this primer design and selection process in a given nucleotide sequence alignment, providing an intuitive, easy to interpret graphical result, which offers a list of all possible primers that meet the user criteria, with a colour-code identity to each sequence in the alignment. The software here presented is a simple and intuitive web based tool that is suitable for distinguishing very similar nucleotide sequences, such as isozymes­coding sequences, to enable the conserved primer design across multiple species, necessary for approaches that rely on knowing if a primer is suitable for a certain set of pre-aligned sequences, to design a specific primer to a certain sequence variation, or a combination thereof. This extremely useful software can, therefore, be used as a tool for the specific amplification of individual members of multigenic families across related species and also to evaluate the differential expression of isogenes for a given species. Availability http://primerident.up.pt PMID:21346862

  10. Estimation of outcrossing rates in interspecific backcross plants of Jatropha curcas (L.) using AFLP and SSR markers.

    PubMed

    Sinha, Pratima; Islam, Md Aminul; Negi, Madan Singh; Tripathi, Shashi Bhushan

    2015-10-01

    In this paper, we report the estimates of outcrossing rates using open-pollinated progeny arrays of 40 BC1 individuals of Jatropha developed as a result of interspecific hybridization between J. curcas and J. integerrima. For analysis PCR-based dominant AFLP and codominant SSR markers were used. The multilocus outcrossing rate (tm) estimated from AFLP markers (0.892 ± 0.112) are almost in the same range with SSR (0.884 ± 0.293) markers which indicate a high level of heterozygosity. A low value of inbreeding coefficient (F) also points out to the fact that outcrossing was the prevalent mode of reproduction in Jatropha and suggests maintenance of adequate genetic variability within families. PMID:26600687

  11. Estimation of outcrossing rates in interspecific backcross plants of Jatropha curcas (L.) using AFLP and SSR markers.

    PubMed

    Sinha, Pratima; Islam, Md Aminul; Negi, Madan Singh; Tripathi, Shashi Bhushan

    2015-10-01

    In this paper, we report the estimates of outcrossing rates using open-pollinated progeny arrays of 40 BC1 individuals of Jatropha developed as a result of interspecific hybridization between J. curcas and J. integerrima. For analysis PCR-based dominant AFLP and codominant SSR markers were used. The multilocus outcrossing rate (tm) estimated from AFLP markers (0.892 ± 0.112) are almost in the same range with SSR (0.884 ± 0.293) markers which indicate a high level of heterozygosity. A low value of inbreeding coefficient (F) also points out to the fact that outcrossing was the prevalent mode of reproduction in Jatropha and suggests maintenance of adequate genetic variability within families.

  12. Internet Primer: Workshop Design and Objectives.

    ERIC Educational Resources Information Center

    Laverty, Corinne Y. C.

    1996-01-01

    Outlines the design, objectives, and evaluation of an introductory Internet workshop offered with library instruction classes in an electronic classroom at Queens University (Kingston, Ontario, Canada). Presents teaching tips and frequently-asked questions. The Internet primer handouts are appended. (AEF)

  13. Theme: A Primer for Agricultural Education.

    ERIC Educational Resources Information Center

    Vaughn, Paul, Ed.; And Others

    1998-01-01

    Includes "A Primer for Agricultural Education" (Vaughn); "What Are the Goals and Purposes of Ag Ed?" (Case, Whitaker); "Basics of Supervised Experience" (Lee); "The FFA [Future Farmers of America]: Why Do We Have It?" (Case, Whitaker); "The Council: Providing Visionary Leadership" (Daniel, Vaughn); "Ag Communications" (Lockaby, Vernon); and…

  14. A Primer on Simulation and Gaming.

    ERIC Educational Resources Information Center

    Barton, Richard F.

    In a primer intended for the administrative professions, for the behavioral sciences, and for education, simulation and its various aspects are defined, illustrated, and explained. Man-model simulation, man-computer simulation, all-computer simulation, and analysis are discussed as techniques for studying object systems (parts of the "real…

  15. Forest Interpreter's Primer on Fire Management.

    ERIC Educational Resources Information Center

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  16. Issues Primer. EEE708 Negotiated Study Program.

    ERIC Educational Resources Information Center

    Jennings, Leonie

    This issues primer is structured around a series of 20 contemporary concerns in the changing world of work and training in Australia in the early 1990s. It is part of the study materials for the one-semester distance education unit, Negotiated Study Program, in the Open Campus Program at Deakin University (Australia). Information on each issue is…

  17. Genomospecies identification and phylogenomic relevance of AFLP analysis of isolated and non-isolated strains of Frankia spp.

    PubMed

    Bautista, G H H; Cruz, H A; Nesme, X; Valdés, M; Mendoza, H A; Fernandez, M P

    2011-05-01

    Amplified fragment length polymorphism (AFLP) was tested as an alternative to the DNA-DNA hybridization technique (DDH) to delineate genomospecies and the phylogenetic structure within the genus Frankia. Forty Frankia strains, including representatives of seven DDH genomospecies, were typed in order to infer current genome mispairing (CGM) and evolutionary genomic distance (EGD). The constructed phylogeny revealed the presence of three main clusters corresponding to the previously identified host-infecting groups. In all instances, strains previously assigned to the same genomospecies were grouped in coherent clusters. A highly significant correlation was found between DDH values and CGM computed from AFLP data. The species definition threshold was found to range from 0.071 to 0.098 mismatches per site, according to host-infecting groups, presumably as a result of large genome size differences. Genomic distances allowed new Frankia strains to be assigned to nine genomospecies previously determined by DDH. The applicability of AFLP for the characterization of uncultured endophytic strains was tested on experimentally inoculated plants and then applied to Alnus incana and A. viridis field nodules hosting culture refractory spore-positive (Sp+, that sporulate in planta) strains. Only 1.3% of all AFLP fragments were shown to be generated by the contaminant plant DNA and did not interfere with accurate genomospecies identification of strains. When applied to field nodules, the procedure revealed that Alnus Sp+ strains were bona fide members of the Alnus-Myrica host infecting group. They displayed significant genomic divergence from genomospecies G1 of Alnus infecting strains (i.e. Frankia alni) and thus may belong to another subspecies or genomospecies.

  18. Genomospecies identification and phylogenomic relevance of AFLP analysis of isolated and non-isolated strains of Frankia spp.

    PubMed

    Bautista, G H H; Cruz, H A; Nesme, X; Valdés, M; Mendoza, H A; Fernandez, M P

    2011-05-01

    Amplified fragment length polymorphism (AFLP) was tested as an alternative to the DNA-DNA hybridization technique (DDH) to delineate genomospecies and the phylogenetic structure within the genus Frankia. Forty Frankia strains, including representatives of seven DDH genomospecies, were typed in order to infer current genome mispairing (CGM) and evolutionary genomic distance (EGD). The constructed phylogeny revealed the presence of three main clusters corresponding to the previously identified host-infecting groups. In all instances, strains previously assigned to the same genomospecies were grouped in coherent clusters. A highly significant correlation was found between DDH values and CGM computed from AFLP data. The species definition threshold was found to range from 0.071 to 0.098 mismatches per site, according to host-infecting groups, presumably as a result of large genome size differences. Genomic distances allowed new Frankia strains to be assigned to nine genomospecies previously determined by DDH. The applicability of AFLP for the characterization of uncultured endophytic strains was tested on experimentally inoculated plants and then applied to Alnus incana and A. viridis field nodules hosting culture refractory spore-positive (Sp+, that sporulate in planta) strains. Only 1.3% of all AFLP fragments were shown to be generated by the contaminant plant DNA and did not interfere with accurate genomospecies identification of strains. When applied to field nodules, the procedure revealed that Alnus Sp+ strains were bona fide members of the Alnus-Myrica host infecting group. They displayed significant genomic divergence from genomospecies G1 of Alnus infecting strains (i.e. Frankia alni) and thus may belong to another subspecies or genomospecies. PMID:21310572

  19. Pairing forces in nuclei

    SciTech Connect

    Chasman, R.R.

    1996-12-31

    In this contribution, the author mentions some features of pairing forces that are unique to nuclei and cover some areas of major interest in nuclear structure research, that involve pairing. At the level of most nuclear structure studies, nuclei are treated as consisting of two kinds of fermions (protons and neutrons) in a valence space with rather few levels. These features give rise to unique aspects of pairing forces in nuclei: (1) n-p pairing in T = 0 as well as the usual T = 1 pairing that is characteristic of like fermions; (2) a need to correct pairing calculations for the (1/N) effects that can typically be neglected in superconducting solids. An issue of current concern is the nature of the pairing interaction: several recent studies suggest a need for a density dependent form of the pairing interaction. There is a good deal of feedback between the questions of accurate calculations of pairing interactions and the form and magnitude of the pairing interaction. Finally, the authors discuss some many-body wave functions that are a generalization of the BCS wave function form, and apply them to a calculation of energy level spacings in superdeformed rotational bands.

  20. Evaluation of new primers for CSF1PO.

    PubMed

    Yoshida, K; Sekiguchi, K; Kasai, K; Sato, H; Seta, S; Sensabaugh, G F

    1997-01-01

    We describe new primers for the detection of the STR polymorphism at the CSF1PO locus. These primers have been designed to produce shorter amplicons (150-182 bp) than the primers in standard use (295-327 bp). The reliability of the new primers for CSF1PO typing has been demonstrated by testing on known samples and by sequence analysis. These primers are superior to the original primers with regard to electrophoretic resolution and utility for typing of severely degraded DNA.

  1. Rust transformation/rust compatible primers

    NASA Technical Reports Server (NTRS)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  2. Analysis of genetic variation within clonal lineages of grape phylloxera (Daktulosphaira vitifoliae Fitch) using AFLP fingerprinting and DNA sequencing.

    PubMed

    Vorwerk, S; Forneck, A

    2007-07-01

    Two AFLP fingerprinting methods were employed to estimate the potential of AFLP fingerprints for the detection of genetic diversity within single founder lineages of grape phylloxera (Daktulosphaira vitifoliae Fitch). Eight clonal lineages, reared under controlled conditions in a greenhouse and reproducing asexually throughout a minimum of 15 generations, were monitored and mutations were scored as polymorphisms between the founder individual and individuals of succeeding generations. Genetic variation was detected within all lineages, from early generations on. Six to 15 polymorphic loci (from a total of 141 loci) were detected within the lineages, making up 4.3% of the total amount of genetic variation. The presence of contaminating extra-genomic sequences (e.g., viral material, bacteria, or ingested chloroplast DNA) was excluded as a source of intraclonal variation. Sequencing of 37 selected polymorphic bands confirmed their origin in mostly noncoding regions of the grape phylloxera genome. AFLP techniques were revealed to be powerful for the identification of reproducible banding patterns within clonal lineages.

  3. Characterization of AFLP Sequences From Regions of Maize B Chromosome Defined by 12 B-10L Translocations

    PubMed Central

    Peng, Shu-Fen; Lin, Yao-Pin; Lin, Bor-yaw

    2005-01-01

    Maize B chromosome sequences have been previously cloned by microdissection, and all are proven to be highly repetitive, to be homologous to the normal complement, and to show no similarity to any published gene other than mobile elements. In this study, we isolated sequences from defined B regions. The strategy involved identification and then mapping of AFLP-derived B fragments before cloning. Of 14 B AFLPs, 13 were mapped by 12 B-10L translocations: 3 around the centromeric knob region, 3 in the proximal euchromatic, 1 around the border of proximal euchromatic and distal heterochromatic, and 6 in the distal heterochromatic region of the B long arm. The AFLP fragments were cloned and sequenced. Analogous to the microdissected sequences, all sequences were repetitive, and all but two were highly homologous to the A chromosomes. FISH signals of all but three clones appeared in pachytene B as well as in somatic A and B chromosomes. None of these clones exhibits identity to any published gene. Six clones displayed homology to two centromeric BACs, four to sequences of chromosomes 3, 4, 7, and 10, four to retrotransposons, and three to no sequence deposited in GenBank. Furthermore, flanking regions of two highly B-specific clones were characterized, showing extension of a B-exclusive nature. The possibility of the presence of novel B repeat(s) is discussed. PMID:15489531

  4. Outgroup effects on root position and tree topology in the AFLP phylogeny of a rapidly radiating lineage of cichlid fish☆

    PubMed Central

    Kirchberger, Paul C.; Sefc, Kristina M.; Sturmbauer, Christian; Koblmüller, Stephan

    2014-01-01

    Phylogenetic analyses of rapid radiations are particularly challenging as short basal branches and incomplete lineage sorting complicate phylogenetic inference. Multilocus data of presence-absence polymorphisms such as obtained by AFLP genotyping overcome some of the difficulties, but also present their own intricacies. Here we analyze >1000 AFLP markers to address the evolutionary history of the Limnochromini, a cichlid fish lineage endemic to Lake Tanganyika, and to test for potential effects of outgroup composition on tree topology. The data support previous mitochondrial evidence on the tribe’s taxonomy by confirming the polyphyly of the genus Limnochromis and – in contradiction to a recent taxonomic revision – nesting the genus Greenwoodochromis within the Limnochromini. Species relationships suggest that ecological segregation occurred during the rapid basal radiation of the Limnochromini. The large phylogenetic distance between candidate outgroup taxa and the Limnochromini radiation caused random outgroup effects. Bootstrap support for ingroup nodes was lower in outgroup-rooted than in midpoint-rooted trees, and root positions and ingroup tree topologies varied in response to the composition of the outgroup. These observations suggest that the predisposition for homoplastic evolution makes AFLP-based phylogenetic analyses particularly susceptible to random biases introduced by too-distant outgroup taxa. PMID:24055738

  5. [Genetic diversity of ancient tea gardens and tableland tea gardens from Yunnan Province as revealed by AFLP marker].

    PubMed

    Ji, Peng-Zhang; Jiang, Hui-Bing; Huang, Xing-Qi; Zhang, Jun; Liang, Min-Zhi; Wang, Ping-Sheng

    2009-01-01

    This study was conducted to evaluate the genetic diversity within and among the plants of four ancient tea gardens and two tableland tea gardens form Yunnan Province, China by AFLP technique. The percentage of polymorphic loci (P) of the plants from six tea gardens was 92.31%. The genetic diversity within the six gardens demonstrated by Nei cents genetic diversity (He) was estimated to be 0.1366, while Shannon indices (Ho) were 0.2323. The percentage of polymorphic loci of the four ancient tea populations was 45.55% on average, with a range of 36.44% (Mengsong) to 59.11% (Mengla). But the percentages of polymorphic loci of the plants from two tableland gardens were 13.77% (Yunkang 10) and 24.2% (Menghai Daye), respectively. There was a great genetic difference between ancient tea gardens and tableland tea gardens. The genetic diversity among the plants of the ancient tea garden was higher than those of the sexual tableland tea garden and the clone tableland tea garden based on P valve. The four ancient tea gardens and two tableland gardens could be differentiated with AFLP markers. The results show that AFLP marker is an effective tool in the discrimination of tea germplasm, as well as sundried green tea.

  6. Matched-pair classification

    SciTech Connect

    Theiler, James P

    2009-01-01

    Following an analogous distinction in statistical hypothesis testing, we investigate variants of machine learning where the training set comes in matched pairs. We demonstrate that even conventional classifiers can exhibit improved performance when the input data has a matched-pair structure. Online algorithms, in particular, converge quicker when the data is presented in pairs. In some scenarios (such as the weak signal detection problem), matched pairs can be generated from independent samples, with the effect not only doubling the nominal size of the training set, but of providing the structure that leads to better learning. A family of 'dipole' algorithms is introduced that explicitly takes advantage of matched-pair structure in the input data and leads to further performance gains. Finally, we illustrate the application of matched-pair learning to chemical plume detection in hyperspectral imagery.

  7. Paired watershed study design

    SciTech Connect

    Clausen, J.C.; Spooner, J.

    1993-09-01

    The purpose of the fact sheet is to describe the paired watershed approach for conducting nonpoint source (NPS) water quality studies. The basic approach requires a minimum of two watersheds - control and treatment - and two periods of study - calibration and treatment. The basis of the paired watershed approach is that there is a quantifiable relationship between paired water quality data for the two watersheds, and that this relationship is valid until a major change is made in one of the watersheds.

  8. Linear-After-The-Exponential (LATE)-PCR: primer design criteria for high yields of specific single-stranded DNA and improved real-time detection.

    PubMed

    Pierce, Kenneth E; Sanchez, J Aquiles; Rice, John E; Wangh, Lawrence J

    2005-06-14

    Traditional asymmetric PCR uses conventional PCR primers at unequal concentrations to generate single-stranded DNA. This method, however, is difficult to optimize, often inefficient, and tends to promote nonspecific amplification. An alternative approach, Linear-After-The-Exponential (LATE)-PCR, solves these problems by using primer pairs deliberately designed for use at unequal concentrations. The present report systematically examines the primer design parameters that affect the exponential and linear phases of LATE-PCR amplification. In particular, we investigated how altering the concentration-adjusted melting temperature (Tm) of the limiting primer (TmL) relative to that of the excess primer (TmX) affects both amplification efficiency and specificity during the exponential phase of LATE-PCR. The highest reaction efficiency and specificity were observed when TmL - TmX 5 degrees C. We also investigated how altering TmX relative to the higher Tm of the double-stranded amplicon (TmA) affects the rate and extent of linear amplification. Excess primers with TmX closer to TmA yielded higher rates of linear amplification and stronger signals from a hybridization probe. These design criteria maximize the yield of specific single-stranded DNA products and make LATE-PCR more robust and easier to implement. The conclusions were validated by using primer pairs that amplify sequences within the cystic fibrosis transmembrane regulator (CFTR) gene, mutations of which are responsible for cystic fibrosis.

  9. Vortex pairs on surfaces

    SciTech Connect

    Koiller, Jair

    2009-05-06

    A pair of infinitesimally close opposite vortices moving on a curved surface moves along a geodesic, according to a conjecture by Kimura. We outline a proof. Numerical simulations are presented for a pair of opposite vortices at a close but nonzero distance on a surface of revolution, the catenoid. We conjecture that the vortex pair system on a triaxial ellipsoid is a KAM perturbation of Jacobi's geodesic problem. We outline some preliminary calculations required for this study. Finding the surfaces for which the vortex pair system is integrable is in order.

  10. Pairing Beyond BCS

    NASA Astrophysics Data System (ADS)

    Volya, Alexander; Zelevinsky, Vladimir

    2013-01-01

    We concentrate on the specifics of the nuclear pairing problem from the standpoint of the BCS approach. We consider the properties of nuclear pairing which usually are not discussed in standard texts: how good is the BCS theory in nuclear context compared to the exact large-scale diagonalization, whether it can be improved by the particle number conservation, how to mark the phase transition regions in a mesoscopic system like a nucleus, how may effective many-body forces influence the formation and structure of the pairing condensate, what effect the decay instability has on the paired nuclear structure, etc.

  11. Amplification of GB virus-C/hepatitis G virus RNA with primers from different regions of the viral genome.

    PubMed

    Kao, J H; Chen, P J; Chen, W; Hsiang, S C; Lai, M Y; Chen, D S

    1997-04-01

    GB virus-C/hepatitis G virus (GBV-C/HGV) is a newly identified RNA virus. The aim of the study was to compare three primer pairs from the 5' untranslated region (5'UTR), envelope region 2 (E 2) and nonstructural region 3 (NS 3) of GBV-C/HGV genome for their ability to detect GBV-C/HGV RNA by polymerase chain reaction (PCR) assays. By using PCR with primers from different regions of the viral genome, serum GBV-C/HGV RNA was assayed in 200 at-risk individuals. The sensitivity of this assay was assessed by a titration experiment, and nucleotide sequences of the amplified products were determined directly. Of 200 serum samples, 43 (21.5%) were positive for GBV-C/HGV RNA with at least one of the primer pairs. The positive rates by 5'UTR, NS 3, and E 2 primers were 100%, 98%, and 84%, respectively, and the sensitivity of PCR assays using 5'UTR primers was 10 to 100 times more likely to detect GBV-C/HGV RNA than that of NS 3 and E 2 primers. The average homology of amplified targets to the prototype HGV genome was 89%, 80%, and 85% and the similarity between each amplified target was up to 100%, 90%, and 92% in the 5'UTR, E 2, and NS 3 regions, respectively. Therefore, the 5'UTR of GBV-C/HGV genome is highly conserved and primers deduced from this region can provideva sensitive and specific PCR assay for GBV-C/HGV RNA.

  12. Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

    PubMed

    Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

    2009-10-28

    GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.

  13. Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

    PubMed

    Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

    2009-10-28

    GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree. PMID:19778057

  14. New primers for adhesive bonding of aluminum alloys

    NASA Technical Reports Server (NTRS)

    Burrell, B. W.; Port, W. S.

    1971-01-01

    Synthetic polypeptide adhesive primers are effective, with high temperature epoxy resins, at temperatures from 100 deg to 300 deg C. Lap-shear failure loads and lap-shear strength of both primers are discussed.

  15. Microsatellite primers resource developed from the mapped sequence scaffolds of Nisqually-1 genome. Submitted to New Phytologist

    SciTech Connect

    Yin, Tongming; ZHANG, Dr. XINYE; Gunter, Lee E; Li, Shuxian; Wullschleger, Stan D; Huang, Prof. Minren; Tuskan, Gerald A

    2009-01-01

    In this study, 148 428 simple sequence repeat (SSR) primer pairs were designed from the unambiguously mapped sequence scaffolds of the Nisqually-1 genome. The physical position of the priming sites were identified along each of the 19 Populus chromosomes, and it was specified whether the priming sequences belong to intronic, intergenic, exonic or UTR regions. A subset of 150 SSR loci were amplified and a high amplification success rate (72%) was obtained in P. tremuloides, which belongs to a divergent subgenus of Populus relative to Nisqually-1. PCR reactions showed that the amplification success rate of exonic primer pairs was much higher than that of the intronic/intergenic primer pairs. Applying ANOVA and regression analyses to the flanking sequences of microsatellites, the repeat lengths, the GC contents of the repeats, the repeat motif numbers, the repeat motif length and the base composition of the repeat motif, it was determined that only the base composition of the repeat motif and the repeat motif length significantly affect the microsatellite variability in P. tremuloides samples. The SSR primer resource developed in this study provides a database for selecting highly transferable SSR markers with known physical position in the Populus genome and provides a comprehensive genetic tool to extend the genome sequence of Nisqually-1 to genetic studies in different Populus species.

  16. The Interaction between tRNALys3 and the Primer Activation Signal Deciphered by NMR Spectroscopy

    PubMed Central

    Brachet, Franck; Tisne, Carine

    2013-01-01

    The initiation of reverse transcription of the human immunodeficiency virus type 1 (HIV-1) requires the opening of the three-dimensional structure of the primer tRNALys3 for its annealing to the viral RNA at the primer binding site (PBS). Despite the fact that the result of this rearrangement is thermodynamically more stable, there is a high-energy barrier that requires the chaperoning activity of the viral nucleocapsid protein. In addition to the nucleotide complementarity to the PBS, several regions of tRNALys3 have been described as interacting with the viral genomic RNA. Among these sequences, a sequence of the viral genome called PAS for “primer activation signal” was proposed to interact with the T-arm of tRNALys3, this interaction stimulating the initiation of reverse transcription. In this report, we investigate the formation of this additional interaction with NMR spectroscopy, using a simple system composed of the primer tRNALys3, the 18 nucleotides of the PBS, the PAS (8 nucleotides) encompassed or not in a hairpin structure, and the nucleocapsid protein. Our NMR study provides molecular evidence of the existence of this interaction and highlights the role of the nucleocapsid protein in promoting this additional RNA-RNA annealing. This study presents the first direct observation at a single base-pair resolution of the PAS/anti-PAS association, which has been proposed to be involved in the chronological regulation of the reverse transcription. PMID:23762248

  17. Helicobacter pylori in dental plaque: a comparison of different PCR primer sets.

    PubMed

    Song, Q; Haller, B; Schmid, R M; Adler, G; Bode, G

    1999-03-01

    This study was designed to compare different primer sets for PCR analysis of H. pylori in the same series of 40 dental plaque samples. Three pairs of primers, HPU1/HPU2, HP1/HP2, and EHC-U/EHC-L, directed to the urease A gene, 16S rRNA gene, or 860-bp DNA of H. pylori, respectively, were used. Our results demonstrate that EHC-L/EHC-U were more specific and sensitive for H. pylori added to saliva or dental plaque than HPU1/HPU2 and HP1/HP2. The detection rates for H. pylori DNA in dental plaque samples from randomly selected adult patients from the Dental Clinic of the University of Ulm were 26.5% (9/34) for HPU1/HPU2, 78.9% (30/38) for HP1/HP2, and 100% (40/40) for EHC-U/EHC-L (P < 0.001). Nested PCR using primers directed to the 860-bp DNA of H. pylori further confirmed the presence of H. pylori DNA (40/40) in all these samples. Our results indicate that primers EHC-U/EHC-L are to be recommended for PCR detection of H. pylori in the oral cavity.

  18. A new set of primers for the detection of Toxoplasma gondii in amniotic fluid using polymerase chain reaction.

    PubMed

    Pelloux, H; Weiss, J; Simon, J; Muet, F; Fricker-Hidalgo, H; Goullier-Fleuret, A; Ambroise-Thomas, P

    1996-04-15

    A new PCR system including a pair of primers, a probe and an internal control were designed from the B1 gene of Toxoplasma gondii. The system described allowed the detection of less than 10 tachyzoites of the RH strain of T. gondii. Among 21 amniotic fluid samples, this system diagnosed the cases of congenital toxoplasmosis which were simultaneously diagnosed using mice inoculation, in vitro culture, and serology from both amniotic fluid and fetal blood. These results show that these new primers allow for a highly sensitive detection of T. gondii DNA.

  19. AFLPs Reveal Different Population Genetic Structure under Contrasting Environments in the Marine Snail Nucella lapillus L.

    PubMed Central

    Carro, Belén; Quintela, María; Ruiz, José Miguel; Barreiro, Rodolfo

    2012-01-01

    Dispersal has received growing attention in marine ecology, particularly since evidence obtained with up-to-date techniques challenged the traditional view. The dogwhelk Nucella lapillus L., a sedentary gastropod with direct development, is a good example: dispersal was traditionally assumed to be limited until studies with microsatellites disputed this idea. To shed some light on this controversy, the genetic structure of dogwhelk populations in northwest Spain was investigated with highly polymorphic AFLP markers giving special attention to the influence of hydrodynamic stress. In agreement with the expectations for a poor disperser, our results show a significant genetic structure at regional (<200 km) and areal scales (<15 km). However, the spatial genetic structure varied with wave-exposure in the present case study: IBD was evident under sheltered conditions but absent from the exposed area where genetic differentiation was stronger. Our results provide evidence that differences in wave-exposure can exert a detectable influence on the genetic structure of coastal organisms, even in species without a planktonic larva. PMID:23185435

  20. Genetic differentiation of Euterpe edulis Mart. populations estimated by AFLP analysis.

    PubMed

    Cardoso, S R; Eloy, N B; Provan, J; Cardoso, M A; Ferreira, P C

    2000-11-01

    Heart-of-palm (Euterpe edulis Mart.) is a wild palm with a wide distribution throughout the Atlantic Rainforest. Populations of E. edulis represent important renewable natural resources but are currently under threat from predatory exploitation. Furthermore, because the species is indigenous to the Atlantic Rainforest, which is located in the most economically developed and populated region of Brazil, social and economic pressures have devastated heart-of-palm forests. In order to estimate the partitioning of genetic variation of endangered E. edulis populations, 429 AFLP markers were used to analyse 150 plants representing 11 populations of the species distribution range. Analysis of the genetic structure of populations carried out using analysis of molecular variance (AMOVA) revealed moderate genetic variation within populations (57. 4%). Genetic differentiation between populations (FST = 0.426) was positively correlated with geographical distance. These results could be explained by the historical fragmentation of the Atlantic coastal region, together with the life cycle and mating system. The data obtained in this work should have important implications for conservation and future breeding programmes of E. edulis. PMID:11091311

  1. Genetic Variability and Population Structure of Disanthus cercidifolius subsp. longipes (Hamamelidaceae) Based on AFLP Analysis

    PubMed Central

    Yu, Yi; Fan, Qiang; Shen, Rujiang; Guo, Wei; Jin, Jianhua; Cui, Dafang; Liao, Wenbo

    2014-01-01

    Disanthus cercidifolius subsp. longipes is an endangered species in China. Genetic diversity and structure analysis of this species was investigated using amplified fragments length polymorphism (AFLP) fingerprinting. Nei's gene diversity ranged from 0.1290 to 0.1394. The AMOVA indicated that 75.06% of variation was distributed within populations, while the between-group component 5.04% was smaller than the between populations-within-group component 19.90%. Significant genetic differentiation was detected between populations. Genetic and geographical distances were not correlated. PCA and genetic structure analysis showed that populations from East China were together with those of the Nanling Range. These patterns of genetic diversity and levels of genetic variation may be the result of D. c. subsp. longipes restricted to several isolated habitats and “excess flowers production, but little fruit set”. It is necessary to protect all existing populations of D. c. subsp. longipes in order to preserve as much genetic variation as possible. PMID:25250583

  2. Pair contact process with diffusion of pairs

    NASA Astrophysics Data System (ADS)

    Santos, F. L.; Dickman, Ronald; Fulco, U. L.

    2011-03-01

    The pair contact process (PCP) is a nonequilibrium stochastic model which, like the basic contact process (CP), exhibits a phase transition to an absorbing state. The two models belong to the directed percolation (DP) universality class, despite the fact that the PCP possesses infinitely many absorbing configurations whereas the CP has but one. The critical behavior of the PCP with hopping by particles (PCPD) is as yet unclear. Here we study a version of the PCP in which nearest-neighbor particle pairs can hop but individual particles cannot. Using quasistationary simulations for three values of the diffusion probability (D = 0.1, 0.5 and 0.9), we find convincing evidence of DP-like critical behavior.

  3. Diversity of Methane-Cycling Archaea in Hydrothermal Sediment Investigated by General and Group-Specific PCR Primers

    PubMed Central

    Teske, Andreas P.

    2014-01-01

    The zonation of anaerobic methane-cycling Archaea in hydrothermal sediment of Guaymas Basin was studied by general primer pairs (mcrI, ME1/ME2, mcrIRD) targeting the alpha subunit of methyl coenzyme M reductase gene (mcrA) and by new group-specific mcrA and 16S rRNA gene primer pairs. The mcrIRD primer pair outperformed the other general mcrA primer pairs in detection sensitivity and phylogenetic coverage. Methanotrophic ANME-1 Archaea were the only group detected with group-specific primers only. The detection of 14 mcrA lineages surpasses the diversity previously found in this location. Most phylotypes have high sequence similarities to hydrogenotrophs, methylotrophs, and anaerobic methanotrophs previously detected at Guaymas Basin or at hydrothermal vents, cold seeps, and oil reservoirs worldwide. Additionally, five mcrA phylotypes belonging to newly defined lineages are detected. Two of these belong to deeply branching new orders, while the others are new species or genera of Methanopyraceae and Methermicoccaceae. Downcore diversity decreases from all groups detected in the upper 6 cm (∼2 to 40°C, sulfate measurable to 4 cm) to only two groups below 6 cm (>40°C). Despite the presence of hyperthermophilic genera (Methanopyrus, Methanocaldococcus) in cooler surface strata, no genes were detected below 10 cm (≥60°C). While mcrA-based and 16S rRNA gene-based community compositions are generally congruent, the deeply branching mcrA cannot be assigned to specific 16S rRNA gene lineages. Our study indicates that even among well-studied metabolic groups and in previously characterized model environments, major evolutionary branches are overlooked. Detecting these groups by improved molecular biological methods is a crucial first step toward understanding their roles in nature. PMID:25527539

  4. Secondary structure of the HIV-2 leader RNA comprising the tRNA-primer binding site.

    PubMed Central

    Berkhout, B; Schoneveld, I

    1993-01-01

    The initiation of reverse transcription of a retroviral RNA genome occurs by a tRNA primer bound near the 5' end of the genomic RNA at a position called the primer-binding site (PBS). To understand the molecular basis for this RNA-RNA interaction, the secondary structure of the leader RNA of the human immunodeficiency virus type 2 (HIV-2) RNA was analyzed. In vitro synthesized HIV-2 RNA was probed with various structure-specific enzymes and chemicals. A computer program was then used to predict the secondary structure consistent with these data. In addition, the nucleotide sequences of different HIV-2 isolates were used to screen for the occurrence of covariation among putative base pairs. The primary sequences have diverged rapidly in some HIV-2 isolates, however, some strikingly conserved secondary structure elements were identified. Most nucleotides in the leader region are involved in base pairing. An exception is the PBS sequence, of which 15 out of 18 nucleotides are exposed in an internal loop. These findings suggest that the overall structure of the HIV-2 genome has evolved to facilitate an optimal interaction with its tRNA primer. Images PMID:8464701

  5. Cooper Pairs in Insulators?!

    SciTech Connect

    James Valles

    2008-07-23

    Nearly 50 years elapsed between the discovery of superconductivity and the emergence of the microscopic theory describing this zero resistance state. The explanation required a novel phase of matter in which conduction electrons joined in weakly bound pairs and condensed with other pairs into a single quantum state. Surprisingly, this Cooper pair formation has also been invoked to account for recently uncovered high-resistance or insulating phases of matter. To address this possibility, we have used nanotechnology to create an insulating system that we can probe directly for Cooper pairs. I will present the evidence that Cooper pairs exist and dominate the electrical transport in these insulators and I will discuss how these findings provide new insight into superconductor to insulator quantum phase transitions. 

  6. Critical Schwinger Pair Production.

    PubMed

    Gies, Holger; Torgrimsson, Greger

    2016-03-01

    We investigate Schwinger pair production in spatially inhomogeneous electric backgrounds. A critical point for the onset of pair production can be approached by fields that marginally provide sufficient electrostatic energy for an off-shell long-range electron-positron fluctuation to become a real pair. Close to this critical point, we observe features of universality which are analogous to continuous phase transitions in critical phenomena with the pair-production rate serving as an order parameter: electric backgrounds can be subdivided into universality classes and the onset of pair production exhibits characteristic scaling laws. An appropriate design of the electric background field can interpolate between power-law scaling, essential Berezinskii-Kosterlitz-Thouless-type scaling, and a power-law scaling with log corrections. The corresponding critical exponents only depend on the large-scale features of the electric background, whereas the microscopic details of the background play the role of irrelevant perturbations not affecting criticality. PMID:26991162

  7. Cooper Pairs in Insulators?!

    ScienceCinema

    James Valles

    2016-07-12

    Nearly 50 years elapsed between the discovery of superconductivity and the emergence of the microscopic theory describing this zero resistance state. The explanation required a novel phase of matter in which conduction electrons joined in weakly bound pairs and condensed with other pairs into a single quantum state. Surprisingly, this Cooper pair formation has also been invoked to account for recently uncovered high-resistance or insulating phases of matter. To address this possibility, we have used nanotechnology to create an insulating system that we can probe directly for Cooper pairs. I will present the evidence that Cooper pairs exist and dominate the electrical transport in these insulators and I will discuss how these findings provide new insight into superconductor to insulator quantum phase transitions. 

  8. A primer for criticality calculations with DANTSYS

    SciTech Connect

    Busch, R.D.

    1997-08-01

    With the closure of many experimental facilities, the nuclear safety analyst has to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. Although deterministic methods often do not provide exact models of a system, a substantial amount of reliable information on nuclear systems can be obtained using these methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico (UNM) in cooperation with the Radiation Transport Group at Los Alamos National Laboratory (LANL) has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. DANTSYS is the new name of the group of codes formerly known as: ONEDANT, TWODANT, TWOHEX, TWOGQ, and THREEDANT. The primer is designed to teach bu example, with each example illustrating two or three DANTSYS features useful in criticality analyses. Starting with a Quickstart chapter, the primer gives an overview of the basic requirements for DANTSYS input and allows the user to quickly run a simple criticality problem with DANTSYS. Each chapter has a list of basic objectives at the beginning identifying the goal of the chapter and the individual DANTSYS features covered in detail in the chapter example problems. On completion of the primer, it is expected that the user will be comfortable doing criticality calculations with DANTSYS and can handle 60--80% of the situations that normally arise in a facility. The primary provides a set of input files that can be selective modified by the user to fit each particular problem.

  9. PCR primer pairs for 100 microsatellites in red drum (Sciaenops ocellatus)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    One hundred nuclear-encoded microsatellites from a genomic DNA library of red drum (Sciaenops ocellatus) were isolated and characterized. Eight of the microsatellites had tetra-nucleotide motifs, while 92 had di-nucleotide motifs. The average number of alleles at the 100 microsatellites among a sa...

  10. ISOLATE SPECIFIC DETECTION OF MYCORRHIZAL FUNGI USING GENOME SPECIFIC PRIMER PAIRS. (R825549C047)

    EPA Science Inventory

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  11. cDNA-AFLP analysis on bolting or flowering of flowering Chinese cabbage and molecular characteristics of BrcuDFR-like/BrcuAXS gene.

    PubMed

    Xiao, Xufeng; Lei, Jianjun; Cao, Bihao; Chen, Guoju; Chen, Changming

    2012-07-01

    The molecular basis of flower bud differentiation in flowering Chinese cabbage (Brassica rapa L. ssp. Chinensis var. utilis Tsen et Lee) was studied in this work. Samples were taken from two varieties, the early-blooming "Youqin 49" and the late-blooming "Youqingtiancaixin 80", at five different developmental stages and studied via cDNA-AFLP. Nineteen expression sequence tags (ESTs) associated with bolting or flowering were isolated and cloned. Blast results indicated that 15 ESTs were involved in the synthesis of anthocayanins, photosynthesis, signal transduction, and phytochrome production. Two ESTs had high similarity to hypothetical proteins with unknown function. Two other ESTs shared no similarity to any sequence in the NCBI database and potentially may be newly identified genes. The deduced amino acid sequences of EST amplified by primer A6T4 or A8T4 had high similarity to both dihydroflavonol reductase (DFR) and UDP-D: -apiose/UDP-D: -xylose synthase (AXS), thus was named BrcuDFR-like/BrcuAXS. Using the cDNA sequence, a putative BrcuDFR-like/BrcuAXS gene was cloned and characterized from flowering Chinese cabbage via rapid amplification of cDNA ends (RACE). The full-length cDNA has 1332 bp with an open frame of 919 bp which codes for a polypeptide of 313 amino acids. The corresponding genome sequence is 2,046 bp. Comparison of cDNA and its corresponding genomic sequence indicates that BrcuDFR-like/BrcuAXS contains 9 exons and 8 introns. The temporal expression patterns indicated the gene is more likely to encode the DFR protein, which catalyzes the synthesis of anthocayanins, than UDP-D: -apiose/UDP-D: -xylose synthase (AXS), which catalyzes the conversion of UDP-D: -glucuronate to a mixture of UDP-D: -apiose and UDP-D: -xylose. Further work is needed to determine what role BrcuDFR-like/BrcuAXS plays during floral organ development.

  12. An AFLP marker tightly linked to apomixis reveals hemizygosity in a portion of the apomixis-controlling locus in Paspalum simplex.

    PubMed

    Labombarda, Paola; Busti, Alessandra; Caceres, Maria Eugenia; Pupilli, Fulvio; Arcioni, Sergio

    2002-06-01

    A mapping population of Paspalum simplex segregating for apomixis (asexual reproduction through seeds) was screened with AFLPs to find apomixis-linked markers. Four AFLPs linked to apomixis in coupling phase were found. Three of them did not show recombinants among the 87 individuals of the mapping population, whereas the other was more loosely linked. Integrating the AFLP data with those obtained previously with rice RFLP anchor markers, a map was drawn for the chromosome region of P. simplex encompassing apomixis. We cloned the three AFLPs tightly linked with apomixis into plasmid vectors and used them as probes to hybridize the restriction digested DNA of the mapping population. Two of them revealed RFLP bands linked to apomixis together with other alleles, whereas one was proven to belong to a hemizygous portion of the apomixis locus. The total picture resulting from AFLP and RFLP analyses was that a cluster of markers tightly linked with apomixis was detected in P simplex together with two other markers that were more loosely linked. These two markers enclosed a relatively large chromosome segment characterized by strong repression of recombination. The block of recombination may have caused sequence divergence and, therefore, hemizygosity of some regions belonging to the apomixis-controlling chromosome segment of P. simplex. The potential of developing an apomixis-specific sequence for screening large-fragment libraries for the physical isolation of the locus encompassing apomixis is discussed.

  13. Electron pairing without superconductivity.

    PubMed

    Cheng, Guanglei; Tomczyk, Michelle; Lu, Shicheng; Veazey, Joshua P; Huang, Mengchen; Irvin, Patrick; Ryu, Sangwoo; Lee, Hyungwoo; Eom, Chang-Beom; Hellberg, C Stephen; Levy, Jeremy

    2015-05-14

    Strontium titanate (SrTiO3) is the first and best known superconducting semiconductor. It exhibits an extremely low carrier density threshold for superconductivity, and possesses a phase diagram similar to that of high-temperature superconductors--two factors that suggest an unconventional pairing mechanism. Despite sustained interest for 50 years, direct experimental insight into the nature of electron pairing in SrTiO3 has remained elusive. Here we perform transport experiments with nanowire-based single-electron transistors at the interface between SrTiO3 and a thin layer of lanthanum aluminate, LaAlO3. Electrostatic gating reveals a series of two-electron conductance resonances-paired electron states--that bifurcate above a critical pairing field Bp of about 1-4 tesla, an order of magnitude larger than the superconducting critical magnetic field. For magnetic fields below Bp, these resonances are insensitive to the applied magnetic field; for fields in excess of Bp, the resonances exhibit a linear Zeeman-like energy splitting. Electron pairing is stable at temperatures as high as 900 millikelvin, well above the superconducting transition temperature (about 300 millikelvin). These experiments demonstrate the existence of a robust electronic phase in which electrons pair without forming a superconducting state. Key experimental signatures are captured by a model involving an attractive Hubbard interaction that describes real-space electron pairing as a precursor to superconductivity. PMID:25971511

  14. Electron pairing without superconductivity

    NASA Astrophysics Data System (ADS)

    Levy, Jeremy

    Strontium titanate (SrTiO3) is the first and best known superconducting semiconductor. It exhibits an extremely low carrier density threshold for superconductivity, and possesses a phase diagram similar to that of high-temperature superconductors--two factors that suggest an unconventional pairing mechanism. Despite sustained interest for 50 years, direct experimental insight into the nature of electron pairing in SrTiO3 has remained elusive. Here we perform transport experiments with nanowire-based single-electron transistors at the interface between SrTiO3 and a thin layer of lanthanum aluminate, LaAlO3. Electrostatic gating reveals a series of two-electron conductance resonances--paired electron states--that bifurcate above a critical pairing field Bp of about 1-4 tesla, an order of magnitude larger than the superconducting critical magnetic field. For magnetic fields below Bp, these resonances are insensitive to the applied magnetic field; for fields in excess of Bp, the resonances exhibit a linear Zeeman-like energy splitting. Electron pairing is stable at temperatures as high as 900 millikelvin, well above the superconducting transition temperature (about 300 millikelvin). These experiments demonstrate the existence of a robust electronic phase in which electrons pair without forming a superconducting state. Key experimental signatures are captured by a model involving an attractive Hubbard interaction that describes real-space electron pairing as a precursor to superconductivity. Support from AFOSR, ONR, ARO, NSF, DOE and NSSEFF is gratefully acknowledged.

  15. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    PubMed

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system.

  16. Primers for low-copy nuclear genes in Metrosideros and cross-amplification in Myrtaceae1

    PubMed Central

    Pillon, Yohan; Johansen, Jennifer; Sakishima, Tomoko; Chamala, Srikar; Barbazuk, W. Brad; Stacy, Elizabeth A.

    2014-01-01

    • Premise of the study: Primers were developed to amplify low-copy nuclear genes in Hawaiian Metrosideros (Myrtaceae). • Methods and Results: Data from a pooled 454 Titanium run of the partial transcriptomes of four Metrosideros taxa were used to identify the loci of interest. Ten exon-primed intron-crossing (EPIC) markers were amplified and sequenced directly with success in Metrosideros, as well as in a representative selection of Myrtaceae, including Syzygium, Psidium, and Melaleuca for most of the markers. The loci amplified ranged between 500 and 1100 bp, and up to 117 polymorphic sites were observed within an individual gene alignment. Two introns contained microsatellites in some of the species. • Conclusions: These novel primer pairs should be useful for phylogenetic analysis and population genetics of a broad range of Myrtaceae, particularly the diverse fleshy-fruited tribes Syzygieae and Myrteae. PMID:25309837

  17. Specificity of Methylation Assays in Cancer Research: A Guideline for Designing Primers and Probes

    PubMed Central

    Barekati, Zeinab; Radpour, Ramin; Kohler, Corina; Zhong, Xiao Yan

    2010-01-01

    DNA methylation is an epigenetic regulation mechanism of genomic function, and aberrant methylation pattern has been found to be a common event in many diseases and human cancers. A large number of cancer studies have been focused on identification of methylation changes as biomarkers (i.e., breast cancer). However, still clinical use of them is very limited because of lack of specificity and sensitivity for diagnostic test. This highlights the critical need for specific primer and probe design to avoid false-positive detection of methylation profiling. The guideline and online web tools that are introduced in this paper might help to perform a successful experiment and to develop specific diagnosis biomarkers by designing right primer pair and probe prior to experimental step. PMID:20798774

  18. Modified Primers for the Identification of Nonpathogenic Fusarium oxysporum Isolates That Have Biological Control Potential against Fusarium Wilt of Cucumber in Taiwan

    PubMed Central

    Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin

    2013-01-01

    Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289

  19. Optimization of turn-back primers in isothermal amplification.

    PubMed

    Kimura, Yasumasa; de Hoon, Michiel J L; Aoki, Shintaro; Ishizu, Yuri; Kawai, Yuki; Kogo, Yasushi; Daub, Carsten O; Lezhava, Alexander; Arner, Erik; Hayashizaki, Yoshihide

    2011-05-01

    The application of isothermal amplification technologies is rapidly expanding and currently covers different areas such as infectious disease, genetic disorder and drug dosage adjustment. Meanwhile, many of such technologies have complex reaction processes and often require a fine-tuned primer set where existing primer design tools are not sufficient. We have developed a primer selection system for one important primer, the turn-back primer (TP), which is commonly used in loop-mediated amplification (LAMP) and smart amplification process (SmartAmp). We chose 78 parameters related to the primer and target sequence, and explored their relationship to amplification speed using experimental data for 1344 primer combinations. We employed the least absolute shrinkage and selection operator (LASSO) method for parameter selection and estimation of their numerical coefficients. We subsequently evaluated our prediction model using additional independent experiments and compared to the LAMP primer design tool, Primer Explorer version4 (PE4). The evaluation showed that our approach yields a superior primer design in isothermal amplification and is robust against variations in the experimental setup. Our LASSO regression analysis revealed that availability of the 3'- and 5'-end of the primer are particularly important factors for efficient isothermal amplification. Our computer script is freely available at: http://gerg.gsc.riken.jp/TP_optimization/.

  20. Paired Straight Hearth Furnace

    SciTech Connect

    2009-04-01

    This factsheet describes a research project whose goals are to design, develop, and evaluate the scalability and commercial feasibility of the PSH Paired Straight Hearth Furnace alternative ironmaking process.

  1. Microsatellite primers for Parkia biglobosa (Fabaceae: Mimosoideae) reveal that a single plant sires all seeds per pod1

    PubMed Central

    Lassen, Kristin Marie; Kjær, Erik Dahl; Ouédraogo, Moussa; Nielsen, Lene Rostgaard

    2014-01-01

    • Premise of the study: Microsatellite primers were developed for an indigenous fruit tree, Parkia biglobosa, as a tool to study reproductive biology and population structure. Here we use the primers to determine the number of fathers per pod. • Methods and Results: Microsatellite loci were enriched in a genomic sample and isolated using pyrosequencing. Eleven primer pairs were characterized in two populations of P. biglobosa in Burkina Faso (each with 40 trees). The number of alleles per locus ranged from eight to 15, and one locus had null alleles. We genotyped seeds from 24 open-pollinated pods. The genotypic profiles of seeds per pod suggest that all seeds are outcrossed and that only one pollen donor sires all ovules in a single fruit. • Conclusions: Ten microsatellite markers were highly polymorphic. All seeds per pod of P. biglobosa were full siblings. The markers will be useful for reproductive and population genetic studies. PMID:25202634

  2. A degenerate primer MOB typing (DPMT) method to classify gamma-proteobacterial plasmids in clinical and environmental settings.

    PubMed

    Alvarado, Andrés; Garcillán-Barcia, M Pilar; de la Cruz, Fernando

    2012-01-01

    Transmissible plasmids are responsible for the spread of genetic determinants, such as antibiotic resistance or virulence traits, causing a large ecological and epidemiological impact. Transmissible plasmids, either conjugative or mobilizable, have in common the presence of a relaxase gene. Relaxases were previously classified in six protein families according to their phylogeny. Degenerate primers hybridizing to coding sequences of conserved amino acid motifs were designed to amplify related relaxase genes from γ-Proteobacterial plasmids. Specificity and sensitivity of a selected set of 19 primer pairs were first tested using a collection of 33 reference relaxases, representing the diversity of γ-Proteobacterial plasmids. The validated set was then applied to the analysis of two plasmid collections obtained from clinical isolates. The relaxase screening method, which we call "Degenerate Primer MOB Typing" or DPMT, detected not only most known Inc/Rep groups, but also a plethora of plasmids not previously assigned to any Inc group or Rep-type.

  3. Adaptive Pairing Reversible Watermarking.

    PubMed

    Dragoi, Ioan-Catalin; Coltuc, Dinu

    2016-05-01

    This letter revisits the pairwise reversible watermarking scheme of Ou et al., 2013. An adaptive pixel pairing that considers only pixels with similar prediction errors is introduced. This adaptive approach provides an increased number of pixel pairs where both pixels are embedded and decreases the number of shifted pixels. The adaptive pairwise reversible watermarking outperforms the state-of-the-art low embedding bit-rate schemes proposed so far.

  4. Advances in multiplex PCR: balancing primer efficiencies and improving detection success

    PubMed Central

    Sint, Daniela; Raso, Lorna; Traugott, Michael

    2012-01-01

    1. Multiplex PCR is a valuable tool in many biological studies but it is a multifaceted procedure that has to be planned and optimised thoroughly to achieve robust and meaningful results. In particular, primer concentrations have to be adjusted to assure an even amplification of all targeted DNA fragments. Until now, total DNA extracts were used for balancing primer efficiencies; however, the applicability for comparisons between taxa or different multiple-copy genes was limited owing to the unknown number of template molecules present per total DNA. 2. Based on a multiplex system developed to track trophic interactions in high Alpine arthropods, we demonstrate a fast and easy way of generating standardised DNA templates. These were then used to balance the amplification success for the different targets and to subsequently determine the sensitivity of each primer pair in the multiplex PCR. 3. In the current multiplex assay, this approach led to an even amplification success for all seven targeted DNA fragments. Using this balanced multiplex PCR, methodological bias owing to variation in primer efficiency will be avoided when analysing field-derived samples. 4. The approach outlined here allows comparing multiplex PCR sensitivity, independent of the investigated species, genome size or the targeted genes. The application of standardised DNA templates not only makes it possible to optimise primer efficiency within a given multiplex PCR, but it also offers to adjust and/or to compare the sensitivity between different assays. Along with other factors that influence the success of multiplex reactions, and which we discuss here in relation to the presented detection system, the adoption of this approach will allow for direct comparison of multiplex PCR data between systems and studies, enhancing the utility of this assay type. PMID:23549328

  5. Resonantly paired fermionic superfluids

    NASA Astrophysics Data System (ADS)

    Gurarie, V.; Radzihovsky, L.

    2007-01-01

    We present a theory of a degenerate atomic Fermi gas, interacting through a narrow Feshbach resonance, whose position and therefore strength can be tuned experimentally, as demonstrated recently in ultracold trapped atomic gases. The distinguishing feature of the theory is that its accuracy is controlled by a dimensionless parameter proportional to the ratio of the width of the resonance to Fermi energy. The theory is therefore quantitatively accurate for a narrow Feshbach resonance. In the case of a narrow s-wave resonance, our analysis leads to a quantitative description of the crossover between a weakly paired BCS superconductor of overlapping Cooper pairs and a strongly paired molecular Bose-Einstein condensate of diatomic molecules. In the case of pairing via a p-wave resonance, that we show is always narrow for a sufficiently low density, we predict a detuning-temperature phase diagram, that in the course of a BCS-BEC crossover can exhibit a host of thermodynamically distinct phases separated by quantum and classical phase transitions. For an intermediate strength of the dipolar anisotropy, the system exhibits a px + i py paired superfluidity that undergoes a topological phase transition between a weakly coupled gapless ground state at large positive detuning and a strongly paired fully gapped molecular superfluid for a negative detuning. In two dimensions the former state is characterized by a Pfaffian ground state exhibiting topological order and non-Abelian vortex excitations familiar from fractional quantum Hall systems.

  6. Cooper Pair Insulators

    NASA Astrophysics Data System (ADS)

    Valles, James

    One of the recent advances in the field of the Superconductor to Insulator Transition (SIT) has been the discovery and characterization of the Cooper Pair Insulator phase. This bosonic insulator, which consists of localized Cooper pairs, exhibits activated transport and a giant magneto-resistance peak. These features differ markedly from the weakly localized transport that emerges as pairs break at a ``fermionic'' SIT. I will describe how our experiments on films nano-patterned with a nearly triangular array of holes have enabled us to 1) distinguish bosonic insulators from fermionic insulators, 2) show that Cooper pairs, rather than quasi-particles dominate the transport in the Cooper Pair insulator phase, 3) demonstrate that very weak, sub nano-meter thickness inhomogeneities control whether a bosonic or fermionic insulator forms at an SIT and 4) reveal that Cooper pairs disintegrate rather than becoming more tightly bound deep in the localized phase. We have also developed a method, using a magnetic field, to tune flux disorder reversibly in these films. I will present our latest results on the influence of magnetic flux disorder and random gauge fields on phenomena near bosonic SITs. This work was performed in collaboration with M. D. Stewart, Jr., Hung Q. Nguyen, Shawna M. Hollen, Jimmy Joy, Xue Zhang, Gustavo Fernandez, Jeffrey Shainline and Jimmy Xu. It was supported by NSF Grants DMR 1307290 and DMR-0907357.

  7. Binary electrokinetic separation of target DNA from background DNA primers.

    SciTech Connect

    James, Conrad D.; Derzon, Mark Steven

    2005-10-01

    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  8. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

    NASA Astrophysics Data System (ADS)

    Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

    2016-03-01

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.

  9. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

    PubMed Central

    Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

    2016-01-01

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity. PMID:26965911

  10. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River.

    PubMed

    Cannon, M V; Hester, J; Shalkhauser, A; Chan, E R; Logue, K; Small, S T; Serre, D

    2016-03-11

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.

  11. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River.

    PubMed

    Cannon, M V; Hester, J; Shalkhauser, A; Chan, E R; Logue, K; Small, S T; Serre, D

    2016-01-01

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity. PMID:26965911

  12. Hydrology of Central Florida Lakes - A Primer

    USGS Publications Warehouse

    Schiffer, Donna M.

    1998-01-01

    INTRODUCTION Lakes are among the most valued natural resources of central Florida. The landscape of central Florida is riddled with lakeswhen viewed from the air, it almost seems there is more water than land. Florida has more naturally formed lakes than other southeastern States, where many lakes are created by building dams across streams. The abundance of lakes on the Florida peninsula is a result of the geology and geologic history of the State. An estimated 7,800 lakes in Florida are greater than 1 acre in surface area. Of these, 35 percent are located in just four counties (fig. 1): Lake, Orange, Osceola, and Polk (Hughes, 1974b). Lakes add to the aesthetic and commercial value of the area and are used by many residents and visitors for fishing, boating, swimming, and other types of outdoor recreation. Lakes also are used for other purposes such as irrigation, flood control, water supply, and navigation. Residents and visitors commonly ask questions such as Whyare there so many lakes here?, Why is my lake drying up (or flooding)?, or Is my lake spring-fed? These questions indicate that the basic hydrology of lakes and the interaction of lakes with ground water and surface water are not well understood by the general population. Because of the importance of lakes to residents of central Florida and the many questions and misconceptions about lakes, this primer was prepared by the U.S. Geological Survey (USGS) in cooperation with the St. Johns River Water Management District and the South Florida Water Management District. The USGS has been collecting hydrologic data in central Florida since the 1920s, obtaining valuable information that has been used to better understand the hydrology of the water resources of central Florida, including lakes. In addition to data collection, as of 1994, the USGS had published 66 reports and maps on central Florida lakes (Garcia and Hoy, 1995). The main purpose of this primer is to describe the hydrology of lakes in central

  13. Species phylogeny and diversification process of Northeast Asian Pungitius revealed by AFLP and mtDNA markers.

    PubMed

    Takahashi, Hiroshi; Møller, Peter R; Shedko, Sergei V; Ramatulla, Temirbekov; Joen, Sang-Rin; Zhang, Chun-Guang; Sideleva, Valentina G; Takata, Keisuke; Sakai, Harumi; Goto, Akira; Nishida, Mutsumi

    2016-06-01

    Pungitius is a highly diversified genus of sticklebacks (Gasterosteidae) occurring widely in northern parts of the Northern Hemisphere. Several ecologically and genetically divergent types that are largely isolated reproductively but occasionally hybridize in sympatry have been discovered in Northeast Asia, although the taxonomy and evolutionary relationships among them remain unclear. We used amplified fragment length polymorphism (AFLP) and mitochondrial DNA (mtDNA) markers to infer phylogenies among individuals collected from sympatric and allopatric populations, including the type localities of the described species. Phylogenetic analyses based on 2683 polymorphic AFLP loci confirmed seven species, each of which (except for one entirely allopatric species P. platygaster) was clearly differentiated from one or two other sympatric species and constituted a highly supported monophyletic clade with conspecific allopatric populations. The phylogeny showed that two lineages arose early; one gave rise to two species (circumpolar species P. pungitius and Paratethys species P. platygaster) and the other to five species endemic to Northeast Asia (P. sinensis, P. tymensis, P. polyakovi, P. kaibarae, and P. bussei). The brackish-water, freshwater, and Omono types previously discovered in Japan were reidentified as P. pungitius, P. sinensis, and P. kaibarae, respectively. A marked incongruence was noted between the phylogenies of AFLP and mtDNA markers, suggesting the occasional occurrence of hybridization and mtDNA introgression among distinct species. Our results highlight that the marginal seas of Northeast Asia played a key role as barriers to or facilitators of gene flow in the evolution of species diversity of Pungitius concentrated in this region. PMID:26997522

  14. Comparison of MALDI-TOF MS and AFLP for strain typing of ESBL-producing Escherichia coli.

    PubMed

    Veenemans, J; Welker, M; van Belkum, A; Saccomani, M C; Girard, V; Pettersson, A; Verhulst, C; Kluytmans-Vandenbergh, M; Kluytmans, J

    2016-05-01

    Typing of bacterial isolates using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) potentially provides an efficient on-site method to monitor the spread of antibiotic-resistant bacteria and rapidly detect outbreaks. We compared MALDI-MS typing results to those of amplified fragment length polymorphism (AFLP) in a collection of 52 ESBL-producing Escherichia coli, isolated in a Dutch nursing home with an on-going outbreak of ST131 E. coli. Specific MALDI types were defined based on spectral data from four replicate colony samples of isolates grown on Columbia agar using multivariate statistical procedures. Type-specific superspectra were computed for four E .coli MALDI-types and tested for the potential of rapid and automated typing. The effect of different incubation conditions on typing performance was tested by analysing five isolates incubated for 24 h and 48 h on five different media. Types defined based on MALDI spectra were largely in agreement with the AFLP results, although some MALDI types comprised of more than one AFLP type. In particular, isolates belonging to ST131 showed distinct mass patterns. The proportion of isolates correctly assigned was substantially lower for isolates incubated on Sabouraud-dextrose and Drigalski agars for 24 h, and for those incubated for 48 h (all media). Our results show that the identification of type-specific peaks potentially allows direct typing of isolates belonging to specific clonal lineages. Both incubation time and media affected type assignment, suggesting that there is a need for a careful standardization of incubation time and culturing conditions when developing MALDI-typing schemes for E. coli.

  15. Assessment of genetic variability in a traditional cassava (Manihot esculenta Crantz) farming system, using AFLP markers.

    PubMed

    Elias, M; Panaud, O; Robert, T

    2000-09-01

    Despite the urgent need to conserve domesticated plant genetic resources, and developing 'on farm' strategies of conservation, the impact of traditional farming practices and of their interaction with ecological factors on the structure and evolutionary dynamics of the genetic variability of crop populations has been little documented. We assessed the genetic variability of 31 varieties of cassava (M. esculenta Crantz) traditionally grown by Makushi Amerindians from Guyana, using AFLP markers. We used a sample of 38 varieties from an ex situ core collection as a reference. Accessions of wild cassava were also included. While clonality of the varieties was expected due to the vegetative propagation of cassava, 21 varieties presented intravarietal polymorphism. Among the varieties from a single site in Guyana, genetic diversity was the same as that in the accessions from the core collection. We suggest that incorporation of volunteer seedlings, produced by sexual reproduction, into the stock of varieties grown by the Makushi plays a major role in explaining both intravarietal polymorphism and the high level of genetic diversity. No correspondence was found between the structure of molecular diversity and variation observed for agronomic traits that are targets for selection by cultivators. As found in previous studies, all wild forms of cassava clustered together and separately from the cultivated varieties in a Neighbour-Joining dendrogram. These results are consistent with the hypothesis of a limited domestication event in a restricted area, followed by rapid diffusion of cultivated phenotypes and convergent evolution. Our results show that local varieties are an important source of genetic diversity, and highlight the importance of the interaction between human and ecological factors in the dynamics of this diversity.

  16. Development of universal primers for detection of potato carlaviruses by RT-PCR.

    PubMed

    Nie, Xianzhou; Bai, Yanju; Molen, Teresa A; Desjardins, David C

    2008-05-01

    To facilitate efficient and accurate detection of potato-infecting carlaviruses, degenerated universal primers were designed based on conserved amino acid and nucleotide sequences. Two sense primers, Car-F1 and Car-F2, were based on the amino acid sequences "SNNMA" and "GLGVPTE", respectively, in the coat protein. The reverse primer, Car-R, which was located at the border of the nucleic acid binding protein gene and the 3' untranslated region, and dT-B, which was derived from the oligo-dT targeting the poly(A) tail, were selected. Successful application of fragments within the predicted size range of carlaviruses was obtained using Car-F1 paired with either Car-R or dT-B from tested carlaviruses (Potato virus S, M and latent) by RT-PCR. The Car-F2 failed to yield clear-cut fragments within the predicted size range when paired with either Car-R or dT-B in RT-PCR. However, a less degenerated version of the primer, Car-F2b, resulted in amplicons within the predicted size range when paired with either Car-R or dT-B. Sequencing of the tentative carlavirus-fragments resulting from Car-F1/Car-R and Car-F2b/dT-B proved their carlavirus-origin, thus indicating the high specificity of these primers. The sensitivity of Car-F1/Car-R or Car-F2b/Car-R mediated RT-PCR for the detection of carlavirus-infected potato tubers were assessed using composite samples containing one carlavirus-infected-potato-tuber RNA sample with up to 49 virus-free-potato-tuber RNA samples under the optimal annealing temperature. The target carlaviruses were detected readily from all composites, demonstrating a high sensitivity. The method was further evaluated using presumed virus-free or carlavirus-infected potatoes of several cultivars, and reliable results were obtained. PMID:18353450

  17. Hubble Space Telescope Primer for Cycle 21

    NASA Astrophysics Data System (ADS)

    Gonzaga, S.; et al.

    2012-12-01

    The Hubble Space Telescope Primer for Cycle 21 is a companion document to the HST Call for Proposals1. It provides an overview of the Hubble Space Telescope (HST), with basic information about telescope operations, instrument capabilities, and technical aspects of the proposal preparation process. A thorough understanding of the material in this document is essential for the preparation of a competitive proposal. This document is available as an online HTML document and a PDF file. The HTML version, optimized for online browsing, contains many links to additional information. The PDF version is optimized for printing, but online PDF readers have search capabilities for quick retrieval of specific information.

  18. Protein sulfation analysis--A primer.

    PubMed

    Monigatti, Flavio; Hekking, Brian; Steen, Hanno

    2006-12-01

    The aim of this review is to present an overview of protein sulfation in the context of 'modificomics', i.e. post-translational modification-specific proteome research. In addition to a short introduction to the biology of protein sulfation (part 1), we will provide detailed discussion regarding (i) methods and tools for prediction of protein tyrosine sulfation sites (part 2), (ii) biochemical techniques used for protein sulfation analysis (part 3.1), and (iii) mass spectrometric strategies and methods applied to protein sulfation analysis (part 3.2). We will highlight strengths and limitations of different strategies and approaches (including references), providing a primer for newcomers to protein sulfation analysis.

  19. Global Health in Family Medicine Summer Primer

    PubMed Central

    Rouleau, Katherine; Janakiram, Praseedha; Nicolle, Eileen; Godoy-Ruiz, Paula; Pakes, Barry N.

    2015-01-01

    Abstract Problem addressed Despite the rapid emergence of global health training across North American universities, there remains a gap in educational programs focusing on the unique role of family medicine and primary care in global health. Objective of program The objective of the Global Health in Family Medicine Summer Primer, developed in 2013 by the Department of Family and Community Medicine at the University of Toronto in Ontario, is to strengthen global health competencies among family medicine residents and faculty. Program description The course covers the meaning of global health; global health ethics; the place of family medicine, primary care, and primary health care in the global health context; epidemiology; infectious diseases; the social determinants of health; and care of vulnerable populations locally and globally. The course is delivered in an intensive 5-day format with didactic lectures, group discussions, interactive workshops, and lived-experience panels. Conclusion The Global Health in Family Medicine Summer Primer has proven to be a successful educational initiative and provides valuable lessons learned for other academic science centres in developing global health training programs for family medicine residents and faculty. PMID:26380854

  20. Alanylated lipoteichoic acid primer in Bacillus subtilis

    PubMed Central

    Luo, Yu

    2016-01-01

    Lipoteichoic acid is a major lipid-anchored polymer in Gram-positive bacteria such as Bacillus subtilis. This polymer typically consists of repeating phosphate-containing units and therefore has a predominant negative charge. The repeating units are attached to a glycolipid anchor which has a diacylglycerol (DAG) moiety attached to a dihexopyranose head group. D-alanylation is known as the major modification of type I and type IV lipoteichoic acids, which partially neutralizes the polymer and plays important roles in bacterial survival and resistance to the host immune system. The biosynthesis pathways of the glycolipid anchor and lipoteichoic acid have been fully characterized. However, the exact mechanism of D-alanyl transfer from the cytosol to cell surface lipoteichoic acid remains unclear. Here I report the use of mass spectrometry in the identification of possible intermediate species in the biosynthesis and D-alanylation of lipoteichoic acid: the glycolipid anchor, nascent lipoteichoic acid primer with one phosphoglycerol unit, as well as mono- and di-alanylated forms of the lipoteichoic acid primer. Monitoring these species as well as the recently reported D-alanyl-phosphatidyl glycerol should aid in shedding light on the mechanism of the D-alanylation pathway of lipoteichoic acid. PMID:27134729

  1. Human mitochondrial DNA complete amplification and sequencing: a new validated primer set that prevents nuclear DNA sequences of mitochondrial origin co-amplification.

    PubMed

    Ramos, Amanda; Santos, Cristina; Alvarez, Luis; Nogués, Ramon; Aluja, Maria Pilar

    2009-05-01

    To date, there are no published primers to amplify the entire mitochondrial DNA (mtDNA) that completely prevent the amplification of nuclear DNA (nDNA) sequences of mitochondrial origin. The main goal of this work was to design, validate and describe a set of primers, to specifically amplify and sequence the complete human mtDNA, allowing the correct interpretation of mtDNA heteroplasmy in healthy and pathological samples. Validation was performed using two different approaches: (i) Basic Local Alignment Search Tool and (ii) amplification using isolated nDNA obtained from sperm cells by differential lyses. During the validation process, two mtDNA regions, with high similarity with nDNA, represent the major problematic areas for primer design. One of these could represent a non-published nuclear DNA sequence of mitochondrial origin. For two of the initially designed fragments, the amplification results reveal PCR artifacts that can be attributed to the poor quality of the DNA. After the validation, nine overlapping primer pairs to perform mtDNA amplification and 22 additional internal primers for mtDNA sequencing were obtained. These primers could be a useful tool in future projects that deal with mtDNA complete sequencing and heteroplasmy detection, since they represent a set of primers that have been tested for the non-amplification of nDNA.

  2. Use of conserved genomic regions and degenerate primers in a PCR-based assay for the detection of members of the genus Caulimovirus.

    PubMed

    Pappu, H R; Druffel, K L

    2009-04-01

    The genus Caulimovirus consists of several distinct virus species with a double-stranded DNA genome that infect diverse plant species. A comparative analysis of the sequences of known Caulimovirus species revealed two regions that are conserved in all Caulimovirus species with the exception of Strawberry vein banding virus. Degenerate primers based on these two regions were designed and tested in a polymerase chain reaction-based assay for broad spectrum detection of members of this genus. Cauliflower mosaic virus, Figwort mosaic virus and three distinct caulimoviruses associated with dahlia (Dahlia variabilis) were used to show the utility of this test in detecting diverse caulimoviruses. The primer pair gave an amplicon of expected size (840bp). Amplicons from each virus were cloned and sequenced to verify their identity. The primer pair and the PCR assay provide approach for the broad spectrum detection of several members of the genus Caulimovirus.

  3. Use of conserved genomic regions and degenerate primers in a PCR-based assay for the detection of members of the genus Caulimovirus.

    PubMed

    Pappu, H R; Druffel, K L

    2009-04-01

    The genus Caulimovirus consists of several distinct virus species with a double-stranded DNA genome that infect diverse plant species. A comparative analysis of the sequences of known Caulimovirus species revealed two regions that are conserved in all Caulimovirus species with the exception of Strawberry vein banding virus. Degenerate primers based on these two regions were designed and tested in a polymerase chain reaction-based assay for broad spectrum detection of members of this genus. Cauliflower mosaic virus, Figwort mosaic virus and three distinct caulimoviruses associated with dahlia (Dahlia variabilis) were used to show the utility of this test in detecting diverse caulimoviruses. The primer pair gave an amplicon of expected size (840bp). Amplicons from each virus were cloned and sequenced to verify their identity. The primer pair and the PCR assay provide approach for the broad spectrum detection of several members of the genus Caulimovirus. PMID:19100290

  4. Morphological changes of Paulownia seedlings infected phytoplasmas reveal the genes associated with witches' broom through AFLP and MSAP.

    PubMed

    Cao, Xibing; Fan, Guoqiang; Zhao, Zhenli; Deng, Minjie; Dong, Yanpeng

    2014-01-01

    Paulownia witches' broom (PaWB) caused by phytoplasma might result in devastating damage to the growth and wood production of Paulownia. To study the effect of phytoplasma on DNA sequence and to discover the genes related to PaWB occurrence, DNA polymorphisms and DNA methylation levels and patterns in PaWB seedlings, the ones treated with various concentration of methyl methane sulfonate (MMS) and healthy seedlings were investigated with amplified fragment length polymorphism (AFLP) and methylation-sensitive amplification polymorphism (MSAP). Our results indicated that PaWB seedlings recovered a normal morphology, similar to healthy seedlings, after treatment with more than 20 mg · L-1 MMS; Phytoplasma infection did not change the Paulownia genomic DNA sequence at AFLP level, but changed the global DNA methylation levels and patterns; Genes related to PaWB were discovered through MSAP and validated using quantitative real-time PCR (qRT-PCR). These results implied that changes of DNA methylation levels and patterns were closely related to the morphological changes of seedlings infected with phytoplasmas.

  5. Morphological Changes of Paulownia Seedlings Infected Phytoplasmas Reveal the Genes Associated with Witches' Broom through AFLP and MSAP

    PubMed Central

    Cao, Xibing; Fan, Guoqiang; Zhao, Zhenli; Deng, Minjie; Dong, Yanpeng

    2014-01-01

    Paulownia witches' broom (PaWB) caused by phytoplasma might result in devastating damage to the growth and wood production of Paulownia. To study the effect of phytoplasma on DNA sequence and to discover the genes related to PaWB occurrence, DNA polymorphisms and DNA methylation levels and patterns in PaWB seedlings, the ones treated with various concentration of methyl methane sulfonate (MMS) and healthy seedlings were investigated with amplified fragment length polymorphism (AFLP) and methylation-sensitive amplification polymorphism (MSAP). Our results indicated that PaWB seedlings recovered a normal morphology, similar to healthy seedlings, after treatment with more than 20 mg·L−1 MMS; Phytoplasma infection did not change the Paulownia genomic DNA sequence at AFLP level, but changed the global DNA methylation levels and patterns; Genes related to PaWB were discovered through MSAP and validated using quantitative real-time PCR (qRT-PCR). These results implied that changes of DNA methylation levels and patterns were closely related to the morphological changes of seedlings infected with phytoplasmas. PMID:25427154

  6. Morphological changes of Paulownia seedlings infected phytoplasmas reveal the genes associated with witches' broom through AFLP and MSAP.

    PubMed

    Cao, Xibing; Fan, Guoqiang; Zhao, Zhenli; Deng, Minjie; Dong, Yanpeng

    2014-01-01

    Paulownia witches' broom (PaWB) caused by phytoplasma might result in devastating damage to the growth and wood production of Paulownia. To study the effect of phytoplasma on DNA sequence and to discover the genes related to PaWB occurrence, DNA polymorphisms and DNA methylation levels and patterns in PaWB seedlings, the ones treated with various concentration of methyl methane sulfonate (MMS) and healthy seedlings were investigated with amplified fragment length polymorphism (AFLP) and methylation-sensitive amplification polymorphism (MSAP). Our results indicated that PaWB seedlings recovered a normal morphology, similar to healthy seedlings, after treatment with more than 20 mg · L-1 MMS; Phytoplasma infection did not change the Paulownia genomic DNA sequence at AFLP level, but changed the global DNA methylation levels and patterns; Genes related to PaWB were discovered through MSAP and validated using quantitative real-time PCR (qRT-PCR). These results implied that changes of DNA methylation levels and patterns were closely related to the morphological changes of seedlings infected with phytoplasmas. PMID:25427154

  7. Reduction of species in the wild potato Solanum section Petota series Longipedicellata: AFLP, RAPD and chloroplast SSR data.

    PubMed

    Van Den Berg, G.; Bryan, J.; Del Rio, A.; Spooner, M.

    2002-12-01

    Species boundaries were assessed with three molecular markers [AFLPs, RAPDs and chloroplast simple sequence repeats (cpSSRs)] for all six species of wild potatoes ( Solanum section Petota) assigned to ser. Longipedicellata: Solanum fendleri, S. hjertingii, S. matehualae, S. papita, S. polytrichon and S. stoloniferum. These tetraploid (2n = 4 x = 48) species grow in the southeastern United States ( S. fendleri) and Mexico (all six species), and a recent morphological analysis supported only three species: (1) S. polytrichon, (2) S. hjertingii (including S. matehualae) and (3) S. stoloniferum (including S. fendleri and S. papita). We analyzed all six species of ser. Longipedicellata (tetraploid) and also analyzed diploids in ser. Bulbocastana, ser. Pinnatisecta, ser. Polyadenia and ser. Tuberosa; tetraploids in ser. Acaulia and hexaploids in ser. Demissa. Concordant with morphological data, AFLP and RAPD results support the synonymy of S. hjertingii and S. matehualae, and completely intermix S. papita and S. fendleri. However, accessions of S. stoloniferum have a tendency to cluster but with exceptions, and S. polytrichon is completely intermixed with S. fendleri and S. papita. The cpSSRs fail to distinguish any of the species in ser. Longipedicellata. Combined morphological and molecular data support only two species in ser. Longipedicellata: S. hjertingii and S. stoloniferum.

  8. AFLP and DNA sequence variation in an Andean domesticate, pepino (Solanum muricatum, Solanaceae): implications for evolution and domestication.

    PubMed

    Blanca, José M; Prohens, Jaime; Anderson, Gregory J; Zuriaga, Elena; Cañizares, Joaquín; Nuez, Fernando

    2007-07-01

    The pepino (Solanum muricatum) is a vegetatively propagated, domesticated native of the Andes, where it grows with wild relatives. We used AFLPs and a 1-kb sequence of the 3-methylcrotonyl-CoA carboxylase gene to study variation of 27 accessions of S. muricatum and 35 collections of 10 species of wild relatives (Solanum section Basarthrum). A total of 298 AFLP fragments and 29 DNA sequence haplotypes were detected. Cluster and principal coordinate analyses and other genetic parameters estimated from both types of markers, show that S. muricatum is closely related to the species from one of the series (Caripensia) of section Basarthrum and that >90% of the variation of the cultigen is also represented in that series. Pepino is highly diverse, either because it is not monophyletic or it has been subjected to regular introgression with wild species, or both. Although a continuous distribution of the genetic variation occurred within the cultivated species, three genetic clusters were recognized. Cluster 1 is mostly centered in Ecuador, cluster 2 in Ecuador and Peru, and cluster 3 in Colombia and Ecuador. Cluster 3 also includes all modern cultivars studied. These results and other evidence suggest that northern Ecuador/southern Colombia is the main center of pepino diversity and the center of origin. The high genetic variation of this cultigen indicates that domestication does not always produce a genetic bottleneck.

  9. Construction of an integrated map of rose with AFLP, SSR, PK, RGA, RFLP, SCAR and morphological markers.

    PubMed

    Yan, Z; Denneboom, C; Hattendorf, A; Dolstra, O; Debener, T; Stam, P; Visser, P B

    2005-02-01

    A high-density genetic map with a number of anchor markers has been created to be used as a tool to dissect genetic variation in rose. Linkage maps for the diploid 94/1 population consisting of 88 individuals were constructed using a total of 520 molecular markers including AFLP, SSR, PK, RGA, RFLP, SCAR and morphological markers. Seven linkage groups, putatively corresponding to the seven haploid rose chromosomes, were identified for each parent, spanning 487 cM and 490 cM, respectively. The average length of 70 cM may cover more than 90% of the rose genome. An integrated map was constructed by incorporating the homologous parental linkage groups, resulting in seven linkage groups with a total length of 545 cM. The present linkage map is currently the most advanced map in rose with regard to marker density, genome coverage and with robust markers, giving good perspectives for QTL mapping and marker-assisted breeding in rose. The SSR markers, together with RFLP markers, provide good anchor points for future map alignment studies in rose and related species. Codominantly scored AFLP markers were helpful in the integration of the parental maps.

  10. Reduction of species in the wild potato Solanum section Petota series Longipedicellata: AFLP, RAPD and chloroplast SSR data.

    PubMed

    Van Den Berg, G.; Bryan, J.; Del Rio, A.; Spooner, M.

    2002-12-01

    Species boundaries were assessed with three molecular markers [AFLPs, RAPDs and chloroplast simple sequence repeats (cpSSRs)] for all six species of wild potatoes ( Solanum section Petota) assigned to ser. Longipedicellata: Solanum fendleri, S. hjertingii, S. matehualae, S. papita, S. polytrichon and S. stoloniferum. These tetraploid (2n = 4 x = 48) species grow in the southeastern United States ( S. fendleri) and Mexico (all six species), and a recent morphological analysis supported only three species: (1) S. polytrichon, (2) S. hjertingii (including S. matehualae) and (3) S. stoloniferum (including S. fendleri and S. papita). We analyzed all six species of ser. Longipedicellata (tetraploid) and also analyzed diploids in ser. Bulbocastana, ser. Pinnatisecta, ser. Polyadenia and ser. Tuberosa; tetraploids in ser. Acaulia and hexaploids in ser. Demissa. Concordant with morphological data, AFLP and RAPD results support the synonymy of S. hjertingii and S. matehualae, and completely intermix S. papita and S. fendleri. However, accessions of S. stoloniferum have a tendency to cluster but with exceptions, and S. polytrichon is completely intermixed with S. fendleri and S. papita. The cpSSRs fail to distinguish any of the species in ser. Longipedicellata. Combined morphological and molecular data support only two species in ser. Longipedicellata: S. hjertingii and S. stoloniferum. PMID:12582888

  11. Elucidation of distribution patterns and possible infection routes of the neurotropic black yeast Exophiala dermatitidis using AFLP.

    PubMed

    Sudhadham, Montarop; Gerrits van den Ende, A H G; Sihanonth, P; Sivichai, S; Chaiyarat, R; Menken, S B J; van Belkum, A; de Hoog, G S

    2011-10-01

    Distribution of populations of the opportunistic black yeast Exophiala dermatitidis was studied using AFLP. This fungus has been hypothesized to have a natural habitat in association with frugivorous birds and bats in the tropical rain forest, and to emerge in the human-dominated environment, where it occasionally causes human pulmonary or fatal disseminated and neurotropic disease. The hypothesis of its natural niche was investigated by comparing a set of 178 strains from natural and human-dominated environments in Thailand with a worldwide selection of 107 strains from the reference collection of the CBS Fungal Biodiversity Centre, comprising 75.7% clinical isolates. Many isolates had unique AFLP patterns and were too remote for confident comparison. Eight populations containing multiple isolates could be distinguished, enabling determination of geographic distributions of these populations. Some of the populations were confined to Thailand, while others occurred worldwide. The local populations from Thailand contained strains from natural and urban environments, suggesting an environmental jump of the fungus. Strains from human brain belonged to widely dispersed populations. In some cases cerebral isolates were identical to isolates from the human intestinal tract. The possibility of cerebral infection through intestinal translocation was thus not excluded.

  12. AFLP markers resolve intra-specific relationships and infer genetic structure among lineages of the canyon treefrog, Hyla arenicolor.

    PubMed

    Klymus, Katy E; Carl Gerhardt, H

    2012-11-01

    The canyon treefrog, Hyla arenicolor, is a wide-ranging hylid found from southwestern US into southern Mexico. Recent studies have shown this species to have a complex evolutionary history, with several phylogeographically distinct lineages, a probable cryptic species, and multiple episodes of mitochondrial introgression with the sister group, the H. eximia complex. We aimed to use genome wide AFLP markers to better resolve relationships within this group. As in other studies, our inferred phylogeny not only provides evidence for repeated mitochondrial introgression between H. arenicolor lineages and H. eximia/H. wrightorum, but it also affords more resolution within the main H. arenicolor clade than was previously achieved with sequence data. However, as with a previous study, the placement of a lineage of H. arenicolor whose distribution is centered in the Balsas Basin of Mexico remains poorly resolved, perhaps due to past hybridization with the H. eximia complex. Furthermore, the AFLP data set shows no differentiation among lineages from the Grand Canyon and Colorado Plateau despite their large mitochondrial sequence divergence. Finally, our results infer a well-supported sister relationship between this combined Colorado Plateau/Grand Canyon lineage and the Sonoran Desert lineage, a relationship that strongly contradicts conclusions drawn from the mtDNA evidence. Our study provides a basis for further behavioral and ecological speciation studies of this system and highlights the importance of multi-taxon (species) sampling in phylogenetic and phylogeographic studies.

  13. AFLP markers resolve intra-specific relationships and infer genetic structure among lineages of the canyon treefrog, Hyla arenicolor.

    PubMed

    Klymus, Katy E; Carl Gerhardt, H

    2012-11-01

    The canyon treefrog, Hyla arenicolor, is a wide-ranging hylid found from southwestern US into southern Mexico. Recent studies have shown this species to have a complex evolutionary history, with several phylogeographically distinct lineages, a probable cryptic species, and multiple episodes of mitochondrial introgression with the sister group, the H. eximia complex. We aimed to use genome wide AFLP markers to better resolve relationships within this group. As in other studies, our inferred phylogeny not only provides evidence for repeated mitochondrial introgression between H. arenicolor lineages and H. eximia/H. wrightorum, but it also affords more resolution within the main H. arenicolor clade than was previously achieved with sequence data. However, as with a previous study, the placement of a lineage of H. arenicolor whose distribution is centered in the Balsas Basin of Mexico remains poorly resolved, perhaps due to past hybridization with the H. eximia complex. Furthermore, the AFLP data set shows no differentiation among lineages from the Grand Canyon and Colorado Plateau despite their large mitochondrial sequence divergence. Finally, our results infer a well-supported sister relationship between this combined Colorado Plateau/Grand Canyon lineage and the Sonoran Desert lineage, a relationship that strongly contradicts conclusions drawn from the mtDNA evidence. Our study provides a basis for further behavioral and ecological speciation studies of this system and highlights the importance of multi-taxon (species) sampling in phylogenetic and phylogeographic studies. PMID:22898531

  14. Non PCR-amplified Transcripts and AFLP fragments as reduced representations of the quail genome for 454 Titanium sequencing

    PubMed Central

    2010-01-01

    Background SNP (Single Nucleotide Polymorphism) discovery is now routinely performed using high-throughput sequencing of reduced representation libraries. Our objective was to adapt 454 GS FLX based sequencing methodologies in order to obtain the largest possible dataset from two reduced representations libraries, produced by AFLP (Amplified Fragment Length Polymorphism) for genomic DNA, and EST (Expressed Sequence Tag) for the transcribed fraction of the genome. Findings The expressed fraction was obtained by preparing cDNA libraries without PCR amplification from quail embryo and brain. To optimize the information content for SNP analyses, libraries were prepared from individuals selected in three quail lines and each individual in the AFLP library was tagged. Sequencing runs produced 399,189 sequence reads from cDNA and 373,484 from genomic fragments, covering close to 250 Mb of sequence in total. Conclusions Both methods used to obtain reduced representations for high-throughput sequencing were successful after several improvements. The protocols may be used for several sequencing applications, such as de novo sequencing, tagged PCR fragments or long fragment sequencing of cDNA. PMID:20667075

  15. Great Lakes rivermouths: a primer for managers

    USGS Publications Warehouse

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  16. Transferability of microsatellite primers developed for stingless bees to four other species of the genus Melipona.

    PubMed

    Viana, M V C; Miranda, E A; de Francisco, A K; Carvalho, C A L; Waldschmidt, A M

    2011-11-22

    Microsatellite markers are a useful tool for ecological monitoring of natural and managed populations. A technical limitation is the necessity for investment in the development of primers. Heterologous primers can provide an alternative to searching for new loci. In bees, these markers have been used in populational and intracolonial genetic analyses. The genus Melipona has the largest number of species among bee genera, about 70, occurring throughout the Neotropical region. However, only five species of the genus Melipona have specific microsatellite markers. Given the great diversity of this genus, this number is not representative. We analyzed the transferability of 49 microsatellite loci to four other species of the genus Melipona (M. scutellaris, M. mondury, M. mandacaia, and M. quadrifasciata). Four individuals of each species, from different localities, were used in amplification tests. Primer pairs described for five Melipona species and for Trigona carbonaria were tested. Among the 49 loci, 22 gave amplification products for all four species, while three gave nonspecific bands and five showed no amplification products. The remaining loci varied in the pattern of amplification, according to the species examined. The number of alleles ranged from 1 to 6. The results demonstrate the possibility of using these heterologous markers in other Melipona species, increasing the number of loci that can be analyzed and contributing to further genetic analyses of intra- and intercolonial structure, which is required for conservation measure planning, genetic improvement and resolution of taxonomic problems.

  17. Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

    SciTech Connect

    Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J.

    2012-08-01

    The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

  18. Development of species-specific primers for rapid identification of Debaryomyces hansenii.

    PubMed

    Wrent, Petra; Rivas, Eva-María; Gil de Prado, Elena; Peinado, José M; de Silóniz, María-Isabel

    2015-01-16

    In this work, we developed a specific PCR assay for Debaryomyces hansenii strains that uses a putative homologous PAD1 region (729 bp) present in this yeast species as a target. The amplification of this sequence with the D. hansenii specific primer pair (DhPADF/DhPADR) was found to be a rapid, specific and an affordable method enabling identification of D. hansenii from other yeast strains. Primers were tested in almost 100 strains, 49 strains from Type Culture Collection belonging to the genus Debaryomyces and to other yeast species commonly found in foods or related genera. These primers were able to discriminate between closely related species of Debaryomyces, such as Debaryomyces fabryi and Debaryomyces subglobosus, with a 100% detection rate for D. hansenii. Also, the method was tested in 45 strains from different foods. Results confirmed the specificity of the PCR method and detected two earlier misidentifications of D. hansenii strains obtained by RFLP analysis of the 5.8S ITS rDNA region. Subsequently we confirmed by sequencing the D1/D2 domain of 26S rDNA that these strains belonged to D. fabryi. We call attention in this work to the fact that the RFLPs of the 5.8S ITS rDNA profiles of D. hansenii, D. fabryi and D. subglobosus are the same and this technique will thus lead to incorrect identifications. PMID:25462930

  19. Conserved primers for DNA barcoding historical and modern samples from New Zealand and Antarctic birds.

    PubMed

    Patel, Selina; Waugh, John; Millar, Craig D; Lambert, David M

    2010-05-01

    Our ability to DNA barcode the birds of the world is based on the effective amplification and sequencing of a 648 base pair (bp) region of the mitochondrial cytochrome c oxidase (COI or cox1) gene. For many geographic regions the large numbers of vouchered specimens necessary for the construction of a DNA barcoding database have already been collected and are available in museums and other institutions. However, many of these specimens are old (>20 years) and are stored as either fixed study skins or dried skeletons. DNA extracted from such historical samples is typically degraded and, generally, only short DNA fragments can be recovered from such specimens making the recovery of the barcoding region as a single fragment difficult. We report two sets of conserved primers that allow the amplification of the entire DNA barcoding region in either three or five overlapping fragments. These primer sets allow the recovery of DNA barcodes from valuable historical specimens that in many cases are unique in that they are unable or unlikely to be collected again. We also report three new primers that in combination allow the effective amplification from modern samples of the entire DNA barcoding region as a single DNA fragment for 17 orders of Southern Hemisphere birds.

  20. Multi-pair states in electron-positron pair creation

    NASA Astrophysics Data System (ADS)

    Wöllert, Anton; Bauke, Heiko; Keitel, Christoph H.

    2016-09-01

    Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron-positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron-positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron-positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron-positron pairs.

  1. HST archive primer, version 4.1

    NASA Technical Reports Server (NTRS)

    Fruchter, A. (Editor); Baum, S. (Editor)

    1994-01-01

    This version of the HST Archive Primer provides the basic information a user needs to know to access the HST archive via StarView the new user interface to the archive. Using StarView, users can search for observations interest, find calibration reference files, and retrieve data from the archive. Both the terminal version of StarView and the X-windows version feature a name resolver which simplifies searches of the HST archive based on target name. In addition, the X-windows version of StarView allows preview of all public HST data; compressed versions of public images are displayed via SAOIMAGE, while spectra are plotted using the public plotting package, XMGR. Finally, the version of StarView described here features screens designed for observers preparing Cycle 5 HST proposals.

  2. Primer on tritium safe handling practices

    SciTech Connect

    Not Available

    1994-12-01

    This Primer is designed for use by operations and maintenance personnel to improve their knowledge of tritium safe handling practices. It is applicable to many job classifications and can be used as a reference for classroom work or for self-study. It is presented in general terms for use throughout the DOE Complex. After reading it, one should be able to: describe methods of measuring airborne tritium concentration; list types of protective clothing effective against tritium uptake from surface and airborne contamination; name two methods of reducing the body dose after a tritium uptake; describe the most common method for determining amount of tritium uptake in the body; describe steps to take following an accidental release of airborne tritium; describe the damage to metals that results from absorption of tritium; explain how washing hands or showering in cold water helps reduce tritium uptake; and describe how tritium exchanges with normal hydrogen in water and hydrocarbons.

  3. Formaldehyde as hypothetical primer of biohomochirality

    SciTech Connect

    Goldanskii, V.I.

    1996-07-01

    One of the most intriguing and crucial problems of the prebiotic evolution and the origin of life is the explanation of the origin of biohomochirality. A scheme of conversions originated by formaldehyde (FA) as hypothetical primer of biohomochirality is proposed. The merit of FA as executor of this function is based -inter alia - on the distinguished role of FA as one of the earliest and simplest molecules in both warm, terrestrial and cold, extraterrestrial scenarios of the origin of life. The confirmation of the role of FA as primer of biohomochirality would support the option of an RNA world as an alternative to the protein world. The suggested hypothesis puts forward for the first time a concrete sequence of chemical reactions which can lead to biohomochirality. The spontaneous breaking of the mirror symmetry is secured by the application of the well-known Frank scheme (combination of autocatalysis and {open_quote}{open_quote}annihilation{close_quote}{close_quote} of L and D enantiomers) to the series of interactions of FA {open_quote}{open_quote}trimers{close_quote}{close_quote} (i.e. C{sub 3}H{sub 6}O{sub 3} compounds) of (aaa), (apa) and (app) types, where the monomeric groups (a) means {open_quote}{open_quote}achirons{close_quote}{close_quote} (a=CH{sub n}, n{ge}2 and C=M, M=C,O) and (p) mean {open_quote}{open_quote}prochirons{close_quote}{close_quote} (p=HC{asterisk}OM, M=H,C). {copyright} {ital 1996 American Institute of Physics.}

  4. Kentucky State Primer. A Primer on Developing Kentucky's Landfill Gas-to-Energy Potential

    NASA Astrophysics Data System (ADS)

    2000-05-01

    Throughout the country, the number of landfill gas-to-energy (LFGTE) projects is growing. Recovering methane gas at solid waste landfills provides significant environmental and economic benefits by eliminating methane emissions while capturing the emissions energy value. The methane captured from landfills can be transformed into a cost-effective fuel source for generating electricity and heat, firing boilers, or even powering vehicles. Permits, incentive programs, and policies for LFGTE project development vary greatly from state to state. To guide LFGTE project developers through the state permitting process and to help them to take advantage of state incentive programs, the U.S. Environmental Protection Agencys (EPAs) Landfill Methane Outreach Program (LMOP) has worked with state agencies to develop individual primers for states participating in the State Ally Program. By presenting the latest information on federal and state regulations and incentives affecting LFGTE projects in this primer, the LMOP and Kentucky state officials hope to facilitate development of many of the landfills listed in Table A. To develop this primer, the Commonwealth of Kentucky identified all the permits and funding programs that could apply to LFGTE projects developed in Kentucky. It should be noted, however, that the regulations, agencies, and policies described are subject to change. Changes are likely to occur whenever a state legislature meets, or when the federal government imposes new directions on state and local governments. LFGTE project developers should verify and continuously monitor the status of laws and rules that might affect their plans or the operations of their projects.

  5. AFLP analysis reveals high genetic diversity but low population structure in Coccidioides posadasii isolates from Mexico and Argentina

    PubMed Central

    2013-01-01

    Background Coccidioides immitis and C. posadasii cause coccidioidomycosis, a disease that is endemic to North and South America, but for Central America, the incidence of coccidioidomycosis has not been clearly established. Several studies suggest genetic variability in these fungi; however, little definitive information has been discovered about the variability of Coccidioides fungi in Mexico (MX) and Argentina (AR). Thus, the goals for this work were to study 32 Coccidioides spp. isolates from MX and AR, identify the species of these Coccidioides spp. isolates, analyse their phenotypic variability, examine their genetic variability and investigate the Coccidioides reproductive system and its level of genetic differentiation. Methods Coccidioides spp. isolates from MX and AR were taxonomically identified by phylogenetic inference analysis using partial sequences of the Ag2/PRA gene and their phenotypic characteristics analysed. The genetic variability, reproductive system and level of differentiation were estimated using AFLP markers. The level of genetic variability was assessed measuring the percentage of polymorphic loci, number of effective allele, expected heterocygosity and Index of Association (IA). The degree of genetic differentiation was determined by AMOVA. Genetic similarities among isolates were estimated using Jaccard index. The UPGMA was used to contsruct the corresponding dendrogram. Finally, a network of haplotypes was built to evaluate the genealogical relationships among AFLP haplotypes. Results All isolates of Coccidioides spp. from MX and AR were identified as C. posadasii. No phenotypic variability was observed among the C. posadasii isolates from MX and AR. Analyses of genetic diversity and population structure were conducted using AFLP markers. Different estimators of genetic variability indicated that the C. posadasii isolates from MX and AR had high genetic variability. Furthermore, AMOVA, dendrogram and haplotype network showed a small

  6. Uncoupling primer and releaser responses to pheromone in honey bees

    NASA Astrophysics Data System (ADS)

    Grozinger, Christina M.; Fischer, Patrick; Hampton, Jacob E.

    2007-05-01

    Pheromones produce dramatic behavioral and physiological responses in a wide variety of species. Releaser pheromones elicit rapid responses within seconds or minutes, while primer pheromones produce long-term changes which may take days to manifest. Honeybee queen mandibular pheromone (QMP) elicits multiple distinct behavioral and physiological responses in worker bees, as both a releaser and primer, and thus produces responses on vastly different time scales. In this study, we demonstrate that releaser and primer responses to QMP can be uncoupled. First, treatment with the juvenile hormone analog methoprene leaves a releaser response (attraction to QMP) intact, but modulates QMP’s primer effects on sucrose responsiveness. Secondly, two components of QMP (9-ODA and 9-HDA) do not elicit a releaser response (attraction) but are as effective as QMP at modulating a primer response, downregulation of foraging-related brain gene expression. These results suggest that different responses to a single pheromone may be produced via distinct pathways.

  7. DNA sequencing technology, walking with modular primers. Final report

    SciTech Connect

    Ulanovsky, L.

    1996-12-31

    The success of the Human Genome Project depends on the development of adequate technology for rapid and inexpensive DNA sequencing, which will also benefit biomedical research in general. The authors are working on DNA technologies that eliminate primer synthesis, the main bottleneck in sequencing by primer walking. They have developed modular primers that are assembled from three 5-mer, 6-mer or 7-mer modules selected from a presynthesized library of as few as 1,000 oligonucleotides ({double_bond}4, {double_bond}5, {double_bond}7). The three modules anneal contiguously at the selected template site and prime there uniquely, even though each is not unique for the most part when used alone. This technique is expected to speed up primer walking 30 to 50 fold, and reduce the sequencing cost by a factor of 5 to 15. Time and expensive will be saved on primer synthesis itself and even more so due to closed-loop automation of primer walking, made possible by the instant availability of primers. Apart from saving time and cost, closed-loop automation would also minimize the errors and complications associated with human intervention between the walks. The author has also developed two additional approaches to primer-library based sequencing. One involves a branched structure of modular primers which has a distinctly different mechanism of achieving priming specificity. The other introduces the concept of ``Differential Extension with Nucleotide Subsets`` as an approach increasing priming specificity, priming strength and allowing cycle sequencing. These approaches are expected to be more robust than the original version of the modular primer technique.

  8. Diversity of methane-cycling archaea in hydrothermal sediment investigated by general and group-specific PCR primers.

    PubMed

    Lever, Mark A; Teske, Andreas P

    2015-02-01

    The zonation of anaerobic methane-cycling Archaea in hydrothermal sediment of Guaymas Basin was studied by general primerpairs (mcrI, ME1/ME2, mcrIRD) targeting the alpha subunit of methyl coenzyme M reductase gene (mcrA) and by new group specific mcrA and 16S rRNA gene primer pairs. The mcrIRD primer pair outperformed the other general mcrA primer pairs indetection sensitivity and phylogenetic coverage. Methanotrophic ANME-1 Archaea were the only group detected with group specific primers only. The detection of 14 mcrA lineages surpasses the diversity previously found in this location. Most phylotypes have high sequence similarities to hydrogenotrophs, methylotrophs, and anaerobic methanotrophs previously detected at Guaymas Basin or at hydrothermal vents, cold seeps, and oil reservoirs worldwide. Additionally, five mcrA phylotypes belonging to newly defined lineages are detected. Two of these belong to deeply branching new orders, while the others are new species or genera of Methanopyraceae and Methermicoccaceae. Downcore diversity decreases from all groups detected in the upper 6 cm(2 to 40 °C, sulfate measurable to 4 cm) to only two groups below 6 cm (>40 °C). Despite the presence of hyperthermophilic genera (Methanopyrus, Methanocaldococcus) in cooler surface strata, no genes were detected below 10 cm (>60 °C). While mcrAbased and 16S rRNA gene-based community compositions are generally congruent, the deeply branching mcrA cannot be assigned to specific 16S rRNA gene lineages. Our study indicates that even among well-studied metabolic groups and in previously characterized model environments, major evolutionary branches are overlooked. Detecting these groups by improved molecular biological methods is a crucial first step toward understanding their roles in nature.

  9. Existence of best proximity pairs and equilibrium pairs

    NASA Astrophysics Data System (ADS)

    Kim, Won Kyu; Lee, Kyoung Hee

    2006-04-01

    In this paper, using the fixed point theorem for Kakutani factorizable multifunctions, we shall prove new existence theorems of best proximity pairs and equilibrium pairs for free abstract economies, which include the previous fixed point theorems and equilibrium existence theorems.

  10. Primer on electricity futures and other derivatives

    SciTech Connect

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  11. Cryptococcal meningitis due to Cryptococcus neoformans genotype AFLP1/VNI in Iran: a review of the literature.

    PubMed

    Badali, Hamid; Alian, Shahriar; Fakhim, Hamed; Falahatinejad, Mahsa; Moradi, Ali; Mohammad Davoudi, Mehrnaz; Hagen, Ferry; Meis, Jacques F

    2015-12-01

    Cryptococcal meningitis is the most important opportunistic fungal infection with a high mortality in HIV-patients in less developed regions. Here, we report a case of cryptococcal meningitis in a 49-year-old HIV-positive female due to Cryptococcus neoformans (serotype A, mating-type alpha, genotype AFLP1/VNI) in Sari, Iran. In vitro antifungal susceptibility tests showed MICs of isavuconazole (0.016 μg ml(-1) ), voriconazole (0.031 μg ml(-1) ), posaconazole (0.031 μg ml(-1) ), itraconazole (0.063 μg ml(-1) ), amphotericin B (0.125 μg ml(-1) ) and fluconazole (8 μg ml(-1) ). Despite immediate antifungal therapy, the patient died 4 days later due to respiratory failure. Cryptococcal infections have been infrequently reported from Iran and therefore we analysed all published cases of cryptococcosis in Iran since the first reported case from 1969.

  12. Specific primer sets used to amplify by PCR the hepatitis B virus overlapping S/Pol region select different viral variants.

    PubMed

    Cuestas, M L; Mathet, V L; Oubiña, J R

    2012-10-01

    PCR detection of viral genomes has provided new insights into viral diagnosis. Nowadays, it is the most frequently used nucleic acid testing (qualitative and quantitative) technique. The aim of this study was to analyse the major circulating hepatitis B virus (HBV) variants PCR-amplified by three sets of primers in a patient infected with genotype E. The HBV S/Pol overlapping genomic region was amplified from the serum of an infected child using three primer sets previously described. Sequence analysis corresponding to the HBV S/Pol region revealed the presence of different viral populations depending on the set of primers used. D144A S-escape mutant was detected with two of the primer sets, while the rtL217R mutant within the Pol - conferring resistance to Adefovir - could be picked up with a different pair of primer sets. This study undoubtedly implies that the description of viral polymorphisms should be stated together with the sequence of the primers used for PCR amplification when studies of escape and/or antiviral-resistant HBV mutants are carried out.

  13. Specific primer sets used to amplify by PCR the hepatitis B virus overlapping S/Pol region select different viral variants.

    PubMed

    Cuestas, M L; Mathet, V L; Oubiña, J R

    2012-10-01

    PCR detection of viral genomes has provided new insights into viral diagnosis. Nowadays, it is the most frequently used nucleic acid testing (qualitative and quantitative) technique. The aim of this study was to analyse the major circulating hepatitis B virus (HBV) variants PCR-amplified by three sets of primers in a patient infected with genotype E. The HBV S/Pol overlapping genomic region was amplified from the serum of an infected child using three primer sets previously described. Sequence analysis corresponding to the HBV S/Pol region revealed the presence of different viral populations depending on the set of primers used. D144A S-escape mutant was detected with two of the primer sets, while the rtL217R mutant within the Pol - conferring resistance to Adefovir - could be picked up with a different pair of primer sets. This study undoubtedly implies that the description of viral polymorphisms should be stated together with the sequence of the primers used for PCR amplification when studies of escape and/or antiviral-resistant HBV mutants are carried out. PMID:22967107

  14. Revisiting AFLP fingerprinting for an unbiased assessment of genetic structure and differentiation of taurine and zebu cattle

    PubMed Central

    2014-01-01

    Background Descendants from the extinct aurochs (Bos primigenius), taurine (Bos taurus) and zebu cattle (Bos indicus) were domesticated 10,000 years ago in Southwestern and Southern Asia, respectively, and colonized the world undergoing complex events of admixture and selection. Molecular data, in particular genome-wide single nucleotide polymorphism (SNP) markers, can complement historic and archaeological records to elucidate these past events. However, SNP ascertainment in cattle has been optimized for taurine breeds, imposing limitations to the study of diversity in zebu cattle. As amplified fragment length polymorphism (AFLP) markers are discovered and genotyped as the samples are assayed, this type of marker is free of ascertainment bias. In order to obtain unbiased assessments of genetic differentiation and structure in taurine and zebu cattle, we analyzed a dataset of 135 AFLP markers in 1,593 samples from 13 zebu and 58 taurine breeds, representing nine continental areas. Results We found a geographical pattern of expected heterozygosity in European taurine breeds decreasing with the distance from the domestication centre, arguing against a large-scale introgression from European or African aurochs. Zebu cattle were found to be at least as diverse as taurine cattle. Western African zebu cattle were found to have diverged more from Indian zebu than South American zebu. Model-based clustering and ancestry informative markers analyses suggested that this is due to taurine introgression. Although a large part of South American zebu cattle also descend from taurine cows, we did not detect significant levels of taurine ancestry in these breeds, probably because of systematic backcrossing with zebu bulls. Furthermore, limited zebu introgression was found in Podolian taurine breeds in Italy. Conclusions The assessment of cattle diversity reported here contributes an unbiased global view to genetic differentiation and structure of taurine and zebu cattle

  15. PD5: A General Purpose Library for Primer Design Software

    PubMed Central

    Riley, Michael C.; Aubrey, Wayne; Young, Michael; Clare, Amanda

    2013-01-01

    Background Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. Results The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C++ with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. Conclusions The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: http://code.google.com/p/primer-design PMID:24278254

  16. On the mechanism of the modular primer effect.

    PubMed Central

    Beskin, A D; Zevin-Sonkin, D; Sobolev, I A; Ulanovsky, L E

    1995-01-01

    Modular primers are strings of three contiguously annealed unligated oligonucleotides (modules) as short as 5- or 6-mers, selected from a presynthesized library. It was previously found that such strings can prime DNA sequencing reactions specifically, thus eliminating the need for the primer synthesis step in DNA sequencing by primer walking. It has remained largely a mystery why modular primers prime uniquely, while a single module, used alone in the same conditions, often shows alternative priming of comparable strength. In a puzzling way, the single module, even in a large excess over the template, no longer primes at the alternative sites, when modules with which it can form a contiguous string are also present. Here we describe experiments indicating that this phenomenon cannot be explained by cooperative annealing of the modules to the template. Instead, the mechanism seems to involve competition between different primers for the available polymerase. In this competition, the polymerase is preferentially engaged by longer primers, whether modular or conventional, at the expense of shorter primers, even though the latter can otherwise prime with similar or occasionally higher efficiency. Images PMID:7659510

  17. A multiplex set of species-specific primers for rapid identification of members of the genus Saccharomyces.

    PubMed

    Muir, Alastair; Harrison, Elizabeth; Wheals, Alan

    2011-11-01

    The Saccharomyces genus (previously Saccharomyces sensu stricto) formally comprises Saccharomyces arboricola, Saccharomyces bayanus, Saccharomyces cariocanus, Saccharomyces cerevisiae, Saccharomyces kudriavzevii, Saccharomyces mikatae, Saccharomyces paradoxus and Saccharomyces pastorianus. Species-specific primer pairs that produce a single band of known and different product size have been developed for each member of the clade with the exception of S. pastorianus, which is a polyphyletic allopolyploid hybrid only found in lager breweries, and for which signature sequences could not be reliably created. Saccharomyces cariocanus is now regarded as an American variant of S. paradoxus, and accordingly a single primer pair that recognizes both species was developed. A different orthologous and essential housekeeping gene was used to detect each species, potentially avoiding competition between PCR primers and overlap between amplicons. In multiplex format, two or more different species could be identified in a single reaction; double and triple hybrids could not always be correctly identified. Forty-two unidentified yeasts from sugar cane juice fermentations were correctly identified as S. cerevisiae. A colony PCR method was developed that is rapid, robust, inexpensive and capable of automation, requires no mycological expertise on the part of the user and is thus useful for large-scale preliminary screens.

  18. Comparison between Mt-DNA D-Loop and Cyt B primers for porcine DNA detection in meat products

    NASA Astrophysics Data System (ADS)

    Hamzah, Azhana; Mutalib, Sahilah Abd.; Babji, Abdul Salam

    2013-11-01

    This study was conducted to detect the presence of porcine DNA in meat products in the market using conventional polymerase chain reaction (PCR) and commercial PCR-southern hybridization analysis. Porcine DNA detection in meat products was tested due to some issues associated with the adulteration of food products in Malaysia. This is an important issue especially for Halal authentication which is required for some religious practices such as in Islam and Hinduisms. Many techniques have been developed for determining the Halal status of food products. In this paper, mt-DNA D-loop primer and cytochrome (cyt) b were used to detect the presence of porcine DNA in meat products. Positive and negative controls were always present for each batch of extraction. DNA of raw pork meat was used as a positive control while nucleus free water is used as negative control. A pair of oligonucleotide primer was used namely Pork1 and Pork2 which produced amplicon of 531 base pair (bp) in size. While, PCR-southern hybridization was conducted using primers readily supplied by commercial PCR-Southern hybridization and produced amplicon with 276 bp in size. In the present study, demonstrated that none of the samples were contaminated with porcine residuals but selected samples with pork meat were positive. The species-specific PCR amplification yielded excellent results for identification of pork derivatives in food products and it is a potentially reliable and suitable technique in routine food analysis for Halal certification.

  19. A multiplex set of species-specific primers for rapid identification of members of the genus Saccharomyces.

    PubMed

    Muir, Alastair; Harrison, Elizabeth; Wheals, Alan

    2011-11-01

    The Saccharomyces genus (previously Saccharomyces sensu stricto) formally comprises Saccharomyces arboricola, Saccharomyces bayanus, Saccharomyces cariocanus, Saccharomyces cerevisiae, Saccharomyces kudriavzevii, Saccharomyces mikatae, Saccharomyces paradoxus and Saccharomyces pastorianus. Species-specific primer pairs that produce a single band of known and different product size have been developed for each member of the clade with the exception of S. pastorianus, which is a polyphyletic allopolyploid hybrid only found in lager breweries, and for which signature sequences could not be reliably created. Saccharomyces cariocanus is now regarded as an American variant of S. paradoxus, and accordingly a single primer pair that recognizes both species was developed. A different orthologous and essential housekeeping gene was used to detect each species, potentially avoiding competition between PCR primers and overlap between amplicons. In multiplex format, two or more different species could be identified in a single reaction; double and triple hybrids could not always be correctly identified. Forty-two unidentified yeasts from sugar cane juice fermentations were correctly identified as S. cerevisiae. A colony PCR method was developed that is rapid, robust, inexpensive and capable of automation, requires no mycological expertise on the part of the user and is thus useful for large-scale preliminary screens. PMID:22093682

  20. A physicists guide to The Los Alamos Primer

    NASA Astrophysics Data System (ADS)

    Reed, B. Cameron

    2016-11-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer, which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons.

  1. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

    2013-08-08

    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether theremore » are also TaqMan/Luminex probe matches within predicted amplicons.« less

  2. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

    SciTech Connect

    Gardner, S. N.

    2013-08-08

    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

  3. Regulated incorporation of two different metal ions into programmed sites in a duplex by DNA polymerase catalyzed primer extension.

    PubMed

    Funai, Tatsuya; Nakamura, Junko; Miyazaki, Yuki; Kiriu, Risa; Nakagawa, Osamu; Wada, Shun-ichi; Ono, Akira; Urata, Hidehito

    2014-06-23

    Metal-mediated base pairs formed by the coordination of metal ions to natural or artificial bases impart unique chemical and physical properties to nucleic acids and have attracted considerable interest in the field of nanodevices. Ag(I) ions were found to mediate DNA polymerase catalyzed primer extension through the formation of a C-Ag(I)-T base pair, as well as the previously reported C-Ag(I)-A base pair. The comparative susceptibility of dNTPs to Ag(I)-mediated enzymatic incorporation into the site opposite cytosine in the template was shown to be dATP>dTTP≫dCTP. Furthermore, two kinds of metal ions, Ag(I) and Hg(II), selectively mediate the incorporation of thymidine 5'-triphosphate into sites opposite cytosine and thymine in the template, respectively. In other words, the regulated incorporation of different metal ions into programmed sites in the duplex by DNA polymerase was successfully achieved.

  4. Regulated incorporation of two different metal ions into programmed sites in a duplex by DNA polymerase catalyzed primer extension.

    PubMed

    Funai, Tatsuya; Nakamura, Junko; Miyazaki, Yuki; Kiriu, Risa; Nakagawa, Osamu; Wada, Shun-ichi; Ono, Akira; Urata, Hidehito

    2014-06-23

    Metal-mediated base pairs formed by the coordination of metal ions to natural or artificial bases impart unique chemical and physical properties to nucleic acids and have attracted considerable interest in the field of nanodevices. Ag(I) ions were found to mediate DNA polymerase catalyzed primer extension through the formation of a C-Ag(I)-T base pair, as well as the previously reported C-Ag(I)-A base pair. The comparative susceptibility of dNTPs to Ag(I)-mediated enzymatic incorporation into the site opposite cytosine in the template was shown to be dATP>dTTP≫dCTP. Furthermore, two kinds of metal ions, Ag(I) and Hg(II), selectively mediate the incorporation of thymidine 5'-triphosphate into sites opposite cytosine and thymine in the template, respectively. In other words, the regulated incorporation of different metal ions into programmed sites in the duplex by DNA polymerase was successfully achieved. PMID:24719384

  5. cDNA-AFLP transcriptional profiling reveals genes expressed during flower development in Oncidium Milliongolds.

    PubMed

    Qian, X; Gong, M J; Wang, C X; Tian, M

    2014-01-01

    The flower developmental process, which is crucial to the whole lifecycle of higher plants, is influenced by both environmental and endogenous factors. The genus Oncidium is commercially important for cut flower and houseplant industry and is ideal for flower development studies. Using cDNA-amplified restriction fragment length polymorphism analysis, we profiled transcripts that are differentially expressed during flower development of Oncidium Milliongolds. A total of 15,960 transcript-derived fragments were generated, with 114 primer sets. Of these, 1248 were sequenced, producing 993 readable sequences. BLASTX/N analysis showed that 833 of the 993 transcripts showed homology to genes in the NCBI databases, exhibiting functions involved in various processes, such as signal transduction, energy conversion, metabolism, and gene expression regulation. The full-length mRNAs of SUCROSE SYNTHASE 1 (SUS1) and LEAFY (LFY) were cloned, and their expression patterns were characterized. The results showed that the expression levels of SUS1 and LFY were similar during flower development. To confirm the function of SUS1 in flower buds, carbohydrate content and sucrose synthase activity were determined. The results showed that changes in sucrose content and sucrose synthase activity reflected SUS1 expression levels. Collectively, these results indicate that SUS1 influences flower development by regulating LFY expression levels through changing the sucrose content of flower buds.

  6. Multiprocessor switch with selective pairing

    DOEpatents

    Gara, Alan; Gschwind, Michael K; Salapura, Valentina

    2014-03-11

    System, method and computer program product for a multiprocessing system to offer selective pairing of processor cores for increased processing reliability. A selective pairing facility is provided that selectively connects, i.e., pairs, multiple microprocessor or processor cores to provide one highly reliable thread (or thread group). Each paired microprocessor or processor cores that provide one highly reliable thread for high-reliability connect with a system components such as a memory "nest" (or memory hierarchy), an optional system controller, and optional interrupt controller, optional I/O or peripheral devices, etc. The memory nest is attached to a selective pairing facility via a switch or a bus

  7. Prospective very young asteroid pairs

    NASA Astrophysics Data System (ADS)

    Galád, A.; Vokrouhlický, D.; Zizka, J.

    2014-07-01

    Several tens of asteroid pairs can be discerned from the background main-belt asteroids. The majority of them are thought to have formed within only the last few 10^6 yr. The youngest recognized pairs have formed more than ≈ 10 kyr ago. As some details of pair formation are still not understood well, the study of young pairs is of great importance. It is mainly because the conditions at the time of the pair formation could be deduced much more reliably for young pairs. For example, space weathering on the surfaces of the components, or changes in their rotational properties (in spin rates, tumbling, coordinates of rotational pole) could be negligible since the formation of young pairs. Also, possible strong perturbations by main-belt bodies on pair formation can be reliably studied only for extremely young pairs. Some pairs can quickly blend in with the background asteroids, so even the frequency of asteroid pair formation could be determined more reliably based on young pairs (though only after a statistically significant sample is at disposal). In our regular search for young pairs in the growing asteroid database, only multiopposition asteroids with very similar orbital and proper elements are investigated. Every pair component is represented by a number of clones within orbital uncertainties and drifting in semimajor axis due to the Yarkovsky effect. We found that, if the previously unrecognized pairs (87887) 2000 SS_{286} - 2002 AT_{49} and (355258) 2007 LY_{4} - 2013AF_{40} formed at the recent very close approach of their components, they could become the youngest known pairs. In both cases, the relative encounter velocities of the components were only ˜ 0.1 m s^{-1}. However, the minimum distances between some clones are too large and a few clones of the latter pair did not encounter recently (within ≈ 10 kyr). The age of some prospective young pairs cannot be determined reliably without improved orbital properties (e.g., the second component of a pair

  8. BTSC VAPOR INSTRUSION PRIMER "VAPOR INTRUSION CONSIDERATION FOR REDEVELOPMENT"

    EPA Science Inventory

    This primer is designed for brownfields stakeholders concerned about vapor intrusion, including property owners, real estate developers, and contractors performing environmental site investigations. It provides an overview of the vapor intrusion issue and how it can impact the ap...

  9. New primers for DNA barcoding of digeneans and cestodes (Platyhelminthes).

    PubMed

    Van Steenkiste, Niels; Locke, Sean A; Castelin, Magalie; Marcogliese, David J; Abbott, Cathryn L

    2015-07-01

    Digeneans and cestodes are species-rich taxa and can seriously impact human health, fisheries, aqua- and agriculture, and wildlife conservation and management. DNA barcoding using the COI Folmer region could be applied for species detection and identification, but both 'universal' and taxon-specific COI primers fail to amplify in many flatworm taxa. We found that high levels of nucleotide variation at priming sites made it unrealistic to design primers targeting all flatworms. We developed new degenerate primers that enabled acquisition of the COI barcode region from 100% of specimens tested (n = 46), representing 23 families of digeneans and 6 orders of cestodes. This high success rate represents an improvement over existing methods. Primers and methods provided here are critical pieces towards redressing the current paucity of COI barcodes for these taxa in public databases.

  10. Multiple origins of asteroid pairs

    NASA Astrophysics Data System (ADS)

    Jacobson, Seth A.

    2016-01-01

    Rotationally fissioned asteroids produce unbound asteroid pairs that have very similar heliocentric orbits. Backward integration of their current heliocentric orbits provides an age of closest proximity that can be used to date the rotational fission event. Most asteroid pairs follow a predicted theoretical relationship between the primary spin period and the mass ratio of the two pair members that is a direct consequence of the YORP-induced rotational fission hypothesis. If the progenitor asteroid has strength, asteroid pairs may have higher mass ratios or faster rotating primaries. However, the process of secondary fission leaves the originally predicted trend unaltered. We also describe the characteristics of pair members produced by four alternative routes from a rotational fission event to an asteroid pair. Unlike direct formation from the event itself, the age of closest proximity of these pairs cannot generally be used to date the rotational fission event since considerable time may have passed.

  11. An apricot (Prunus armeniaca L.) F2 progeny linkage map based on SSR and AFLP markers, mapping plum pox virus resistance and self-incompatibility traits.

    PubMed

    Vilanova, S; Romero, C; Abbott, A G; Llácer, G; Badenes, M L

    2003-07-01

    A genetic linkage map of apricot ( Prunus armeniaca L.) was constructed using AFLP and SSR markers. The map is based on an F(2) population (76 individuals) derived from self-pollination of an F(1) individual ('Lito') originated from a cross between 'Stark Early Orange' and 'Tyrinthos'. This family, designated as 'Lito' x 'Lito', segregated for two important agronomical traits: plum pox virus resistance (PPV) and self-incompatibility. A total of 211 markers (180 AFLPs, 29 SSRs and two agronomic traits) were assigned to 11 linkage groups covering 602 cM of the apricot genome. The average distance (cM/marker) between adjacent markers is 3.84 cM. The PPV resistance trait was mapped on linkage group G1 and the self-incompatibility trait was mapped on linkage group G6. Twenty two loci held in common with other Prunus maps allowed us to compare and establish homologies among the respective linkage groups.

  12. Comparison of RAPD, AFLP, and EF-1α Sequences for the Phylogenetic Analysis of Fusarium oxysporum and Its formae speciales in Korea.

    PubMed

    Park, Jae-Min; Kim, Gi-Young; Lee, Song-Jin; Kim, Mun-Ok; Huh, Man-Kyu; Lee, Tae-Ho; Lee, Jae-Dong

    2006-06-01

    Although Fursarium oxysporum causes diseases in economically important plant hosts, identification of F. oxysporum formae speciales has been difficult due to confusing phenotypic classification systems. To resolve these complexity, we evaluated genetic relationship of nine formae speciales of F. oxysporum with random amplified polymorphic DNA (RAPD), amplified fragment length polymorphism (AFLP), and translation elongation factor-1 alpha (EF-1α) gene. In addition, the correlation between mycotoxin content of fusaric acid and isolates based on molecular marker data was evaluated using the modified Mantel's test. According to these result, these fusaric acid-producing strains could not identify clearly, and independent of geographic locations and host specificities. However, in the identification of F. oxysporum formae speciales, especially, AFLP analysis showed a higher discriminatory power than that of a the RAPD and EF-1α analyses, all three techniques were able to detect genetic variability among F. oxysporum formae speciales in this study. PMID:24039470

  13. Stereo Pair, Honolulu, Oahu

    NASA Technical Reports Server (NTRS)

    2000-01-01

    Honolulu, on the island of Oahu, is a large and growing urban area. This stereoscopic image pair, combining a Landsat image with topography measured by the Shuttle Radar Topography Mission (SRTM), shows how topography controls the urban pattern. This color image can be viewed in 3-D by viewing the left image with the right eye and the right image with the left eye (cross-eyed viewing), or by downloading and printing the image pair, and viewing them with a stereoscope.

    Features of interest in this scene include Diamond Head (an extinct volcano near the bottom of the image), Waikiki Beach (just above Diamond Head), the Punchbowl National Cemetary (another extinct volcano, near the image center), downtown Honolulu and Honolulu harbor (image left-center), and offshore reef patterns. The slopes of the Koolau mountain range are seen in the right half of the image. Clouds commonly hang above ridges and peaks of the Hawaiian Islands, but in this synthesized stereo rendition appear draped directly on the mountains. The clouds are actually about 1000 meters (3300 feet) above sea level.

    This stereoscopic image pair was generated using topographic data from the Shuttle Radar Topography Mission, combined with a Landsat 7 Thematic Mapper image collected at the same time as the SRTM flight. The topography data were used to create two differing perspectives, one for each eye. When stereoscopically merged, the result is a vertically exaggerated view of the Earth's surface in its full three dimensions. The United States Geological Survey's Earth Resources Observations Systems (EROS) Data Center, Sioux Falls, South Dakota, provided the Landsat data.

    The Shuttle Radar Topography Mission (SRTM), launched on February 11, 2000, used the same radar instrument that comprised the Spaceborne Imaging Radar-C/X-Band Synthetic Aperture Radar (SIR-C/X-SAR) that flew twice on the Space Shuttle Endeavour in 1994. The mission was designed to collect three-dimensional measurements of the

  14. Stereo Pair, Pasadena, California

    NASA Technical Reports Server (NTRS)

    2000-01-01

    This stereoscopic image pair is a perspective view that shows the western part of the city of Pasadena, California, looking north toward the San Gabriel Mountains. Portions of the cities of Altadena and La Canada Flintridge are also shown. The cluster of large buildings left of center, at the base of the mountains, is the Jet Propulsion Laboratory. This image shows the power of combining data from different sources to create planning tools to study problems that affect large urban areas. In addition to the well-known earthquake hazards, Southern California is affected by a natural cycle of fire and mudflows. Data shown in this image can be used to predict both how wildfires spread over the terrain and how mudflows are channeled down the canyons.

    The image was created from three datasets: the Shuttle Radar Topography Mission (SRTM) supplied the elevation, U. S. Geological Survey digital aerial photography provided the image detail, and the Landsat Thematic Mapper provided the color. The United States Geological Survey's Earth Resources Observations Systems (EROS) Data Center, Sioux Falls, South Dakota, provided the Landsat data and the aerial photography. The image can be viewed in 3-D by viewing the left image with the right eye and the right image with the left eye (cross-eyed viewing), or by downloading and printing the image pair, and viewing them with a stereoscope.

    The Shuttle Radar Topography Mission (SRTM), launched on February 11, 2000, used the same radar instrument that comprised the Spaceborne Imaging Radar-C/X-Band Synthetic Aperture Radar (SIR-C/X-SAR) that flew twice on the Space Shuttle Endeavour in 1994. The mission was designed to collect three-dimensional measurements of the Earth's surface. To collect the 3-D data, engineers added a 60-meter-long (200-foot) mast, an additional C-band imaging antenna and improved tracking and navigation devices. The mission is a cooperative project between the National Aeronautics and Space Administration

  15. Genotypic Characterization of Yersinia enterocolitica Biotype 4/O:3 Isolates from Pigs and Slaughterhouses Using SE-AFLP, ERIC-PCR, and PFGE

    PubMed Central

    Moreno, Luisa Zanolli; Sena de Gobbi, Débora Dirani; Raimundo, Daniele Cristine; Ferreira, Thais Sebastiana Porfida; Spindola, Maria Garcia; Hofer, Ernesto; Falavina dos Reis, Cristhiane Moura; Matté, Maria Helena; Micke Moreno, Andrea

    2013-01-01

    Yersinia enterocolitica is a foodborne pathogen that causes illness in humans and animals. The biotype 4/O:3 has been commonly associated with yersiniosis and is characterized by the presence of chromosomal and extra-chromosomal virulence genes. Molecular typing methods have been successfully used to characterize Y. enterocolitica genetic heterogeneity and to study the epidemiology of the bacteria from different origins. In this study, 320 Y. enterocolitica biotype 4/O:3 isolates originating in pigs and slaughterhouses were characterized according to the virulence profile, and 61 isolates were typified through SE-AFLP, ERIC-PCR, and PFGE techniques. The majority of the isolates originated from pigs, and the predominant virulence profile was ail+ virF+ rfbC+ ystA+, representing 83.4% of the tested isolates. All of the Y. enterocolitica 4/O:3 isolates were positive for at least ystA gene. The SE-AFLP and ERIC-PCR patterns were highly homogeneous. The SE-AFLP was more discriminative than the ERIC-PCR and tended to cluster isolates according to the slaughterhouse. Despite the limited genetic diversity of Y. enterocolitica 4/O:3, PFGE was shown to be the most discriminative technique considering one band of difference. Fattening pigs proved to be an important reservoir of Y. enterocolitica biotype 4/O:3 carrying virulence genes. PMID:23819054

  16. Application of sliding-window discretization and minimization of stochastic complexity for the analysis of fAFLP genotyping fingerprint patterns of Vibrionaceae.

    PubMed

    Dawyndt, Peter; Thompson, Fabiano L; Austin, Brian; Swings, Jean; Koski, Timo; Gyllenberg, Mats

    2005-01-01

    Minimization of stochastic complexity (SC) was used as a method for classification of genotypic fingerprints. The method was applied to fluorescent amplified fragment length polymorphism (fAFLP) fingerprint patterns of 507 Vibrionaceae representatives. As the current BinClass implementation of the optimization algorithm for classification only works on binary vectors, the original fingerprints were discretized in a preliminary step using the sliding-window band-matching method, in order to maximally preserve the information content of the original band patterns. The novel classification generated using the BinClass software package was subjected to an in-depth comparison with a hierarchical classification of the same dataset, in order to acknowledge the applicability of the new classification method as a more objective algorithm for the classification of genotyping fingerprint patterns. Recent DNA-DNA hybridization and 16S rRNA gene sequence experiments proved that the classification based on SC-minimization forms separate clusters that contain the fAFLP patterns for all representatives of the species Enterovibrio norvegicus, Vibrio fortis, Vibrio diazotrophicus or Vibrio campbellii, while previous hierarchical cluster analysis had suggested more heterogeneity within the fAFLP patterns by splitting the representatives of the above-mentioned species into multiple distant clusters. As a result, the new classification methodology has highlighted some previously unseen relationships within the biodiversity of the family Vibrionaceae.

  17. Pygmy stars: first pair.

    PubMed

    Zwicky, F

    1966-07-01

    The binary LP 101-15/16 having the proper motion of 1.62 seconds of arc per year has been studied with the prime-focus spectrograph of the 200-inch (508 cm) telescope. Indications are that LP 101-15/16 is the first pair of pygmy stars ever discovered. One of its components, LP 101-16, is probably a blue pygmy star which is at least four magnitudes fainter than the ordinary white dwarfs. Also, two of the Balmer lines in absorption appear to be displaced toward the red by amounts which indicate the existence of an Einstein gravitational red shift corresponding to about 1000 km sec-1. On the other hand LP 101-15 is red and shows an entirely new type of spectrum, which suggests that it may be a first representative of a type of red pygmy star which is 2.5 magnitudes fainter than the M-type dwarf stars of the main sequence. PMID:17730606

  18. Pygmy stars: first pair.

    PubMed

    Zwicky, F

    1966-07-01

    The binary LP 101-15/16 having the proper motion of 1.62 seconds of arc per year has been studied with the prime-focus spectrograph of the 200-inch (508 cm) telescope. Indications are that LP 101-15/16 is the first pair of pygmy stars ever discovered. One of its components, LP 101-16, is probably a blue pygmy star which is at least four magnitudes fainter than the ordinary white dwarfs. Also, two of the Balmer lines in absorption appear to be displaced toward the red by amounts which indicate the existence of an Einstein gravitational red shift corresponding to about 1000 km sec-1. On the other hand LP 101-15 is red and shows an entirely new type of spectrum, which suggests that it may be a first representative of a type of red pygmy star which is 2.5 magnitudes fainter than the M-type dwarf stars of the main sequence.

  19. TSUNAMI Primer: A Primer for Sensitivity/Uncertainty Calculations with SCALE

    SciTech Connect

    Rearden, Bradley T; Mueller, Don; Bowman, Stephen M; Busch, Robert D.; Emerson, Scott

    2009-01-01

    This primer presents examples in the application of the SCALE/TSUNAMI tools to generate k{sub eff} sensitivity data for one- and three-dimensional models using TSUNAMI-1D and -3D and to examine uncertainties in the computed k{sub eff} values due to uncertainties in the cross-section data used in their calculation. The proper use of unit cell data and need for confirming the appropriate selection of input parameters through direct perturbations are described. The uses of sensitivity and uncertainty data to identify and rank potential sources of computational bias in an application system and TSUNAMI tools for assessment of system similarity using sensitivity and uncertainty criteria are demonstrated. Uses of these criteria in trending analyses to assess computational biases, bias uncertainties, and gap analyses are also described. Additionally, an application of the data adjustment tool TSURFER is provided, including identification of specific details of sources of computational bias.

  20. Pairs of promoter pairs in a web of transcription.

    PubMed

    Kaplan, Craig D

    2016-08-30

    A new analysis has characterized a fundamental building block of complex transcribed loci. Constellations of core promoters can generally be reduced to pairs of divergent transcription units, where the distance between the pairs of transcription units correlates with constraints on genomic context, which in turn contribute to transcript fate. PMID:27573684

  1. Pairs of promoter pairs in a web of transcription.

    PubMed

    Kaplan, Craig D

    2016-08-30

    A new analysis has characterized a fundamental building block of complex transcribed loci. Constellations of core promoters can generally be reduced to pairs of divergent transcription units, where the distance between the pairs of transcription units correlates with constraints on genomic context, which in turn contribute to transcript fate.

  2. Novel multiplex PCR assay using locked nucleic acid (LNA)-based universal primers for the simultaneous detection of five swine viruses.

    PubMed

    Chen, Ru; Gao, Xiao-Bo; Yu, Xiao-Lu; Song, Chang-Xu; Qiu, Yang

    2016-02-01

    A novel multiplex PCR assay using non-homologous oligonucleotides with locked nucleic acid (LNA) modifications as universal primers was developed and validated for the simultaneous detection of five swine viruses. The assay utilizes five virus-specific primer pairs modified at the 5' end through the addition of the universal primer sequence. In the reaction, small amounts of target templates with the 5' tail were generated and subsequently amplified through the extension of a LNA universal primer set. To validate the specificity of this assay, 27 viral target strains and 12 non-target pathogens were tested. The lower limit of detection of viral nucleic acids was 1.1-1.9 pg per reaction or 11-32 pg in a five-plex viral nucleic acid mixture. The LNA mPCR assay displayed higher analytical sensitivity and efficiency for the detection of plasmid standards compared with the conventional assay, which uses standard primers without the 5' tail. A total of 207 field samples were tested using both assays. The LNA mPCR assay provided numerically higher detection rates for all pathogens in independent samples. Moreover, the LNA mPCR assay had significantly higher detection rates in independent samples compared with the conventional assay. PMID:26615807

  3. Quantitative real-time PCR assay for detection of Paenibacillus polymyxa using membrane-fusion protein-based primers.

    PubMed

    Cho, Min Seok; Park, Dong Suk; Lee, Jung Won; Chi, Hee Youn; Sohn, Soo-In; Jeon, Bong-Kyun; Ma, Jong-Beom

    2012-11-01

    Paenibacillus polymyxa is known to be a plant-growthpromoting rhizobacterium. The present study describes a quantitative polymerase chain reaction (qPCR) assay for the specific detection and quantitation of P. polymyxa using a primer pair based on the sequence of a membranefusion protein for the amplification of a 268 bp DNA fragment. This study reports that the qPCR-based method is applicable for the rapid and sensitive detection of P. polymyxa and can be used as an alternative method for agricultural soil monitoring.

  4. The Neurobiologist's Guide to Structural Biology: A Primer on Why Macromolecular Structure Matters and How to Evaluate Structural Data

    PubMed Central

    Minor, Daniel L.

    2010-01-01

    Structural biology now plays a prominent role in addressing questions central to understanding how excitable cells function. Although interest in the insights gained from the definition and dissection of macromolecular anatomy is high, many neurobiologists remain unfamiliar with the methods employed. This primer aims to help neurobiologists understand approaches for probing macromolecular structure and where the limits and challenges remain. Using examples of macromolecules with neurobiological importance, the review covers X-ray crystallography, electron microscopy (EM), small-angle X-ray scattering (SAXS), and nuclear magnetic resonance (NMR) and biophysical methods with which these approaches are often paired: isothermal titration calorimetry (ITC), equilibrium analytical ultracentifugation, and molecular dynamics (MD). PMID:17521566

  5. Initialization of Formation Flying Using Primer Vector Theory

    NASA Technical Reports Server (NTRS)

    Mailhe, Laurie; Schiff, Conrad; Folta, David

    2002-01-01

    In this paper, we extend primer vector analysis to formation flying. Optimization of the classical rendezvous or free-time transfer problem between two orbits using primer vector theory has been extensively studied for one spacecraft. However, an increasing number of missions are now considering flying a set of spacecraft in close formation. Missions such as the Magnetospheric MultiScale (MMS) and Leonardo-BRDF (Bidirectional Reflectance Distribution Function) need to determine strategies to transfer each spacecraft from the common launch orbit to their respective operational orbit. In addition, all the spacecraft must synchronize their states so that they achieve the same desired formation geometry over each orbit. This periodicity requirement imposes constraints on the boundary conditions that can be used for the primer vector algorithm. In this work we explore the impact of the periodicity requirement in optimizing each spacecraft transfer trajectory using primer vector theory. We first present our adaptation of primer vector theory to formation flying. Using this method, we then compute the AV budget for each spacecraft subject to different formation endpoint constraints.

  6. Rapid and simple method of qPCR primer design.

    PubMed

    Thornton, Brenda; Basu, Chhandak

    2015-01-01

    Quantitative real-time polymerase chain reaction (qPCR) is a powerful tool for analysis and quantification of gene expression. It is advantageous compared to traditional gel-based method of PCR, as gene expression can be visualized "real-time" using a computer. In qPCR, a reporter dye system is used which intercalates with DNA's region of interest and detects DNA amplification. Some of the popular reporter systems used in qPCR are the following: Molecular Beacon(®), SYBR Green(®), and Taqman(®). However, success of qPCR depends on the optimal primers used. Some of the considerations for primer design are the following: GC content, primer self-dimer, or secondary structure formation. Freely available software could be used for ideal qPCR primer design. Here we have shown how to use some freely available web-based software programs (such as Primerquest(®), Unafold(®), and Beacon designer(®)) to design qPCR primers.

  7. Construction of an integrated pepper map using RFLP, SSR, CAPS, AFLP, WRKY, rRAMP, and BAC end sequences.

    PubMed

    Lee, Heung-Ryul; Bae, Ik-Hyun; Park, Soung-Woo; Kim, Hyoun-Joung; Min, Woong-Ki; Han, Jung-Heon; Kim, Ki-Taek; Kim, Byung-Dong

    2009-01-31

    Map-based cloning to find genes of interest, markerassisted selection (MAS), and marker-assisted breeding (MAB) all require good genetic maps with high reproducible markers. For map construction as well as chromosome assignment, development of single copy PCR-based markers and map integration process are necessary. In this study, the 132 markers (57 STS from BAC-end sequences, 13 STS from RFLP, and 62 SSR) were newly developed as single copy type PCR-based markers. They were used together with 1830 markers previously developed in our lab to construct an integrated map with the Joinmap 3.0 program. This integrated map contained 169 SSR, 354 RFLP, 23 STS from BAC-end sequences, 6 STS from RFLP, 152 AFLP, 51 WRKY, and 99 rRAMP markers on 12 chromosomes. The integrated map contained four genetic maps of two interspecific (Capsicum annuum 'TF68' and C. chinense 'Habanero') and two intraspecific (C. annuum 'CM334' and C. annuum 'Chilsungcho') populations of peppers. This constructed integrated map consisted of 805 markers (map distance of 1858 cM) in interspecific populations and 745 markers (map distance of 1892 cM) in intraspecific populations. The used pepper STS were first developed from end sequences of BAC clones from Capsicum annuum 'CM334'. This integrated map will provide useful information for construction of future pepper genetic maps and for assignment of linkage groups to pepper chromosomes.

  8. Assessing The Spatial Dependence of Adaptive Loci in 43 European and Western Asian Goat Breeds Using AFLP Markers

    PubMed Central

    Negrini, Riccardo; Nicoloso, Letizia; Crepaldi, Paola; Ajmone-Marsan, Paolo

    2014-01-01

    Background During the past decades, neutral DNA markers have been extensively employed to study demography, population genetics and structure in livestock, but less interest has been devoted to the evaluation of livestock adaptive potential through the identification of genomic regions likely to be under natural selection. Methodology/Principal findings Landscape genomics can greatly benefit the entire livestock system through the identification of genotypes better adapted to specific or extreme environmental conditions. Therefore we analyzed 101 AFLP markers in 43 European and Western Asian goat breeds both with Matsam software, based on a correlative approach (SAM), and with Mcheza and Bayescan, two FST based software able to detect markers carrying signatures of natural selection. Matsam identified four loci possibly under natural selection – also confirmed by FST-outlier methods – and significantly associated with environmental variables such as diurnal temperature range, frequency of precipitation, relative humidity and solar radiation. Conclusions/Significance These results show that landscape genomics can provide useful information on the environmental factors affecting the adaptive potential of livestock living in specific climatic conditions. Besides adding conservation value to livestock genetic resources, this knowledge may lead to the development of novel molecular tools useful to preserve the adaptive potential of local breeds during genetic improvement programs, and to increase the adaptability of industrial breeds to changing environments. PMID:24497965

  9. Extension of the core map of common bean with EST-SSR, RGA, AFLP, and putative functional markers.

    PubMed

    Hanai, Luiz Ricardo; Santini, Luciane; Camargo, Luis Eduardo Aranha; Fungaro, Maria Helena Pelegrinelli; Gepts, Paul; Tsai, Siu Mui; Vieira, Maria Lucia Carneiro

    2010-01-01

    Microsatellites and gene-derived markers are still underrepresented in the core molecular linkage map of common bean compared to other types of markers. In order to increase the density of the core map, a set of new markers were developed and mapped onto the RIL population derived from the 'BAT93' x 'Jalo EEP558' cross. The EST-SSR markers were first characterized using a set of 24 bean inbred lines. On average, the polymorphism information content was 0.40 and the mean number of alleles per locus was 2.7. In addition, AFLP and RGA markers based on the NBS-profiling method were developed and a subset of the mapped RGA was sequenced. With the integration of 282 new markers into the common bean core map, we were able to place markers with putative known function in some existing gaps including regions with QTL for resistance to anthracnose and rust. The distribution of the markers over 11 linkage groups is discussed and a newer version of the common bean core linkage map is proposed.

  10. cDNA-AFLP analysis of differential gene expression related to cell chemotactic and encystment of Azospirillum brasilense.

    PubMed

    Li, Huamin; Cui, Yanhua; Wu, Lixian; Tu, Ran; Chen, Sanfeng

    2011-12-20

    Our previous study indicated org35 was involved in chemotaxis and interacted with nitrogen fixation transcriptional activator NifA via PAS domain. In order to reveal the role of org35 in nitrogen regulation, the downstream target genes of org35 were identified. We here report differentially expressed genes in org35 mutants comparing with wild type Sp7 by means of cDNA-AFLP. Four up-regulated transcript-derived fragments (TDFs) homologues of chemotaxis transduction proteins were found, including CheW, methyl-accepting chemotaxis protein and response regulator CheY-like receiver. Three distinct TDFs (AB46, AB58 and AB63) were similar to PHB de-polymerase C-terminus, cell shape-determining protein and flagellin domain protein. And 11 TDFs showed similarities with signal transduction proteins, including homologous protein of the nitrogen regulation protein NtrY and nitrate/nitrite response regulator protein NarL. These data suggested that the Azospirillum brasilense org35 was a multi-effecter and involved in chemotaxis, cyst development and regulation of nitrogen fixation.

  11. Assessment Strategies for Pair Programming

    ERIC Educational Resources Information Center

    Hahn, Jan Hendrik; Mentz, Elsa; Meyer, Lukas

    2009-01-01

    Although pair programming has proved its usefulness in teaching and learning programming skills, it is difficult to assess the individual roles and abilities of students whilst programming in pairs. (Note that within this manuscript, the term assessment refers to evaluating individual student performance.) Assessing only the outcomes of a pair…

  12. Guanidinium Pairing Facilitates Membrane Translocation.

    PubMed

    Allolio, Christoph; Baxova, Katarina; Vazdar, Mario; Jungwirth, Pavel

    2016-01-14

    Ab initio free energy calculations of guanidinium pairing in aqueous solution confirm the counterintuitive conjecture that the like-charge ion pair is thermodynamically stable. Transferring the guanidinium pair to the inside of a POPC lipid bilayer, like-charge ion pairing is found to occur also inside the membrane defect. It is found to contribute to the nonadditivity of ion transfer, thereby facilitating the presence of ions inside the bilayer. The effect is quantified by free energy decomposition and comparison with ammonium ions, which do not form a stable pair. The presence of two charges inside the center of the bilayer leads to the formation of a pore. Potential consequences for cell penetrating peptides and ion conduction are drawn.

  13. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    SciTech Connect

    Bowman, Stephen M

    2008-09-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  14. Base pairing and base mis-pairing in nucleic acids

    NASA Technical Reports Server (NTRS)

    Wang, A. H. J.; Rich, A.

    1986-01-01

    In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.

  15. Stereo Pair: Patagonia, Argentina

    NASA Technical Reports Server (NTRS)

    2000-01-01

    This view of northern Patagonia, near El Cain, Argentina shows complexly eroded volcanic terrain, with basalt mesas, sinkholes, landslide debris, playas, and relatively few integrated drainage channels. Surrounding this site (but also extending far to the east) is a broad plateau capped by basalt, the Meseta de Somuncura. Here, near the western edge of the plateau, erosion has broken through the basalt cap in a variety of ways. On the mesas, water-filled sinkholes (lower left) are most likely the result of the collapse of old lava tubes. Along the edges of the mesas (several locations) the basalt seems to be sliding away from the plateau in a series of slices. Water erosion by overland flow is also evident, particularly in canyons where vegetation blankets the drainage channels (green patterns, bottom of image). However, overland water flow does not extend very far at any location. This entire site drains to local playas, some of which are seen here (blue). While the water can reach the playas and then evaporate, what becomes of the eroded rock debris? Wind might excavate some of the finer eroded debris, but the fate of much of the missing bedrock remains mysterious.

    This cross-eyed stereoscopic image pair was generated using topographic data from the Shuttle Radar Topography Mission, combined with an enhanced Landsat 7 satellite color image. The topography data are used to create two differing perspectives of a single image, one perspective for each eye. In doing so, each point in the image is shifted slightly, depending on its elevation. When stereoscopically merged, the result is a vertically exaggerated view of the Earth's surface in its full three dimensions.

    Landsat satellites have provided visible light and infrared images of the Earth continuously since 1972. SRTM topographic data match the 30-meter (99-foot) spatial resolution of most Landsat images and provide a valuable complement for studying the historic and growing Landsat data archive. The

  16. Stereo Pair, Patagonia, Argentina

    NASA Technical Reports Server (NTRS)

    2000-01-01

    This view of northern Patagonia, at Los Menucos, Argentina shows remnants of relatively young volcanoes built upon an eroded plain of much older and contorted volcanic, granitic, and sedimentary rocks. The large purple, brown, and green 'butterfly' pattern is a single volcano that has been deeply eroded. Large holes on the volcano's flanks indicate that they may have collapsed soon after eruption, as fluid molten rock drained out from under its cooled and solidified outer shell. At the upper left, a more recent eruption occurred and produced a small volcanic cone and a long stream of lava, which flowed down a gully. At the top of the image, volcanic intrusions permeated the older rocks resulting in a chain of small dark volcanic peaks. At the top center of the image, two halves of a tan ellipse pattern are offset from each other. This feature is an old igneous intrusion that has been split by a right-lateral fault. The apparent offset is about 6.6 kilometers (4 miles). Color, tonal, and topographic discontinuities reveal the fault trace as it extends across the image to the lower left. However, young unbroken basalt flows show that the fault has not been active recently.

    This cross-eyed stereoscopic image pair was generated using topographic data from the Shuttle Radar Topography Mission, combined with an enhanced Landsat 7satellite color image. The topography data are used to create two differing perspectives of a single image, one perspective for each eye. In doing so, each point in the image is shifted slightly, depending on its elevation. When stereoscopically merged, the result is a vertically exaggerated view of the Earth's surface in its full three dimensions.

    Landsat satellites have provided visible light and infrared images of the Earth continuously since 1972. SRTM topographic data match the 30-meter (99-foot) spatial resolution of most Landsat images and provide a valuable complement for studying the historic and growing Landsat data archive

  17. A High Temperature Hermetic Primer and a Variable Spring Tester

    SciTech Connect

    Begeal, D.R.

    1994-05-01

    Percussion primers are used at Sandia to ignite energetic components such as pyrotechnic actuators and thermal batteries. This report describes a High Temperature Hermetic Primer (HTHP) that was developed to replace a previous G16 Percussion Primer Subassembly (Gl6PPS). The ignition mix in these primers is the same as in the discontinued Remington 44G16 (KC1O{sub 3}, SbS{sub 3}, and Ca{sub 2}Si). The HTHP has nearly the same sensitivity as the 44G16 and a significantly lower sensitivity than the G16PPS. In parallel with the HTHP development, we also designed a Variable Spring Tester (VST) to determine percussion primer ignition sensitivity with firing pins that have the same mass as those used in field applications. The tester is capable of accelerating firing pins over a velocity range of 100 to 600 inches per second for pins weighing up to 6 grams. The desired impulse can be preselected with an accuracy of better than {plus_minus}1%. The actual impulse is measured on every shot. The VST was characterized using the WW42Cl primer, as well as with the G16PPS and the HTHP. Compared to data from conventional ball drop testers, we found that ignition sensitivities were lower and there was less scatter in the sensitivity data. Our experiments indicate that ignition sensitivity is not strictly energy dependent, but also depends on the rate of deposition, or firing pin velocity in this case. Development results for the HTHP and Variable Spring Tester are discussed and design details are shown.

  18. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    SciTech Connect

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  19. Changes in Rous Sarcoma Virus RNA Secondary Structure near the Primer Binding Site upon tRNATrp Primer Annealing

    PubMed Central

    Morris, Shannon; Leis, Jonathan

    1999-01-01

    Predicted secondary-structure elements encompassing the primer binding site in the 5′ untranslated region of Rous sarcoma virus (RSV) RNA play an integral role in multiple viral replications steps including reverse transcription, DNA integration, and RNA packaging (A. Aiyar, D. Cobrinik, Z. Ge, H. J. Kung, and J. Leis, J. Virol. 66:2464–2472, 1992; D. Cobrinik, A. Aiyar, Z. Ge, M. Katzman, H. Huang, and J. Leis, J. Virol. 65:3864–3872, 1991; J. T. Miller, Z. Ge, S. Morris, K. Das, and J. Leis, J. Virol. 71:7648–7656, 1997). These elements include the U5-Leader stem, U5-IR stem-loop, and U5-TΨC interaction region. Limited digestion of the 5′ untranslated region of wild-type and mutant RSV RNAs with structure- and/or sequence-specific RNases detects the presence of the U5-Leader stem and the U5-IR stem-loop. When a tRNATrp primer is annealed to wild-type RNAs in vitro, limited nuclease mapping indicates that the U5-IR stem becomes partially unwound. This is not observed when mutant RNAs with altered U5-IR stem-loop structures are substituted for wild-type RNAs. The U5-Leader stem also becomes destabilized when the tRNA primer is annealed to either wild-type or mutant RNA fragments. Nuclease mapping studies of tRNATrp, as well as the viral RNA, indicate that the U5-TΨC helix does form in vitro upon primer annealing. Collectively, these data suggest that the various structural elements near the RSV primer binding site undergo significant changes during the process of primer annealing. PMID:10400722

  20. Pairing Correlations at High Spins

    NASA Astrophysics Data System (ADS)

    Ma, Hai-Liang; Dong, Bao-Guo; Zhang, Yan; Fan, Ping; Yuan, Da-Qing; Zhu, Shen-Yun; Zhang, Huan-Qiao; Petrache, C. M.; Ragnarsson, I.; Carlsson, B. G.

    The pairing correcting energies at high spins in 161Lu and 138Nd are studied by comparing the results of the cranked-Nilsson-Strutinsky (CNS) and cranked-Nilsson-Strutinsky-Bogoliubov (CNSB) models. It is concluded that the Coriolis effect rather than the rotational alignment effect plays a major role in the reduction of the pairing correlations in the high spin region. Then we proposed an average pairing correction method which not only better reproduces the experimental data comparing with the CNS model but also enables a clean-cut tracing of the configurations thus the full-spin-range discussion on the various rotating bands.

  1. Pairing Properties of Superheavy Nuclei

    SciTech Connect

    Staszczak, A.; Dobaczewski, J.; Nazarewicz, Witold

    2007-01-01

    Pairing properties of even-even superheavy N=184 isotones are studied within the Skyrme-Hartree-Fock+BCS approach. In the particle-hole channel we take the Skyrme energy density functional SLy4, while in the particle-particle channel we employ the seniority pairing force and zero-range delta-interactions with different forms of density dependence. We conclude that the calculated static fission trajectories weakly depend on the specific form of the delta-pairing interaction. We also investigate the impact of triaxiality on the inner fission barrier and find a rather strong Z dependence of the effect.

  2. A Primer on Fresh Water: The Environmental Citizenship Series.

    ERIC Educational Resources Information Center

    Environment Canada, Ottawa (Ontario).

    Water is the lifeblood of the environment as no organisms can survive without it. This reference booklet is designed to help people make environmentally responsible decisions. The primer is targeted at the general public (grade 8 to post-secondary) to be used by educators, communities and organizations as well as individuals, as part of a learning…

  3. Depth profiles and free volume in aircraft primer films

    NASA Astrophysics Data System (ADS)

    Van Horn, J. D.; Chen, H.; Jean, Y. C.; Zhang, W.; Jaworowski, M. R.

    2015-06-01

    Positron annihilation lifetime spectroscopy (PALS) and associated techniques provide non-destructive methods to study the free volume inside polymeric materials, and to study material characteristics over a depth profile. Cast free films of organic- or aqueous-based, non-chromated aerospace primers, when cured for about one week, had very different water vapour transport (through-plane) behaviour. In addition, both types of primer films showed strong anisotropic behaviour in in-plane versus through-plane water vapour transport rates. We report the differences between the organic- and aqueous-based aircraft primer films samples and their surface depth profiles. In bulk PALS measurements, an aged, organic-based film exhibited typical lifetimes and intensities for a particulate-containing polymer film on both faces. In contrast, aqueous-based films exhibited face oriented-dependent differences. In all aqueous- based samples, the I3 value of the back of the sample was smaller. The primer film samples were also evaluated with mono-energetic positron beam techniques to generate depth profile information. The heterogeneity in the samples was verified by Doppler broadening of energy spectroscopy (DBES). A model for the differences in the faces of the films, and their layered structure is discussed.

  4. Children on Medication: A Primer for School Personnel.

    ERIC Educational Resources Information Center

    Gadow, Kenneth D.

    Intended as a primer for school personnel, the book discusses children whose various disorders require them to be on medication, and describes the behavioral effects of these drugs along with their major side effects. Fundamental concepts in pharmacotherapy are reviewed, including dosage adjustment and side effects, and a brief introduction to the…

  5. Exploding the Myths about DETC Accreditation: A Primer for Students

    ERIC Educational Resources Information Center

    Distance Education and Training Council, 2011

    2011-01-01

    Prospective distance education students are faced with a bewildering number of choices in selecting an institution that is best suited to achieving their educational goals. They also face a confusing forest of institutions' promotional claims of being the best or most respected school. This primer is intended to help the prospective student of an…

  6. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    ERIC Educational Resources Information Center

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  7. Zip Pak for Pre-Primer Reading Level (Teacher's Manual).

    ERIC Educational Resources Information Center

    Scott, Norval C., Comp.

    The Zip Pak for the pre-primer reading level was developed for use with migrant Mexican American children with reading deficiencies. Its goals are to: (1) increase and widen the child's ability to be selective in choosing his information and selecting information pertinent to a purpose; and (2) improve the child's ability to make decisions,…

  8. Zip Pak for Pre-Primer Reading Level.

    ERIC Educational Resources Information Center

    Scott, Norval C., Comp.

    The Zip Pak for the pre-primer reading level was developed for use with migrant Mexican American children who have reading deficiencies. The area of failure with these children has not been with the visual discrimination involved in decoding, but with the interpretation of the material to be decoded. Therefore, the 5 lessons in this student…

  9. Philosophical Foundations: A Primer for Adult Continuing Education.

    ERIC Educational Resources Information Center

    Rampp, Lary C., Ed.; Guffey, J. Stephen, Ed.

    This document, which is intended as a primer for adult continuing education, contains 11 chapters examining the philosophical foundations of adult and continuing education. The chapter titles and authors are as follows: "Progressivism and Adult Continuing Education" (Michael Day); "Progressivism: An Anthology" (Andrea Reeve); "Progressivism;…

  10. 5. LOOKING NORTH TOWARD BARRICADES AROUND BUILDING NO. 230, PRIMER ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. LOOKING NORTH TOWARD BARRICADES AROUND BUILDING NO. 230, PRIMER AND DETONATOR LOADING BUILDING. BARRICADES DIRECT FORCE OF BLAST UPWARD IN THE EVENT OF AN EXPLOSION. - Picatinny Arsenal, 200 Area, Shell Component Loading, State Route 15 near I-80, Dover, Morris County, NJ

  11. Computer Terminals and Terminology Made Easy! A Primer.

    ERIC Educational Resources Information Center

    Penny, Judith H.

    Designed to make computer users comfortable with both computers and user/reference manual instructions before they have hands-on training, this primer is an introduction to computer concepts, devices, and terms. Common questions related to learning about data processing are addressed, and the following topics are covered: captured data; reports;…

  12. Factor Scores, Structure and Communality Coefficients: A Primer

    ERIC Educational Resources Information Center

    Odum, Mary

    2011-01-01

    (Purpose) The purpose of this paper is to present an easy-to-understand primer on three important concepts of factor analysis: Factor scores, structure coefficients, and communality coefficients. Given that statistical analyses are a part of a global general linear model (GLM), and utilize weights as an integral part of analyses (Thompson, 2006;…

  13. Improved primer for bonding polyurethane adhesives to metals

    NASA Technical Reports Server (NTRS)

    Constanza, L. J.

    1969-01-01

    Primer ensures effective bonding integrity of polyurethane adhesives on metal surfaces at temperatures ranging from minus 423 degrees to plus 120 degrees F. It provides greater metal surface protection and bond strengths over this temperature range than could be attained with other adhesive systems.

  14. Deeper Learning: A Primer for State Legislators. ECS Education Trends

    ERIC Educational Resources Information Center

    Aragon, Stephanie

    2015-01-01

    A growing number of schools across the country are working hard to provide a "deeper" learning experience for their students, and state legislators are being asked to create policies that support wide-scale implementation of 21st century learning practices. This primer is created for state policymakers seeking to modify instruction and…

  15. Barcoded primers used in multiplex amplicon pyrosequencing bias amplification.

    PubMed

    Berry, David; Ben Mahfoudh, Karim; Wagner, Michael; Loy, Alexander

    2011-11-01

    "Barcode-tagged" PCR primers used for multiplex amplicon sequencing generate a thus-far-overlooked amplification bias that produces variable terminal restriction fragment length polymorphism (T-RFLP) and pyrosequencing data from the same environmental DNA template. We propose a simple two-step PCR approach that increases reproducibility and consistently recovers higher genetic diversity in pyrosequencing libraries. PMID:21890669

  16. Blood Donation and Transfusion: A Primer for Health Educators.

    ERIC Educational Resources Information Center

    Felts, W. Michael; Glascoff, Mary A.

    1991-01-01

    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  17. Method to amplify variable sequences without imposing primer sequences

    DOEpatents

    Bradbury, Andrew M.; Zeytun, Ahmet

    2006-11-14

    The present invention provides methods of amplifying target sequences without including regions flanking the target sequence in the amplified product or imposing amplification primer sequences on the amplified product. Also provided are methods of preparing a library from such amplified target sequences.

  18. Dynamical interactions of galaxy pairs

    NASA Technical Reports Server (NTRS)

    Athanassoula, E.

    1990-01-01

    Here the author briefly reviews the dynamics of sinking satellites and the effect of companions on elliptical galaxies. The author then discusses recent work on interacting disk systems, and finally focuses on a favorite interacting pair, NGC 5194/5195.

  19. Pair Excitations in Fermi Fluids

    NASA Astrophysics Data System (ADS)

    Böhm, Helga M.; Krotscheck, Eckhard; Schörkhuber, Karl; Springer, Josef

    2006-09-01

    We present a theory of multi-pair excitations in strongly interacting Fermi systems. Based on an equations-of-motion approach for time-dependent pair correlations it leads to a qualitatively new structure of the density-density response function. Our theory reduces to both, i) the "correlated" random-phase approximation (RPA) for fermions if the two-pair excitations are ignored, and ii) the correlated Brillouin-Wigner perturbation theory for bosons in the appropriate limit. The theory preserves the two first energy-weighted sum rules. A familiar problem of the standard RPA is that its zero-sound mode is energetically much higher than found in experiments. The popular cure of introducing an average effective mass in the Lindhard function violates sum rules and describes the physics incorrectly. We demonstrate that the inclusion of correlated pair excitations gives the correct dispersion. As in 4He, a modification of the effective mass is unnecessary also in 3He.

  20. cDNA-AFLP analysis reveals differential gene expression in incompatible interaction between infected non-heading Chinese cabbage and Hyaloperonospora parasitica.

    PubMed

    Xiao, Dong; Liu, Shi-Tuo; Wei, Yan-Ping; Zhou, Dao-Yun; Hou, Xi-Lin; Li, Ying; Hu, Chun-Mei

    2016-01-01

    Non-heading Chinese cabbage (Brassica rapa ssp. chinensis) is one of the main green leafy vegetables in the world, especially in China, with significant economic value. Hyaloperonospora parasitica is a fungal pathogen responsible for causing downy mildew disease in Chinese cabbage, which greatly affects its production. The objective of this study was to identify transcriptionally regulated genes during incompatible interactions between non-heading Chinese cabbage and H. parasitica using complementary DNA-amplified fragment length polymorphism (cDNA-AFLP). We obtained 129 reliable differential transcript-derived fragments (TDFs) in a resistant line 'Suzhou Qing'. Among them, 121 upregulated TDFs displayed an expression peak at 24-48 h post inoculation (h.p.i.). Fifteen genes were further selected for validation of cDNA-AFLP expression patterns using quantitative reverse transcription PCR. Results confirmed the altered expression patterns of 13 genes (86.7%) revealed by the cDNA-AFLP. We identified four TDFs related to fungal resistance among the 15 TDFs. Furthermore, comparative analysis of four TDFs between resistant line 'Suzhou Qing' and susceptible line 'Aijiao Huang' showed that transcript levels of TDF14 (BcLIK1_A01) peaked at 48 h.p.i. and 25.1-fold increased in the resistant line compared with the susceptible line. Similarly, transcript levels of the other three genes, TDF42 (BcCAT3_A07), TDF75 (BcAAE3_A06) and TDF88 (BcAMT2_A05) peaked at 24, 48 and 24 h.p.i. with 25.1-, 100- and 15.8-fold increases, respectively. The results suggested that the resistance genes tended to transcribe at higher levels in the resistance line than in the susceptible line, which may provide resistance against pathogen infections. The present study might facilitate elucidating the molecular basis of the infection process and identifying candidate genes for resistance improvement of susceptible cultivars.

  1. Evolution of the polyploid north-west Iberian Leucanthemum pluriflorum clan (Compositae, Anthemideae) based on plastid DNA sequence variation and AFLP fingerprinting

    PubMed Central

    Greiner, Roland; Vogt, Robert; Oberprieler, Christoph

    2013-01-01

    Background and Aims The genus Leucanthemum is a species-rich polyploid complex from southern and central Europe, comprising 41 species with ploidy ranging from 2x to 22x. The present contribution aims at reconstructing the evolutionary history of a geographically isolated species group (the L. pluriflorum clan) from the north-west Iberian Peninsula comprising the diploid L. pluriflorum, the tetraploids L. ircutianum subsp. pseudosylvaticum and L. × corunnense (a putative hybrid taxon based on crossing between L. pluriflorum and L. merinoi), and the hexaploids L. sylvaticum and L. merinoi. Methods Chromosome number variation (determined flow cytometrically) and sequence variation were analysed for two intergenic spacer regions on the plastid genome (psbA-trnH and trnC-petN) for individuals from 54 populations in combination with amplified fragment length polymorphism (AFLP) fingerprinting of 246 representative individuals from these populations. Key Results Plastid sequence data revealed that all surveyed members of the L. pluriflorum clan possess plastid haplotypes that are closely related to each other and distinctly separated from other Leucanthemum species. AFLP fingerprinting resulted in allopolyploid fragment patterns for most of the polyploid populations, except for the tetraploid L. × corunnense and a further tetraploid population in northern Galicia, which cluster with the diploids rather than with the other polyploids. In silico modelling of (auto)tetraploid AFLP genotypes further corroborates the allopolyploid nature of L. ircutianum subsp. pseudosylvaticum, L. sylvaticum and L. merinoi. Conclusions The present study provides evidence for recognizing one diploid (L. pluriflorum), one autotetraploid (L. corunnense), one allotetraploid (L. pseudosylvaticum) and one allohexaploid (L. sylvaticum with the two geographically and ecologically differentiated subspecies subsp. sylvaticum and subsp. merinoi) in the L. pluriflorum clan. It also has implications

  2. cDNA-AFLP analysis reveals differential gene expression in incompatible interaction between infected non-heading Chinese cabbage and Hyaloperonospora parasitica.

    PubMed

    Xiao, Dong; Liu, Shi-Tuo; Wei, Yan-Ping; Zhou, Dao-Yun; Hou, Xi-Lin; Li, Ying; Hu, Chun-Mei

    2016-01-01

    Non-heading Chinese cabbage (Brassica rapa ssp. chinensis) is one of the main green leafy vegetables in the world, especially in China, with significant economic value. Hyaloperonospora parasitica is a fungal pathogen responsible for causing downy mildew disease in Chinese cabbage, which greatly affects its production. The objective of this study was to identify transcriptionally regulated genes during incompatible interactions between non-heading Chinese cabbage and H. parasitica using complementary DNA-amplified fragment length polymorphism (cDNA-AFLP). We obtained 129 reliable differential transcript-derived fragments (TDFs) in a resistant line 'Suzhou Qing'. Among them, 121 upregulated TDFs displayed an expression peak at 24-48 h post inoculation (h.p.i.). Fifteen genes were further selected for validation of cDNA-AFLP expression patterns using quantitative reverse transcription PCR. Results confirmed the altered expression patterns of 13 genes (86.7%) revealed by the cDNA-AFLP. We identified four TDFs related to fungal resistance among the 15 TDFs. Furthermore, comparative analysis of four TDFs between resistant line 'Suzhou Qing' and susceptible line 'Aijiao Huang' showed that transcript levels of TDF14 (BcLIK1_A01) peaked at 48 h.p.i. and 25.1-fold increased in the resistant line compared with the susceptible line. Similarly, transcript levels of the other three genes, TDF42 (BcCAT3_A07), TDF75 (BcAAE3_A06) and TDF88 (BcAMT2_A05) peaked at 24, 48 and 24 h.p.i. with 25.1-, 100- and 15.8-fold increases, respectively. The results suggested that the resistance genes tended to transcribe at higher levels in the resistance line than in the susceptible line, which may provide resistance against pathogen infections. The present study might facilitate elucidating the molecular basis of the infection process and identifying candidate genes for resistance improvement of susceptible cultivars. PMID:27602230

  3. The attractiveness fragment—AFLP analysis of local adaptation and sexual selection in a caeliferan grasshopper, Chorthippus biguttulus

    NASA Astrophysics Data System (ADS)

    Klappert, Kirsten; Butlin, Roger K.; Reinhold, Klaus

    2007-08-01

    Genetic variability among males is a necessary precondition for the evolution of female choice based on indirect genetic benefits. In addition to mutations and host parasite cycles, migration of locally adapted individuals offers an explanation for the maintenance of genetic variability. In a previous study, conducting a reciprocal transplant experiment on a grasshopper, Chorthippus biguttulus, we found that environmental conditions significantly influenced not only body condition but also an important trait of male calling song, the amplitude of song. Although not significant, all other analysed physical and courtship song traits and attractiveness were superior in native than in transferred males. Thus, we concluded that local adaptation has a slight but consistent influence on a range of traits in our study populations, including male acoustic attractiveness. In our present study, we scanned male grasshoppers from the same two populations for amplification fragment length polymorphism (AFLP) loci connected with acoustic attractiveness to conspecific females. We found greater differences in allele frequencies between the two populations, for some loci, than are expected from a balance between drift and gene flow. These loci are potentially connected with locally adapted traits. We examined whether these alleles show the proposed genotype environment interaction by having different associations with attractiveness in the two populations. One locus was significantly related to sexual attractiveness; however, this was independent of the males’ population affiliation. Future research on the evolution of female choice will benefit from knowledge of the underlying genetic architecture of male traits under intraspecific sexual selection, and the ‘population genomics’ approach can be a powerful tool for revealing this structure.

  4. Analyses of amplified fragment length polymorphisms (AFLP) indicate rapid radiation of Diospyros species (Ebenaceae) endemic to New Caledonia

    PubMed Central

    2013-01-01

    Background Radiation in some plant groups has occurred on islands and due to the characteristic rapid pace of phenotypic evolution, standard molecular markers often provide insufficient variation for phylogenetic reconstruction. To resolve relationships within a clade of 21 closely related New Caledonian Diospyros species and evaluate species boundaries we analysed genome-wide DNA variation via amplified fragment length polymorphisms (AFLP). Results A neighbour-joining (NJ) dendrogram based on Dice distances shows all species except D. minimifolia, D. parviflora and D. vieillardii to form unique clusters of genetically similar accessions. However, there was little variation between these species clusters, resulting in unresolved species relationships and a star-like general NJ topology. Correspondingly, analyses of molecular variance showed more variation within species than between them. A Bayesian analysis with BEAST produced a similar result. Another Bayesian method, this time a clustering method, Structure, demonstrated the presence of two groups, highly congruent with those observed in a principal coordinate analysis (PCO). Molecular divergence between the two groups is low and does not correspond to any hypothesised taxonomic, ecological or geographical patterns. Conclusions We hypothesise that such a pattern could have been produced by rapid and complex evolution involving a widespread progenitor for which an initial split into two groups was followed by subsequent fragmentation into many diverging populations, which was followed by range expansion of then divergent entities. Overall, this process resulted in an opportunistic pattern of phenotypic diversification. The time since divergence was probably insufficient for some species to become genetically well-differentiated, resulting in progenitor/derivative relationships being exhibited in a few cases. In other cases, our analyses may have revealed evidence for the existence of cryptic species, for which

  5. Semi-quantitative differences in gene transcription profiles between sexes of a marine snail by a new variant of cDNA-AFLP analysis.

    PubMed

    Martínez-Fernández, M; Bernatchez, L; Rolán-Alvarez, E; Quesada, H

    2010-03-01

    A variant of the cDNA-AFLP method coupled to an automated sequencer was used to quantify transcripts differentially expressed between sexes of the marine snail Littorina saxatilis. First, we conducted a validation study of the technique using known concentrations of a commercial marker. Second, we analysed six replicates of males and females from a population showing no apparent sexual dimorphism. The results confirm that the method can be properly used within the range of DNA concentrations utilized. In addition, we detected a small percentage of spots (1.8%) differentially expressed between sexes, as expected from a low to moderately sexual dimorphic species. PMID:21565027

  6. Molecular phylogeny and population structure of the codling moth (Cydia pomonella) in Central Europe: II. AFLP analysis reflects human-aided local adaptation of a global pest species.

    PubMed

    Thaler, R; Brandstätter, A; Meraner, A; Chabicovski, M; Parson, W; Zelger, R; Dalla Via, J; Dallinger, R

    2008-09-01

    Originally resident in southeastern Europe, the codling moth (Cydia pomonella L.) (Tortricidae) has achieved a nearly global distribution, being one of the most successful pest insect species known today. As shown in our accompanying study, mitochondrial genetic markers suggest a Pleistocenic splitting of Cydia pomonella into two refugial clades which came into secondary contact after de-glaciation. The actual distribution pattern shows, however, that Central European codling moths have experienced a geographic splitting into many strains and locally adapted populations, which is not reflected by their mitochondrial haplotype distribution. We therefore have applied, in addition to mitochondrial markers, an approach with a higher resolution potential at the population level, based on the analysis of amplification fragment length polymorphisms (AFLPs). As shown in the present study, AFLP markers elucidate the genetic structure of codling moth strains and populations from different Central European apple orchard sites. While individual genetic diversity within codling moth strains and populations was small, a high degree of genetic differentiation was observed between the analyzed strains and populations, even at a small geographic scale. One of the main factors contributing to local differentiation may be limited gene flow among adjacent codling moth populations. In addition, microclimatic, ecological, and geographic constraints also may favour the splitting of Cydia pomonella into many local populations. Lastly, codling moths in Central European fruit orchards may experience considerable selective pressure due to pest control activities. As a consequence of all these selective forces, today in Central Europe we see a patchy distribution of many locally adapted codling moth populations, each of them having its own genetic fingerprint. Because of the complete absence of any correlation between insecticide resistance and geographic or genetic distances among

  7. Design and testing of multiplex RT-PCR primers for the rapid detection of influenza A virus genomic segments: Application to equine influenza virus.

    PubMed

    Lee, EunJung; Kim, Eun-Ju; Shin, Yeun-Kyung; Song, Jae-Young

    2016-02-01

    The avian influenza A virus causes respiratory infections in animal species. It can undergo genomic recombination with newly obtained genetic material through an interspecies transmission. However, the process is an unpredictable event, making it difficult to predict the emergence of a new pandemic virus and distinguish its origin, especially when the virus is the result of multiple infections. Therefore, identifying a novel influenza is entirely dependent on sequencing its whole genome. Occasionally, however, it can be time-consuming, costly, and labor-intensive when sequencing many influenza viruses. To compensate for the difficulty, we developed a rapid, cost-effective, and simple multiplex RT-PCR to identify the viral genomic segments. As an example to evaluate its performance, H3N8 equine influenza virus (EIV) was studied for the purpose. In developing this protocol to amplify the EIV eight-segments, a series of processes, including phylogenetic analysis based on different influenza hosts, in silico analyses to estimate primer specificity, coverage, and variation scores, and investigation of host-specific amino acids, were progressively conducted to reduce or eliminate the negative factors that might affect PCR amplification. Selectively, EIV specific primers were synthesized with dual priming oligonucleotides (DPO) system to increase primer specificity. As a result, 16 primer pairs were selected to screen the dominantly circulating H3N8 EIV 8 genome segments: PA (3), PB2 (1), PA (3), NP (3), NA8 (2), HA3 (1), NS (1), and M (2). The diagnostic performance of the primers was evaluated with eight sets composing of four segment combinations using viral samples from various influenza hosts. The PCR results suggest that the multiplex RT-PCR has a wide range of applications in detection and diagnosis of newly emerging EIVs. Further, the proposed procedures of designing multiplex primers are expected to be used for detecting other animal influenza A viruses. PMID

  8. Superconductivity: The persistence of pairs

    SciTech Connect

    Edelman, Alex; Littlewood, Peter

    2015-05-20

    Superconductivity stems from a weak attraction between electrons that causes them to form bound pairs and behave much like bosons. These so-called Cooper pairs are phase coherent, which leads to the astonishing properties of zero electrical resistance and magnetic flux expulsion typical of superconducting materials. This coherent state may be qualitatively understood within the Bose–Einstein condensate (BEC) model, which predicts that a gas of interacting bosons will become unstable below a critical temperature and condense into a phase of matter with a macroscopic, coherent population in the lowest energy state, as happens in 4He or cold atomic gases. The successful theory proposed by Bardeen, Cooper and Schrieffer (BCS) predicts that at the superconducting transition temperature Tc, electrons simultaneously form pairs and condense, with no sign of pairing above Tc. Theorists have long surmised that the BCS and BEC models are opposite limits of a single theory and that strong interactions or low density can, in principle, drive the system to a paired state at a temperature Tpair higher than Tc, making the transition to the superconducting state BEC-like (Fig. 1). Yet most superconductors to date are reasonably well described by BCS theory or its extensions, and there has been scant evidence in electronic materials for the existence of pairing independent of the full superconducting state (though an active debate rages over the cuprate superconductors). Writing in Nature, Jeremy Levy and colleagues have now used ingenious nanostructured devices to provide evidence for electron pairing1. Perhaps surprisingly, the material they have studied is a venerable, yet enigmatic, low-temperature superconductor, SrTiO3.

  9. An Efficient Approach for the Development of Locus Specific Primers in Bread Wheat (Triticum aestivum L.) and Its Application to Re-Sequencing of Genes Involved in Frost Tolerance.

    PubMed

    Babben, Steve; Perovic, Dragan; Koch, Michael; Ordon, Frank

    2015-01-01

    Recent declines in costs accelerated sequencing of many species with large genomes, including hexaploid wheat (Triticum aestivum L.). Although the draft sequence of bread wheat is known, it is still one of the major challenges to developlocus specific primers suitable to be used in marker assisted selection procedures, due to the high homology of the three genomes. In this study we describe an efficient approach for the development of locus specific primers comprising four steps, i.e. (i) identification of genomic and coding sequences (CDS) of candidate genes, (ii) intron- and exon-structure reconstruction, (iii) identification of wheat A, B and D sub-genome sequences and primer development based on sequence differences between the three sub-genomes, and (iv); testing of primers for functionality, correct size and localisation. This approach was applied to single, low and high copy genes involved in frost tolerance in wheat. In summary for 27 of these genes for which sequences were derived from Triticum aestivum, Triticum monococcum and Hordeum vulgare, a set of 119 primer pairs was developed and after testing on Nulli-tetrasomic (NT) lines, a set of 65 primer pairs (54.6%), corresponding to 19 candidate genes, turned out to be specific. Out of these a set of 35 fragments was selected for validation via Sanger's amplicon re-sequencing. All fragments, with the exception of one, could be assigned to the original reference sequence. The approach presented here showed a much higher specificity in primer development in comparison to techniques used so far in bread wheat and can be applied to other polyploid species with a known draft sequence.

  10. An Efficient Approach for the Development of Locus Specific Primers in Bread Wheat (Triticum aestivum L.) and Its Application to Re-Sequencing of Genes Involved in Frost Tolerance

    PubMed Central

    Babben, Steve; Perovic, Dragan; Koch, Michael; Ordon, Frank

    2015-01-01

    Recent declines in costs accelerated sequencing of many species with large genomes, including hexaploid wheat (Triticum aestivum L.). Although the draft sequence of bread wheat is known, it is still one of the major challenges to developlocus specific primers suitable to be used in marker assisted selection procedures, due to the high homology of the three genomes. In this study we describe an efficient approach for the development of locus specific primers comprising four steps, i.e. (i) identification of genomic and coding sequences (CDS) of candidate genes, (ii) intron- and exon-structure reconstruction, (iii) identification of wheat A, B and D sub-genome sequences and primer development based on sequence differences between the three sub-genomes, and (iv); testing of primers for functionality, correct size and localisation. This approach was applied to single, low and high copy genes involved in frost tolerance in wheat. In summary for 27 of these genes for which sequences were derived from Triticum aestivum, Triticum monococcum and Hordeum vulgare, a set of 119 primer pairs was developed and after testing on Nulli-tetrasomic (NT) lines, a set of 65 primer pairs (54.6%), corresponding to 19 candidate genes, turned out to be specific. Out of these a set of 35 fragments was selected for validation via Sanger's amplicon re-sequencing. All fragments, with the exception of one, could be assigned to the original reference sequence. The approach presented here showed a much higher specificity in primer development in comparison to techniques used so far in bread wheat and can be applied to other polyploid species with a known draft sequence. PMID:26565976

  11. Pair extended coupled cluster doubles

    SciTech Connect

    Henderson, Thomas M.; Scuseria, Gustavo E.; Bulik, Ireneusz W.

    2015-06-07

    The accurate and efficient description of strongly correlated systems remains an important challenge for computational methods. Doubly occupied configuration interaction (DOCI), in which all electrons are paired and no correlations which break these pairs are permitted, can in many cases provide an accurate account of strong correlations, albeit at combinatorial computational cost. Recently, there has been significant interest in a method we refer to as pair coupled cluster doubles (pCCD), a variant of coupled cluster doubles in which the electrons are paired. This is simply because pCCD provides energies nearly identical to those of DOCI, but at mean-field computational cost (disregarding the cost of the two-electron integral transformation). Here, we introduce the more complete pair extended coupled cluster doubles (pECCD) approach which, like pCCD, has mean-field cost and reproduces DOCI energetically. We show that unlike pCCD, pECCD also reproduces the DOCI wave function with high accuracy. Moreover, pECCD yields sensible albeit inexact results even for attractive interactions where pCCD breaks down.

  12. White primer permits a corrosion-resistant coating of minimum weight

    NASA Technical Reports Server (NTRS)

    Albrecht, R. H.; Jensen, D. P.; Schnake, P.

    1966-01-01

    White primer for coating 2219 aluminum alloy supplies a base for a top coating of enamel. A formulation of pigments and vehicle results in a primer with high corrosion resistance and minimum film thickness.

  13. Pair-Starved Pulsar Magnetospheres

    NASA Technical Reports Server (NTRS)

    Muslimov, Alex G.; Harding, Alice K.

    2009-01-01

    We propose a simple analytic model for the innermost (within the light cylinder of canonical radius, approx. c/Omega) structure of open-magnetic-field lines of a rotating neutron star (NS) with relativistic outflow of charged particles (electrons/positrons) and arbitrary angle between the NS spin and magnetic axes. We present the self-consistent solution of Maxwell's equations for the magnetic field and electric current in the pair-starved regime where the density of electron-positron plasma generated above the pulsar polar cap is not sufficient to completely screen the accelerating electric field and thus establish thee E . B = 0 condition above the pair-formation front up to the very high altitudes within the light cylinder. The proposed mode1 may provide a theoretical framework for developing the refined model of the global pair-starved pulsar magnetosphere.

  14. Isolation of fertility-related genes of multiple-allele-inherited male sterility in Brassica rapa ssp pekinensis by cDNA-AFLP.

    PubMed

    Ji, R Q; Song, Q; Xin, X F; Zhou, X; Feng, H

    2011-01-01

    To better understand the molecular mechanisms of multiple-allele-inherited male sterility in Chinese cabbage (Brassica rapa ssp pekinensis), differentially expressed genes in fertile and sterile plants must be isolated. We used cDNA-AFLP analysis to isolate differentially expressed genes in fertile and sterile buds of the two-type line, AB01. Sixteen high-quality sequences were generated, 11 of which were up-regulated in fertile buds, and five of which were up-regulated in sterile buds. Based on BLAST screening and functional annotation, these genes have homology with genes encoding known flower- or bud-specific proteins, metabolism-related proteins and cell-structure proteins. In addition, the full-length cDNA sequences of the actin gene were cloned from the cabbage plants by RACE and used as an internal standard for semi-quantitative reverse transcription-PCR. Expression of three flower- or bud-specific differentially expressed transcript-derived fragments in fertile and sterile buds was examined using RT-PCR; the expression patterns of these genes were similar to the patterns observed in the cDNA-AFLP analysis.

  15. Profiling of Leptospira interrogans, L. santarosai, L. meyeri and L. borgpetersenii by SE-AFLP, PFGE and susceptibility testing--a continuous attempt at species and serovar differentiation.

    PubMed

    Moreno, Luisa Z; Miraglia, Fabiana; Lilenbaum, Walter; Neto, José S F; Freitas, Julio C; Morais, Zenaide M; Hartskeerl, Rudy A; da Costa, Barbara L P; Vasconcellos, Silvio A; Moreno, Andrea M

    2016-01-01

    Leptospirosis is a widespread systemic zoonosis, considered as reemerging in certain developing countries. Although the cross agglutinin absorption test is still considered the standard method for Leptospira identification, it presents several disadvantages. The aim of this study was to characterize Leptospira spp. isolated from various hosts by genotyping and broth microdilution susceptibility testing in an attempt to differentiate Leptospira species, serogroups and serovars. Forty-seven isolates were studied. They were previously serotyped, and species confirmation was performed by 16S rRNA sequencing. Single-enzyme amplified fragment length polymorphism (SE-AFLP) and pulsed-field gel electrophoresis (PFGE) analysis enabled the distinction of L. interrogans from L. santarosai, L. meyeri and L. borgpetersenii in two main clusters. Among L. interrogans, it was possible to differentiate into two new clusters the serogroup Icterohaemorrhagiae from the serogroups Canicola and Pomona. L. santarosai isolates presented higher genetic variation than the other species in both techniques. Interestingly, the minimum inhibitory concentration (MIC) cluster analysis also provided Leptospira serogroup differentiation. Further studies are necessary regarding serovar Bananal isolates, as they presented the highest MIC values for most of the antimicrobials tested. All studied techniques successfully distinguished Leptospira species and serogroups. Despite being library-dependent methods, these approaches are less labor intensive and more economically viable, particularly SE-AFLP, and can be implemented in most reference laboratories worldwide to enable faster Leptospira typing. PMID:26956446

  16. A first AFLP-Based Genetic Linkage Map for Brine Shrimp Artemia franciscana and Its Application in Mapping the Sex Locus

    PubMed Central

    De Vos, Stephanie; Bossier, Peter; Van Stappen, Gilbert; Vercauteren, Ilse; Sorgeloos, Patrick; Vuylsteke, Marnik

    2013-01-01

    We report on the construction of sex-specific linkage maps, the identification of sex-linked markers and the genome size estimation for the brine shrimp Artemia franciscana. Overall, from the analysis of 433 AFLP markers segregating in a 112 full-sib family we identified 21 male and 22 female linkage groups (2n = 42), covering 1,041 and 1,313 cM respectively. Fifteen putatively homologous linkage groups, including the sex linkage groups, were identified between the female and male linkage map. Eight sex-linked AFLP marker alleles were inherited from the female parent, supporting the hypothesis of a WZ–ZZ sex-determining system. The haploid Artemia genome size was estimated to 0.93 Gb by flow cytometry. The produced Artemia linkage maps provide the basis for further fine mapping and exploring of the sex-determining region and are a possible marker resource for mapping genomic loci underlying phenotypic differences among Artemia species. PMID:23469207

  17. Profiling of Leptospira interrogans, L. santarosai, L. meyeri and L. borgpetersenii by SE-AFLP, PFGE and susceptibility testing—a continuous attempt at species and serovar differentiation

    PubMed Central

    Moreno, Luisa Z; Miraglia, Fabiana; Lilenbaum, Walter; Neto, José SF; Freitas, Julio C; Morais, Zenaide M; Hartskeerl, Rudy A; da Costa, Barbara LP; Vasconcellos, Silvio A; Moreno, Andrea M

    2016-01-01

    Leptospirosis is a widespread systemic zoonosis, considered as reemerging in certain developing countries. Although the cross agglutinin absorption test is still considered the standard method for Leptospira identification, it presents several disadvantages. The aim of this study was to characterize Leptospira spp. isolated from various hosts by genotyping and broth microdilution susceptibility testing in an attempt to differentiate Leptospira species, serogroups and serovars. Forty-seven isolates were studied. They were previously serotyped, and species confirmation was performed by 16S rRNA sequencing. Single-enzyme amplified fragment length polymorphism (SE-AFLP) and pulsed-field gel electrophoresis (PFGE) analysis enabled the distinction of L. interrogans from L. santarosai, L. meyeri and L. borgpetersenii in two main clusters. Among L. interrogans, it was possible to differentiate into two new clusters the serogroup Icterohaemorrhagiae from the serogroups Canicola and Pomona. L. santarosai isolates presented higher genetic variation than the other species in both techniques. Interestingly, the minimum inhibitory concentration (MIC) cluster analysis also provided Leptospira serogroup differentiation. Further studies are necessary regarding serovar Bananal isolates, as they presented the highest MIC values for most of the antimicrobials tested. All studied techniques successfully distinguished Leptospira species and serogroups. Despite being library-dependent methods, these approaches are less labor intensive and more economically viable, particularly SE-AFLP, and can be implemented in most reference laboratories worldwide to enable faster Leptospira typing. PMID:26956446

  18. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    SciTech Connect

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  19. Recombination of polynucleotide sequences using random or defined primers

    DOEpatents

    Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin H; Giver, Lorraine J.

    2000-01-01

    A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

  20. Recombination of polynucleotide sequences using random or defined primers

    DOEpatents

    Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin; Giver, Lorraine J.

    2001-01-01

    A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.