Science.gov

Sample records for aflp primer pairs

  1. Cost-effective fluorescent amplified fragment length polymorphism (AFLP) analyses using a three primer system.

    PubMed

    Stölting, Kai N; Clarke, Andrew C; Meudt, Heidi M; Blankenhorn, Wolf U; Wilson, Anthony B

    2011-05-01

    The amplified fragment length polymorphism (AFLP) technique is a widely used multi-purpose DNA fingerprinting tool. The ability to size-separate fluorescently labelled AFLP fragments on a capillary electrophoresis instrument has provided a means for high-throughput genome screening, an approach particularly useful in studying the molecular ecology of nonmodel organisms. While the 'per-marker-generated' costs for AFLP are low, fluorescently labelled oligonucleotides remain costly. We present a cost-effective method for fluorescently end-labelling AFLPs that should make this tool more readily accessible for laboratories with limited budgets. Both standard fluorescent AFLPs and the end-labelled alternatives presented here are repeatable and produce similar numbers of fragments when scored using both manual and automated scoring methods. While it is not recommended to combine data using the two approaches, the results of the methods are qualitatively comparable, indicating that AFLP end-labelling is a robust alternative to standard methods of AFLP genotyping. For researchers commencing a new AFLP project, the AFLP end-labelling method outlined here is easily implemented, as it does not require major changes to PCR protocols and can significantly reduce the costs of AFLP studies.

  2. AFLP fingerprinting for paternity testing in ducks.

    PubMed

    Huang, C-W; Cheng, Y-S; Rouvier, R; Yang, K-T; Wu, C-P; Huang, M-C

    2007-06-01

    1. The accuracy and reproducibility of AFLP fingerprinting was investigated in the duck (Anas Platyrhynchos), using a multicolour fluorescent labeling technique. The fluorescent labelling fragments were separated on a capillary electrophoresis-base ABI PRISM 3100 Genetic Analyzer. 2. A total of 337 AFLP peaks with 103 of them being polymorphic markers were generated by 16 sets consisting of EcoRI/TaqI primer pair combinations. The number and size range of AFLP polymorphisms detected per primer pair varied from 3 to 11 and 58 to 290 bp, respectively. About 30.6% (103/337) of AFLP peaks were detected polymorphisms, with an average of 6.4 polymorphic markers per primer pair. 3. The clear polymorphic peaks were amplified with EcoR+AC/Taq+AC primer combinations. The AFLP peaks showed high reproducibility. From the family testing, we found that the fingerprints of all the offspring were derived from one or other parent. Therefore, we conclude that AFLP fingerprinting might be a suitable method for duck paternity testing.

  3. Comparison and validation of some ITS primer pairs useful for fungal metabarcoding studies.

    PubMed

    Op De Beeck, Michiel; Lievens, Bart; Busschaert, Pieter; Declerck, Stéphan; Vangronsveld, Jaco; Colpaert, Jan V

    2014-01-01

    Current metabarcoding studies aiming to characterize microbial communities generally rely on the amplification and sequencing of relatively short DNA regions. For fungi, the internal transcribed spacer (ITS) region in the ribosomal RNA (rRNA) operon has been accepted as the formal fungal barcode. Despite an increasing number of fungal metabarcoding studies, the amplification efficiency of primers is generally not tested prior to their application in metabarcoding studies. Some of the challenges that metabarcoding primers should overcome efficiently are the amplification of target DNA strands in samples rich in non-target DNA and environmental pollutants, such as humic acids, that may have been co-extracted with DNA. In the current study, three selected primer pairs were tested for their suitability as fungal metabarcoding primers. The selected primer pairs include two primer pairs that have been frequently used in fungal metabarcoding studies (ITS1F/ITS2 and ITS3/ITS4) and a primer pair (ITS86F/ITS4) that has been shown to efficiently amplify the ITS2 region of a broad range of fungal taxa in environmental soil samples. The selected primer pairs were evaluated in a 454 amplicon pyrosequencing experiment, real-time PCR (qPCR) experiments and in silico analyses. Results indicate that experimental evaluation of primers provides valuable information that could aid in the selection of suitable primers for fungal metabarcoding studies. Furthermore, we show that the ITS86F/ITS4 primer pair outperforms other primer pairs tested in terms of in silico primer efficiency, PCR efficiency, coverage, number of reads and number of species-level operational taxonomic units (OTUs) obtained. These traits push the ITS86F/ITS4 primer pair forward as highly suitable for studying fungal diversity and community structures using DNA metabarcoding.

  4. Comparison and Validation of Some ITS Primer Pairs Useful for Fungal Metabarcoding Studies

    PubMed Central

    Op De Beeck, Michiel; Lievens, Bart; Busschaert, Pieter; Declerck, Stéphan; Vangronsveld, Jaco; Colpaert, Jan V.

    2014-01-01

    Current metabarcoding studies aiming to characterize microbial communities generally rely on the amplification and sequencing of relatively short DNA regions. For fungi, the internal transcribed spacer (ITS) region in the ribosomal RNA (rRNA) operon has been accepted as the formal fungal barcode. Despite an increasing number of fungal metabarcoding studies, the amplification efficiency of primers is generally not tested prior to their application in metabarcoding studies. Some of the challenges that metabarcoding primers should overcome efficiently are the amplification of target DNA strands in samples rich in non-target DNA and environmental pollutants, such as humic acids, that may have been co-extracted with DNA. In the current study, three selected primer pairs were tested for their suitability as fungal metabarcoding primers. The selected primer pairs include two primer pairs that have been frequently used in fungal metabarcoding studies (ITS1F/ITS2 and ITS3/ITS4) and a primer pair (ITS86F/ITS4) that has been shown to efficiently amplify the ITS2 region of a broad range of fungal taxa in environmental soil samples. The selected primer pairs were evaluated in a 454 amplicon pyrosequencing experiment, real-time PCR (qPCR) experiments and in silico analyses. Results indicate that experimental evaluation of primers provides valuable information that could aid in the selection of suitable primers for fungal metabarcoding studies. Furthermore, we show that the ITS86F/ITS4 primer pair outperforms other primer pairs tested in terms of in silico primer efficiency, PCR efficiency, coverage, number of reads and number of species-level operational taxonomic units (OTUs) obtained. These traits push the ITS86F/ITS4 primer pair forward as highly suitable for studying fungal diversity and community structures using DNA metabarcoding. PMID:24933453

  5. Design of primer pairs for species-specific diagnosis of Leishmania (Leishmania) infantum chagasi using PCR.

    PubMed

    da Silveira Neto, Osvaldo José; Duarte, Sabrina Castilho; da Costa, Hérika Xavier; Linhares, Guido Fontgalland Coelho

    2012-01-01

    The objective of this study was to design and evaluate new primers for species-specific detection of L. infantum chagasi using PCR. Two combinations of primer pairs were established with the aim of obtaining specific amplification products from the L. infantum chagasi 18S rRNA gene. The combinations of the primer pairs and the respective sizes of the PCR products, based on the U422465 GenBank reference sequence of L. infantum chagasi, were: LCS1/LCS3 (259 bp) and LCS2/LCS3 (820 bp). It was concluded that the new PCR assays optimized using the primer pairs LCS1/LCS3 and LCS2/LCS3 were effective for specific detection of L. infantum chagasi, with analytical sensitivity to detect 1 pg/µL of DNA.

  6. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

    PubMed Central

    Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666

  7. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.

    PubMed

    Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.

  8. Use of AFLP for differentiation of Metschnikowia pulcherrima strains for postharvest disease biological control.

    PubMed

    Spadaro, D; Sabetta, W; Acquadro, A; Portis, E; Garibaldi, A; Gullino, M L

    2008-01-01

    Metschnikowia pulcherrima occurs naturally on fruits, buds and floral parts of apple trees. Some strains are effective as biocontrol agents against postharvest decay of apples and other fruits. The usefulness of the amplified fragment length polymorphism (AFLP) technique was evaluated for the genetic analysis of 26 strains of M. pulcherrima, isolated from different sources in different geographical regions. With six AFLP primer pairs, 729 polymorphic bands were scored. The technique showed a high discriminatory power. Genetic relationships between strains were also estimated using AFLP. All the isolates from the carposphere of apple, previously tested as biocontrol agents, were grouped in a single cluster with a high bootstrap value (97), indicating robustness and reproducibility. AFLP patterns could clearly distinguish the different strains and research is in progress to use some putative specific bands for single tag sequence (STS) conversion to develop isolate-specific markers.

  9. Development of primer pairs from diverse chloroplast genomes for use in plant phylogenetic research.

    PubMed

    Yang, Y C; Kung, T L; Hu, C Y; Lin, S F

    2015-11-23

    Variation in the chloroplast DNA sequence is useful for plant phylogenetic studies. However, the number of variable sequences provided by chloroplast DNA for suggested genes or genomic regions in plant phylogenetic analyses is often inadequate. To identify conserved regions that can be used to design primers and amplify variable sequences for use in plant phylogenetic studies, the complete chloroplast genomic sequences of six plant species (including Oryza sativa, Arabidopsis thaliana, Glycine max, Lotus japonicus, Medicago truncatula, and Phaseolus vulgaris), searched from the taxonomy database of NCBI were investigated. A total of 93 conserved regions, 32 in large single copy and 61 in inverted repeat regions, were identified. A set of five primer pairs were designed according to the conserved sequences located in the psbA~trnK, psbB~psbH, rpl23~trnI, trnR~trnN, and trnY~trnD regions to amplify variable DNA fragments. An additional 18 plant accessions from 14 species were used to validate their utility. Each of the tested species could be distinguished by length polymorphisms of fragments amplified with the five primer pairs. trnR~trnN and rpl23~trnI amplified fragments specific to monocot and legume species, respectively. Three primer pairs located in the psbA~trnK, psbB~psbH, and trnR~trnN regions were applied to amplify variable DNA sequences for phylogenetic analysis using the maximum parsimony method. The consistent result between taxonomy and phylogenetic analysis on the variable sequences amplified with these three primer pairs was revealed. The five newly developed primer pairs are recommended as tools for use in the identification of plant species and in phylogenetic studies.

  10. Hybridization in the section Mentha (Lamiaceae) inferred from AFLP markers.

    PubMed

    Gobert, V; Moja, S; Colson, M; Taberlet, P

    2002-12-01

    The amplified fragment length polymorphism (AFLP) method was used to evaluate genetic diversity and to assess genetic relationships within the section Mentha in order to clarify the taxonomy of several interspecific mint hybrids with molecular markers. To this end, genetic diversity of 62 Mentha accessions from different geographic origins, representing five species and three hybrids, was assessed. Three EcoRI/MseI AFLP primer combinations generated an average of 40 AFLP markers per primer combination, ranging in size from 50 to 500 base pairs (bp). The percentage of markers polymorphic ranged from 50% to 60% across all accessions studied. According to phenetic and cladistic analysis, the 62 mint accessions were grouped into two major clusters. Principal coordinates analysis separated species into well-defined groups, and clear relationships between species and hybrids could be described. Our AFLP analysis supports taxonomic classification established among Mentha species by conventional (morphological, cytological, and chemical) methods. It allows the assessment of phenetic relationships between species and the hybrids M. spicata and M. × piperita, largely cultivated all over the world for their menthol source, and provides new insights into the subdivision of M. spicata, based for the first time on molecular markers.

  11. Duck (Anas platyrhynchos) linkage mapping by AFLP fingerprinting.

    PubMed

    Huang, Chang-Wen; Cheng, Yu-Shin; Rouvier, Roger; Yang, Kuo-Tai; Wu, Chean-Ping; Huang, Hsiu-Lin; Huang, Mu-Chiou

    2009-03-17

    Amplified fragment length polymorphism (AFLP) with multicolored fluorescent molecular markers was used to analyze duck (Anas platyrhynchos) genomic DNA and to construct the first AFLP genetic linkage map. These markers were developed and genotyped in 766 F2 individuals from six families from a cross between two different selected duck lines, brown Tsaiya and Pekin. Two hundred and ninety-six polymorphic bands (64% of all bands) were detected using 18 pairs of fluorescent TaqI/EcoRI primer combinations. Each primer set produced a range of 7 to 29 fragments in the reactions, and generated on average 16.4 polymorphic bands. The AFLP linkage map included 260 co-dominant markers distributed in 32 linkage groups. Twenty-one co-dominant markers were not linked with any other marker. Each linkage group contained three to 63 molecular markers and their size ranged between 19.0 cM and 171.9 cM. This AFLP linkage map provides important information for establishing a duck chromosome map, for mapping quantitative trait loci (QTL mapping) and for breeding applications.

  12. Duck (Anas platyrhynchos) linkage mapping by AFLP fingerprinting

    PubMed Central

    Huang, Chang-Wen; Cheng, Yu-Shin; Rouvier, Roger; Yang, Kuo-Tai; Wu, Chean-Ping; Huang, Hsiu-Lin; Huang, Mu-Chiou

    2009-01-01

    Amplified fragment length polymorphism (AFLP) with multicolored fluorescent molecular markers was used to analyze duck (Anas platyrhynchos) genomic DNA and to construct the first AFLP genetic linkage map. These markers were developed and genotyped in 766 F2 individuals from six families from a cross between two different selected duck lines, brown Tsaiya and Pekin. Two hundred and ninety-six polymorphic bands (64% of all bands) were detected using 18 pairs of fluorescent TaqI/EcoRI primer combinations. Each primer set produced a range of 7 to 29 fragments in the reactions, and generated on average 16.4 polymorphic bands. The AFLP linkage map included 260 co-dominant markers distributed in 32 linkage groups. Twenty-one co-dominant markers were not linked with any other marker. Each linkage group contained three to 63 molecular markers and their size ranged between 19.0 cM and 171.9 cM. This AFLP linkage map provides important information for establishing a duck chromosome map, for mapping quantitative trait loci (QTL mapping) and for breeding applications. PMID:19291328

  13. Evaluation of AFLPs for germplasm fingerprinting and assessment of genetic diversity in cultivars of tomato (Lycopersicon esculentum L.).

    PubMed

    Park, Young Hoon; West, Marilyn A L; St Clair, Dina A

    2004-06-01

    Cultivated tomato (L. esculentum L.) germplasm exhibits limited genetic variation compared with wild Lycopersicon species. Amplified fragment length polymorphism (AFLP) markers were used to evaluate genetic variation among 74 cultivars, primarily from California, and to fingerprint germplasm to determine if cultivar-specific patterns could be obtained. All 74 cultivars were genotyped using 26 AFLP primer combinations; of the 1092 bands scored, 102 AFLP bands (9.3%) were polymorphic. Pair-wise genetic similarity coefficients (Jaccard and Nei-Li) were calculated. Jaccard coefficients varied from 0.16 to 0.98 among cultivar pairs, and 72% of pair-wise comparisons exceeded 0.5. UPGMA (unweighted pair-group method with arithmetic averaging) clustering and principle component analysis revealed four main clusters, I-IV; most modern hybrid cultivars grouped in II, whereas most vintage cultivars grouped in I. Clusters III and IV contained three and two cultivars, respectively. Some groups of cultivars closely related by pedigree exhibited high bootstrap values, but lower values (<50%) were obtained for cluster II and its four subgroups. Unique fingerprints for all 74 cultivars were obtained by a minimum of seven AFLP primer pairs, despite inclusion of some closely related cultivars. This study demonstrated that AFLP markers are effective for obtaining unique fingerprints of, and assessing genetic diversity among, tomato cultivars.

  14. Highly effective sequencing whole chloroplast genomes of angiosperms by nine novel universal primer pairs.

    PubMed

    Yang, Jun-Bo; Li, De-Zhu; Li, Hong-Tao

    2014-09-01

    Chloroplast genomes supply indispensable information that helps improve the phylogenetic resolution and even as organelle-scale barcodes. Next-generation sequencing technologies have helped promote sequencing of complete chloroplast genomes, but compared with the number of angiosperms, relatively few chloroplast genomes have been sequenced. There are two major reasons for the paucity of completely sequenced chloroplast genomes: (i) massive amounts of fresh leaves are needed for chloroplast sequencing and (ii) there are considerable gaps in the sequenced chloroplast genomes of many plants because of the difficulty of isolating high-quality chloroplast DNA, preventing complete chloroplast genomes from being assembled. To overcome these obstacles, all known angiosperm chloroplast genomes available to date were analysed, and then we designed nine universal primer pairs corresponding to the highly conserved regions. Using these primers, angiosperm whole chloroplast genomes can be amplified using long-range PCR and sequenced using next-generation sequencing methods. The primers showed high universality, which was tested using 24 species representing major clades of angiosperms. To validate the functionality of the primers, eight species representing major groups of angiosperms, that is, early-diverging angiosperms, magnoliids, monocots, Saxifragales, fabids, malvids and asterids, were sequenced and assembled their complete chloroplast genomes. In our trials, only 100 mg of fresh leaves was used. The results show that the universal primer set provided an easy, effective and feasible approach for sequencing whole chloroplast genomes in angiosperms. The designed universal primer pairs provide a possibility to accelerate genome-scale data acquisition and will therefore magnify the phylogenetic resolution and species identification in angiosperms.

  15. The application of high-throughput AFLP's in assessing genetic diversity in Fusarium oxysporum f. sp. cubense.

    PubMed

    Groenewald, Susan; Van Den Berg, Noëlani; Marasas, Walter F O; Viljoen, Altus

    2006-03-01

    Fusarium oxysporum f. sp. cubense (Foc) is responsible for fusarium wilt of bananas. The pathogen consists of several variants that are divided into three races and 21 vegetative compatibility groups (VCGs). Several DNA-based techniques have previously been used to analyse the worldwide population of Foc, sometimes yielding results that were not always consistent. In this study, the high-resolution genotyping method of AFLP is introduced as a potentially effective molecular tool to investigate diversity in Foc at a genome-wide level. The population selected for this study included Foc isolates representing different VCGs and races, isolates of F. oxysporum f. sp. dianthi, a putatively non-pathogenic biological control strain F. oxysporum (Fo47), and F. circinatum. High-throughput AFLP analysis was attained using five different infrared dye-labelled primer combinations using a two-dye model 4200s LI-COR automated DNA analyser. An average of approx. 100 polymorphic loci were scored for each primer pair using the SAGA(MX) automated AFLP analysis software. Data generated from five primer pair combinations were combined and subjected to distance analysis, which included the use of neighbour-joining and a bootstrap of 1000 replicates. A tree inferred from AFLP distance analysis revealed the polyphyletic nature of the Foc isolates, and seven genotypic groups could be identified. The results indicate that AFLP is a powerful tool to perform detailed analysis of genetic diversity in the banana pathogen Foc.

  16. SP-Designer: a user-friendly program for designing species-specific primer pairs from DNA sequence alignments.

    PubMed

    Villard, Pierre; Malausa, Thibaut

    2013-07-01

    SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php.

  17. Evaluation of 16S rRNA Gene Primer Pairs for Monitoring Microbial Community Structures Showed High Reproducibility within and Low Comparability between Datasets Generated with Multiple Archaeal and Bacterial Primer Pairs

    PubMed Central

    Fischer, Martin A.; Güllert, Simon; Neulinger, Sven C.; Streit, Wolfgang R.; Schmitz, Ruth A.

    2016-01-01

    The application of next-generation sequencing technology in microbial community analysis increased our knowledge and understanding of the complexity and diversity of a variety of ecosystems. In contrast to Bacteria, the archaeal domain was often not particularly addressed in the analysis of microbial communities. Consequently, established primers specifically amplifying the archaeal 16S ribosomal gene region are scarce compared to the variety of primers targeting bacterial sequences. In this study, we aimed to validate archaeal primers suitable for high throughput next generation sequencing. Three archaeal 16S primer pairs as well as two bacterial and one general microbial 16S primer pairs were comprehensively tested by in-silico evaluation and performing an experimental analysis of a complex microbial community of a biogas reactor. The results obtained clearly demonstrate that comparability of community profiles established using different primer pairs is difficult. 16S rRNA gene data derived from a shotgun metagenome of the same reactor sample added an additional perspective on the community structure. Furthermore, in-silico evaluation of primers, especially those for amplification of archaeal 16S rRNA gene regions, does not necessarily reflect the results obtained in experimental approaches. In the latter, archaeal primer pair ArchV34 showed the highest similarity to the archaeal community structure compared to observed by the metagenomic approach and thus appears to be the appropriate for analyzing archaeal communities in biogas reactors. However, a disadvantage of this primer pair was its low specificity for the archaeal domain in the experimental application leading to high amounts of bacterial sequences within the dataset. Overall our results indicate a rather limited comparability between community structures investigated and determined using different primer pairs as well as between metagenome and 16S rRNA gene amplicon based community structure analysis

  18. Musa genetic diversity revealed by SRAP and AFLP.

    PubMed

    Youssef, Muhammad; James, Andrew C; Rivera-Madrid, Renata; Ortiz, Rodomiro; Escobedo-GraciaMedrano, Rosa María

    2011-03-01

    The sequence-related amplified polymorphism (SRAP) technique, aimed for the amplification of open reading frames (ORFs), vis-â-vis that of the amplified fragment length polymorphisms (AFLP) were used to analyze the genetic variation and relationships among forty Musa accessions; which include commercial cultivars and wild species of interest for the genetic enhancement of Musa. A total of 403 SRAP and 837 AFLP amplicons were generated by 10 SRAP and 15 AFLP primer combinations, of which 353 and 787 bands were polymorphic, respectively. Both cluster analysis of unweighted pair-grouping method with arithmetic averages (UPGMA) and principal coordinate (PCO) analysis separated the forty accessions into their recognized sections (Eumusa, Australimusa, Callimusa and Rhodochlamys) and species. The percentage of polymorphism amongst sections and species and the relationships within Eumusa species and subspecies varied between the two marker systems. In addition to its practical simplicity, SRAP exhibited approximately threefold more specific and unique bands than AFLP, 37 and 13%, respectively. SRAP markers are demonstrated here to be proficient tools for discriminating amongst M. acuminata, M. balbisiana and M. schizocarpa in the Eumusa section, as well as between plantains and cooking bananas within triploid cultivars.

  19. A Set of 100 Chloroplast DNA Primer Pairs to Study Population Genetics and Phylogeny in Monocotyledons

    PubMed Central

    Scarcelli, Nora; Barnaud, Adeline; Eiserhardt, Wolf; Treier, Urs A.; Seveno, Marie; d'Anfray, Amélie; Vigouroux, Yves; Pintaud, Jean-Christophe

    2011-01-01

    Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of markers are commonly used. Most of them have been designed for amplification in a large range of Angiosperms and are located in the Large Single Copy (LSC). Here we developed a new set of 100 primer pairs optimized for amplification in Monocotyledons. Primer pairs amplify coding (exon) and non-coding regions (intron and intergenic spacer). They span the different chloroplast regions: 72 are located in the LSC, 13 in the Small Single Copy (SSC) and 15 in the Inverted Repeat region (IR). Amplification and sequencing were tested in 13 species of Monocotyledons: Dioscorea abyssinica, D. praehensilis, D. rotundata, D. dumetorum, D. bulbifera, Trichopus sempervirens (Dioscoreaceae), Phoenix canariensis, P. dactylifera, Astrocaryum scopatum, A. murumuru, Ceroxylon echinulatum (Arecaceae), Digitaria excilis and Pennisetum glaucum (Poaceae). The diversity found in Dioscorea, Digitaria and Pennisetum mainly corresponded to Single Nucleotide Polymorphism (SNP) while the diversity found in Arecaceae also comprises Variable Number Tandem Repeat (VNTR). We observed that the most variable loci (rps15-ycf1, rpl32-ccsA, ndhF-rpl32, ndhG-ndhI and ccsA) are located in the SSC. Through the analysis of the genetic structure of a wild-cultivated species complex in Dioscorea, we demonstrated that this new set of primers is of great interest for population genetics and we anticipate that it will also be useful for phylogeny and bar-coding studies. PMID:21637837

  20. A degenerate pair of primers for simultaneous detection of four alpha- and betanecroviruses.

    PubMed

    Varanda, C M R; Cardoso, J M S; Oliveira, M D M; Oliveira, S; Clara, M I E; Félix, M R F

    2014-11-01

    The high infection levels due to Olive latent virus 1 (OLV-1), Olive mild mosaic virus (OMMV) (alphanecrovirus) and Tobacco necrosis virus D (TNV-D) (betanecrovirus) in Portuguese olive orchards prompted us to develop a rapid PCR-based assay for the simultaneous detection of these viruses aimed at the sanitary selection and marketing of plant material in compliance with European Union regulations. A pair of degenerate oligonucleotide primers, parRdRp5' and parCoat3' was designed based on conserved regions located in the RNA-dependent RNA polymerase (RdRp) and coat protein (CP) genes of these viruses and one other alphanecrovirus, Tobacco necrosis virus A. Its use in RT-PCR assays generated a product of ca. 2000 bp for the 4 viral species tested. These primers were compared with virus specific primers in multiplex RT-PCR, and identical results were obtained. Its application to dsRNA extracted from 54 olive field growing trees originated the expected ca. 2000 bp amplicon in 17 trees. The virus identity was determined by sequencing the cloned RT-PCR products. No TNV-A was found. The RT-PCR assay using the degenerate primers described in this study were shown to be reliable in detecting any of the above-mentioned alpha- and betanecroviruses, and it is as sensitive as that which uses virus specific primers in multiplex assays. Therefore, this assay is well suited for the rapid screen of virus-free plant material in selection and improvement crop programmes. Additionally, it has the potential to reveal virus diversity and the presence of new viruses, provided the RT-PCR generated amplicon is further sequenced.

  1. An RT-PCR primer pair for the detection of Pospiviroid and its application in surveying ornamental plants for viroids.

    PubMed

    Bostan, Hidayet; Nie, Xianzhou; Singh, Rudra P

    2004-03-15

    A primer pair for reverse transcription-polymerase chain reaction (RT-PCR), based on the conserved sequences of the members of genus Pospiviroid was designed to yield a fragment of about 200 base pairs (bp). Since pospiviroids infect a large number of plants species and a few members of the genus Pospiviroid have been already detected in some ornamental plants, the primer pair was evaluated for its efficacy using ornamental plants. The method of return-polyacrylamide gel electrophoresis (R-PAGE) was used to determine the general presence of viroids in the test samples. Efficacy of the primer pair for members of genus Pospiviroid was demonstrated by the detection of Potato spindle tuber viroid (PSTVd) and Tomato chlorotic dwarf viroid (TCDVd) in potato, Chrysanthemum stunt viroid and Iresine viroid in Verbena and Vinca species, and Citrus exocortis viroid in Impatiens species. Specificity of the primer pair became evident, where additional viroids were detected by R-PAGE in Coleus and Magilla species, but they were not amplified by the Pospiviroid primer. This primer pair would be of benefit in indexing ornamental plants in quarantine samples or in viroid-free certification schemes, irrespective of their actual identity.

  2. Comparative Evaluation of Four Bacteria-Specific Primer Pairs for 16S rRNA Gene Surveys

    PubMed Central

    Thijs, Sofie; Op De Beeck, Michiel; Beckers, Bram; Truyens, Sascha; Stevens, Vincent; Van Hamme, Jonathan D.; Weyens, Nele; Vangronsveld, Jaco

    2017-01-01

    Bacterial taxonomic community analyses using PCR-amplification of the 16S rRNA gene and high-throughput sequencing has become a cornerstone in microbiology research. To reliably detect the members, or operational taxonomic units (OTUs), that make up bacterial communities, taxonomic surveys rely on the use of the most informative PCR primers to amplify the broad range of phylotypes present in up-to-date reference databases. However, primers specific for the domain Bacteria were often developed some time ago against database versions that are now out of date. Here we evaluated the performance of four bacterial primers for characterizing complex microbial communities in explosives contaminated and non-contaminated forest soil and by in silico evaluation against the current SILVA123 database. Primer pair 341f/785r produced the highest number of bacterial OTUs, phylogenetic richness, Shannon diversity, low non-specificity and most reproducible results, followed by 967f/1391r and 799f/1193r. Primer pair 68f/518r showed overall low coverage and a bias toward Alphaproteobacteria. In silico, primer pair 341f/785r showed the highest coverage of the domain Bacteria (96.1%) with no obvious bias toward the majority of bacterial species. This suggests the high utility of primer pair 341f/785r for soil and plant-associated bacterial microbiome studies.

  3. Genetic diversity in natural populations of Jacaranda decurrens Cham. determined using RAPD and AFLP markers.

    PubMed

    Bertoni, Bianca W; de C Telles, Mariana P; Malosso, Milena G; Torres, Simone C Z; Pereira, José O; Lourenço, Mirian V; de C França, Suzelei; Pereira, Ana M S

    2010-07-01

    Jacaranda decurrens (Bignoniaceae) is an endemic species of the Cerrado with validated antitumoral activity. The genetic diversity of six populations of J. decurrens located in the State of São Paulo was determined in this study by using molecular markers for randomly amplified polymorphic DNA (RAPD) and amplified fragment length polymorphism (AFLP). Following optimization of the amplification reaction, 10 selected primers generated 78 reproducible RAPD fragments that were mostly (69.2%) polymorphic. Two hundred and five reproducible AFLP fragments were generated by using four selected primer combinations; 46.3% of these fragments were polymorphic, indicating a considerable level of genetic diversity. Analysis of molecular variance (AMOVA) using these two groups of markers indicated that variability was strongly structured amongst populations. The unweighted pair group method with arithmatic mean (UPGMA) and Pearson's correlation coefficient (RAPD -0.16, p = 0.2082; AFLP 0.37, p = 0.1006) between genetic matrices and geographic distances suggested that the population structure followed an island model in which a single population of infinite size gave rise to the current populations of J. decurrens, independently of their spatial position. The results of this study indicate that RAPD and AFLP markers were similarly efficient in measuring the genetic variability amongst natural populations of J. decurrens. These data may be useful for developing strategies for the preservation of this medicinal species in the Cerrado.

  4. Genetic diversity in natural populations of Jacaranda decurrens Cham. determined using RAPD and AFLP markers

    PubMed Central

    2010-01-01

    Jacaranda decurrens (Bignoniaceae) is an endemic species of the Cerrado with validated antitumoral activity. The genetic diversity of six populations of J. decurrens located in the State of São Paulo was determined in this study by using molecular markers for randomly amplified polymorphic DNA (RAPD) and amplified fragment length polymorphism (AFLP). Following optimization of the amplification reaction, 10 selected primers generated 78 reproducible RAPD fragments that were mostly (69.2%) polymorphic. Two hundred and five reproducible AFLP fragments were generated by using four selected primer combinations; 46.3% of these fragments were polymorphic, indicating a considerable level of genetic diversity. Analysis of molecular variance (AMOVA) using these two groups of markers indicated that variability was strongly structured amongst populations. The unweighted pair group method with arithmatic mean (UPGMA) and Pearson's correlation coefficient (RAPD -0.16, p = 0.2082; AFLP 0.37, p = 0.1006) between genetic matrices and geographic distances suggested that the population structure followed an island model in which a single population of infinite size gave rise to the current populations of J. decurrens, independently of their spatial position. The results of this study indicate that RAPD and AFLP markers were similarly efficient in measuring the genetic variability amongst natural populations of J. decurrens. These data may be useful for developing strategies for the preservation of this medicinal species in the Cerrado. PMID:21637428

  5. Determination of genetic relationships between evergreen azalea cultivars in China using AFLP markers*

    PubMed Central

    Zhou, Hong; Liao, Jin; Xia, Yi-ping; Teng, Yuan-wen

    2013-01-01

    Evergreen azaleas are among the most important ornamental shrubs in China. Today, there are probably over 300 cultivars preserved in different nurseries, but with little information available on the cultivar itself or relationships between cultivars. Amplified fragment length polymorphism (AFLP) markers were employed to determine the genetic relationships between evergreen azalea cultivars in China. One hundred and thirty genotypes collected from gardens and nurseries, including cultivars classified in the groups East, West, Hairy, and Summer, unknown cultivars, and close species, were analyzed using three primer pairs. A total of 408 polymorphic fragments were generated by AFLP reactions with an average of 136 fragments per primer pair. The average values of expected heterozygosity and Shannon’s information index were 0.3395 and 0.5153, respectively. Genetic similarities were generated based on Dice coefficients, used to construct a neighbor joining tree, and bootstrapped for 100 replicates in Treecon V1.3b. Principal coordinate analysis (PCO) was performed based on Dice distances using NTSYS-pc software. The AFLP technique was useful for analyzing genetic diversity in evergreen azaleas. Cluster analysis revealed that cultivars in the West and Summer groups were quite distinct from other groups in the four-group classification system and that the East and Hairy groups should be redefined. PMID:23549847

  6. Species-specific AFLP markers for identification of Zingiber officinale, Z. montanum and Z. zerumbet (Zingiberaceae).

    PubMed

    Ghosh, S; Majumder, P B; Sen Mandi, S

    2011-02-08

    The Zingiber genus, which includes the herbs known as gingers, commonly used in cooking, is well known for its medicinal properties, as described in the Indian pharmacopoeia. Different members of this genus, although somewhat similar in morphology, differ widely in their pharmacological and therapeutic properties. The most important species of this genus, with maximal therapeutic properties, is Zingiber officinale (garden ginger), which is often adulterated with other less-potent Zingiber sp. There is an existing demand in the herbal drug industry for an authentication system for the Zingiber sp in order to facilitate their commercial use as genuine phytoceuticals. To this end, we used amplified fragment length polymorphism (AFLP) to produce DNA fingerprints for three Zingiber species. Sixteen collections (six of Z. officinale, five of Z. montanum, and five of Z. zerumbet) were used in the study. Seven selective primer pairs were found to be useful for all the accessions. A total of 837 fragments were produced by these primer pairs. Species-specific markers were identified for all three Zingiber species (91 for Z. officinale, 82 for Z. montanum, and 55 for Z. zerumbet). The dendogram analysis generated from AFLP patterns showed that Z. montanum and Z. zerumbet are phylogenetically closer to each other than to Z. officinale. The AFLP fingerprints of the Zingiber species could be used to authenticate Zingiber sp-derived drugs and to resolve adulteration-related problems faced by the commercial users of these herbs.

  7. Bacterial Diversity Dynamics Associated with Different Diets and Different Primer Pairs in the Rumen of Kankrej Cattle

    PubMed Central

    Pitta, Dipti W.; Parmar, Nidhi; Patel, Amrut K.; Indugu, Nagaraju; Kumar, Sanjay; Prajapathi, Karsanbhai B.; Patel, Anand B.; Reddy, Bhaskar; Joshi, Chaitanya

    2014-01-01

    The ruminal microbiome in herbivores plays a dominant role in the digestion of lignocellulose and has potential to improve animal productivity. Kankrej cattle, a popular native breed of the Indian subcontinent, were used to investigate the effect of different dietary treatments on the bacterial diversity in ruminal fractions using different primer pairs. Two groups of four cows were assigned to two primary diets of either dry or green forages. Each group was fed one of three dietary treatments for six weeks each. Dietary treatments were; K1 (50% dry/green roughage: 50% concentrate), K2 (75% dry/green roughage: 25% concentrate) and K3 (100% dry/green roughage). Rumen samples were collected using stomach tube at the end of each dietary period and separated into solid and liquid fractions. The DNA was extracted and amplified for V1–V3, V4–V5 and V6–V8 hypervariable regions using P1, P2 and P3 primer pairs, sequenced on a 454 Roche platform and analyzed using QIIME. Community compositions and the abundance of most bacterial lineages were driven by interactions between primer pair, dietary treatment and fraction. The most abundant bacterial phyla identified were Bacteroidetes and Firmicutes however, the abundance of these phyla varied between different primer pairs; in each primer pair the abundance was dependent on the dietary treatment and fraction. The abundance of Bacteroidetes in cattle receiving K1 treatment indicate their diverse functional capabilities in the digestion of both carbohydrate and protein while the predominance of Firmicutes in the K2 and K3 treatments signifies their metabolic role in fibre digestion. It is apparent that both liquid and solid fractions had distinct bacterial community patterns (P<0.001) congruent to changes in the dietary treatments. It can be concluded that the P1 primer pair flanking the V1–V3 hyper-variable region provided greater species richness and diversity of bacterial populations in the rumen of Kankrej cattle

  8. Analysis of genetic diversity and sectional relationships in Musa using AFLP markers.

    PubMed

    Ude, G.; Pillay, M.; Nwakanma, D.; Tenkouano, A.

    2002-06-01

    The AFLP technique was used to assess the genetic diversity and sectional relationships in 39 accessions representing the four main sections of the genus Musa. Eight AFLP + 3 primer pairs produced 260 polymorphic bands that were used in cluster and PCO analysis. A wide range of variability was observed among the species within the sections of the genus Musa. AFLP data was useful in separating the different sections of the genus as well as differentiating the different genomic groups of section Eumusa. Section Rhodochlamys ( x = 11) appeared as a distinct entity and clustered closely with the Musa acuminata Colla complex of section Eumusa that has the same basic chromosome number. This relationship is congruent with previous studies. However, unlike previous proposals that questioned the identity of Rhodochlamys as a separate taxonomic unit, PCO analysis of the AFLP data showed that it is a distinct entity. Musa laterita Cheesman ( Rhodochlamys) and Musa schizocarpa Simmonds clustered with the M. acuminata complex suggesting that they may be sources of useful genes for the improvement of the cultivated bananas. Callimusa formed a distinct unit and was closer to Australimusa than to the other sections. Although both sections share the same basic chromosome number of x = 10 these sections are genetically distinct

  9. Efficacy of random primer-pair arrays in plant genome analysis: a case study of Cucumis (Cucurbitaceae) for identification of wild and cultivated species.

    PubMed

    Gatphoh, E M; Sharma, S K; Rajkumari, K; Rama Rao, S

    2011-01-01

    The efficacy of random primer-pair arrays compared to conventional RAPD method with a single decamer primer was evaluated using DNA from two species of Cucumis. The banding patterns of amplicons revealed enhanced utility of primer-pair arrays over conventional RAPDs, producing more bands and a higher degree of polymorphism, both at intra- and inter-specific levels. Amplification produced by both methods clearly distinguished a wild from a cultivated species of the genus Cucumis. The main advantage of the primer-pair RAPD over single-primer-based RAPD is the increase in the number of reactions and amplification products in the form of novel/unique bands with a limited number of primers. It also enables the generation of reliable amplicons with a large number of polymorphic bands, which can be linked to gene-governing traits, allowing sequence-characterized partial genome analysis.

  10. Assessment of genetic diversity in Chinese eared pheasant using fluorescent-AFLP markers.

    PubMed

    Li, Xiujuan; Zhu, Yaohong; Liu, Panqi; Zhuge, Zengyu; Su, Guosheng; Wang, Jiufeng

    2010-10-01

    The eared pheasant consists of four species: white eared pheasant (Crossoptilon crossoptilon), Tibetan eared pheasant (Crossoptilon harmani), blue eared pheasant (Crossoptilon auritum), and brown eared pheasant (Crossoptilon mantchuricum). These species are found only in China, and are also on the list of the world's threatened species. In this paper, 74 individuals from the four eared pheasant species were assessed for population genetic diversity by means of fluorescent-AFLP markers. A total of 429 AFLP peaks were amplified by 11 pairs of fluorescent EcoRI/TaqI primer combinations. Out of all markers, 329 AFLPs were polymorphic. Each primer combination produced in reactions from 19 to 72 fragments and the polymorphic peaks percentage ranged from 53.33% to 86.11% with an average of 74.36% polymorphic bands. Genetic distance between species and genetic diversity within species were evaluated using Jaccard's similarity coefficients (SC) and the corresponding dendrogram. It was found that there was a moderate genetic distance between the four species (SC=0.674-0.832). Brown eared pheasant was genetically closely related to blue eared pheasant (SC=0.832), while white eared pheasant was more closely related to Tibetan eared pheasant (SC=0.812). Genetic diversity was lower in brown eared pheasant (SC=0.913) and Tibetan eared pheasant (SC=0.903) than in white eared pheasant (SC=0.832) and blue eared pheasant (SC=0.853).

  11. Genetic structure of Pilosocereus gounellei (Cactaceae) as revealed by AFLP marker to guide proposals for improvement and restoration of degraded areas in Caatinga biome.

    PubMed

    Monteiro, E R; Strioto, D K; Meirelles, A C S; Mangolin, C A; Machado, M F P S

    2015-12-15

    Amplified fragment length polymorphism (AFLP) analysis was used to evaluate DNA polymorphism in Pilosocereus gounellei with the aim of differentiating samples grown in different Brazilian semiarid regions. Seven primer pairs were used to amplify 703 AFLP markers, of which 700 (99.21%) markers were polymorphic. The percentage of polymorphic markers ranged from 95.3% for the primer combination E-AAG/M-CTT to 100% for E-ACC/M-CAT, E-ACC/M-CAA, E-AGC/M-CAG, E-ACT/M-CTA, and E-AGG/M-CTG. The largest number of informative markers (126) was detected using the primer combination E-AAC/M-CTA. Polymorphism of the amplified DNA fragments ranged from 72.55% (in sample from Piauí State) to 82.79% (in samples from Rio Grande Norte State), with an average of 75.39%. Despite the high genetic diversity of AFLP markers in xiquexique, analysis using the STRUCTURE software identified relatively homogeneous clusters of xiquexique from the same location, indicating a differentiation at the molecular level, among the plant samples from different regions of the Caatinga biome. The AFLP methodology identified genetically homogeneous and contrasting plants, as well as plants from different regions with common DNA markers. Seeds from such plants can be used for further propagation of plants for establishment of biodiversity conservation units and restoration of degraded areas of the Caatinga biome.

  12. A first linkage map of globe artichoke (Cynara cardunculus var. scolymus L.) based on AFLP, S-SAP, M-AFLP and microsatellite markers.

    PubMed

    Lanteri, S; Acquadro, A; Comino, C; Mauro, R; Mauromicale, G; Portis, E

    2006-05-01

    We present the first genetic maps of globe artichoke (Cynara cardunculus var. scolymus L. 2n=2x=34), constructed with a two-way pseudo-testcross strategy. A F1 mapping population of 94 individuals was generated between a late-maturing, non-spiny type and an early-maturing spiny type. The 30 AFLP, 13 M-AFLP and 9 S-SAP primer combinations chosen identified, respectively, 352, 38 and 41 polymorphic markers. Of 32 microsatellite primer pairs tested, 12 identified heterozygous loci in one or other parent, and 7 were fully informative as they segregated in both parents. The female parent map comprised 204 loci, spread over 18 linkage groups and spanned 1330.5 cM with a mean marker density of 6.5 cM. The equivalent figures for the male parent map were 180 loci, 17 linkage groups, 1239.4 and 6.9 cM. About 3% of the AFLP and AFLP-derived markers displayed segregation distortion with a P value below 0.01, and were not used for map construction. All the SSR loci were included in the linkage analysis, although one locus did show some segregation distortion. The presence of 78 markers in common to both maps allowed the alignment of 16 linkage groups. The maps generated provide a firm basis for the mapping of agriculturally relevant traits, which will then open the way for the application of a marker-assisted selection breeding strategy in this species.

  13. Performance of 16s rDNA Primer Pairs in the Study of Rhizosphere and Endosphere Bacterial Microbiomes in Metabarcoding Studies

    PubMed Central

    Beckers, Bram; Op De Beeck, Michiel; Thijs, Sofie; Truyens, Sascha; Weyens, Nele; Boerjan, Wout; Vangronsveld, Jaco

    2016-01-01

    Next-generation sequencing technologies have revolutionized the methods for studying microbial ecology by enabling high-resolution community profiling. However, the use of these technologies in unraveling the plant microbiome remains challenging. Many bacterial 16S rDNA primer pairs also exhibit high affinity for non-target DNA such as plastid (mostly chloroplast) DNA and mitochondrial DNA. Therefore, we experimentally tested a series of commonly used primers for the analysis of plant-associated bacterial communities using 454 pyrosequencing. We evaluated the performance of all selected primer pairs in the study of the bacterial microbiomes present in the rhizosphere soil, root, stem and leaf endosphere of field-grown poplar trees (Populus tremula × Populus alba) based on (a) co-amplification of non-target DNA, (b) low amplification efficiency for pure chloroplast DNA (real-time PCR), (c) high retrieval of bacterial 16S rDNA, (d) high operational taxonomic unit (OTU) richness and Inverse Simpson diversity and (e) taxonomic assignment of reads. Results indicate that experimental evaluation of primers provide valuable information that could contribute in the selection of suitable primer pairs for 16S rDNA metabarcoding studies in plant-microbiota research. Furthermore, we show that primer pair 799F-1391R outperforms all other primer pairs in our study in the elimination of non-target DNA and retrieval of bacterial OTUs. PMID:27242686

  14. A specific primer pair for the diagnosis and identification of Acanthamoeba astronyxis by random amplified polymorphic DNA-polymerase chain reaction.

    PubMed

    Ortega-Rivas, A; Lorenzo-Morales, J; Martínez, E; Villa, M; Clavel, A; Valladares, B; del Castillo, A

    2005-02-01

    Random amplified polymorphic DNA (RAPD) is a useful tool for species identification. The obtained band patterns can be used for specific primer pair design that is useful for species identification. In this study, a distinctive 485-bp band in Acanthamoeba astronyxis band patterns was found, using the OPC20 primer (ACTTCGCCAC). The band specificity was confirmed by hybridization, using it as a probe, against all OPC20 amplifications from different Acanthamoeba species. Once the fragment was sequenced, we used it to design a specific primer pair that was useful for the identification of different isolates as A. astronyxis species.

  15. Insight into the genomic diversity and relationship of Astragalus glycyphyllos symbionts by RAPD, ERIC-PCR, and AFLP fingerprinting.

    PubMed

    Gnat, Sebastian; Małek, Wanda; Oleńska, Ewa; Trościańczyk, Aleksandra; Wdowiak-Wróbel, Sylwia; Kalita, Michał; Wójcik, Magdalena

    2015-11-01

    We assessed the genomic diversity and genomic relationship of 28 Astragalus glycyphyllos symbionts by three methodologies based on PCR reaction, i.e., RAPD, ERIC-PCR, and AFLP. The AFLP method with one PstI restriction enzyme and selective PstI-GC primer pair had a comparable discriminatory power as ERIC-PCR one and these fingerprinting techniques distinguished among the studied 28 A. glycyphyllos symbionts 18 and 17 genomotypes, respectively. RAPD method was less discriminatory in the genomotyping of rhizobia analyzed and it efficiently resolved nine genomotypes. The cluster analysis of RAPD, ERIC-PCR, and AFLP profiles resulted in a generally similar grouping of the test strains on generated dendrograms supporting a great potential of these DNA fingerprinting techniques for study of genomic polymorphism and evolutionary relationship of A. glycyphyllos nodulators. The RAPD, ERIC-PCR, and AFLP pattern similarity coefficients between A. glycyphyllos symbionts studied was in the ranges 8-100, 18-100, and 23-100%, respectively.

  16. Evaluation of six primer pairs targeting the nuclear rRNA operon for characterization of arbuscular mycorrhizal fungal (AMF) communities using 454 pyrosequencing.

    PubMed

    Van Geel, Maarten; Busschaert, Pieter; Honnay, Olivier; Lievens, Bart

    2014-11-01

    In the last few years, 454 pyrosequencing-based analysis of arbuscular mycorrhizal fungal (AMF; Glomeromycota) communities has tremendously increased our knowledge of the distribution and diversity of AMF. Nonetheless, comparing results between different studies is difficult, as different target genes (or regions thereof) and primer combinations, with potentially dissimilar specificities and efficacies, are being utilized. In this study we evaluated six primer pairs that have previously been used in AMF studies (NS31-AM1, AMV4.5NF-AMDGR, AML1-AML2, NS31-AML2, FLR3-LSUmBr and Glo454-NDL22) for their use in 454 pyrosequencing based on both an in silico approach and 454 pyrosequencing of AMF communities from apple tree roots. Primers were evaluated in terms of (i) in silico coverage of Glomeromycota fungi, (ii) the number of high-quality sequences obtained, (iii) selectivity for AMF species, (iv) reproducibility and (v) ability to accurately describe AMF communities. We show that primer pairs AMV4.5NF-AMDGR, AML1-AML2 and NS31-AML2 outperformed the other tested primer pairs in terms of number of Glomeromycota reads (AMF specificity and coverage). Additionally, these primer pairs were found to have no or only few mismatches to AMF sequences and were able to consistently describe AMF communities from apple roots. However, whereas most high-quality AMF sequences were obtained for AMV4.5NF-AMDGR, our results also suggest that this primer pair favored amplification of Glomeraceae sequences at the expense of Ambisporaceae, Claroideoglomeraceae and Paraglomeraceae sequences. Furthermore, we demonstrate the complementary specificity of AMV4.5NF-AMDGR with AML1-AML2, and of AMV4.5NF-AMDGR with NS31-AML2, making these primer combinations highly suitable for tandem use in covering the diversity of AMF communities.

  17. Analysis of genetic relationships among Rosa damascena plants grown in Turkey by using AFLP and microsatellite markers.

    PubMed

    Baydar, Nilgün Göktürk; Baydar, Hasan; Debener, Thomas

    2004-08-05

    Rosa damascena Mill. is the most important rose species for rose oil production. The main rose oil producers in the world are Turkey and Bulgaria and they obtain the rose oil almost exclusively from R. damascena. In spite of coming from the same original populations, R. damascena plants grown in Turkey show some morphological differences. In this study, it was aimed to investigate the genetic relationships among R. damascena plants grown in Turkey by using microsatellite and AFLP markers. Twenty three AFLP and nine microsatellite primer pairs were used for this aim. No polymorphism could be detected among the plants, as the marker patterns obtained from different plants are identical. The conclusion from these data is that all R. damascena plants under study are derived from the same original genotype by vegetative propagation. Furthermore, the observed morphological differences originate from point mutations not detectable by molecular markers. Therefore, they are equivalent to sport mutations frequently observed in cut and garden rose varieties.

  18. Preliminary analysis of population genetic diversity of cultivated Laminaria japonica sporophyte via AFLP technique

    NASA Astrophysics Data System (ADS)

    Yi, Heng; Sui, Zhenghong; Bao, Zhenmin

    2010-03-01

    The amplified fragment length polymorphic DNA (AFLP) technique was adopted to estimate the population genetic polymorphism among 30 sporophytes of Laminaria japonica collected from a cultivating farm in Rongcheng, China. Three methods were used for genomic DNA extraction from Laminaria japonica sporophyte and only the products obtained using the improved genomic DNA extraction kit method proved qualified for AFLP analysis. The parameters of the method were optimized. Samples of forty milligrams and the cell lysis time of 120 min were suggested to replace the parameters recommended by the manufacturer. Thirty individuals of Laminaria japonica from the same cultivating site were investigated using one pair of selective primers. A total of 21 loci were obtained and 17 of them were polymorphic. The mean percent age of polymorphic loci of this population was 80.95%. The Nei’s gene diversity (H) within this population was 0.3028 and the average Shannon’s Information index (I) was 0.4498. A genetic distance matrix among different individuals was constructed as well. Through this study, an applicable AFLP genetic analysis working system for Laminaria japonica sporophyte was established. The results of this research also revealed a high level of genetic diversity within the studied population.

  19. Data supporting the design and evaluation of a universal primer pair for pseudogene-free amplification of HPRT1 in real-time PCR.

    PubMed

    Valadan, Reza; Hedayatizadeh-Omran, Akbar; Alhosseini-Abyazani, Mahdyieh Naghavi; Amjadi, Omolbanin; Rafiei, Alireza; Tehrani, Mohsen; Alizadeh-Navaei, Reza

    2015-09-01

    Hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1) is a common housekeeping gene for sample normalization in the quantitative reverse transcriptase polymerase chain (qRT-PCR). However, co-amplification of HPRT1 pseudogenes may affect accurate results obtained in qRT-PCR. We designed a primer pair (HPSF) for pseudogene-free amplification of HPRT1 in qRT-PCR [1]. We showed specific amplification of HPRT1 mRNA in some common laboratory cell lines, including HeLa, NIH/3T3, CHO, BHK, COS-7 and VERO. This article provides data supporting the presence and location of HPRT1 pseudogenes within human and mouse genome, and the strategies used for designing primers that avoid the co-amplification of contaminating pseudogenes in qRT-PCR. In silico analysis of human genome showed three homologous sequences for HPRT1 on chromosomes 4, 5 and 11. The mRNA sequence of HPRT1 was aligned with the pseudogenes, and the primers were designed toward 5' end of HPRT1 mRNA that was only specific to HPRT1 mRNA not to the pseudogenes. The standard curve plot generated by HPSF primers showed the correlation coefficient of 0.999 and the reaction efficiency of 99.5%. Our findings suggest that HPSF primers can be recommended as a candidate primer pair for accurate and reproducible qRT-PCR assays.

  20. Data supporting the design and evaluation of a universal primer pair for pseudogene-free amplification of HPRT1 in real-time PCR

    PubMed Central

    Valadan, Reza; Hedayatizadeh-Omran, Akbar; Alhosseini-Abyazani, Mahdyieh Naghavi; Amjadi, Omolbanin; Rafiei, Alireza; Tehrani, Mohsen; Alizadeh-Navaei, Reza

    2015-01-01

    Hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1) is a common housekeeping gene for sample normalization in the quantitative reverse transcriptase polymerase chain (qRT-PCR). However, co-amplification of HPRT1 pseudogenes may affect accurate results obtained in qRT-PCR. We designed a primer pair (HPSF) for pseudogene-free amplification of HPRT1 in qRT-PCR [1]. We showed specific amplification of HPRT1 mRNA in some common laboratory cell lines, including HeLa, NIH/3T3, CHO, BHK, COS-7 and VERO. This article provides data supporting the presence and location of HPRT1 pseudogenes within human and mouse genome, and the strategies used for designing primers that avoid the co-amplification of contaminating pseudogenes in qRT-PCR. In silico analysis of human genome showed three homologous sequences for HPRT1 on chromosomes 4, 5 and 11. The mRNA sequence of HPRT1 was aligned with the pseudogenes, and the primers were designed toward 5′ end of HPRT1 mRNA that was only specific to HPRT1 mRNA not to the pseudogenes. The standard curve plot generated by HPSF primers showed the correlation coefficient of 0.999 and the reaction efficiency of 99.5%. Our findings suggest that HPSF primers can be recommended as a candidate primer pair for accurate and reproducible qRT-PCR assays. PMID:26217821

  1. A set of 16 consensus primer pairs amplifying the complete mitochondrial genomes of orange-spotted grouper (Epinephelus coioides) and Hong Kong grouper (Epinephelus akaara).

    PubMed

    Zhuang, Xuan; Ding, Shaoxiong; Wang, Jun; Wang, Ying; Su, Yongquan

    2009-11-01

    Groupers are of considerable economic value; however, their classification and evolutionary relationships have long been hindered by the overwhelming number of species and lack of morphological specializations. Mitochondrial genome is a source of original markers that are potentially useful in the study of phylogeny and population genetics of groupers. We describe a set of 16 new primer pairs that allow PCR amplification of the entire mitochondrial genomes of orange-spotted grouper and Hong Kong grouper. This primer set has been defined for consensus over eight other grouper species, facilitating further studies on the molecular evolution and population genetics of groupers.

  2. AFLP marking and polymorphism among progenies of Gymnema sylvestre: an important medicinal plant of India.

    PubMed

    Osman, Magda Abbaker; Dhawan, Sunita Singh; Bahl, Janak Raj; Darokar, Mahendra P; Khanuja, Suman P S

    2011-11-01

    The level of polymorphism among twelve selected progenies of Gymnema sylvestre was investigated through AFLP markers by multiplexing PCR reactions using 64 (8x8) primer combinations. Fourteen primer combinations were selected as the most suitable combination for G. sylvestre. Analysis of the 12 progenies with these 14 primer pairs produced 1689 fragments of which 972 (57.5%) were polymorphic and 485 (28.7%) were unique to a particular genotype. The number of fragments produced by individual primer pairs was in the range of 55 to 225. Out of these, polymorphic fragments were in the range of 34 (E-ACC/M-CAC) to 157 (E-AGG/M-CAG) and unique bands observed were 8 (E-ACC / M-CAC) to 69 (E-AGG/M-CAC). Different primer combinations detected different levels of polymorphism, ranging from 33% (E-AGG/ M-CAC) to 69.8% (E-AGG/ M-CAC). From the observations, it appears that the primer combinations E-AGG/M-CAC, E-AGG/CTG, E-AGG/CAG and E-ACA/CAT were the most informative for the detection of polymorphism among the progenies compared with others, since they produced a high number of unique fragments. The similarity coefficient ranged from 0.212 to 0.731. High similarity was observed between progeny S8 and S9 (73%) and high divergence between progenies S3 and S11. Among the selected progeny, S9 was found to be the most similar to the parent (63%), while genotype S11 was the most distant (36.9%).

  3. Genetic Diversity in Musa acuminata Colla and Musa balbisiana Colla and some of their natural hybrids using AFLP Markers.

    PubMed

    Ude, G.; Pillay, M.; Nwakanma, D.; Tenkouano, A.

    2002-06-01

    Genetic diversity and relationships were assessed in 28 accessions of Musa acuminata (AA) Colla and Musa balbisiana (BB) Colla, and some of their natural hybrids, using the amplified fragment length polymorphisms (AFLP) technique. Fifteen AFLP +3 primer pairs produced 527 polymorphic bands among the accessions. Neighbor-joining and principal co-ordinate (PCO) analyses using Jaccard's similarity coefficient produced four major clusters that closely corresponded with the genome composition of the accessions (AA, BB, AAB and ABB). The AFLP data distinguished between the wild diploid accessions and suggested new subspecies relationships in the M. acuminata complex that are different from those based on morphological data. The data suggested that there are three subspecies within the M. acuminata complex (ssp. burmannica Simmonds, malaccensis Simmonds, and microcarpa Simmonds). 'Tjau Lagada' (ssp. microcarpa), 'Truncata' [ssp truncata (Ridl.) Shepherd] and 'SF247' [ssp. banksii (F.Muell) Simmonds] clustered very closely with 'Gros Michel' and 'Km 5', indicating that more than one M. acuminata subspecies may be involved in the origin of triploid AAA bananas. 'Calcutta 4' (ssp. burmannicoides De Langhe & Devreux) and 'Long Tavoy' (ssp. burmannica) were closely related and could be together in the same subspecies. This study also showed that there is much more genetic diversity within M. balbisiana that was split into two groups: (1) 'I-63' and 'HND' and (2) 'Los Banos', 'MPL' (Montpellier), '10852', 'Singapuri', 'Etikehel', and 'Butohan 1' as the other.

  4. Identification of two AFLP markers linked to bacterial wilt resistance in tomato and conversion to SCAR markers.

    PubMed

    Miao, Lixiang; Shou, Senyan; Cai, Jiayan; Jiang, Fang; Zhu, Zhujun; Li, Hongbin

    2009-03-01

    Tomato bacterial wilt (BW) incited by Ralstonia solanacearum is a constraint on tomato production in tropical, subtropical and humid regions of the world. In this paper, we present the results of a research aimed at the identification of PCR-based markers amplified fragment length polymorphism (AFLP) linked to the genes that confer resistance to tomato BW. To this purpose, bulked segregant analysis was applied to an F(2) population segregating for the BW resistant gene and derived from the pair-cross between a BW resistant cultivar T51A and the susceptible cultivar T9230. Genetic analysis indicated that tomato BW was conferred by two incomplete dominant genes. A CTAB method for total DNA extraction, developed by Murray and Thompson with some modifications was used to isolation the infected tomato leaves. Thirteen differential fragments were detected using 256 primer combinations, and two AFLP markers were linked to the BW resistance. Subsequently, the AFLP markers were converted to co-dominant SCAR markers, named TSCAR(AAT/CGA) and TSCAR(AAG/CAT). Linkage analysis showed that the two markers are on the contralateral side of TRSR-1. Genetic distance between TSCAR(AAT/CGA) and TRS-1 was estimated to 4.6 cM, while 8.4 cM between TSCAR(AAG/CAT) and TRS-1.

  5. BatchPrimer3: A high throughput web application for PCR and sequencing primer design

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A new web primer design program, BatchPrimer3, is developed based on Primer3. BatchPrimer3 adopted the Primer3 core program as a major primer design engine to choose the best primer pairs. A new score-based primer picking module is incorporated into BatchPrimer3 and used to pick position-restricte...

  6. AFLP and SCAR markers associated with the sex in Gracilaria lemaneiformis (Rhodophyta).

    PubMed

    Huan, Li; He, Linwen; Zhang, Baoyu; Niu, Jianfeng; Lin, Apeng; Wang, Guangce

    2013-08-01

    Gracilaria lemaneiformis (Bory de Saint-Vincent) Greville, an important marine alga, has great economic and nutritional value. However, during the nonreproductive period, it is difficult to distinguish the sporophyte, male gametophyte, and female gametophyte from each other by appearance. Amplified fragment length polymorphism (AFLP) is a multilocus marker technique, which was used in this study to identify markers associated with G. lemaneiformis sex type. By applying 80 primer combinations in the screening process, three fragments were found that were specific to male or female forms of the alga. A 173 bp band and an 89 bp band were found in the sporophyte and the male gametophyte by using primer E-AGG/M-CGT. E-ACC/M-CGG was used to amplify a 118 bp specific fragment in the sporophyte and the female gametophyte. Sequence characterized amplified region (SCAR) primers were designed and showed the expected bands at the corresponding stages. This suggested that the SCAR markers that had been developed were successful. The joint use of the three primer pairs allowed us to characterize sex and the G. lemaneiformis developmental phase in the nondescript stages. Rapid gender testing is expected to improve cross-breeding experiments and other genetic research in this economically important seaweed.

  7. A High-throughput AFLP-based Method for Constructing Integrated Genetic and Physical Maps: Progress Toward a Sorghum Genome Map

    PubMed Central

    Klein, Patricia E.; Klein, Robert R.; Cartinhour, Samuel W.; Ulanch, Paul E.; Dong, Jianmin; Obert, Jacque A.; Morishige, Daryl T.; Schlueter, Shannon D.; Childs, Kevin L.; Ale, Melissa; Mullet, John E.

    2000-01-01

    Sorghum is an important target for plant genomic mapping because of its adaptation to harsh environments, diverse germplasm collection, and value for comparing the genomes of grass species such as corn and rice. The construction of an integrated genetic and physical map of the sorghum genome (750 Mbp) is a primary goal of our sorghum genome project. To help accomplish this task, we have developed a new high-throughput PCR-based method for building BAC contigs and locating BAC clones on the sorghum genetic map. This task involved pooling 24,576 sorghum BAC clones (∼4× genome equivalents) in six different matrices to create 184 pools of BAC DNA. DNA fragments from each pool were amplified using amplified fragment length polymorphism (AFLP) technology, resolved on a LI-COR dual-dye DNA sequencing system, and analyzed using Bionumerics software. On average, each set of AFLP primers amplified 28 single-copy DNA markers that were useful for identifying overlapping BAC clones. Data from 32 different AFLP primer combinations identified ∼2400 BACs and ordered ∼700 BAC contigs. Analysis of a sorghum RIL mapping population using the same primer pairs located ∼200 of the BAC contigs on the sorghum genetic map. Restriction endonuclease fingerprinting of the entire collection of sorghum BAC clones was applied to test and extend the contigs constructed using this PCR-based methodology. Analysis of the fingerprint data allowed for the identification of 3366 contigs each containing an average of 5 BACs. BACs in ∼65% of the contigs aligned by AFLP analysis had sufficient overlap to be confirmed by DNA fingerprint analysis. In addition, 30% of the overlapping BACs aligned by AFLP analysis provided information for merging contigs and singletons that could not be joined using fingerprint data alone. Thus, the combination of fingerprinting and AFLP-based contig assembly and mapping provides a reliable, high-throughput method for building an integrated genetic and physical map

  8. [Morphology and AFLP analysis of tetraploid plantlets of Atractylodes macrocephala].

    PubMed

    Wang, Hong-juan; Li, Ya-ting; Xiang, Zeng-xu

    2015-02-01

    In order to investigate the genetic basis of morphological variation of tetraploid plantlets of Atractylodes macrocephala, diploid plantlets were taken as experimental material, sterile filtration colchicine was used to soak 0.5-1.0 cm long buds. The difference between morphology and stomatal of diploid and tetraploid of A. macrocephala was compared, and genome polymorphism was explored by AFLP. The results showed that the buds dipped in 0.1% colchicine solution for 36 h was optimal conditions to induce tetraploid of A. macrocephala with induction rate of 32.0%. Morphological indexes such as leaf area index, leaf length and width, the density of stomas and the number of chloroplast of tetraploid were distinctly different from diploid. Four hundred and fifty-one bands ranging with 80-500 bp were amplified with 24 pairs of primers, the rate of polymorphism was 32.59%. These amplification sites of diploid were different from tetraploid of A. macrocephala, and the differences in morphology of them were reflected in the DNA polymorphism.

  9. Verification of AFLP kinship methods of entomological evidence by sequencing.

    PubMed

    Faulds, Kelsie J; Wells, Jeffrey D; Picard, Christine J

    2014-12-01

    Kinship analysis allows the determination of sibship based on the individuals' genetic profile. In a recent empirical study, amplified fragment length polymorphism (AFLP) analysis was proposed as a test to determine kinship between Phormia regina individuals useful in inferring postmortem transport of a corpse. In order to validate this technique, mitochondrial DNA gene cytochrome oxidase II was sequenced for all individuals used in the previous study. Then, the relatedness coefficient based on AFLP profiles was determined for the pairs of individuals that had different haplotypes, and thus could not be full siblings, to determine a conservative false positive error rate of this proposed test. A majority, 96%, of pair wise comparisons of individuals with different haplotypes had relatedness coefficients <0.41 supporting the conclusion that AFLP analysis for full sibship is a valid and robust technique and thus useful for the detection of postmortem movement of a corpse.

  10. [Morphologic and AFLP analysis of relationships between tulip species Tulipa biebersteiniana (Liliaceae)].

    PubMed

    Kutlunina, N A; Polezhaeva, M A; Permiakova, M V

    2013-04-01

    In populations of four species of tulips, (Tulipa biebersteiniana, T. patens, T. scytica and T. riparia) from the Volgograd, Kurgansk, Orenburg, and Chelyabinsk regions and the Republic of Bashkortostan, genetic diversity was studied by means of morphological and AFLP analysis. A morphological analysis of seven quantitative and two qualitative criteria was carried out. Three selective EcoRI/MseI primer pairs allowed one to genotype 81 individuals from 13 tulip populations with 87 loci. The low level of variability by AFLP loci were revealed in all species, including T. biebersteiniana (P = 20.41%, UH(e) = 0.075), T. patens (26.97%, 0.082), T. scytica (27.53%, 0.086), and T. riparia (27.72%, 0.096). According to the AMOVA results, the variability proportion that characterizes the differences between the four Tulip species was lower (F(CT) = 0.235) than between populations within species (F(ST) = 0.439). Tulipa patens is well differentiated by means of Nei's distances, coordination, and analysis in the STRUCTURE program. An analysis in the STRUCTURE revealed four genetic groups of tulips that are not completely in accordance with the analyzed species. This acknowledges the presence of complicated genetic process in the tulip population.

  11. Analysis of the genetic diversity and differentiation of Fenneropenaeus penicillatus populations using AFLP technology

    NASA Astrophysics Data System (ADS)

    Zhang, Guiling; Cao, Yuanyu; Li, Zhongbao; Chen, Jin; Zhao, Binli; Lei, Guanggao; Wang, Zhanlin

    2012-05-01

    Fenneropenaeus penicillatus (redtail shrimp) is an important marine commercial animal in China. Recently, its resources have been depleted rapidly as a result of, for example, over-exploitation and environmental degradation of spawning grounds. Therefore, we analyzed the genetic diversity and differentiation of nine wild populations of F. penicillatus of China (Ningde, Lianjiang, Putian, Xiamen, Quanzhou, Zhangpu, Dongshan, Nanao, and Shenzhen populations) by amplified fragment length polymorphism (AFLP) technology, to provide genetic information necessary for resource protection, rejuvenation, artificial breeding, and sustainable use of the resource. Eight AFLP primer pairs were used for amplification, and 508 bands were detected among the populations. The results show that the percentage of polymorphic loci ( P) ranged from 41.34% to 63.58%; the Nei's gene diversity ( H) of the populations was 0.119 4-0.230 5; and Shannon's Information Index ( I) was 0.184 1-0.342 5. These genetic data indicate that the genetic diversity of F. penicillatus was high. The genetic differentiation coefficient ( G ST=0.216 2) and gene flow ( N m=1.812 4) show that there was a high level of genetic differentiation and a moderate level of gene flow among populations. More studies on the genetic differentiation mechanism of F. penicillatus along the south-eastern coast of China need to be conducted to find more effective scientific protection strategies for the conservation of F. penicillatus genetic resources.

  12. A genetic linkage map of the sea cucumber, Apostichopus japonicus (Selenka), based on AFLP and microsatellite markers.

    PubMed

    Li, Q; Chen, L; Kong, L

    2009-10-01

    We present the first genetic maps of the sea cucumber (Apostichopus japonicus), constructed with an F(1) pseudo-testcross strategy. The 37 amplified fragment length polymorphism (AFLP) primer combinations chosen identified 484 polymorphic markers. Of the 21 microsatellite primer pairs tested, 16 identified heterozygous loci in one or other parent, and six were fully informative, as they segregated in both parents. The female map comprised 163 loci, spread over 20 linkage groups (which equals the haploid chromosome number), and spanned 1522.0 cM, with a mean marker density of 9.3 cM. The equivalent figures for the male map were 162 loci, 21 linkage groups, 1276.9 and 7.9 cM. About 2.5% of the AFLP markers displayed segregation distortion and were not used for map construction. The estimated coverage of the genome was 84.8% for the female map and 83.4% for the male map. The maps generated will serve as a basis for the construction of a high-resolution genetic map and mapping of the functional genes and quantitative trait loci, which will then open the way for the application of a marker-assisted selection breeding strategy in this species.

  13. Population genetic structure in apricot (Prunus armeniaca L.) cultivars revealed by fluorescent-AFLP markers in southern Xinjiang, China.

    PubMed

    Yuan, Zhaohe; Chen, Xuesen; He, Tianming; Feng, Jianrong; Feng, Tao; Zhang, Chunyu

    2007-11-01

    Population-wide genetic structure was studied using fluorescent-AFLP markers on 85 apricot (Prunus armeniaca L.) cultivars collected from Kuche, Kashi, Hetian in the Tarim Basin, southern Xinjiang Uygur Autonomous Region of China. The purpose of this study was to determine the genetic structure and genotypic diversity among the different eco-geographical populations. Based on the results from this study, 8 pairs of fluorescent-AFLP primers showed clear electrophoregram and high polymorphism amongst the 64 pairs of EcoR|/Mse|(Mse|--a FAM fluorescent marked primer) primers screened. There was a significant polymorphic difference for the same primer pair in different populations and for the same population with different primer pairs. The percentage of polymorphic loci (P) at species level was higher than Kuche, Hetian, Kashi population levels, respectively. The Nei's gene diversity index (H) and Shannon's information index (I) at species level were higher than those of Kuche, Hetian, and Kashi at population level, respectively. H and I of Kuche population were the highest amongst the three populations. Apricot population genetic diversity was found mainly within the population. Genetic differentiation coefficient between populations (G(ST)) was 0.0882. Gene flow Nm between the populations was 5.1689. Population genetic identity was between 0.9772-0.9811 and genetic distance was between 0.0191-0.0232. These results further indicated that the similarity between populations was higher and the genetic distance between populations was smaller. The UPGMA cluster analysis indicates that the geographical populations at Kuche, Kashi, Hetian were relatively independent Mendelian populations. Concurrently, there was also partial gene exchange between the populations. All the evidences indicated that the genetic diversity in Kuche population was the highest, suggesting that it could be a transition population from wild apricot to cultivated apricot. There were abundant genetic

  14. Genetic Structure and Diversity Analysis Revealed by AFLP Markers on Different Glycyrrhiza glabra L. an Endangered Medicinal Species from South of Iran and Implications for Conservation.

    PubMed

    Hakimi, Atieh; Zolfaghari, Maryam; Sorkheh, Karim

    2016-09-28

    Glycyrrhiza glabra is an endangered and national-protected medicinal plant species distributed in semi-arid and arid areas of South of Iran. This study addresses the genetic diversity and relationship between populations in different habitats by amplified fragment length polymorphism (AFLP). The plant materials consisted of 90 individuals from nine different populating areas of Dezful, Ramhormoz, Ahvaz, Abadan, Khorramshahr, Behbahan, Haft-tapeh, Andimeshk, and Shushtar. Twenty-three AFLP primer combinations generated a total of 1019 bands with 94.80 % polymorphism. Unweighted pair group method based on arithmetic average (UPGMA) analysis was performed on Jaccard's similarity coefficient matrix. According to results, the genetic resources and diversity in wild populations of G. glabra were rich. The number of polymorphic fragments per primer combination detected ranged from 18 to 65 bands with an average of 41.95 bands. Average polymorphic information content (PIC) was 0.81 in overall primer combinations. M-GTC+P-AGC primer combination showed the highest PIC (0.94) which can be a good candidate primer combination to verify genetic diversity in G. glabra. The UPGMA and principal coordinate analysis showed a clear distinction among the genotypes and the genotypes divided into three clusters in the dendrogram results. A model-based structure analysis revealed the presence of three groups. The study showed that genetic variation and population structure are determined among the accessions of G. glabra collected from different locations. High level of genetic variation in both intra- and inter-species was detected. Conservational efforts have to be strengthened for all populations of the plant species in different habitats.

  15. Genotyping of Ochrobactrum spp. by AFLP analysis.

    PubMed

    Leal-Klevezas, Diana Sara; Martínez-de-la-Vega, Octavio; Ramírez-Barba, Ector Jaime; Osterman, Björn; Martínez-Soriano, Juan Pablo; Simpson, June

    2005-04-01

    AFLP was used to analyze the genetic diversity among Ochrobactrum strains. AFLP patterns showed a great genomic variability that separated the samples into three distinct clusters. Ochrobactrum intermedium was found to be closely related to Brucella abortus S99.

  16. Identification of Phoenix dactylifera L. varieties based on amplified fragment length polymorphism (AFLP) markers.

    PubMed

    Diaz, Susana; Pire, Carmen; Ferrer, Juan; Bonete, Maria José

    2003-01-01

    The amplified fragment length polymorphism (AFLP) technique was applied to identify palm varieties. Fluorescence labelled primers were used in selective amplifications and the amplified fragments were detected on capillary gel electrophoresis using an automated DNA sequencer with the analysis fragment option. This is a rapid and efficient technique for detecting a large number of DNA markers on the date palm. Phoenix dactylifera L. varieties Bou-Fegous, Medjool, and E-528 from Estación Phoenix (Elche), Spain, were analysed, yielding a total of 310 AFLP fragments derived from five primer combinations. The process for regenerating the date palm cultivars from in vitro tissue culture should yield individuals phenotypically and genetically identical to the explant they are derived from. The AFLP markers obtained were successfully used for comparing and identifying vitroplants of palm.

  17. RFLP and AFLP analysis of inter- and intraspecific variation of Brassica rapa and B. napus shows that B. rapa is an important genetic resource for B. napus improvement.

    PubMed

    Liu, Ren-Hu; Meng, Jin-Ling

    2006-09-01

    Fingerprinting of 29 accessions of oilseed rape, including seven accessions of Brassica napus, and 22 accessions of B. rapa (B. campestris) from Europe, North America, and China was analyzed using RFLP and AFLP markers. In total, 1,477 polymorphic RFLP bands and 183 polymorphic AFLP bands from 166 enzyme-probe combinations and two pairs of AFLP primers, respectively, were scored for the 29 accessions. On average, RFLP analysis showed that the Arabidopsis EST probe detected more polymorphic bands in Brassica than the random genomic probe performed. More polymorphic RFLP markers were detected with the digestion of EcoR I or BamH I than HindIII. According to the number of bands amplified from each accession, the copy numbers of each gene in the genomes of B. rapa and B. napus were estimated. The average copy numbers in B. rapa of China, B. rapa of Europe, and B. napus, were 3.2, 3.1, and 2.9, respectively. Genetic distance based on the AFLP data was well correlated with that based on the RFLP data (r = 0.72, P<0.001), but 0.39 smaller on average. Genetic diversity analysis showed that Chinese B. rapa was more polymorphic than Chinese B. napus and European materials. Some European B. napus accessions were clustered into European B. rapa, which were distinctly different from Chinese B. napus. The larger variations of Chinese accessions of B. rapa suggest that they are valuable in oilseed rape breeding. Novel strategies to use intersubgenomic heterosis between genome of B. rapa (A(r)A(r)) and genome of B. napus (A(n)A(n)C(n)C(n)) were elucidated.

  18. Genetic variation of Trigonobalanus verticillata, a primitive species of Fagaceae, in Malaysia revealed by chloroplast sequences and AFLP markers.

    PubMed

    Kamiya, Koichi; Harada, Ko; Clyde, Mahani Mansor; Mohamed, Abdul Latiff

    2002-06-01

    The genetic variation of Trigonobalanus verticillata, the most recently described genus of Fagaceae, was studied using chloroplast DNA sequences and AFLP fingerprinting. This species has a restricted distribution that is known to include seven localities in tropical lower montane forests in Malaysia and Indonesia. A total of 75 individuals were collected from Bario, Kinabalu, and Fraser's Hill in Malaysia. The sequences of rbcL, matK, and three non-coding regions (atpB-rbcL spacer, trnL intron, and trnL-trnF spacer) were determined for 19 individuals from these populations. We found a total of 30 nucleotide substitutions and four length variations, which allowed identification of three haplotypes characterizing each population. No substitutions were detected within populations, while the tandem repeats in the trnL -trnF spacer had a variable repeat number of a 20-bp motif only in Kinabalu. The differentiation of the populations inferred from the cpDNA molecular clock calibrated with paleontological data was estimated to be 8.3 MYA between Bario and Kinabalu, and 16.7 MYA between Fraser's Hill and the other populations. In AFLP analysis, four selective primer pairs yielded a total of 431 loci, of which 340 (78.9%) were polymorphic. The results showed relatively high gene diversity (H(S) = 0.153 and H(T) = 0.198) and nucleotide diversity (pi(S) = 0.0132 and pi(T) = 0.0168) both within and among the populations. Although the cpDNA data suggest that little or no gene flow occurred between the populations via seeds, the fixation index estimated from AFLP data (F(ST) = 0.153 and N(ST) = 0.214) implies that some gene flow occurs between populations, possibly through pollen transfer.

  19. [Genetic diversity and genetic differentiation of Rhododendron concinnum wild populations in Qinling Mountains of Northwest China: an AFLP analysis].

    PubMed

    Zhao, Bing; Xu, Man; Si, Guo-Chen; Li, Hou-Hua; Zhang, Yan-Long

    2012-11-01

    By using amplified fragment length polymorphism (AFLP) technique, an investigation was made on the genetic diversity and genetic differentiation of seven wild populations of Rhododendron concinnum in Qinling Mountains of Northwest China. A total of 182 amplification products were generated from three AFLP selective primer combinations, of which, 151 were polymorphic. The percentage of polymorphism was 83.1%. The change trends showed by the percentage of polymorphic loci (PPL), Nei's gene diversity (h), and Shannon's information index (I) were uniform, and the order of the populations was Meixian > Zhashui > Zhen' an > Huxian > Ningqiang > Nanzheng > Zhouzhi. The POPGENE analysis showed that the R. concinnum had higher genetic diversity at both species level (PPL = 91.22%, I = 0.7217, h = 0.5095) and population level (PPL = 77.56%, I = 0.6409, h = 0.4725). The coefficient of gene differentiation among the populations (Gst) was 0.0726, indicating that 92.74% of genetic variation occurred within the populations. The analysis of molecular variance (AMOVA) showed that 85.3% of the genetic variation was within the populations, and 14.7% of it was among the populations. The unweighted pair group method with arithmeticmean (UPGMA) indicated that there was no significant correlation between the genetic distance and the geographic distance among the R. concinnum populations. The conservation strategies for R. concinnum germplasm resources were put forward.

  20. AFLP analysis of genetic variation among three natural populations of horseshoe crab Tachypleus tridentatus along Chinese coast

    NASA Astrophysics Data System (ADS)

    Xu, Qian; Chen, Fei; Shin, Paul K. S.; Cheung, S. G.; Chen, Yan; Ke, Caihuan

    2011-03-01

    The AFLP (amplified fragment length polymorphism) technique was used to analyze and compare the genetic diversity of Tachypleus tridentatus from three south-eastern coastal sites of China (Pingtan, Hong Kong and Beihai). Eight pairs of primers generated 361 loci, including 285 polymorphic loci. The ratio of polymorphic loci was 96.97%. Nei's genetic diversity index was 0.420 8 and the Shannon information index was 0.607 5, both of which were higher than that reported for many other arthropods. These results show that the genetic diversity detected was mainly caused by individual differences within a population. Genetic distance showed that the rational division of the three geographic populations of T. tridentatus along the south-eastern coast of China was not significant, in which the genetic distance was not proportional to the geographic distance. All three horseshoe crab populations may belong to a large group, and had a high degree of genetic similarity. The high level of genetic diversity obtained from the present AFLP analysis may be due to the large effective population size of the species in Chinese waters.

  1. Fluorescent amplified fragment length polymorphism (fAFLP) analysis of Listeria monocytogenes.

    PubMed

    Amar, Corinne

    2014-01-01

    Fluorescent amplified fragment length polymorphism (fAFLP) is based on the selective PCR amplification of restriction fragments from a digest of total genomic DNA. Genomic DNA extracted from a purified bacterial isolate is completely digested with two endonucleases generating fragments which are ligated to specific double-stranded adaptors. The ligated fragments are then amplified by PCR using fluorescently labelled primers. Fluorescent amplified fragments are separated by size on an automated sequencer with a size standard. fAFLP is a rapid, highly reproducible technique which can be used to discriminate and subtype Listeria monocytogenes strains.

  2. Simultaneous Detection and Genotype Determination of HSV 1 and 2 by Real-time PCR Using Melting Curve Analysis and a Unique Pair of Primers.

    PubMed

    Paryan, Mahdi; Mohammadi-Yeganeh, Samira; Rezvan, Houri; Kia, Vahid; Mansouri, Ardalan; Mirab Samiee, Siamak

    2017-02-01

    Herpes simplex virus (HSV) is a human pathogen that causes different pathologic manifestations. Rapid and feasible detection and discrimination methods for HSV genotyping is a challenge in clinical laboratories, especially in children suffering from herpetic encephalitis. A quantitative real-time polymerase chain reaction (PCR)-based genotyping assay using SYBR Green I was established. We designed only 1 pair of primer for HSV 1 and 2, targeting thymidine kinase gene conserved region. HSV genotypes were determined by PCR using melting curve analysis with LightCycler. Different HSV genotypes were successfully detected in all clinical samples. The melting temperature for HSV 1 and 2 was 85.5±0.78°C and 89±0.53°C, respectively. These 2 genotypes were completely distinguished by means of the accurate melting assay. Importantly, detection was reliably performed within only 1 hour. The assay had no cross-reactivity across species, an excellent dynamic range from 10 to 10 copies per reaction, a good intra-assay and interassay reproducibility, and a detection limit of a single copy per reaction. Our homebrew designed and validated quantitative real-time PCR followed by a melting curve analysis provided a rapid and convenient screening test for differential identification of HSV genotypes 1 and 2. We recommend the large-scale application of this method for HSV 1 and 2 detection.

  3. Genetic analyses of captive Alala (Corvus hawaiiensis) using AFLP analyses

    USGS Publications Warehouse

    Jarvi, Susan I.; Bianchi, Kiara R.

    2006-01-01

    affected by the mutation rate at microsatellite loci, thus introducing a bias. Also, the number of loci that can be studied is frequently limited to fewer than 10. This theoretically represents a maximum of one marker for each of 10 chromosomes. Dominant markers like AFLP allow a larger fraction of the genome to be screened. Large numbers of loci can be screened by AFLP to resolve very small individual differences that can be used for identification of individuals, estimates of pairwise relatedness and, in some cases, for parentage analyses. Since AFLP is a dominant marker (can not distinguish between +/+ homozygote versus +/- heterozygote), it has limitations for parentage analyses. Only when both parents are homozygous for the absence of alleles (-/-) and offspring show a presence (+/+ or +/-) can the parents be excluded. In this case, microsatellites become preferable as they have the potential to exclude individual parents when the other parent is unknown. Another limitation of AFLP is that the loci are generally less polymorphic (only two alleles/locus) than microsatellite loci (often >10 alleles/locus). While generally fewer than 10 highly polymorphic microsatellite loci are enough to exclude and assign parentage, it might require up to 100 or more AFLP loci. While there are pros and cons to different methodologies, the total number of loci evaluated by AFLP generally offsets the limitations imposed due to the dominant nature of this approach and end results between methods are generally comparable. Overall objectives of this study were to evaluate the level of genetic diversity in the captive population of Alala, to compare genetic data with currently available pedigree information, and to determine the extent of relatedness of mating pairs and among founding individuals.

  4. Genetic diversity of Chilean and Brazilian alstroemeria species assessed by AFLP analysis.

    PubMed

    Han, T H; de Jeu, M; van Eck, H; Jacobsen, E

    2000-05-01

    One to three accessions of 22 Alstroemeria species, an interspecific hybrid (A. aurea x A. inodora), and single accessions of Bomarea salsilla and Leontochir ovallei were evaluated using the AFLP-marker technique to estimate the genetic diversity within the genus Alstroemeria. Three primer combinations generated 716 markers and discriminated all Alstroemeria species. The dendrogram inferred from the AFLP fingerprints supported the conjecture of the generic separation of the Chilean and Brazilian Alstroemeria species. The principal co-ordinate plot showed the separate allocation of the A. ligtu group and the allocation of A. aurea, which has a wide range of geographical distribution and genetic variation, in the middle of other Alstroemeria species. The genetic distances, based on AFLP markers, determined the genomic contribution of the parents to the interspecific hybrid.

  5. Characterization of ten date palm (Phoenix dactylifera L.) cultivars from Saudi Arabia using AFLP and ISSR markers.

    PubMed

    Sabir, Jamal S M; Abo-Aba, Salah; Bafeel, Sameera; Zari, Talal A; Edris, Sherif; Shokry, Ahmed M; Atef, Ahmed; Gadalla, Nour O; Ramadan, Ahmed M; Al-Kordy, Magdy A; El-Domyati, Fotouh M; Jansen, Robert K; Bahieldin, Ahmed

    2014-01-01

    Date palm is the most economically important plant in the Middle East due to its nutritionally valuable fruit. The development of accurate DNA fingerprints to characterize cultivars and the detection of genetic diversity are of great value for breeding programs. The present study explores the usefulness of ISSR and AFLP molecular markers to detect relationships among 10 date palm (Phoenix dactylifera L.) cultivars from Saudi Arabia. Thirteen ISSR primers and six AFLP primer combinations were examined. The level of polymorphism among cultivars for ISSRs ranged from 20% to 100% with an average of 85%. Polymorphism levels for AFLPs ranged from 63% to 84% with an average of 76%. The total number of cultivar-specific markers was 241, 208 of which were generated from AFLP analysis. AJWA cultivar had the highest number of cultivar-specific ISSR markers, whereas DEK, PER, SUK-Q, SHA and MOS-H cultivars had the lowest. RAB and SHA cultivars had the most and least AFLP cultivar-specific markers, respectively. The highest pairwise similarity indices for ISSRs, AFLPs and combined markers were 84% between DEK (female) and PER (female), 81% between SUK-Q (male) and RAB (male), and 80% between SUK-Q (male) and RAB (male), respectively. The lowest similarity indices were 65% between TAB (female) and SUK-Q (male), 67% between SUK-A (female) and SUK-Q (male), and 67% between SUK-A (female) and SUK-Q (male). Cultivars of the same sex had higher pairwise similarities than those between cultivars of different sex. The Neighbor-Joining (NJ) tree generated from the ISSR dataset was not well resolved and bootstrap support for resolved nodes in the tree was low. AFLP and combined data generated completely resolved trees with high levels of bootstrap support. In conclusion, AFLP and ISSR approaches enabled discrimination among 10 date palm cultivars of from Saudi Arabia, which will provide valuable information for future improvement of this important crop.

  6. Genotyping of Ochrobactrum spp. by AFLP Analysis

    PubMed Central

    Leal-Klevezas, Diana Sara; Martínez-de-la-Vega, Octavio; Ramírez-Barba, Ector Jaime; Osterman, Björn; Martínez-Soriano, Juan Pablo; Simpson, June

    2005-01-01

    AFLP was used to analyze the genetic diversity among Ochrobactrum strains. AFLP patterns showed a great genomic variability that separated the samples into three distinct clusters. Ochrobactrum intermedium was found to be closely related to Brucella abortus S99. PMID:15774899

  7. A new high-throughput AFLP approach for identification of new genetic polymorphism in the genome of the clonal microorganism Mycobacterium tuberculosis.

    PubMed

    van den Braak, Nicole; Simons, Guus; Gorkink, Roy; Reijans, Martin; Eadie, Kimberly; Kremers, Kristin; van Soolingen, Dick; Savelkoul, Paul; Verbrugh, Henri; van Belkum, Alex

    2004-01-01

    We have here applied high-throughput amplified fragment length polymorphism (htAFLP) analysis to strains belonging to the five classical species of the Mycobacterium tuberculosis complex. Using 20 strains, three enzyme combinations and eight selective amplification primer pairs, 24 AFLP reactions were performed per strain. Overall, this resulted in 480 DNA fingerprints and more than 1200 htAFLP-amplified PCR fragments were visualised per strain. The cumulative dendrogram correctly clustered strains from the various species, albeit within a distance of 6.5% for most of them. The single isolate of Mycobacterium canettii presented separately at 19% distance. All over, 169 fragments (14%) appeared to be polymorphic. Sixty-eight were specific for M. canetti and forty-five for Mycobacterium bovis. For the 10 different M. tuberculosis strains included in the present analysis, 56 polymorphic markers were identified. Upon sequencing 20 of these marker regions and comparisons with the H37Rv genome sequence, 25% appeared to share homology to members of the antigenically variable PE/PPE surface protein encoding gene family confirming previous findings on the genetic heterogeneity within these genes. In addition, homologues for phage genes and insertion element-encoded genes were detected. Forty-five percent of the sequences derived from ORFs with a currently unknown function, which was corroborated by genome sequence comparison for the clinical M. tuberculosis CD 1551 isolate. Sequence variation in M. tuberculosis was assessed in more detail for a subset of these loci by newly designed PCR restriction fragment length polymorphism (RFLP) tests and direct sequencing. Fourteen novel PCR RFLP tests were developed and twelve novel single nucleotide polymorphisms (SNPs) were identified, all suited for epidemiological analysis of M. tuberculosis. The tests allowed for identification of the major Mycobacterium species and M. tuberculosis variants and clones.

  8. An AFLP-based linkage map of Japanese red pine (Pinus densiflora) using haploid DNA samples of megagametophytes from a single maternal tree.

    PubMed

    Kim, Yong-Yul; Choi, Hyung-Soon; Kang, Bum-Yong

    2005-10-31

    We have constructed an AFLP-based linkage map of Japanese red pine (Pinus densiflora Siebold et Zucc.) using haploid DNA samples of 96 megagametophytes from a single maternal tree, selection clone Kyungbuk 4. Twenty-eight primer pairs generated a total of 5,780 AFLP fragments. Five hundreds and thirteen fragments were verified as genetic markers with two alleles by their Mendelian segregation. At the linkage criteria LOD 4.0 and maximum recombination fraction 0.25(theta), a total of 152 markers constituted 25 framework maps for 19 major linkage groups. The maps spanned a total length of 2,341 cM with an average framework marker spacing of 18.4 cM. The estimated genome size was 2,662 cM. With an assumption of equal marker density, 82.2% of the estimated genome would be within 10 cM of one of the 230 linked markers, and 68.1% would be within 10 cM of one of the 152 framework markers. We evaluated map completeness in terms of LOD value, marker density, genome length, and map coverage. The resulting map will provide crucial information for future genomic studies of the Japanese red pine, in particular for QTL mapping of economically important breeding target traits.

  9. AFLP diversity in the common vetch ( Vicia sativa L.) on the world scale.

    PubMed

    Potokina, E.; Blattner, R.; Alexandrova, T.; Bachmann, K.

    2002-07-01

    The Vavilov Institute of Plant Industry (VIR) keeps a living seed collection of about 700 accessions of landraces and local cultivars of common vetch ( Vicia sativa L.) that have been collected over a period of more than 50 years throughout the former USSR. Much of the material is available nowhere else. The collection of this economically important fodder crop is well adapted to the various growing regions of Russia and serves as a basis for the all domestic vetch breeding programs. Using AFLP as a DNA fingerprinting method we investigated 673 accessions from the VIR and compared their genetic variability with that of the worldwide vetch collection of the Institut für Pflanzengenetik und Kulturpflanzenforschung (IPK), 450 accessions. The analysis is a first assessment of the intra-specific diversity of V. sativa stored ex situ on a scale of more than 1,000 accessions. Six primer combinations, which gave clear polymorphic amplification products with 96 test samples, were chosen from 111 primer combinations tested. The selected AFLP primers used to analyse the V. sativa intra-specific diversity resulted in 70 unequivocally recognizable polymorphic fragments. We found that all of the AFLP fragments generated can be detected with varying frequency throughout the entire distribution area of V. sativa. The difference in frequency of some AFLP fragments between the regions may amount to 90%. The arrangement of most of the accessions in all dendrograms reflects their geographical origin, with a differentiation between Russia, Western Europe, Turkey and Bulgaria, and the Mediterranean. The "Russian" genepool stored at the IPK is a limited and biased sample of the available diversity when compared to the material stored at the VIR. Approximately 10-15% of the accessions in each geographical group showed AFLP patterns that clustered with members of other groups. This appreciable overlap raises several questions: (1) to which degree is an AFLP pattern representative of the

  10. Ecological Epigenetics: Beyond MS-AFLP.

    PubMed

    Schrey, Aaron W; Alvarez, Mariano; Foust, Christy M; Kilvitis, Holly J; Lee, Jacob D; Liebl, Andrea L; Martin, Lynn B; Richards, Christina L; Robertson, Marta

    2013-08-01

    Ecological Epigenetics studies the relationship between epigenetic variation and ecologically relevant phenotypic variation. As molecular epigenetic mechanisms often control gene expression, even across generations, they may impact many evolutionary processes. Multiple molecular epigenetic mechanisms exist, but methylation of DNA so far has dominated the Ecological Epigenetic literature. There are several molecular techniques used to screen methylation of DNA; here, we focus on the most common technique, methylation-sensitive-AFLP (MS-AFLP), which is used to identify genome-wide methylation patterns. We review studies that used MS-AFLP to address ecological questions, that describe which taxa have been investigated, and that identify general trends in the field. We then discuss, noting the general themes, four studies across taxa that demonstrate characteristics that increase the inferences that can be made from MS-AFLP data; we suggest that future MS-AFLP studies should incorporate these methods and techniques. We then review the short-comings of MS-AFLP and suggest alternative techniques that might address some of these limitations. Finally, we make specific suggestions for future research on MS-AFLP and identify questions that are most compelling and tractable in the short term.

  11. Metabolic Profiles and cDNA-AFLP Analysis of Salvia miltiorrhiza and Salvia castanea Diel f. tomentosa Stib

    PubMed Central

    Liang, Xiao; Liang, Zongsuo; Zhang, Meixiang; Shen, Shuang; Liu, Hongyun; Liu, Yan

    2012-01-01

    Plants of the genus Salvia produce various types of phenolic compounds and tanshinones which are effective for treatment of coronary heart disease. Salvia miltiorrhiza and S. castanea Diels f. tomentosa Stib are two important members of the genus. In this study, metabolic profiles and cDNA-AFLP analysis of four samples were employed to identify novel genes potentially involved in phenolic compounds and tanshinones biosynthesis, including the red roots from the two species and two tanshinone-free roots from S. miltiorrhiza. The results showed that the red roots of S. castanea Diels f. tomentosa Stib produced high contents of rosmarinic acid (21.77 mg/g) and tanshinone IIA (12.60 mg/g), but low content of salvianolic acid B (1.45 mg/g). The red roots of S. miltiorrhiza produced high content of salvianolic acid B (18.69 mg/g), while tanshinones accumulation in this sample was much less than that in S. castanea Diels f. tomentosa Stib. Tanshinones were not detected in the two tanshinone-free samples, which produced high contents of phenolic compounds. A cDNA-AFLP analysis with 128 primer pairs revealed that 2300 transcript derived fragments (TDFs) were differentially expressed among the four samples. About 323 TDFs were sequenced, of which 78 TDFs were annotated with known functions through BLASTX searching the Genbank database and 14 annotated TDFs were assigned into secondary metabolic pathways through searching the KEGGPATHWAY database. The quantitative real-time PCR analysis indicated that the expression of 9 TDFs was positively correlated with accumulation of phenolic compounds and tanshinones. These TDFs additionally showed coordinated transcriptional response with 6 previously-identified genes involved in biosynthesis of tanshinones and phenolic compounds in S. miltiorrhiza hairy roots treated with yeast extract. The sequence data in the present work not only provided us candidate genes involved in phenolic compounds and tanshinones biosynthesis but also gave us

  12. Empirical testing of 16S rRNA gene PCR primer pairs reveals variance in target specificity and efficacy not suggested by in silico analysis.

    PubMed

    Morales, Sergio E; Holben, William E

    2009-05-01

    Phylogenetic and "fingerprinting" analyses of the 16S rRNA genes of prokaryotes have been a mainstay of microbial ecology during the last two decades. However, many methods and results from studies that rely on the 16S rRNA gene for detection and quantification of specific microbial taxa have seemingly received only cursory or even no validation. To directly examine the efficacy and specificity of 16S rRNA gene-based primers for phylum-, class-, and operational taxonomic unit-specific target amplification in quantitative PCR, we created a collection of primers based solely on an extensive soil bacterial 16S rRNA gene clone library containing approximately 5,000 sequences from a single soil sample (i.e., a closed site-specific library was used to create PCR primers for use at this site). These primers were initially tested in silico prior to empirical testing by PCR amplification of known target sequences and of controls based on disparate phylogenetic groups. Although all primers were highly specific according to the in silico analysis, the empirical analyses clearly exhibited a high degree of nonspecificity for many of the phyla or classes, while other primers proved to be highly specific. These findings suggest that significant care must be taken when interpreting studies whose results were obtained with target specific primers that were not adequately validated, especially where population densities or dynamics have been inferred from the data. Further, we suggest that the reliability of quantification of specific target abundance using 16S rRNA-based quantitative PCR is case specific and must be determined through rigorous empirical testing rather than solely in silico.

  13. AFLP studies on downy-mildew-resistant and downy-mildew-susceptible genotypes of opium poppy.

    PubMed

    Dubey, Mukesh K; Shasany, Ajit K; Dhawan, Om P; Shukla, Ashutosh K; Khanuja, Suman P S

    2010-04-01

    Downy mildew (DM) caused by Peronospora arborescens, is a serious disease in opium poppy (Papaver somniferum), which has a world-wide spread. The establishment of DM-resistant cultivars appears to be a sustainable way to control the In this paper, we present the results of a study aimed at the identification of amplified fragment length polymorphism (AFLP) markers for DM-resistance in opium poppy. Three opium poppy genotypes (inbred over about 10 years): Pps-1 (DM-resistant), Jawahar-16 (DM-susceptible) and H-9 (DM-susceptible) were crossed in a diallel manner and the F(1) progeny along with the parents were subjected to AFLP analysis of chloroplast (cp) and nuclear DNA with seven and nine EcoRI / MseI primer combinations, respectively. cpDNA AFLP analysis identified 24 Pps-1 (DM-resistant)-specific unique fragments that were found to be maternally inherited in both the crosses, Pps-1 x Jawahar-16 and Pps-1 x H-9. In the case of nuclear DNA AFLP analysis, it was found that 17 fragments inherited from Pps-1 were common to the reciprocal crosses of both (i) Pps-1 and Jawahar-16 as well as (ii) Pps-1 and H-9. This is the first molecular investigation on the identification of polymorphism between DM-resistant and DM-susceptible opium poppy genotypes and development of DM-resistant opium poppy genotypespecific AFLP markers. These AFLP markers could be used in future genetic studies for analysis of linkage to the downy mildew resistance trait.

  14. AFLP-Based Analysis of Genetic Diversity, Population Structure, and Relationships with Agronomic Traits in Rice Germplasm from North Region of Iran and World Core Germplasm Set.

    PubMed

    Sorkheh, Karim; Masaeli, Mohammad; Chaleshtori, Maryam Hosseini; Adugna, Asfaw; Ercisli, Sezai

    2016-04-01

    Analysis of the genetic diversity and population structure of crops is very important for use in breeding programs and for genetic resources conservation. We analyzed the genetic diversity and population structure of 47 rice genotypes from diverse origins using amplified fragment length polymorphism (AFLP) markers and morphological characters. The 47 genotypes, which were composed of four populations: Iranian native varieties, Iranian improved varieties, International Rice Research Institute (IRRI) rice varieties, and world rice collections, were analyzed using ten primer combinations. A total of 221 scorable bands were produced with an average of 22.1 alleles per pair of primers, of which 120 (54.30%) were polymorphic. The polymorphism information content (PIC) values varied from 0.32 to 0.41 with an average of 0.35. The high percentage of polymorphic bands (%PB) was found to be 64.71 and the resolving power (R p) collections were 63.36. UPGMA clustering based on numerical data from AFLP patterns clustered all 47 genotypes into three large groups. The genetic similarity between individuals ranged from 0.54 to 0.94 with an average of 0.74. Population genetic tree showed that Iranian native cultivars formed far distant cluster from the other populations, which may indicate that these varieties had minimal genetic change over time. Analysis of molecular variance (AMOVA) revealed that the largest proportion of the variation (84%) to be within populations showing the inbreeding nature of rice. Therefore, Iranian native varieties (landraces) may have unique genes, which can be used for future breeding programs and there is a need to conserve this unique diversity. Furthermore, crossing of Iranian genotypes with the genetically distant genotypes in the other three populations may result in useful combinations, which can be used as varieties and/or lines for future rice breeding programs.

  15. Genetic relationships among wild Felidae in Thailand using AFLP markers.

    PubMed

    Srisamoot, Nattapong; Chaveerach, Arunrat; Nuchadomrong, Suporn; Sattayasai, Nison; Chaveerach, Prapansak; Tanomtong, Alongkoad; Pinthong, Krit

    2007-08-15

    The cytogenetics of eight Felidae species in Thailand were investigated by the colchicines-hypotonic fixation-air drying technique followed by a conventional technique. All species studied have an identical number of 38 diploid chromosomes, indicating a close genetic relationship among species. At a deep study level, the genetic relationships of eight Felidae species were accessed by the AFLP method. Blood samples were collected from sources locating in their original regions for DNA extraction. With ten successful primer combinations, a total of 4208 scorable bands were generated. Of these bands, 18.91% are polymorphic. Percentages of Polymorphic Bands (PPB) for each primer combination range from 15.00 to 23.59%. The generating bands were used for dendrogram construction. The average genetic similarity values among all Felidae species are 68.20% (between Panthera tigris and Neofelis nebulosa) to 85.53% (between Prionailurus bengalensis and Prionailurus viverrinus). The dendrogram shows that the eight Felidae species were clustered together and the subfamily Pantherinae and Felinae with Neofelis nebulosa are distinguished. The Felinae, Prionailurus bengalensis, Prionailurus viverrinus, Catopuma temminckii, Felis chaus, Pardofelis marmorata and Neofelis nebulosa were clustered together with 91% bootstrap support and the Pantherinae, Panthera pardus is clustered with Panthera tigris with 92% bootstrap support. In summary, the ten successful primer combinations can be used to determine genetic differences among eight Thailand Felidae species.

  16. AFLP fingerprinting of tartary buckwheat accessions (Fagopyrum tataricum) displaying rutin content variation.

    PubMed

    Gupta, Nidhi; Sharma, Sunil K; Rana, Jai C; Chauhan, Rajinder S

    2012-09-01

    In light of the economic importance of buckwheat as well as existence of enormous accessions of Fagopyrum species in the Himalayan regions of India, the characterization of tartary buckwheat for rutin content variation vis-à-vis DNA fingerprinting was undertaken so as to identify fingerprint profiles unique to high rutin content accessions. Rutin content analysis in mature seeds of 195 accessions of Fagopyrum tataricum showed a wide range of variation (6 μg/mg to 30 μg/mg D.W.) with most of the accessions (81%) containing 10-16 μg/mg of rutin followed by 14% accessions with significantly higher rutin content (17 μg/mg to 30 μg/mg) and 5% accessions with low rutin content (≤10 μg/mg). AFLP fingerprinting of 18 accessions having high (≥17 μg/mg) and low rutin content (≤10 μg/mg) with 19 EcoRI/MseI primer combinations yielded 136 polymorphic fragments out of total 907. The hierarchical and model-based cluster analyses of AFLP data strongly suggested that the 18 populations of F. tataricum were clustered into two separate groups. The high and low rutin content accessions were clustered into two separate groups based on AFLP fingerprinting. The AFLP fingerprints associated with high rutin content accessions of F. tataricum are expected to be useful for evaluation, conservation and genetic improvement of buckwheat.

  17. Phylogenetic relationships in the genus Leontopodium (Asteraceae: Gnaphalieae) based on AFLP data

    PubMed Central

    SAFER, STEFAN; TREMETSBERGER, KARIN; GUO, YAN-PING; KOHL, GUDRUN; SAMUEL, MARY R.; STUESSY, TOD F.; STUPPNER, HERMANN

    2012-01-01

    The genus Leontopodium comprises 30–41 species. The centre of diversity is the Sino-Himalayan region in south-western China, where about 15 species occur. The two species native to Europe, L. alpinum (known as the common ‘Edelweiss’) and L. nivale, are part of the cultural heritage of the people living there. Despite its importance, very little is known about the systematics of the genus. Because recent molecular studies have shown that species within this genus are closely related and difficult to distinguish with rDNA and cpDNA data, we used AFLPs to obtain a more detailed understanding of the phylogeny of the genus. Our main aims were as follows: (1) to clarify species relationships within the genus; and (2) to reveal information about the biogeography of the genus. We used AFLPs with six primer combinations to investigate 216 individuals in 38 populations of 16 different species. With AFLPs, we were able to recognize 10 different groups, all of which had strong bootstrap support. These results were also congruent with the morphology-based taxonomy of the genus. Most private and rare fragments were found in the Yunnan region (south-western China) relative to Europe and Mongolia/central China, suggesting a long-lasting in situ history of populations in the centre of diversity of the genus. Our results illustrate the utility of AFLPs to resolve phylogenetic relationships between these closely related species. PMID:23258943

  18. Differentiation of entC1 from entC2/entC3 with a single primer pair using simple and rapid SYBR Green-based RT-PCR melt curve analysis.

    PubMed

    Nagaraj, Sowmya; Ramlal, Shylaja; Venkataswamachari, Bhavani Peddayelachagiri; Paul, Soumya; Kingston, Joseph; Batra, Harsh Vardhan

    2016-10-01

    In spite of their involvement in foodborne illness, the epidemiological relevance of staphylococcal enterotoxin C (SEC) subtypes is poorly documented may be due to high sequence similarity. Among subtypes, SEC1, SEC2, and SEC3 exhibit more than 97 % homology because of which specific detection tools are seldom available to identify and differentiate them. In this study, a SYBR Green-based RT-PCR followed by melt curve analysis was developed for differentiation of entC1 from entC2/entC3 using a single primer pair. Nucleotide sequences of all three subtypes were analyzed using Clustal Omega program and the region with significant sequence variation/heterogeneity (where utmost SNPs were closely located and accessible for RT-PCR) was selected for amplification by designing a single primer pair that could amplify all three subtypes. In spite of same amplicon size, entC1 showed distinct melt peak at 76 °C. However, due to high similarity between entC2 and entC3, the developed format was deficient to discriminate between them and both showed melt peak at 82 °C. Reliability of developed RT-PCR was evaluated using various naturally contaminated samples and 91 food and clinical Staphylococcus aureus isolates where satisfactory results were obtained in comparison with commercial immunoassay kit and conventional PCRs using validated primers. To the best of our knowledge, this is the first method being reported to differentiate entC1 from entC2/entC3 using single primer pair which is unachievable by conventional PCR due to same amplicon size. As benefits, the method is sensitive, rapid, and inexpensive with no requirement of fluorescent probes, multiple primers, and post-PCR procedures. Thus, the assay might find its utility as a detection tool in epidemiological survey of foodborne outbreaks for simultaneous identification and differentiation of entC1 from entC2/entC3.

  19. Genomic distribution of AFLP markers relative to gene locations for different eukaryotic species

    PubMed Central

    2013-01-01

    Background Amplified fragment length polymorphism (AFLP) markers are frequently used for a wide range of studies, such as genome-wide mapping, population genetic diversity estimation, hybridization and introgression studies, phylogenetic analyses, and detection of signatures of selection. An important issue to be addressed for some of these fields is the distribution of the markers across the genome, particularly in relation to gene sequences. Results Using in-silico restriction fragment analysis of the genomes of nine eukaryotic species we characterise the distribution of AFLP fragments across the genome and, particularly, in relation to gene locations. First, we identify the physical position of markers across the chromosomes of all species. An observed accumulation of fragments around (peri) centromeric regions in some species is produced by repeated sequences, and this accumulation disappears when AFLP bands rather than fragments are considered. Second, we calculate the percentage of AFLP markers positioned within gene sequences. For the typical EcoRI/MseI enzyme pair, this ranges between 28 and 87% and is usually larger than that expected by chance because of the higher GC content of gene sequences relative to intergenic ones. In agreement with this, the use of enzyme pairs with GC-rich restriction sites substantially increases the above percentages. For example, using the enzyme system SacI/HpaII, 86% of AFLP markers are located within gene sequences in A. thaliana, and 100% of markers in Plasmodium falciparun. We further find that for a typical trait controlled by 50 genes of average size, if 1000 AFLPs are used in a study, the number of those within 1 kb distance from any of the genes would be only about 1–2, and only about 50% of the genes would have markers within that distance. Conclusions The high coverage of AFLP markers across the genomes and the high proportion of markers within or close to gene sequences make them suitable for genome scans and

  20. Development of a SCAR marker for male gametophyte of Gracilariopsis lemaneiformis based on AFLP technique

    NASA Astrophysics Data System (ADS)

    Zhou, Wei; Ding, Hongye; Sui, Zhenghong; Wang, Zhongxia; Wang, Jinguo

    2014-05-01

    The red alga Gracilariopsis lemaneiformis (Bory) is an economically valuable macroalgae. As a means to identify the sex of immature Gracilariopsis lemaneiformis, the amplified fragment length polymorphism (AFLP) technique was used to search for possible sex- or phase-related markers in male gametophytes, female gametophytes, and tetrasporophytes, respectively. Seven AFLP selective amplification primers were used in this study. The primer combination E-TG/M-CCA detected a specific band linked to male gametophytes. The DNA fragment was recovered and a 402-bp fragment was sequenced. However, no DNA sequence match was found in public databases. Sequence characterized amplified region (SCAR) primers were designed from the sequence to test the repeatability of the relationship to the sex, using 69 male gametophytes, 139 female gametophytes, and 47 tetrasporophytes. The test results demonstrate a good linkage and repeatability of the SCAR marker to sex. The SCAR primers developed in this study could reduce the time required for sex identification of Gracilariopsis lemaneiformis by four to six months. This can reduce both the time investment and number of specimens required in breeding experiments.

  1. Genetic Comparison of B. Anthracis and its Close Relatives Using AFLP and PCR Analysis

    SciTech Connect

    Jackson, P.J.; Hill, K.K.; Laker, M.T.; Ticknor, L.O.; Keim, P.S.

    1999-02-01

    rapidly generated by other means. AFLP sample analysis quickly generates a very large amount of molecular information about microbial genomes. However, this information cannot be analyzed rapidly using manual methods. The authors are developing a large archive of electronic AFLP signatures that is being used to identify isolates collected from medical, veterinary, forensic and environmental samples. They are also developing the computational packages necessary to rapidly and unambiguously analyze the AFLP profiles and conduct a phylogenetic comparison of these data relative to information already in the database. They will use this archive and the associated algorithms to determine the species identity of previously uncharacterized isolates and place them phylogenetically relative to other microbes based on their AFLP signatures. This study provides significant new information about microbes with environmental, veterinary and medical significance. This information can be used in further studies to understand the relationships among these species and the factors that distinguish them from one another. It should also allow identification of unique factors that contribute to important microbial traits including pathogenicity and virulence. They are also using AFLP data to identify, isolate and sequence DNA fragments that are unique to particular microbial species and strains. The fragment patterns and sequence information provide insights into the complexity and organization of bacterial genomes relative to one another. They also provide the information necessary for development of species-specific PCR primers that can be used to interrogate complex samples for the presence of B. anthracis, other microbial pathogens or their remnants.

  2. Challenges and pitfalls in the characterization of anonymous outlier AFLP markers in non-model species: lessons from an ocellated lizard genome scan.

    PubMed

    Nunes, V L; Beaumont, M A; Butlin, R K; Paulo, O S

    2012-12-01

    In the last few years, dozens of studies have documented the detection of loci influenced by selection from genome scans in a wide range of non-model species. Many of those studies used amplified fragment length polymorphism (AFLP) markers, which became popular for being easily applicable to any organism. However, because they are anonymous markers, AFLPs impose many challenges for their isolation and identification. Most recent AFLP genome scans used capillary electrophoresis (CE), which adds even more obstacles to the isolation of bands with a specific size for sequencing. These caveats might explain the extremely low number of studies that moved from the detection of outlier AFLP markers to their actual isolation and characterization. We document our efforts to characterize a set of outlier AFLP markers from a previous genome scan with CE in ocellated lizards (Lacerta lepida). Seven outliers were successfully isolated, cloned and sequenced. Their sequences are noncoding and show internal indels or polymorphic repetitive elements (microsatellites). Three outliers were converted into codominant markers by using specific internal primers to sequence and screen population variability from undigested DNA. Amplification in closely related lizard species was also achieved, revealing remarkable interspecific conservation in outlier loci sequences. We stress the importance of following up AFLP genome scans to validate selection signatures of outlier loci, but also report the main challenges and pitfalls that may be faced during the process.

  3. Challenges and pitfalls in the characterization of anonymous outlier AFLP markers in non-model species: lessons from an ocellated lizard genome scan

    PubMed Central

    Nunes, V L; Beaumont, M A; Butlin, R K; Paulo, O S

    2012-01-01

    In the last few years, dozens of studies have documented the detection of loci influenced by selection from genome scans in a wide range of non-model species. Many of those studies used amplified fragment length polymorphism (AFLP) markers, which became popular for being easily applicable to any organism. However, because they are anonymous markers, AFLPs impose many challenges for their isolation and identification. Most recent AFLP genome scans used capillary electrophoresis (CE), which adds even more obstacles to the isolation of bands with a specific size for sequencing. These caveats might explain the extremely low number of studies that moved from the detection of outlier AFLP markers to their actual isolation and characterization. We document our efforts to characterize a set of outlier AFLP markers from a previous genome scan with CE in ocellated lizards (Lacerta lepida). Seven outliers were successfully isolated, cloned and sequenced. Their sequences are noncoding and show internal indels or polymorphic repetitive elements (microsatellites). Three outliers were converted into codominant markers by using specific internal primers to sequence and screen population variability from undigested DNA. Amplification in closely related lizard species was also achieved, revealing remarkable interspecific conservation in outlier loci sequences. We stress the importance of following up AFLP genome scans to validate selection signatures of outlier loci, but also report the main challenges and pitfalls that may be faced during the process. PMID:22892639

  4. Comparison of RAPD, ISSR, and AFLP Molecular Markers to Reveal and Classify Orchardgrass (Dactylis glomerata L.) Germplasm Variations

    PubMed Central

    Costa, Rita; Pereira, Graça; Garrido, Inmaculada; Tavares-de-Sousa, Manuel María; Espinosa, Francisco

    2016-01-01

    Three different DNA-based techniques, Random Amplified Polymorphic DNA (RAPD), Inter Simple Sequence Repeat (ISSR) and Amplified Fragment Length Polymorphism (AFLP) markers, were used for fingerprinting Dactylis glomerata genotypes and for detecting genetic variation between the three different subspecies. In this study, RAPD assays produced 97 bands, of which 40 were polymorphic (41.2%). The ISSR primers amplified 91 bands, and 54 showed polymorphism (59.3%). Finally, the AFLP showed 100 bands, of which 92 were polymorphic (92%). The fragments were scored as present (1) or absent (0), and those readings were entered in a computer file as a binary matrix (one for each marker). Three cluster analyses were performed to express–in the form of dendrograms–the relationships among the genotypes and the genetic variability detected. All DNA-based techniques used were able to amplify all of the genotypes. There were highly significant correlation coefficients between cophenetic matrices based on the genetic distance for the RAPD, ISSR, AFLP, and combined RAPD-ISSR-AFLP data (0.68, 0.78, 0.70, and 0.70, respectively). Two hypotheses were formulated to explain these results; both of them are in agreement with the results obtained using these three types of molecular markers. We conclude that when we study genotypes close related, the analysis of variability could require more than one DNA-based technique; in fact, the genetic variation present in different sources could interfere or combine with the more or less polymorphic ability, as our results showed for RAPD, ISSR and AFLP markers. Our results indicate that AFLP seemed to be the best-suited molecular assay for fingerprinting and assessing genetic relationship among genotypes of Dactylis glomerata. PMID:27070939

  5. Comparison of RAPD, ISSR, and AFLP Molecular Markers to Reveal and Classify Orchardgrass (Dactylis glomerata L.) Germplasm Variations.

    PubMed

    Costa, Rita; Pereira, Graça; Garrido, Inmaculada; Tavares-de-Sousa, Manuel María; Espinosa, Francisco

    2016-01-01

    Three different DNA-based techniques, Random Amplified Polymorphic DNA (RAPD), Inter Simple Sequence Repeat (ISSR) and Amplified Fragment Length Polymorphism (AFLP) markers, were used for fingerprinting Dactylis glomerata genotypes and for detecting genetic variation between the three different subspecies. In this study, RAPD assays produced 97 bands, of which 40 were polymorphic (41.2%). The ISSR primers amplified 91 bands, and 54 showed polymorphism (59.3%). Finally, the AFLP showed 100 bands, of which 92 were polymorphic (92%). The fragments were scored as present (1) or absent (0), and those readings were entered in a computer file as a binary matrix (one for each marker). Three cluster analyses were performed to express--in the form of dendrograms--the relationships among the genotypes and the genetic variability detected. All DNA-based techniques used were able to amplify all of the genotypes. There were highly significant correlation coefficients between cophenetic matrices based on the genetic distance for the RAPD, ISSR, AFLP, and combined RAPD-ISSR-AFLP data (0.68, 0.78, 0.70, and 0.70, respectively). Two hypotheses were formulated to explain these results; both of them are in agreement with the results obtained using these three types of molecular markers. We conclude that when we study genotypes close related, the analysis of variability could require more than one DNA-based technique; in fact, the genetic variation present in different sources could interfere or combine with the more or less polymorphic ability, as our results showed for RAPD, ISSR and AFLP markers. Our results indicate that AFLP seemed to be the best-suited molecular assay for fingerprinting and assessing genetic relationship among genotypes of Dactylis glomerata.

  6. Isolation of female-specific AFLP markers and molecular identification of genetic sex in half-smooth tongue sole (Cynoglossus semilaevis).

    PubMed

    Chen, Song-Lin; Li, Jing; Deng, Si-Ping; Tian, Yong-Sheng; Wang, Qing-Yin; Zhuang, Zhi-Meng; Sha, Zhen-Xia; Xu, Jian-Yong

    2007-01-01

    The sex-specific molecular marker is a useful gene resource for studying sex- determining mechanisms and controlling fish sex. Artificially produced male and female half-smooth tongue sole (Cynoglossus semilaevis) were used to screen sex-specific amplified fragment length polymorphism (AFLPs) molecular markers. The phenotypic sex of 28 tongue soles was determined by histological sectioning of gonads. The AFLP analysis of 15 females and 13 males via 64 primer combinations produced a total of 4681 scorable bands, of which 42.11% and 43.39% of bands were polymorphic in females and males, respectively. Seven female-specific AFLP markers were identified and designated as CseF382, CseF575, CseF783, CseF464, CseF136, CseF618, and CseF305, respectively. One female-specific AFLP marker (CseF382) was amplified, recovered from the gels, cloned, and sequenced (accession no. DQ487760). This female-specific AFLP marker was converted into a single-locus polymerase-chain reaction (PCR) marker of a sequence-characterized amplified region (SCAR). A simple PCR method of using the specific primers was developed for identifying genetic sex of half-smooth tongue sole. PCR products demonstrated that the initial 15 females produced the female-specific band of about 350 bp, but the initial 13 male individuals failed to produce the band. We also investigated the applicability of the PCR primers in other tongue sole individuals. The same female-specific fragment of about 350 bp was found in the additional 59 female individuals, but not in the additional 58 male individuals. This AFLP-based molecular sexing technique may have great application potential in elucidation of sex determination mechanisms and sex control in half-smooth tongue sole.

  7. Identification of Lactobacillus brevis using a species-specific AFLP-derived marker.

    PubMed

    Fusco, Vincenzina; Quero, Grazia Marina; Chieffi, Daniele; Franz, Charles M A P

    2016-09-02

    A simple and specific method for the rapid detection and identification of Lactobacillus brevis was developed. A fAFLP (Fluorescent Amplified Fragment Length Polymorphisms) marker for L. brevis was used to design oligonucleotide primers for a species-specific PCR assay, targeting a 125bp fragment of the gene encoding the aldo/keto reductase of the diketogulonate-reductase family of L. brevis. This assay resulted in 100% inclusivity and exclusivity of assignment of strains to the species L. brevis. The analytical specificity of this assay was successfully tested to identify L. brevis isolates from sourdoughs.

  8. Linkage mapping in apomictic and sexual Kentucky bluegrass ( Poa pratensis L.) genotypes using a two way pseudo-testcross strategy based on AFLP and SAMPL markers.

    PubMed

    Porceddu, A.; Albertini, E.; Barcaccia, G.; Falistocco, E.; Falcinelli, M.

    2002-02-01

    The high versatility of the mode of reproduction and the retention of a pollen recognition system are the factors responsible for the extreme complexity of the genome in Poa pratensis L. Two genetic maps, one of an apomictic and one of a sexual genotype, were constructed using a two-way pseudo-testcross strategy and multiplex PCR-based molecular markers (AFLP and SAMPL). Due to the high ploidy level and the uncertainty of chromosome pairing-behavior at meiosis, only parent-specific single-dose markers (SDMs) that segregated 1:1 in an F(1) mapping population (161 out of 299 SAMPLs, and 70 out of 275 AFLPs) were used for linkage analysis. A total of 41 paternal (33 SAMPLs and 8 AFLPs) and 47 maternal (33 SAMPLs and 14 AFLPs) SDMs, tested to be linked in coupling phase, were mapped to 7+7 linkage groups covering 367 and 338.4 cM, respectively. The comparison between the two marker systems revealed that SAMPL markers were statistically more efficient than AFLP ones in detecting parent-specific SDMs (75% vs 32.4%). There were no significant differences in the percentages of distorted marker alleles detected by the two marker systems (27.8% of SAMPLs vs 21.3% of AFLPs). The pairwise comparison of co-segregational groups for linkage detection between marker loci suggested that at least some of the P. pratensis chromosomes pair preferentially at meiosis-I.

  9. Phonics Primer

    ERIC Educational Resources Information Center

    Elam, Sandra

    2007-01-01

    This primer lists the 44 sounds in the English language and then gives steps for teaching those 44 sounds and their most common spelling patterns. In addition to learning sounds and spellings, each day the student must read lists of phonetically related words and spell these words from dictation. Phonics instruction must be reinforced by having…

  10. Novel PCR-based identification of Weissella confusa using an AFLP-derived marker.

    PubMed

    Fusco, Vincenzina; Quero, Grazia M; Stea, Gaetano; Morea, Maria; Visconti, Angelo

    2011-02-28

    An extensive use of Weissella (W.) confusa is currently being made for the production of a variety of fermented foods and beverages although some strains of this species have emerged as opportunistic pathogens for humans and animals. Nevertheless, no rapid methods are available for the reliable identification of W. confusa. We developed a novel PCR using AFLP (Amplified Fragment Length Polymorphism)-derived primers for the rapid and unequivocal identification of W. confusa. Fluorescent AFLP of 30 strains of W. confusa, Leuconostoc citreum, Lactobacillus (Lb.) brevis, Lb. rossiae, Lb. plantarum and Lb. buchneri allowed us to detect, purify and sequence several W. confusa specific AFLP fragments. The homology search in BLAST of a 303 bp nucleotide sequence revealed a ≤ 77% identity of the purified fragment with the lepA gene of several lactic acid bacteria. A PCR assay targeting 225 bp of this fragment was developed and tested against the DNA of 109 strains, including 34 foodborne and clinical W. confusa and 75 strains of 47 phylogenetically closely and distantly related species, resulting in 100% specificity with a detection limit of 16 pg. Being the first species-specific PCR to date developed for the rapid and unambiguous identification of W. confusa, this novel assay could be a reliable and efficient tool for detecting W. confusa not only in food and beverages, but also in clinical specimens, thus contributing to clarify its real significance in human and animal infections.

  11. Genetic diversity among oat varieties of worldwide origin and associations of AFLP markers with quantitative traits.

    PubMed

    Achleitner, Andreas; Tinker, Nicholas A; Zechner, Elisabeth; Buerstmayr, Hermann

    2008-11-01

    One hundred and fourteen oat (Avena sativa L.) varieties of worldwide origin were evaluated for genetic diversity based on 77 molecular polymorphisms produced by eight selective AFLP primer combinations. Genetic similarity, calculated using the DICE coefficient, was used for cluster analysis and principal component analysis was applied. In addition population structure was explored to identify discrete subpopulations based on allele frequency. Although clustering and population structure showed relationships with region and country of origin, there was no obvious relationship to hull presence or hull colour. Oat varieties originating from European breeding programs showed less diversity than varieties originating from North and South America. Associations between AFLP markers and agronomic traits (grain yield, groat yield, panicle emergence, plant height, and lodging) as well as kernel quality traits (kernel weight, test weight, screening percent and groat percent) were also investigated. Marker-trait associations were tested using a naïve simple regression model and five additional models that account for population structure. Significant associations were found for 23 AFLP markers, with many of these affecting multiple traits. This study demonstrates that diversity can be significantly enhanced using a global collection, and provides evidence for marker-trait associations that can be validated in segregating populations and exploited through marker-assisted selection.

  12. Neuraminidase subtyping of avian influenza viruses with PrimerHunter-designed primers and quadruplicate primer pools.

    PubMed

    Huang, Yanyan; Khan, Mazhar I; Khan, Mazhar; Măndoiu, Ion; Măndoiu, Ion I

    2013-01-01

    We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers.

  13. Salinas primer.

    SciTech Connect

    Walsh, Timothy Francis; Reese, Garth M.; Bhardwaj, Manoj Kumar

    2004-08-01

    Salinas provides a massively parallel implementation of structural dynamics finite element analysis. This capability is required for high fidelity, validated models used in modal, vibration, static and shock analysis of weapons systems. General capabilities for modal, statics and transient dynamics are provided. Salinas is similar to commercial codes like Nastran or Abaqus. It has some nonlinear capability, but excels in linear computation. It is different than the above commercial codes in that it is designed to operate efficiently in a massively parallel environment. Even for an experienced analyst, running a new finite element package can be a challenge. This little primer is intended to make part of this task easier by presenting the basic steps in a simple way. The analyst is referred to the theory manual for details of the mathematics behind the work. The User's Notes should be used for more complex inputs, and will have more details about the process (as well as many more examples). More information can be found on our web pages, 3 or 4. Finite element analysis can be deceptive. Any software can give the wrong answers if used improperly, and occasionally even when used properly. Certainly a solid background in structural mechanics is necessary to build an adequate finite element model and interpret the results. This primer should provide a quick start in answering some of the more common questions that come up in using Salinas.

  14. [Development of female-specific AFLP marker CseF783 and its application in genetic sex identification in half-smooth tongue sole (Cynoglossus semilaevis)].

    PubMed

    Ma, Hong-Yu; Chen, Song-Lin; Li, Jing; Tian, Yong-Sheng; Ji, Xiang-Shan; Zhang, Li-Jing

    2009-01-01

    Molecular sex identification is important in studying sex control, sex determination, and all-female breeding in half-smooth tongue sole (Cynoglossus semilaevis). In the present study, a female-specific AFLP marker was isolated from Cynoglossus semilaevis by AFLP technique using the selective primer combination E-ACT/M-CAA. This marker was re-amplified, recovered from the agarose gels, cloned and sequenced. Bioinformatic analysis indicated that the length of the product was 791 bp, and the sequence showed no similarity to any known sequences deposited in the GenBank database using BLASTn. According to the DNA sequence of the female-specific AFLP marker, specific PCR primers were designed and PCR amplification was performed on 100 sex-known individuals of C. semilaevis (50 females and 50 males each). A specific band 324 bp in length was present in all females but absent in all males (except for one male), indicating that the female-specific AFLP marker was successfully converted into female-specific SCAR (sequence characterized amplified regions) marker. The sex analysis of 3-day-old C. semilaevis individuals using this female-specific SCAR marker indicated that the female ratio was 41.7%. The female-specific SCAR marker developed in this study allowed simple, reliable, and rapid molecular sex identification using small amounts of fin tissue without sacrifice of C. semilaevis especially at early stage of development.

  15. Design and validation of a RT-qPCR procedure for diagnosis and quantification of most types of infectious pancreatic necrosis virus using a single pair of degenerated primers.

    PubMed

    Vázquez, D; Cutrín, J M; Olveira, J G; Dopazo, C P

    2016-12-27

    Infectious pancreatic necrosis virus (IPNV) is an important virus which affects the salmonid aquaculture industry worldwide; therefore, it is important to develop rapid and reliable methods of diagnosis to detect the disease at early stages. Nowadays, RT-qPCR is replacing other methods because it provides additional information on the viral load, which is important to have a better understanding of the virus replication level and of the stage of the infection and its risk level. The main problem stems from the high diversity of this virus, which can compromise the reliability of the diagnosis. In this study, we have designed an RT-qPCR procedure for diagnosis and quantification of IPNV based on a single pair of primers targeted to segment B. The procedure has been validated, in vitro and in vivo, testing two different types of standards against seven reference strains and 23 field isolates from different types. The procedure is reliable for the detection of any type, with a detection limit of 31 TCID50  mL(-1) , 50 pfu mL(-1) or 66 RNA copies mL(-1) , depending on the standard. All the standard curves showed high reliability (R(2)  > 0.95). The results support the high reliability of this new procedure for the diagnosis and quantification of IPNV.

  16. Genetic analysis of the sugarcane (Saccharum spp.) cultivar 'LCP 85-384'. I. Linkage mapping using AFLP, SSR, and TRAP markers.

    PubMed

    Andru, Suman; Pan, Yong-Bao; Thongthawee, Songkran; Burner, David M; Kimbeng, Collins A

    2011-06-01

    Sugarcane hybrids are complex aneu-polyploids (2n = 100-130) derived from inter-specific hybridization between ancestral polyploid species, namely S. officinarum L. and S. spontaneum L. Efforts to understand the sugarcane genome have recently been enhanced through the use of new molecular marker technologies. A framework genetic linkage map of Louisiana's popular cultivar LCP 85-384 was constructed using the selfed progeny and based on polymorphism derived from 64 AFLP, 19 SSR and 12 TRAP primer pairs. Of 1,111 polymorphic markers detected, 773 simplex (segregated in 3:1 ratio) and 182 duplex (segregate in 77:4 ratio) markers were used to construct the map using a LOD value of ≥ 4.0 and recombination threshold of 0.44. The genetic distances between pairs of markers linked in the coupling phase was computed using the Kosambi mapping function. Of the 955 markers, 718 simplex and 66 duplex markers were assigned to 108 co-segregation groups (CGs) with a cumulative map length of 5,617 cM and a density of 7.16 cM per marker. Fifty-five simplex and 116 duplex markers remained unlinked. With an estimated genome size of 12,313 cM for LCP 85-384, the map covered approximately 45.6% of the genome. Forty-four of the 108 CGs were assigned into 9 homo(eo)logous groups (HGs) based on information from locus-specific SSR and duplex markers, and repulsion phase linkages detected between CGs. Meiotic behavior of chromosomes in cytogenetic studies and repulsion phase linkage analysis between CGs in this study inferred the existence of strong preferential chromosome pairing behavior in LCP 85-384. This framework map marks an important beginning for future mapping of QTLs associated with important agronomic traits in the Louisiana sugarcane breeding programs.

  17. Automated Masking of AFLP Markers Improves Reliability of Phylogenetic Analyses

    PubMed Central

    Gimnich, France

    2012-01-01

    The amplified fragment length polymorphisms (AFLP) method has become an attractive tool in phylogenetics due to the ease with which large numbers of characters can be generated. In contrast to sequence-based phylogenetic approaches, AFLP data consist of anonymous multilocus markers. However, potential artificial amplifications or amplification failures of fragments contained in the AFLP data set will reduce AFLP reliability especially in phylogenetic inferences. In the present study, we introduce a new automated scoring approach, called “AMARE” (AFLP MAtrix REduction). The approach is based on replicates and makes marker selection dependent on marker reproducibility to control for scoring errors. To demonstrate the effectiveness of our approach we record error rate estimations, resolution scores, PCoA and stemminess calculations. As in general the true tree (i.e. the species phylogeny) is not known, we tested AMARE with empirical, already published AFLP data sets, and compared tree topologies of different AMARE generated character matrices to existing phylogenetic trees and/or other independent sources such as morphological and geographical data. It turns out that the selection of masked character matrices with highest resolution scores gave similar or even better phylogenetic results than the original AFLP data sets. PMID:23152859

  18. AFLP analysis of genetic diversity and phylogenetic relationships of Brassica oleracea in Ireland.

    PubMed

    El-Esawi, Mohamed A; Germaine, Kieran; Bourke, Paula; Malone, Renee

    2016-01-01

    Brassica oleracea L. is one of the most economically important vegetable crop species of the genus Brassica L. This species is threatened in Ireland, without any prior reported genetic studies. The use of this species is being very limited due to its imprecise phylogeny and uncompleted genetic characterisation. The main objective of this study was to assess the genetic diversity and phylogenetic relationships of a set of 25 Irish B. oleracea accessions using the powerful amplified fragment length polymorphism (AFLP) technique. A total of 471 fragments were scored across all the 11 AFLP primer sets used, out of which 423 (89.8%) were polymorphic and could differentiate the accessions analysed. The dendrogram showed that cauliflowers were more closely related to cabbages than kales were, and accessions of some cabbage types were distributed among different clusters within cabbage subgroups. Approximately 33.7% of the total genetic variation was found among accessions, and 66.3% of the variation resided within accessions. The total genetic diversity (HT) and the intra-accessional genetic diversity (HS) were 0.251 and 0.156, respectively. This high level of variation demonstrates that the Irish B. oleracea accessions studied should be managed and conserved for future utilisation and exploitation in food and agriculture. In conclusion, this study addressed important phylogenetic questions within this species, and provided a new insight into the inclusion of four accessions of cabbages and kales in future breeding programs for improving varieties. AFLP markers were efficient for assessing genetic diversity and phylogenetic relationships in Irish B. oleracea species.

  19. AFLP and MS-AFLP analysis of the variation within saffron crocus (Crocus sativus L.) germplasm.

    PubMed

    Busconi, Matteo; Colli, Licia; Sánchez, Rosa Ana; Santaella, Marcela; De-Los-Mozos Pascual, Marcelino; Santana, Omar; Roldán, Marta; Fernández, José-Antonio

    2015-01-01

    The presence and extent of genetic variation in saffron crocus are still debated, as testified by several contradictory articles providing contrasting results about the monomorphism or less of the species. Remarkably, phenotypic variations have been frequently observed in the field, such variations are usually unstable and can change from one growing season to another. Considering that gene expression can be influenced both by genetic and epigenetic changes, epigenetics could be a plausible cause of the alternative phenotypes. In order to obtain new insights into this issue, we carried out a molecular marker analysis of 112 accessions from the World Saffron and Crocus Collection. The accessions were grown for at least three years in the same open field conditions. The same samples were analysed using Amplified Fragment Length Polymorphism (AFLP) and Methyl Sensitive AFLP in order to search for variation at the genetic (DNA sequence) and epigenetic (cytosine methylation) level. While the genetic variability was low (4.23% polymorphic peaks and twelve (12) effective different genotypes), the methyl sensitive analysis showed the presence of high epigenetic variability (33.57% polymorphic peaks and twenty eight (28) different effective epigenotypes). The pattern obtained by Factorial Correspondence Analysis of AFLP and, in particular, of MS-AFLP data was consistent with the geographical provenance of the accessions. Very interestingly, by focusing on Spanish accessions, it was observed that the distribution of the accessions in the Factorial Correspondence Analysis is not random but tends to reflect the geographical origin. Two clearly defined clusters grouping accessions from the West (Toledo and Ciudad Real) and accessions from the East (Cuenca and Teruel) were clearly recognised.

  20. AFLP and MS-AFLP Analysis of the Variation within Saffron Crocus (Crocus sativus L.) Germplasm

    PubMed Central

    Busconi, Matteo; Colli, Licia; Sánchez, Rosa Ana; Santaella, Marcela; De-Los-Mozos Pascual, Marcelino; Santana, Omar; Roldán, Marta; Fernández, José-Antonio

    2015-01-01

    The presence and extent of genetic variation in saffron crocus are still debated, as testified by several contradictory articles providing contrasting results about the monomorphism or less of the species. Remarkably, phenotypic variations have been frequently observed in the field, such variations are usually unstable and can change from one growing season to another. Considering that gene expression can be influenced both by genetic and epigenetic changes, epigenetics could be a plausible cause of the alternative phenotypes. In order to obtain new insights into this issue, we carried out a molecular marker analysis of 112 accessions from the World Saffron and Crocus Collection. The accessions were grown for at least three years in the same open field conditions. The same samples were analysed using Amplified Fragment Length Polymorphism (AFLP) and Methyl Sensitive AFLP in order to search for variation at the genetic (DNA sequence) and epigenetic (cytosine methylation) level. While the genetic variability was low (4.23% polymorphic peaks and twelve (12) effective different genotypes), the methyl sensitive analysis showed the presence of high epigenetic variability (33.57% polymorphic peaks and twenty eight (28) different effective epigenotypes). The pattern obtained by Factorial Correspondence Analysis of AFLP and, in particular, of MS-AFLP data was consistent with the geographical provenance of the accessions. Very interestingly, by focusing on Spanish accessions, it was observed that the distribution of the accessions in the Factorial Correspondence Analysis is not random but tends to reflect the geographical origin. Two clearly defined clusters grouping accessions from the West (Toledo and Ciudad Real) and accessions from the East (Cuenca and Teruel) were clearly recognised. PMID:25885113

  1. Differentiation of species of the family Acetobacteraceae by AFLP DNA fingerprinting: Gluconacetobacter kombuchae is a later heterotypic synonym of Gluconacetobacter hansenii.

    PubMed

    Cleenwerck, Ilse; De Wachter, Marjan; González, Angel; De Vuyst, Luc; De Vos, Paul

    2009-07-01

    Amplified fragment length polymorphism (AFLP) DNA fingerprinting was investigated as a tool for fast and accurate identification of acetic acid bacteria (AAB) to the species level. One hundred and thirty five reference strains and 15 additional strains, representing 50 recognized species of the family Acetobacteraceae, were subjected to AFLP analysis using the restriction enzyme combination ApaI/TaqI and the primer combination A03/T03. The reference strains had been previously subjected to either DNA-DNA hybridization or 16S-23S rRNA spacer region gene sequence analysis and were regarded as being accurately classified at the species level. The present study revealed that six of these strains should be reclassified, namely Gluconacetobacter europaeus LMG 1518 and Gluconacetobacter xylinus LMG 1510 as Gluconacetobacter xylinus and Gluconacetobacter europaeus, respectively; Gluconacetobacter kombuchae LMG 23726(T) as Gluconacetobacter hansenii; and Acetobacter orleanensis strains LMG 1545, LMG 1592 and LMG 1608 as Acetobacter cerevisiae. Cluster analysis of the AFLP DNA fingerprints of the reference strains revealed one cluster for each species, showing a linkage level below 50 % with other clusters, except for Acetobacter pasteurianus, Acetobacter indonesiensis and Acetobacter cerevisiae. These three species were separated into two, two, and three clusters, respectively. At present, confusion exists regarding the taxonomic status of Gluconacetobacter oboediens and Gluconacetobacter intermedius; the AFLP data from this study supported their classification as separate taxa. The 15 additional strains could all be identified at the species level. AFLP analysis further revealed that some species harboured genetically diverse strains, whereas other species consisted of strains showing similar banding patterns, indicating a more limited genetic diversity. It can be concluded that AFLP DNA fingerprinting is suitable for accurate identification and classification of a broad

  2. Primer design for large scale sequencing.

    PubMed

    Haas, S; Vingron, M; Poustka, A; Wiemann, S

    1998-06-15

    We have developed PRIDE, a primer design program that automatically designs primers in single contigs or whole sequencing projects to extend the already known sequence and to double strand single-stranded regions. The program is fully integrated into the Staden package (GAP4) and accessible with a graphical user interface. PRIDE uses a fuzzy logic-based system to calculate primer qualities. The computational performance of PRIDE is enhanced by using suffix trees to store the huge amount of data being produced. A test set of 110 sequencing primers and 11 PCR primer pairs has been designed on genomic templates, cDNAs and sequences containing repetitive elements to analyze PRIDE's success rate. The high performance of PRIDE, combined with its minimal requirement of user interaction and its fast algorithm, make this program useful for the large scale design of primers, especially in large sequencing projects.

  3. Primer design for large scale sequencing.

    PubMed Central

    Haas, S; Vingron, M; Poustka, A; Wiemann, S

    1998-01-01

    We have developed PRIDE, a primer design program that automatically designs primers in single contigs or whole sequencing projects to extend the already known sequence and to double strand single-stranded regions. The program is fully integrated into the Staden package (GAP4) and accessible with a graphical user interface. PRIDE uses a fuzzy logic-based system to calculate primer qualities. The computational performance of PRIDE is enhanced by using suffix trees to store the huge amount of data being produced. A test set of 110 sequencing primers and 11 PCR primer pairs has been designed on genomic templates, cDNAs and sequences containing repetitive elements to analyze PRIDE's success rate. The high performance of PRIDE, combined with its minimal requirement of user interaction and its fast algorithm, make this program useful for the large scale design of primers, especially in large sequencing projects. PMID:9611248

  4. Genetic relationships among Aster species by multivariate analysis and AFLP markers.

    PubMed

    Cammareri, M; Errico, A; Sebastiano, A; Conicella, C

    2004-01-01

    Fourteen species of Aster were characterized for morphological traits of commercial interest, chromosome number and genetic diversity by AFLP markers to exploit this material not only for breeding purposes but also as source of pharmaceuticals. The variation observed among the Aster species for five morphological traits was summarized by means of discriminant analysis. Three significant canonical variables, accounting for about 96% of total variance, were mainly correlated with capitulum diameter, number of ligulae and leaf length. The morphological variation appeared related to ploidy level of the species. A diploid chromosome number ranging from 10 to 18 was evident in seven species whereas the other species are polyploids with variable chromosome numbers up to 52. The pollen production and stainability were quite variable among Aster species. Furthermore, seven species produced big pollen grains besides normally-sized ones, at a frequency ranging from 1 to 12%, possibly due to 2n pollen production. The possibility that evolution of Aster genus could be driven by 2n gametes and sexual polyploidization is discussed. Implications of 2n gametes for Aster breeding are also mentioned. AFLP analysis of the fourteen Aster species based on six primer combinations revealed a total number of 421 polymorphic amplified DNA fragments. The genetic similarities estimated between the Aster species, based on both shared and unique amplification products ranged from 0.335 to 0.604 across all species and revealed a geographically based clustering within the genus. The highest similarity was detected between A. alpinus and A. amellus with Eurasian origin.

  5. AFLP analysis of genetic relationships in the genus Fosterella L.B. Smith (Pitcairnioideae, Bromeliaceae).

    PubMed

    Rex, Martina; Patzolt, Kerstin; Schulte, Katharina; Zizka, Georg; Vásquez, Roberto; Ibisch, Pierre L; Weising, Kurt

    2007-01-01

    The neotropical genus Fosterella L.B. Smith (Pitcairnioideae, Bromeliaceae) comprises about 30 species, with a centre of diversity in semiarid to humid habitats of the Andean slopes and valleys of Bolivia. Morphologic differentiation of species is difficult because of a paucity of diagnostic characters, and little is known about the infrageneric phylogeny. Here, we present the results of an amplified fragment length polymorphism (AFLP) analysis of 77 Fosterella specimens, covering 18 recognized species and 9 as-yet undescribed morphospecies. Eight primer combinations produced 310 bands, which were scored as presence/absence characters. Neighbour-joining tree reconstruction revealed 12 clusters (A-L) with various levels of support. Well-supported species groups were also recovered by a principal coordinates analysis. With few exceptions, morphologically defined species boundaries were confirmed by the molecular data. Phylogenetic relationships between species groups remained ambiguous, however, because of short internal branch lengths. The AFLP data were complemented by a survey of the leaf anatomy of 19 Fosterella species. Species concepts and assemblages are discussed in the context of molecular, morphologic, anatomic, ecologic, and biogeographic data. The data suggest that accidental long-distance dispersal and founder events have been important for Fosterella speciation.

  6. A genetic linkage map of quinoa ( Chenopodium quinoa) based on AFLP, RAPD, and SSR markers.

    PubMed

    Maughan, P J; Bonifacio, A; Jellen, E N; Stevens, M R; Coleman, C E; Ricks, M; Mason, S L; Jarvis, D E; Gardunia, B W; Fairbanks, D J

    2004-10-01

    Quinoa ( Chenopodium quinoa Willd.) is an important seed crop for human consumption in the Andean region of South America. It is the primary staple in areas too arid or saline for the major cereal crops. The objective of this project was to build the first genetic linkage map of quinoa. Selection of the mapping population was based on a preliminary genetic similarity analysis of four potential mapping parents. Breeding lines 'Ku-2' and '0654', a Chilean lowland type and a Peruvian Altiplano type, respectively, showed a low similarity coefficient of 0.31 and were selected to form an F(2) mapping population. The genetic map is based on 80 F(2) individuals from this population and consists of 230 amplified length polymorphism (AFLP), 19 simple-sequence repeat (SSR), and six randomly amplified polymorphic DNA markers. The map spans 1,020 cM and contains 35 linkage groups with an average marker density of 4.0 cM per marker. Clustering of AFLP markers was not observed. Additionally, we report the primer sequences and map locations for 19 SSR markers that will be valuable tools for future quinoa genome analysis. This map provides a key starting point for genetic dissection of agronomically important characteristics of quinoa, including seed saponin content, grain yield, maturity, and resistance to disease, frost, and drought. Current efforts are geared towards the generation of more than 200 mapped SSR markers and the development of several recombinant-inbred mapping populations.

  7. Genetic Diversity in Hypericum and AFLP Markers for Species-Specific Identification of H. perforatum L.

    PubMed Central

    Percifield, Ryan J.; Hawkins, Jennifer S.; McCoy, Joe-Ann; Widrlechner, Mark P.; Wendel, Jonathan F.

    2008-01-01

    One of the top-selling medicinal products worldwide is Hypericum perforatum (St. John's Wort). Despite its cosmopolitan distribution and utilization, little is known regarding the relationship of the bioactive compounds in H. perforatum to the plants from which they are purportedly derived. In this study, amplified fragment length polymorphism (AFLP) analysis of 56 Hypericum accessions, representing 11 species, was conducted to gain a better understanding of diversity within Hypericum species, especially within cultivated accessions of H. perforatum, and to establish a molecular methodology that will provide breeders and regulators with a simple, affordable, and accurate tool with which to identify purported H. perforatum material. Utilizing four primer combinations, a total of 298 polymorphic markers were generated, of which 17 were present in all H. perforatum accessions and 2 were specific to only H. perforatum. This study demonstrates that AFLP can be utilized not only to determine the relationships of closely related Hypericum accessions, but as a tool to authenticate material in herbal remedies through the use of genetic fingerprinting. PMID:18072074

  8. Assessment of the Validity of the Sections in Musa (Musaceae) using AFLP

    PubMed Central

    WONG, CAROL; KIEW, RUTH; ARGENT, GEORGE; SET, OHN; LEE, SING KONG; GAN, YIK YUEN

    2002-01-01

    Musa L. (Musaceae) is currently separated into five sections (Musa, Rhodochlamys, Callimusa, Australimusa and Ingentimusa) based on chromosome numbers and morphological characters. However, the validation of this classification system is questioned due to the common occurrence of hybridizations across sections and the system not accommodating anomalous species. This study employed amplified fragment length polymorphism (AFLP) in a phenetic examination of the relationships among four sections (material of sect. Ingentimusa was not available) to evaluate whether their genetic differences justify distinction into separate groups. Using eight primer combinations, a total of 276 bands was scored, of which 275 were polymorphic. Among the monomorphic bands, 11 unique markers were identified that revealed the distinct separation of the 11‐chromosome species from the 10‐chromosome species. AFLP results suggest that species of sect. Rhodochlamys should be combined into a single section with species of sect. Musa, and likewise for species of sect. Australimusa to be merged with those of sect. Callimusa. PMID:12197520

  9. Genetic structure and distribution of pythium aphanidermatum populations in Pennsylvania greenhouses based on analysis of AFLP and SSR markers.

    PubMed

    Lee, Seonghee; Garzón, Carla D; Moorman, Gary W

    2010-01-01

    Pythium aphanidermatum is one of the most aggressive species in the genus and has a wide host range, but little is known about its population genetic structure. We tested 123 P. aphanidermatum isolates with six AFLP primer combinations and four SSR markers. The genetic diversity of P. aphanidermatum was 0.34 with AFLP and 0.55 with SSR markers. SSR genotypes totaled 3-8 for each locus, and a total of 14 SSR genotypes were found among all isolates. Three major genetic groups were identified with the combination of AFLP and SSR marker data. The genetic structure observed among P. aphanidermatum isolates was related to location and mefenoxam fungicide resistance instead of host. Four genotypes (PA1, PA2, PA5 and PA7) were found in the population from a commercial greenhouse, and the genetic diversity of a greenhouse population was similar to that found in the whole sample. The molecular tools for P. aphanidermatum isolates identified the possible gene flow within and among populations in Pennsylvania greenhouses.

  10. AFLP-based genetic diversity assessment of commercially important tea germplasm in India.

    PubMed

    Sharma, R K; Negi, M S; Sharma, S; Bhardwaj, P; Kumar, R; Bhattachrya, E; Tripathi, S B; Vijayan, D; Baruah, A R; Das, S C; Bera, B; Rajkumar, R; Thomas, J; Sud, R K; Muraleedharan, N; Hazarika, M; Lakshmikumaran, M; Raina, S N; Ahuja, P S

    2010-08-01

    India has a large repository of important tea accessions and, therefore, plays a major role in improving production and quality of tea across the world. Using seven AFLP primer combinations, we analyzed 123 commercially important tea accessions representing major populations in India. The overall genetic similarity recorded was 51%. No significant differences were recorded in average genetic similarity among tea populations cultivated in various geographic regions (northwest 0.60, northeast and south both 0.59). UPGMA cluster analysis grouped the tea accessions according to geographic locations, with a bias toward China or Assam/Cambod types. Cluster analysis results were congruent with principal component analysis. Further, analysis of molecular variance detected a high level of genetic variation (85%) within and limited genetic variation (15%) among the populations, suggesting their origin from a similar genetic pool.

  11. Analysis of the genetic relationships among Thai gibbon species using AFLP markers.

    PubMed

    Tanee, Tawatchai; Chaveerach, Arunrat; Sattayasai, Nison; Tanomtong, Alongkoad; Suarez, Scott A; Nuchadomrong, Suporn

    2007-05-01

    Cytogenetic studies of three gibbon species using conventional banding patterns were investigated showing an identical number of 44 diploid chromosomes. They are assumed to have common evolutionary relationships. For in depth study, molecular markers were assessed using the Amplified Fragment Length Polymorphism (AFLP) method. With seven successful primer combinations, a total of 1669 scorable bands were generated. The resulting bands were used for dendrogram construction. From the dendrogram, the individuals of Hylobates lar are closely related to H. agilis more than H. pileatus with a bootstrap value of 78%. Averages of inter-specific genetic similarity values among all gibbon species studied are 67.15% (between H. lar and H. pileatus) to 71.03% (between H. lar and H. agilis). In summary three gibbon species show genetic stability within a species. The development of specific molecular markers of a species is beneficial for genetic differentiation of this group of primates.

  12. Development of AFLP and RAPD markers linked to a locus associated with twisted growth in corkscrew willow (Salix matsudana 'Tortuosa').

    PubMed

    Lin, Juan; Gunter, Lee E; Harding, Scott A; Kopp, Richard F; McCord, Rachel P; Tsai, Chung-Jui; Tuskan, Gerald A; Smart, Lawrence B

    2007-11-01

    Salix matsudana Koidz. cultivar 'Tortuosa' (corkscrew willow) is characterized by extensive stem bending and curling of leaves. To investigate the genetic basis of this trait, controlled crosses were made between a corkscrew female (S. matsudana 'Tortuosa') and a straight-stemmed, wild-type male (Salix alba L. Clone 99010). Seventy-seven seedlings from this family (ID 99270) were grown in the field for phenotypic observation. Among the progeny, 39 had straight stems and leaves and 38 had bent stems and curled leaves, suggesting that a dominant allele at a single locus controls this phenotype. As a first step in characterizing the locus, we searched for amplified fragment length polymorphism (AFLP) and randomly amplified polymorphic DNA (RAPD) markers linked to the tortuosa allele using bulked segregant analysis. Samples of DNA from 10 corkscrew individuals were combined to produce a corkscrew pool, and DNA from 10 straight progeny was combined to make a wild-type pool. Sixty-four AFLP primer combinations and 640 RAPD primers were screened to identify marker bands amplified from the corkscrew parent and progeny pool, but not from the wild-type parent or progeny pool. An AFLP marker and a RAPD marker linked to and flanking the tortuosa locus were placed on a preliminary linkage map constructed based on segregation among the 77 progeny. Sectioning and analysis of shoot tips revealed that the corkscrew phenotype is associated with vascular cell collapse, smaller cell size in regions near the cambium and less developed phloem fibers than in wild-type progeny. Identification of a gene associated with this trait could lead to greater understanding of the control of normal stem development in woody plants.

  13. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    PubMed

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast

  14. Use of RAPD and AFLP markers to identify inter- and intraspecific hybrids of Mentha.

    PubMed

    Shasany, A K; Darokar, M P; Dhawan, S; Gupta, A K; Gupta, S; Shukla, A K; Patra, N K; Khanuja, S P S

    2005-01-01

    Three controlled crosses were carried out involving Mentha arvensis and Mentha spicata [M. spicata CIMAP/C30 x M. spicata CIMAP/C33 (cv. Neera); M. arvensis CIMAP/C18 x CIMAP/C17 (cv. Kalka); and M. arvensis CIMAP/C17 x M. spicata CIMAP/C33]. The parents were subjected to random amplified polymorphic DNA (RAPD) analysis with 80 primers, and polymorphic primers were tested for detecting coinherited RAPD profiles among the progeny of these crosses. Of 50 seedlings tested from each intraspecific cross, all demonstrated dominant profiles with the selected RAPD primers except the detected hybrid from respective crosses. Coinherited markers could be detected with the primers OPJ 01, MAP 06, OPT 08, and OPO 20 for M. arvensis; OPJ 05, OPJ 14, OPO 19, and OPT 09 for M. spicata; and OPJ 07, OPJ 10, OPJ 11, OPJ 14, and OPO 02 for the cross M. arvensis x M. spicata. In our amplified fragment length polymorphism (AFLP) analysis, 40 coinherited marker fragments were identified for the cross involving M. arvensis, 32 for the cross involving M. spicata, and 41 for the interspecific cross between M. arvensis and M. spicata. In all crosses, similarity values between the parents were less than those between the parents and the hybrids. Although RAPD markers are generally considered dominant, it is possible to identify a few codominant markers that behave like restriction fragment length polymorphism (RFLP) markers. This molecular marker system may be helpful in rapidly screening out hybrids in crops where cross-pollination is a problem.

  15. Analysis of genetic diversity in banana cultivars (Musa cvs.) from the South of Oman using AFLP markers and classification by phylogenetic, hierarchical clustering and principal component analyses.

    PubMed

    Opara, Umezuruike Linus; Jacobson, Dan; Al-Saady, Nadiya Abubakar

    2010-05-01

    Banana is an important crop grown in Oman and there is a dearth of information on its genetic diversity to assist in crop breeding and improvement programs. This study employed amplified fragment length polymorphism (AFLP) to investigate the genetic variation in local banana cultivars from the southern region of Oman. Using 12 primer combinations, a total of 1094 bands were scored, of which 1012 were polymorphic. Eighty-two unique markers were identified, which revealed the distinct separation of the seven cultivars. The results obtained show that AFLP can be used to differentiate the banana cultivars. Further classification by phylogenetic, hierarchical clustering and principal component analyses showed significant differences between the clusters found with molecular markers and those clusters created by previous studies using morphological analysis. Based on the analytical results, a consensus dendrogram of the banana cultivars is presented.

  16. Oligonucleotide primers for PCR amplification of coelomate introns.

    PubMed

    Jarman, Simon N; Ward, Robert D; Elliott, Nicholas G

    2002-09-01

    Abstract Seven novel oligonucleotide primer pairs for polymerase chain reaction amplification of introns from nuclear genes in coelomates were designed and tested. Each pair bound to adjacent exons that are separated by a single intron in most coelomate species. The primer sets amplified introns in species as widely separated by the course of evolution as oysters (Mollusca: Protostoma) and salmon (Chordata: Deuterostoma). Each primer set was tested on a further 6 coelomate species and found to amplify introns in most cases. These primer sets may therefore be useful tools for developing nuclear DNA markers in diverse coelomate species for studies of population genetics, phylogenetics, or genome mapping.

  17. AFLP analysis of genetic diversity in charcoal rot fungal populations impacted by crop rotations.

    PubMed

    Brooker, N; Lord, J R; Long, J; Jayawardhana, A

    2008-01-01

    The application of molecular markers enables scientists to clarify the genetic relationships among fungi who are difficult to classify or partition into sub-species using traditional morphological or physiological criteria. One such fungus is Macrophomina phaseolina, a plant pathogenic soil-borne fungus that is the causative agent of Charcoal Rot on soybeans and 500 other plant species world-wide. This plant pathogenic fungus is a very heterogeneous species and disease population dynamics and pathogen genetic diversity are poorly understood. Using a multi-variant Amplified Fragment Length Polymorphism (AFLP) approach for the analysis of genomic data, valuable insight into cultural and environmental pressures that shape the fungal genome was possible. Fungal isolates from 12-year rotated field plots ranging from 1-3 years of crop rotations of the same plant type(s), rotation duration and plant maturity groups provided a unique opportunity to survey M. phaseolina isolates taken from the different crop rotation conditions. Using different data interval partitioning of amplified restriction fragments it was possible to see trends associated with the specific cropping history of the fungal isolates. AFLP neutral primers of intermediate and large amplified products using 20-bp intervals were the most efficient and reliable for demonstrating intra-population dynamics. Results indicate that the highest amount of M. phaseolina genetic diversity was conclusively found in fungal isolates taken from three-year rotation plots. Lesser amounts of genetic diversity were found in two-year rotated and non-rotated fungal isolates. Insight gained from this study may now be incorporated into a larger understanding of how crop rotation and the availability of hosts shape and influence the genetic variability within Macrophomina isolates and populations. This information can then be used to make better-informed decisions regarding crop protection strategies against this diverse and

  18. PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR

    PubMed Central

    Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-lin; Korbie, Darren; Trau, Matt

    2017-01-01

    The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com). PMID:28117430

  19. PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.

    PubMed

    Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt

    2017-01-24

    The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com).

  20. Genomic scanning using AFLP to detect loci under selection in the moss Funaria hygrometrica along a climate gradient in the Sierra Nevada Mountains, Spain.

    PubMed

    Magdy, M; Werner, O; McDaniel, S F; Goffinet, B; Ros, R M

    2016-03-01

    The common cord moss Funaria hygrometrica has a worldwide distribution and thrives in a wide variety of environments. Here, we studied the genetic diversity in F. hygrometrica along an abiotic gradient in the Mediterranean high mountain of Sierra Nevada (Spain) using a genome scan method. Eighty-four samples from 17 locations from 24 to 2700 m were fingerprinted based on their amplified fragment length polymorphism (AFLP) banding pattern. Using PCA and Bayesian inference we found that the genetic diversity was structured in three or four clusters, respectively. Using a genome scan method we identified 13 outlier loci, which showed a signature of positive selection. Partial Mantel tests were performed between the Euclidean distance matrices of geographic and climatic variables, versus the pair-wise genetic distance of the AFLP dataset and AFLP-positive outliers dataset. AFLP-positive outlier data were significantly correlated with the gradient of the climatic variables, suggesting adaptive variation among populations of F. hygrometrica along the Sierra Nevada Mountains. We highlight the additional analyses necessary to identify the nature of these loci, and their biological role in the adaptation process.

  1. SBE primer : multiplexing minisequencing-based genotyping

    SciTech Connect

    Kaderali, L.; Deshpande, A.; Uribe-Romeo, F. J.; Schliep, A.; Torney, D. C.

    2002-01-01

    Single-nucleotide polymorphism (SNP) analysis is a powerful tool for mapping and diagnosing disease-related alleles. Most of the known genetic diseases are caused by point mutations, and a growing number of SNPs will be routinely analyzed to diagnose genetic disorders. Mutation analysis by polymerase mediated single-base primer extension (minisequencing) can be massively parallelized using for example DNA microchips or flow cytometry with microspheres as solid support. By adding a unique oligonucleotide tag to the 5-inch end of the minisequencing primer and attaching the complementary anti-tag to the array or bead surface, the assay can be 'demultiplexed'. However, such high-throughput scoring of SNPs requires a high level of primer multiplexing in order to analyze multiple loci in one assay, thus enabling inexpensive and fast polymorphism scoring. Primers can be chosen from either the plus or the minus strand, and primers used in the same experiment must not bind to one another. To genotype a given number of polymorphic sites, the question is which primer to use for each SNP, and which primers to group into the same experiment. Furthermore, a crosshybridization-free tag/anti-tag code is required in order to sort the extended primers to the corresponding microspheres or chip spots. These problems pose challenging algorithmic questions. We present a computer program lo automate the design process for the assay. Oligonucleotide primers for the reaction are automatically selected by the software, a unique DNA tag/anti-tag system is generated, and the pairing of primers and DNA-Tags is automatically done in a way to avoid any crossreactivity. We report first results on a 45-plex genotyping assay, indicating that minisequencing can be adapted to be a powerful tool for high-throughput, massively parallel genotyping.

  2. Polyacid macromolecule primers

    DOEpatents

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  3. Polyacid macromolecule primers

    DOEpatents

    Sugama, Toshifumi

    1989-01-01

    Hydrophylic polyacids, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests.

  4. Microsatellite primers for red drum (Sciaenops ocellatus)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In this note, we document polymerase-chain-reaction (PCR) primer pairs for 101, nuclear-encoded microsatellites designed and developed from a red drum (Sciaenops ocellatus) genomic library. The 101 microsatellites (Genbank Accession Numbers EU015882-EU015982) were amplified successfully and used to...

  5. Transmission Investment: A Primer

    SciTech Connect

    McGarvey, Joe

    2006-10-15

    This primer highlights recent trends in transmission investment, summarizes the division of jurisdictional authority over transmission, and presents four alternative models for transmission ownership. (author)

  6. ConservedPrimers 2.0: A high-throughput pipeline for comparative genome referenced intron-flanking PCR primer design and its application in wheat SNP discovery

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In some genomic applications it is necessary to design large numbers of PCR primers in exons flanking one or several introns on the basis of orthologous gene sequences in related species. The primer pairs designed by this target gene approach are called "intron-flanking primers" or because they ar...

  7. Population genetic structure in Phyla scaberrima from Mexico and Colombia assessed by AFLP markers and implications for conservation.

    PubMed

    Androcioli, L G; Ruas, E A; Rodrigues, L A; Ruas, C F; Perilla, H E R; Ruas, P M

    2015-12-02

    Phyla scaberrima (Verbenaceae) is a herbaceous perennial species that is distributed from Mexico (center of origin) to Colombia, growing in forest and swamp edges or grasslands from sea level up to an altitude of 1800 m. The chemical properties and uses in popular medicine have drastically affected the population size of this species. In this study, we investigated genetic variability in populations of P. scaberrima using AFLP markers. Three AFLP primer combinations rendered a total of 997 markers in a sample of 131 individuals from five populations, including two populations from Mexico and three from Colombia. The average percentage of polymorphic loci, gene diversity and Shannon-Wiener index were 46.62, 0.0695, and 0.119, respectively. Analysis of molecular variance showed that the distribution of the genetic variability within populations (85.41%) was higher than between groups (8.11%) and between populations (6.48%). Principal coordinate analysis and Bayesian analysis for the K number of clusters showed that the individuals were dispersed in five (K= 5) clusters. The low levels of genetic diversity observed in these populations demonstrated that the populations from Mexico and Colombia need urgent management to recover their genetic variability.

  8. GISH, AFLP and PCR-RFLP analysis of an intergeneric somatic hybrid combining Goutou sour orange and Poncirus trifoliata.

    PubMed

    Fu, C H; Chen, C L; Guo, W W; Deng, X X

    2004-11-01

    Intergeneric somatic hybrids combining Goutou sour orange (Citrus aurantium L.) with trifoliate orange Poncirus trifoliata (L.) Raf] were produced by electrofusion and their genetic inheritance analyzed by amplified fragment length polymorphism (AFLP), genomic in situ hybridization (GISH), and PCR-restriction fragment length polymorphism (PCR-RFLP). Sixteen mini-calluses were obtained after 20 days of culture; they all developed into embryoids on EME500 medium. Following several subcultures on shoot induction medium for a total culture period of 6 months, shoots regenerated. The plants grew vigorously with a well-developed root system and exhibited the trifoliate leaf character of P. trifoliata. Ploidy analysis verified that all of the regenerates were tetraploids (2 n=4 x=36) as expected. GISH analysis confirmed that 18 chromosomes came from trifoliate orange and the remaining 18 from Goutou sour orange, as with most symmetric somatic hybrid plants; moreover, chromosome translocations were also observed in one plant. AFLP analysis of 16 regenerates and their fusion parents indicated that all of the somatic hybrids except one were genetically uniform. Analysis of the somatic hybrid cytoplasmic genomes with universal primers revealed that their chloroplast DNA (cpDNA) banding patterns were identical to those of the mesophyll parent trifoliate orange, while their mitochondria (mt) genomes were of the callus parent sour orange. The potential of GISH in Citrus somatic hybrid analysis is discussed.

  9. A preliminary study for identification of candidate AFLP markers under artificial selection for shell color in pearl oyster Pinctada fucata.

    PubMed

    Zou, Keshu; Zhang, Dianchang; Guo, Huayang; Zhu, Caiyan; Li, Min; Jiang, Shigui

    2014-05-25

    Pearl oyster Pinctada fucata is widely cultured to produce seawater pearl in South China, and the quality of pearl is significantly affected by its shell color. Thus the Pearl Oyster Selective Breeding Program (POSBP) was carried out for the shell color and growth traits. The black (B), gold (G), red (R) and white (W) shell strains with fast growth trait were achieved after five successive generation selection. In this study, AFLP technique was used to scan genome of four strains with different shell colors to identify the candidate markers under artificial selection. Eight AFLP primer combinations were screened and yielded 688 loci, 676 (98.26%) of which were polymorphic. In black, gold, red and white strains, the percentage of polymorphic loci was 90.41%, 87.79%, 93.60% and 93.31%, respectively, Nei's gene diversity was 0.3225, 0.2829, 0.3221 and 0.3292, Shannon's information index was 0.4801, 0.4271, 0.4825 and 0.4923, and the value of FST was 0.1805. These results suggested that the four different shell color strains had high genetic diversity and great genetic differentiation among strains, which had been subjected to the continuous selective pressures during the artificial selective breeding. Furthermore, six outlier loci were considered as the candidate markers under artificial selection for shell color. This study provides a molecular evidence for the inheritance of shell color of P. fucata.

  10. Identification of Amplified Fragment Length Polymorphism (AFLP) Markers Tightly Associated with Drought Stress Gene in Male Sterile and Fertile Salvia miltiorrhiza Bunge.

    PubMed

    Zhang, Yuejin; Guo, Lijun; Shu, Zhiming; Sun, Yiyue; Chen, Yuanyuan; Liang, Zongsuo; Guo, Hongbo

    2013-03-22

    Consistent grain yield in drought environment has attracted wide attention due to global climate change. However, the important drought-related traits/genes in crops have been rarely reported. Many near-isogenic lines (NILs) of male sterile and fertile Salvia miltiorrhiza have been obtained in our previous work through testcross and backcross in continuous field experiments conducted in 2006-2009. Both segregating sterile and fertile populations were subjected to bulked segregant analysis (BSA) and amplified fragment length polymorphism (AFLP) with 384 and 170 primer combinations, respectively. One out of 14 AFLP markers (E9/M3246) was identified in treated fertile population as tightly linked to the drought stress gene with a recombination frequency of 6.98% and at a distance of 7.02 cM. One of 15 other markers (E2/M5357) was identified in a treated sterile population that is closely associated with the drought stress gene. It had a recombination frequency of 4.65% and at a distance of 4.66 cM. Interestingly, the E9/M3246 fragment was found to be identical to another AFLP fragment E11/M4208 that was tightly linked to the male sterile gene of S. miltiorrhiza with 95% identity and e-value 4 × 10-93. Blastn analysis suggested that the drought stress gene sequence showed higher identity with nucleotides in Arabidopsis chromosome 1-5.

  11. The molecular genetic characterization of the 'Bobwhite' bread wheat family using AFLPs and the effect of the T1BL.1RS translocation.

    PubMed

    Warburton, L.; Skovmand, B.; Mujeeb-Kazi, A.

    2002-04-01

    Bobwhite is a generic name that refers to all sister lines derived from the cross CM 33203 with the pedigree Aurora//Kalyan/Bluebird/3/Woodpecker made by the CIMMYT bread wheat program in the early 1970s. Individual sister lines can be distinguished by their unique selection history. One of the parents, Aurora, contains the T1BL.1RS translocation from rye, and approximately 85% of the sister lines have inherited the translocation. The sister lines demonstrate great variability for agronomic traits such as maturity, height, grain color, reaction to leaf rust, stem rust, yellow rust, septoria leaf blotch and powdery mildew. Certain groups of sister lines derived from particular F(1) plants can be distinguished by their phenotype. One hundred and one Bobwhite sister lines were fingerprinted using four AFLP enzyme/primer combinations. Following multivariate analysis, two main and very distinct clusters were found, which reflected the presence or absence of the T1BL.1RS translocation. Within these clusters, lines clustered together, for the most part, with other sister lines sharing a common selection history. Removal of the AFLP markers that were correlated with the presence or absence of the translocation caused lines to cluster based on pedigree alone. Therefore, the presence of translocations in wheat could bias genetic diversity studies using unmapped markers such as AFLPs that are located on the translocated segment(s), with the result that the resulting clusters will not reflect the true degree of relatedness.

  12. Microsatellite primer resource for Populus developed from

    SciTech Connect

    Yin, Tongming; Yang, Xiaohan; Gunter, Lee E; Tuskan, Gerald A; Wullschleger, Stan D; Huang, Prof. Minren; Li, Shuxian; Zhang, Xinye

    2008-01-01

    In this study, 148 428 simple sequence repeat (SSR) primer pairs were designed from the unambiguously mapped sequence scaffolds of the Nisqually-1 genome. The physical position of the priming sites were identified along each of the 19 Populus chromosomes, and it was specified whether the priming sequences belong to intronic, intergenic, exonic or UTR regions. A subset of 150 SSR loci were amplified and a high amplification success rate (72%) was obtained in P. tremuloides, which belongs to a divergent subgenus of Populus relative to Nisqually-1. PCR reactions showed that the amplification success rate of exonic primer pairs was much higher than that of the intronic/intergenic primer pairs. Applying ANOVA and regression analyses to the flanking sequences of microsatellites, the repeat lengths, the GC contents of the repeats, the repeat motif numbers, the repeat motif length and the base composition of the repeat motif, it was determined that only the base composition of the repeat motif and the repeat motif length significantly affect the microsatellite variability in P. tremuloides samples. The SSR primer resource developed in this study provides a database for selecting highly transferable SSR markers with known physical position in the Populus genome and provides a comprehensive genetic tool to extend the genome sequence of Nisqually-1 to genetic studies in different Populus species.

  13. Development of Specific Primer for Tricholoma matsutake

    PubMed Central

    Kim, Jang-Han

    2009-01-01

    In this study, in an effort to develop a method for the molecular detection of Tricholoma matsutake in Korea from other closely related Tricholomataceae, a species-specific PCR primer pair, TmF and TmR, was designed using nuclear ribosomal intertranscribed spacer (ITS) sequences. The DTmF and DTmR sequences were 5'-CCTGACGCCAATCTTTTCA-3' and 5'-GGAGAGCAGACTTGTGAGCA-3', respectively. The PCR primers reliably amplified only the ITS sequences of T. matsutake, and not those of other species used in this study. PMID:23983557

  14. Are "universal" DNA primers really universal?

    PubMed

    Sharma, Pranay; Kobayashi, Tsuyoshi

    2014-11-01

    "Universal" DNA primers LCO 1490 and HCO 2198 were originally designed from three coding and six anticoding strands by comparing highly conserved regions of mitochondrial cytochrome c oxidase subunit I (COI) genes across 15 taxa. These primers have been successful in amplifying a 710-bp fragment of highly conserved regions of the COI gene for more than 80 invertebrate species from 11 phyla. In the present study, 130,843 variations were reviewed in the primer region of mitochondrial molecular markers by comparing 725 COI sequences from the kingdom Animalia. It was found that, for 177 invertebrate species, the forward primer (LCO 1490) showed only four conserved regions, compared to 12 in the original study. For ascidians, fungi and vertebrates, it showed approximately 50 % conserved regions, dropping to one conserved region for echinoderms. However, the reverse primer (HCO 2198) was highly conserved across 725 COI primer sequences. A similar pattern was observed in amino acid distributions. There was a significant difference in the means of base pair differences from the level of family, genus and species for LCO 1490 [analysis of variance (ANOVA), F 6,188 = 8.193, P < 0.001] and at the level of genus and species for HCO 2198 (ANOVA, F 6,77 = 2.538, P < 0.027). We conclude that, at different taxonomic levels, it is possible to design forward primers from reference sequences belonging to the level of order (maximum 5 bp differences), family (maximum 6 bp differences) or genus (maximum 1 bp difference). Reverse primers can be designed from the level of family (maximum 5 bp differences) or genus (maximum 2 bp differences).

  15. PrecisePrimer: an easy-to-use web server for designing PCR primers for DNA library cloning and DNA shuffling.

    PubMed

    Pauthenier, Cyrille; Faulon, Jean-Loup

    2014-07-01

    PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions.

  16. Genetic diversity and structure of Brazilian ginger germplasm (Zingiber officinale) revealed by AFLP markers.

    PubMed

    Blanco, Eleonora Zambrano; Bajay, Miklos Maximiliano; Siqueira, Marcos Vinícius Bohrer Monteiro; Zucchi, Maria Imaculada; Pinheiro, José Baldin

    2016-12-01

    Ginger is a vegetable with medicinal and culinary properties widely cultivated in the Southern and Southeastern Brazil. The knowledge of ginger species' genetic variability is essential to direct correctly future studies of conservation and genetic improvement, but in Brazil, little is known about this species' genetic variability. In this study, we analyzed the genetic diversity and structure of 55 Brazilian accessions and 6 Colombian accessions of ginger, using AFLP (Amplified Fragment Length Polymorphism) molecular markers. The molecular characterization was based on 13 primers combinations, which generated an average of 113.5 polymorphic loci. The genetic diversity estimates of Nei (Hj), Shannon-Weiner index (I) and an effective number of alleles (n e ) were greater in the Colombian accessions in relation to the Brazilian accessions. The analysis of molecular variance showed that most of the genetic variation occurred between the two countries while in the Brazilian populations there is no genetic structure and probably each region harbors 100 % of genetic variation found in the samples. The bayesian model-based clustering and the dendrogram using the dissimilarity's coefficient of Jaccard were congruent with each other and showed that the Brazilian accessions are highly similar between themselves, regardless of the geographic region of origin. We suggested that the exploration of the interspecific variability and the introduction of new varieties of Z.officinale are viable alternatives for generating diversity in breeding programs in Brazil. The introduction of new genetic materials will certainly contribute to a higher genetic basis of such crop.

  17. Genetic diversity and population structure of six species of Capparis in Tunisia using AFLP markers.

    PubMed

    Aichi-Yousfi, Haifa; Bahri, Bochra Amina; Medini, Maher; Rouz, Slim; Nejib Rejeb, Mohamed; Ghrabi-Gammar, Zeineb

    In order to study the genetic diversity, the phylogeographic pattern and hybridization between six Tunisian Capparis species, 213 accessions of Caper were genotyped with three primer combinations of amplified fragment length polymorphism (AFLP) markers. Out of 750 fragments generated, 636 were polymorphic and 407 of them were restricted to a single species. STRUCTURE and PCoA analyses clearly separated morphologically different populations into six distinct genetic ones. The UPGMA analysis grouped the species into three main clusters: G1 grouped C. spinosa subsp. spinosa var. spinosa and C. sicula subsp. sicula; G2 grouped C. ovata subsp. ovata and C. orientalis and G3 clustered C. zoharyi and C. aegyptia. Populations from G1, G2 and G3 were mainly distributed in arid, subhumid, and semi-arid bioclimates, respectively. Additional genetic studies on Capparis could help to identify genes underlying speciation events and local adaptation to geographic areas leading to the development of breeding programs.

  18. Quick spacecraft charging primer

    SciTech Connect

    Larsen, Brian Arthur

    2014-03-12

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  19. Assessing mycoplasma contamination of cell cultures by qPCR using a set of universal primer pairs targeting a 1.5 kb fragment of 16S rRNA genes

    PubMed Central

    Jean, Audrey; Tardy, Florence; Allatif, Omran; Grosjean, Isabelle; Blanquier, Bariza

    2017-01-01

    Mycoplasmas (a generic name for Mollicutes) are a predominant bacterial contaminant of cell culture and cell derived products including viruses. This prokaryote class is characterized by very small size and lack of a cell wall. Consequently, mycoplasmas escape ultrafiltration and visualization under routine microscopic examination, hence the ease with which cells in culture can be contaminated, with routinely more than 10% of cell lines being contaminated. Mycoplasma are a formidable threat both in fundamental research by perverting a whole range of cell properties and functions and in the pharmacological use of cells and cell derived products. Although many methods have been developed, there is still a need for a sensitive, universal assay. Here is reported the development and validation of a quantitative polymerase chain reaction (qPCR) based on the amplification of a 1.5 kb fragment covering the 16S rDNA of the Mollicute class by real-time PCR using universal U1 and U8 degenerate primers. The method includes the addition of a DNA loading probe to each sample to monitor DNA extraction and the absence of PCR inhibitors in the extracted DNA, a positive mycoplasma 16S rDNA traceable reference sample to exclude any accidental contamination of an unknown sample with this reference DNA, an analysis procedure based on the examination of the melting curve and the size of the PCR amplicon, followed by quantification of the number of 16S rDNA copies (with a lower limit of 19 copies) when relevant, and, if useful, the identification of the contaminating prokaryote by sequencing. The method was validated on a collection of mycoplasma strains and by testing over 100 samples of unknown contamination status including stocks of viruses requiring biosafety level 2, 3 or 4 containments. When compared to four established methods, the m16S_qPCR technique exhibits the highest sensitivity in detecting mycoplasma contamination. PMID:28225826

  20. Plastid primers for angiosperm phylogenetics and phylogeography1

    PubMed Central

    Prince, Linda M.

    2015-01-01

    Premise of the study: PCR primers are available for virtually every region of the plastid genome. Selection of which primer pairs to use is second only to selection of the genic region. This is particularly true for research at the species/population interface. Methods: Primer pairs for 130 regions of the chloroplast genome were evaluated in 12 species distributed across the angiosperms. Likelihood of amplification success was inferred based upon number and location of mismatches to target sequence. Intraspecific sequence variability was evaluated under three different criteria in four species. Results: Many published primer pairs should work across all taxa sampled, with the exception of failure due to genomic reorganization events. Universal barcoding primers were the least likely to work (65% success). The list of most variable regions for use within species has little in common with the lists identified in prior studies. Discussion: Published primer sequences should amplify a diversity of flowering plant DNAs, even those designed for specific taxonomic groups. “Universal” primers may have extremely limited utility. There was little consistency in likelihood of amplification success for any given publication across lineages or within lineage across publications. PMID:26082876

  1. Primer-design for multiplexed genotyping.

    PubMed

    Kaderali, Lars; Deshpande, Alina; Nolan, John P; White, P Scott

    2003-03-15

    Single-nucleotide polymorphism (SNP) analysis is a powerful tool for mapping and diagnosing disease-related alleles. Mutation analysis by polymerase-mediated single-base primer extension (minisequencing) can be massively parallelized using DNA microchips or flow cytometry with microspheres as solid support. By adding a unique oligonucleotide tag to the 5' end of the minisequencing primer and attaching the complementary antitag to the array or bead surface, the assay can be 'demultiplexed'. Such high-throughput scoring of SNPs requires a high level of primer multiplexing in order to analyze multiple loci in one assay, thus enabling inexpensive and fast polymorphism scoring. We present a computer program to automate the design process for the assay. Oligonucleotide primers for the reaction are automatically selected by the software, a unique DNA tag/antitag system is generated, and the pairing of primers and DNA tags is automatically done in a way to avoid any crossreactivity. We report results on a 45-plex genotyping assay, indicating that minisequencing can be adapted to be a powerful tool for high-throughput, massively parallel genotyping. The software is available to academic users on request.

  2. Predicting Offspring Performance in Hop (Humulus lupulus L.) Using AFLP Markers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pedigree and combining ability information for male and female hop accessions is limited and choice of breeding parents remains guesswork. This studies’ objective was to determine if AFLP markers could be used to predict offspring performance in hop. AFLP assays were used to estimate genetic dista...

  3. China Energy Primer

    SciTech Connect

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  4. In vitro susceptibility testing of amphotericin B for Cryptococcus neoformans variety grubii AFLP1/VNI and Cryptococcus gattii AFLP6/VGII by CLSI and flow cytometry.

    PubMed

    Morales, Bernardina Penarrieta; Trilles, Luciana; Bertho, Álvaro Luiz; Junior, Ivan Neves; de Oliveira, Raquel de Vasconcellos Carvalhaes; Wanke, Bodo; Lazéra, Márcia dos Santos

    2015-05-01

    Cryptococcus neoformans var. grubii AFLP1/VNI is the main causative agent of cryptococcosis associated with AIDS in the world. Cryptococcus gattii AFLP6/VGII causes mainly endemic primary infection in immunocompetent hosts. To determine the minimum inhibitory concentrations (MICs) of C. neoformans var. grubii AFLP1/VNI and C. gattii AFLP6/VGII against amphotericin B (AMB) in a short period of time, flow cytometry (FCM) with FUN-1 fluorochrome was used to compare with broth microdilution method (CLSI M27-A3). The minimum incubation period was evaluated by minimum fungicidal concentration procedure. Seventeen clinical isolates of C. neoformans var. grubii AFLP1/VNI and 18 of C. gattii AFLP6/VGII were analysed. The time for the determination of MICs by FCM was 2 h against 72 h by CLSI M27-A3 and the comparison of MIC showed a positive significant correlation (P = 0.048). It is important to highlight the role of the FCM as an alternative method to determine the MICs for AMB in within a day, with positive cost-benefit.

  5. Systems Engineering Measurement Primer

    DTIC Science & Technology

    1998-03-01

    Systems Engineering Measurement Primer A Basic Introduction to Systems Engineering Measurement Concepts and Use Version 1.0 March 1998 This document...Federal Systems Garry Roedler Lockheed Martin Management & Data Systems Cathy Tilton The National Registry, Inc. E. Richard Widmann Raytheon Systems...IV 1. INTRODUCTION

  6. An SAT® Validity Primer

    ERIC Educational Resources Information Center

    Shaw, Emily J.

    2015-01-01

    This primer should provide the reader with a deeper understanding of the concept of test validity and will present the recent available validity evidence on the relationship between SAT® scores and important college outcomes. In addition, the content examined on the SAT will be discussed as well as the fundamental attention paid to the fairness of…

  7. Primer on Social Economics.

    ERIC Educational Resources Information Center

    Darcy, Robert L.

    An elaboration of the author's booklet entitled "First Steps Toward Economic Understanding," this primer is designed to help the reader develop a functional understanding of the economic process so that he can make wiser decisions on issues of social policy and on matters affecting his economic well-being. The document is not "economics in one…

  8. Primer on Water Quality

    MedlinePlus

    ... fs-027-01.pdf--665KB A Primer on Water Quality What is in the water? Is it safe for drinking? Can fish and ... affect water quality. What do we mean by "water quality"? Water quality can be thought of as ...

  9. Alterations of leaf cell ultrastructures and AFLP DNA profiles in Earth-grown tomato plants propagated from long-term six years Mir-flown seeds

    NASA Astrophysics Data System (ADS)

    Liu, Min; Xue, Huai; Pan, Yi; Zhang, Chunhua; Lu, Jinying

    Leaf cell ultrastructures and DNA variations in the firstand the second-generation of Earthgrown tomato (Lycopersicon esculentun Mill) plants that had been endured a long-term six years spaceflight in the Mir were compared to their ground-based control plants, under observations with a Transmission Electron Microscope and the Amplification Fragment Length Polymorphism (AFLP) analysis. For alterations in the morphological ultrastructures, one plant among the 11 first-generation plants generated from 30 Mir-flown seeds had a three-layered palisade cell structure, while other 10 first-generation plants and all ground-based controls had one-layered palisade cell structure in leaves. Starch grains were larger and in clusters, numbers of starch grains increased in the chloroplasts in the Mir-flown plants. Leaf cells became contracted and deformed, and cell shape patterns were different in the Mir-flown plants. For the leaf genomic DNA alterations, 34 DNA bands were polymorphic with a 1.32% polymorphism among 2582 DNA bands in the first-generation Mir-flown plants. Band types in the spaceflight treated plants were also different from those in the ground-based control. Of 11 survived first-generation plants, 7 spaceflight treated plants (Plant Nos. 1-6 and No. 9) had a same 7 polymorphic bands and a same 0.27%DNA mutation. The DNA mutation rate was greatest in Plants No.10 and No.7 (0.90% and 0.94%), less in Plant No.11 (0.31%) and least in Plant No.8 (0.20%). For the 38 send-generation plants propagated from the No. 5 Mir-flown seed, 6 DNA bands were polymorphic with a 0.23% polymorphism among 2564 amplified DNA bands. Among those 38 second-generation plants amplified by primer pair (E4: ACC, M8: CTT), one DNA band disappeared in 29 second-generation plants and in the original Mir-flown No. 5 plant, compared to the ground-base controls. Among the 38 second-generation plants generated from the Mir-flown No. 5 seed, the DNA band types of 29 second-generation plants were

  10. Quantitative experimental determination of primer-dimer formation risk by free-solution conjugate electrophoresis.

    PubMed

    Desmarais, Samantha M; Leitner, Thomas; Barron, Annelise E

    2012-02-01

    DNA barcodes are short, unique ssDNA primers that "mark" individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 base-pairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive base-pairs formed, yet non-consecutive base-pairs did not create stable dimers even when 20 out of 30 possible base-pairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation.

  11. First environmental isolation of Cryptococcus gattii, genotype AFLP5, from India and a global review.

    PubMed

    Chowdhary, A; Prakash, A; Randhawa, H S; Kathuria, S; Hagen, F; Klaassen, C H; Meis, J F

    2013-05-01

    We report the first environmental isolation from India of Cryptococcus gattii, genotype amplified fragment length polymorphism 5 (AFLP5), which is one of the rarely reported genotypes of this pathogen. It originated from decayed wood inside a trunk hollow of Manilkara hexandra, a native tree in Delhi. We investigated 101 isolates of C. gattii, originating from 556 samples of decayed wood inside trunk hollows of 311 heterogeneous tree species and their surrounding soil. Of these, only a solitary isolate proved to be AFLP5, the remainder belonged to AFLP4. Antifungal susceptibility testing showed a low MIC90 (0.25 μg ml(-1) ) of the new azoles posaconazole and isavuconazole for these environmental isolates. Genotype AFLP5 has been mainly reported from environmental sources in Colombia and from clinical sources in California (USA), where it seems to be endemic. Phylogenetic analysis of multi-locus sequence typing data showed that the Indian AFLP5 C. gattii isolate had a distinct profile compared with a cluster of mainly Colombian and Californian C. gattii AFLP5 isolates. As molecular typing of human pathogenic fungi is still in its infancy and not accessible to many countries, our current knowledge cannot be taken as reflective of the true geographic distribution of C. gattii AFLP5 or its other rarely reported molecular types.

  12. Universal COI primers for DNA barcoding amphibians.

    PubMed

    Che, Jing; Chen, Hong-Man; Yang, Jun-Xiao; Jin, Jie-Qiong; Jiang, Ke; Yuan, Zhi-Yong; Murphy, Robert W; Zhang, Ya-Ping

    2012-03-01

    DNA barcoding is a proven tool for the rapid and unambiguous identification of species, which is essential for many activities including the vouchering tissue samples in the genome 10K initiative, genealogical reconstructions, forensics and biodiversity surveys, among many other applications. A large-scale effort is underway to barcode all amphibian species using the universally sequenced DNA region, a partial fragment of mitochondrial cytochrome oxidase subunit I COI. This fragment is desirable because it appears to be superior to 16S for barcoding, at least for some groups of salamanders. The barcoding of amphibians is essential in part because many species are now endangered. Unfortunately, existing primers for COI often fail to achieve this goal. Herein, we report two new pairs of primers (➀, ➁) that in combination serve to universally amplify and sequence all three orders of Chinese amphibians as represented by 36 genera. This taxonomic diversity, which includes caecilians, salamanders and frogs, suggests that the new primer pairs will universally amplify COI for the vast majority species of amphibians.

  13. Primer on molecular genetics

    SciTech Connect

    Not Available

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  14. Coal Bed Methane Primer

    SciTech Connect

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  15. Crystalline Silica Primer

    USGS Publications Warehouse

    ,

    1992-01-01

    substance and will present a nontechnical overview of the techniques used to measure crystalline silica. Because this primer is meant to be a starting point for anyone interested in learning more about crystalline silica, a list of selected readings and other resources is included. The detailed glossary, which defines many terms that are beyond the scope of this publication, is designed to help the reader move from this presentation to a more technical one, the inevitable next step.

  16. Sex-linked AFLP markers indicate a pseudoautosomal region in hemp ( Cannabis sativa L.).

    PubMed

    Peil, A; Flachowsky, H; Schumann, E; Weber, W E

    2003-06-01

    In dioecious plants of hemp ( Cannabis sativa L.), males are regarded as heterogametic XY and females as homogametic XX, although it is difficult to discriminate the X cytologically from the Y. The Y chromosome is somewhat larger than the X. Our aim was to analyse AFLP markers on X and Y, and to use them to gain some insight into the structure of the sex chromosomes. Markers located on the sex chromosomes can be grouped into different classes, depending on the presence or absence of a fragment on the X and/or the Y. They are detected by separately analysing male and female progenies of a single cross. Five markers were found to be located on both chromosomes. A few recombinants were observed for marker pairs of this class in the male progenies. Two completely linked markers located on the Y chromosome in the male parent show a recombination rate of r = 0.25 with sex. Recombination must have occurred between the sex chromosomes in the male parent. The recombination analysis led to the conclusion that there is a pseudoautosomal region (PAR) on the sex chromosomes, allowing recombination between the X and the Y chromosome. The other regions of the sex chromosomes show only a few recombination events, for the Y as well as for the X. These results are discussed in comparison to other dioecious plants.

  17. primers4clades: a web server that uses phylogenetic trees to design lineage-specific PCR primers for metagenomic and diversity studies.

    PubMed

    Contreras-Moreira, Bruno; Sachman-Ruiz, Bernardo; Figueroa-Palacios, Iraís; Vinuesa, Pablo

    2009-07-01

    Primers4clades is an easy-to-use web server that implements a fully automatic PCR primer design pipeline for cross-species amplification of novel sequences from metagenomic DNA, or from uncharacterized organisms, belonging to user-specified phylogenetic clades or taxa. The server takes a set of non-aligned protein coding genes, with or without introns, aligns them and computes a neighbor-joining tree, which is displayed on screen for easy selection of species or sequence clusters to design lineage-specific PCR primers. Primers4clades implements an extended CODEHOP primer design strategy based on both DNA and protein multiple sequence alignments. It evaluates several thermodynamic properties of the oligonucleotide pairs, and computes the phylogenetic information content of the predicted amplicon sets from Shimodaira-Hasegawa-like branch support values of maximum likelihood phylogenies. A non-redundant set of primer formulations is returned, ranked according to their thermodynamic properties. An amplicon distribution map provides a convenient overview of the coverage of the target locus. Altogether these features greatly help the user in making an informed choice between alternative primer pair formulations. Primers4clades is available at two mirror sites: http://maya.ccg.unam.mx/primers4clades/and http://floresta.eead.csic.es/primers4clades/. Three demo data sets and a comprehensive documentation/tutorial page are provided for easy testing of the server's capabilities and interface.

  18. Design of allele-specific primers and detection of the human ABO genotyping to avoid the pseudopositive problem.

    PubMed

    Yaku, Hidenobu; Yukimasa, Tetsuo; Nakano, Shu-ichi; Sugimoto, Naoki; Oka, Hiroaki

    2008-11-01

    PCR experiments using DNA primers forming mismatch pairing with template lambda DNA at the 3' end were carried out in order to develop allele-specific primers capable of detecting SNP in genomes without generating pseudopositive amplification products, and thus avoiding the so-called pseudopositive problem. Detectable amounts of PCR products were obtained when primers forming a single or two mismatch pairings at the 3' end were used. In particular, 3' terminal A/C or T/C (primer/template) mismatches tended to allow PCR amplification to proceed, resulting in pseudopositive results in many cases. While less PCR product was observed for primers forming three terminal mismatch pairings, target DNA sequences were efficiently amplified by primers forming two mismatch pairings next to the terminal G/C base pairing. These results indicate that selecting a primer having a 3' terminal nucleotide that recognizes the SNP nucleotide and the next two nucleotides that form mismatch pairings with the template sequence can be used as an allele-specific primer that eliminates the pseudopositive problem. Trials with the human ABO genes demonstrated that this primer design is also useful for detecting a single base pair difference in gene sequences with a signal-to-noise ratio of at least 45.

  19. Primer on Beam Optics

    DTIC Science & Technology

    2007-11-02

    Inc. San Diego, California Table of Contents Page 1 . Introduction 1 1.1 Organization of Primer 1 1.2 Introduction to Neutral Particle Beam...Optical Systems 3 2. Fundamentals of Charged Particle Optics 10 2.1 Introduction 1 ° 2.2 Phase Space and Nonlinear Motion 10 2.3 Linear Maps 22 2.4...102 Figures Figure Pag© 1 . Generic Neutral Particle Beam Device 4 2. An orthogonal three dimensional coordinate system 11 3. Trajectory of a

  20. Laser Doppler velocimetry primer

    NASA Technical Reports Server (NTRS)

    Bachalo, William D.

    1985-01-01

    Advanced research in experimental fluid dynamics required a familiarity with sophisticated measurement techniques. In some cases, the development and application of new techniques is required for difficult measurements. Optical methods and in particular, the laser Doppler velocimeter (LDV) are now recognized as the most reliable means for performing measurements in complex turbulent flows. And such, the experimental fluid dynamicist should be familiar with the principles of operation of the method and the details associated with its application. Thus, the goals of this primer are to efficiently transmit the basic concepts of the LDV method to potential users and to provide references that describe the specific areas in greater detail.

  1. AFLP genome scan in the black rat (Rattus rattus) from Madagascar: detecting genetic markers undergoing plague-mediated selection.

    PubMed

    Tollenaere, C; Duplantier, J-M; Rahalison, L; Ranjalahy, M; Brouat, C

    2011-03-01

    The black rat (Rattus rattus) is the main reservoir of plague (Yersinia pestis infection) in Madagascar's rural zones. Black rats are highly resistant to plague within the plague focus (central highland), whereas they are susceptible where the disease is absent (low altitude zone). To better understand plague wildlife circulation and host evolution in response to a highly virulent pathogen, we attempted to determine genetic markers associated with plague resistance in this species. To this purpose, we combined a population genomics approach and an association study, both performed on 249 AFLP markers, in Malagasy R. rattus. Simulated distributions of genetic differentiation were compared to observed data in four independent pairs, each consisting of one population from the plague focus and one from the plague-free zone. We found 22 loci (9% of 249) with higher differentiation in at least two independent population pairs or with combining P-values over the four pairs significant. Among the 22 outlier loci, 16 presented significant association with plague zone (plague focus vs. plague-free zone). Population genetic structure inferred from outlier loci was structured by plague zone, whereas the neutral loci dataset revealed structure by geography (eastern vs. western populations). A phenotype association study revealed that two of the 22 loci were significantly associated with differentiation between dying and surviving rats following experimental plague challenge. The 22 outlier loci identified in this study may undergo plague selective pressure either directly or more probably indirectly due to hitchhiking with selected loci.

  2. Limited-life cartridge primers

    DOEpatents

    Makowiecki, Daniel M.; Rosen, Robert S.

    2005-04-19

    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  3. Limited-life cartridge primers

    DOEpatents

    Makowiecki, D.M.; Rosen, R.S.

    1998-06-30

    A cartridge primer is described which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML`s would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers. 10 figs.

  4. Limited-life cartridge primers

    DOEpatents

    Makowiecki, Daniel M.; Rosen, Robert S.

    1998-01-01

    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  5. Multiplexed Primer Prediction for PCR

    SciTech Connect

    2007-07-23

    MPP predicts sets of multiplex-compatible primers for Polymerase Chain Reaction (PCR), finding a near minimal set of primers such that at least one amplicon will be generated from every target sequence in the input file. The code finds highly conserved oligos that are suitable as primers, according to user-specified desired primer characteristics such as length, melting temperature, and amplicon length. The primers are predicted not to form unwanted dimer or hairpin structures. The target sequences used as input can be diverse, since no multiple sequence alighment is required. The code is scalable, taking up to tens of thousands of sequences as input, and works, for example, to find a "universal primer set" for all viral genomes provided as a single input file. The code generates a periodic check-point file, thus in the event of premature execution termination, the application can be restarted from the last check-point file.

  6. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    USGS Publications Warehouse

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  7. A primer on water

    USGS Publications Warehouse

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  8. Metabolomics: A Primer.

    PubMed

    Liu, Xiaojing; Locasale, Jason W

    2017-04-01

    Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future.

  9. cDNA-AFLP-based numerical comparison of leaf and root organ cDNAs in Catharanthus roseus.

    PubMed

    Shukla, Ashutosh K; Shasany, Ajit K; Khanuja, Suman P S

    2012-01-01

    Comparative transcriptome study of the leaf and root tissues of Catharanthus roseus is a prerequisite for causing any favorable tissue-specific change in the secondary metabolism of this species. This study was aimed at comparative analysis of the leaf and root cDNAs in C. roseus, using a cDNA-AFLP approach. Using 64 primer combinations (EcoRI and MseI), a total of 784 distinct transcriptionally-defined fragments (TDFs) could be detected in the root and leaf tissue transcript populations. The leaf tissue yielded a larger number of TDFs than the root tissue (556 versus 464), indicating a greater variety of expressing genes in the leaf. The leaf-specific TDFs (320) outnumbered the root-specific TDFs (228), indicating a higher number of leaf-specific functions and the relative complexity of the leaf tissue vis-à-vis the root tissue. Among the 236 TDFs that were detected in both types of tissues, 42 had nearly equal expression levels in both the tissues (L=R). Common TDFs having higher expression levels in the leaf (L>R; 124) outnumbered those having higher expression levels in the root (L

  10. Differential gene expression for Curvularia eragrostidis pathogenic incidence in crabgrass (Digitaria sanguinalis) revealed by cDNA-AFLP analysis.

    PubMed

    Wang, Jianshu; Wang, Xuemin; Yuan, Bohua; Qiang, Sheng

    2013-01-01

    Gene expression profiles of Digitaria sanguinalis infected by Curvularia eragrostidis strain QZ-2000 at two concentrations of conidia and two dew durations were analyzed by cDNA amplified fragment length polymorphisms (cDNA-AFLP). Inoculum strength was more determinant of gene expression than dew duration. A total of 256 primer combinations were used for selective amplification and 1214 transcript-derived fragments (TDFs) were selected for their differential expression. Of these, 518 up-regulated differentially expressed TDFs were identified. Forty-six differential cDNA fragments were chosen to be cloned and 35 of them were successfully cloned and sequenced, of which 25 were homologous to genes of known function according to the GenBank database. Only 6 genes were up-regulated in Curvularia eragrostidis-inoculated D. sanguinalis, with functions involved in signal transduction, energy metabolism, cell growth and development, stress responses, abscisic acid biosynthesis and response. It appears that a few pathways may be important parts of the pathogenic strategy of C. eragrostidis strain QZ-2000 on D. sanguinalis. Our study provides the fundamentals to further study the pathogenic mechanism, screen for optimal C. eragrostidis strains as potential mycoherbicide and apply this product to control D. sanguinalis.

  11. AFLP analysis of genetic diversity of the endangered species Sinopodophyllum hexandrum in the Tibetan region of Sichuan Province, China.

    PubMed

    Xiao, Meng; Li, Qun; Guo, Liang; Luo, Tong; Duan, Wen-Xia; He, Wen-Xing; Wang, Li; Chen, Fang

    2006-02-01

    Amplified fragment length polymorphism (AFLP) markers were used to estimate the genetic diversity of seven wild populations of Sinopodophyllum hexandrum (Royle) Ying from the Tibetan region of Sichuan Province, China. Six primer combinations generated a total of 428 discernible DNA fragments, of which 111 were polymorphic. The percentage of polymorphic bands (PPB) was 25.93 at the species level, and PPB within population ranged from 4.91 to 12.38%. Genetic diversity (H(E)) within populations varied from 0.01 to 0.04, averaging 0.05 at the species level. As revealed by the results of AMOVA analysis, 58.8% of the genetic differentiation occurred between populations, and 41.2% within populations. The genetic differentiation was, perhaps, due to the limited gene flow (Nm = 0.43) of the species. The correlation coefficient (r) between genetic and geographical distance using Mantel's test for all populations was 0.698 (P = 0.014). The UPGMA cluster analysis revealed a similar result in that the genetic distances among the populations show, to a certain extent, a spatial pattern corresponding to their geographic locations. On the basis of the genetic and ecological information, we propose some appropriate strategies for conserving the endangered S. hexandrum in this region.

  12. Pick a Pair. Pancake Pairs

    ERIC Educational Resources Information Center

    Miller, Pat

    2005-01-01

    Cold February weather and pancakes are a traditional pairing. Pancake Day began as a way to eat up the foods that were abstained from in Lent--traditionally meat, fat, eggs and dairy products. The best-known pancake event is The Pancake Day Race in Buckinghamshire, England, which has been run since 1445. This column describes pairs of books that…

  13. MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR.

    PubMed

    Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

    2015-11-16

    Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR.

  14. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  15. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  16. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  17. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  18. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  19. An AFLP estimation of the outcrossing rate of Spondias tuberosa (Anacardiaceae), an endemic species to the Brazilian semiarid region.

    PubMed

    Fernandes Santos, Carlos Antonio; de Souza Gama, Renata Natália Cândido

    2013-06-01

    The umbu tree (Spondias tuberosa) is one of the most important endemic species to the Brazilian tropical semiarid region. The umbu tree has edible fruits with a peculiar flavor that are consumed in natura or in a semi-industrialized form, such as jams, candies and juices. The majority of endemic species to Brazilian semiarid region have not been studied or sampled to form germ-plasm collections, which increases the risk of losing genetic variability of the adapted species to xerophytic conditions. The aim of this study was to estimate outcrossing rates in S. tuberosa using a multilocus mixed model in order to guide genetic resources and breeding programs of this species. DNA samples were extracted from 92 progenies of umbu trees, which were distributed among 12 families. These trees were planted by seed in 1991 in Petrolina, PE, Brazil. The experimental design was a randomized block, with a total of 42 progenies sampled in three regions. The experimental units were composed by five plants and five replications. The outcrossing rate was estimated by the multilocus model, which is available in the MLTR software, and was based on 17 polymorphic AFLP bands obtained from AAA_CTG and AAA_CTC primer combinations. The observed heterozygotes ranged from 0.147 to 0.499, with a maximum frequency estimated for the AAA_CTC 10 amplicon. The multilocus outcrossing estimation (t(m)) was 0.804 +/- 0.072, while the single-locus (t(s)) was 0.841 +/- 0.079, which suggests that S. tuberosa is predominantly an outcrossing species. The difference between t(m) and t(s) was -0.037 +/- 0.029, which indicates that biparental inbreeding was nearly absent. The mean inbreeding coefficient or fixation index (F) among maternal plants was--0.103 +/- 0.045, and the expected F was 0.108, which indicates that there was no excess of heterozygotes in the maternal population. The outcrossing estimates obtained in the present study indicate that S. tuberosa is an open-pollinated species. Biometrical

  20. Improved COI barcoding primers for Southeast Asian perching birds (Aves: Passeriformes).

    PubMed

    Lohman, David J; Prawiradilaga, Dewi M; Meier, Rudolf

    2009-01-01

    The All Birds Barcoding Initiative aims to assemble a DNA barcode database for all bird species, but the 648-bp 'barcoding' region of cytochrome c oxidase subunit I (COI) can be difficult to amplify in Southeast Asian perching birds (Aves: Passeriformes). Using COI sequences from complete mitochondrial genomes, we designed a primer pair that more reliably amplifies and sequences the COI barcoding region of Southeast Asian passerine birds. The 655-bp region amplified with these primers overlaps the COI region amplified with other barcoding primer pairs, enabling direct comparison of sequences with previously published DNA barcodes.

  1. A new PCR method: one primer amplification of PCR-CTPP products.

    PubMed

    Yin, Guang; Mitsuda, Yoko; Ezaki, Takayuki; Hamajima, Nobuyuki

    2012-10-01

    Polymerase chain reaction with confronting two-pair primers (PCR-CTPP) is a convenient method for genotyping single nucleotide polymorphisms, saving time, and costs. It uses four primers for PCR; F1 and R1 for one allele, and F2 and R2 for the other allele, by which three different sizes of DNA are amplified; between F1 and R1, between F2 and R2, and between F1 and R2. To date, we have applied PCR-CTPP successfully for genotyping more than 60 polymorphisms. However, it is not rare that PCR does not produce balanced amplification of allele specific bands. Accordingly, the method was modified by attaching a common sequence at the 5' end of two-pair primers and adding another primer with the common sequence in PCR, in total five different primers in a tube for PCR. The modification allowed one primer amplification for the products of initial PCR with confronting two-pair primers, named as one primer amplification of PCR-CTPP products (OPA-CTPP). This article demonstrates an example for an A/G polymorphism of paraoxonase 1 (PON1) Gln192Arg (rs662). PCR-CTPP failed clear genotyping for the polymorphism, while OPA-CTPP successfully produced PCR products corresponding to the allele. The present example indicated that the OPA-CTPP would be useful in the case that PCR-CTPP failed to produce balanced PCR products specific to each allele.

  2. MRPrimerV: a database of PCR primers for RNA virus detection

    PubMed Central

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Kim, Doyun; Koo, JaeHyung; Kim, Min-Soo

    2017-01-01

    Many infectious diseases are caused by viral infections, and in particular by RNA viruses such as MERS, Ebola and Zika. To understand viral disease, detection and identification of these viruses are essential. Although PCR is widely used for rapid virus identification due to its low cost and high sensitivity and specificity, very few online database resources have compiled PCR primers for RNA viruses. To effectively detect viruses, the MRPrimerV database (http://MRPrimerV.com) contains 152 380 247 PCR primer pairs for detection of 1818 viruses, covering 7144 coding sequences (CDSs), representing 100% of the RNA viruses in the most up-to-date NCBI RefSeq database. Due to rigorous similarity testing against all human and viral sequences, every primer in MRPrimerV is highly target-specific. Because MRPrimerV ranks CDSs by the penalty scores of their best primer, users need only use the first primer pair for a single-phase PCR or the first two primer pairs for two-phase PCR. Moreover, MRPrimerV provides the list of genome neighbors that can be detected using each primer pair, covering 22 192 variants of 532 RefSeq RNA viruses. We believe that the public availability of MRPrimerV will facilitate viral metagenomics studies aimed at evaluating the variability of viruses, as well as other scientific tasks. PMID:27899620

  3. Express Primer Tool for high-throughput gene cloning and expression

    SciTech Connect

    2002-12-01

    A tool to assist in the design of primers for DNA amplification. The Express Primer web-based tool generates primer sequences specifically for the generation of expression clones for both lab scale and high-throughput projects. The application is designed not only to allow the user complete flexibility to specify primer design parameters but also to minimize the amount of manual intervention needed to generate a large number of primers for simultaneous amplification of multiple target genes. The Express Primer Tool enables the user to specify various experimental parameters (e.g. optimal Tm, Tm range, maximum Tm difference) for single or multiple candidate sequence(s) in FASTA format input as a flat text (ASCII) file. The application generates condidate primers, selects optimal primer pairs, and writes the forward and reverse primers pairs to an Excel file that is suitable for electronic submission to a synthesis facility. The program parameters emphasize high-throughput but allow for target atrition at various stages of the project.

  4. Assessing genetic diversity in a sugarcane germplasm collection using an automated AFLP analysis.

    PubMed

    Besse, P; Taylor, G; Carroll, B; Berding, N; Burner, D; McIntyre, C L

    1998-10-01

    An assessment of genetic diversity within and between Saccharum, Old World Erianthus sect. Ripidium, and North American E.giganteus (S.giganteum) was conducted using Amplified Fragment Length Polymorphism (AFLP(TM)) markers. An automated gel scoring system (GelCompar(TM)) was successfully used to analyse the complex AFLP patterns obtained in sugarcane and its relatives. Similarity coefficient calculations and clustering revealed a genetic structure for Saccharum and Erianthus sect. Ripidium that was identical to the one previously obtained using other molecular marker types, showing the appropriateness of AFLP markers and the associated automated analysis in assessing genetic diversity in sugarcane. A genetic structure that correlated with cytotype (2n=30, 60, 90) was revealed within the North American species, E. giganteus (S.giganteum). Complex relationships among Saccharum, Erianthus sect. Ripidium, and North American E.giganteus were revealed and are discussed in the light of a similar study which involved RAPD markers.

  5. Isolation, cloning and sequencing of AFLP markers related to disease-resistance traits in Fenneropenaeus chinensis

    NASA Astrophysics Data System (ADS)

    Yue, Zhiqin; Wang, Weiji; Kong, Jie; Dai, Jixun

    2005-12-01

    Amplified fragment length polymorphism (AFLP) technique was used to analyze the fingerprinting of four successive generations of Fenneropenaeus chinensis to reveal their disease-resistance traits. Some loci showed quite different genetic frequencies due to artificial selection, which implied that these fragments were putative markers related to the disease-resistance trait. We developed a simple and effective method to further characterize these AFLP fragments. Specific AFLP bands were cut directly from polyacrylamide gels, re-amplified, cloned and sequenced. Eight putative genetic markers were sequenced and their sizes ranged from 63 to 209 bp. The sequences were submitted to dbGSS (database of Genome Sequence Survey); and the BLAST analysis showed low similarity to the function genes, indicating these markers were tightly linked to a disease-resistance trait but were not functional genes.

  6. SNP Discovery by Illumina-Based Transcriptome Sequencing of the Olive and the Genetic Characterization of Turkish Olive Genotypes Revealed by AFLP, SSR and SNP Markers

    PubMed Central

    Kaya, Hilal Betul; Cetin, Oznur; Kaya, Hulya; Sahin, Mustafa; Sefer, Filiz; Kahraman, Abdullah; Tanyolac, Bahattin

    2013-01-01

    Background The olive tree (Olea europaea L.) is a diploid (2n = 2x = 46) outcrossing species mainly grown in the Mediterranean area, where it is the most important oil-producing crop. Because of its economic, cultural and ecological importance, various DNA markers have been used in the olive to characterize and elucidate homonyms, synonyms and unknown accessions. However, a comprehensive characterization and a full sequence of its transcriptome are unavailable, leading to the importance of an efficient large-scale single nucleotide polymorphism (SNP) discovery in olive. The objectives of this study were (1) to discover olive SNPs using next-generation sequencing and to identify SNP primers for cultivar identification and (2) to characterize 96 olive genotypes originating from different regions of Turkey. Methodology/Principal Findings Next-generation sequencing technology was used with five distinct olive genotypes and generated cDNA, producing 126,542,413 reads using an Illumina Genome Analyzer IIx. Following quality and size trimming, the high-quality reads were assembled into 22,052 contigs with an average length of 1,321 bases and 45 singletons. The SNPs were filtered and 2,987 high-quality putative SNP primers were identified. The assembled sequences and singletons were subjected to BLAST similarity searches and annotated with a Gene Ontology identifier. To identify the 96 olive genotypes, these SNP primers were applied to the genotypes in combination with amplified fragment length polymorphism (AFLP) and simple sequence repeats (SSR) markers. Conclusions/Significance This study marks the highest number of SNP markers discovered to date from olive genotypes using transcriptome sequencing. The developed SNP markers will provide a useful source for molecular genetic studies, such as genetic diversity and characterization, high density quantitative trait locus (QTL) analysis, association mapping and map-based gene cloning in the olive. High levels of

  7. A LISA Interferometry Primer

    NASA Technical Reports Server (NTRS)

    Thorpe, James Ira

    2010-01-01

    A key challenge for all gravitational wave detectors in the detection of changes in the fractional difference between pairs of test masses with sufficient precision to measure astrophysical strains with amplitudes on the order of approx.10(exp -21). ln the case of the five million km arms of LISA, this equates to distance measurements on the ten picometer level. LISA interferometry utilizes a decentralized topology, in which each of the sciencecraft houses its own light sources, detectors, and electronics. The measurements made at each of the sciencecraft are then telemetered to ground and combined to extract the strain experienced by the constellation as a whole. I will present an overview of LISA interferometry and highlight some of the key components and technologies that make it possible.

  8. A new image of plantain diversity assessed by SSR, AFLP and MSAP markers.

    PubMed

    Noyer, J L; Causse, S; Tomekpe, K; Bouet, A; Baurens, F C

    2005-05-01

    Using both SSR and AFLP markers, the genetic diversity of 30 plantains constituting a representative sample of the phenotypic diversity was assessed. The results confirmed a very narrow genetic base of this cultivar group. SSR and AFLP data support the hypothesis that these cultivars may have arisen from vegetative multiplication of a single seed. MSAP were used to survey cytosine methylation status at CCGG sites in order to obtain an alternative source of diversity data. A higher degree of polymorphism was revealed allowing the classification of the samples into three clusters. No correlation was observed between the phenotypic classification and methylation diversity. Implications for breeding programs are discussed.

  9. New cyt b gene universal primer set for forensic analysis.

    PubMed

    Lopez-Oceja, A; Gamarra, D; Borragan, S; Jiménez-Moreno, S; de Pancorbo, M M

    2016-07-01

    Analysis of mitochondrial DNA, and in particular the cytochrome b gene (cyt b), has become an essential tool for species identification in routine forensic practice. In cases of degraded samples, where the DNA is fractionated, universal primers that are highly efficient for the amplification of the target region are necessary. Therefore, in the present study a new universal cyt b primer set with high species identification capabilities, even in samples with highly degraded DNA, has been developed. In order to achieve this objective, the primers were designed following the alignment of complete sequences of the cyt b from 751 species from the Class of Mammalia listed in GenBank. A highly variable region of 148bp flanked by highly conserved sequences was chosen for placing the primers. The effectiveness of the new pair of primers was examined in 63 animal species belonging to 38 Families from 14 Orders and 5 Classes (Mammalia, Aves, Reptilia, Actinopterygii, and Malacostraca). Species determination was possible in all cases, which shows that the fragment analyzed provided a high capability for species identification. Furthermore, to ensure the efficiency of the 148bp fragment, the intraspecific variability was analyzed by calculating the concordance between individuals with the BLAST tool from the NCBI (National Center for Biotechnological Information). The intraspecific concordance levels were superior to 97% in all species. Likewise, the phylogenetic information from the selected fragment was confirmed by obtaining the phylogenetic tree from the sequences of the species analyzed. Evidence of the high power of phylogenetic discrimination of the analyzed fragment of the cyt b was obtained, as 93.75% of the species were grouped within their corresponding Orders. Finally, the analysis of 40 degraded samples with small-size DNA fragments showed that the new pair of primers permits identifying the species, even when the DNA is highly degraded as it is very common in

  10. [Screening of peafowl microsatellite primers and analysis of genetic diversity].

    PubMed

    Bao, Wen-Bin; Chen, Guo-Hong; Shu, Jing-Ting; Xu, Qi; Li, Hui-Fang

    2006-10-01

    The applicability of chicken microsatellite primers to peafowl population was analyzed in the present paper, and the results showed 14 of 29 pairs of microsatellite primers from chicken could amplify peafowl DNA and produce specific allele patterns. A mean of 1.71 alleles was found for each locus. Seven pairs were highly polymorphic, and MCW0080 and MCW0098 were ideal markers for peafowl. Genetic diversity analysis within and between the green peafowl and the blue peafowl populations demonstrated that the expected heterozygosity of two peafowl populations were 0.2482 and 0.2744, respectively. The inbreeding index (FST), Reynolds' genetic distance and gene flow between the two populations were 0.078, 0.0603 and 3.896 respectively. These results indicate that the heterozygosity and the genetic diversity of these two peafowl populations were very low, and suggest a tendency towards intermixing.

  11. PCR Primers for Metazoan Mitochondrial 12S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Kweskin, Matthew; Knowlton, Nancy

    2012-01-01

    Background Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. Methodology/Principal Findings A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These regions were used to design a primer pair that flanks a more variable region in the gene. Then all of the complete metazoan mitochondrial genomes available in NCBI's Organelle Genome Resources database were used to determine the percentage of taxa that would likely be amplified using these primers. Results suggest that these primers will amplify target sequences for many metazoans. Conclusions/Significance Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis because of their ability to amplify sequences from many metazoans. PMID:22536450

  12. Primer design for PCR reactions in forensic biology.

    PubMed

    Elkins, Kelly M

    2015-01-01

    The polymerase chain reaction (PCR) is a popular method to copy DNA in vitro. Its invention revolutionized fields ranging from clinical medicine to anthropology, molecular biology, and forensic biology. The method employs one of many available heat-stable DNA polymerases in a reaction that is repeated many times in situ. The DNA polymerase reads a template DNA strand and using the components of the reaction mix, catalyzes the addition of free 2'-deoxynucleotide triphosphate nitrogenous bases to short segment of DNA that forms a complement with the template via Watson-Crick base pairing. This short segment of DNA is referred to as a PCR primer and it is essential to the success of the reaction. The most widely used application of PCR in forensic labs is the amplification of short tandem repeat (STR) loci used in DNA typing. The STRs are routinely evaluated in concert with 16 or more reactions, a multiplex, run in one test tube simultaneously. In a multiplex, it is essential that the primers work specifically and accurately on the intended reactions without hindering the other reactions. The primers, which are very specific, also can be used to probe single nucleotide polymorphisms (SNPs) in a DNA sequence of interest by single base extension. Primers are often designed using one of many available automated software packages. Here the process of manually designing PCR primers for forensic biology using no-cost software is described.

  13. Genetic diversity of sweet sorghum germplasm in Mexico using AFLP and SSR markers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The objective of this work was to evaluate the diversity and genetic relationships between lines and varieties of the sweet sorghum (Sorghum bicolor) germplasm bank of the National Institute for Forestry, Agriculture and Livestock Research, Mexico, using AFLP and SSR markers. The molecular markers ...

  14. An AFLP-based procedure for the efficient mapping of mutations and DNA probes in barley.

    PubMed Central

    Castiglioni, P; Pozzi, C; Heun, M; Terzi, V; Müller, K J; Rohde, W; Salamini, F

    1998-01-01

    A strategy based upon AFLP markers for high-efficiency mapping of morphological mutations and DNA probes to linkage groups in barley is presented. First, 511 AFLP markers were placed on the linkage map derived from the cross Proctor x Nudinka. Second, loci controlling phenotypic traits were assigned to linkage groups by AFLP analysis, using F2 populations consisting of 30-50 mutant plants derived from crosses of the type "mutant x Proctor" and "mutant x Nudinka." To map DNA probes, 67 different wild-type barley lines were selected to generate F2 populations by crossing with Proctor and Nudinka. F2 plants that were polymorphic for a given RFLP fragment were classified into genotypic classes. Linkage of the RFLP polymorphism to 1 of the 511 AFLP loci was indicated by cosegregation. The use of the strategy is exemplified by the mapping of the mutation branched-5 to chromosome 2 and of the DNA probes Bkn2 and BM-7 to chromosomes 5 and 1, respectively. Map expansion and marker order in map regions with dense clustering of markers represented a particular problem. A discussion considering the effect of noncanonical recombinant products on these two parameters is provided. PMID:9691056

  15. Developing AFLP Markers to study genetic differentiation of the Cotton Fleahopper, Pseudatomoscelis seriatus (Reuter) (Hemiptera: Miridae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genetic comparisons of fleahopper populations in cotton and weed hosts may be useful for identifying the weed sources contributing the majority of fleahoppers in cotton. Molecular markers such as amplified fragment length polymorphisms (AFLP) are useful to identify genetic similarities and differen...

  16. Relationship of European Persimmon (Diospyros kaki Thunb.) Cultivars to Asian Cultivars, Characterized Using AFLPs.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Sixty one persimmon (Diospyros kaki Thunb.) selections, including 17 Italian, 11 Spanish, 13 Japanese, six Korean, five Chinese, one Israeli, and eight of unknown origin, were evaluated for genetic differences by AFLP analysis. Relationships among cultivars were evaluated by UPGMA clustering, Neigh...

  17. Genetic Likage Map for Hydrangea macrophylla Using SSR and AFLP Markers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We used a two-way pseudo-testcross mapping strategy in combination with simple sequence repeat (SSR) and Amplified Fragment Length Polymorphism (AFLP) markers to construct a genetic map of Hydrangea macrophylla. Map was generated using JoinMap 4.0 software, with a minimum LOD of 3.0 and a maximum r...

  18. Bootsie: estimation of coefficient of variation of AFLP data by bootstrap analysis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Bootsie is an English-native replacement for ASG Coelho’s “DBOOT” utility for estimating coefficient of variation of a population of AFLP marker data using bootstrapping. Bootsie improves on DBOOT by supporting batch processing, time-to-completion estimation, built-in graphs, and a suite of export t...

  19. A search for diagnostic AFLP markers in Cichorium species with emphasis on endive and chicory cultivar groups.

    PubMed

    Kiers, A M; Mes, T H; van der Meijden, R; Bachmann, K

    2000-06-01

    The genus Cichorium consists of two widely cultivated species C. intybus (chicory) and C. endivia (endive) and four wild species, C. bottae, C. spinosum, C. calvum, and C. pumilum. A multivariate and an UPGMA (unweighted pair group method average) analysis based on AFLP (amplified fragment length polymorphism) markers were used to establish the genetic relationships among the species and cultivar groups of C. intybus and C. endivia. At the species level, the results correspond with previously obtained phylogenetic relationships in that C. bottae is the most divergent species, and C. intybus and C. spinosum, as well as C. endivia, C. pumilum, and C. calvum formed clusters. Based on the congruence between phylogenetic and genetic analyses, unique markers were expected for all species, however, hardly any specific marker was found except for C. bottae. The analysis of cultivar groups of C. intybus resembled the species analysis in two respects: (i) grouping of cultivars according to cultivar groups, and (ii) lack of markers unique to cultivar groups. In contrast to C. intybus, the cultivar series of C. endivia do not form distinct groups, which would reflect that crosses have been made among the various cultivar groups. The relationships among Cichorium species and cultivars will be useful for setting up a core collection of Cichorium, and stress the importance of inclusion of the wild species in the collection.

  20. Design and evaluation of primers targeting genes encoding NO-forming nitrite reductases: implications for ecological inference of denitrifying communities

    PubMed Central

    Bonilla-Rosso, Germán; Wittorf, Lea; Jones, Christopher M.; Hallin, Sara

    2016-01-01

    The detection of NO-forming nitrite reductase genes (nir) has become the standard when studying denitrifying communities in the environment, despite well-known amplification biases in available primers. We review the performance of 35 published and 121 newly designed primers targeting the nirS and nirK genes, against sequences from complete genomes and 47 metagenomes from three major habitats where denitrification is important. There were no optimal universal primer pairs for either gene, although published primers targeting nirS displayed up to 75% coverage. The alternative is clade-specific primers, which show a trade-off between coverage and specificity. The test against metagenomic datasets showed a distinct performance of primers across habitats. The implications of clade-specific nir primers choice and their performance for ecological inference when used for quantitative estimates and in sequenced-based community ecology studies are discussed and our phylogenomic primer evaluation can be used as a reference along with their environmental specificity as a guide for primer selection. Based on our results, we also propose a general framework for primer evaluation that emphasizes the testing of coverage and phylogenetic range using full-length sequences from complete genomes, as well as accounting for environmental range using metagenomes. This framework serves as a guideline to simplify primer performance comparisons while explicitly addressing the limitations and biases of the primers evaluated. PMID:27966627

  1. Charter School Primer. Peter Lang Primer. Volume 34

    ERIC Educational Resources Information Center

    Tryjankowski, Anne Marie

    2012-01-01

    The "Charter School Primer" presents an overview of public charter schools in the United States. The book discusses what charter schools are; the history of public charter school choice in the United States; the role of teachers, parents, boards, and unions in the charter school movement; and gives examples of innovations in education made…

  2. Vygotsky on Education Primer. Peter Lang Primer. Volume 30

    ERIC Educational Resources Information Center

    Lake, Robert

    2012-01-01

    The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…

  3. Taxon-specific oligonucleotide primers for detection of two ancient endomycorrhizal fungi, Glomus occultum and Glomus brasilianum.

    PubMed

    Millner, P D; Mulbry, W W; Reynolds, S L

    2001-03-15

    A unique oligonucleotide pair, GOCC56:GOCC427, was designed that correctly primed specific amplification of a approximately 370-bp sequence spanning the ITS and 5.8S rDNA regions of Glomus occultum and Glomus brasilianum. In addition, this primer pair successfully detected G. occultum and G. brasilianum DNA in nested PCR using a primary PCR product amplified from highly diluted extracts of colonized corn (Zea mays) roots using modified ITS1:ITS4 primers. A second primer pair, GBRAS86:GBRAS388, primed specific amplification of a approximately 200-bp sequence spanning the ITS and 5.8S rDNA regions present only in G. brasilianum and Glomus strain GR582. Combined use of both primer pairs provides the means to detect and differentiate two ancient endomycorrhizal species, G. occultum and G. brasilianum, undetectable by standard root staining procedures. Sequence analysis showed that the purported G. occultum strain GR582 is likely a strain of G. brasilianum.

  4. A Primer on Multilevel Modeling

    ERIC Educational Resources Information Center

    Hayes, Andrew F.

    2006-01-01

    Multilevel modeling (MLM) is growing in use throughout the social sciences. Although daunting from a mathematical perspective, MLM is relatively easy to employ once some basic concepts are understood. In this article, I present a primer on MLM, describing some of these principles and applying them to the analysis of a multilevel data set on…

  5. A Hearing Aid Primer 1

    ERIC Educational Resources Information Center

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  6. Primer vector theory and applications

    NASA Technical Reports Server (NTRS)

    Jezewski, D. J.

    1975-01-01

    A method developed to compute two-body, optimal, N-impulse trajectories was presented. The necessary conditions established define the gradient structure of the primer vector and its derivative for any set of boundary conditions and any number of impulses. Inequality constraints, a conjugate gradient iterator technique, and the use of a penalty function were also discussed.

  7. Postsecondary Data Connections: A Primer

    ERIC Educational Resources Information Center

    Data Quality Campaign, 2011

    2011-01-01

    There is an increasing focus at the state and federal levels on linking data across the P-20/Workforce spectrum to help inform policies and practices. This primer is intended to provide policymakers with: (1) An overview of the status of states vis-a-vis the linking of postsecondary data to K-12 and workforce data; (2) A subset of questions…

  8. Freshwater Wetlands: A Citizen's Primer.

    ERIC Educational Resources Information Center

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  9. Straight Talk: A Communication Primer.

    ERIC Educational Resources Information Center

    Maidment, Robert

    Using typical statements made by teachers and school administrators as examples, this self-help primer offers tips for developing conversational patterns that promote interpersonal understanding. The tips are designed to help readers learn about 40 effective conversational habits, including being specific, talking sparingly, admitting mistakes,…

  10. Alternative Teacher Compensation: A Primer

    ERIC Educational Resources Information Center

    Koppich, Julia E.; Rigby, Jessica

    2009-01-01

    This policy primer is designed to provide base-line information about new forms of teacher pay that are emerging around the country, to support the local conversations and negotiations that will lead to the development of innovative compensation systems. It identifies reasons why teacher compensation is high on local, state, and federal policy…

  11. Status of NC Primer Demonstration & Transition

    DTIC Science & Technology

    2014-11-20

    Primer Demos: Gloss Paint Scheme 4 Demonstration COMPLETE BUNO Induction Date Non- Chrome Primer Date Delivery Date Carrier Deployments...Includes T-6, T-34, T-44, T-45* NC Primer Demos: Gloss Paint Scheme 6 P-3C Demonstration is on-going… • PPG-Deft 02-GN-084 demonstrated over CCC on OML...Only one P-3C demonstrating NC Primer, A/C # 510  Primed Sept. 15, 2011 NC Primer Demos: Gloss Paint Scheme 7 NC Primer Demos: Gloss Paint

  12. PCR primers for 30 novel gene regions in the nuclear genomes of Lepidoptera.

    PubMed

    Wahlberg, Niklas; Peña, Carlos; Ahola, Milla; Wheat, Christopher W; Rota, Jadranka

    2016-01-01

    We report primer pairs for 30 new gene regions in the nuclear genomes of Lepidoptera that can be amplified using a standard PCR protocol. The new primers were tested across diverse Lepidoptera, including nonditrysians and a wide selection of ditrysians. These new gene regions give a total of 11,043 bp of DNA sequence data and they show similar variability to traditionally used nuclear gene regions in studies of Lepidoptera. We feel that a PCR-based approach still has its place in molecular systematic studies of Lepidoptera, particularly at the intrafamilial level, and our new set of primers now provides a route to generating phylogenomic datasets using traditional methods.

  13. Streamlining DNA Barcoding Protocols: Automated DNA Extraction and a New cox1 Primer in Arachnid Systematics

    PubMed Central

    Vidergar, Nina; Toplak, Nataša; Kuntner, Matjaž

    2014-01-01

    Background DNA barcoding is a popular tool in taxonomic and phylogenetic studies, but for most animal lineages protocols for obtaining the barcoding sequences—mitochondrial cytochrome C oxidase subunit I (cox1 AKA CO1)—are not standardized. Our aim was to explore an optimal strategy for arachnids, focusing on the species-richest lineage, spiders by (1) improving an automated DNA extraction protocol, (2) testing the performance of commonly used primer combinations, and (3) developing a new cox1 primer suitable for more efficient alignment and phylogenetic analyses. Methodology We used exemplars of 15 species from all major spider clades, processed a range of spider tissues of varying size and quality, optimized genomic DNA extraction using the MagMAX Express magnetic particle processor—an automated high throughput DNA extraction system—and tested cox1 amplification protocols emphasizing the standard barcoding region using ten routinely employed primer pairs. Results The best results were obtained with the commonly used Folmer primers (LCO1490/HCO2198) that capture the standard barcode region, and with the C1-J-2183/C1-N-2776 primer pair that amplifies its extension. However, C1-J-2183 is designed too close to HCO2198 for well-interpreted, continuous sequence data, and in practice the resulting sequences from the two primer pairs rarely overlap. We therefore designed a new forward primer C1-J-2123 60 base pairs upstream of the C1-J-2183 binding site. The success rate of this new primer (93%) matched that of C1-J-2183. Conclusions The use of C1-J-2123 allows full, indel-free overlap of sequences obtained with the standard Folmer primers and with C1-J-2123 primer pair. Our preliminary tests suggest that in addition to spiders, C1-J-2123 will also perform in other arachnids and several other invertebrates. We provide optimal PCR protocols for these primer sets, and recommend using them for systematic efforts beyond DNA barcoding. PMID:25415202

  14. Detection of summer truffle (Tuber aestivum Vittad.) in ectomycorrhizae and in soil using specific primers.

    PubMed

    Gryndler, Milan; Hršelová, Hana; Soukupová, Lucie; Streiblová, Eva; Valda, Slavomír; Borovička, Jan; Gryndlerová, Hana; Gažo, Ján; Miko, Marián

    2011-05-01

    Tuber aestivum is becoming an important commodity of great economical value in some European countries. At the same time, it is a highly protected organism in other countries, where it needs careful treatment. A reliable method of detection in roots and soil is thus needed for assessment of geographic distribution, ecological studies and inoculation efficiency testing in man-made experiments. A PCR-based method of detection of T. aestivum using specific primers was therefore developed. A pair of PCR primers Tu1sekvF/Tu2sekvR selective for T. aestivum and some genotypes of Tuber mesentericum was designed on the basis of the known internal transcribed spacer T. aestivum sequences. TaiI restriction cleavage was then used to distinguish the two species. The selectivity of the designed primer pair was evaluated using DNA extracted from specimens of a further 13 Tuber spp. Subsequently, the selectivity and robustness to false-positive results with nontarget DNA of the designed primers was compared with two other primer pairs (UncI/UncII and BTAE-F/BTAEMB-R). The occurrence of T. aestivum in soil and ectomycorrhizae collected in its native habitat has been successfully detected using the designed primers and nested PCR. The method is reliable and thus suitable for detection of T. aestivum in the field.

  15. Design and evaluation of universal 16S rRNA gene primers for high-throughput sequencing to simultaneously detect DAMO microbes and anammox bacteria.

    PubMed

    Lu, Yong-Ze; Ding, Zhao-Wei; Ding, Jing; Fu, Liang; Zeng, Raymond J

    2015-12-15

    To develop universal 16S rRNA gene primers for high-throughput sequencing for the simultaneous detection of denitrifying anaerobic methane oxidation (DAMO) archaea, DAMO bacteria, and anaerobic ammonium oxidation (anammox) bacteria, four published primer sets (PS2-PS5) were modified. The overall coverage of the four primer pairs was evaluated in silico with the Silva SSU r119 dataset. Based on the virtual evaluation, the two best primer pairs (PS4 and PS5) were selected for further verification. Illumina MiSeq sequencing of a freshwater sediment and a culture from a DAMO-anammox reactor using these two primer pairs revealed that PS5 (341b4F-806R) was the most promising universal primer pair. This pair of primers detected both archaea and bacteria with less bias than PS4. Furthermore, an anaerobic fermentation culture and a wastewater treatment plant culture were used to verify the accuracy of PS5. More importantly, it detected DAMO archaea, DAMO bacteria, and anammox bacteria simultaneously with no false positives appeared. This universal 16S rRNA gene primer pair extends the existing molecular tools for studying the community structures and distributions of DAMO microbes and their potential interactions with anammox bacteria in different environments.

  16. Amplification of soil fungal community DNA using the ITS86F and ITS4 primers.

    PubMed

    Vancov, Tony; Keen, Brad

    2009-07-01

    Internal transcribed spacer (ITS) 86F and ITS4 and the ITS1-F and ITS86R primer pairs were tested to specifically amplify fungal community DNA extracted from soil. Libraries were constructed from PCR-amplified fragments, sequenced and compared against sequences deposited in GenBank. The results confirmed that the ITS86F and ITS4 primer pair was selectively specific for the Ascomycetes, Basidiomycetes and Zygomycetes fungal clades. Amplified products generated by the ITS1F and ITS86R primer pair also aligned with sequences from a range of species within the Ascomycete and Basidiomycete clades but not from the Zygomycete. Both primer sets demonstrated fungal specificity and appear to be well suited for rapid PCR-based (fingerprinting) analysis of environmental fungal community DNA. This is the first reported use and assessment of the ITS86F and ITS4 and the ITS1-F and ITS86R primer pairs in amplifying fungal community DNA from soil.

  17. Development of SCAR Primers for PCR Assay to Detect Diplodia seriata

    PubMed Central

    Martín, M. T.; Cuesta, M. J.; Martín, L.

    2014-01-01

    The aim of this study was to develop primer pairs for Diplodia seriata identification, one of the most common fungal species associated with grapevine decline in Castilla y León (Spain). Genetic variability of selected isolates of D. seriata was estimated. A molecular marker was generated from a random amplified polymorphic DNA (RAPD) fragment. PCR products of around 1200 bp were obtained with OPE20 primer. The PCR products were cloned and sequenced. The sequences were compared and a fragment of 1207 bp was used to design primer pairs. Two primer pairs were selected (DS3.8 S3-DS3.8 R6 and DS3.8 S3-DS3.8 R4) that amplified a single DNA product of 634 bp and 233 bp, respectively, with D. seriata isolates. No amplification was obtained for any of the 57 isolates of other species. The designed SCAR primer pairs allowed a rapid detection of D. seriata, and were able to detect 0.1 pg of the target DNA. Detection was specific and sensitive for D. seriata. The established protocols detected these fungi in naturally infected grapevines after DNA purification. Diplodia seriata was detectable without DNA purification and isolation in 62.5% to 75% of reactions. The detection of this pathogen in wood samples has great potential for use in pathogen-free certification schemes. PMID:27437468

  18. A simple DNA extraction method for marijuana samples used in amplified fragment length polymorphism (AFLP) analysis.

    PubMed

    Miller Coyle, Heather; Shutler, Gary; Abrams, Sharon; Hanniman, Janet; Neylon, Suzanne; Ladd, Carll; Palmbach, Timothy; Lee, Henry C

    2003-03-01

    As a first step in developing a molecular method for the individualization of marijuana samples, we evaluated a plant DNA extraction kit. The QIAGEN plant DNeasy method uses a spin column format for recovery of DNA and is effective for obtaining high molecular weight DNA from leaf, flower (bud), and seed samples of marijuana. The average DNA yield was 125-500 ng per 100 milligrams of fresh plant tissue. The recovered DNA was of polymerase chain reaction (PCR) quality as measured by the ability to generate reproducible amplified fragment length polymorphism (AFLP) profiles. AFLP is a technique used to create a DNA profile for plant varieties and is being applied to marijuana samples by the authors to link growers and distributors of clonal material. The QIAGEN plant DNeasy method was simple, efficient, and reproducible for processing small quantities of marijuana into DNA.

  19. Novel computational methods for increasing PCR primer design effectiveness in directed sequencing

    PubMed Central

    Li, Kelvin; Brownley, Anushka; Stockwell, Timothy B; Beeson, Karen; McIntosh, Tina C; Busam, Dana; Ferriera, Steve; Murphy, Sean; Levy, Samuel

    2008-01-01

    Background Polymerase chain reaction (PCR) is used in directed sequencing for the discovery of novel polymorphisms. As the first step in PCR directed sequencing, effective PCR primer design is crucial for obtaining high-quality sequence data for target regions. Since current computational primer design tools are not fully tuned with stable underlying laboratory protocols, researchers may still be forced to iteratively optimize protocols for failed amplifications after the primers have been ordered. Furthermore, potentially identifiable factors which contribute to PCR failures have yet to be elucidated. This inefficient approach to primer design is further intensified in a high-throughput laboratory, where hundreds of genes may be targeted in one experiment. Results We have developed a fully integrated computational PCR primer design pipeline that plays a key role in our high-throughput directed sequencing pipeline. Investigators may specify target regions defined through a rich set of descriptors, such as Ensembl accessions and arbitrary genomic coordinates. Primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the specified target regions. As part of the tiling process, primer pairs are computationally screened to meet the criteria for success with one of two PCR amplification protocols. In the process of improving our sequencing success rate, which currently exceeds 95% for exons, we have discovered novel and accurate computational methods capable of identifying primers that may lead to PCR failures. We reveal the laboratory protocols and their associated, empirically determined computational parameters, as well as describe the novel computational methods which may benefit others in future primer design research. Conclusion The high-throughput PCR primer design pipeline has been very successful in providing the basis for high-quality directed sequencing results and for minimizing costs associated with labor and

  20. HIV lipodystrophy syndrome: a primer.

    PubMed

    Robinson, F Patrick

    2004-01-01

    Treatment with highly active antiretroviral therapy (HAART) has been implicated in the development of anthropomorphic and metabolic abnormalities termed HIV lipodystrophy syndrome (or LDS). This primer offers a comprehensive overview of LDS including epidemiology, hypothesized etiologies, and clinical consequences. The evidence-based literature is reviewed for current treatment strategies including discontinuation of specific antiretrovirals, pharmacological management of dyslipidemia and insulin resistance, exercise training, facial augmentation, liposuction, and hormonal therapy. Patient education, counseling, and adherence are discussed.

  1. Design and evaluation of PCR primers for denaturing gradient gel electrophoresis analysis of plant parasitic and fungivorous nematode communities.

    PubMed

    Kushida, Atsuhiko

    2013-01-01

    A PCR-DGGE primer pair, Tyl2F-Tyl4R, specific to plant parasitic and fungivorous nematodes was designed based on the 18S rRNA gene. The results of community analysis using the primers showed that they are specific to the order Tylenchida. This primer pair detected species belonging to Tylenchida with high sensitivity and high resolution. The number of detected species of plant parasitic and fungivorous nematodes and their band intensity were much improved compared with PCR-DGGE analysis using the SSU18A-SSU9R primer, which is commonly used for nematode community analysis. It was confirmed that using a group-specific primer was effective for nematode community analysis with PCR-DGGE.

  2. Using Primers to Motivate Your Students

    ERIC Educational Resources Information Center

    Graff, Dan

    2002-01-01

    Primers are used to motivate and uplift your class. They come in many different styles and can be used in a variety of ways. Making primers relevant to students helps them to learn and makes them feel appreciated and knowledgeable when they participate. Using primers in the classroom to make students feel valued brings much success.

  3. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Primer protection. 57.6304 Section 57.6304... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters)...

  4. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Primer protection. 57.6304 Section 57.6304... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters)...

  5. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  6. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  7. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  8. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  9. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters)...

  10. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Primer protection. 57.6304 Section 57.6304... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters)...

  11. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  12. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Primer protection. 57.6304 Section 57.6304... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters)...

  13. Environmental Acceptable Medium Caliber Ammunition Percussion Primers

    DTIC Science & Technology

    2008-05-01

    percussion primers typically consist of lead styphnate and antimony sulfide. Although highly effective, these heavy material compounds were identified under...Percussion primers, including those used in medium caliber ammunition, typically contain lead styphnate and antimony sulfide along with other constituents...Furthermore, current percussion primer compositions also contain barium nitrate. Although not negatively categorized by the Environmental Protection

  14. Increased inbreeding and strong kinship structure in Taxus baccata estimated from both AFLP and SSR data.

    PubMed

    Chybicki, I J; Oleksa, A; Burczyk, J

    2011-12-01

    Habitat fragmentation can have severe genetic consequences for trees, such as increased inbreeding and decreased effective population size. In effect, local populations suffer from reduction of genetic variation, and thus loss of adaptive capacity, which consequently increases their risk of extinction. In Europe, Taxus baccata is among a number of tree species experiencing strong habitat fragmentation. However, there is little empirical data on the population genetic consequences of fragmentation for this species. This study aimed to characterize local genetic structure in two natural remnants of English yew in Poland based on both amplified fragment length polymorphism (AFLP) and microsatellite (SSR) markers. We introduced a Bayesian approach that estimates the average inbreeding coefficient using AFLP (dominant) markers. Results showed that, in spite of high dispersal potential (bird-mediated seed dispersal and wind-mediated pollen dispersal), English yew populations show strong kinship structure, with a spatial extent of 50-100 m, depending on the population. The estimated inbreeding levels ranged from 0.016 to 0.063, depending on the population and marker used. Several patterns were evident: (1) AFLP markers showed stronger kinship structure than SSRs; (2) AFLP markers provided higher inbreeding estimates than SSRs; and (3) kinship structure and inbreeding were more pronounced in denser populations regardless of the marker used. Our results suggest that, because both kinship structure and (bi-parental) inbreeding exist in populations of English yew, gene dispersal can be fairly limited in this species. Furthermore, at a local scale, gene dispersal intensity can be more limited in a dense population.

  15. Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.

    PubMed

    Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S

    2015-06-01

    Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed.

  16. Pairing Learners in Pair Work Activity

    ERIC Educational Resources Information Center

    Storch, Neomy; Aldosari, Ali

    2013-01-01

    Although pair work is advocated by major theories of second language (L2) learning and research findings suggest that pair work facilitates L2 learning, what is unclear is how to best pair students in L2 classes of mixed L2 proficiency. This study investigated the nature of pair work in an English as a Foreign Language (EFL) class in a college in…

  17. Influence of parameter settings in automated scoring of AFLPs on population genetic analysis.

    PubMed

    Herrmann, Marc; Holderegger, Rolf; Van Strien, Maarten J

    2013-01-01

    The use of procedures for the automated scoring of amplified fragment length polymorphisms (AFLP) fragments has recently increased. Corresponding software does not only automatically score the presence or absence of AFLP fragments, but also allows an evaluation of how different settings of scoring parameters influence subsequent population genetic analyses. In this study, we used the automated scoring package rawgeno to evaluate how five scoring parameters influence the number of polymorphic bins and estimates of pairwise genetic differentiation between populations (F(st)). Steps were implemented in r to automatically run the scoring process in rawgeno for a set of different parameter combinations. While we found the scoring parameters minimum bin width and minimum number of samples per bin to have only weak influence on pairwise F(st) values, maximum bin width and bin reproducibility had much stronger effects. The minimum average bin fluorescence scoring parameter affected F(st) values in an only moderate way. At a range of scoring parameters around the default settings of rawgeno, the number of polymorphic bins as well as pairwise F(st) values stayed rather constant. This study thus shows the particularities of AFLP scoring, be it either manual or automatical, can have profound effects on subsequent population genetic analysis.

  18. Sequence homology of polymorphic AFLP markers in garlic (Allium sativum L.).

    PubMed

    Ipek, Meryem; Ipek, Ahmet; Simon, Philipp W

    2006-10-01

    Linkage mapping and genetic diversity studies with DNA markers in plant species assume that comigrating bands are identical, or at least that they have homologous sequences. To test this assumption in a plant with a large genome, sequence identities of 7 polymorphic amplified fragment length polymorphism (AFLP) markers of garlic, previously used to estimate similarity in genetic diversity studies, were characterized. Among 37 diverse garlic clones, 87 bands from these 7 polymorphisms were excised, amplicons were cloned, and 2 to 6 colonies were sequenced from each band, to yield a total of 191 DNA amplicons. Of these 87 bands, 83 bands (95.4%) contained AFLP amplicons that were identical or highly homologous to the typical marker of that band; only 4 bands contained amplicons with little homology to the same-sized amplicons of other garlic clones. Of these 83 bands, 64 (73.6%) contained only highly homologous amplicons (>90% sequence identity), whereas 19 (21.8%) contained both homologous and nonhomologous amplicons, with sequence identities less than 60%. Of the 37 nonhomologous amplicons identified, 25 (67.5%) differed in length from other amplicons in the band. Sequence conservation of AFLP amplicons followed patterns similar to phylogenetic relationships among garlic clones, making them useful for developing simple PCR-based markers in genetic mapping and diversity assessment.

  19. AFLPs and Mitochondrial Haplotypes Reveal Local Adaptation to Extreme Thermal Environments in a Freshwater Gastropod

    PubMed Central

    Quintela, María; Johansson, Magnus P.; Kristjánsson, Bjarni K.; Barreiro, Rodolfo; Laurila, Anssi

    2014-01-01

    The way environmental variation shapes neutral and adaptive genetic variation in natural populations is a key issue in evolutionary biology. Genome scans allow the identification of the genetic basis of local adaptation without previous knowledge of genetic variation or traits under selection. Candidate loci for divergent adaptation are expected to show higher FST than neutral loci influenced solely by random genetic drift, migration and mutation. The comparison of spatial patterns of neutral markers and loci under selection may help disentangle the effects of gene flow, genetic drift and selection among populations living in contrasting environments. Using the gastropod Radix balthica as a system, we analyzed 376 AFLP markers and 25 mtDNA COI haplotypes for candidate loci and associations with local adaptation among contrasting thermal environments in Lake Mývatn, a volcanic lake in northern Iceland. We found that 2% of the analysed AFLP markers were under directional selection and 12% of the mitochondrial haplotypes correlated with differing thermal habitats. The genetic networks were concordant for AFLP markers and mitochondrial haplotypes, depicting distinct topologies at neutral and candidate loci. Neutral topologies were characterized by intense gene flow revealed by dense nets with edges connecting contrasting thermal habitats, whereas the connections at candidate loci were mostly restricted to populations within each thermal habitat and the number of edges decreased with temperature. Our results suggest microgeographic adaptation within Lake Mývatn and highlight the utility of genome scans in detecting adaptive divergence. PMID:25007329

  20. Genetic variability of Brazilian isolates of Alternaria alternata detected by AFLP and RAPD techniques

    PubMed Central

    Dini-Andreote, Francisco; Pietrobon, Vivian Cristina; Andreote, Fernando Dini; Romão, Aline Silva; Spósito, Marcel Bellato; Araújo, Welington Luiz

    2009-01-01

    The Alternaria brown spot (ABS) is a disease caused in tangerine plants and its hybrids by the fungus Alternaria alternata f. sp. citri which has been found in Brazil since 2001. Due to the recent occurrence in Brazilian orchards, the epidemiology and genetic variability of this pathogen is still an issue to be addressed. Here it is presented a survey about the genetic variability of this fungus by the characterization of twenty four pathogenic isolates of A. alternata f. sp. citri from citrus plants and four endophytic isolates from mango (one Alternaria tenuissima and three Alternaria arborescens). The application of two molecular markers Random Amplified Polymorphic DNA (RAPD) and Amplified Fragment Length Polymorphism (AFLP) had revealed the isolates clustering in distinct groups when fingerprintings were analyzed by Principal Components Analysis (PCA). Despite the better assessment of the genetic variability through the AFLP, significant modifications in clusters components were not observed, and only slight shifts in the positioning of isolates LRS 39/3 and 25M were observed in PCA plots. Furthermore, in both analyses, only the isolates from lemon plants revealed to be clustered, differently from the absence of clustering for other hosts or plant tissues. Summarizing, both RAPD and AFLP analyses were both efficient to detect the genetic variability within the population of the pathogenic fungus Alternaria spp., supplying information on the genetic variability of this species as a basis for further studies aiming the disease control. PMID:24031413

  1. What is Comet assay not telling us: AFLP reveals wider aspects of genotoxicity.

    PubMed

    Šrut, Maja; Štambuk, Anamaria; Klobučar, Göran I V

    2013-06-01

    DNA damage detected by genotoxicity biomarkers such as the Comet assay is not always a reliable indicator of the consequences that genotoxic agents can have on the genome integrity of the exposed organisms. Therefore, to reveal the existence of more permanent alterations of DNA structure after genotoxic stress, the RTG-2 rainbow trout cell line was exposed for 3 days to benzo[a]pyrene (B[a]P, 0.1-10 μM) and ethyl methanesulfonate (EMS, 0.1-1mM) followed by 3 days of recovery period. Primary DNA damage was evaluated by the Comet assay and DNA alterations were assessed using AFLP (amplified fragment length polymorphism). Qualitative and quantitative modifications in AFLP profiles were analyzed in order to detect genetic alterations arising from mutation events and/or DNA damage. Significant induction in DNA damage measured by the Comet assay was noticed after B[a]P treatment at all concentrations but values returned to the control level after recovery. Exposure to EMS induced significant DNA damage only at the highest concentration and damage persisted after the recovery period. AFLP profiles detected DNA alterations even when Comet assay indicated complete DNA repair, revealing more persistent damage. Since such DNA damage can impair its structure and function, Comet assay results should preferably be supplemented with other methods in order to predict the consequences of genotoxic insult more accurately.

  2. Association of AFLP and SCAR markers with common leafspot resistance in autotetraploid alfalfa (Medicago sativa).

    PubMed

    Wang, Y; Bi, B; Yuan, Q H; Li, X L; Gao, J M

    2012-03-14

    To identify amplified fragment length polymorphism (AFLP) markers associated with resistance or susceptibility of alfalfa to common leafspot (CLS) caused by the fungus Pseudopeziza medicaginis (Dermateaceae), bulked segregant analysis was conducted based on an F(1(M × M)) population of 93 plants and a BC(1)S population of 91 plants. Three AFLP markers, ACTCAA(R206), TAGCAC(R185), and GGACTA(S264), were found to be associated with CLS resistance or susceptibility. All three markers were found at significantly different frequencies (71.9, 80.3 and 91.8%) compared to resistant or susceptible plants in the original population. Subsequently, these three AFLP markers were converted into three SCAR markers, ACTCAA(R136), TAGCAC(R128) and GGACTA(S254), which are easier to employ in breeding programs. The three SCAR markers were used in a randomly selected population with 50% resistance; the probability of finding one resistant plant was increased to 67.3, 66.7 and 90.0% with markers ACTCAA(R136), TAGCAC(R128) and GGACTA(S254), independently. If two of the SCAR markers were used simultaneously, the probability would be higher than 89%. The three SCAR markers identified in this study would be applicable for selection for CLS resistance in alfalfa breeding programs. Moreover, the genetic analysis indicated that CLS resistance in alfalfa is conferred by a single dominant gene.

  3. Genetic diversity among red swamp crayfish (Procambarus clarkii) populations in the middle and lower reaches of the Yangtze River based on AFLP markers.

    PubMed

    Zhu, B F; Huang, Y; Dai, Y G; Bi, C W; Hu, C Y

    2013-03-13

    The red swamp crayfish has become one of the most important freshwater aquaculture species in China. At present, although it is widely distributed in the middle and lower reaches of the Yangze River basin, little is known about its population genetics and geographic distribution in China. We estimated the genetic diversity among 6 crayfish populations from 4 lakes (Hongze Lake, Poyang Lake, Dongting Lake, and Yue Lake) using AFLPs. A total of 129 loci were generated with 5 EcoRI-MseI primer combinations and scored as binary data in 139 individuals. These data were analyzed by cluster methods with the NTSYSpc software package. The 6 populations were separated into 3 major clusters by principal coordinate analysis and cluster analysis. Among the 6 populations, the highest gene diversity was found within the Nanjing population. Analysis of molecular variance demonstrated that most variation occurred within populations (91.20%). The estimated average GST value across all loci was 0.4186, suggesting (very) low gene flow among the different localities. We conclude that there is high genetic differentiation among crayfish in the middle and lower reaches of the Yangze River. This information will help in the selection of high-quality individuals for artificial reproduction.

  4. AFLP marker analysis revealing genetic structure of the tree Parapiptadenia rigida (Benth.) Brenan (Leguminosae-Mimosoideae) in the southern Brazilian Tropical Rainforest

    PubMed Central

    de Souza, Laís Bérgamo; Ruas, Eduardo A.; Rodrigues, Luana A.; Ruas, Claudete F.; Ruas, Paulo M.

    2013-01-01

    Parapiptadenia rigida is a tropical early secondary succession tree characteristic of the Tropical Atlantic Rainforest. This species is of great ecological importance in the recovery of degraded areas. In this study we investigated the variability and population genetic structure of eight populations of P. rigida. Five AFLP primer combinations were used in a sample of 159 individuals representing these eight populations, rendering a total of 126 polymorphic fragments. The averages of percentage of polymorphic loci, gene diversity, and Shannon index were 60.45%, 0.217, and 0.322, respectively. A significant correlation between the population genetic variability and the population sizes was observed. The genetic variability within populations (72.20%) was higher than between these (22.80%). No perfect correlation was observed between geographic and genetic distances, which might be explained by differences in deforestation intensities that occurred in these areas. A dendrogram constructed by the UPGMA method revealed the formation of two clusters, these also confirmed by Bayesian analysis for the number of K cluster. These results show that it is necessary to develop urgent management strategies for the conservation of certain populations of P. rigida, while other populations still preserve reasonably high levels of genetic variability. PMID:24385857

  5. AFLP marker analysis revealing genetic structure of the tree Parapiptadenia rigida (Benth.) Brenan (Leguminosae-Mimosoideae) in the southern Brazilian Tropical Rainforest.

    PubMed

    de Souza, Laís Bérgamo; Ruas, Eduardo A; Rodrigues, Luana A; Ruas, Claudete F; Ruas, Paulo M

    2013-12-01

    Parapiptadenia rigida is a tropical early secondary succession tree characteristic of the Tropical Atlantic Rainforest. This species is of great ecological importance in the recovery of degraded areas. In this study we investigated the variability and population genetic structure of eight populations of P. rigida. Five AFLP primer combinations were used in a sample of 159 individuals representing these eight populations, rendering a total of 126 polymorphic fragments. The averages of percentage of polymorphic loci, gene diversity, and Shannon index were 60.45%, 0.217, and 0.322, respectively. A significant correlation between the population genetic variability and the population sizes was observed. The genetic variability within populations (72.20%) was higher than between these (22.80%). No perfect correlation was observed between geographic and genetic distances, which might be explained by differences in deforestation intensities that occurred in these areas. A dendrogram constructed by the UPGMA method revealed the formation of two clusters, these also confirmed by Bayesian analysis for the number of K cluster. These results show that it is necessary to develop urgent management strategies for the conservation of certain populations of P. rigida, while other populations still preserve reasonably high levels of genetic variability.

  6. Microsatellite primers for the rare shrub Acacia adinophylla (Fabaceae)1

    PubMed Central

    Nevill, Paul G.; Wardell-Johnson, Grant

    2016-01-01

    Premise of the study: Microsatellite primers were developed for the rare shrub Acacia adinophylla (Fabaceae) to assess genetic diversity and its spatial structuring. Methods and Results: Shotgun sequencing on an Illumina MiSeq produced 6,372,575 reads. Using the QDD pipeline, we designed 60 primer pairs, which were screened using PCR. Seventeen loci were developed, of which 12 loci were identified that were polymorphic, amplified reliably, and could be consistently scored. These loci were then screened for variation in individuals from three populations. The number of alleles observed for these 12 loci ranged from three to 18 and expected heterozygosity ranged from 0.13 to 0.85. Conclusions: These markers will enable the quantification of genetic impact of proposed mining activities on the short-range endemic Acacia adinophylla. PMID:27843728

  7. Water based adhesive primers on aluminum substrates

    SciTech Connect

    Wightman, J.P.; Mori, S.

    1996-12-31

    The number of aluminum alloy bonding applications has been increasing recently in the automobile industry. Primer coating of aluminum substrates is one of the main processes used to promote bond performance. Solvent based organic primers have been used for a long time but environmental regulations now require the substitution of volatile organic compounds (VOC) by alternate materials such as water based adhesive primers. However, the bond strengths obtained with many water based primers are generally lower than for solvent based ones. Water based primers which have some reactive functional groups have been proposed recently but such primers require special treatment. This paper describes a study conducted to optimize bond strength using a water based adhesive as a primer in the adhesive bonding of anodized aluminum.

  8. Output testing of small-arms primers

    NASA Technical Reports Server (NTRS)

    Bement, Laurence J.; Doris, Thomas A.; Schimmel, Morry L.

    1991-01-01

    The performance of two standard primers for initiating small-caliber ammunition are compared to that of a primer for initiating aircraft escape-system components. Three testing methods are employed including: (1) firing the primer to measure total energy delivered; (2) monitoring output in terms of gaseous product-mass flow rate and pressure as a function of time; and (3) firing the primer onto ignition material to study gas pressure produced during ignition and burning as a function of time. The results of the test demonstrate differences in the ignitability factors of the standard primers and time peak pressures of less than 100 microseconds. One unexpected result is that two percussion primers (the FA-41 and the M42C1) developed for different applications have the same ignitability. The ignitability test method is shown to yield the most useful data and can be used to specify percussion primers and optimize their performance.

  9. Improved Bacterial 16S rRNA Gene (V4 and V4-5) and Fungal Internal Transcribed Spacer Marker Gene Primers for Microbial Community Surveys.

    PubMed

    Walters, William; Hyde, Embriette R; Berg-Lyons, Donna; Ackermann, Gail; Humphrey, Greg; Parada, Alma; Gilbert, Jack A; Jansson, Janet K; Caporaso, J Gregory; Fuhrman, Jed A; Apprill, Amy; Knight, Rob

    2016-01-01

    Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of data sets amplified with varied primers requires attention. Here, we examined the performance of modified 16S rRNA gene and internal transcribed spacer (ITS) primers for archaea/bacteria and fungi, respectively, with nonaquatic samples. We moved primer bar codes to the 5' end, allowing for a range of different 3' primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4 and 5 of the 16S rRNA gene. We additionally demonstrated that modifications to the 515f/806r (variable region 4) 16S primer pair, which improves detection of Thaumarchaeota and clade SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies. IMPORTANCE We continue to uncover a wealth of information connecting microbes in important ways to human and environmental ecology. As our scientific knowledge and technical abilities improve, the tools used for microbiome surveys can be modified to improve the accuracy of our techniques, ensuring that we can continue to identify groundbreaking connections between microbes and the ecosystems they populate, from ice caps to the human body. It is important to confirm that modifications to these tools do not cause new, detrimental biases that would inhibit the field rather than continue to move it forward. We therefore demonstrated that two recently modified primer pairs that target taxonomically discriminatory regions of bacterial and fungal genomic DNA do not introduce new biases when used on a variety of sample types, from soil to human skin. This confirms the utility of these primers for

  10. Comparison of three different primer sets for sexing birds.

    PubMed

    Çakmak, Emel; Akın Pekşen, Çiğdem; Bilgin, C Can

    2017-01-01

    Because many bird species are monomorphic or only sexually dimorphic in adult stages, it is difficult to determine their sexes, which may cause significant problems in population and conservation studies. DNA-based sexing relies on the chromodomain helicase DNA binding ( CHD) gene located on the W chromosome and its homolog on the Z chromosome, giving distinct banding patterns on agarose gel as a result of length differences in intronic regions within this gene. We used 3 specific primer sets, CHD1F/CHD1R, 2550F/2718R, and P2/P8, for sex determination of 230 samples from 77 avian species. We report here the records for 70 of those species analyzed using the CHD1F/CHD1R primer set, and 49 species using 2550F/2718R, and 46 species using P2/P8. CHD1F/CHD1R PCR products on agarose gel generally showed an apparent single band in males and 2 bands in females, but the products of 2550F/2718R (61%) and P2/P8 (42%) showed distinct banding patterns for separate bird orders. However, when PCR products of these last 2 primer pairs labeled with fluorescent dye were run in a capillary gel and detected using a DNA analyzer, P2/P8 gave 2 distinguishable peaks in females, whereas 2550F/2718R results remained the same. DNA sexing with any of those 3 primer sets can be used for all sexually monomorphic avian taxa although the primer sets should be compared before choosing the most efficient one for molecular sexing of the studied species.

  11. Sample Return Primer and Handbook

    NASA Technical Reports Server (NTRS)

    Barrow, Kirk; Cheuvront, Allan; Faris, Grant; Hirst, Edward; Mainland, Nora; McGee, Michael; Szalai, Christine; Vellinga, Joseph; Wahl, Thomas; Williams, Kenneth; Lee, Gentry; Duxbury, Thomas

    2007-01-01

    This three-part Sample Return Primer and Handbook provides a road map for conducting the terminal phase of a sample return mission. The main chapters describe element-by-element analyses and trade studies, as well as required operations plans, procedures, contingencies, interfaces, and corresponding documentation. Based on the experiences of the lead Stardust engineers, the topics include systems engineering (in particular range safety compliance), mission design and navigation, spacecraft hardware and entry, descent, and landing certification, flight and recovery operations, mission assurance and system safety, test and training, and the very important interactions with external support organizations (non-NASA tracking assets, landing site support, and science curation).

  12. Widespread utility of highly informative AFLP molecular markers across divergent shark species.

    PubMed

    Zenger, Kyall R; Stow, Adam J; Peddemors, Victor; Briscoe, David A; Harcourt, Robert G

    2006-01-01

    Population numbers of many shark species are declining rapidly around the world. Despite the commercial and conservation significance, little is known on even the most fundamental aspects of their population biology. Data collection that relies on direct observation can be logistically challenging with sharks. Consequently, molecular methods are becoming increasingly important to obtain knowledge that is critical for conservation and management. Here we describe an amplified fragment length polymorphism method that can be applied universally to sharks to identify highly informative genome-wide polymorphisms from 12 primer pairs. We demonstrate the value of our method on 15 divergent shark species within the superorder Galeomorphii, including endangered species which are notorious for low levels of genetic diversity. Both the endangered sand tiger shark (Carcharodon taurus, N = 18) and the great white shark (Carcharodon carcharias, N = 7) displayed relatively high levels of allelic diversity. A total of 59 polymorphic loci (H(e) = 0.373) and 78 polymorphic loci (H(e) = 0.316) were resolved in C. taurus and C. carcharias, respectively. Results from other sharks (e.g., Orectolobus ornatus, Orectolobus sp., and Galeocerdo cuvier) produced remarkably high numbers of polymorphic loci (106, 94, and 86, respectively) from a limited sample size of only 2. A major constraint to obtaining much needed genetic data from sharks is the time-consuming process of developing molecular markers. Here we demonstrate the general utility of a technique that provides large numbers of informative loci in sharks.

  13. Genus-Specific Primers for Study of Fusarium Communities in Field Samples.

    PubMed

    Karlsson, Ida; Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-10-30

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology.

  14. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    PubMed Central

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  15. PrimerZ: streamlined primer design for promoters, exons and human SNPs.

    PubMed

    Tsai, Ming-Fang; Lin, Yi-Jung; Cheng, Yu-Chang; Lee, Kuo-Hsi; Huang, Cheng-Chih; Chen, Yuan-Tsong; Yao, Adam

    2007-07-01

    PrimerZ (http://genepipe.ngc.sinica.edu.tw/primerz/) is a web application dedicated primarily to primer design for genes and human SNPs. PrimerZ accepts genes by gene name or Ensembl accession code, and SNPs by dbSNP rs or AFFY_Probe IDs. The promoter and exon sequence information of all gene transcripts fetched from the Ensembl database (http://www.ensembl.org) are processed before being passed on to Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) for individual primer design. All results returned from Primer 3 are organized and integrated in a specially designed web page for easy browsing. Besides the web page presentation, csv text file export is also provided for enhanced user convenience. PrimerZ automates highly standard but tedious gene primer design to improve the success rate of PCR experiments. More than 2000 primers have been designed with PrimerZ at our institute since 2004 and the success rate is over 70%. The addition of several new features has made PrimerZ even more useful to the research community in facilitating primer design for promoters, exons and SNPs.

  16. New primers for detecting and quantifying denitrifying anaerobic methane oxidation archaea in different ecological niches.

    PubMed

    Ding, Jing; Ding, Zhao-Wei; Fu, Liang; Lu, Yong-Ze; Cheng, Shuk H; Zeng, Raymond J

    2015-11-01

    The significance of ANME-2d in methane sink in the environment has been overlooked, and there was no any study evaluating the distribution of ANME-2d in the environment. New primers were thus needed to be designed for following research. In this paper, a pair of primers (DP397F and DP569R) was designed to quantify ANME-2d. The specificity and amplification efficiency of this primer pair were acceptable. PCR amplification of another pair of primers (DP142F and DP779R) generated a single, bright targeted band from the enrichment sample, but yielded faint, multiple bands from the environmental samples. Nested PCR was conducted using the primers DP142F/DP779R in the first round and DP142F/DP569R in the second round, which generated a bright targeted band. Further phylogenetic analysis showed that these targeted bands were ANME-2d-related sequences. Real-time PCR showed that the copies of the 16s ribosomal RNA gene of ANME-2d in these samples ranged from 3.72 × 10(4) to 2.30 × 10(5) copies μg(-1) DNA, indicating that the percentage of ANME-2d was greatest in a polluted river sample and least in a rice paddy sample. These results demonstrate that the newly developed real-time PCR primers could sufficiently quantify ANME-2d and that nested PCR with an appropriate combination of the new primers could successfully detect ANME-2d in environmental samples; the latter finding suggests that ANME-2d may spread in environments.

  17. Moisture insensitive primer: A myth or truth

    PubMed Central

    Shukla, Chandresh; Maurya, Rajkumar; Jain, Upendra; Gupta, Ankur; Garg, Jayshree

    2014-01-01

    Objectives: To compare the mean shear bond strength (SBS) of moisture insensitive primer (MIP) used for orthodontic bonding in the presence and absence of saliva. Materials and Methods: A total of 60 human noncarious maxillary premolars with sound buccal surfaces, recently extracted were collected in two groups of each 30. Maxillary premolar brackets were bonded to the teeth using light cure (Transbond XT, 3M Unitek, Monrovia, CA, USA) and MIP (Transbond MIP 3M Unitek, Monrovia, CA, USA,) in the presence and absence of saliva. Operators’ saliva was used during the bonding under moist condition. After debonding, all the specimens were examined under a stereomicroscope (×40 magnification) for adhesive remnant using adhesive remnant index (ARI). The SBS tests were done using Instron universal testing machine at cross-head speed of 1 mm/min, force passing parallel to the buccal surface using custom rod and registered in Newtons later converted into Megapascals. Results: Light cure and MIP (Transbond MIP and Transbond XT, 3M Unitek, Monrovia, CA, USA) in the absence of saliva showed higher mean SBS than the presence of saliva. Group I (light cure and MIP) in the absence of saliva showed mean SBS of 9.65 ± 0.90 Mpa. Group II (light cure and MIP) with the presence of saliva showed mean SBS of 9.03 ± 1.14 Mpa. The difference between both the groups was statistically significant, as confirmed by paired t-test (P < 0.05). In-Group I, ARI scores showed that more than half of the adhesive was left over the tooth surface, and Group II showed that there was no or insignificant amount of adhesive left over the tooth surface. Chi-square test revealed significant difference in debonding characteristics among the test groups of ARI (P < 0.05). Failure occurred mainly in resin– bracket base and resin – adhesive interfaces (χ² = 10.04, df = 3, P = 0.031). Conclusion: Moisture insensitive primer is effective in the presence/absence of moisture and has shown SBS value of more

  18. Use of AFLP, plasmid typing and phenotyping in a comparative study to assess genetic diversity of Shigella flexneri strains.

    PubMed Central

    Herrera, S.; Cabrera, R.; Ramirez, M. M.; Usera, M. A.; Echeita, M. A.

    2002-01-01

    Shigella flexneri infections are one of the main causes of acute diarrhoea in Cuba. Twenty strains isolated from sporadic cases in nine different Cuban provinces were characterized. Serotyping, antibiotic-resistance typing, plasmid-typing and AFLP-typing were used to determine their suitability for use in epidemiological studies of S. flexneri. The predominant serotypes were serotype 6 (35%) and serotype 2 (35%). Eleven different plasmid profiles were detected (Diversity Index = 0.92). AFLP-typing discriminated 12 different patterns (DI = 0.95), these patterns were not coincident with plasmid-typing patterns. Both techniques combined distinguished 14 patterns among the 20 studied strains (DI = 0.99). There was no consistent relationship between plasmid-typing and AFLP-typing patterns or antibiotic-resistance typing patterns. Ninety-five percent of S. flexneri strains were multiresistant. PMID:12558326

  19. Nucleic acid amplification using modular branched primers

    DOEpatents

    Ulanovsky, Levy; Raja, Mugasimangalam C.

    2001-01-01

    Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.

  20. Molecular characterisation and antifungal susceptibility of clinical Cryptococcus deuterogattii (AFLP6/VGII) isolates from Southern Brazil.

    PubMed

    Herkert, P F; Hagen, F; de Oliveira Salvador, G L; Gomes, R R; Ferreira, M S; Vicente, V A; Muro, M D; Pinheiro, R L; Meis, J F; Queiroz-Telles, F

    2016-11-01

    Cryptococcosis, caused by Cryptococcus gattii sensu lato, is an emerging disease that was initially found in (sub)tropical regions but recently expanded to temperate regions. Cryptococcus gattii s.l. infections are mostly encountered in healthy individuals, frequently affecting both lungs and the central nervous system (CNS). Usually, C. gattii s.l. is less susceptible to antifungal compounds than its counterpart, C. neoformans s.l. We studied 18 clinical C. gattii s.l. isolates with amplified fragment length polymorphism (AFLP) fingerprinting, mating-typing, multi-locus sequence typing (MLST) and antifungal susceptibility testing. All isolates were C. deuterogattii (genotype AFLP6/VGII), 14 were mating-type α and four were type a. Amphotericin B, itraconazole, voriconazole, posaconazole and isavuconazole showed high activity, with minimum inhibitory concentration (MIC) ranges of 0.063-0.25, 0.031-0.25, 0.031-0.25, 0.031-0.25 and <0.016-0.25 μg mL(-1), respectively. Fluconazole and flucytosine had high geometric mean MICs of 2.07 and 3.7 μg mL(-1), respectively. Most cases occurred in immunocompetent patients (n = 10; 55.6 %) and CNS involvement was the most common clinical presentation (n = 14; 77.8 %). Three patients (16.7 %) showed sequelae, hyperreflexia, dysarthria, diadochokinesia, anosmia and upper limb weakness. In conclusion, all infections were caused by C. deuterogattii (AFLP6/VGII) and the majority of patients were immunocompetent, with the CNS as the most affected site. All antifungal drugs had high in vitro activity against C. deuterogattii isolates, except fluconazole and flucytosine.

  1. Comparative ITS and AFLP Analysis of Diploid Cardamine (Brassicaceae) Taxa from Closely Related Polyploid Complexes

    PubMed Central

    MARHOLD, KAROL; LIHOVÁ, JUDITA; PERNÝ, MARIÁN; BLEEKER, WALTER

    2004-01-01

    • Background and Aims Diploid representatives from the related polyploid complexes of Cardamine amara, C. pratensis and C. raphanifolia (Brassicaceae), were studied to elucidate phylogenetic relationships among the complexes and among the individual taxa included. • Methods Two independent molecular data sets were used: nucleotide sequences from the internal transcribed spacers (ITS) of nrDNA, and amplified fragment length polymorphism (AFLP) markers. Seventeen diploid taxa from the studied groups were sampled. • Key Results Both ITS and AFLP analyses provided congruent results in inferred relationships, and revealed two main lineages. While the C. amara group, consisting of C. wiedemanniana and four subspecies of C. amara, was resolved as a well‐supported monophyletic group, taxa from the C. pratensis and C. tenera groups (the latter representing diploid taxa of the complex of C. raphanifolia) all appeared together in a single clade/cluster with no support for the recognition of either of the groups. Intra‐individual polymorphisms and patterns of nucleotide variation in the ITS region in C. uliginosa and C. tenera, together with the distribution of AFLP bands, indicate ancient hybridization and introgression among these Caucasian diploids. • Conclusions The lack of supported hierarchical structure suggests that extensive reticulate evolution between these groups, even at the diploid level, has occurred (although an alternative explanation, namely ancestral polymorphism in ITS data, cannot be completely excluded). Several implications for the investigation of the polyploid complexes of concern are drawn. When tracing origins of polyploid taxa, a much more complex scenario should be expected, taking into account all relatives as potential parents, irrespective of the group in which they are classified. PMID:15037449

  2. A Primer on Observational Measurement.

    PubMed

    Girard, Jeffrey M; Cohn, Jeffrey F

    2016-08-01

    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  3. A Practical Primer on Geostatistics

    USGS Publications Warehouse

    Olea, Ricardo A.

    2009-01-01

    significant methodological implications. HISTORICAL REMARKS As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields. PIONEERS Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorology CALCULATIONS Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations. SOFTWARE For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics. ORGANIZATION OF THE PRIMER The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of th

  4. Linear elastic fracture mechanics primer

    NASA Technical Reports Server (NTRS)

    Wilson, Christopher D.

    1992-01-01

    This primer is intended to remove the blackbox perception of fracture mechanics computer software by structural engineers. The fundamental concepts of linear elastic fracture mechanics are presented with emphasis on the practical application of fracture mechanics to real problems. Numerous rules of thumb are provided. Recommended texts for additional reading, and a discussion of the significance of fracture mechanics in structural design are given. Griffith's criterion for crack extension, Irwin's elastic stress field near the crack tip, and the influence of small-scale plasticity are discussed. Common stress intensities factor solutions and methods for determining them are included. Fracture toughness and subcritical crack growth are discussed. The application of fracture mechanics to damage tolerance and fracture control is discussed. Several example problems and a practice set of problems are given.

  5. Primer: Shotgun Proteomics in Neuroscience

    PubMed Central

    Liao, Lujian; McClatchy, Daniel B.; Yates, John R.

    2009-01-01

    Mass spectrometry-based proteomics is increasingly used to address basic and clinical questions in biomedical research through studies of differential protein expression, protein-protein interactions, and post-translational modifications. The complex structural and functional organization of the human brain warrants the application of high-throughput, systematic approaches to understand the functional alterations under normal physiological conditions and the perturbations of neurological diseases. This primer focuses on shotgun proteomics based tandem mass spectrometry for the identification of proteins in a complex mixture. It describes the basic concepts of protein differential expression analysis and post-translational modification analysis and discusses several strategies to improve the coverage of the proteome. PMID:19607789

  6. Beyond an AFLP genome scan towards the identification of immune genes involved in plague resistance in Rattus rattus from Madagascar.

    PubMed

    Tollenaere, C; Jacquet, S; Ivanova, S; Loiseau, A; Duplantier, J-M; Streiff, R; Brouat, C

    2013-01-01

    Genome scans using amplified fragment length polymorphism (AFLP) markers became popular in nonmodel species within the last 10 years, but few studies have tried to characterize the anonymous outliers identified. This study follows on from an AFLP genome scan in the black rat (Rattus rattus), the reservoir of plague (Yersinia pestis infection) in Madagascar. We successfully sequenced 17 of the 22 markers previously shown to be potentially affected by plague-mediated selection and associated with a plague resistance phenotype. Searching these sequences in the genome of the closely related species Rattus norvegicus assigned them to 14 genomic regions, revealing a random distribution of outliers in the genome (no clustering). We compared these results with those of an in silico AFLP study of the R. norvegicus genome, which showed that outlier sequences could not have been inferred by this method in R. rattus (only four of the 15 sequences were predicted). However, in silico analysis allowed the prediction of AFLP markers distribution and the estimation of homoplasy rates, confirming its potential utility for designing AFLP studies in nonmodel species. The 14 genomic regions surrounding AFLP outliers (less than 300 kb from the marker) contained 75 genes encoding proteins of known function, including nine involved in immune function and pathogen defence. We identified the two interleukin 1 genes (Il1a and Il1b) that share homology with an antigen of Y. pestis, as the best candidates for genes subject to plague-mediated natural selection. At least six other genes known to be involved in proinflammatory pathways may also be affected by plague-mediated selection.

  7. Improved efficiency and robustness in qPCR and multiplex end-point PCR by twisted intercalating nucleic acid modified primers.

    PubMed

    Schneider, Uffe Vest; Mikkelsen, Nikolaj Dam; Lindqvist, Anja; Okkels, Limei Meng; Jøhnk, Nina; Lisby, Gorm

    2012-01-01

    We introduce quantitative polymerase chain reaction (qPCR) primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA) molecule at the 5'-end. In qPCR, the 5'-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5'-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5'-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5'-o-TINA modified primers allows for a further reduction (>45% or approximately one hour) in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5'-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5'-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions.

  8. Fungal-specific PCR primers developed for analysis of the ITS region of environmental DNA extracts

    PubMed Central

    Martin, Kendall J; Rygiewicz, Paul T

    2005-01-01

    Background The Internal Transcribed Spacer (ITS) regions of fungal ribosomal DNA (rDNA) are highly variable sequences of great importance in distinguishing fungal species by PCR analysis. Previously published PCR primers available for amplifying these sequences from environmental samples provide varying degrees of success at discriminating against plant DNA while maintaining a broad range of compatibility. Typically, it has been necessary to use multiple primer sets to accommodate the range of fungi under study, potentially creating artificial distinctions for fungal sequences that amplify with more than one primer set. Results Numerous sequences for PCR primers were tested to develop PCR assays with a wide range of fungal compatibility and high discrimination from plant DNA. A nested set of 4 primers was developed that reflected these criteria and performed well amplifying ITS regions of fungal rDNA. Primers in the 5.8S sequence were also developed that would permit separate amplifications of ITS1 and ITS2. A range of basidiomycete fruiting bodies and ascomycete cultures were analyzed with the nested set of primers and Restriction Fragment Length Polymorphism (RFLP) fingerprinting to demonstrate the specificity of the assay. Single ectomycorrhizal root tips were similarly analyzed. These primers have also been successfully applied to Quantitative PCR (QPCR), Length Heterogeneity PCR (LH-PCR) and Terminal Restriction Fragment Length Polymorphism (T-RFLP) analyses of fungi. A set of wide-range plant-specific primers were developed at positions corresponding to one pair of the fungal primers. These were used to verify that the host plant DNA was not being amplified with the fungal primers. Conclusion These plant primers have been successfully applied to PCR-RFLP analyses of forest plant tissues from above- and below-ground samples and work well at distinguishing a selection of plants to the species level. The complete set of primers was developed with an emphasis on

  9. PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Knowlton, Nancy

    2012-01-01

    Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets

  10. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection.

    PubMed

    O'Halloran, Damien M

    2016-02-08

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction.

  11. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection

    PubMed Central

    O’Halloran, Damien M.

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  12. A Primer on Sampling for Statewide Assessment.

    ERIC Educational Resources Information Center

    Jaeger, Richard M.

    This paper is a primer on sampling procedures for statewide assessment. The careful reader should gain substantial knowledge about the promises and pitfalls of sampling for assessment. The primer has three basic objectives: (1) to define terms and concepts basic to sampling theory and its application, including population, sampling unit, sampling…

  13. Primer on Special Education in Charter Schools

    ERIC Educational Resources Information Center

    Luna, Tom

    2007-01-01

    This section of the Idaho Primer on Special Education in Charter Schools is divided into two parts: (1) a discussion of the legal status of charter schools and their linkage to other local education agencies (LEAs), and (2) a synopsis of federal laws that are most relevant to special education in charter schools. The Primer on Special Education in…

  14. The novel primers for sex identification in the brown eared-pheasant and their application to other species.

    PubMed

    Wang, N; Zhang, Z-W

    2009-01-01

    We designed a pair of primers for sex identification in the brown eared-pheasant (Crossoptilon mantchuricum) based on the mechanism of PCR amplification of CHD fragments, and identified the number of products. The new primers were considered to have more sensitivity than P2/P8, and cross-species application indicated that they can also be used for sex identification in other species of Phasianidae and Passeriformes.

  15. Veronaea botryosa: molecular identification with amplified fragment length polymorphism (AFLP) and in vitro antifungal susceptibility.

    PubMed

    Badali, Hamid; Yazdanparast, Seyed Amir; Bonifaz, Alexandro; Mousavi, Bita; de Hoog, G Sybren; Klaassen, Corné H W; Meis, Jacques F

    2013-06-01

    Inter- and intraspecific genomic variability of 18 isolates of Veronaea botryosa originating from clinical and environmental sources was studied using amplified fragment length polymorphism (AFLP). The species was originally described from the environment, but several severe cases of disseminated infection in apparently healthy individuals have been reported worldwide. All tested strains of V. botryosa, identified on the basis of sequencing and phenotypic and physiological criteria prior to our study, were confirmed by AFLP analysis, yielding a clear separation of V. botryosa as a rather homogeneous group from related species. In vitro antifungal susceptibility testing resulted in MIC90s across all strains in increasing order posaconazole (0.25 μg/ml), itraconazole (1 μg/ml), voriconazole (4 μg/ml), terbinafine (4 μg/ml), caspofungin (8 μg/ml), anidulafungin (8 μg/ml), isavuconazole (16 μg/ml), amphotericin B (16 μg/ml), and fluconazole (32 μg/ml). Overall, the isolates showed a uniform pattern of low MICs of itraconazole and posaconazole, but high MICs for remaining agents. The echinocandins (caspofungin and anidulafungin) had no activity against V. botryosa. There was no statistically significant difference between susceptibilities of environmental (n = 11) and clinical (n = 7) isolates of V. botryosa (P > 0.05).

  16. Molecular analysis of post-harvest withering in grape by AFLP transcriptional profiling

    PubMed Central

    Zamboni, Anita; Minoia, Leone; Ferrarini, Alberto; Tornielli, Giovanni Battista; Zago, Elisa; Delledonne, Massimo; Pezzotti, Mario

    2008-01-01

    Post-harvest withering of grape berries is used in the production of dessert and fortified wines to alter must quality characteristics and increase the concentration of simple sugars. The molecular processes that occur during withering are poorly understood, so a detailed transcriptomic analysis of post-harvest grape berries was carried out by AFLP-transcriptional profiling analysis. This will help to elucidate the molecular mechanisms of berry withering and will provide an opportunity to select markers that can be used to follow the drying process and evaluate different drying techniques. AFLP-TP identified 699 withering-specific genes, 167 and 86 of which were unique to off-plant and on-plant withering, respectively. Although similar molecular events were revealed in both withering processes, it was apparent that off-plant withering induced a stronger dehydration stress response resulting in the high level expression of genes involved in stress protection mechanisms, such as dehydrin and osmolite accumulation. Genes involved in hexose metabolism and transport, cell wall composition, and secondary metabolism (particularly the phenolic and terpene compound pathways) were similarly regulated in both processes. This work provides the first comprehensive analysis of the molecular events underpinning post-harvest withering and could help to define markers for different withering processes. PMID:19010774

  17. AFLP phylogeny of Mimulus section Erythranthe and the evolution of hummingbird pollination.

    PubMed

    Beardsley, Paul M; Yen, Alan; Olmstead, Richard G

    2003-06-01

    Species in Mimulus section Erythranthe (monkeyflowers) have become model systems for the study of the genetic basis of ecological adaptations. In this study, we pursued two goals. First, we reconstructed the phylogeny of species in Erythranthe using both DNA sequences from the ribosomal DNA ITS and ETS and AFLPs. Data from rDNA sequences support the monophyly of the section, including M. parishii, but provide little support for relationships within it. Analyses using AFLP data resulted in a well-supported hypothesis of relationships among all Erythranthe species. Our second goal was to reconstruct ancestral pollination syndromes and ancestral states of individual characters associated with hummingbird-pollinated flowers. Both parsimony and likelihood approaches indicate that hummingbird pollination evolved twice in Erythranthe from insect-pollinated ancestors. Our reconstruction of individual characters indicates that corolla color and some aspects of corolla shape change states at the same point on the phylogenetic tree as the switch to hummingbird pollination; however, a switch to secretion of high amounts of nectar does not. Floral trait transformation may have been more punctuational than gradual.

  18. AFLP and single-strand conformation polymorphism studies of recombination in the entomopathogenic fungus Nomuraea rileyi.

    PubMed

    Devi, Uma K; Reineke, Annette; Rao, Uma C Maheswara; Reddy, Nageswara Rao N; Khan, Akbar P Ali

    2007-06-01

    In most putative asexual fungi analysed through population genetic studies, recombination has been detected. However, the mechanism by which it is achieved is still not known. A parasexual cycle is known to occur in asexual fungi but there is no evidence, as yet, of its prevalence in natural populations. This study was undertaken to investigate the possibility of a parasexual cycle mediating recombination in the mitosporic fungus Nomuraea rileyi. The genotypic diversity in isolates sampled from an epizootic population from South India was studied through AFLP. The AFLP data were subjected to analysis of molecular variance (AMOVA) and cluster analysis. Great genetic variation was observed in the population including the isolates from a single insect. To assess the occurrence of recombination in the population, single-strand conformation polymorphism (SSCP) of partial regions of two mitochondrial (mt) genes (rRNA genes of LSU and SSU) and a nuclear gene (beta tubulin) was performed. The SSCP data were analysed using MP, the tree length permutation test, and multilocus analysis. Recombination was inferred from the SSCP analysis. The occurrence of isolates with diverse genotypes in a single insect; the fact that fungi multiply as hyphal bodies (cell wall-less) in the insect haemolymph; and the inference of recombination in mitochondrial genes (suggesting cytomixis), all indicate that recombination is accomplished by fusion of hyphal bodies of different isolates infecting the insect.

  19. [AFLP Analysis of Genetic Diversity in the Genus Mallus Mill. (Apple)].

    PubMed

    Savelyeva, E N; Kudryavtsev, A M

    2015-10-01

    The first molecular genetic analysis of the apple species and varieties from Russian collections with the AFLP marker system was performed in order to study the genetic diversity of the genus Malus, as well as to clarify the phylogeny and solve some systematic issues of the genus. Nienty-one apple accessions, including species from five sections of the genus Malus and hybrid species, were examined. The level of polymorphism constituted 90.2%. It was demonstrated that the classical taxonomy of the genus Malus, which identifies five sections based on differences in their morphological characters, is valid and may be used to classify apple species. The species assignment of the Antonovka landraces was established. All of them belonged to the species M. domestica. It was demonstrated that the Yakutskaya apple variety was a domesticated species of the section Gymnomeles, presumably, M. baccata. AFLP analysis confirmed the hybrid nature of many species. The relationships between apple varieties of the Golden group with American wild species were demonstrated. The data suggest that the species M. sieversii was the ancestor of not only the domestic apple but also of other species of the Malus sections.

  20. Identification of Genes Related to Paulownia Witches’ Broom by AFLP and MSAP

    PubMed Central

    Cao, Xibing; Fan, Guoqiang; Deng, Minjie; Zhao, Zhenli; Dong, Yanpeng

    2014-01-01

    DNA methylation is believed to play important roles in regulating gene expression in plant growth and development. Paulownia witches’ broom (PaWB) infection has been reported to be related to gene expression changes in paulownia plantlets. To determine whether DNA methylation is associated with gene expression changes in response to phytoplasma, we investigated variations in genomic DNA sequence and methylation in PaWB plantlets treated with methyl methane sulfonate (MMS) using amplified fragment length polymorphism (AFLP) and methylation-sensitive amplification polymorphism (MSAP) techniques, respectively. The results indicated that PaWB seedings recovered a normal morphology after treatment with more than 15 mg·L−1 MMS. PaWB infection did not cause changes of the paulownia DNA sequence at the AFLP level; However, DNA methylation levels and patterns were altered. Quantitative real-time PCR (qRT-PCR) showed that three of the methylated genes were up-regulated and three were down-regulated in the MMS-treated PaWB plantlets that had regained healthy morphology. These six genes might be involved in transcriptional regulation, plant defense, signal transduction and energy. The possible roles of these genes in PaWB are discussed. The results showed that changes of DNA methylation altered gene expression levels, and that MSAP might help identify genes related to PaWB. PMID:25196603

  1. Identification of genes related to Paulownia witches' broom by AFLP and MSAP.

    PubMed

    Cao, Xibing; Fan, Guoqiang; Deng, Minjie; Zhao, Zhenli; Dong, Yanpeng

    2014-08-21

    DNA methylation is believed to play important roles in regulating gene expression in plant growth and development. Paulownia witches' broom (PaWB) infection has been reported to be related to gene expression changes in paulownia plantlets. To determine whether DNA methylation is associated with gene expression changes in response to phytoplasma, we investigated variations in genomic DNA sequence and methylation in PaWB plantlets treated with methyl methane sulfonate (MMS) using amplified fragment length polymorphism (AFLP) and methylation-sensitive amplification polymorphism (MSAP) techniques, respectively. The results indicated that PaWB seedings recovered a normal morphology after treatment with more than 15 mg·L(-1) MMS. PaWB infection did not cause changes of the paulownia DNA sequence at the AFLP level; However, DNA methylation levels and patterns were altered. Quantitative real-time PCR (qRT-PCR) showed that three of the methylated genes were up-regulated and three were down-regulated in the MMS-treated PaWB plantlets that had regained healthy morphology. These six genes might be involved in transcriptional regulation, plant defense, signal transduction and energy. The possible roles of these genes in PaWB are discussed. The results showed that changes of DNA methylation altered gene expression levels, and that MSAP might help identify genes related to PaWB.

  2. Key Processes for Cheirolophus (Asteraceae) Diversification on Oceanic Islands Inferred from AFLP Data

    PubMed Central

    Vitales, Daniel; García-Fernández, Alfredo; Pellicer, Jaume; Vallès, Joan; Santos-Guerra, Arnoldo; Cowan, Robyn S.; Fay, Michael F.; Hidalgo, Oriane; Garnatje, Teresa

    2014-01-01

    The radiation of the genus Cheirolophus (Asteraceae) in Macaronesia constitutes a spectacular case of rapid diversification on oceanic islands. Twenty species – nine of them included in the IUCN Red List of Threatened Species – have been described to date inhabiting the Madeiran and Canarian archipelagos. A previous phylogenetic study revealed that the diversification of Cheirolophus in Macaronesia started less than 2 Ma. As a result of such an explosive speciation process, limited phylogenetic resolution was reported, mainly due to the low variability of the employed molecular markers. In the present study, we used highly polymorphic AFLP markers to i) evaluate species' boundaries, ii) infer their evolutionary relationships and iii) investigate the patterns of genetic diversity in relation to the potential processes likely involved in the radiation of Cheirolophus. One hundred and seventy-two individuals representing all Macaronesian Cheirolophus species were analysed using 249 AFLP loci. Our results suggest that geographic isolation played an important role in this radiation process. This was likely driven by the combination of poor gene flow capacity and a good ability for sporadic long-distance colonisations. In addition, we also found some traces of introgression and incipient ecological adaptation, which could have further enhanced the extraordinary diversification of Cheirolophus in Macaronesia. Last, we hypothesize that current threat categories assigned to Macaronesian Cheirolophus species do not reflect their respective evolutionary relevance, so future evaluations of their conservation status should take into account the results presented here. PMID:25412495

  3. Genetic diversity of a germplasm collection of Cucurbita pepo using SRAP and AFLP markers.

    PubMed

    Ferriol, M; Picó, B; Nuez, F

    2003-07-01

    Cucurbita pepo is a highly polymorphic species. The cultivars can be grouped into eight morphotypes in two subspecies, ssp. pepo and ssp. ovifera. A collection of 69 accessions representative of the morphotypes and some unclassified types was used for analysing the morphological and molecular diversity of this species. This collection includes commercial cultivars and Spanish landraces, which represent the great diversification of types that have arisen in Europe after this species arrived from America. For the molecular variability studies, two PCR-based systems were employed, AFLP and SRAP, which preferentially amplify ORFs. Principal coordinates analysis and cluster analysis using the UPGMA method clearly separate the accessions into the two subspecies through the use of both markers. However, the gene diversity and the genetic identity values among morphotypes and subspecies varied between the two marker systems. The information given by SRAP markers was more concordant to the morphological variability and to the evolutionary history of the morphotypes than that of AFLP markers. In ssp. ovifera, the accessions of the different morphotypes were basically grouped according to the fruit colour. This may indicate different times of development and also the extent of breeding in the accessions used. This study has allowed identification of new types that can be employed for the development of new cultivars. The landraces of the spp. ovifera, used as ornamental in Europe, have proved to be of great interest for preserving the diversity of C. pepo.

  4. Genome-Wide Characterization of Simple Sequence Repeat (SSR) Loci in Chinese Jujube and Jujube SSR Primer Transferability

    PubMed Central

    Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui

    2015-01-01

    Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization. PMID:26000739

  5. Impact of primer choice on characterization of orchid mycorrhizal communities using 454 pyrosequencing.

    PubMed

    Waud, Michael; Busschaert, Pieter; Ruyters, Stefan; Jacquemyn, Hans; Lievens, Bart

    2014-07-01

    Although the number of studies investigating mycorrhizal associations in orchids has increased in recent years, the fungal communities associating with orchids and how they differ between species and sites remain unclear. Recent research has indicated that individual orchid plants may associate with several fungi concurrently, implying that to study mycorrhizal associations in orchids the fungal community should be assessed, rather than the presence of individual dominant fungal species or strains. High-throughput sequencing methods, such as 454 pyrosequencing, are increasingly used as the primary tool for such analyses. However, many studies combine universal primers from previous phylogenetic or ecological studies to generate amplicons suitable for 454 pyrosequencing without first critically evaluating their performance, potentially resulting in biased fungal community descriptions. Here, following in silico primer analysis we evaluated the performance of different combinations of existing PCR primers to characterize orchid mycorrhizal communities using 454 pyrosequencing by analysis of both an artificially assembled community of mycorrhizal fungi isolated from diverse orchid species and root samples from three different orchid species (Anacamptis morio, Ophrys tenthredinifera and Serapias lingua). Our results indicate that primer pairs ITS3/ITS4OF and ITS86F/ITS4, targeting the internal transcribed spacer-2 (ITS-2) region, outperformed other tested primer pairs in terms of number of reads, number of operational taxonomic units recovered from the artificial community and number of different orchid mycorrhizal associating families detected in the orchid samples. Additionally, we show the complementary specificity of both primer pairs, making them highly suitable for tandem use when studying the diversity of orchid mycorrhizal communities.

  6. Species-specific PCR primers for the rapid identification of yeasts of the genus Zygosaccharomyces.

    PubMed

    Harrison, Elizabeth; Muir, Alastair; Stratford, Malcolm; Wheals, Alan

    2011-06-01

    Species-specific primer pairs that produce a single band of known product size have been developed for members of the Zygosaccharomyces clade including Zygosaccharomyces bailii, Zygosaccharomyces bisporus, Zygosaccharomyces kombuchaensis, Zygosaccharomyces lentus, Zygosaccharomyces machadoi, Zygosaccharomyces mellis and Zygosaccharomyces rouxii. An existing primer pair for the provisional new species Zygosaccharomyces pseudorouxii has been confirmed as specific. The HIS3 gene, encoding imidazole-glycerolphosphate dehydratase, was used as the target gene. This housekeeping gene evolves slowly and is thus well conserved among different isolates, but shows a significant number of base pair changes between even closely related species, sufficient for species-specific primer design. The primers were tested on type and wild strains of the genus Zygosaccharomyces and on members of the Saccharomycetaceae. Sequencing of the D1/D2 region of rDNA was used to confirm the identification of all nonculture collection isolates. This approach used extracted genomic DNA, but in practice, it can be used efficiently with a rapid colony PCR protocol. The method also successfully detected known and new hybrid strains of Z. rouxii and Z. pseudorouxii. The method is rapid, robust and inexpensive. It requires little expertise by the user and is thus useful for preliminary, large-scale screens.

  7. Primer and platform effects on 16S rRNA tag sequencing

    DOE PAGES

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; ...

    2015-08-04

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

  8. Primer and platform effects on 16S rRNA tag sequencing

    SciTech Connect

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; Kirton, Edward S.; He, Shaomei; Woyke, Tanja; Lee, Janey; Chen, Feng; Dangl, Jeffery L.; Tringe, Susannah G.

    2015-08-04

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as well as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.

  9. Impact of deep coalescence and recombination on the estimation of phylogenetic relationships among species using AFLP markers.

    PubMed

    García-Pereira, María Jesús; Carvajal-Rodríguez, Antonio; Whelan, Simon; Caballero, Armando; Quesada, Humberto

    2014-07-01

    Deep coalescence and the nongenealogical pattern of descent caused by recombination have emerged as a common problem for phylogenetic inference at the species level. Here we use computer simulations to assess whether AFLP-based phylogenies are robust to the uncertainties introduced by these factors. Our results indicate that phylogenetic signal can prevail even in the face of extensive deep coalescence allowing recovering the correct species tree topology. The impact of recombination on tree accuracy was related to total tree depth and species effective population size. The correct tree topology could be recovered upon many simulation settings due to a trade-off between the conflicting signals resulting from intra-locus recombination and the benefits of the joint consideration of unlinked loci that better matched overall the true species tree. Errors in tree topology were not only determined by deep coalescence, but also by the timing of divergence and the tree-building errors arising from an insufficient number of characters. DNA sequences generally outperformed AFLPs upon any simulated scenario, but this difference in performance was nearly negligible when a sufficient number of AFLP characters were sampled. Our simulations suggest that the impact of deep coalescence and intra-locus recombination on the reliability of AFLP trees could be minimal for effective population sizes equal to or lower than 10,000 (typical of many vertebrates and tree plants) given tree depths above 0.02 substitutions per site.

  10. First genetic linkage map of Taraxacum koksaghyz Rodin based on AFLP, SSR, COS and EST-SSR markers.

    PubMed

    Arias, Marina; Hernandez, Monica; Remondegui, Naroa; Huvenaars, Koen; van Dijk, Peter; Ritter, Enrique

    2016-08-04

    Taraxacum koksaghyz Rodin (TKS) has been studied in many occasions as a possible alternative source for natural rubber production of good quality and for inulin production. Some tire companies are already testing TKS tire prototypes. There are also many investigations on the production of bio-fuels from inulin and inulin applications for health improvement and in the food industry. A limited amount of genomic resources exist for TKS and particularly no genetic linkage map is available in this species. We have constructed the first TKS genetic linkage map based on AFLP, COS, SSR and EST-SSR markers. The integrated linkage map with eight linkage groups (LG), representing the eight chromosomes of Russian dandelion, has 185 individual AFLP markers from parent 1, 188 individual AFLP markers from parent 2, 75 common AFLP markers and 6 COS, 1 SSR and 63 EST-SSR loci. Blasting the EST-SSR sequences against known sequences from lettuce allowed a partial alignment of our TKS map with a lettuce map. Blast searches against plant gene databases revealed some homologies with useful genes for downstream applications in the future.

  11. First genetic linkage map of Taraxacum koksaghyz Rodin based on AFLP, SSR, COS and EST-SSR markers

    PubMed Central

    Arias, Marina; Hernandez, Monica; Remondegui, Naroa; Huvenaars, Koen; van Dijk, Peter; Ritter, Enrique

    2016-01-01

    Taraxacum koksaghyz Rodin (TKS) has been studied in many occasions as a possible alternative source for natural rubber production of good quality and for inulin production. Some tire companies are already testing TKS tire prototypes. There are also many investigations on the production of bio-fuels from inulin and inulin applications for health improvement and in the food industry. A limited amount of genomic resources exist for TKS and particularly no genetic linkage map is available in this species. We have constructed the first TKS genetic linkage map based on AFLP, COS, SSR and EST-SSR markers. The integrated linkage map with eight linkage groups (LG), representing the eight chromosomes of Russian dandelion, has 185 individual AFLP markers from parent 1, 188 individual AFLP markers from parent 2, 75 common AFLP markers and 6 COS, 1 SSR and 63 EST-SSR loci. Blasting the EST-SSR sequences against known sequences from lettuce allowed a partial alignment of our TKS map with a lettuce map. Blast searches against plant gene databases revealed some homologies with useful genes for downstream applications in the future. PMID:27488242

  12. AFLP Genome Scanning Reveals Divergent Selection in Natural Populations of Liriodendron chinense (Magnoliaceae) along a Latitudinal Transect

    PubMed Central

    Yang, Ai-Hong; Wei, Na; Fritsch, Peter W.; Yao, Xiao-Hong

    2016-01-01

    Understanding adaptive genetic variation and its relation to environmental factors are important for understanding how plants adapt to climate change and for managing genetic resources. Genome scans for the loci exhibiting either notably high or low levels of population differentiation (outlier loci) provide one means of identifying genomic regions possibly associated with convergent or divergent selection. In this study, we combined Amplified Fragment Length Polymorphism (AFLP) genome scan and environmental association analysis to test for signals of natural selection in natural populations of Liriodendron chinense (Chinese Tulip Tree; Magnoliaceae) along a latitudinal transect. We genotyped 276 individuals from 11 populations of L. chinense using 987 AFLP markers. Both frequency-based (Dfdist and BayeScan) and correlation-based (MLM) methods were applied to detect outlier loci. Our analyses recovered both neutral and potentially adaptive genetic differentiation among populations of L. chinense. We found moderate genetic diversity within populations and high genetic differentiation among populations with reduced genetic diversity toward the periphery of the species ranges. Nine AFLP marker loci showed evidence of being outliers for population differentiation for both detection methods. Of these, six were strongly associated with at least one climate factor. Temperature, precipitation, and radiation were found to be three important factors influencing local adaptation of L. chinense. The outlier AFLP loci are likely not the target of natural selection, but the neighboring genes of these loci might be involved in local adaptation. Hence, these candidates should be validated by further studies. PMID:27303414

  13. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

    PubMed

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

    2015-12-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

  14. The possible physical barrier and coastal dispersal strategy for Japanese grenadier anchovy, Coilia nasus in the East China Sea and Yellow Sea: evidence from AFLP markers.

    PubMed

    Han, Zhi-Qiang; Han, Gang; Wang, Zhi-Yong; Gao, Tian-Xiang

    2015-02-03

    In order to ascertain the taxonomic status of the Ariake Sea population of Japanese grenadier anchovy, Coilia nasus, and assess the contemporary possible genetic barrier between the west and east coastal waters of the East China Sea, we used amplified fragment length polymorphism (AFLP) markers to detect the genetic structure of C. nasus, in the East China Sea and Yellow Sea. Eighty-one individuals of C. nasus were collected from five locations and 12 individuals of Coilia mystus were sampled from the Yangtze River Estuary. A total of 371 loci were detected by five primer combinations, 310 of which were polymorphic (83.56%). Analysis of molecular variation (AMOVA) and pairwise fixation index (FST) revealed significant genetic differentiation among five samples, indicating limited gene flow among populations. The dendrogram for populations by neighbor-joining (NJ) cluster analysis provided evidence of a clear relationship between genetic and geographic patterns, supporting significant genetic differentiation between China coastal populations and Ariake Sea populations. Compared to the genetic divergence between C. nasus and C. mystus, the level of genetic differentiation between China and the Ariake Sea populations of C. nasus is obvious below the species level, indicating isolated populations of C. nasus in the Ariake Sea. Isolation by distance analysis revealed that direct ocean distance with deep-water at the continental slope and high salinity between west and east coastal waters of the East China Sea served as major physical barrier to C. nasus, supporting the coastal dispersal pattern in this estuarine species, and rejecting offshore dispersal strategy.

  15. The Possible Physical Barrier and Coastal Dispersal Strategy for Japanese Grenadier Anchovy, Coilia nasus in the East China Sea and Yellow Sea: Evidence from AFLP Markers

    PubMed Central

    Han, Zhi-Qiang; Han, Gang; Wang, Zhi-Yong; Gao, Tian-Xiang

    2015-01-01

    In order to ascertain the taxonomic status of the Ariake Sea population of Japanese grenadier anchovy, Coilia nasus, and assess the contemporary possible genetic barrier between the west and east coastal waters of the East China Sea, we used amplified fragment length polymorphism (AFLP) markers to detect the genetic structure of C. nasus, in the East China Sea and Yellow Sea. Eighty-one individuals of C. nasus were collected from five locations and 12 individuals of Coilia mystus were sampled from the Yangtze River Estuary. A total of 371 loci were detected by five primer combinations, 310 of which were polymorphic (83.56%). Analysis of molecular variation (AMOVA) and pairwise fixation index (FST) revealed significant genetic differentiation among five samples, indicating limited gene flow among populations. The dendrogram for populations by neighbor-joining (NJ) cluster analysis provided evidence of a clear relationship between genetic and geographic patterns, supporting significant genetic differentiation between China coastal populations and Ariake Sea populations. Compared to the genetic divergence between C. nasus and C. mystus, the level of genetic differentiation between China and the Ariake Sea populations of C. nasus is obvious below the species level, indicating isolated populations of C. nasus in the Ariake Sea. Isolation by distance analysis revealed that direct ocean distance with deep-water at the continental slope and high salinity between west and east coastal waters of the East China Sea served as major physical barrier to C. nasus, supporting the coastal dispersal pattern in this estuarine species, and rejecting offshore dispersal strategy. PMID:25654225

  16. Primer on spontaneous heating and pyrophoricity

    SciTech Connect

    Not Available

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  17. Prim-SNPing: a primer designer for cost-effective SNP genotyping.

    PubMed

    Chang, Hsueh-Wei; Chuang, Li-Yeh; Cheng, Yu-Huei; Hung, Yu-Chen; Wen, Cheng-Hao; Gu, De-Leung; Yang, Cheng-Hong

    2009-05-01

    Many kinds of primer design (PD) software tools have been developed, but most of them lack a single nucleotide polymorphism (SNP) genotyping service. Here, we introduce the web-based freeware "Prim-SNPing," which, in addition to general PD, provides three kinds of primer design functions for cost-effective SNP genotyping: natural PD, mutagenic PD, and confronting two-pair primers (CTPP) PD. The natural PD and mutagenic PD provide primers and restriction enzyme mining for polymerase chain reaction-restriction fragment of length polymorphism (PCR-RFLP), while CTPP PD provides primers for restriction enzyme-free SNP genotyping. The PCR specificity and efficiency of the designed primers are improved by BLAST searching and evaluating secondary structure (such as GC clamps, dimers, and hairpins), respectively. The length pattern of PCR-RFLP using natural PD is user-adjustable, and the restriction sites of the RFLP enzymes provided by Prim-SNPing are confirmed to be absent within the generated PCR product. In CTPP PD, the need for a separate digestion step in RFLP is eliminated, thus making it faster and cheaper. The output of Prim-SNPing includes the primer list, melting temperature (Tm) value, GC percentage, and amplicon size with enzyme digestion information. The reference SNP (refSNP, or rs) clusters from the Single Nucleotide Polymorphism database (dbSNP) at the National Center for Biotechnology Information (NCBI), and multiple other formats of human, mouse, and rat SNP sequences are acceptable input. In summary, Prim-SNPing provides interactive, user-friendly and cost-effective primer design for SNP genotyping. It is freely available at http://bio.kuas.edu.tw/prim-snping.

  18. Multiplexing Short Primers for Viral Family PCR

    SciTech Connect

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  19. Use of labeled primers for differential display

    SciTech Connect

    Paunesku, T.; Woloschak, G.E.

    1995-01-01

    Two artifacts introduced in using differential display technology are (1) random priming from dT present from affinity purification of PolyA+ RNA and (2) hybridization of the arbitrary primer to template target sequences on both cDNA strands. We have developed a method eliminating both problems. By separately using 5`-end-labeled (T){sub 12}XY and arbitrary primers to label bands and comparing two differential display patterns, we can detect only those products incorporating the (T){sub 12}XY primer on the 3` ends and the arbitrary primer on 5` ends. Those bands that are generated randomly in the PCR are readily detectable and can be ignored.

  20. Climate Ready Estuaries Rolling Easements Primer

    EPA Pesticide Factsheets

    Rolling easements enable wetlands and beaches to migrate inland and allow society to avoid the costs and hazards of protecting low lands from rising sea levels. This document provides a primer on more than a dozen rolling easement approaches.

  1. PCR hot-start using duplex primers.

    PubMed

    Kong, Deming; Shen, Hanxi; Huang, Yanping; Mi, Huaifeng

    2004-02-01

    A new technique of PCR hot-start using duplex primers has been developed which can decrease the undesirable products arising throughout PCR amplification thereby giving better results than a manual hot-start method.

  2. Comparative analysis of oligonucleotide primers for high-throughput screening of genes encoding adenylation domains of nonribosomal peptide synthetases in actinomycetes.

    PubMed

    Bakal, Tomas; Goo, Kian-Sim; Najmanova, Lucie; Plhackova, Kamila; Kadlcik, Stanislav; Ulanova, Dana

    2015-11-01

    In the biosynthesis of diverse natural bioactive products the adenylation domains (ADs) of nonribosomal peptide synthetases select specific precursors from the cellular pool and activate them for further incorporation into the scaffold of the final compound. Therefore, the drug discovery programs employing PCR-based screening studies of microbial collections or metagenomic libraries often use AD-coding genes as markers of relevant biosynthetic gene clusters. However, due to significant sequence diversity of ADs, the conventional approach using only one primer pair in a single screening experiment could be insufficient for maximal coverage of AD abundance. In this study, the widely used primer pair A3F/A7R was compared with the newly designed aa194F/aa413R one by 454 pyrosequencing of two sets of actinomycete strains from highly dissimilar environments: subseafloor sediments and forest soil. Individually, none of the primer pairs was able to cover the overall diversity of ADs. However, due to slightly shifted specificity of the primer pairs, the total number and diversity of identified ADs were noticeably extended when both primer pairs were used in a single assay. Additionally, the efficiency of AD detection by different primer combinations was confirmed on the model of Salinispora tropica genomic DNA of known sequence.

  3. A Dozen Primers on Important Information Standards

    ERIC Educational Resources Information Center

    Dempsey, Kathy, Comp.

    2007-01-01

    This is a compilation of 12 primers on important information standards and protocols. These primers are: (1) Atom; (2) COinS; (3) MADS; (4) MARC 21/MARCXML; (5) MIX; (6) MXG; (7) OpenSearch; (8) PREMIS; (9) RESTful HTTP; (10) unAPI; (11) XMPP (aka Jabber); and (12) ZeeRex. The Atom Syndication Format defines a new XML-based syndication format for…

  4. Protective Coats For Zinc-Rich Primers

    NASA Technical Reports Server (NTRS)

    Macdowell, Louis G, III

    1993-01-01

    Report describes tests of topcoats for inorganic zinc-rich primers on carbon steel. Topcoats intended to provide additional protection against corrosion in acidic, salty seacoast-air/rocket-engine-exhaust environment of Space Shuttle launch site. Tests focused on polyurethane topcoats on epoxy tie coats on primers. Part of study involved comparison between "high-build" coating materials and thin-film coating materials.

  5. Use of labeled primers for differential display

    SciTech Connect

    Paunesku, T.; Woloschak, G.E.

    1995-02-01

    The differential display of eukaryotic cDNAs using PCR allows for determination of mRNA species differentially expressed when comparing two similar cell populations. This procedure uses a (T){sub 12}XY oligonucleotide as the 3 ft primer and an arbitrary 8-10-mer as the 5 ft primer. Labeling occurs by inclusion of {alpha}[{sup 33}P]-dATP in the PCR reaction. Two artifacts caused by this approach are (1) random printing from dT present from affinity purification of PolyA+RNA and (2) hybridization of the arbitrary primer to template target sequences on both cDNA strands. In this work, we have developed an approach for both eliminating smearing and identifying nonspecific bands on sequencing gels. By separately using 5 ft-end-labeled (T){sub 12}XY and arbitrary primers to label bands and comparing two differential display patterns rather than including labeled nucleotides in the PCR reaction itself, we can detect only those products incorporating the M{sub 12}XY primer on the 3 ft ends and the arbitrary primer on 5 ft ends. Those bands that are generated randomly in the PCR reaction are readily detectable and can be ignored. If on the other hand, one is interested only in a diagnostic banding pattern for differential display, benefit can be derived from the simplicity of the pattern obtained when labeled (T){sub 12}XY is used.

  6. AFLP-based genetic mapping of the “bud-flowering” trait in heather (Calluna vulgaris)

    PubMed Central

    2013-01-01

    Background Calluna vulgaris is one of the most important landscaping plants produced in Germany. Its enormous economic success is due to the prolonged flower attractiveness of mutants in flower morphology, the so-called bud-bloomers. In this study, we present the first genetic linkage map of C. vulgaris in which we mapped a locus of the economically highly desired trait “flower type”. Results The map was constructed in JoinMap 4.1. using 535 AFLP markers from a single mapping population. A large fraction (40%) of markers showed distorted segregation. To test the effect of segregation distortion on linkage estimation, these markers were sorted regarding their segregation ratio and added in groups to the data set. The plausibility of group formation was evaluated by comparison of the “two-way pseudo-testcross” and the “integrated” mapping approach. Furthermore, regression mapping was compared to the multipoint-likelihood algorithm. The majority of maps constructed by different combinations of these methods consisted of eight linkage groups corresponding to the chromosome number of C. vulgaris. Conclusions All maps confirmed the independent inheritance of the most important horticultural traits “flower type”, “flower colour”, and “leaf colour”. An AFLP marker for the most important breeding target “flower type” was identified. The presented genetic map of C. vulgaris can now serve as a basis for further molecular marker selection and map-based cloning of the candidate gene encoding the unique flower architecture of C. vulgaris bud-bloomers. PMID:23915059

  7. A first linkage map of pecan cultivars based on RAPD and AFLP markers.

    PubMed

    Beedanagari, Sudheer R; Dove, Sue K; Wood, Bruce W; Conner, Patrick J

    2005-04-01

    We report here the first genetic linkage maps of pecan [Carya illinoinensis (Wangenh.) K. Koch], using random amplified polymorphic DNA (RAPD) and amplified fragment length polymorphism (AFLP) markers. Independent maps were constructed for the cultivars 'Pawnee' and 'Elliot' using the double pseudo-testcross mapping strategy and 120 F1 seedlings from a full-sib family. A total of 477 markers, including 217 RAPD, 258 AFLP, and two morphological markers were used in linkage analysis. The 'Pawnee' linkage map has 218 markers, comprising 176 testcross and 42 intercross markers placed in 16 major and 13 minor (doublets and triplets) linkage groups. The 'Pawnee' linkage map covered 2,227 cM with an average map distance of 12.7 cM between adjacent markers. The 'Elliot' linkage map has 174 markers comprising 150 testcross and 22 intercross markers placed in 17 major and nine minor linkage groups. The 'Elliot' map covered 1,698 cM with an average map distance of 11.2 cM between adjacent markers. Segregation ratios for dichogamy type and stigma color were not significantly different from 1:1, suggesting that both traits are controlled by single loci with protogyny and green stigmas dominant to protandry and red stigmas. These loci were tightly linked (1.9 cM) and were placed in 'Elliot' linkage group 16. These linkage maps are an important first step towards the detection of genes controlling horticulturally important traits such as nut size, nut maturity date, kernel quality, and disease resistance.

  8. PCR primers for 30 novel gene regions in the nuclear genomes of Lepidoptera

    PubMed Central

    Wahlberg, Niklas; Peña, Carlos; Ahola, Milla; Wheat, Christopher W.; Rota, Jadranka

    2016-01-01

    Abstract We report primer pairs for 30 new gene regions in the nuclear genomes of Lepidoptera that can be amplified using a standard PCR protocol. The new primers were tested across diverse Lepidoptera, including nonditrysians and a wide selection of ditrysians. These new gene regions give a total of 11,043 bp of DNA sequence data and they show similar variability to traditionally used nuclear gene regions in studies of Lepidoptera. We feel that a PCR-based approach still has its place in molecular systematic studies of Lepidoptera, particularly at the intrafamilial level, and our new set of primers now provides a route to generating phylogenomic datasets using traditional methods. PMID:27408580

  9. Searching for Beta-Haemolysin hlb Gene in Staphylococcus pseudintermedius with Species-Specific Primers.

    PubMed

    Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin

    2016-07-01

    The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification.

  10. Significant population genetic structure detected in the rock bream Oplegnathus fasciatus (Temminck & Schlegel, 1844) inferred from fluorescent-AFLP analysis

    NASA Astrophysics Data System (ADS)

    Xiao, Yongshuang; Ma, Daoyuan; Xu, Shihong; Liu, Qinghua; Wang, Yanfeng; Xiao, Zhizhong; Li, Jun

    2016-05-01

    Oplegnathus fasciatus (rock bream) is a commercial rocky reef fish species in East Asia that has been considered for aquaculture. We estimated the population genetic diversity and population structure of the species along the coastal waters of China using fluorescent-amplified fragment length polymorphisms technology. Using 53 individuals from three populations and four pairs of selective primers, we amplified 1 264 bands, 98.73% of which were polymorphic. The Zhoushan population showed the highest Nei's genetic diversity and Shannon genetic diversity. The results of analysis of molecular variance (AMOVA) showed that 59.55% of genetic variation existed among populations and 40.45% occurred within populations, which indicated that a significant population genetic structure existed in the species. The pairwise fixation index F st ranged from 0.20 to 0.63 and were significant after sequential Bonferroni correction. The topology of an unweighted pair group method with arithmetic mean tree showed two significant genealogical branches corresponding to the sampling locations of North and South China. The AMOVA and STRUCTURE analyses suggested that the O. fasciatus populations examined should comprise two stocks.

  11. Design and validation of four new primers for next-generation sequencing to target the 18S rRNA genes of gastrointestinal ciliate protozoa.

    PubMed

    Ishaq, Suzanne L; Wright, André-Denis G

    2014-09-01

    Four new primers and one published primer were used to PCR amplify hypervariable regions within the protozoal 18S rRNA gene to determine which primer pair provided the best identification and statistical analysis. PCR amplicons of 394 to 498 bases were generated from three primer sets, sequenced using Roche 454 pyrosequencing with Titanium, and analyzed using the BLAST database (NCBI) and MOTHUR version 1.29. The protozoal diversity of rumen contents from moose in Alaska was assessed. In the present study, primer set 1, P-SSU-316F and GIC758R (amplicon of 482 bases), gave the best representation of diversity using BLAST classification, and the set amplified Entodinium simplex and Ostracodinium spp., which were not amplified by the other two primer sets. Primer set 2, GIC1080F and GIC1578R (amplicon of 498 bases), had similar BLAST results and a slightly higher percentage of sequences that were identified with a higher sequence identity. Primer sets 1 and 2 are recommended for use in ruminants. However, primer set 1 may be inadequate to determine protozoal diversity in nonruminants. The amplicons created by primer set 1 were indistinguishable for certain species within the genera Bandia, Blepharocorys, Polycosta, and Tetratoxum and between Hemiprorodon gymnoprosthium and Prorodonopsis coli, none of which are normally found in the rumen.

  12. Design and Validation of Four New Primers for Next-Generation Sequencing To Target the 18S rRNA Genes of Gastrointestinal Ciliate Protozoa

    PubMed Central

    Wright, André-Denis G.

    2014-01-01

    Four new primers and one published primer were used to PCR amplify hypervariable regions within the protozoal 18S rRNA gene to determine which primer pair provided the best identification and statistical analysis. PCR amplicons of 394 to 498 bases were generated from three primer sets, sequenced using Roche 454 pyrosequencing with Titanium, and analyzed using the BLAST database (NCBI) and MOTHUR version 1.29. The protozoal diversity of rumen contents from moose in Alaska was assessed. In the present study, primer set 1, P-SSU-316F and GIC758R (amplicon of 482 bases), gave the best representation of diversity using BLAST classification, and the set amplified Entodinium simplex and Ostracodinium spp., which were not amplified by the other two primer sets. Primer set 2, GIC1080F and GIC1578R (amplicon of 498 bases), had similar BLAST results and a slightly higher percentage of sequences that were identified with a higher sequence identity. Primer sets 1 and 2 are recommended for use in ruminants. However, primer set 1 may be inadequate to determine protozoal diversity in nonruminants. The amplicons created by primer set 1 were indistinguishable for certain species within the genera Bandia, Blepharocorys, Polycosta, and Tetratoxum and between Hemiprorodon gymnoprosthium and Prorodonopsis coli, none of which are normally found in the rumen. PMID:24973070

  13. Ion pair receptors†

    PubMed Central

    Kim, Sung Kuk

    2010-01-01

    Compared with simple ion receptors, which are able to bind either a cation or an anion, ion pair receptors bearing both a cation and an anion recognition site offer the promise of binding ion pairs or pairs of ions strongly as the result of direct or indirect cooperative interactions between co-bound ions. This critical review focuses on the recent progress in the design of ion pair receptors and summarizes the various binding modes that have been used to accommodate ion pairs (110 references). PMID:20737073

  14. Design and Implementation of Degenerate Microsatellite Primers for the Mammalian Clade

    PubMed Central

    Buschiazzo, Emmanuel; Beck, Josephine S.; Gemmell, Neil J.

    2011-01-01

    Microsatellites are popular genetic markers in molecular ecology, genetic mapping and forensics. Unfortunately, despite recent advances, the isolation of de novo polymorphic microsatellite loci often requires expensive and intensive groundwork. Primers developed for a focal species are commonly tested in a related, non-focal species of interest for the amplification of orthologous polymorphic loci; when successful, this approach significantly reduces cost and time of microsatellite development. However, transferability of polymorphic microsatellite loci decreases rapidly with increasing evolutionary distance, and this approach has shown its limits. Whole genome sequences represent an under-exploited resource to develop cross-species primers for microsatellites. Here we describe a three-step method that combines a novel in silico pipeline that we use to (1) identify conserved microsatellite loci from a multiple genome alignments, (2) design degenerate primer pairs, with (3) a simple PCR protocol used to implement these primers across species. Using this approach we developed a set of primers for the mammalian clade. We found 126,306 human microsatellites conserved in mammalian aligned sequences, and isolated 5,596 loci using criteria based on wide conservation. From a random subset of ∼1000 dinucleotide repeats, we designed degenerate primer pairs for 19 loci, of which five produced polymorphic fragments in up to 18 mammalian species, including the distinctly related marsupials and monotremes, groups that diverged from other mammals 120–160 million years ago. Using our method, many more cross-clade microsatellite loci can be harvested from the currently available genomic data, and this ability is set to improve exponentially as further genomes are sequenced. PMID:22216321

  15. DegePrime, a program for degenerate primer design for broad-taxonomic-range PCR in microbial ecology studies.

    PubMed

    Hugerth, Luisa W; Wefer, Hugo A; Lundin, Sverker; Jakobsson, Hedvig E; Lindberg, Mathilda; Rodin, Sandra; Engstrand, Lars; Andersson, Anders F

    2014-08-01

    The taxonomic composition of a microbial community can be deduced by analyzing its rRNA gene content by, e.g., high-throughput DNA sequencing or DNA chips. Such methods typically are based on PCR amplification of rRNA gene sequences using broad-taxonomic-range PCR primers. In these analyses, the use of optimal primers is crucial for achieving an unbiased representation of community composition. Here, we present the computer program DegePrime that, for each position of a multiple sequence alignment, finds a degenerate oligomer of as high coverage as possible and outputs its coverage among taxonomic divisions. We show that our novel heuristic, which we call weighted randomized combination, performs better than previously described algorithms for solving the maximum coverage degenerate primer design problem. We previously used DegePrime to design a broad-taxonomic-range primer pair that targets the bacterial V3-V4 region (341F-805R) (D. P. Herlemann, M. Labrenz, K. Jurgens, S. Bertilsson, J. J. Waniek, and A. F. Andersson, ISME J. 5:1571-1579, 2011, http://dx.doi.org/10.1038/ismej.2011.41), and here we use the program to significantly increase the coverage of a primer pair (515F-806R) widely used for Illumina-based surveys of bacterial and archaeal diversity. By comparison with shotgun metagenomics, we show that the primers give an accurate representation of microbial diversity in natural samples.

  16. PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes

    DOE PAGES

    Yoon, Hyejin; Leitner, Thomas

    2014-12-17

    Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-Mmore » finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.« less

  17. PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes

    SciTech Connect

    Yoon, Hyejin; Leitner, Thomas

    2014-12-17

    Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-M finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.

  18. Microsatellite primers for the rare sedge Lepidosperma bungalbin (Cyperaceae)1

    PubMed Central

    Nevill, Paul G.; Wardell-Johnson, Grant

    2016-01-01

    Premise of the study: Microsatellite markers were developed for the rare sedge Lepidosperma bungalbin (Cyperaceae) to assess genetic variation and its spatial structuring. Methods and Results: We conducted shotgun sequencing on an Illumina MiSeq and produced 6,215,872 sequence reads. The QDD pipeline was used to design 60 primer pairs that were screened using PCR. We developed 17 loci, of which 12 loci were identified that were polymorphic, amplified reliably, and could be consistently scored. We then screened these loci for variation in individuals from three populations. The number of alleles observed for these 12 loci across the three populations ranged from nine to 19 and expected heterozygosity ranged from 0.41 to 0.89. Conclusions: These markers will enable the quantification of the potential impact of mining on genetic variation within L. bungalbin and establish a baseline for future management of genetic variation of the rare sedge. PMID:27843727

  19. Beam shaping for laser initiated optical primers

    NASA Astrophysics Data System (ADS)

    Lizotte, Todd E.

    2008-08-01

    Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.

  20. A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

    DOE PAGES

    Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

    2015-12-09

    The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less

  1. A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

    SciTech Connect

    Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

    2015-12-09

    The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable region of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.

  2. Improving AFLP analysis of large-scale patterns of genetic variation--a case study with the Central African lianas Haumania spp (Marantaceae) showing interspecific gene flow.

    PubMed

    Ley, A C; Hardy, O J

    2013-04-01

    AFLP markers are often used to study patterns of population genetic variation and gene flow because they offer a good coverage of the nuclear genome, but the reliability of AFLP scoring is critical. To assess interspecific gene flow in two African rainforest liana species (Haumania danckelmaniana, H. liebrechtsiana) where previous evidence of chloroplast captures questioned the importance of hybridization and species boundaries, we developed new AFLP markers and a novel approach to select reliable bands from their degree of reproducibility. The latter is based on the estimation of the broad-sense heritability of AFLP phenotypes, an improvement over classical scoring error rates, which showed that the polymorphism of most AFLP bands was affected by a substantial nongenetic component. Therefore, using a quantitative genetics framework, we also modified an existing estimator of pairwise kinship coefficient between individuals correcting for the limited heritability of markers. Bayesian clustering confirms the recognition of the two Haumania species. Nevertheless, the decay of the relatedness between individuals of distinct species with geographic distance demonstrates that hybridization affects the nuclear genome. In conclusion, although we showed that AFLP markers might be substantially affected by nongenetic factors, their analysis using the new methods developed considerably advanced our understanding of the pattern of gene flow in our model species.

  3. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    NASA Astrophysics Data System (ADS)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  4. Enhanced primers for amplification of DNA barcodes from a broad range of marine metazoans

    PubMed Central

    2013-01-01

    Background Building reference libraries of DNA barcodes is relatively straightforward when specifically designed primers are available to amplify the COI-5P region from a relatively narrow taxonomic group (e.g. single class or single order). DNA barcoding marine communities have been comparatively harder to accomplish due to the broad taxonomic diversity and lack of consistently efficient primers. Although some of the so-called “universal” primers have been relatively successful, they still fail to amplify COI-5P of many marine animal groups, while displaying random success even among species within each group. Here we propose a new pair of primers designed to enhance amplification of the COI-5P region in a wide range of marine organisms. Results Amplification tests conducted on a wide range of marine animal taxa, rendered possible the first–time sequencing of DNA barcodes from eight separated phyla (Annelida, Arthropoda, Chordata, Cnidaria, Echinodermata, Mollusca, Nemertea and Platyhelminthes), comprising a total of 14 classes, 28 orders, 57 families, 68 genus and 76 species. Conclusions These primers demonstrated to be highly cost-effective, which is of key importance for DNA barcoding procedures, such as for building comprehensive DNA barcode libraries of marine communities, where the processing of a large numbers of specimens from a wide variety of marine taxa is compulsory. PMID:24020880

  5. Nano-magnetic primer based electrochemiluminescence-polymerase chain reaction (NMPE-PCR) assay.

    PubMed

    Zhu, Xiao; Zhou, Xiaoming; Xing, Da

    2012-01-15

    Here we have developed a novel nano-magnetic primer based electrochemiluminescence-polymerase chain reaction (NMPE-PCR) strategy for detection of genome. The key idea of this method is integrating the two in situ processes: PCR on the surface of magnetic nanoparticles (MNPs) and magnetic beads based ECL readout platform, to avoid some laborious manual operations and achieve rapid yet sensitive detection. At first, the approach employs a pair of functional primers for amplification: one is tris-(2,2'-bipyridyl) ruthenium (TBR) labeled primer; the other one is nano-magnetic primer which is prepared by attaching the primer to the surfaces of MNPs. With the presence of DNA analyte and PCR mixture, the TBR labeled products are directly loaded and enriched on the surface of MNPs during PCR cycling. Then the MNPs-TBR complexes can be analyzed by a magnetic ECL platform without any post-modification or post-incubation. Finally, we used Listeria monocytogenes as the target to examine these desirable properties of this assay, reaching a detection limit of 500 fg/μL for genome in 1 h. The proposed study has provided the evidence as a proof-of-concept, thus having potential for development of automatic mode for detection of specific gene.

  6. Primers on Special Education and Charter Schools: Compilation of Full Primer Set

    ERIC Educational Resources Information Center

    Ahearn, Eileen M.; Giovannetti, Elizabeth A.; Lange, Cheryl M.; Rhim, Lauren Morando; Warren, Sandra Hopfengardner

    2004-01-01

    This set of primers for charter school authorizers; charter school operators and state-level administrators has been developed to provide background information and resources for the "builders" of charter schools and policymakers to facilitate the successful inclusion of students with disabilities in charter schools. The primers open…

  7. Exquisite allele discrimination by toehold hairpin primers

    PubMed Central

    Byrom, Michelle; Bhadra, Sanchita; Jiang, Yu Sherry; Ellington, Andrew D.

    2014-01-01

    The ability to detect and monitor single nucleotide polymorphisms (SNPs) in biological samples is an enabling research and clinical tool. We have developed a surprising, inexpensive primer design method that provides exquisite discrimination between SNPs. The field of DNA computation is largely reliant on using so-called toeholds to initiate strand displacement reactions, leading to the execution of kinetically trapped circuits. We have now similarly found that the short toehold sequence to a target of interest can initiate both strand displacement within the hairpin and extension of the primer by a polymerase, both of which will further stabilize the primer:template complex. However, if the short toehold does not bind, neither of these events can readily occur and thus amplification should not occur. Toehold hairpin primers were used to detect drug resistance alleles in two genes, rpoB and katG, in the Mycobacterium tuberculosis genome, and ten alleles in the Escherichia coli genome. During real-time PCR, the primers discriminate between mismatched templates with Cq delays that are frequently so large that the presence or absence of mismatches is essentially a ‘yes/no’ answer. PMID:24990378

  8. RNase H-dependent PCR (rhPCR): improved specificity and single nucleotide polymorphism detection using blocked cleavable primers

    PubMed Central

    2011-01-01

    Background The polymerase chain reaction (PCR) is commonly used to detect the presence of nucleic acid sequences both in research and diagnostic settings. While high specificity is often achieved, biological requirements sometimes necessitate that primers are placed in suboptimal locations which lead to problems with the formation of primer dimers and/or misamplification of homologous sequences. Results Pyrococcus abyssi (P.a.) RNase H2 was used to enable PCR to be performed using blocked primers containing a single ribonucleotide residue which are activated via cleavage by the enzyme (rhPCR). Cleavage occurs 5'-to the RNA base following primer hybridization to the target DNA. The requirement of the primer to first hybridize with the target sequence to gain activity eliminates the formation of primer-dimers and greatly reduces misamplification of closely related sequences. Mismatches near the scissile linkage decrease the efficiency of cleavage by RNase H2, further increasing the specificity of the assay. When applied to the detection of single nucleotide polymorphisms (SNPs), rhPCR was found to be far more sensitive than standard allele-specific PCR. In general, the best discrimination occurs when the mismatch is placed at the RNA:DNA base pair. Conclusion rhPCR eliminates the formation of primer dimers and markedly improves the specificity of PCR with respect to off-target amplification. These advantages of the assay should find utility in challenging qPCR applications such as genotyping, high level multiplex assays and rare allele detection. PMID:21831278

  9. Novel primers for complete mitochondrial cytochrome b gene sequencing in mammals.

    PubMed

    Naidu, Ashwin; Fitak, Robert R; Munguia-Vega, Adrian; Culver, Melanie

    2012-03-01

    Sequence-based species identification relies on the extent and integrity of sequence data available in online databases such as GenBank. When identifying species from a sample of unknown origin, partial DNA sequences obtained from the sample are aligned against existing sequences in databases. When the sequence from the matching species is not present in the database, high-scoring alignments with closely related sequences might produce unreliable results on species identity. For species identification in mammals, the cytochrome b (cyt b) gene has been identified to be highly informative; thus, large amounts of reference sequence data from the cyt b gene are much needed. To enhance availability of cyt b gene sequence data on a large number of mammalian species in GenBank and other such publicly accessible online databases, we identified a primer pair for complete cyt b gene sequencing in mammals. Using this primer pair, we successfully PCR amplified and sequenced the complete cyt b gene from 40 of 44 mammalian species representing 10 orders of mammals. We submitted 40 complete, correctly annotated, cyt b protein coding sequences to GenBank. To our knowledge, this is the first single primer pair to amplify the complete cyt b gene in a broad range of mammalian species. This primer pair can be used for the addition of new cyt b gene sequences and to enhance data available on species represented in GenBank. The availability of novel and complete gene sequences as high-quality reference data can improve the reliability of sequence-based species identification.

  10. Fatal Cryptococcus gattii genotype AFLP6/VGII infection in a HIV-negative patient: case report and a literature review.

    PubMed

    Favalessa, Olivia Cometti; Lázera, Márcia dos Santos; Wanke, Bodo; Trilles, Luciana; Takahara, Doracilde Terumi; Tadano, Tomoko; Dias, Luciana Basili; Vieira, Ananda Castro; Novack, Glaúcia Vanessa; Hahn, Rosane Christine

    2014-10-01

    Cryptococcus gattii, a species belonging to the Cryptococcus complex which occurs endemically in tropical and subtropical regions, has been reported as a causative agent of cryptococcosis in healthy individuals. We report a case of meningitis in HIV-negative patient from Cuiaba, MT, in the Midwestern region of Brazil. Cryptococcus gattii AFLP6/VGII was isolated from cerebrospinal fluid and molecular typing was performed by URA5-RFLP. The in vitro susceptibility profile was determined using the standard method according to the document M27A3, CLSI 2008. C. gattii AFLP6/VGII was shown to be susceptible to the antifungals tested. Treatment with 0.8 mg/kg of amphotericin B was initiated; however, the patient died 2 days after the onset of therapy.

  11. Matched-pair classification

    SciTech Connect

    Theiler, James P

    2009-01-01

    Following an analogous distinction in statistical hypothesis testing, we investigate variants of machine learning where the training set comes in matched pairs. We demonstrate that even conventional classifiers can exhibit improved performance when the input data has a matched-pair structure. Online algorithms, in particular, converge quicker when the data is presented in pairs. In some scenarios (such as the weak signal detection problem), matched pairs can be generated from independent samples, with the effect not only doubling the nominal size of the training set, but of providing the structure that leads to better learning. A family of 'dipole' algorithms is introduced that explicitly takes advantage of matched-pair structure in the input data and leads to further performance gains. Finally, we illustrate the application of matched-pair learning to chemical plume detection in hyperspectral imagery.

  12. Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies

    PubMed Central

    Klindworth, Anna; Pruesse, Elmar; Schweer, Timmy; Peplies, Jörg; Quast, Christian; Horn, Matthias; Glöckner, Frank Oliver

    2013-01-01

    16S ribosomal RNA gene (rDNA) amplicon analysis remains the standard approach for the cultivation-independent investigation of microbial diversity. The accuracy of these analyses depends strongly on the choice of primers. The overall coverage and phylum spectrum of 175 primers and 512 primer pairs were evaluated in silico with respect to the SILVA 16S/18S rDNA non-redundant reference dataset (SSURef 108 NR). Based on this evaluation a selection of ‘best available’ primer pairs for Bacteria and Archaea for three amplicon size classes (100–400, 400–1000, ≥1000 bp) is provided. The most promising bacterial primer pair (S-D-Bact-0341-b-S-17/S-D-Bact-0785-a-A-21), with an amplicon size of 464 bp, was experimentally evaluated by comparing the taxonomic distribution of the 16S rDNA amplicons with 16S rDNA fragments from directly sequenced metagenomes. The results of this study may be used as a guideline for selecting primer pairs with the best overall coverage and phylum spectrum for specific applications, therefore reducing the bias in PCR-based microbial diversity studies. PMID:22933715

  13. Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

    PubMed

    Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

    2015-05-01

    Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

  14. Vortex pairs on surfaces

    SciTech Connect

    Koiller, Jair

    2009-05-06

    A pair of infinitesimally close opposite vortices moving on a curved surface moves along a geodesic, according to a conjecture by Kimura. We outline a proof. Numerical simulations are presented for a pair of opposite vortices at a close but nonzero distance on a surface of revolution, the catenoid. We conjecture that the vortex pair system on a triaxial ellipsoid is a KAM perturbation of Jacobi's geodesic problem. We outline some preliminary calculations required for this study. Finding the surfaces for which the vortex pair system is integrable is in order.

  15. Climate Change, Health, and Communication: A Primer.

    PubMed

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  16. [Genetic diversity of ancient tea gardens and tableland tea gardens from Yunnan Province as revealed by AFLP marker].

    PubMed

    Ji, Peng-Zhang; Jiang, Hui-Bing; Huang, Xing-Qi; Zhang, Jun; Liang, Min-Zhi; Wang, Ping-Sheng

    2009-01-01

    This study was conducted to evaluate the genetic diversity within and among the plants of four ancient tea gardens and two tableland tea gardens form Yunnan Province, China by AFLP technique. The percentage of polymorphic loci (P) of the plants from six tea gardens was 92.31%. The genetic diversity within the six gardens demonstrated by Nei cents genetic diversity (He) was estimated to be 0.1366, while Shannon indices (Ho) were 0.2323. The percentage of polymorphic loci of the four ancient tea populations was 45.55% on average, with a range of 36.44% (Mengsong) to 59.11% (Mengla). But the percentages of polymorphic loci of the plants from two tableland gardens were 13.77% (Yunkang 10) and 24.2% (Menghai Daye), respectively. There was a great genetic difference between ancient tea gardens and tableland tea gardens. The genetic diversity among the plants of the ancient tea garden was higher than those of the sexual tableland tea garden and the clone tableland tea garden based on P valve. The four ancient tea gardens and two tableland gardens could be differentiated with AFLP markers. The results show that AFLP marker is an effective tool in the discrimination of tea germplasm, as well as sundried green tea.

  17. Analysis of genetic variation within clonal lineages of grape phylloxera (Daktulosphaira vitifoliae Fitch) using AFLP fingerprinting and DNA sequencing.

    PubMed

    Vorwerk, S; Forneck, A

    2007-07-01

    Two AFLP fingerprinting methods were employed to estimate the potential of AFLP fingerprints for the detection of genetic diversity within single founder lineages of grape phylloxera (Daktulosphaira vitifoliae Fitch). Eight clonal lineages, reared under controlled conditions in a greenhouse and reproducing asexually throughout a minimum of 15 generations, were monitored and mutations were scored as polymorphisms between the founder individual and individuals of succeeding generations. Genetic variation was detected within all lineages, from early generations on. Six to 15 polymorphic loci (from a total of 141 loci) were detected within the lineages, making up 4.3% of the total amount of genetic variation. The presence of contaminating extra-genomic sequences (e.g., viral material, bacteria, or ingested chloroplast DNA) was excluded as a source of intraclonal variation. Sequencing of 37 selected polymorphic bands confirmed their origin in mostly noncoding regions of the grape phylloxera genome. AFLP techniques were revealed to be powerful for the identification of reproducible banding patterns within clonal lineages.

  18. Application of cDNA-AFLP to biomarker exploration in a non-model species Grandidierella japonica.

    PubMed

    Hiki, Kyoshiro; Nakajima, Fumiyuki; Tobino, Tomohiro

    2017-06-01

    Biomarkers of exposure can be used to identify specific contaminants that are adversely affecting aquatic organisms. However, it remains prohibitively costly to investigate multiple novel biomarkers of exposure in a non-model species, despite the development of next-generation sequencing technology. In this study, we focused on the use of cDNA-amplified fragment length polymorphism (AFLP) as a cost-effective biomarker discovery tool to test whether it could identify biomarkers of exposure in the non-model amphipod species Grandidierella japonica. Loci were identified that were differentially expressed in amphipods exposed to reference chemicals (Cu, Zn, and nicotine) and to an environmental sample (road dust) at sublethal concentrations. Eight loci were shown to respond consistently to nicotine at different concentrations, but not to Cu or Zn. Some of the loci also responded to an environmental road dust sample containing nicotine. These findings suggest that loci identified using cDNA-AFLP could be used as biomarkers of nicotine exposure in environmental samples with complex matrices. Further studies with other organisms and toxicants are needed, but we have demonstrated that the use of cDNA-AFLP to identify biomarkers for ecotoxicological studies of non-model species is at least feasible.

  19. The use of AFLP to relate cheese-contaminating Penicillium strains to specific points in the production plants.

    PubMed

    Kure, C F; Skaar, I; Holst-Jensen, A; Abeln, E C A

    2003-06-15

    Amplified fragment length polymorphism (AFLP) analysis was performed on isolates of Penicillium commune and Penicillium palitans originating from cheese and indoor environment in four cheese factories. The AFLP method was found to be a useful tool for identification of P. commune and P. palitans on, as well as below, species level. However, AFLP in combination with M13 fingerprinting described in a previous paper provided better resolution at the intraspecific level than either of the methods alone. Specific P. commune and P. palitans strains were found in the same factories over a period of more than a year and showed that the cheese factories have contaminating strains that are well established. The majority of the P. commune and P. palitans strains were found only within a single factory, but several were found in different cheese factories. The combined fingerprinting data could relate strains isolated from cheese to specific points in the production plants. Several of cheese-contaminating Penicillium strains could be related to air in the wrapping room, which must be considered to be a critical point for contamination of cheese.

  20. Amplified fragment length polymorphism (AFLP) analysis of Clostridium novyi, C. perfringens and Bacillus cereus isolated from injecting drug users during 2000.

    PubMed

    McLauchlin, J; Salmon, J E; Ahmed, S; Brazier, J S; Brett, M M; George, R C; Hood, J

    2002-11-01

    As part of the follow-up investigations associated with an outbreak of severe illness and death among illegal injecting drug users during 2000, 43 cultures of Clostridium novyi type A, 40 C. perfringens type A and 6 isolates of Bacillus cereus were characterised by amplified fragment length polymorphism (AFLP) analysis. Among the 43 C. novyi isolates, 23 different AFLP profiles were detected. The same AFLP profile was detected in isolates from 18 drug users investigated during 2000 from Scotland, England, the Republic of Ireland and Norway and a wound from a patient in 2000 who was not identified as a drug user. Unique AFLP profiles were obtained from four drug users from England and the Republic of Ireland, 10 historical isolates from culture collections, an isolate from food (1989) and three isolates from wounds (1995, 1991, 1988). The 40 C. perfringens isolates were from 13 drug users, the contents of one syringe and two samples of heroin. Sixteen AFLP types of C. perfringens were distinguished and there was little evidence for commonality among the isolates. The AFLP types of C. perfringens from heroin differed and were unique. Six isolates of B. cereus were from four drug users and two samples of heroin. Four different AFLP patterns were distinguished. Three AFLP types were isolated from four drug users. B. cereus isolates from an aspirate and a heroin sample collected from the same drug user were identical, and were also indistinguishable from an isolate from a groin infection in a second drug user. The AFLP type of the isolate from a second and unrelated heroin sample was unique. The AFLP results showed no or very limited evidence for commonality between the different isolates of B. cereus and C. perfringens. In marked contrast, the C. novyi isolates from the majority of the drug users during 2000 were homogeneous, suggesting a common source or clonal selection of a C. novyi type, or both, which either had an adaptive advantage in spore germination, survival

  1. Improved Bacterial 16S rRNA Gene (V4 and V4-5) and Fungal Internal Transcribed Spacer Marker Gene Primers for Microbial Community Surveys

    SciTech Connect

    Walters, William; Hyde, Embriette R.; Berg-Lyons, Donna; Ackermann, Gail; Humphrey, Greg; Parada, Alma; Gilbert, Jack A.; Jansson, Janet K.; Caporaso, J. Gregory; Fuhrman, Jed A.; Apprill, Amy; Knight, Rob; Bik, Holly

    2015-12-22

    ABSTRACT

    Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of data sets amplified with varied primers requires attention. Here, we examined the performance of modified 16S rRNA gene and internal transcribed spacer (ITS) primers for archaea/bacteria and fungi, respectively, with nonaquatic samples. We moved primer bar codes to the 5′ end, allowing for a range of different 3′ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4 and 5 of the 16S rRNA gene. We additionally demonstrated that modifications to the 515f/806r (variable region 4) 16S primer pair, which improves detection ofThaumarchaeotaand clade SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies.

    ImportanceWe continue to uncover a wealth of information connecting microbes in important ways to human and environmental ecology. As our scientific knowledge and technical abilities improve, the tools used for microbiome surveys can be modified to improve the accuracy of our techniques, ensuring that we can continue to identify groundbreaking connections between microbes and the ecosystems they populate, from ice caps to the human body. It is important to confirm that modifications to these tools do not cause new, detrimental biases that would inhibit the field rather than continue to move it forward. We therefore demonstrated that two recently modified primer pairs that target taxonomically discriminatory regions of bacterial and fungal genomic DNA do not introduce new biases when used on a variety of sample types, from soil to

  2. Improved Bacterial 16S rRNA Gene (V4 and V4-5) and Fungal Internal Transcribed Spacer Marker Gene Primers for Microbial Community Surveys

    PubMed Central

    Walters, William; Hyde, Embriette R.; Berg-Lyons, Donna; Ackermann, Gail; Humphrey, Greg; Parada, Alma; Gilbert, Jack A.; Jansson, Janet K.; Caporaso, J. Gregory; Fuhrman, Jed A.; Apprill, Amy

    2015-01-01

    ABSTRACT Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of data sets amplified with varied primers requires attention. Here, we examined the performance of modified 16S rRNA gene and internal transcribed spacer (ITS) primers for archaea/bacteria and fungi, respectively, with nonaquatic samples. We moved primer bar codes to the 5′ end, allowing for a range of different 3′ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4 and 5 of the 16S rRNA gene. We additionally demonstrated that modifications to the 515f/806r (variable region 4) 16S primer pair, which improves detection of Thaumarchaeota and clade SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies. IMPORTANCE We continue to uncover a wealth of information connecting microbes in important ways to human and environmental ecology. As our scientific knowledge and technical abilities improve, the tools used for microbiome surveys can be modified to improve the accuracy of our techniques, ensuring that we can continue to identify groundbreaking connections between microbes and the ecosystems they populate, from ice caps to the human body. It is important to confirm that modifications to these tools do not cause new, detrimental biases that would inhibit the field rather than continue to move it forward. We therefore demonstrated that two recently modified primer pairs that target taxonomically discriminatory regions of bacterial and fungal genomic DNA do not introduce new biases when used on a variety of sample types, from soil to human skin. This confirms the utility of these primers

  3. Cooper pairs and bipolarons

    NASA Astrophysics Data System (ADS)

    Lakhno, Victor

    2016-11-01

    It is shown that Cooper pairs are a solution of the bipolaron problem for model Fröhlich Hamiltonian. The total energy of a pair for the initial Fröhlich Hamiltonian is found. Differences between the solutions for the model and initial two-particle problems are discussed.

  4. Cooper Pairs in Insulators?!

    ScienceCinema

    James Valles

    2016-07-12

    Nearly 50 years elapsed between the discovery of superconductivity and the emergence of the microscopic theory describing this zero resistance state. The explanation required a novel phase of matter in which conduction electrons joined in weakly bound pairs and condensed with other pairs into a single quantum state. Surprisingly, this Cooper pair formation has also been invoked to account for recently uncovered high-resistance or insulating phases of matter. To address this possibility, we have used nanotechnology to create an insulating system that we can probe directly for Cooper pairs. I will present the evidence that Cooper pairs exist and dominate the electrical transport in these insulators and I will discuss how these findings provide new insight into superconductor to insulator quantum phase transitions. 

  5. PCR Primer Design for 16S rRNAs for Experimental Horizontal Gene Transfer Test in Escherichia coli

    PubMed Central

    Miyazaki, Kentaro; Sato, Mitsuharu; Tsukuda, Miyuki

    2017-01-01

    We recently demonstrated that the Escherichia coli ribosome is robust enough to accommodate foreign 16S rRNAs from diverse gamma- and betaproteobacteria bacteria (Kitahara et al., 2012). Therein, we used the common universal primers Bac8f and UN1541r to obtain a nearly full-length gene. However, we noticed that these primers overlap variable sites at 19[A/C] and 1527[U/C] in Bac8f and UN1541r, respectively, and thus, the amplicon could contain mutations. This is problematic, particularly for the former site, because the 19th nucleotide pairs with the 916th nucleotide, which is a part of the “central pseudoknot” and is critical for function. Therefore, we mutationally investigated the role of the base pair using several 16S rRNAs from gamma- and betaproteobacteria. We found that both the native base pairs (gammaproteobacterial 19A–916U and betaproteobacterial 19C–916G) and the non-native 19A–916G pair retained function, whereas the non-native 19C–916U was defective 16S rRNAs. We next designed a new primer set, Bac1f and UN1542r, so that they do not overlap the potential mismatch sites. 16S rRNA amplicons obtained from the environmental metagenome using the new primer set were dominated by proteobacterial species (~85%). Subsequent functional screening identified various 16S rRNAs from proteobacteria, all of which contained native 19A–916U or 19C–916G base pairs. The primers developed in this study are thus advantageous for functional characterization of foreign 16S rRNA in E. coli with no artifacts. PMID:28293553

  6. PCR Primer Design for 16S rRNAs for Experimental Horizontal Gene Transfer Test in Escherichia coli.

    PubMed

    Miyazaki, Kentaro; Sato, Mitsuharu; Tsukuda, Miyuki

    2017-01-01

    We recently demonstrated that the Escherichia coli ribosome is robust enough to accommodate foreign 16S rRNAs from diverse gamma- and betaproteobacteria bacteria (Kitahara et al., 2012). Therein, we used the common universal primers Bac8f and UN1541r to obtain a nearly full-length gene. However, we noticed that these primers overlap variable sites at 19[A/C] and 1527[U/C] in Bac8f and UN1541r, respectively, and thus, the amplicon could contain mutations. This is problematic, particularly for the former site, because the 19th nucleotide pairs with the 916th nucleotide, which is a part of the "central pseudoknot" and is critical for function. Therefore, we mutationally investigated the role of the base pair using several 16S rRNAs from gamma- and betaproteobacteria. We found that both the native base pairs (gammaproteobacterial 19A-916U and betaproteobacterial 19C-916G) and the non-native 19A-916G pair retained function, whereas the non-native 19C-916U was defective 16S rRNAs. We next designed a new primer set, Bac1f and UN1542r, so that they do not overlap the potential mismatch sites. 16S rRNA amplicons obtained from the environmental metagenome using the new primer set were dominated by proteobacterial species (~85%). Subsequent functional screening identified various 16S rRNAs from proteobacteria, all of which contained native 19A-916U or 19C-916G base pairs. The primers developed in this study are thus advantageous for functional characterization of foreign 16S rRNA in E. coli with no artifacts.

  7. Barcoding the kingdom Plantae: new PCR primers for ITS regions of plants with improved universality and specificity.

    PubMed

    Cheng, Tao; Xu, Chao; Lei, Li; Li, Changhao; Zhang, Yu; Zhou, Shiliang

    2016-01-01

    The internal transcribed spacer (ITS) of nuclear ribosomal DNA is one of the most commonly used DNA markers in plant phylogenetic and DNA barcoding analyses, and it has been recommended as a core plant DNA barcode. Despite this popularity, the universality and specificity of PCR primers for the ITS region are not satisfactory, resulting in amplification and sequencing difficulties. By thoroughly surveying and analysing the 18S, 5.8S and 26S sequences of Plantae and Fungi from GenBank, we designed new universal and plant-specific PCR primers for amplifying the whole ITS region and a part of it (ITS1 or ITS2) of plants. In silico analyses of the new and the existing ITS primers based on these highly representative data sets indicated that (i) the newly designed universal primers are suitable for over 95% of plants in most groups; and (ii) the plant-specific primers are suitable for over 85% of plants in most groups without amplification of fungi. A total of 335 samples from 219 angiosperm families, 11 gymnosperm families, 24 fern and lycophyte families, 16 moss families and 17 fungus families were used to test the performances of these primers. In vitro PCR produced similar results to those from the in silico analyses. Our new primer pairs gave PCR improvements up to 30% compared with common-used ones. The new universal ITS primers will find wide application in both plant and fungal biology, and the new plant-specific ITS primers will, by eliminating PCR amplification of nonplant templates, significantly improve the quality of ITS sequence information collections in plant molecular systematics and DNA barcoding.

  8. Forest Interpreter's Primer on Fire Management.

    ERIC Educational Resources Information Center

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  9. The FAS Child: A Primer for Teachers.

    ERIC Educational Resources Information Center

    Wentz, Thomas L.; Larson, Julie

    1993-01-01

    This primer on fetal alcohol syndrome (FAS) distinguishes between the syndrome and fetal alcohol effects (FAE), offers a history of FAS, outlines medical criteria for diagnosis, rates of incidence, factors influencing incidence and severity, developmental stages of children with FAS, clinical features, and educational implications and approaches.…

  10. Issues Primer. EEE708 Negotiated Study Program.

    ERIC Educational Resources Information Center

    Jennings, Leonie

    This issues primer is structured around a series of 20 contemporary concerns in the changing world of work and training in Australia in the early 1990s. It is part of the study materials for the one-semester distance education unit, Negotiated Study Program, in the Open Campus Program at Deakin University (Australia). Information on each issue is…

  11. School Safety & Youth Violence: A Legal Primer.

    ERIC Educational Resources Information Center

    Bailey, Kirk A.; Ross, Catherine J.

    This legal primer on violence in schools addresses the responsibility of school officials to respond to undisciplined youths whose behavior threatens the welfare and safety of other children in attendance. It is broken down into sections that provide a brief overview of the key rules and guidelines for school officials and teachers in each topic…

  12. Exploratory Development of Corrosion Inhibiting Primers

    DTIC Science & Technology

    1977-07-01

    melamine , were selected for further evaluation in primer systems as examples of soluble and insoluble corrosion inhibitors. Other routes to potential...guanidine dichromate gave relatively poor performance. Melamine dich- romate pigment was more generally effective in preventing corrosion than the common...dihpneyl- guanidine ....... ..................... ... 66 9.2.1.3) Preparation Of Melamine Dichromate (Compound #25). 66 vii TABLE OF CONTENTS

  13. Apparatus For Tests Of Percussion Primers

    NASA Technical Reports Server (NTRS)

    Bement, Laurence J.; Bailey, James W.; Schimmel, Morry L.

    1991-01-01

    Test apparatus and method developed to measure ignition capability of percussion primers. Closely simulates actual conditions and interfaces encountered in such applications as in munitions and rocket motors. Ignitability-testing apparatus is small bomb instrumented with pressure transducers. Sizes, shapes, and positions of bomb components and materials under test selected to obtain quantitative data on ignition.

  14. A primer on effectiveness and efficacy trials.

    PubMed

    Singal, Amit G; Higgins, Peter D R; Waljee, Akbar K

    2014-01-02

    Although efficacy and effectiveness studies are both important when evaluating interventions, they serve distinct purposes and have different study designs. Unfortunately, the distinction between these two types of trials is often poorly understood. In this primer, we highlight several differences between these two types of trials including study design, patient populations, intervention design, data analysis, and result reporting.

  15. A Primer on Simulation and Gaming.

    ERIC Educational Resources Information Center

    Barton, Richard F.

    In a primer intended for the administrative professions, for the behavioral sciences, and for education, simulation and its various aspects are defined, illustrated, and explained. Man-model simulation, man-computer simulation, all-computer simulation, and analysis are discussed as techniques for studying object systems (parts of the "real…

  16. Environmentally Acceptable Medium Caliber Ammunition Percussion Primers

    DTIC Science & Technology

    2007-10-31

    typically contain lead styphnate and antimony sulfide along with other constituents. Although highly effective, these heavy metal compounds have been...contain barium nitrate. Although not negatively categorized by the EPA itself, barium compounds are generally regarded as toxic and likewise should...contains the lead styphnate based FA956 composition2 which is a typical formulation of conventional military ammunition percussion primers. The

  17. Genetic diversity analysis of Croton antisyphiliticus Mart. using AFLP molecular markers.

    PubMed

    Oliveira, T G; Pereira, A M S; Coppede, J S; França, S C; Ming, L C; Bertoni, B W

    2016-02-19

    Croton antisyphiliticus Mart. is a medicinal plant native to Cerrado vegetation in Brazil, and it is popularly used to treat urogenital tract infections. The objective of the present study was to assess the genetic variability of natural C. antisyphiliticus populations using AFLP molecular markers. Accessions were collected in the states of Minas Gerais, São Paulo, and Goiás. The genotyping of individuals was performed using a LI-COR® DNA Analyzer 4300. The variability within populations was found to be greater than the variability between them. The F(ST) value was 0.3830, which indicated that the populations were highly structured. A higher percentage of polymorphic loci (92.16%) and greater genetic diversity were found in the population accessions from Pratinha-MG. Gene flow was considered restricted (N(m) = 1.18), and there was no correlation between genetic and geographic distances. The populations of C. antisyphiliticus exhibited an island-model structure, which demonstrates the vulnerability of the species.

  18. AFLPs Reveal Different Population Genetic Structure under Contrasting Environments in the Marine Snail Nucella lapillus L.

    PubMed Central

    Carro, Belén; Quintela, María; Ruiz, José Miguel; Barreiro, Rodolfo

    2012-01-01

    Dispersal has received growing attention in marine ecology, particularly since evidence obtained with up-to-date techniques challenged the traditional view. The dogwhelk Nucella lapillus L., a sedentary gastropod with direct development, is a good example: dispersal was traditionally assumed to be limited until studies with microsatellites disputed this idea. To shed some light on this controversy, the genetic structure of dogwhelk populations in northwest Spain was investigated with highly polymorphic AFLP markers giving special attention to the influence of hydrodynamic stress. In agreement with the expectations for a poor disperser, our results show a significant genetic structure at regional (<200 km) and areal scales (<15 km). However, the spatial genetic structure varied with wave-exposure in the present case study: IBD was evident under sheltered conditions but absent from the exposed area where genetic differentiation was stronger. Our results provide evidence that differences in wave-exposure can exert a detectable influence on the genetic structure of coastal organisms, even in species without a planktonic larva. PMID:23185435

  19. AFLPs reveal different population genetic structure under contrasting environments in the marine snail Nucella lapillus L.

    PubMed

    Carro, Belén; Quintela, María; Ruiz, José Miguel; Barreiro, Rodolfo

    2012-01-01

    Dispersal has received growing attention in marine ecology, particularly since evidence obtained with up-to-date techniques challenged the traditional view. The dogwhelk Nucella lapillus L., a sedentary gastropod with direct development, is a good example: dispersal was traditionally assumed to be limited until studies with microsatellites disputed this idea. To shed some light on this controversy, the genetic structure of dogwhelk populations in northwest Spain was investigated with highly polymorphic AFLP markers giving special attention to the influence of hydrodynamic stress. In agreement with the expectations for a poor disperser, our results show a significant genetic structure at regional (<200 km) and areal scales (<15 km). However, the spatial genetic structure varied with wave-exposure in the present case study: IBD was evident under sheltered conditions but absent from the exposed area where genetic differentiation was stronger. Our results provide evidence that differences in wave-exposure can exert a detectable influence on the genetic structure of coastal organisms, even in species without a planktonic larva.

  20. Genetic Variability and Population Structure of Disanthus cercidifolius subsp. longipes (Hamamelidaceae) Based on AFLP Analysis

    PubMed Central

    Yu, Yi; Fan, Qiang; Shen, Rujiang; Guo, Wei; Jin, Jianhua; Cui, Dafang; Liao, Wenbo

    2014-01-01

    Disanthus cercidifolius subsp. longipes is an endangered species in China. Genetic diversity and structure analysis of this species was investigated using amplified fragments length polymorphism (AFLP) fingerprinting. Nei's gene diversity ranged from 0.1290 to 0.1394. The AMOVA indicated that 75.06% of variation was distributed within populations, while the between-group component 5.04% was smaller than the between populations-within-group component 19.90%. Significant genetic differentiation was detected between populations. Genetic and geographical distances were not correlated. PCA and genetic structure analysis showed that populations from East China were together with those of the Nanling Range. These patterns of genetic diversity and levels of genetic variation may be the result of D. c. subsp. longipes restricted to several isolated habitats and “excess flowers production, but little fruit set”. It is necessary to protect all existing populations of D. c. subsp. longipes in order to preserve as much genetic variation as possible. PMID:25250583

  1. Rust transformation/rust compatible primers

    NASA Technical Reports Server (NTRS)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  2. Deconstructing the polymerase chain reaction: understanding and correcting bias associated with primer degeneracies and primer-template mismatches.

    PubMed

    Green, Stefan J; Venkatramanan, Raghavee; Naqib, Ankur

    2015-01-01

    The polymerase chain reaction (PCR) is sensitive to mismatches between primer and template, and mismatches can lead to inefficient amplification of targeted regions of DNA template. In PCRs in which a degenerate primer pool is employed, each primer can behave differently. Therefore, inefficiencies due to different primer melting temperatures within a degenerate primer pool, in addition to mismatches between primer binding sites and primers, can lead to a distortion of the true relative abundance of targets in the original DNA pool. A theoretical analysis indicated that a combination of primer-template and primer-amplicon interactions during PCR cycles 3-12 is potentially responsible for this distortion. To test this hypothesis, we developed a novel amplification strategy, entitled "Polymerase-exonuclease (PEX) PCR", in which primer-template interactions and primer-amplicon interactions are separated. The PEX PCR method substantially and significantly improved the evenness of recovery of sequences from a mock community of known composition, and allowed for amplification of templates with introduced mismatches near the 3' end of the primer annealing sites. When the PEX PCR method was applied to genomic DNA extracted from complex environmental samples, a significant shift in the observed microbial community was detected. Furthermore, the PEX PCR method provides a mechanism to identify which primers in a primer pool are annealing to target gDNA. Primer utilization patterns revealed that at high annealing temperatures in the PEX PCR method, perfect match annealing predominates, while at lower annealing temperatures, primers with up to four mismatches with templates can contribute substantially to amplification. The PEX PCR method is simple to perform, is limited to PCR mixes and a single exonuclease step which can be performed without reaction cleanup, and is recommended for reactions in which degenerate primer pools are used or when mismatches between primers and

  3. PCR primer pairs for 100 microsatellites in red drum (Sciaenops ocellatus)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    One hundred nuclear-encoded microsatellites from a genomic DNA library of red drum (Sciaenops ocellatus) were isolated and characterized. Eight of the microsatellites had tetra-nucleotide motifs, while 92 had di-nucleotide motifs. The average number of alleles at the 100 microsatellites among a sa...

  4. ISOLATE SPECIFIC DETECTION OF MYCORRHIZAL FUNGI USING GENOME SPECIFIC PRIMER PAIRS. (R825549C047)

    EPA Science Inventory

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  5. Linear-After-The-Exponential (LATE)-PCR: Primer design criteria for high yields of specific single-stranded DNA and improved real-time detection

    PubMed Central

    Pierce, Kenneth E.; Sanchez, J. Aquiles; Rice, John E.; Wangh, Lawrence J.

    2005-01-01

    Traditional asymmetric PCR uses conventional PCR primers at unequal concentrations to generate single-stranded DNA. This method, however, is difficult to optimize, often inefficient, and tends to promote nonspecific amplification. An alternative approach, Linear-After-The-Exponential (LATE)-PCR, solves these problems by using primer pairs deliberately designed for use at unequal concentrations. The present report systematically examines the primer design parameters that affect the exponential and linear phases of LATE-PCR amplification. In particular, we investigated how altering the concentration-adjusted melting temperature (Tm) of the limiting primer (TmL) relative to that of the excess primer (TmX) affects both amplification efficiency and specificity during the exponential phase of LATE-PCR. The highest reaction efficiency and specificity were observed when TmL - TmX ≥ 5°C. We also investigated how altering TmX relative to the higher Tm of the double-stranded amplicon (TmA) affects the rate and extent of linear amplification. Excess primers with TmX closer to TmA yielded higher rates of linear amplification and stronger signals from a hybridization probe. These design criteria maximize the yield of specific single-stranded DNA products and make LATE-PCR more robust and easier to implement. The conclusions were validated by using primer pairs that amplify sequences within the cystic fibrosis transmembrane regulator (CFTR) gene, mutations of which are responsible for cystic fibrosis. PMID:15937116

  6. Paired Straight Hearth Furnace

    SciTech Connect

    2009-04-01

    This factsheet describes a research project whose goals are to design, develop, and evaluate the scalability and commercial feasibility of the PSH Paired Straight Hearth Furnace alternative ironmaking process.

  7. An AFLP marker tightly linked to apomixis reveals hemizygosity in a portion of the apomixis-controlling locus in Paspalum simplex.

    PubMed

    Labombarda, Paola; Busti, Alessandra; Caceres, Maria Eugenia; Pupilli, Fulvio; Arcioni, Sergio

    2002-06-01

    A mapping population of Paspalum simplex segregating for apomixis (asexual reproduction through seeds) was screened with AFLPs to find apomixis-linked markers. Four AFLPs linked to apomixis in coupling phase were found. Three of them did not show recombinants among the 87 individuals of the mapping population, whereas the other was more loosely linked. Integrating the AFLP data with those obtained previously with rice RFLP anchor markers, a map was drawn for the chromosome region of P. simplex encompassing apomixis. We cloned the three AFLPs tightly linked with apomixis into plasmid vectors and used them as probes to hybridize the restriction digested DNA of the mapping population. Two of them revealed RFLP bands linked to apomixis together with other alleles, whereas one was proven to belong to a hemizygous portion of the apomixis locus. The total picture resulting from AFLP and RFLP analyses was that a cluster of markers tightly linked with apomixis was detected in P simplex together with two other markers that were more loosely linked. These two markers enclosed a relatively large chromosome segment characterized by strong repression of recombination. The block of recombination may have caused sequence divergence and, therefore, hemizygosity of some regions belonging to the apomixis-controlling chromosome segment of P. simplex. The potential of developing an apomixis-specific sequence for screening large-fragment libraries for the physical isolation of the locus encompassing apomixis is discussed.

  8. Human Blastocystis subtyping with subtype-specific primers developed from unique sequences of the SSU rRNA gene.

    PubMed

    Yoshikawa, Hisao; Iwamasa, Ayana

    2016-12-01

    The genus Blastocystis is one of the most genetically diverse parasites. Blastocystis isolates from humans and animals have been classified into subtypes (STs) based on the phylogeny of the small subunit rRNA gene (SSU rDNA). Although human Blastocystis isolates are limited to STs 1-9, the identification of all 9 STs remains challenging due to the lack of specific primers for several STs. The sequencing of partial SSU rDNA is therefore essential for the identification of several STs. In this study, we developed 9 sets of PCR primers to detect each of the 9 kinds of ST in humans. When these ST-specific primer pairs were examined reference Blastocystis for the 9 STs, all 9 amplified only the target ST even in a DNA mixture of all 9 STs. The specificities of the 9 primer sets were tested against several intestinal parasites and fungi found in human stool samples. No amplification with these common human intestinal eukaryotes was observed using the primer pairs for 8 STs, while the ST5 primer set gave only faint bands with some parasites. Since genomic DNA levels of these parasites extracted from Blastocystis-positive cultures are expected to be markedly lower than the pure or highly concentrated DNA samples tested, the cross-amplifications with these organisms are unlikely to be detected when DNA samples are extracted from Blastocystis-positive cultures. The PCR conditions for all 9 primer sets were the same, hence a one-step analysis by PCR amplification, followed by electrophoresis has potential as a simple tool for the subtyping of human Blastocystis isolates.

  9. Differentiation of mycoplasmalike organisms (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of the apple proliferation MLO.

    PubMed

    Jarausch, W; Saillard, C; Dosba, F; Bové, J M

    1994-08-01

    A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle.

  10. Microsatellite primers resource developed from the mapped sequence scaffolds of Nisqually-1 genome. Submitted to New Phytologist

    SciTech Connect

    Yin, Tongming; ZHANG, Dr. XINYE; Gunter, Lee E; Li, Shuxian; Wullschleger, Stan D; Huang, Prof. Minren; Tuskan, Gerald A

    2009-01-01

    In this study, 148 428 simple sequence repeat (SSR) primer pairs were designed from the unambiguously mapped sequence scaffolds of the Nisqually-1 genome. The physical position of the priming sites were identified along each of the 19 Populus chromosomes, and it was specified whether the priming sequences belong to intronic, intergenic, exonic or UTR regions. A subset of 150 SSR loci were amplified and a high amplification success rate (72%) was obtained in P. tremuloides, which belongs to a divergent subgenus of Populus relative to Nisqually-1. PCR reactions showed that the amplification success rate of exonic primer pairs was much higher than that of the intronic/intergenic primer pairs. Applying ANOVA and regression analyses to the flanking sequences of microsatellites, the repeat lengths, the GC contents of the repeats, the repeat motif numbers, the repeat motif length and the base composition of the repeat motif, it was determined that only the base composition of the repeat motif and the repeat motif length significantly affect the microsatellite variability in P. tremuloides samples. The SSR primer resource developed in this study provides a database for selecting highly transferable SSR markers with known physical position in the Populus genome and provides a comprehensive genetic tool to extend the genome sequence of Nisqually-1 to genetic studies in different Populus species.

  11. Cooper Pair Insulators

    NASA Astrophysics Data System (ADS)

    Valles, James

    One of the recent advances in the field of the Superconductor to Insulator Transition (SIT) has been the discovery and characterization of the Cooper Pair Insulator phase. This bosonic insulator, which consists of localized Cooper pairs, exhibits activated transport and a giant magneto-resistance peak. These features differ markedly from the weakly localized transport that emerges as pairs break at a ``fermionic'' SIT. I will describe how our experiments on films nano-patterned with a nearly triangular array of holes have enabled us to 1) distinguish bosonic insulators from fermionic insulators, 2) show that Cooper pairs, rather than quasi-particles dominate the transport in the Cooper Pair insulator phase, 3) demonstrate that very weak, sub nano-meter thickness inhomogeneities control whether a bosonic or fermionic insulator forms at an SIT and 4) reveal that Cooper pairs disintegrate rather than becoming more tightly bound deep in the localized phase. We have also developed a method, using a magnetic field, to tune flux disorder reversibly in these films. I will present our latest results on the influence of magnetic flux disorder and random gauge fields on phenomena near bosonic SITs. This work was performed in collaboration with M. D. Stewart, Jr., Hung Q. Nguyen, Shawna M. Hollen, Jimmy Joy, Xue Zhang, Gustavo Fernandez, Jeffrey Shainline and Jimmy Xu. It was supported by NSF Grants DMR 1307290 and DMR-0907357.

  12. Exploiting extension bias in polymerase chain reaction to improve primer specificity in ensembles of nearly identical DNA templates.

    PubMed

    Wright, Erik S; Yilmaz, L Safak; Ram, Sri; Gasser, Jeremy M; Harrington, Gregory W; Noguera, Daniel R

    2014-05-01

    We describe a semi-empirical framework that combines thermodynamic models of primer hybridization with experimentally determined elongation biases introduced by 3'-end mismatches for improving polymerase chain reaction (PCR)-based sequence discrimination. The framework enables rational and automatic design of primers for optimal targeting of one or more sequences in ensembles of nearly identical DNA templates. In situations where optimal targeting is not feasible, the framework accurately predicts non-target sequences that are difficult to distinguish with PCR alone. Based on the synergistic effects of disparate sources of PCR bias, we used our framework to robustly distinguish between two alleles that differ by a single base pair. To demonstrate the applicability to environmental microbiology, we designed primers specific to all recognized archaeal and bacterial genera in the Ribosomal Database Project, and have made these primers available online. We applied these primers experimentally to obtain genus-specific amplification of 16S rRNA genes representing minor constituents of an environmental DNA sample. Our results demonstrate that inherent PCR biases can be reliably employed in an automatic fashion to maximize sequence discrimination and accurately identify potential cross-amplifications. We have made our framework accessible online as a programme for designing primers targeting one group of sequences in a set with many other sequences (http://DECIPHER.cee.wisc.edu).

  13. Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

    PubMed

    Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

    2009-10-28

    GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.

  14. New primers for adhesive bonding of aluminum alloys

    NASA Technical Reports Server (NTRS)

    Burrell, B. W.; Port, W. S.

    1971-01-01

    Synthetic polypeptide adhesive primers are effective, with high temperature epoxy resins, at temperatures from 100 deg to 300 deg C. Lap-shear failure loads and lap-shear strength of both primers are discussed.

  15. Sequence context effect on strand slippage in natural DNA primer-templates.

    PubMed

    Chi, Lai Man; Lam, Sik Lok

    2012-02-16

    Strand slippage has been found to occur in primer-templates containing a templating thymine, cytosine, and guanine, leading to the formation of misaligned structures with a single-nucleotide bulge. If remained in the active site of low-fidelity polymerases during DNA replication, these misaligned structures can ultimately bring about deletion mutations. In this study, we performed NMR investigations on primer-template models containing a templating adenine. Similar to our previous results on guanine, adenine templates are also less prone to strand slippage than pyrimidine templates. Misalignment occurs only in primer-templates that form a terminal C·G or G·C base pair. Together with our previous findings on thymine, cytosine, and guanine templates, the present study reveals strand slippage can occur in any kind of natural templating bases during DNA replication, providing insights into the origin of mutation hotspots in natural DNA sequences. In addition to the type of incoming base upon misincorporation, the propensity of strand slippage in primer-templates depends also on the type of templating base, its upstream and downstream bases.

  16. Electrocoat Process for Non-Chromate Primers in DOD Manufacturing

    DTIC Science & Technology

    2012-08-29

    2 with two levels of corrosion inhibitor – MIL-PRF-23377N Cr-free spray primer – MIL-PRF-23377C Solvent Cr spray primer – MIL-PRF-85582C Water...NC spray primer Residual coating Results summary- Galvanic assemblies Corrosion mechanism different between Electrocoat and spray primers...An application method which uses direct electrical current to deposit the coating ● Waterborne coating ● Chromium-free (no heavy metals

  17. Diversity of Methane-Cycling Archaea in Hydrothermal Sediment Investigated by General and Group-Specific PCR Primers

    PubMed Central

    Teske, Andreas P.

    2014-01-01

    The zonation of anaerobic methane-cycling Archaea in hydrothermal sediment of Guaymas Basin was studied by general primer pairs (mcrI, ME1/ME2, mcrIRD) targeting the alpha subunit of methyl coenzyme M reductase gene (mcrA) and by new group-specific mcrA and 16S rRNA gene primer pairs. The mcrIRD primer pair outperformed the other general mcrA primer pairs in detection sensitivity and phylogenetic coverage. Methanotrophic ANME-1 Archaea were the only group detected with group-specific primers only. The detection of 14 mcrA lineages surpasses the diversity previously found in this location. Most phylotypes have high sequence similarities to hydrogenotrophs, methylotrophs, and anaerobic methanotrophs previously detected at Guaymas Basin or at hydrothermal vents, cold seeps, and oil reservoirs worldwide. Additionally, five mcrA phylotypes belonging to newly defined lineages are detected. Two of these belong to deeply branching new orders, while the others are new species or genera of Methanopyraceae and Methermicoccaceae. Downcore diversity decreases from all groups detected in the upper 6 cm (∼2 to 40°C, sulfate measurable to 4 cm) to only two groups below 6 cm (>40°C). Despite the presence of hyperthermophilic genera (Methanopyrus, Methanocaldococcus) in cooler surface strata, no genes were detected below 10 cm (≥60°C). While mcrA-based and 16S rRNA gene-based community compositions are generally congruent, the deeply branching mcrA cannot be assigned to specific 16S rRNA gene lineages. Our study indicates that even among well-studied metabolic groups and in previously characterized model environments, major evolutionary branches are overlooked. Detecting these groups by improved molecular biological methods is a crucial first step toward understanding their roles in nature. PMID:25527539

  18. Systemic Identification of Hevea brasiliensis EST-SSR Markers and Primer Screening

    PubMed Central

    Hou, Benjun

    2017-01-01

    This research aimed to systematically identify and preliminarily validate the Hevea brasiliensis expressed sequence tag (EST) information using Simple Sequence Repeat (SSR) and provide evidence for further development of SSR molecular marker. The definition of general SSR features of Hevea EST splicing sequences and development of SSR primers founded the basis of diversity analysis and variety identification for Hevea tree resource. 1134 SSR loci were identified in the EST splicing sequence and distributed in 840 Unigene. The occurrence rate of SSR loci was 23.9%, and the average distribution distance of EST-SSR was 2.59 kb. The major repeat type was mononucleotide repeat motif, which accounted for 38.89%, while the corresponding value was 36.95% for dinucleotide repeat motif and 18.17% for trinucleotide repeat motif; the proportion of other motifs was only 5.99%. The superior repeat motifs for mononucleotide, dinucleotide, and trinucleotide were A/T, AG/CT, and AAG/CTT, respectively. 739 pair of primers were designed for 1134 SSR loci. PCR amplification was performed on Hevea Reyan5-11, Reyan87-6-47, and PR107, and 180 pairs of primers were selected which were able to amplify polymorphism bands. PMID:28232872

  19. ThermoAlign: a genome-aware primer design tool for tiled amplicon resequencing

    PubMed Central

    Francis, Felix; Dumas, Michael D.; Wisser, Randall J.

    2017-01-01

    Isolating and sequencing specific regions in a genome is a cornerstone of molecular biology. This has been facilitated by computationally encoding the thermodynamics of DNA hybridization for automated design of hybridization and priming oligonucleotides. However, the repetitive composition of genomes challenges the identification of target-specific oligonucleotides, which limits genetics and genomics research on many species. Here, a tool called ThermoAlign was developed that ensures the design of target-specific primer pairs for DNA amplification. This is achieved by evaluating the thermodynamics of hybridization for full-length oligonucleotide-template alignments — thermoalignments — across the genome to identify primers predicted to bind specifically to the target site. For amplification-based resequencing of regions that cannot be amplified by a single primer pair, a directed graph analysis method is used to identify minimum amplicon tiling paths. Laboratory validation by standard and long-range polymerase chain reaction and amplicon resequencing with maize, one of the most repetitive genomes sequenced to date (≈85% repeat content), demonstrated the specificity-by-design functionality of ThermoAlign. ThermoAlign is released under an open source license and bundled in a dependency-free container for wide distribution. It is anticipated that this tool will facilitate multiple applications in genetics and genomics and be useful in the workflow of high-throughput targeted resequencing studies. PMID:28300202

  20. Genetics and health communication: a primer.

    PubMed

    Greenberg, Marisa S

    2015-01-01

    The progress of genetic knowledge has been swift and steadfast. As we move forward in the genomic era, post Human Genome Project, and continue to explore how one's genes interact with one's environment, it becomes increasingly important for all audiences to have a firm grasp of the vocabulary used in this health context. This primer is intended to be used as a reference and to introduce and/or make more clear concepts related to genetics to increase understanding.

  1. A primer for criticality calculations with DANTSYS

    SciTech Connect

    Busch, R.D.

    1997-08-01

    With the closure of many experimental facilities, the nuclear safety analyst has to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. Although deterministic methods often do not provide exact models of a system, a substantial amount of reliable information on nuclear systems can be obtained using these methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico (UNM) in cooperation with the Radiation Transport Group at Los Alamos National Laboratory (LANL) has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. DANTSYS is the new name of the group of codes formerly known as: ONEDANT, TWODANT, TWOHEX, TWOGQ, and THREEDANT. The primer is designed to teach bu example, with each example illustrating two or three DANTSYS features useful in criticality analyses. Starting with a Quickstart chapter, the primer gives an overview of the basic requirements for DANTSYS input and allows the user to quickly run a simple criticality problem with DANTSYS. Each chapter has a list of basic objectives at the beginning identifying the goal of the chapter and the individual DANTSYS features covered in detail in the chapter example problems. On completion of the primer, it is expected that the user will be comfortable doing criticality calculations with DANTSYS and can handle 60--80% of the situations that normally arise in a facility. The primary provides a set of input files that can be selective modified by the user to fit each particular problem.

  2. Fractal antenna and fractal resonator primer

    NASA Astrophysics Data System (ADS)

    Cohen, Nathan

    2015-03-01

    Self-similarity and fractals have opened new and important avenues for antenna and electronic solutions over the last 25 years. This primer provides an introduction to the benefits provided by fractal geometry in antennas, resonators, and related structures. Such benefits include, among many, wider bandwidths, smaller sizes, part-less electronic components, and better performance. Fractals also provide a new generation of optimized design tools, first used successfully in antennas but applicable in a general fashion.

  3. Specific PCR product primer design using memetic algorithm.

    PubMed

    Yang, Cheng-Hong; Cheng, Yu-Huei; Chuang, Li-Yeh; Chang, Hsueh-Wei

    2009-01-01

    To provide feasible primer sets for performing a polymerase chain reaction (PCR) experiment, many primer design methods have been proposed. However, the majority of these methods require a relatively long time to obtain an optimal solution since large quantities of template DNA need to be analyzed. Furthermore, the designed primer sets usually do not provide a specific PCR product size. In recent years, evolutionary computation has been applied to PCR primer design and yielded promising results. In this article, a memetic algorithm (MA) is proposed to solve primer design problems associated with providing a specific product size for PCR experiments. The MA is compared with a genetic algorithm (GA) using an accuracy formula to estimate the quality of the primer design and test the running time. Overall, 50 accession nucleotide sequences were sampled for the comparison of the accuracy of the GA and MA for primer design. Five hundred runs of the GA and MA primer design were performed with PCR product lengths of 150-300 bps and 500-800 bps, and two different methods of calculating T(m) for each accession nucleotide sequence were tested. A comparison of the accuracy results for the GA and MA primer design showed that the MA primer design yielded better results than the GA primer design. The results further indicate that the proposed method finds optimal or near-optimal primer sets and effective PCR products in a dry dock experiment. Related materials are available online at http://bio.kuas.edu.tw/ma-pd/.

  4. An analysis of genetic variation in Astragalus cremnophylax var. cremnophylax, a critically endangered plant, using AFLP markers.

    PubMed

    Travis, S E; Maschinski, J; Keim, P

    1996-12-01

    A recently developed molecular technique (amplified fragment length polymorphisms, AFLP) was used for characterizing genetic heterogeneity within and among populations of a critically endangered species of plant, Astragalus cremnophylax var. cremnophylax. Using AFLP, up to 50 polymorphic genetic markers per AFLP-PCR amplification were generated, and a total of 220 variable markers overall. This information was used first to assess genetic diversity within each of the three known populations of Astragalus cremnophylax var. cremnophylax from Grand Canyon National Park in Arizona, USA: North Rim (NR; n = 970), South Rim Site 1 (SR1; n = 500), and South Rim Site 2 (SR2; n = 2). Diversity in the form of average heterozygosity [symbol: see text] H [symbol: see text] and the proportion of polymorphic genes [symbol: see text] P [symbol: see text] was greatest in the NR population ([symbol: see text] H [symbol: see text] = 0.13 and [symbol: see text] P [symbol: see text] = 0.38) and least in the SR2 population ([symbol: see text] H [symbol: see text] = 0.02 and [symbol: see text] P [symbol: see text] = 0.04). Diversity was also quite low for the SR1 population ([symbol: see text] H [symbol: see text] = 0.04 and [symbol: see text] P [symbol: see text] = 0.10). In addition, substantial genetic differentiation among populations was indicated by both phenetic (AMOVA) and genetic analyses (overall corrected FST = 0.41). This finding was corroborated by the results of several multivariate analyses which utilized the genetic data, including a UPGMA cluster analysis and a principal coordinate analysis which revealed the existence of discrete groups corresponding to the populations. Population structure was further revealed within the NR population which was known to consist of four spatially separated groups of plants. Several recommendations for the future management of the species are discussed.

  5. A call for more transparent reporting of error rates: the quality of AFLP data in ecological and evolutionary research.

    PubMed

    Crawford, Lindsay A; Koscinski, Daria; Keyghobadi, Nusha

    2012-12-01

    Despite much discussion of the importance of quantifying and reporting genotyping error in molecular studies, it is still not standard practice in the literature. This is particularly a concern for amplified fragment length polymorphism (AFLP) studies, where differences in laboratory, peak-calling and locus-selection protocols can generate data sets varying widely in genotyping error rate, the number of loci used and potentially estimates of genetic diversity or differentiation. In our experience, papers rarely provide adequate information on AFLP reproducibility, making meaningful comparisons among studies difficult. To quantify the extent of this problem, we reviewed the current molecular ecology literature (470 recent AFLP articles) to determine the proportion of studies that report an error rate and follow established guidelines for assessing error. Fifty-four per cent of recent articles do not report any assessment of data set reproducibility. Of those studies that do claim to have assessed reproducibility, the majority (~90%) either do not report a specific error rate or do not provide sufficient details to allow the reader to judge whether error was assessed correctly. Even of the papers that do report an error rate and provide details, many (≥23%) do not follow recommended standards for quantifying error. These issues also exist for other marker types such as microsatellites, and next-generation sequencing techniques, particularly those which use restriction enzymes for fragment generation. Therefore, we urge all researchers conducting genotyping studies to estimate and more transparently report genotyping error using existing guidelines and encourage journals to enforce stricter standards for the publication of genotyping studies.

  6. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    PubMed

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system.

  7. Microsatellite primers for Camissoniopsis cheiranthifolia (Onagraceae) and cross-amplification in related species1

    PubMed Central

    López-Villalobos, Adriana; Samis, Karen E.; Eckert, Christopher G.

    2014-01-01

    • Premise of the study: We developed 24 nuclear microsatellite primers from an enriched genomic library for the Pacific coastal dune endemic Camissoniopsis cheiranthifolia to study the consequences of mating system differentiation, the genetics of species’ range limits, and hybridization with its closest sister taxon, C. bistorta. • Methods and Results: Twenty-four primer pairs were developed and characterized in four populations of C. cheiranthifolia and one population of C. bistorta. We also tested eight additional taxa for cross-amplification. The average number of alleles per locus per species was 4.3 and 6.0, respectively. The number of loci that amplified and were variable within the eight related taxa ranged from six to 17. • Conclusions: These markers will be useful in studying mating system evolution, the genetic structure of species’ ranges, hybridization, and the provenance of material used for habitat restoration in C. cheiranthifolia, C. bistorta, and related species. PMID:25309839

  8. On Adiabatic Pair Creation

    NASA Astrophysics Data System (ADS)

    Pickl, Peter; Dürr, Detlef

    2008-08-01

    We give here a rigorous proof of the well known prediction of pair creation as it arises from the Dirac equation with an external time dependent potential. Pair creation happens with probability one if the potential changes adiabatically in time and becomes overcritical, which means that an eigenvalue curve (as a function of time) bridges the gap between the negative and positive spectral continuum. The potential can be thought of as being zero at large negative and large positive times. The rigorous treatment of this effect has been lacking since the pioneering work of Beck, Steinwedel and Süßmann [1] in 1963 and Gershtein and Zeldovich [8] in 1970.

  9. Modified primers for the identification of nonpathogenic Fusarium oxysporum isolates that have biological control potential against Fusarium wilt of cucumber in Taiwan.

    PubMed

    Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin

    2013-01-01

    Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber.

  10. Binary electrokinetic separation of target DNA from background DNA primers.

    SciTech Connect

    James, Conrad D.; Derzon, Mark Steven

    2005-10-01

    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  11. Minimal Pairs: Minimal Importance?

    ERIC Educational Resources Information Center

    Brown, Adam

    1995-01-01

    This article argues that minimal pairs do not merit as much attention as they receive in pronunciation instruction. There are other aspects of pronunciation that are of greater importance, and there are other ways of teaching vowel and consonant pronunciation. (13 references) (VWL)

  12. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

    PubMed Central

    Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

    2016-01-01

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity. PMID:26965911

  13. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

    NASA Astrophysics Data System (ADS)

    Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

    2016-03-01

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.

  14. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River.

    PubMed

    Cannon, M V; Hester, J; Shalkhauser, A; Chan, E R; Logue, K; Small, S T; Serre, D

    2016-03-11

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.

  15. Advances in multiplex PCR: balancing primer efficiencies and improving detection success

    PubMed Central

    Sint, Daniela; Raso, Lorna; Traugott, Michael

    2012-01-01

    1. Multiplex PCR is a valuable tool in many biological studies but it is a multifaceted procedure that has to be planned and optimised thoroughly to achieve robust and meaningful results. In particular, primer concentrations have to be adjusted to assure an even amplification of all targeted DNA fragments. Until now, total DNA extracts were used for balancing primer efficiencies; however, the applicability for comparisons between taxa or different multiple-copy genes was limited owing to the unknown number of template molecules present per total DNA. 2. Based on a multiplex system developed to track trophic interactions in high Alpine arthropods, we demonstrate a fast and easy way of generating standardised DNA templates. These were then used to balance the amplification success for the different targets and to subsequently determine the sensitivity of each primer pair in the multiplex PCR. 3. In the current multiplex assay, this approach led to an even amplification success for all seven targeted DNA fragments. Using this balanced multiplex PCR, methodological bias owing to variation in primer efficiency will be avoided when analysing field-derived samples. 4. The approach outlined here allows comparing multiplex PCR sensitivity, independent of the investigated species, genome size or the targeted genes. The application of standardised DNA templates not only makes it possible to optimise primer efficiency within a given multiplex PCR, but it also offers to adjust and/or to compare the sensitivity between different assays. Along with other factors that influence the success of multiplex reactions, and which we discuss here in relation to the presented detection system, the adoption of this approach will allow for direct comparison of multiplex PCR data between systems and studies, enhancing the utility of this assay type. PMID:23549328

  16. Hydrology of Central Florida Lakes - A Primer

    USGS Publications Warehouse

    Schiffer, Donna M.

    1998-01-01

    INTRODUCTION Lakes are among the most valued natural resources of central Florida. The landscape of central Florida is riddled with lakeswhen viewed from the air, it almost seems there is more water than land. Florida has more naturally formed lakes than other southeastern States, where many lakes are created by building dams across streams. The abundance of lakes on the Florida peninsula is a result of the geology and geologic history of the State. An estimated 7,800 lakes in Florida are greater than 1 acre in surface area. Of these, 35 percent are located in just four counties (fig. 1): Lake, Orange, Osceola, and Polk (Hughes, 1974b). Lakes add to the aesthetic and commercial value of the area and are used by many residents and visitors for fishing, boating, swimming, and other types of outdoor recreation. Lakes also are used for other purposes such as irrigation, flood control, water supply, and navigation. Residents and visitors commonly ask questions such as Whyare there so many lakes here?, Why is my lake drying up (or flooding)?, or Is my lake spring-fed? These questions indicate that the basic hydrology of lakes and the interaction of lakes with ground water and surface water are not well understood by the general population. Because of the importance of lakes to residents of central Florida and the many questions and misconceptions about lakes, this primer was prepared by the U.S. Geological Survey (USGS) in cooperation with the St. Johns River Water Management District and the South Florida Water Management District. The USGS has been collecting hydrologic data in central Florida since the 1920s, obtaining valuable information that has been used to better understand the hydrology of the water resources of central Florida, including lakes. In addition to data collection, as of 1994, the USGS had published 66 reports and maps on central Florida lakes (Garcia and Hoy, 1995). The main purpose of this primer is to describe the hydrology of lakes in central

  17. Spectrophotometric determination of tetrazene in primers and primer mixes by use of resorcinol.

    PubMed

    Norwitz, G; Keliher, P N

    1979-06-01

    A spectrophotometric method is proposed for the determination of tetrazene (tetracene) in primers and primer mixes that involves treatment of the tetrazene with resorcinol solution and measurement of the intensity of the yellow colour of the diazo-dye produced. In the application of the method, lead styphnate and barium nitrate are first removed by extraction with ammonium acetate solution and then nitrocellulose and PETN are removed by extraction with acetone. The insoluble matter containing the tetrazene is boiled with resorcinol reagent, the solution filtered, and the absorbance measured at 400 nm. Conditions for optimum colour development are studied and the nature of the reaction is considered.

  18. Development of strain-specific PCR primers for quantitative detection of Bacillus mesentericus strain TO-A in human feces.

    PubMed

    Sato, Naoki; Seo, Genichiro; Benno, Yoshimi

    2014-01-01

    Strain-specific polymerase chain reaction (PCR) primers for detection of Bacillus mesentericus strain TO-A (BM TO-A) were developed. The randomly amplified polymorphic DNA (RAPD) technique was used to produce potential strain-specific markers. A 991-bp RAPD marker found to be strain-specific was sequenced, and two primer pairs specific to BM TO-A were constructed based on this sequence. In addition, we explored a more specific DNA region using inverse PCR, and designed a strain-specific primer set for use in real-time quantitative PCR (qPCR). These primer pairs were tested against 25 Bacillus subtilis strains and were found to be strain-specific. After examination of the detection limit and linearity of detection of BM TO-A in feces, the qPCR method and strain-specific primers were used to quantify BM TO-A in the feces of healthy volunteers who had ingested 3×10(8) colony forming unit (CFU) of BM TO-A per day in tablets. During the administration period, BM TO-A was detected in the feces of all 24 subjects, and the average number of BM TO-A detected using the culture method and qPCR was about 10(4.8) and 10(5.8) cells per gram of feces, respectively. Using the qPCR method, BM TO-A was detected in the feces of half of the subjects 3 d after withdrawal, and was detected in the feces of only one subject 1 week after withdrawal. These results suggest that the qPCR method using BM TO-A strain-specific primers is useful for the quantitative detection of this strain in feces.

  19. Genetic structure in Orchesella cincta (Collembola): strong subdivision of European populations inferred from mtDNA and AFLP markers.

    PubMed

    Timmermans, M J T N; Ellers, J; Mariën, J; Verhoef, S C; Ferwerda, E B; VAN Straalen, N M

    2005-06-01

    Population genetic structure is determined both by current processes and historical events. Current processes include gene flow, which is largely influenced by the migration capacity of a species. Historical events are, for example, glaciation periods, which have had a major impact on the distribution of many species. Species with a low capacity or tendency to move about or disperse often exhibit clear spatial genetic structures, whereas mobile species mostly show less spatial genetic differentiation. In this paper we report on the genetic structure of a small, wingless arthropod species (Orchesella cincta: Collembola) in Europe. For this purpose we used mtDNA COII sequences and AFLP markers. We show that large genetic differences exist between populations of O. cincta, as expected from O. cincta's winglessness and sedentary lifestyle. Despite the fact that most variability was observed within populations (59%), a highly significant amount of AFLP variation (25%) was observed between populations from northwestern Europe, central Europe and Italy. This suggests that gene flow among regions is extremely low, which is additionally supported by the lack of shared mtDNA alleles between regions. Based on the genetic variation and sequence differences observed we conclude that the subdivision occurred long before the last glaciation periods. Although the populations still interbreed in the lab, we assume that in the long term the genetic isolation of these regions may lead to speciation processes.

  20. AFLP markers resolve intra-specific relationships and infer genetic structure among lineages of the canyon treefrog, Hyla arenicolor.

    PubMed

    Klymus, Katy E; Carl Gerhardt, H

    2012-11-01

    The canyon treefrog, Hyla arenicolor, is a wide-ranging hylid found from southwestern US into southern Mexico. Recent studies have shown this species to have a complex evolutionary history, with several phylogeographically distinct lineages, a probable cryptic species, and multiple episodes of mitochondrial introgression with the sister group, the H. eximia complex. We aimed to use genome wide AFLP markers to better resolve relationships within this group. As in other studies, our inferred phylogeny not only provides evidence for repeated mitochondrial introgression between H. arenicolor lineages and H. eximia/H. wrightorum, but it also affords more resolution within the main H. arenicolor clade than was previously achieved with sequence data. However, as with a previous study, the placement of a lineage of H. arenicolor whose distribution is centered in the Balsas Basin of Mexico remains poorly resolved, perhaps due to past hybridization with the H. eximia complex. Furthermore, the AFLP data set shows no differentiation among lineages from the Grand Canyon and Colorado Plateau despite their large mitochondrial sequence divergence. Finally, our results infer a well-supported sister relationship between this combined Colorado Plateau/Grand Canyon lineage and the Sonoran Desert lineage, a relationship that strongly contradicts conclusions drawn from the mtDNA evidence. Our study provides a basis for further behavioral and ecological speciation studies of this system and highlights the importance of multi-taxon (species) sampling in phylogenetic and phylogeographic studies.

  1. Morphological Changes of Paulownia Seedlings Infected Phytoplasmas Reveal the Genes Associated with Witches' Broom through AFLP and MSAP

    PubMed Central

    Cao, Xibing; Fan, Guoqiang; Zhao, Zhenli; Deng, Minjie; Dong, Yanpeng

    2014-01-01

    Paulownia witches' broom (PaWB) caused by phytoplasma might result in devastating damage to the growth and wood production of Paulownia. To study the effect of phytoplasma on DNA sequence and to discover the genes related to PaWB occurrence, DNA polymorphisms and DNA methylation levels and patterns in PaWB seedlings, the ones treated with various concentration of methyl methane sulfonate (MMS) and healthy seedlings were investigated with amplified fragment length polymorphism (AFLP) and methylation-sensitive amplification polymorphism (MSAP). Our results indicated that PaWB seedlings recovered a normal morphology, similar to healthy seedlings, after treatment with more than 20 mg·L−1 MMS; Phytoplasma infection did not change the Paulownia genomic DNA sequence at AFLP level, but changed the global DNA methylation levels and patterns; Genes related to PaWB were discovered through MSAP and validated using quantitative real-time PCR (qRT-PCR). These results implied that changes of DNA methylation levels and patterns were closely related to the morphological changes of seedlings infected with phytoplasmas. PMID:25427154

  2. Morphological changes of Paulownia seedlings infected phytoplasmas reveal the genes associated with witches' broom through AFLP and MSAP.

    PubMed

    Cao, Xibing; Fan, Guoqiang; Zhao, Zhenli; Deng, Minjie; Dong, Yanpeng

    2014-01-01

    Paulownia witches' broom (PaWB) caused by phytoplasma might result in devastating damage to the growth and wood production of Paulownia. To study the effect of phytoplasma on DNA sequence and to discover the genes related to PaWB occurrence, DNA polymorphisms and DNA methylation levels and patterns in PaWB seedlings, the ones treated with various concentration of methyl methane sulfonate (MMS) and healthy seedlings were investigated with amplified fragment length polymorphism (AFLP) and methylation-sensitive amplification polymorphism (MSAP). Our results indicated that PaWB seedlings recovered a normal morphology, similar to healthy seedlings, after treatment with more than 20 mg · L-1 MMS; Phytoplasma infection did not change the Paulownia genomic DNA sequence at AFLP level, but changed the global DNA methylation levels and patterns; Genes related to PaWB were discovered through MSAP and validated using quantitative real-time PCR (qRT-PCR). These results implied that changes of DNA methylation levels and patterns were closely related to the morphological changes of seedlings infected with phytoplasmas.

  3. Non PCR-amplified Transcripts and AFLP fragments as reduced representations of the quail genome for 454 Titanium sequencing

    PubMed Central

    2010-01-01

    Background SNP (Single Nucleotide Polymorphism) discovery is now routinely performed using high-throughput sequencing of reduced representation libraries. Our objective was to adapt 454 GS FLX based sequencing methodologies in order to obtain the largest possible dataset from two reduced representations libraries, produced by AFLP (Amplified Fragment Length Polymorphism) for genomic DNA, and EST (Expressed Sequence Tag) for the transcribed fraction of the genome. Findings The expressed fraction was obtained by preparing cDNA libraries without PCR amplification from quail embryo and brain. To optimize the information content for SNP analyses, libraries were prepared from individuals selected in three quail lines and each individual in the AFLP library was tagged. Sequencing runs produced 399,189 sequence reads from cDNA and 373,484 from genomic fragments, covering close to 250 Mb of sequence in total. Conclusions Both methods used to obtain reduced representations for high-throughput sequencing were successful after several improvements. The protocols may be used for several sequencing applications, such as de novo sequencing, tagged PCR fragments or long fragment sequencing of cDNA. PMID:20667075

  4. AFLP and DNA sequence variation in an Andean domesticate, pepino (Solanum muricatum, Solanaceae): implications for evolution and domestication.

    PubMed

    Blanca, José M; Prohens, Jaime; Anderson, Gregory J; Zuriaga, Elena; Cañizares, Joaquín; Nuez, Fernando

    2007-07-01

    The pepino (Solanum muricatum) is a vegetatively propagated, domesticated native of the Andes, where it grows with wild relatives. We used AFLPs and a 1-kb sequence of the 3-methylcrotonyl-CoA carboxylase gene to study variation of 27 accessions of S. muricatum and 35 collections of 10 species of wild relatives (Solanum section Basarthrum). A total of 298 AFLP fragments and 29 DNA sequence haplotypes were detected. Cluster and principal coordinate analyses and other genetic parameters estimated from both types of markers, show that S. muricatum is closely related to the species from one of the series (Caripensia) of section Basarthrum and that >90% of the variation of the cultigen is also represented in that series. Pepino is highly diverse, either because it is not monophyletic or it has been subjected to regular introgression with wild species, or both. Although a continuous distribution of the genetic variation occurred within the cultivated species, three genetic clusters were recognized. Cluster 1 is mostly centered in Ecuador, cluster 2 in Ecuador and Peru, and cluster 3 in Colombia and Ecuador. Cluster 3 also includes all modern cultivars studied. These results and other evidence suggest that northern Ecuador/southern Colombia is the main center of pepino diversity and the center of origin. The high genetic variation of this cultigen indicates that domestication does not always produce a genetic bottleneck.

  5. Hubble Space Telescope Primer for Cycle 21

    NASA Astrophysics Data System (ADS)

    Gonzaga, S.; et al.

    2012-12-01

    The Hubble Space Telescope Primer for Cycle 21 is a companion document to the HST Call for Proposals1. It provides an overview of the Hubble Space Telescope (HST), with basic information about telescope operations, instrument capabilities, and technical aspects of the proposal preparation process. A thorough understanding of the material in this document is essential for the preparation of a competitive proposal. This document is available as an online HTML document and a PDF file. The HTML version, optimized for online browsing, contains many links to additional information. The PDF version is optimized for printing, but online PDF readers have search capabilities for quick retrieval of specific information.

  6. A primer on clinical trial design.

    PubMed

    Ellimoottil, Chad; Vijan, Sandeep; Flanigan, Robert C

    2015-03-01

    A well-designed and executed clinical trial is the gold standard of evidence-based medicine. It is important for readers to understand the rationale for the study design, identify common pitfalls, and scrutinize limitations. Herein, we present a brief overview of types of designs used for clinical trials and discuss the use of appropriate end points, the selection of study participants, randomization, sample size calculation, blinding, and analysis of data. Finally, we emphasize the importance of accurate and transparent reporting. Our goal is to provide a primer for practicing urologists to enhance their understanding of the clinical trial literature.

  7. An SSR- and AFLP-based genetic linkage map of tall fescue (Festuca arundinacea Schreb.).

    PubMed

    Saha, Malay C; Mian, Rouf; Zwonitzer, John C; Chekhovskiy, Konstantin; Hopkins, Andrew A

    2005-01-01

    Tall fescue (Festuca arundinacea Schreb.) is commonly grown as forage and turf grass in the temperate regions of the world. Here, we report the first genetic map of tall fescue constructed with PCR-based markers. A combination of amplified fragment length polymorphisms (AFLPs) and expressed sequence tag-simple sequence repeats (EST-SSRs) of both tall fescue and those conserved in grass species was used for map construction. Genomic SSRs developed from Festuca x Lolium hybrids were also mapped. Two parental maps were initially constructed using a two-way pseudo-testcross mapping strategy. The female (HD28-56) map included 558 loci placed in 22 linkage groups (LGs) and covered 2,013 cM of the genome. In the male (R43-64) map, 579 loci were grouped in 22 LGs with a total map length of 1,722 cM. The marker density in the two maps varied from 3.61 cM (female parent) to 2.97 (male parent) cM per marker. These differences in map length indicated a reduced level of recombination in the male parent. Markers that revealed polymorphism within both parents and showed 3:1 segregation ratios were used as bridging loci to integrate the two parental maps as a bi-parental consensus. The integrated map covers 1,841 cM on 17 LGs, with an average of 54 loci per LG, and has an average marker density of 2.0 cM per marker. Homoeologous relationships among linkage groups of six of the seven predicted homeologous groups were identified. Three small groups from the HD28-56 map and four from the R43-64 map are yet to be integrated. Homoeologues of four of those groups were detected. Except for a few gaps, markers are well distributed throughout the genome. Clustering of those markers showing significant segregation distortion (23% of total) was observed in four of the LGs of the integrated map.

  8. AFLP fragment isolation technique as a method to produce random sequences for single nucleotide polymorphism discovery in the green turtle, Chelonia mydas.

    PubMed

    Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A

    2009-01-01

    The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.

  9. Global Health in Family Medicine Summer Primer

    PubMed Central

    Rouleau, Katherine; Janakiram, Praseedha; Nicolle, Eileen; Godoy-Ruiz, Paula; Pakes, Barry N.

    2015-01-01

    Abstract Problem addressed Despite the rapid emergence of global health training across North American universities, there remains a gap in educational programs focusing on the unique role of family medicine and primary care in global health. Objective of program The objective of the Global Health in Family Medicine Summer Primer, developed in 2013 by the Department of Family and Community Medicine at the University of Toronto in Ontario, is to strengthen global health competencies among family medicine residents and faculty. Program description The course covers the meaning of global health; global health ethics; the place of family medicine, primary care, and primary health care in the global health context; epidemiology; infectious diseases; the social determinants of health; and care of vulnerable populations locally and globally. The course is delivered in an intensive 5-day format with didactic lectures, group discussions, interactive workshops, and lived-experience panels. Conclusion The Global Health in Family Medicine Summer Primer has proven to be a successful educational initiative and provides valuable lessons learned for other academic science centres in developing global health training programs for family medicine residents and faculty. PMID:26380854

  10. Protected Flux Pairing Qubit

    NASA Astrophysics Data System (ADS)

    Bell, Matthew; Zhang, Wenyuan; Ioffe, Lev; Gershenson, Michael

    2014-03-01

    We have studied the coherent flux tunneling in a qubit containing two submicron Josephson junctions shunted by a superinductor (a dissipationless inductor with an impedance much greater than the resistance quantum). The two low energy quantum states of this device, 0 and 1, are represented by even and odd number of fluxes in the loop, respectively. This device is dual to the charge pairing Josephson rhombi qubit. The spectrum of the device, studied by microwave spectroscopy, reflects the interference between coherent quantum phase slips in the two junctions (the Aharonov-Casher effect). The time domain measurements demonstrate the suppression of the qubit's energy relaxation in the protected regime, which illustrates the potential of this flux pairing device as a protected quantum circuit. Templeton Foundation, NSF, and ARO.

  11. Junctionless Cooper pair transistor

    NASA Astrophysics Data System (ADS)

    Arutyunov, K. Yu.; Lehtinen, J. S.

    2017-02-01

    Quantum phase slip (QPS) is the topological singularity of the complex order parameter of a quasi-one-dimensional superconductor: momentary zeroing of the modulus and simultaneous 'slip' of the phase by ±2π. The QPS event(s) are the dynamic equivalent of tunneling through a conventional Josephson junction containing static in space and time weak link(s). Here we demonstrate the operation of a superconducting single electron transistor (Cooper pair transistor) without any tunnel junctions. Instead a pair of thin superconducting titanium wires in QPS regime was used. The current-voltage characteristics demonstrate the clear Coulomb blockade with magnitude of the Coulomb gap modulated by the gate potential. The Coulomb blockade disappears above the critical temperature, and at low temperatures can be suppressed by strong magnetic field.

  12. The Use of a Combination of alkB Primers to Better Characterize the Distribution of Alkane-Degrading Bacteria.

    PubMed

    Jurelevicius, Diogo; Alvarez, Vanessa Marques; Peixoto, Raquel; Rosado, Alexandre S; Seldin, Lucy

    2013-01-01

    The alkane monooxygenase AlkB, which is encoded by the alkB gene, is a key enzyme involved in bacterial alkane degradation. To study the alkB gene within bacterial communities, researchers need to be aware of the variations in alkB nucleotide sequences; a failure to consider the sequence variations results in the low representation of the diversity and richness of alkane-degrading bacteria. To minimize this shortcoming, the use of a combination of three alkB-targeting primers to enhance the detection of the alkB gene in previously isolated alkane-degrading bacteria was proposed. Using this approach, alkB-related PCR products were detected in 79% of the strains tested. Furthermore, the chosen set of primers was used to study alkB richness and diversity in different soils sampled in Carmópolis, Brazil and King George Island, Antarctica. The DNA extracted from the different soils was PCR amplified with each set of alkB-targeting primers, and clone libraries were constructed, sequenced and analyzed. A total of 255 alkB phylotypes were detected. Venn diagram analyses revealed that only low numbers of alkB phylotypes were shared among the different libraries derived from each primer pair. Therefore, the combination of three alkB-targeting primers enhanced the richness of alkB phylotypes detected in the different soils by 45% to 139%, when compared to the use of a single alkB-targeting primer. In addition, a dendrogram analysis and beta diversity comparison of the alkB composition showed that each of the sampling sites studied had a particular set of alkane-degrading bacteria. The use of a combination of alkB primers was an efficient strategy for enhancing the detection of the alkB gene in cultivable bacteria and for better characterizing the distribution of alkane-degrading bacteria in different soil environments.

  13. The Use of a Combination of alkB Primers to Better Characterize the Distribution of Alkane-Degrading Bacteria

    PubMed Central

    Jurelevicius, Diogo; Alvarez, Vanessa Marques; Peixoto, Raquel; Rosado, Alexandre S.; Seldin, Lucy

    2013-01-01

    The alkane monooxygenase AlkB, which is encoded by the alkB gene, is a key enzyme involved in bacterial alkane degradation. To study the alkB gene within bacterial communities, researchers need to be aware of the variations in alkB nucleotide sequences; a failure to consider the sequence variations results in the low representation of the diversity and richness of alkane-degrading bacteria. To minimize this shortcoming, the use of a combination of three alkB-targeting primers to enhance the detection of the alkB gene in previously isolated alkane-degrading bacteria was proposed. Using this approach, alkB-related PCR products were detected in 79% of the strains tested. Furthermore, the chosen set of primers was used to study alkB richness and diversity in different soils sampled in Carmópolis, Brazil and King George Island, Antarctica. The DNA extracted from the different soils was PCR amplified with each set of alkB-targeting primers, and clone libraries were constructed, sequenced and analyzed. A total of 255 alkB phylotypes were detected. Venn diagram analyses revealed that only low numbers of alkB phylotypes were shared among the different libraries derived from each primer pair. Therefore, the combination of three alkB-targeting primers enhanced the richness of alkB phylotypes detected in the different soils by 45% to 139%, when compared to the use of a single alkB-targeting primer. In addition, a dendrogram analysis and beta diversity comparison of the alkB composition showed that each of the sampling sites studied had a particular set of alkane-degrading bacteria. The use of a combination of alkB primers was an efficient strategy for enhancing the detection of the alkB gene in cultivable bacteria and for better characterizing the distribution of alkane-degrading bacteria in different soil environments. PMID:23825163

  14. GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms

    PubMed Central

    David, Fabrice P.A.; Rougemont, Jacques; Deplancke, Bart

    2017-01-01

    GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. PMID:28053161

  15. Controlled hot start and improved specificity in carrying out PCR utilizing touch-up and loop incorporated primers (TULIPS).

    PubMed

    Ailenberg, M; Silverman, M

    2000-11-01

    The PCR technique often yields nonspecific products. To overcome this problem, a simple, specific and efficient method was designed: touch-up and loop incorporated primers (TULIPS)-PCR. This approach utilizes loop primers (i.e., additional nontemplate 5' sequence that self-anneals to the 3' region and inhibits initiation of polymerization). Upon heating of the reaction, the primers melt, initiating hot start. The reaction also uses touch-up pre-cycling with gradual elevation in annealing temperatures to ensure correct pairing. The method has been validated with glyceraldehyde-3-phosphate dehydrogenase (GAPD) primers, and its general applicability is demonstrated by specific amplification of the human gelatinase A transgene from genomic DNA extracted from transgenic mice tails. The TULIPS-PCR protocol is a novel method. The self-annealing primers utilized in this method offer improved specificity and more robust synthesis compared with touch-down and manual hot start PCR. It is performed without the need to open, pause or add to the reaction mixture any nonrectant components, such as wax, antibody or nonspecific dsDNA.

  16. Differentially expressed genes in Populus simonii x P. nigra in respnse to NaCl stress using cDNA-AFLP

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Salinity is an important environmental factor limiting growth and productivity of plants, and affects almost every aspect of the plant physiology and biochemistry. The objective of this study was to apply cDNA-AFLP and to identify differentially expressed genes in response to NaCl stress vs. no-stre...

  17. A new PCR primer for the identification of Paracoccidioides brasiliensis based on rRNA sequences coding the internal transcribed spacers (ITS) and 5 x 8S regions.

    PubMed

    Imai, T; Sano, A; Mikami, Y; Watanabe, K; Aoki, F H; Branchini, M L; Negroni, R; Nishimura, K; Miyaji, M

    2000-08-01

    Internal transcribed spacer (ITS) genes including the 5.8S ribosomal (r)RNA of Paracoccidioides brasiliensis were amplified and the DNA sequences were determined. Based on a comparison of the sequence information, a new polymerase chain reaction (PCR) primer pair was designed for specific amplification of DNA for P. brasiliensis. This primer pair amplified a 418-bp DNA sequence and was 100% successful in identifying 29 strains of P. brasiliensis (including the reference strains) isolated from the regions of Brazil, Costa Rica, Japan, Argentina or from different sources. The results of specificity tests of these primers to compare the fungus with those of Aspergillus fumigatus, Blastomyces dermatitidis, Candida albicans, Cryptococcus neoformans, Histoplasma capsulatum and Penicillium marneffei are also reported.

  18. Use of conserved genomic regions and degenerate primers in a PCR-based assay for the detection of members of the genus Caulimovirus.

    PubMed

    Pappu, H R; Druffel, K L

    2009-04-01

    The genus Caulimovirus consists of several distinct virus species with a double-stranded DNA genome that infect diverse plant species. A comparative analysis of the sequences of known Caulimovirus species revealed two regions that are conserved in all Caulimovirus species with the exception of Strawberry vein banding virus. Degenerate primers based on these two regions were designed and tested in a polymerase chain reaction-based assay for broad spectrum detection of members of this genus. Cauliflower mosaic virus, Figwort mosaic virus and three distinct caulimoviruses associated with dahlia (Dahlia variabilis) were used to show the utility of this test in detecting diverse caulimoviruses. The primer pair gave an amplicon of expected size (840bp). Amplicons from each virus were cloned and sequenced to verify their identity. The primer pair and the PCR assay provide approach for the broad spectrum detection of several members of the genus Caulimovirus.

  19. Great Lakes rivermouths: a primer for managers

    USGS Publications Warehouse

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  20. Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

    EPA Pesticide Factsheets

    This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

  1. AFLP analysis reveals high genetic diversity but low population structure in Coccidioides posadasii isolates from Mexico and Argentina

    PubMed Central

    2013-01-01

    Background Coccidioides immitis and C. posadasii cause coccidioidomycosis, a disease that is endemic to North and South America, but for Central America, the incidence of coccidioidomycosis has not been clearly established. Several studies suggest genetic variability in these fungi; however, little definitive information has been discovered about the variability of Coccidioides fungi in Mexico (MX) and Argentina (AR). Thus, the goals for this work were to study 32 Coccidioides spp. isolates from MX and AR, identify the species of these Coccidioides spp. isolates, analyse their phenotypic variability, examine their genetic variability and investigate the Coccidioides reproductive system and its level of genetic differentiation. Methods Coccidioides spp. isolates from MX and AR were taxonomically identified by phylogenetic inference analysis using partial sequences of the Ag2/PRA gene and their phenotypic characteristics analysed. The genetic variability, reproductive system and level of differentiation were estimated using AFLP markers. The level of genetic variability was assessed measuring the percentage of polymorphic loci, number of effective allele, expected heterocygosity and Index of Association (IA). The degree of genetic differentiation was determined by AMOVA. Genetic similarities among isolates were estimated using Jaccard index. The UPGMA was used to contsruct the corresponding dendrogram. Finally, a network of haplotypes was built to evaluate the genealogical relationships among AFLP haplotypes. Results All isolates of Coccidioides spp. from MX and AR were identified as C. posadasii. No phenotypic variability was observed among the C. posadasii isolates from MX and AR. Analyses of genetic diversity and population structure were conducted using AFLP markers. Different estimators of genetic variability indicated that the C. posadasii isolates from MX and AR had high genetic variability. Furthermore, AMOVA, dendrogram and haplotype network showed a small

  2. Genetic maps for Pinus elliottii var. elliottii and P. caribaea var. hondurensis using AFLP and microsatellite markers.

    PubMed

    Shepherd, M; Cross, M; Dieters, M J; Henry, R

    2003-05-01

    Genetic maps for individual Pinus elliottii var. elliottii and P. caribaea var. hondurensis trees were generated using a pseudo-testcross mapping strategy. A total of 329 amplified fragment length polymorphic (AFLP) and 12 microsatellite markers were found to segregate in a sample of 93 interspecfic F(1) progeny. The male P. caribaea var. hondurensis parent was more heterozygous than the female P. elliottii var. elliottii parent with 19% more markers segregating on the male side. Framework maps were constructed using a LOD 5 threshold for grouping and interval support threshold of LOD 2. The framework map length for the P. elliottii var. elliottii megagametophyte parent (1,170 cM Kosambi; 23 linkage groups) was notably smaller than the P. caribaea var. hondurensis pollen parent (1,658 cM Kosambi; 27 linkage groups). The difference in map lengths was assumed to be due to sex-related recombination variation, which has been previously reported for pines, as the difference in map lengths not be accounted for by the larger number of markers mapping to the P. caribaea var. hondurensis parent - 109 compared with 78 in P. elliottii var. elliottii parent. Based on estimated genome sizes for these species, the framework maps for P. elliottii var. elliottii and P. caribaea var. hondurensis covered 82% and 88% of their respective genomes. The pseudo-testcross strategy was extended to include AFLP and microsatellite markers in an intercross configuration. These comprehensive maps provided further genome coverage, 1,548 and 1,828 cM Kosambi for P. elliottii var. elliottii and P. caribaea var. hondurensis, respectively, and enabled homologous linkage groups to be identified in the two parental maps. Homologous linkage groups were identified for 11 out of 24 P. elliottii var. elliottii and 10 out of 25 P. caribaea var. hondurensis groups. A higher than expected level of segregation distortion was found for both AFLP and microsatellite markers. An explanation for this segregation

  3. McrA primers for the detection and quantification of the anaerobic archaeal methanotroph 'Candidatus Methanoperedens nitroreducens'.

    PubMed

    Vaksmaa, Annika; Jetten, Mike S M; Ettwig, Katharina F; Lüke, Claudia

    2017-02-01

    The nitrogen and methane cycles are important biogeochemical processes. Recently, 'Candidatus Methanoperedens nitroreducens,' archaea that catalyze nitrate-dependent anaerobic oxidation of methane (AOM), were enriched, and their genomes were analyzed. Diagnostic molecular tools for the sensitive detection of 'Candidatus M. nitroreducens' are not yet available. Here, we report the design of two novel mcrA primer combinations that specifically target the alpha sub-unit of the methyl-coenzyme M reductase (mcrA) gene of 'Candidatus M. nitroreducens'. The first primer pair produces a fragment of 186-bp that can be used to quantify 'Candidatus M. nitroreducens' cells, whereas the second primer pair yields an 1191-bp amplicon that is with sufficient length and well suited for more detailed phylogenetic analyses. Six different environmental samples were evaluated with the new qPCR primer pair, and the abundances were compared with those determined using primers for the 16S rRNA gene. The qPCR results indicated that the number of copies of the 'Candidatus M. nitroreducens' mcrA gene was highest in rice field soil, with 5.6 ± 0.8 × 10(6) copies g(-1) wet weight, whereas Indonesian river sediment had only 4.6 ± 2.7 × 10(2) copies g(-1) wet weight. In addition to freshwater environments, sequences were also detected in marine sediment of the North Sea, which contained approximately 2.5 ± 0.7 × 10(4) copies g(-1) wet weight. Phylogenetic analysis revealed that the amplified 1191-bp mcrA gene sequences from the different environments all clustered together with available genome sequences of mcrA from known 'Candidatus M. nitroreducens' archaea. Taken together, these results demonstrate the validity and utility of the new primers for the quantitative and sensitive detection of the mcrA gene sequences of these important nitrate-dependent AOM archaea. Furthermore, the newly obtained mcrA sequences will contribute to greater phylogenetic resolution of 'Candidatus M

  4. Conserved primers for DNA barcoding historical and modern samples from New Zealand and Antarctic birds.

    PubMed

    Patel, Selina; Waugh, John; Millar, Craig D; Lambert, David M

    2010-05-01

    Our ability to DNA barcode the birds of the world is based on the effective amplification and sequencing of a 648 base pair (bp) region of the mitochondrial cytochrome c oxidase (COI or cox1) gene. For many geographic regions the large numbers of vouchered specimens necessary for the construction of a DNA barcoding database have already been collected and are available in museums and other institutions. However, many of these specimens are old (>20 years) and are stored as either fixed study skins or dried skeletons. DNA extracted from such historical samples is typically degraded and, generally, only short DNA fragments can be recovered from such specimens making the recovery of the barcoding region as a single fragment difficult. We report two sets of conserved primers that allow the amplification of the entire DNA barcoding region in either three or five overlapping fragments. These primer sets allow the recovery of DNA barcodes from valuable historical specimens that in many cases are unique in that they are unable or unlikely to be collected again. We also report three new primers that in combination allow the effective amplification from modern samples of the entire DNA barcoding region as a single DNA fragment for 17 orders of Southern Hemisphere birds.

  5. Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

    SciTech Connect

    Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J.

    2012-08-01

    The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

  6. HST archive primer, version 4.1

    NASA Technical Reports Server (NTRS)

    Fruchter, A. (Editor); Baum, S. (Editor)

    1994-01-01

    This version of the HST Archive Primer provides the basic information a user needs to know to access the HST archive via StarView the new user interface to the archive. Using StarView, users can search for observations interest, find calibration reference files, and retrieve data from the archive. Both the terminal version of StarView and the X-windows version feature a name resolver which simplifies searches of the HST archive based on target name. In addition, the X-windows version of StarView allows preview of all public HST data; compressed versions of public images are displayed via SAOIMAGE, while spectra are plotted using the public plotting package, XMGR. Finally, the version of StarView described here features screens designed for observers preparing Cycle 5 HST proposals.

  7. Primer on tritium safe handling practices

    SciTech Connect

    Not Available

    1994-12-01

    This Primer is designed for use by operations and maintenance personnel to improve their knowledge of tritium safe handling practices. It is applicable to many job classifications and can be used as a reference for classroom work or for self-study. It is presented in general terms for use throughout the DOE Complex. After reading it, one should be able to: describe methods of measuring airborne tritium concentration; list types of protective clothing effective against tritium uptake from surface and airborne contamination; name two methods of reducing the body dose after a tritium uptake; describe the most common method for determining amount of tritium uptake in the body; describe steps to take following an accidental release of airborne tritium; describe the damage to metals that results from absorption of tritium; explain how washing hands or showering in cold water helps reduce tritium uptake; and describe how tritium exchanges with normal hydrogen in water and hydrocarbons.

  8. Pair of Craters

    NASA Technical Reports Server (NTRS)

    2005-01-01

    14 July 2005 This Mars Global Surveyor (MGS) Mars Orbiter Camera (MOC) image shows a 1.5 meters per pixel (5 ft/pixel) view of a pair of small meteor impact craters in the Arena Colles region of Mars, located north of Isidis Planitia.

    Location near: 22.7oN, 278.5oW Image width: width: 3 km (1.9 mi) Illumination from: lower left Season: Northern Autumn

  9. Formaldehyde as hypothetical primer of biohomochirality

    SciTech Connect

    Goldanskii, V.I.

    1996-07-01

    One of the most intriguing and crucial problems of the prebiotic evolution and the origin of life is the explanation of the origin of biohomochirality. A scheme of conversions originated by formaldehyde (FA) as hypothetical primer of biohomochirality is proposed. The merit of FA as executor of this function is based -inter alia - on the distinguished role of FA as one of the earliest and simplest molecules in both warm, terrestrial and cold, extraterrestrial scenarios of the origin of life. The confirmation of the role of FA as primer of biohomochirality would support the option of an RNA world as an alternative to the protein world. The suggested hypothesis puts forward for the first time a concrete sequence of chemical reactions which can lead to biohomochirality. The spontaneous breaking of the mirror symmetry is secured by the application of the well-known Frank scheme (combination of autocatalysis and {open_quote}{open_quote}annihilation{close_quote}{close_quote} of L and D enantiomers) to the series of interactions of FA {open_quote}{open_quote}trimers{close_quote}{close_quote} (i.e. C{sub 3}H{sub 6}O{sub 3} compounds) of (aaa), (apa) and (app) types, where the monomeric groups (a) means {open_quote}{open_quote}achirons{close_quote}{close_quote} (a=CH{sub n}, n{ge}2 and C=M, M=C,O) and (p) mean {open_quote}{open_quote}prochirons{close_quote}{close_quote} (p=HC{asterisk}OM, M=H,C). {copyright} {ital 1996 American Institute of Physics.}

  10. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine.

    PubMed

    Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard

    2012-11-01

    8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.

  11. Type III burst pair

    NASA Astrophysics Data System (ADS)

    Ning, Zongjun; Fu, Qijun; Lu, Quankang

    2000-05-01

    We present a special solar radio burst detected on 5 January 1994 using the multi-channel (50) spectrometer (1.0-2.0 GHz) of the Beijing Astronomical Observatory (BAO). Sadly, the whole event could not be recorded since it had a broader bandwidth than the limit range of the instrument. The important part was obtained, however. The event is composed of a normal drift type III burst on the lower frequency side and a reverse drift type III burst appearing almost simultaneously on the high side. We call the burst type III a burst pair. It is a typical characteristic of two type III bursts that they are morphologically symmetric about some frequency from 1.64 GHz to 1.78 GHz on the dynamic spectra records, which indicates that there are two different electron beams from the same acceleration region travelling simultaneously in opposite directions (upward and downward). A magnetic reconnection mode is a nice interpretation of type III burst pair since the plasma beta β~=0.01 is much less than 1 and the beams have velocity of about 1.07×10^8 cm s^-1 after leaving the reconnection region if we assume that the ambient magnetic field strength is about 100 G.

  12. Type III burst pair.

    NASA Astrophysics Data System (ADS)

    Zongjun, Ning; Fu, Qijun; Quankang, Lu

    2000-05-01

    Presents a special solar radio burst detected on 5 January 1994 using the multi-channel (50) spectrometer (1.0 - 2.0 GHz) of the Beijing Astronomical Observatory. Sadly, the whole event could not be recorded since it had a broader bandwidth than the limit range of the instrument. The important part was obtained, however. The event is composed of a normal drift type III burst on the lower frequency side and a reverse drift type III burst appearing almost simultaneously on the high side. The authors call the burst type III a burst pair. It is a typical characteristic of two type III bursts that they are morphologically symmetric about some frequency from 1.64 GHz to 1.78 GHz on the dynamic spectra records, which indicates that there are two different electron beams from the same acceleration region travelling simultaneously in opposite directions (upward and downward). A magnetic reconnection mode is an interpretation of type III burst pair.

  13. Cryptococcal meningitis due to Cryptococcus neoformans genotype AFLP1/VNI in Iran: a review of the literature.

    PubMed

    Badali, Hamid; Alian, Shahriar; Fakhim, Hamed; Falahatinejad, Mahsa; Moradi, Ali; Mohammad Davoudi, Mehrnaz; Hagen, Ferry; Meis, Jacques F

    2015-12-01

    Cryptococcal meningitis is the most important opportunistic fungal infection with a high mortality in HIV-patients in less developed regions. Here, we report a case of cryptococcal meningitis in a 49-year-old HIV-positive female due to Cryptococcus neoformans (serotype A, mating-type alpha, genotype AFLP1/VNI) in Sari, Iran. In vitro antifungal susceptibility tests showed MICs of isavuconazole (0.016 μg ml(-1) ), voriconazole (0.031 μg ml(-1) ), posaconazole (0.031 μg ml(-1) ), itraconazole (0.063 μg ml(-1) ), amphotericin B (0.125 μg ml(-1) ) and fluconazole (8 μg ml(-1) ). Despite immediate antifungal therapy, the patient died 4 days later due to respiratory failure. Cryptococcal infections have been infrequently reported from Iran and therefore we analysed all published cases of cryptococcosis in Iran since the first reported case from 1969.

  14. Opisthorchis viverrini and Haplorchis taichui: development of a multiplex PCR assay for their detection and differentiation using specific primers derived from HAT-RAPD.

    PubMed

    Wongsawad, Chalobol; Wongsawad, Pheravut

    2012-10-01

    Specific primers for the detection of Opisthorchis viverrini and Haplorchis taichui were investigated by using the HAT-RAPD PCR method. Fourteen arbitrary primers (Operon Technologies) were performed for the generation of polymorphic DNA profiles. The results showed that a 319 bp fragment generated from the OPA-04 primer was expected to be O. viverrini-specific while a 256 bp fragment generated from the OPP-11 primer was considered to be H. taichui-specific. Based on each sequence data, two pairs of specific primers were designed and sequences of each primer were as follows; H. taichui; Hapt_F5'-GGCCAACGCAATCGTCATCC-3'and Hapt_R1 5'-CTCTCGACCTCCTCTAGAAT-3' which yielded a 170 bp PCR product. For O. viverrini, OpV-1F: 5'-AATCGGGCTGCATATTGACCGAT-3' and OpV-1R: 5'-CGGTGTTGCTTATTTTGCAGACAA-3' which generated a 319 bp PCR product. These specific primers were tested for efficacy and specific detection for all parasites DNA samples. The results showed that 170 and 319 bp specific PCR products were generated as equivalent to positive result in H. taichui and O. viverrini, respectively by having no cross-reaction with any parasites tested. PCR conditions are recommended at 68°C annealing temperature and with 0.5 mM magnesium chloride (Mg Cl(2)). Additionally, specific primers developed in this study were effective to determine the presence of both parasites in fish and snail intermediate hosts, which the DNA of O. viverrini was artificially spiked since it is rarely found in northern Thailand. The H. taichui and O. viverrini-specific primers successfully developed in this study can be use for epidemiological monitoring, preventing management and control programs.

  15. Seafood Identification in Multispecies Products: Assessment of 16SrRNA, cytb, and COI Universal Primers' Efficiency as a Preliminary Analytical Step for Setting up Metabarcoding Next-Generation Sequencing Techniques.

    PubMed

    Giusti, Alice; Tinacci, Lara; Sotelo, Carmen G; Marchetti, Martina; Guidi, Alessandra; Zheng, Wenjie; Armani, Andrea

    2017-04-05

    Few studies applying NGS have been conducted in the food inspection field, particularly on multispecies seafood products. A preliminary study screening the performance and the potential application in NGS analysis of 14 "universal primers" amplifying 16SrRNA, cytb, and COI genes in fish and cephalopods was performed. Species used in surimi preparation were chosen as target. An in silico analysis was conducted to test primers' coverage capacity by assessing mismatches (number and position) with the target sequences. The 9 pairs showing the best coverage capacity were tested in PCR on DNA samples of 53 collected species to assess their amplification performance (amplification rate and amplicon concentration). The results confirm that primers designed for the 16SrRNA gene amplification are the most suitable for NGS analysis also for identification of multispecies seafood products. In particular, the primer pair of Chapela et al. (2002) is the best candidate.

  16. Revisiting AFLP fingerprinting for an unbiased assessment of genetic structure and differentiation of taurine and zebu cattle

    PubMed Central

    2014-01-01

    Background Descendants from the extinct aurochs (Bos primigenius), taurine (Bos taurus) and zebu cattle (Bos indicus) were domesticated 10,000 years ago in Southwestern and Southern Asia, respectively, and colonized the world undergoing complex events of admixture and selection. Molecular data, in particular genome-wide single nucleotide polymorphism (SNP) markers, can complement historic and archaeological records to elucidate these past events. However, SNP ascertainment in cattle has been optimized for taurine breeds, imposing limitations to the study of diversity in zebu cattle. As amplified fragment length polymorphism (AFLP) markers are discovered and genotyped as the samples are assayed, this type of marker is free of ascertainment bias. In order to obtain unbiased assessments of genetic differentiation and structure in taurine and zebu cattle, we analyzed a dataset of 135 AFLP markers in 1,593 samples from 13 zebu and 58 taurine breeds, representing nine continental areas. Results We found a geographical pattern of expected heterozygosity in European taurine breeds decreasing with the distance from the domestication centre, arguing against a large-scale introgression from European or African aurochs. Zebu cattle were found to be at least as diverse as taurine cattle. Western African zebu cattle were found to have diverged more from Indian zebu than South American zebu. Model-based clustering and ancestry informative markers analyses suggested that this is due to taurine introgression. Although a large part of South American zebu cattle also descend from taurine cows, we did not detect significant levels of taurine ancestry in these breeds, probably because of systematic backcrossing with zebu bulls. Furthermore, limited zebu introgression was found in Podolian taurine breeds in Italy. Conclusions The assessment of cattle diversity reported here contributes an unbiased global view to genetic differentiation and structure of taurine and zebu cattle

  17. Detecting reticulate relationships among diploid Leucanthemum Mill. (Compositae, Anthemideae) taxa using multilocus species tree reconstruction methods and AFLP fingerprinting.

    PubMed

    Konowalik, Kamil; Wagner, Florian; Tomasello, Salvatore; Vogt, Robert; Oberprieler, Christoph

    2015-11-01

    We examined the evolutionary history of the diploid representatives of the genus Leucanthemum Mill. (Compositae, Anthemideae), which constitutes an extensive polyploid complex comprising around 41 species with ploidy levels ranging from 2x to 22x. The inference of phylogenetic relationships even on the diploid level is complicated in this genus due to the overlay of hybridisation and incomplete lineage sorting processes leading to incongruence among gene trees based on nuclear and plastid sequence information. Species tree and network reconstructions were based on gene trees from nine low-copy nuclear markers and the concatenated sequence information for five intergenic spacer regions of the chloroplast genome, either sequenced by Roche 454 pyrosequencing techniques or traditional Sanger sequencing techniques. Additional phylogenetic information came from multi-locus AFLP-fingerprinting of representative individuals of all diploid taxa under study and the subsequent analysis of AFLP patterns with Bayesian clustering and network reconstruction methods. To distinguish between hybridisation and incomplete lineage sorting, we developed and utilized a new 'hybrid index' calculation for individual taxa of the data set, which was compared to a simulated null-distribution assuming the occurrence of incomplete lineage sorting alone for pinpointing taxa with a significant hybrid signal. As a result, two species groups with contrasting patterns of gene flow and/or hybrid speciation signals could be identified in the diploids of Leucanthemum: (a) an early-diverging stock of allopatrically distributed diploid species with a lack of evidence for recent hybridisation events among its members and (b) a more recently radiated taxon assemblage with morphologically less clearly circumscribed taxa and a pronounced signal of gene flow among lineages and several candidate taxa, for which a homoploid hybrid origin may be considered.

  18. Microsatellite primers for the Pacific Northwest conifer Callitropsis nootkatensis (Cupressaceae)1

    PubMed Central

    Jennings, Tara N.; Knaus, Brian J.; Alderman, Katherine; Hennon, Paul E.; D’Amore, David V.; Cronn, Richard

    2013-01-01

    • Premise of the study: Microsatellite primers were developed for Nootka cypress (Callitropsis nootkatensis) to provide quantitative measures for gene conservation that can assist in guiding management decisions for a species experiencing climate-induced decline. • Methods and Results: Using multiplexed massively parallel sequencing, we identified 136,785 microsatellite-containing sequences from 489,625 Illumina paired-end 80-bp reads. After stringent filtering, we selected 144 primer pairs and screened variation at these loci in five populations of C. nootkatensis. Loci show between three and 36 dinucleotide repeats per locus, with an average of 13. Screening of these markers in the Pacific Northwest relative Chamaecyparis lawsoniana demonstrated no marker transferability. This finding highlights the narrow taxonomic utility of microsatellite markers in Callitropsis. • Conclusions: These microsatellites show high polymorphism and can be used for routine screening of natural variation in Callitropsis nootkatensis, and will be particularly helpful in identifying clones and inbred relatives at the stand-level. PMID:25202587

  19. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    ERIC Educational Resources Information Center

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  20. A Primer for the NEWBASIC/CATALYST System.

    ERIC Educational Resources Information Center

    Dwyer, Thomas A.; And Others

    Assuming no previous experience with computers, this primer is designed to help students, teachers, scientists, and other scholars to learn how to use the NEWBASIC/CATALYST system (NBS). The primer contains nine sections: (1) instructions for establishing contact with the computer (logging on); (2) examples and problems to lead the student through…

  1. Tolerance of base pair size and shape in postlesion DNA synthesis.

    PubMed

    Gahlon, Hailey L; Schweizer, W Bernd; Sturla, Shana J

    2013-05-01

    The influence of base pair size and shape on the fidelity of DNA polymerase-mediated extension past lesion-containing mispairs was examined. Primer extension analysis was performed with synthetic nucleosides paired opposite the pro-mutagenic DNA lesion O(6)-benzylguanine (O(6)-BnG). These data indicate that the error-prone DNA polymerase IV (Dpo4) inefficiently extended past the larger Peri:O(6)-BnG base pair, and in contrast, error-free extension was observed for the smaller BIM:O(6)-BnG base pair. Steady-state kinetic analysis revealed that Dpo4 catalytic efficiency was strongly influenced by the primer:template base pair. Compared to the C:G pair, a 1.9- and 79,000-fold reduction in Dpo4 efficiency was observed for terminal C:O(6)-BnG and BIM:G base pairs respectively. These results demonstrate the impact of geometrical size and shape on polymerase-mediated mispair extension.

  2. Uncoupling primer and releaser responses to pheromone in honey bees

    NASA Astrophysics Data System (ADS)

    Grozinger, Christina M.; Fischer, Patrick; Hampton, Jacob E.

    2007-05-01

    Pheromones produce dramatic behavioral and physiological responses in a wide variety of species. Releaser pheromones elicit rapid responses within seconds or minutes, while primer pheromones produce long-term changes which may take days to manifest. Honeybee queen mandibular pheromone (QMP) elicits multiple distinct behavioral and physiological responses in worker bees, as both a releaser and primer, and thus produces responses on vastly different time scales. In this study, we demonstrate that releaser and primer responses to QMP can be uncoupled. First, treatment with the juvenile hormone analog methoprene leaves a releaser response (attraction to QMP) intact, but modulates QMP’s primer effects on sucrose responsiveness. Secondly, two components of QMP (9-ODA and 9-HDA) do not elicit a releaser response (attraction) but are as effective as QMP at modulating a primer response, downregulation of foraging-related brain gene expression. These results suggest that different responses to a single pheromone may be produced via distinct pathways.

  3. Diversity of methane-cycling archaea in hydrothermal sediment investigated by general and group-specific PCR primers.

    PubMed

    Lever, Mark A; Teske, Andreas P

    2015-02-01

    The zonation of anaerobic methane-cycling Archaea in hydrothermal sediment of Guaymas Basin was studied by general primerpairs (mcrI, ME1/ME2, mcrIRD) targeting the alpha subunit of methyl coenzyme M reductase gene (mcrA) and by new group specific mcrA and 16S rRNA gene primer pairs. The mcrIRD primer pair outperformed the other general mcrA primer pairs indetection sensitivity and phylogenetic coverage. Methanotrophic ANME-1 Archaea were the only group detected with group specific primers only. The detection of 14 mcrA lineages surpasses the diversity previously found in this location. Most phylotypes have high sequence similarities to hydrogenotrophs, methylotrophs, and anaerobic methanotrophs previously detected at Guaymas Basin or at hydrothermal vents, cold seeps, and oil reservoirs worldwide. Additionally, five mcrA phylotypes belonging to newly defined lineages are detected. Two of these belong to deeply branching new orders, while the others are new species or genera of Methanopyraceae and Methermicoccaceae. Downcore diversity decreases from all groups detected in the upper 6 cm(2 to 40 °C, sulfate measurable to 4 cm) to only two groups below 6 cm (>40 °C). Despite the presence of hyperthermophilic genera (Methanopyrus, Methanocaldococcus) in cooler surface strata, no genes were detected below 10 cm (>60 °C). While mcrAbased and 16S rRNA gene-based community compositions are generally congruent, the deeply branching mcrA cannot be assigned to specific 16S rRNA gene lineages. Our study indicates that even among well-studied metabolic groups and in previously characterized model environments, major evolutionary branches are overlooked. Detecting these groups by improved molecular biological methods is a crucial first step toward understanding their roles in nature.

  4. Multiprocessor switch with selective pairing

    DOEpatents

    Gara, Alan; Gschwind, Michael K; Salapura, Valentina

    2014-03-11

    System, method and computer program product for a multiprocessing system to offer selective pairing of processor cores for increased processing reliability. A selective pairing facility is provided that selectively connects, i.e., pairs, multiple microprocessor or processor cores to provide one highly reliable thread (or thread group). Each paired microprocessor or processor cores that provide one highly reliable thread for high-reliability connect with a system components such as a memory "nest" (or memory hierarchy), an optional system controller, and optional interrupt controller, optional I/O or peripheral devices, etc. The memory nest is attached to a selective pairing facility via a switch or a bus

  5. Assessment of primers designed for the subspecies-specific discrimination among Babesia canis canis, Babesia canis vogeli and Babesia canis rossi by PCR assay.

    PubMed

    Duarte, Sabrina Castilho; Linhares, Guido Fontgalland Coelho; Romanowsky, Tatiana Nunes; da Silveira Neto, Osvaldo José; Borges, Ligia Miranda Ferreira

    2008-03-25

    Canine babesiosis is an infectious disease caused by either Babesia gibsoni or Babesia canis protozoans. The latter is also classified under three different phylogenetic groups, referred to as subspecies B. canis canis, B. canis vogeli and B. canis rossi. The objective of the present study was to validate and standardize a PCR assay to discriminate the organisms at the subspecies level. First, the reference sequences of the 18S rRNA, 5.8S rRNA and 28S rRNA genes, including the internal transcribed spacer 1 (ITS1) and 2 (ITS2) of the most common species and subspecies of the genus Babesia were retrieved from the GenBank database. Subspecies-specific primers (BAB3, BAB4 and BAB5) and one genus-specific primer were designed from the alignment of the sequences. The PCR assays were evaluated in three different combinations of primer pairs in order to assure complete specificity for each reaction. The results of the tests had demonstrated effectiveness of the novel primer pairs BAB1/BAB3, BAB1/BAB4 and BAB1/BAB5 for the amplification of the subspecies-specific target fragments of 746 bp (B. c. canis), 546 bp (B. c. vogeli) and 342 bp (B. c. rossi) by PCR. The original enzymatic amplification assays with novel primers reported in this paper were confirmed to be a reliable tool for the specific discrimination among B. canis subspecies by single-step PCR assays.

  6. Primer on electricity futures and other derivatives

    SciTech Connect

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  7. Stereo Pair, Pasadena, California

    NASA Technical Reports Server (NTRS)

    2000-01-01

    This stereoscopic image pair is a perspective view that shows the western part of the city of Pasadena, California, looking north toward the San Gabriel Mountains. Portions of the cities of Altadena and La Canada Flintridge are also shown. The cluster of large buildings left of center, at the base of the mountains, is the Jet Propulsion Laboratory. This image shows the power of combining data from different sources to create planning tools to study problems that affect large urban areas. In addition to the well-known earthquake hazards, Southern California is affected by a natural cycle of fire and mudflows. Data shown in this image can be used to predict both how wildfires spread over the terrain and how mudflows are channeled down the canyons.

    The image was created from three datasets: the Shuttle Radar Topography Mission (SRTM) supplied the elevation, U. S. Geological Survey digital aerial photography provided the image detail, and the Landsat Thematic Mapper provided the color. The United States Geological Survey's Earth Resources Observations Systems (EROS) Data Center, Sioux Falls, South Dakota, provided the Landsat data and the aerial photography. The image can be viewed in 3-D by viewing the left image with the right eye and the right image with the left eye (cross-eyed viewing), or by downloading and printing the image pair, and viewing them with a stereoscope.

    The Shuttle Radar Topography Mission (SRTM), launched on February 11, 2000, used the same radar instrument that comprised the Spaceborne Imaging Radar-C/X-Band Synthetic Aperture Radar (SIR-C/X-SAR) that flew twice on the Space Shuttle Endeavour in 1994. The mission was designed to collect three-dimensional measurements of the Earth's surface. To collect the 3-D data, engineers added a 60-meter-long (200-foot) mast, an additional C-band imaging antenna and improved tracking and navigation devices. The mission is a cooperative project between the National Aeronautics and Space Administration

  8. cDNA-AFLP transcriptional profiling reveals genes expressed during flower development in Oncidium Milliongolds.

    PubMed

    Qian, X; Gong, M J; Wang, C X; Tian, M

    2014-02-21

    The flower developmental process, which is crucial to the whole lifecycle of higher plants, is influenced by both environmental and endogenous factors. The genus Oncidium is commercially important for cut flower and houseplant industry and is ideal for flower development studies. Using cDNA-amplified restriction fragment length polymorphism analysis, we profiled transcripts that are differentially expressed during flower development of Oncidium Milliongolds. A total of 15,960 transcript-derived fragments were generated, with 114 primer sets. Of these, 1248 were sequenced, producing 993 readable sequences. BLASTX/N analysis showed that 833 of the 993 transcripts showed homology to genes in the NCBI databases, exhibiting functions involved in various processes, such as signal transduction, energy conversion, metabolism, and gene expression regulation. The full-length mRNAs of SUCROSE SYNTHASE 1 (SUS1) and LEAFY (LFY) were cloned, and their expression patterns were characterized. The results showed that the expression levels of SUS1 and LFY were similar during flower development. To confirm the function of SUS1 in flower buds, carbohydrate content and sucrose synthase activity were determined. The results showed that changes in sucrose content and sucrose synthase activity reflected SUS1 expression levels. Collectively, these results indicate that SUS1 influences flower development by regulating LFY expression levels through changing the sucrose content of flower buds.

  9. Pygmy stars: first pair.

    PubMed

    Zwicky, F

    1966-07-01

    The binary LP 101-15/16 having the proper motion of 1.62 seconds of arc per year has been studied with the prime-focus spectrograph of the 200-inch (508 cm) telescope. Indications are that LP 101-15/16 is the first pair of pygmy stars ever discovered. One of its components, LP 101-16, is probably a blue pygmy star which is at least four magnitudes fainter than the ordinary white dwarfs. Also, two of the Balmer lines in absorption appear to be displaced toward the red by amounts which indicate the existence of an Einstein gravitational red shift corresponding to about 1000 km sec-1. On the other hand LP 101-15 is red and shows an entirely new type of spectrum, which suggests that it may be a first representative of a type of red pygmy star which is 2.5 magnitudes fainter than the M-type dwarf stars of the main sequence.

  10. Shear bond strength comparison of moisture-insensitive primer and self-etching primer

    PubMed Central

    Goswami, Arunima; Mitali, Borah; Roy, BK

    2014-01-01

    Context: The detrimental effect of moisture on orthodontic bonding has long been known. Hydrophilic bonding materials have been introduced suggesting the possibility of obtaining successful orthodontic bonding to a moisture contaminated enamel surface. Aims: This study has been performed with an aim to compare the in vitro shear bond strength (SBS) and debonding characteristic of moisture-insensitive primer (MIP) (Transbond MIP) (3M Unitek, South Peck Road, Monrovia, California, USA) and self-etching primer (SEP) (Transbond Plus SEP) (3M Unitek, South Peck Road, Monrovia, California, USA) in combination with a color changing adhesive system (Transbond Plus Color Change) (3M Unitek, South Peck Road, Monrovia, California, USA) under both dry and contaminated condition. Settings and Design: Randomized controlled clinical study. Subjects and Methods: One hundred and twenty freshly extracted teeth for the purpose of orthodontic treatment were collected. Teeth were randomly assigned into four groups, each consisting of 30 specimen and stainless steel brackets were bonded using each primer-adhesive combination under different enamel conditions, that is, dry and enamel contaminated with natural saliva. SBS and adhesive remnant index were calculated for each group. Results: Analysis of variance of SBS for both MIP and SEP under dry and contaminated condition showed no statistical significance (P = 0.5). Chi-square test showed significant difference in debonding characteristics among the test groups (P < 0.001). All the groups showed typical debonding characteristics of separation either at the bracket-adhesive interface or within the adhesive itself. Conclusions: Moisture contamination did not affect the SBS and adhesive remaining on tooth for both MIP and SEP. PMID:25143933

  11. PD5: A General Purpose Library for Primer Design Software

    PubMed Central

    Riley, Michael C.; Aubrey, Wayne; Young, Michael; Clare, Amanda

    2013-01-01

    Background Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. Results The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C++ with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. Conclusions The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: http://code.google.com/p/primer-design PMID:24278254

  12. An apricot (Prunus armeniaca L.) F2 progeny linkage map based on SSR and AFLP markers, mapping plum pox virus resistance and self-incompatibility traits.

    PubMed

    Vilanova, S; Romero, C; Abbott, A G; Llácer, G; Badenes, M L

    2003-07-01

    A genetic linkage map of apricot ( Prunus armeniaca L.) was constructed using AFLP and SSR markers. The map is based on an F(2) population (76 individuals) derived from self-pollination of an F(1) individual ('Lito') originated from a cross between 'Stark Early Orange' and 'Tyrinthos'. This family, designated as 'Lito' x 'Lito', segregated for two important agronomical traits: plum pox virus resistance (PPV) and self-incompatibility. A total of 211 markers (180 AFLPs, 29 SSRs and two agronomic traits) were assigned to 11 linkage groups covering 602 cM of the apricot genome. The average distance (cM/marker) between adjacent markers is 3.84 cM. The PPV resistance trait was mapped on linkage group G1 and the self-incompatibility trait was mapped on linkage group G6. Twenty two loci held in common with other Prunus maps allowed us to compare and establish homologies among the respective linkage groups.

  13. Eighteen-month clinical performance of a self-etching primer in unprepared class V resin restorations.

    PubMed

    Brackett, Willliam W; Brackett, Martha Goel; Dib, Alejandro; Franco, Guillermo; Estudillo, Hugo

    2005-01-01

    This study evaluated the clinical performance of unprepared Class V resin composites, placed using a self-etching primer and a single-bottle adhesive, over a period of 18 months. Thirty-eight pairs of restorations of Renew hybrid resin composite (BISCO, Inc) were placed using adhesives from the same manufacturer in caries-free cervical erosion/abfraction lesions. Based on insensitivity to air, the dentin in 76% of these lesions was considered to be sclerotic. The restorations were placed without abrasion of tooth surfaces, except for cleaning with plain pumice. One of each pair was placed using Tyrian, a self-etching primer and the other was placed using One-Step, a single-bottle adhesive placed after acid etching. Both the etchant and self-etching primer were applied for 20 seconds. The restorations were clinically evaluated at baseline, 6, 12 and 18 months, using modified Ryge/USPHS criteria. For both adhesives, very low retention of 50% to 56% of the restorations was observed over 18 months, leading to the conclusion that tooth surfaces must receive some additional treatment prior to restoration with these adhesives. No statistically significant difference (p=0.75) between the two adhesives was observed in overall performance, and dentinal sclerosis and axial depth did not appear to be important factors in the study.

  14. Comparison between Mt-DNA D-Loop and Cyt B primers for porcine DNA detection in meat products

    NASA Astrophysics Data System (ADS)

    Hamzah, Azhana; Mutalib, Sahilah Abd.; Babji, Abdul Salam

    2013-11-01

    This study was conducted to detect the presence of porcine DNA in meat products in the market using conventional polymerase chain reaction (PCR) and commercial PCR-southern hybridization analysis. Porcine DNA detection in meat products was tested due to some issues associated with the adulteration of food products in Malaysia. This is an important issue especially for Halal authentication which is required for some religious practices such as in Islam and Hinduisms. Many techniques have been developed for determining the Halal status of food products. In this paper, mt-DNA D-loop primer and cytochrome (cyt) b were used to detect the presence of porcine DNA in meat products. Positive and negative controls were always present for each batch of extraction. DNA of raw pork meat was used as a positive control while nucleus free water is used as negative control. A pair of oligonucleotide primer was used namely Pork1 and Pork2 which produced amplicon of 531 base pair (bp) in size. While, PCR-southern hybridization was conducted using primers readily supplied by commercial PCR-Southern hybridization and produced amplicon with 276 bp in size. In the present study, demonstrated that none of the samples were contaminated with porcine residuals but selected samples with pork meat were positive. The species-specific PCR amplification yielded excellent results for identification of pork derivatives in food products and it is a potentially reliable and suitable technique in routine food analysis for Halal certification.

  15. ISSR and AFLP analysis of the temporal and spatial population structure of the post-fire annual, Nicotiana attenuata, in SW Utah

    PubMed Central

    Bahulikar, Rahul A; Stanculescu, Dominic; Preston, Catherine A; Baldwin, Ian T

    2004-01-01

    Background The native annual tobacco, Nicotiana attenuata, is found primarily in large ephemeral populations (typically for less than 3 growing seasons) after fires in sagebrush and pinyon-juniper ecosystems and in small persistent populations (for many growing seasons) in isolated washes typically along roadsides throughout the Great Basin Desert of the SW USA. This distribution pattern is due to its unusual germination behavior. Ephemeral populations are produced by the germination of dormant seeds from long-lived seed banks which are stimulated to germinate by a combination of unidentified positive cues found in wood smoke and the removal of inhibitors leached from the unburned litter of the dominant vegetation. Persistent populations may result where these inhibitors do not exist, as in washes or along disturbed roadsides. To determine if this germination behavior has influenced population structure, we conducted an AFLP (244 individuals), ISSR (175 individuals) and ISSR+ AFLP (175 individuals) analysis on plants originating from seed collected from populations growing in 11 wash and burns over 11 years from the SW USA. Results Genetic variance as measured by both ISSR and AFLP markers was low among sites and comparatively higher within populations. Cluster analysis of the Utah samples with samples collected from Arizona, California, and Oregon as out-groups also did not reveal patterns. AMOVA analysis of the combined AFLP and ISSR data sets yielded significantly low genetic differentiation among sites (Φct), moderate among populations within sites (Φsc) and higher genetic differentiation within populations (Φst). Conclusions We conclude that the seed dormancy of this post-fire annual and its resulting age structure in conjunction with natural selection processes are responsible for significantly low among sites and comparatively high within-population genetic variation observed in this species. PMID:15350209

  16. A physicists guide to The Los Alamos Primer

    NASA Astrophysics Data System (ADS)

    Reed, B. Cameron

    2016-11-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer, which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons.

  17. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

    SciTech Connect

    Gardner, S. N.

    2013-08-08

    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

  18. Local conformations and competitive binding affinities of single- and double-stranded primer-template DNA at the polymerization and editing active sites of DNA polymerases.

    PubMed

    Datta, Kausiki; Johnson, Neil P; LiCata, Vince J; von Hippel, Peter H

    2009-06-19

    In addition to their capacity for template-directed 5' --> 3' DNA synthesis at the polymerase (pol) site, DNA polymerases have a separate 3' --> 5' exonuclease (exo) editing activity that is involved in assuring the fidelity of DNA replication. Upon misincorporation of an incorrect nucleotide residue, the 3' terminus of the primer strand at the primer-template (P/T) junction is preferentially transferred to the exo site, where the faulty residue is excised, allowing the shortened primer to rebind to the template strand at the pol site and incorporate the correct dNTP. Here we describe the conformational changes that occur in the primer strand as it shuttles between the pol and exo sites of replication-competent Klenow and Klentaq DNA polymerase complexes in solution and use these conformational changes to measure the equilibrium distribution of the primer between these sites for P/T DNA constructs carrying both matched and mismatched primer termini. To this end, we have measured the fluorescence and circular dichroism spectra at wavelengths of >300 nm for conformational probes comprising pairs of 2-aminopurine bases site-specifically replacing adenine bases at various positions in the primer strand of P/T DNA constructs bound to DNA polymerases. Control experiments that compare primer conformations with available x-ray structures confirm the validity of this approach. These distributions and the conformational changes in the P/T DNA that occur during template-directed DNA synthesis in solution illuminate some of the mechanisms used by DNA polymerases to assure the fidelity of DNA synthesis.

  19. SDSS DR2 Merging pairs

    NASA Astrophysics Data System (ADS)

    Allam, S. S.; Tucker, D. L.; SDSS Collaboration

    2004-05-01

    We present and analyze a catalog of 9,000 Merging pairs candidates to g=21 from the imaging data of the Sloan Digital Sky Survey (SDSS) Second Data Release (DR2). Candidates were selected using an automated algorithm (Allam et al. 2004) that is efficient in its selection of galaxy pairs. We highlight possible science applications of such a large photometric sample of merging pais and discuss future improvements, including incorporating magnitudes and pushing to higher redshifts and fainter pairs.

  20. Genotypic Characterization of Yersinia enterocolitica Biotype 4/O:3 Isolates from Pigs and Slaughterhouses Using SE-AFLP, ERIC-PCR, and PFGE

    PubMed Central

    Moreno, Luisa Zanolli; Sena de Gobbi, Débora Dirani; Raimundo, Daniele Cristine; Ferreira, Thais Sebastiana Porfida; Spindola, Maria Garcia; Hofer, Ernesto; Falavina dos Reis, Cristhiane Moura; Matté, Maria Helena; Micke Moreno, Andrea

    2013-01-01

    Yersinia enterocolitica is a foodborne pathogen that causes illness in humans and animals. The biotype 4/O:3 has been commonly associated with yersiniosis and is characterized by the presence of chromosomal and extra-chromosomal virulence genes. Molecular typing methods have been successfully used to characterize Y. enterocolitica genetic heterogeneity and to study the epidemiology of the bacteria from different origins. In this study, 320 Y. enterocolitica biotype 4/O:3 isolates originating in pigs and slaughterhouses were characterized according to the virulence profile, and 61 isolates were typified through SE-AFLP, ERIC-PCR, and PFGE techniques. The majority of the isolates originated from pigs, and the predominant virulence profile was ail+ virF+ rfbC+ ystA+, representing 83.4% of the tested isolates. All of the Y. enterocolitica 4/O:3 isolates were positive for at least ystA gene. The SE-AFLP and ERIC-PCR patterns were highly homogeneous. The SE-AFLP was more discriminative than the ERIC-PCR and tended to cluster isolates according to the slaughterhouse. Despite the limited genetic diversity of Y. enterocolitica 4/O:3, PFGE was shown to be the most discriminative technique considering one band of difference. Fattening pigs proved to be an important reservoir of Y. enterocolitica biotype 4/O:3 carrying virulence genes. PMID:23819054

  1. Development of silver carp (Hypophthalmichthys molitrix) and bighead carp (Aristichthys nobilis) genetic maps using microsatellite and AFLP markers and a pseudo-testcross strategy.

    PubMed

    Liao, M; Zhang, L; Yang, G; Zhu, M; Wang, D; Wei, Q; Zou, G; Chen, D

    2007-08-01

    Silver carp (Hypophthalmichthys molitrix) and bighead carp (Aristichthys nobilis) are two of the four most important pond-cultured fish species inhabiting the major river basins of China. In the present study, genetic maps of silver carp and bighead carp were constructed using microsatellite and AFLP markers and a two-way pseudo-testcross strategy. To create the maps, 60 individuals were obtained from a cross of a single bighead carp (female) and a single silver carp (male). The silver carp map consisted of 271 markers (48 microsatellites and 223 AFLPs) that were assembled into 27 linkage groups, of which 22 contained at least four markers. The total length of the silver carp map was 952.2 cM, covering 82.8% of the estimated genome size. The bighead carp map consisted of 153 markers (27 microsatellites and 126 AFLPs) which were organized into 30 linkage groups, of which 19 contained at least four markers. The total length of the bighead carp map was 852.0 cM, covering 70.5% of the estimated genome size. Eighteen microsatellite markers were common to both maps. These maps will contribute to discovery of genes and genetic regions controlling traits in the two species of carp.

  2. Controversies in kidney paired donation.

    PubMed

    Gentry, Sommer E; Montgomery, Robert A; Segev, Dorry L

    2012-07-01

    Kidney paired donation represented 10% of living kidney donation in the United States in 2011. National registries around the world and several separate registries in the United States arrange paired donations, although with significant variations in their practices. Concerns about ethical considerations, clinical advisability, and the quantitative effectiveness of these approaches in paired donation result in these variations. For instance, although donor travel can be burdensome and might discourage paired donation, it was nearly universal until convincing analysis showed that living donor kidneys can sustain many hours of cold ischemia time without adverse consequences. Opinions also differ about whether the last donor in a chain of paired donation transplants initiated by a nondirected donor should donate immediately to someone on the deceased donor wait-list (a domino or closed chain) or should be asked to wait some length of time and donate to start another sequence of paired donations later (an open chain); some argue that asking the donor to donate later may be coercive, and others focus on balancing the probability that the waiting donor withdraws versus the number of additional transplants if the chain can be continued. Other controversies in paired donation include simultaneous versus nonsimultaneous donor operations, whether to enroll compatible pairs, and interactions with desensitization protocols. Efforts to expand public awareness of and participation in paired donation are needed to generate more transplant opportunities.

  3. Quantitative PCR measurements of the effects of introducing inosines into primers provides guidelines for improved degenerate primer design.

    PubMed

    Zheng, Linda; Gibbs, Mark J; Rodoni, Brendan C

    2008-11-01

    Polymerase chain reaction (PCR) is used to detect groups of viruses with the use of group-specific degenerate primers. Inosine residues are sometimes used in the primers to match variable positions within the complementary target sequences, but there is little data on their effects on cDNA synthesis and amplification. A quantitative reverse-transcription PCR was used to measure the rate of amplification with primers containing inosine residues substituted at different positions and in increasing numbers. Experiments were conducted using standard quantities of cloned DNA copied from Potato virus Y genomic RNA and RNA (cRNA) transcribed from the cloned DNA. Single inosine residues had no affect on the amplification rate in the forward primer, except at one position close to the 3' terminus. Conversely, single inosine residues significantly reduced the amplification rate when placed at three out of four positions in the reverse primer. Four or five inosine substitutions could be tolerated with some decline in rates, but amplification often failed from cRNA templates with primers containing larger numbers of inosines. Greater declines in the rate of amplification were observed with RNA templates, suggesting that reverse transcription suffers more than PCR amplification when inosine is included in the reverse primer.

  4. DPPrimer – A Degenerate PCR Primer Design Tool

    PubMed Central

    Gahoi, Shachi; Arya, L; Anil, Rai; Marla, ss

    2013-01-01

    Designed degenerate primers unlike conventional primers are superior in matching and amplification of large number of genes, from related gene families. DPPrimer tool was designed to predict primers for PCR amplification of homologous gene from related or diverse plant species. The key features of this tool include platform independence and user friendliness in primer design. Embedded features such as search for functional domains, similarity score selection and phylogebetic tree further enhance the user friendliness of DPPrimer tool. Performance of DPPrimer tool was evaluated by successful PCR amplification of ADP-glucose phosphorylase genes from wheat, barley and rice. Availability DPPrimer is freely accessible at http://202.141.12.147/DGEN_tool/index.html PMID:24307773

  5. BTSC VAPOR INSTRUSION PRIMER "VAPOR INTRUSION CONSIDERATION FOR REDEVELOPMENT"

    EPA Science Inventory

    This primer is designed for brownfields stakeholders concerned about vapor intrusion, including property owners, real estate developers, and contractors performing environmental site investigations. It provides an overview of the vapor intrusion issue and how it can impact the ap...

  6. Best Development Practices: A Primer for Smart Growth

    EPA Pesticide Factsheets

    Best Development Practices: A Primer for Smart Growth lists specific practices to achieve development principles that mix land uses, support transportation options, protect natural systems, and provide housing choices.

  7. 20. BUILDINGS 243247. PRIMER DRYHOUSES. HEATING LAYOUT. October 16, 1917 ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    20. BUILDINGS 243-247. PRIMER DRYHOUSES. HEATING LAYOUT. October 16, 1917 - Frankford Arsenal, Building Nos. 242-246A, South side Craig Road between Eakin & Walbach Streets, Philadelphia, Philadelphia County, PA

  8. 13. BUILDING 239. ARTILLERY PRIMER SHOP. ADDITIONS AND ALTERATIONS. FIRST ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    13. BUILDING 239. ARTILLERY PRIMER SHOP. ADDITIONS AND ALTERATIONS. FIRST FLOOR PLAN AND ELEVATIONS. May 12, 1920. - Frankford Arsenal, Building Nos. 239-239A, Southeast corner of Clay Street & Cray Road, Philadelphia, Philadelphia County, PA

  9. 19. BUILDINGS 243247. PRIMER DRYHOUSES. BUILDING LAYOUT. February 16, 1917 ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    19. BUILDINGS 243-247. PRIMER DRYHOUSES. BUILDING LAYOUT. February 16, 1917 - Frankford Arsenal, Building Nos. 242-246A, South side Craig Road between Eakin & Walbach Streets, Philadelphia, Philadelphia County, PA

  10. 18. BUILDING 243247. PRIMER DRYHOUSES. GENERAL LAYOUT. February 16, 1917 ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    18. BUILDING 243-247. PRIMER DRYHOUSES. GENERAL LAYOUT. February 16, 1917 - Frankford Arsenal, Building Nos. 242-246A, South side Craig Road between Eakin & Walbach Streets, Philadelphia, Philadelphia County, PA

  11. PCR Primers for identification of high sucrose Saccharum genotypes.

    PubMed

    Vinayak, Vandana; Dhawan, Ashok K; Gupta, V K

    2010-01-01

    The progeny of a cross between high sucrose sugarcane clone S. officinarum 'Gungera' and a low sucrose clone S. spontaneum 'SES 603' resulted in interspecific hybrids that were named as ISH-1 to ISH-29 and graded on the basis of sucrose content. Hybrids ISH-1, ISH-5, ISH-17 and ISH-23 were selected as very high sucrose (65 to 100 mg/g tissue) genotypes, whereas ISH-10, ISH-11, ISH-12 and ISH-25 were very low sucrose (2 to 25 mg/g tissue) genotypes. DNA from leaves of both the parent clones, as also the progeny hybrids, was amplified using selected primers, in order to identify markers for sucrose content. Ten specific primers were examined: primers 'A' and 'B' that detect polymorphism in promoter region of sucrose synthase-2 gene; primers AI, SS and SPS that were designed on the basis of nucleotide sequences of genes for acid invertase, sucrose synthase and sucrose phosphate synthase enzymes, respectively and primers MSSCIR43, MSSCIRI, SMC226CG, SMC1039CG and SCB07 selected for relation to sucrose accumulation process. DNA products specific to low or high sucrose clones were identified. Primer 'A' and AI amplified DNA products of size 230 and 500 bp, respectively only in high sucrose genotypes ('Gungera', ISH-1, ISH-5, ISH-17 and ISH-23), while primer SMC226CG generated a DNA product of size 920 bp only in low sucrose genotypes ('SES 603', ISH-10, ISH-11, ISH-12 and ISH-25). Ten random decamer primers were also examined, but their products did not show relationship to sucrose content of genotypes.

  12. Electronic pairing in exotic superconductors

    SciTech Connect

    Cox, D.L. ); Maple, M.B. )

    1995-02-01

    Superconductivity in heavy-fermion materials and high T[sub c] cuprates may involve electronic pairing with unconventional symmetries and mechanisms. Although there has been no smoking-gun proof, numerous pieces of circumstantial evidence combined with heuristic theoretical arguments make a compelling case that these materials have pairs with exotic symmetry bound by nonphonon glue. 20 refs., 5 figs.

  13. Homologous pairing and the role of pairing centers in meiosis.

    PubMed

    Tsai, Jui-He; McKee, Bruce D

    2011-06-15

    Homologous pairing establishes the foundation for accurate reductional segregation during meiosis I in sexual organisms. This Commentary summarizes recent progress in our understanding of homologous pairing in meiosis, and will focus on the characteristics and mechanisms of specialized chromosome sites, called pairing centers (PCs), in Caenorhabditis elegans and Drosophila melanogaster. In C. elegans, each chromosome contains a single PC that stabilizes chromosome pairing and initiates synapsis of homologous chromosomes. Specific zinc-finger proteins recruited to PCs link chromosomes to nuclear envelope proteins--and through them to the microtubule cytoskeleton--thereby stimulating chromosome movements in early prophase, which are thought to be important for homolog sorting. This mechanism appears to be a variant of the 'telomere bouquet' process, in which telomeres cluster on the nuclear envelope, connect chromosomes through nuclear envelope proteins to the cytoskeleton and lead chromosome movements that promote homologous synapsis. In Drosophila males, which undergo meiosis without recombination, pairing of the largely non-homologous X and Y chromosomes occurs at specific repetitive sequences in the ribosomal DNA. Although no other clear examples of PC-based pairing mechanisms have been described, there is evidence for special roles of telomeres and centromeres in aspects of chromosome pairing, synapsis and segregation; these roles are in some cases similar to those of PCs.

  14. Base pairing and base mis-pairing in nucleic acids

    NASA Technical Reports Server (NTRS)

    Wang, A. H. J.; Rich, A.

    1986-01-01

    In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.

  15. Stereo Pair, Patagonia, Argentina

    NASA Technical Reports Server (NTRS)

    2000-01-01

    This view of northern Patagonia, at Los Menucos, Argentina shows remnants of relatively young volcanoes built upon an eroded plain of much older and contorted volcanic, granitic, and sedimentary rocks. The large purple, brown, and green 'butterfly' pattern is a single volcano that has been deeply eroded. Large holes on the volcano's flanks indicate that they may have collapsed soon after eruption, as fluid molten rock drained out from under its cooled and solidified outer shell. At the upper left, a more recent eruption occurred and produced a small volcanic cone and a long stream of lava, which flowed down a gully. At the top of the image, volcanic intrusions permeated the older rocks resulting in a chain of small dark volcanic peaks. At the top center of the image, two halves of a tan ellipse pattern are offset from each other. This feature is an old igneous intrusion that has been split by a right-lateral fault. The apparent offset is about 6.6 kilometers (4 miles). Color, tonal, and topographic discontinuities reveal the fault trace as it extends across the image to the lower left. However, young unbroken basalt flows show that the fault has not been active recently.

    This cross-eyed stereoscopic image pair was generated using topographic data from the Shuttle Radar Topography Mission, combined with an enhanced Landsat 7satellite color image. The topography data are used to create two differing perspectives of a single image, one perspective for each eye. In doing so, each point in the image is shifted slightly, depending on its elevation. When stereoscopically merged, the result is a vertically exaggerated view of the Earth's surface in its full three dimensions.

    Landsat satellites have provided visible light and infrared images of the Earth continuously since 1972. SRTM topographic data match the 30-meter (99-foot) spatial resolution of most Landsat images and provide a valuable complement for studying the historic and growing Landsat data archive

  16. Stereo Pair: Patagonia, Argentina

    NASA Technical Reports Server (NTRS)

    2000-01-01

    This view of northern Patagonia, near El Cain, Argentina shows complexly eroded volcanic terrain, with basalt mesas, sinkholes, landslide debris, playas, and relatively few integrated drainage channels. Surrounding this site (but also extending far to the east) is a broad plateau capped by basalt, the Meseta de Somuncura. Here, near the western edge of the plateau, erosion has broken through the basalt cap in a variety of ways. On the mesas, water-filled sinkholes (lower left) are most likely the result of the collapse of old lava tubes. Along the edges of the mesas (several locations) the basalt seems to be sliding away from the plateau in a series of slices. Water erosion by overland flow is also evident, particularly in canyons where vegetation blankets the drainage channels (green patterns, bottom of image). However, overland water flow does not extend very far at any location. This entire site drains to local playas, some of which are seen here (blue). While the water can reach the playas and then evaporate, what becomes of the eroded rock debris? Wind might excavate some of the finer eroded debris, but the fate of much of the missing bedrock remains mysterious.

    This cross-eyed stereoscopic image pair was generated using topographic data from the Shuttle Radar Topography Mission, combined with an enhanced Landsat 7 satellite color image. The topography data are used to create two differing perspectives of a single image, one perspective for each eye. In doing so, each point in the image is shifted slightly, depending on its elevation. When stereoscopically merged, the result is a vertically exaggerated view of the Earth's surface in its full three dimensions.

    Landsat satellites have provided visible light and infrared images of the Earth continuously since 1972. SRTM topographic data match the 30-meter (99-foot) spatial resolution of most Landsat images and provide a valuable complement for studying the historic and growing Landsat data archive. The

  17. Polymerization behavior of Klenow fragment and Taq DNA polymerase in short primer extension reactions.

    PubMed

    Zhao, Guojie; Guan, Yifu

    2010-10-01

    DNA polymerases amplify DNA fragments through primer extension reactions. However, polymerization behavior of short primers in the primer extension process has not been systematically explored. In this study, we examined the minimal primer length required for primer extension, and the effect of primer length, mismatches and other conditions on DNA polymerization using a non-radioactive method. Under the condition we conducted, the shortest primers polymerized by Klenow fragment (KF) and Taq DNA polymerase in our experiments were respectively heptamer and octamer. The extension efficiency was also affected by the up-stream overhanging structure of the primer-template complex. We hypothesized a simple model to interpret these observations based on the polymerase structures. Furthermore, it was found that the longer the primer, the more efficient is the primer extension. These polymerization behavior of short primers lay foundation about DNA polymerization mechanism and development of novel nucleic acid detection assays.

  18. Detection of recent hybridization between sympatric Chilean Puya species (Bromeliaceae) using AFLP markers and reconstruction of complex relationships.

    PubMed

    Schulte, Katharina; Silvestro, Daniele; Kiehlmann, Elke; Vesely, Sanja; Novoa, Patricio; Zizka, Georg

    2010-12-01

    The Chilean Puya species constitute a monophyletic group, co-occurring in different species combinations within the country and displaying a remarkable morphological variability. Here, we studied the importance of recent hybridization and introgression in the group and reconstructed the complex inter- and intraspecific relationships. Amplified fragment length polymorphism (AFLP) analysis, including 109 accessions of all Chilean Puya species and four putative hybrids, yielded 984 characters. Three main genetic groups were revealed, with the chilensis group (P. chilensis, P. gilmartiniae, P. boliviensis) diverging first, and the alpestris (P. alpestris, P. berteroniana) and coerulea group (P. venusta, P. coerulea) forming sister groups. STRUCTURE analyses confirmed a hybrid origin of morphologically intermediate individuals, and detected several additional hybrids. Hybrids were found between the chilensis and alpestris group, and between the alpestris and coerulea group. Exclusion of hybrids improved phylogenetic reconstructions. The study demonstrates that the detection of hybrids within Bromeliaceae can be difficult based on morphological characters alone and that efficient reproductive barriers may only slowly establish, leading to hybridization between closely related sympatric species. The importance of hybridization for the rapid diversification of Puya is discussed.

  19. Analysis of peripheral blood mononuclear cells gene expression in endurance horses by cDNA-AFLP technique.

    PubMed

    Cappelli, Katia; Verini-Supplizi, Andrea; Capomaccio, Stefano; Silvestrelli, Maurizio

    2007-06-01

    The knowledge of molecular mechanisms of stress response in athlete horses can allow us to plan an appropriate and high-grade training to obtain better performance and to preserve horse welfare. It is well known that excessive muscular exercise can lead to a number of responses which may be associated with modification of the mRNA levels for a number of metabolic genes such as those involved in the immune response. In the present study cDNA-AFLP technique was applied to Arab endurance horses under stressing conditions to visualise variations of transcriptional profiles; 49 transcript derived fragments (TDFs), differentially expressed, were cloned and sequenced. Four of these showed high sequence similarity with genes probably involved in exercise-induced stress response and resulted to be not sequenced in the horse. Their modulation was confirmed by RT-PCR and the full-length transcripts were isolated by RACE-PCR. The mRNAs sequences obtained were included in the GenBank database as Equus caballus interleukin 8 (IL8), E. caballus retinoblastoma binding protein 6 mRNA (RBBP6), E. caballus eukaryotic translation initiation factor 4 gamma 3 (eIF4G3) and E. caballus heat shock protein 90 (Hsp90). The expression pattern of these genes was verified in other endurance horses under stressing conditions, strengthening the hypothesis of their real involvement in exercise stress-induced response.

  20. Rapid Microsatellite Isolation from a Butterfly by De Novo Transcriptome Sequencing: Performance and a Comparison with AFLP-Derived Distances

    PubMed Central

    Mikheyev, Alexander S.; Vo, Tanya; Wee, Brian; Singer, Michael C.; Parmesan, Camille

    2010-01-01

    Background The isolation of microsatellite markers remains laborious and expensive. For some taxa, such as Lepidoptera, development of microsatellite markers has been particularly difficult, as many markers appear to be located in repetitive DNA and have nearly identical flanking regions. We attempted to circumvent this problem by bioinformatic mining of microsatellite sequences from a de novo-sequenced transcriptome of a butterfly (Euphydryas editha). Principal Findings By searching the assembled sequence data for perfect microsatellite repeats we found 10 polymorphic loci. Although, like many expressed sequence tag-derived microsatellites, our markers show strong deviations from Hardy-Weinberg equilibrium in many populations, and, in some cases, a high incidence of null alleles, we show that they nonetheless provide measures of population differentiation consistent with those obtained by amplified fragment length polymorphism analysis. Estimates of pairwise population differentiation between 23 populations were concordant between microsatellite-derived data and AFLP analysis of the same samples (r = 0.71, p<0.00001, 425 individuals from 23 populations). Significance De novo transcriptional sequencing appears to be a rapid and cost-effective tool for developing microsatellite markers for difficult genomes. PMID:20585453

  1. Construction of an integrated pepper map using RFLP, SSR, CAPS, AFLP, WRKY, rRAMP, and BAC end sequences.

    PubMed

    Lee, Heung-Ryul; Bae, Ik-Hyun; Park, Soung-Woo; Kim, Hyoun-Joung; Min, Woong-Ki; Han, Jung-Heon; Kim, Ki-Taek; Kim, Byung-Dong

    2009-01-31

    Map-based cloning to find genes of interest, markerassisted selection (MAS), and marker-assisted breeding (MAB) all require good genetic maps with high reproducible markers. For map construction as well as chromosome assignment, development of single copy PCR-based markers and map integration process are necessary. In this study, the 132 markers (57 STS from BAC-end sequences, 13 STS from RFLP, and 62 SSR) were newly developed as single copy type PCR-based markers. They were used together with 1830 markers previously developed in our lab to construct an integrated map with the Joinmap 3.0 program. This integrated map contained 169 SSR, 354 RFLP, 23 STS from BAC-end sequences, 6 STS from RFLP, 152 AFLP, 51 WRKY, and 99 rRAMP markers on 12 chromosomes. The integrated map contained four genetic maps of two interspecific (Capsicum annuum 'TF68' and C. chinense 'Habanero') and two intraspecific (C. annuum 'CM334' and C. annuum 'Chilsungcho') populations of peppers. This constructed integrated map consisted of 805 markers (map distance of 1858 cM) in interspecific populations and 745 markers (map distance of 1892 cM) in intraspecific populations. The used pepper STS were first developed from end sequences of BAC clones from Capsicum annuum 'CM334'. This integrated map will provide useful information for construction of future pepper genetic maps and for assignment of linkage groups to pepper chromosomes.

  2. Identification of antimony resistance markers in Leishmania tropica field isolates through a cDNA-AFLP approach.

    PubMed

    Kazemi-Rad, Elham; Mohebali, Mehdi; Khadem-Erfan, Mohammad Bagher; Saffari, Mojtaba; Raoofian, Reza; Hajjaran, Homa; Hadighi, Ramtin; Khamesipour, Ali; Rezaie, Sassan; Abedkhojasteh, Hoda; Heidari, Mansour

    2013-10-01

    Pentavalent antimonial compounds have been the first line therapy for leishmaniasis; unfortunately the rate of treatment failure of anthroponotic cutaneous leishmaniasis (ACL) is increasing due to emerging of drug resistance. Elucidation of the molecular mechanisms operating in antimony resistance is critical for development of new strategies for treatment. Here, we used a cDNA-AFLP approach to identify gene(s) which are differentially expressed in resistant and sensitive Leishmania tropica field isolates. We identified five genes, aquaglyceroporin (AQP1) acts in drug uptake, ATP-binding cassette (ABC) transporter (MRPA) involved in sequestration of drug, phosphoglycerate kinase (PGK) implicated in glycolysis metabolism, mitogen activated protein kinase (MAPK) and protein tyrosine phosphatase (PTP) responsible for phosphorylation pathway. The results were confirmed using real time RT-PCR which revealed an upregulation of MRPA, PTP and PGK genes and downregulation of AQP1 and MAPK genes in resistant isolate. To our knowledge, this is the first report of identification of PTP and PGK genes potentially implicated in resistance to antimonials. Our findings support the idea that distinct biomolecules might be involved in antimony resistance in L. tropica field isolates.

  3. Assessing The Spatial Dependence of Adaptive Loci in 43 European and Western Asian Goat Breeds Using AFLP Markers

    PubMed Central

    Negrini, Riccardo; Nicoloso, Letizia; Crepaldi, Paola; Ajmone-Marsan, Paolo

    2014-01-01

    Background During the past decades, neutral DNA markers have been extensively employed to study demography, population genetics and structure in livestock, but less interest has been devoted to the evaluation of livestock adaptive potential through the identification of genomic regions likely to be under natural selection. Methodology/Principal findings Landscape genomics can greatly benefit the entire livestock system through the identification of genotypes better adapted to specific or extreme environmental conditions. Therefore we analyzed 101 AFLP markers in 43 European and Western Asian goat breeds both with Matsam software, based on a correlative approach (SAM), and with Mcheza and Bayescan, two FST based software able to detect markers carrying signatures of natural selection. Matsam identified four loci possibly under natural selection – also confirmed by FST-outlier methods – and significantly associated with environmental variables such as diurnal temperature range, frequency of precipitation, relative humidity and solar radiation. Conclusions/Significance These results show that landscape genomics can provide useful information on the environmental factors affecting the adaptive potential of livestock living in specific climatic conditions. Besides adding conservation value to livestock genetic resources, this knowledge may lead to the development of novel molecular tools useful to preserve the adaptive potential of local breeds during genetic improvement programs, and to increase the adaptability of industrial breeds to changing environments. PMID:24497965

  4. Unusual Base-Pairing Interactions in Monomer–Template Complexes

    PubMed Central

    2016-01-01

    Many high-resolution crystal structures have contributed to our understanding of the reaction pathway for catalysis by DNA and RNA polymerases, but the structural basis of nonenzymatic template-directed RNA replication has not been studied in comparable detail. Here we present crystallographic studies of the binding of ribonucleotide monomers to RNA primer–template complexes, with the goal of improving our understanding of the mechanism of nonenzymatic RNA copying, and of catalysis by polymerases. To explore how activated ribonucleotides recognize and bind to RNA templates, we synthesized an unreactive phosphonate-linked pyrazole analogue of guanosine 5′-phosphoro-2-methylimidazolide (2-MeImpG), a highly activated nucleotide that has been used extensively to study nonenzymatic primer extension. We cocrystallized this analogue with structurally rigidified RNA primer–template complexes carrying single or multiple monomer binding sites, and obtained high-resolution X-ray structures of these complexes. In addition to Watson–Crick base pairing, we repeatedly observed noncanonical guanine:cytidine base pairs in our crystal structures. In most structures, the phosphate and leaving group moieties of the monomers were highly disordered, while in others the distance from O3′ of the primer to the phosphorus of the incoming monomer was too great to allow for reaction. We suggest that these effects significantly influence the rate and fidelity of nonenzymatic RNA replication, and that even primitive ribozyme polymerases could enhance RNA replication by enforcing Watson–Crick base pairing between monomers and primer–template complexes, and by bringing the reactive functional groups into closer proximity. PMID:28058281

  5. TSUNAMI Primer: A Primer for Sensitivity/Uncertainty Calculations with SCALE

    SciTech Connect

    Rearden, Bradley T; Mueller, Don; Bowman, Stephen M; Busch, Robert D.; Emerson, Scott

    2009-01-01

    This primer presents examples in the application of the SCALE/TSUNAMI tools to generate k{sub eff} sensitivity data for one- and three-dimensional models using TSUNAMI-1D and -3D and to examine uncertainties in the computed k{sub eff} values due to uncertainties in the cross-section data used in their calculation. The proper use of unit cell data and need for confirming the appropriate selection of input parameters through direct perturbations are described. The uses of sensitivity and uncertainty data to identify and rank potential sources of computational bias in an application system and TSUNAMI tools for assessment of system similarity using sensitivity and uncertainty criteria are demonstrated. Uses of these criteria in trending analyses to assess computational biases, bias uncertainties, and gap analyses are also described. Additionally, an application of the data adjustment tool TSURFER is provided, including identification of specific details of sources of computational bias.

  6. Evaluation of Different Primers for Detection of Brucella by Using PCR Method

    PubMed Central

    Moulana, Zahra; Roushan, Mohammad Reza Hasanjani; Marashi, Seyed Mahmoud Amin

    2016-01-01

    Introduction Brucellosis is a worldwide zoonosis and a significant cause of loss of health in humans and animals. Traditionally, classic diagnosis is carried out by isolation of Brucella, which is time-consuming, technically challenging and potentially dangerous. The aim of this study was to expand a molecular test that would be used for the develop detection of Brucella in a single reaction with high sensitivity and specificity, by targeting IS711element. Methods This study was carried out from 2015 to 2016 at the Ayatolla Rohani hospital in Babol, Iran. The present study was designed to develop PCR assay, based on IS711 gene for rapid diagnosis of Brucella spp. and immediate detection of Brucella, with high sensitivity and specificity. Four pairs of oligo-nucleotide primers with sizes of 547, 403, 291 and 127bp respectively, were planned to exclusively amplify the targeted genes of Brucella species. Results Our results show that, five PCR primers set up, would be helpful in amplifying the DNAs from the genus Brucella with high specificity and sensitivity so it can be 12 fg, for Brucella species to provide a valuable tool for diagnosis. Conclusion This method can be more useful than serological and biochemical tests and in addition, this reduces the number of required tests more rapidly and economically. PMID:28070255

  7. Effect of an abasic site on strand slippage in DNA primer-templates.

    PubMed

    Au, Ring Yan; Ng, Kui Sang; Chi, Lai Man; Lam, Sik Lok

    2012-12-27

    An abasic site is the most common lesion in DNA. It is also an intermediate product formed during base excision repair. Previously, we demonstrated that strand slippage can occur in primer-template model systems containing any kind of natural templating bases, suggesting deletion and expansion errors are possible in any kind of sequences during DNA replication. In this study, nuclear magnetic resonance spectroscopic investigations have been performed to study the intrinsic effect of a templating abasic residue on strand slippage in primer-template models. A DNA hairpin model system containing an abasic site and a 5'-overhang region was used to mimic the situation that a dNTP has just been incorporated opposite the abasic site. Our results show that, after dNTP incorporation, strand slippage occurs regardless of the type of terminal base pair formed. Compared to natural templating bases, abasic sites possess a higher slippage propensity, implicating a higher chance of expansion or deletion errors during DNA replication.

  8. Diversity Measures in Environmental Sequences Are Highly Dependent on Alignment Quality—Data from ITS and New LSU Primers Targeting Basidiomycetes

    PubMed Central

    Fischer, Christiane; Daniel, Rolf; Wubet, Tesfaye

    2012-01-01

    The ribosomal DNA comprised of the ITS1-5.8S-ITS2 regions is widely used as a fungal marker in molecular ecology and systematics but cannot be aligned with confidence across genetically distant taxa. In order to study the diversity of Agaricomycotina in forest soils, we designed primers targeting the more alignable 28S (LSU) gene, which should be more useful for phylogenetic analyses of the detected taxa. This paper compares the performance of the established ITS1F/4B primer pair, which targets basidiomycetes, to that of two new pairs. Key factors in the comparison were the diversity covered, off-target amplification, rarefaction at different Operational Taxonomic Unit (OTU) cutoff levels, sensitivity of the method used to process the alignment to missing data and insecure positional homology, and the congruence of monophyletic clades with OTU assignments and BLAST-derived OTU names. The ITS primer pair yielded no off-target amplification but also exhibited the least fidelity to the expected phylogenetic groups. The LSU primers give complementary pictures of diversity, but were more sensitive to modifications of the alignment such as the removal of difficult-to align stretches. The LSU primers also yielded greater numbers of singletons but also had a greater tendency to produce OTUs containing sequences from a wider variety of species as judged by BLAST similarity. We introduced some new parameters to describe alignment heterogeneity based on Shannon entropy and the extent and contents of the OTUs in a phylogenetic tree space. Our results suggest that ITS should not be used when calculating phylogenetic trees from genetically distant sequences obtained from environmental DNA extractions and that it is inadvisable to define OTUs on the basis of very heterogeneous alignments. PMID:22363808

  9. Diversity measures in environmental sequences are highly dependent on alignment quality--data from ITS and new LSU primers targeting basidiomycetes.

    PubMed

    Krüger, Dirk; Kapturska, Danuta; Fischer, Christiane; Daniel, Rolf; Wubet, Tesfaye

    2012-01-01

    The ribosomal DNA comprised of the ITS1-5.8S-ITS2 regions is widely used as a fungal marker in molecular ecology and systematics but cannot be aligned with confidence across genetically distant taxa. In order to study the diversity of Agaricomycotina in forest soils, we designed primers targeting the more alignable 28S (LSU) gene, which should be more useful for phylogenetic analyses of the detected taxa. This paper compares the performance of the established ITS1F/4B primer pair, which targets basidiomycetes, to that of two new pairs. Key factors in the comparison were the diversity covered, off-target amplification, rarefaction at different Operational Taxonomic Unit (OTU) cutoff levels, sensitivity of the method used to process the alignment to missing data and insecure positional homology, and the congruence of monophyletic clades with OTU assignments and BLAST-derived OTU names. The ITS primer pair yielded no off-target amplification but also exhibited the least fidelity to the expected phylogenetic groups. The LSU primers give complementary pictures of diversity, but were more sensitive to modifications of the alignment such as the removal of difficult-to align stretches. The LSU primers also yielded greater numbers of singletons but also had a greater tendency to produce OTUs containing sequences from a wider variety of species as judged by BLAST similarity. We introduced some new parameters to describe alignment heterogeneity based on Shannon entropy and the extent and contents of the OTUs in a phylogenetic tree space. Our results suggest that ITS should not be used when calculating phylogenetic trees from genetically distant sequences obtained from environmental DNA extractions and that it is inadvisable to define OTUs on the basis of very heterogeneous alignments.

  10. Development of MHC class I and II B primers in common carp and its molecular characterization.

    PubMed

    Jia, Zhiying; Chi, Xifeng; Li, Chitao; Shi, Lianyu

    2010-08-01

    The major histocompatibility complex (MHC) has an important role in immune response and is known as the most polymorphic locus in vertebrates. We developed three pairs of polymerase chain reaction primers of the alpha-2 domain (exon 3) of MHC class I and the beta-2 (exon 3) and beta-3 domains (exon 4) of MHC class II B gene in the German mirror common carp (Cyprinus carpio L.). We analyzed the three loci in a population of 65 individuals that had suffered the serious disease of gill rot. Five to six variable nucleotide sites and two to six variable amino acid sites (71.43%) were detected in the exon sequence of the sampled populations, indicating that many of them corresponded to amino acids involved in antigen recognition. Deviation from Hardy-Weinberg equilibrium and linkage disequilibrium were differentially found in some loci, which will be important for further study of disease resistance/susceptibility and population evolution.

  11. Pairing Correlations at High Spins

    NASA Astrophysics Data System (ADS)

    Ma, Hai-Liang; Dong, Bao-Guo; Zhang, Yan; Fan, Ping; Yuan, Da-Qing; Zhu, Shen-Yun; Zhang, Huan-Qiao; Petrache, C. M.; Ragnarsson, I.; Carlsson, B. G.

    The pairing correcting energies at high spins in 161Lu and 138Nd are studied by comparing the results of the cranked-Nilsson-Strutinsky (CNS) and cranked-Nilsson-Strutinsky-Bogoliubov (CNSB) models. It is concluded that the Coriolis effect rather than the rotational alignment effect plays a major role in the reduction of the pairing correlations in the high spin region. Then we proposed an average pairing correction method which not only better reproduces the experimental data comparing with the CNS model but also enables a clean-cut tracing of the configurations thus the full-spin-range discussion on the various rotating bands.

  12. The Neurobiologist's Guide to Structural Biology: A Primer on Why Macromolecular Structure Matters and How to Evaluate Structural Data

    PubMed Central

    Minor, Daniel L.

    2010-01-01

    Structural biology now plays a prominent role in addressing questions central to understanding how excitable cells function. Although interest in the insights gained from the definition and dissection of macromolecular anatomy is high, many neurobiologists remain unfamiliar with the methods employed. This primer aims to help neurobiologists understand approaches for probing macromolecular structure and where the limits and challenges remain. Using examples of macromolecules with neurobiological importance, the review covers X-ray crystallography, electron microscopy (EM), small-angle X-ray scattering (SAXS), and nuclear magnetic resonance (NMR) and biophysical methods with which these approaches are often paired: isothermal titration calorimetry (ITC), equilibrium analytical ultracentifugation, and molecular dynamics (MD). PMID:17521566

  13. The neurobiologist's guide to structural biology: a primer on why macromolecular structure matters and how to evaluate structural data.

    PubMed

    Minor, Daniel L

    2007-05-24

    Structural biology now plays a prominent role in addressing questions central to understanding how excitable cells function. Although interest in the insights gained from the definition and dissection of macromolecular anatomy is high, many neurobiologists remain unfamiliar with the methods employed. This primer aims to help neurobiologists understand approaches for probing macromolecular structure and where the limits and challenges remain. Using examples of macromolecules with neurobiological importance, the review covers X-ray crystallography, electron microscopy (EM), small-angle X-ray scattering (SAXS), and nuclear magnetic resonance (NMR) and biophysical methods with which these approaches are often paired: isothermal titration calorimetry (ITC), equilibrium analytical ultracentifugation, and molecular dynamics (MD).

  14. Novel multiplex PCR assay using locked nucleic acid (LNA)-based universal primers for the simultaneous detection of five swine viruses.

    PubMed

    Chen, Ru; Gao, Xiao-Bo; Yu, Xiao-Lu; Song, Chang-Xu; Qiu, Yang

    2016-02-01

    A novel multiplex PCR assay using non-homologous oligonucleotides with locked nucleic acid (LNA) modifications as universal primers was developed and validated for the simultaneous detection of five swine viruses. The assay utilizes five virus-specific primer pairs modified at the 5' end through the addition of the universal primer sequence. In the reaction, small amounts of target templates with the 5' tail were generated and subsequently amplified through the extension of a LNA universal primer set. To validate the specificity of this assay, 27 viral target strains and 12 non-target pathogens were tested. The lower limit of detection of viral nucleic acids was 1.1-1.9 pg per reaction or 11-32 pg in a five-plex viral nucleic acid mixture. The LNA mPCR assay displayed higher analytical sensitivity and efficiency for the detection of plasmid standards compared with the conventional assay, which uses standard primers without the 5' tail. A total of 207 field samples were tested using both assays. The LNA mPCR assay provided numerically higher detection rates for all pathogens in independent samples. Moreover, the LNA mPCR assay had significantly higher detection rates in independent samples compared with the conventional assay.

  15. Group-specific identification of polioviruses by PCR using primers containing mixed-base or deoxyinosine residue at positions of codon degeneracy.

    PubMed Central

    Kilpatrick, D R; Nottay, B; Yang, C F; Yang, S J; Mulders, M N; Holloway, B P; Pallansch, M A; Kew, O M

    1996-01-01

    We have developed a method for differentiating polioviruses from nonpolio enteroviruses using PCR. A pair of panpoliovirus PCR primers were designed to match intervals encoding amino acid sequences within VP1 that are strongly conserved among polioviruses. The initiating primer hybridizes with codons of a 7-amino-acid sequence that has been found only in polioviruses; the second primer matches codons of a domain thought to interact with the cell receptor. The panpoliovirus PCR primers contain mixed-base and deoxyinosine residues to compensate for the high degeneracy of the targeted codons. All RNAs from 48 vaccine-related and 110 wild poliovirus isolates of all three serotypes served as efficient templates for amplification of 79-bp product. None of the genomic sequences of 49 nonpolio enterovirus reference strains were amplified under equivalent reaction conditions. Sensitivities of poliovirus detection were as low as 100 fg (equivalent to approximately 25,000 genomic copies or 25 to 250 PFU) when the amplified products were visualized by ethidium bromide fluorescence. These degenerate PCR primers should aid in the detection of all polioviruses, including those wild poliovirus isolates for which genotype-specific reagents are unavailable. PMID:8940436

  16. Agronomically important thrips: development of species-specific primers in multiplex PCR and microarray assay using internal transcribed spacer 1 (ITS1) sequences for identification.

    PubMed

    Yeh, W B; Tseng, M J; Chang, N T; Wu, S Y; Tsai, Y S

    2015-02-01

    Thrips, the sole vector of plant Tospovirus, are major pests of many agricultural crops throughout the world. Molecular approaches have been applied in recent decades to identify these minute and morphologically difficult to distinguish insects. In this study, sequences of internal transcribed spacer 1 (ITS1) region of 15 agronomically important thrips, including several virus transmission species, have been analyzed in order to design species-specific primers for multiplex PCR and probes for microarray assay. That the ITS1 sequence distances within species were smaller than those among species suggests that the ITS1 fragment can be used for thrips species identification. The specificity and stability of these primers, combined with universal paired primers, were tested and verified in multiplex PCR. Using these specific primers as probes, microarray assay showed that PCR products of all thrips species hybridized consistently to their corresponding probes, though some signals were weak. We have demonstrated that multiplex PCR using specific primers based on ITS1 sequences is a simple, reliable, and cost-effective diagnostic tool for thrips species identification. Moreover, the DNA microarray assay is expected to extend into a reliable high-throughput screening tool for the vast numbers of thrips.

  17. Initialization of Formation Flying Using Primer Vector Theory

    NASA Technical Reports Server (NTRS)

    Mailhe, Laurie; Schiff, Conrad; Folta, David

    2002-01-01

    In this paper, we extend primer vector analysis to formation flying. Optimization of the classical rendezvous or free-time transfer problem between two orbits using primer vector theory has been extensively studied for one spacecraft. However, an increasing number of missions are now considering flying a set of spacecraft in close formation. Missions such as the Magnetospheric MultiScale (MMS) and Leonardo-BRDF (Bidirectional Reflectance Distribution Function) need to determine strategies to transfer each spacecraft from the common launch orbit to their respective operational orbit. In addition, all the spacecraft must synchronize their states so that they achieve the same desired formation geometry over each orbit. This periodicity requirement imposes constraints on the boundary conditions that can be used for the primer vector algorithm. In this work we explore the impact of the periodicity requirement in optimizing each spacecraft transfer trajectory using primer vector theory. We first present our adaptation of primer vector theory to formation flying. Using this method, we then compute the AV budget for each spacecraft subject to different formation endpoint constraints.

  18. New PCR primers targeting hydrazine synthase and cytochrome c biogenesis proteins in anammox bacteria.

    PubMed

    Zhou, Zhichao; Chen, Jing; Meng, Han; Dvornyk, Volodymyr; Gu, Ji-Dong

    2017-02-01

    PCR primers targeting genes encoding the two proteins of anammox bacteria, hydrazine synthase and cytochrome c biogenesis protein, were designed and tested in this study. Three different ecotypes of samples, namely ocean sediments, coastal wetland sediments, and wastewater treatment plant (WWTP) samples, were used to assess the primer efficiency and the community structures of anammox bacteria retrieved by 16S ribosomal RNA (rRNA) and the functional genes. Abundances of hzsB gene of anammox bacteria in South China Sea (SCS) samples were significantly correlated with 16S rRNA gene by qPCR method. And hzsB and hzsC gene primer pair hzsB364f-hzsB640r and hzsC745f-hzsC862r in combination with anammox bacterial 16S rRNA gene primers were recommended for quantifying anammox bacteria. Congruent with 16S rRNA gene-based community study, functional gene hzsB could also delineate the coastal-ocean distributing pattern, and seawater depth was positively associated with the diversity and abundance of anammox bacteria from shallow- to deep-sea. Both hzsC and ccsA genes could differentiate marine samples between deep and shallow groups of the Scalindua sp. clades. As for WWTP samples, non-Scalindua anammox bacteria reflected by hzsB, hzsC, ccsA, and ccsB gene-based libraries showed a similar distribution pattern with that by 16S rRNA gene. NH4(+) and NH4(+)/Σ(NO3(-) + NO2(-)) positively correlated with anammox bacteria gene diversity, but organic matter contents correlated negatively with anammox bacteria gene diversity in SCS. Salinity was positively associated with diversity indices of hzsC and ccsB gene-harboring anammox bacteria communities and could potentially differentiate the distribution patterns between shallow- and deep-sea sediment samples. SCS surface sediments harbored considerably diverse community of Scalindua. A new Mai Po clade representing coastal estuary wetland anammox bacteria group based on 16S rRNA gene phylogeny is proposed. Existence of anammox

  19. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    SciTech Connect

    Bowman, Stephen M

    2008-09-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  20. cDNA-AFLP analysis reveals differential gene expression in response to salt stress in foxtail millet (Setaria italica L.).

    PubMed

    Jayaraman, Ananthi; Puranik, Swati; Rai, Neeraj Kumar; Vidapu, Sudhakar; Sahu, Pranav Pankaj; Lata, Charu; Prasad, Manoj

    2008-11-01

    Plant growth and productivity are affected by various abiotic stresses such as heat, drought, cold, salinity, etc. The mechanism of salt tolerance is one of the most important subjects in plant science as salt stress decreases worldwide agricultural production. In our present study we used cDNA-AFLP technique to compare gene expression profiles of a salt tolerant and a salt-sensitive cultivar of foxtail millet (Seteria italica) in response to salt stress to identify early responsive differentially expressed transcripts accumulated upon salt stress and validate the obtained result through quantitative real-time PCR (qRT-PCR). The expression profile was compared between a salt tolerant (Prasad) and susceptible variety (Lepakshi) of foxtail millet in both control condition (L0 and P0) and after 1 h (L1 and P1) of salt stress. We identified 90 transcript-derived fragments (TDFs) that are differentially expressed, out of which 86 TDFs were classified on the basis of their either complete presence or absence (qualitative variants) and 4 on differential expression pattern levels (quantitative variants) in the two varieties. Finally, we identified 27 non-redundant differentially expressed cDNAs that are unique to salt tolerant variety which represent different groups of genes involved in metabolism, cellular transport, cell signaling, transcriptional regulation, mRNA splicing, seed development and storage, etc. The expression patterns of seven out of nine such genes showed a significant increase of differential expression in tolerant variety after 1 h of salt stress in comparison to salt-sensitive variety as analyzed by qRT-PCR. The direct and indirect relationship of identified TDFs with salinity tolerance mechanism is discussed.