Science.gov

Sample records for africa cape town

  1. Cape Town, South Africa, Anaglyph, Landsat Image over SRTM Elevation

    NASA Technical Reports Server (NTRS)

    2004-01-01

    Cape Town and the Cape of Good Hope, South Africa, appear on the left (west) of this anaglyph view generated from a Landsat satellite image and elevation data from the Shuttle Radar Topography Mission (SRTM). The city center is located between Table Bay (upper left) and Table Mountain (just to the south), a 1,086-meter (3,563-foot) tall sandstone and granite natural landmark.

    Cape Town enjoys a Mediterranean climate but must deal with the limited water supply characteristic of that climate. Until the 1890s the city relied upon streams and springs along the base of Table Mountain, then built a small reservoir atop Table Mountain to capture and store rainfall there (visible in this anaglyph when viewed at full resolution). Now the needs of a much larger population are met in part by much larger reservoirs such as seen well inland (upper right) at the Theewaterskloof Dam.

    False Bay is the large bay to the southeast (lower right) of Cape Town, just around the Cape of Good Hope. It is one of the largest bays along the entire South African coast, but nearby Cape Town has its harbor at Table Bay. False Bay got its name because mariners approaching Cape Town from the east would see the prominent bay and falsely assume it to be the entrance to Cape Town harbor. Similarly, people often mistake the Cape of Good Hope as the southernmost point of Africa. But the southernmost point is actually Cape Agulhas, located just to the southeast (lower right) of this scene.

    This anaglyph was created by draping a Landsat visible light image over an SRTM elevation model, and then generating two differing perspectives, one for each eye. When viewed through special glasses, the anaglyph is a vertically exaggerated view of the Earth's surface in its full three dimensions. Anaglyph glasses cover the left eye with a red filter and cover the right eye with a blue filter.

    Elevation data used in this image was acquired by the Shuttle Radar Topography Mission (SRTM) aboard

  2. Characteristics of Students Receiving Counselling Services at the University of Cape Town, South Africa.

    ERIC Educational Resources Information Center

    Flisher, Alan J.; De Beer, Jeremy P.; Bokhorst, Frank

    2002-01-01

    The aim of the study was to document the correlates of receiving counseling services at the University of Cape Town, South Africa. Results reveal that non-English speakers, humanities students, undergraduates, first-year students, students who were eligible to receive financial assistance, and students from outside Cape Town were significantly…

  3. A Principal's Perspective of School Integration: The First School To Integrate in Cape Town, South Africa.

    ERIC Educational Resources Information Center

    Wieder, Alan

    2001-01-01

    Presents the historical context of Cape Town, South Africa, and its struggles against apartheid and apartheid education. It offers a case study of Allen Powell, a white teacher and administrator who worked to integrate Plumstead High School, an act that defied South African commonplace and the views of most white South Africans. Analyzes Powell's…

  4. Child Abuse Services at a Children's Hospital in Cape Town, South Africa.

    ERIC Educational Resources Information Center

    Argent, Andrew C.; And Others

    1995-01-01

    All child abuse-related patients (n=503) seen at 1 Cape Town (South Africa) hospital over a 1-year period were reviewed. Abuse was confirmed in 389 cases (160 physical abuse and 229 sexual abuse). Most (81 percent) of the young children were seen by residents with minimal pediatric training. Lack of staff speaking Xhosa (spoken by 134 of the…

  5. Disrespecting Teacher: The Decline in Social Standing of Teachers in Cape Town, South Africa

    ERIC Educational Resources Information Center

    Hammett, Daniel

    2008-01-01

    This paper examines the declining levels of respect for teachers in two communities in Cape Town, South Africa. Education has been identified as a key area of reform and redress, but a critical skills shortage and under-resourced schools are hindering progress. Data from current and former teachers illustrate how the social and institutional…

  6. Education, Ethnic Homogenization and Cultural Hybridization (Brussels, Belgium, and Cape Town, South Africa).

    ERIC Educational Resources Information Center

    Leman, Johan, Ed.

    1999-01-01

    The eight chapters of this theme issue examine the ways in which autochthonous communities regard the supply side of education. The supply side is segregational in nature, and immigrants themselves move toward ethnic homogenization. The focus is on urban minorities in Brussels (Belgium). Compares the situation in Cape Town (South Africa). (SLD)

  7. The Effects of Community Violence on Children in Cape Town, South Africa

    ERIC Educational Resources Information Center

    Shields, Nancy; Nadasen, Kathy; Pierce, Lois

    2008-01-01

    Objective: The primary objective of the study was to investigate the relationship between exposure to community violence (neighborhood, school, police, and gang violence) and psychological distress in a sample of children living in the Cape Town, South Africa area. Another objective was to identify variables that moderate and mediate the…

  8. Intimate partner violence among adolescents in Cape Town, South Africa.

    PubMed

    Russell, Marcia; Cupp, Pamela K; Jewkes, Rachel K; Gevers, Anik; Mathews, Catherine; LeFleur-Bellerose, Chantel; Small, Jeon

    2014-06-01

    This study aimed to describe potentially preventable factors in intimate partner violence (IPV) perpetration and victimization among South African 8th grade students. Data were collected during a pilot evaluation of a classroom 8th grade curriculum on gender-based violence prevention in nine public schools in Cape Town through self-completed interviews with 549 8th grade students, 238 boys and 311 girls. Structural equation models (SEM) predicting IPV were constructed with variables a priori hypothesized to be associated. The majority of students (78.5 %) had had a partner in the past 3 months, and they reported high rates of IPV during that period (e.g., over 10 % of boys reported forcing a partner to have sex, and 39 % of girls reported physical IPV victimization). A trimmed version of the hypothesized SEM (CFI = .966; RMSEA = .051) indicated that disagreement with the ideology of male superiority and violence predicted lower risk of IPV (p < .001), whereas the frequency of using negative conflict resolution styles (e.g., walking off angrily, sending angry text messages, or refusing to talk to them) predicted high IPV risk (p < .001) and mediated the impact of heavy alcohol drinking on IPV (Sobel test, z = 3.16; p < .001). The model fit both girls and boys, but heavy drinking influenced negative styles of resolving conflict more strongly among girls than boys. Findings suggest that interventions to reduce IPV among South African adolescents should challenge attitudes supportive of male superiority and violence; encourage use of positive conflict resolution styles; and discourage heavy alcohol use among both boys and girls.

  9. Intimate Partner Violence among Adolescents in Cape Town, South Africa

    PubMed Central

    Russell, Marcia; Cupp, Pamela K.; Jewkes, Rachel K.; Gevers, Anik; Mathews, Catherine; LeFleur-Bellerose, Chantel; Small, Jeon

    2013-01-01

    GOAL To describe potentially preventable factors in intimate partner violence (IPV) perpetration and victimization among South African 8th grade students. METHOD Data were collected during a pilot evaluation of a classroom 8th grade curriculum on gender-based violence prevention in 9 public schools in Cape Town through self-completed interviews with 549 8th grade students, 238 boys and 311 girls. Structural equation models (SEM) predicting IPV were constructed with variables a priori hypothesized to be associated. RESULTS The majority of students (78.5%) had had a partner in the past three months, and they reported high rates of IPV during that period (e.g., over 10% of boys reported forcing a partner to have sex, and 39% of girls reported physical IPV victimization). A trimmed version of the hypothesized SEM (CFI =.966; RMSEA=.051) indicated that disagreement with the ideology of male superiority and violence predicted lower risk of IPV (p<.001), whereas the frequency of using negative conflict resolution styles (e.g., walking off angrily, sending angry text messages, or refusing to talk to them) predicted high IPV risk (p<.001) and mediated the impact of heavy alcohol drinking on IPV (Sobel test, z=3.16; p<.001). The model fit both girls and boys, but heavy drinking influenced negative styles of resolving conflict more strongly among girls than boys. CONCLUSIONS Findings suggest that interventions to reduce IPV among South African adolescents should challenge attitudes supportive of male superiority and violence; encourage use of positive conflict resolution styles; and discourage heavy alcohol use among both boys and girls. PMID:23743796

  10. The influence of older classmates on adolescent sexual behavior in Cape Town, South Africa.

    PubMed

    Lam, David; Marteleto, Letícia J; Ranchhod, Vimal

    2013-06-01

    This study examines the influence of exposure to older within-grade peers on sexual behavior among students in urban South Africa. Data are drawn from the Cape Area Panel Study, a longitudinal survey of young people conducted in metropolitan Cape Town from 2002 to 2006. The combination of early sexual debut, high rates of school enrollment into the late teens, and grade repetition create an environment in which young people who progress through school ahead of many in their cohort interact with classmates who may be several years older. We construct a measure of cumulative exposure to classmates who are at least two years older and show that such exposure is statistically significantly associated with early sexual initiation among adolescent girls. This exposure also increases the age difference between these girls and their first sexual partner, and helps explain a significant proportion of the earlier sexual debut of African girls, compared with colored and white girls in Cape Town.

  11. Report of the 7th African Rotavirus Symposium, Cape Town, South Africa, 8th November 2012.

    PubMed

    Seheri, L M; Mwenda, J M; Page, N

    2014-11-12

    The 7th African Rotavirus Symposium was held in Cape Town, South Africa, on the 8th November 2012 as a Satellite Symposium at the First International African Vaccinology Conference. Over 150 delegates participated in this symposium including scientists, clinicians, health officials, policymakers and vaccine manufacturers from across Africa. Key topics discussed included rotavirus surveillance, rotavirus vaccine introduction, post rotavirus vaccine impact analysis and intussusception data and surveillance in Africa. The symposium provided early rotavirus vaccine adopter countries in Africa (South Africa, Ghana and Botswana) an opportunity to share up-to-date information on vaccine introduction, and allowed colleagues to share experiences in establishing routine rotavirus surveillance (Tanzania, Niger and Rwanda). Overall, the symposium highlighted the high burden of rotavirus in Africa, and the need to continue to strengthen efforts in preventing rotavirus diarrhoea in Africa.

  12. Substance Use and Psychosocial Predictors of High School Dropout in Cape Town, South Africa

    ERIC Educational Resources Information Center

    Flisher, Alan J.; Townsend, Loraine; Chikobvu, Perpetual; Lombard, Carl F.; King, Gary

    2010-01-01

    The aims of this study were to examine whether use of tobacco, alcohol, and illicit drugs predicts dropout among secondary school students in Cape Town, South Africa. A self-report instrument was administered to 1,470 Grade 8 students. The proportion of students that dropped out of school between the onset of the study and 4 years later was 54.9%.…

  13. Indicators of substance abuse treatment demand in Cape Town, South Africa (1997-2001).

    PubMed

    Myers, B; Parry, C D H; Plüddemann, M A

    2004-05-01

    Few studies have investigated the demand for substance abuse treatment in South Africa. This article uses data collected from specialist substance abuse treatment centres to describe substance abuse treatment demand and patterns of service utilisation in Cape Town for the period January 1997 to December 2001. Findings suggest that although treatment demand for alcohol-related problems remains high, treatment demand for substances other than alcohol has increased over time. Patterns of treatment service utilisation suggest that women and black South Africans remain underserved. The need for comprehensive and accessible substance abuse treatment services in Cape Town is highlighted and recommendations are made for improving access to treatment services, and undertaking comprehensive evaluations of existing treatment facilities.

  14. Stress, Substance Use and Sexual Risk Behaviors among Primary Care Patients in Cape Town, South Africa

    PubMed Central

    Avalos, Lyndsay Ammon; Mertens, Jennifer R.; Ward, Catherine L.; Flisher, Alan J.; Bresick, Graham F.; Weisner, Constance M.

    2009-01-01

    We assessed the relationship between stress, substance use and sexual risk behaviors in a primary care population in Cape Town, South Africa. A random sample of participants (and over-sampled 18–24 year olds) from 14 of the 49 clinics in Cape Town's public health sector using stratified random sampling (N=2,618), was selected. We evaluated current hazardous drug and alcohol use and three domains of stressors (Personal Threats, Lacking Basic Needs, and Interpersonal Problems). Several personal threat stressors and an interpersonal problem stressor were related to sexual risk behaviors. With stressors included in the model, hazardous alcohol use, but not hazardous drug use, was related to higher rates of sexual risk behaviors. Our findings suggest a positive screening for hazardous alcohol use should alert providers about possible sexual risk behaviors and vice versa. Additionally, it is important to address a broad scope of social problems and incorporate stress and substance use in HIV prevention campaigns. PMID:19205865

  15. Popular Education in Three Organisations in Cape Town, South Africa

    ERIC Educational Resources Information Center

    Endresen, Kristin

    2013-01-01

    In the past, non-formal education in South Africa was committed to supporting the Mass Democratic Movement (MDM) in opposition to apartheid. Such non-formal political education was concerned with education for democracy. Post 1994, South African adult education policy has exclusively concentrated on vocational training, shifting the focus away…

  16. Cape Town, South Africa, Perspective View, Landsat Image over SRTM Elevation

    NASA Technical Reports Server (NTRS)

    2004-01-01

    Cape Town and the Cape of Good Hope, South Africa, appear in the foreground of this perspective view generated from a Landsat satellite image and elevation data from the Shuttle Radar Topography Mission (SRTM). The city center is located at Table Bay (at the lower left), adjacent to Table Mountain, a 1,086-meter (3,563-foot) tall sandstone and granite natural landmark.

    Cape Town enjoys a Mediterranean climate but must deal with the limited water supply characteristic of that climate. Until the 1890s the city relied upon streams and springs along the base of Table Mountain, then built a small reservoir atop Table Mountain to capture and store rainfall there. Now the needs of a much larger population are met in part by much larger reservoirs such as seen here far inland (mid-distance left) at the Theewaterskloof Dam.

    False Bay is the large bay to the south (right) of Cape Town, just around the Cape of Good Hope. It is one of the largest bays along the entire South African coast, but nearby Cape Town has its harbor at Table Bay. False Bay got its name because mariners approaching Cape Town from the east would see the prominent bay and falsely assume it to be the entrance to Cape Town harbor. Similarly, people often mistake the Cape of Good Hope as the southernmost point of Africa. But the southernmost point is actually Cape Agulhas, located just to the southeast (upper right) of this scene.

    This Landsat and SRTM perspective view uses a 2-times vertical exaggeration to enhance topographic expression. The back edges of the data sets form a false horizon and a false sky was added. Colors of the scene were enhanced by image processing but are the natural color band combination from the Landsat satellite.

    Elevation data used in this image was acquired by the Shuttle Radar Topography Mission (SRTM) aboard the Space Shuttle Endeavour, launched on February 11, 2000. SRTM used the same radar instrument that comprised the Spaceborne Imaging Radar

  17. Prevalence, Causes and Socio-Economic Determinants of Vision Loss in Cape Town, South Africa

    PubMed Central

    Cockburn, Nicky; Steven, David; Lecuona, Karin; Joubert, Francois; Rogers, Graeme; Cook, Colin; Polack, Sarah

    2012-01-01

    Purpose To estimate the prevalence and causes of blindness and visual impairment in Cape Town, South Africa and to explore socio-economic and demographic predictors of vision loss in this setting. Methods A cross sectional population-based survey was conducted in Cape Town. Eighty-two clusters were selected using probability proportionate to size sampling. Within each cluster 35 or 40 people aged 50 years and above were selected using compact segment sampling. Visual acuity of participants was assessed and eyes with a visual acuity less than 6/18 were examined by an ophthalmologist to determine the cause of vision loss. Demographic data (age, gender and education) were collected and a socio-economic status (SES) index was created using principal components analysis. Results Out of 3100 eligible people, 2750 (89%) were examined. The sample prevalence of bilateral blindness (presenting visual acuity <3/60) was 1.4% (95% CI 0.9–1.8). Posterior segment diseases accounted for 65% of blindness and cataract was responsible for 27%. The prevalence of vision loss was highest among people over 80 years (odds ratio (OR) 6.9 95% CI 4.6–10.6), those in the poorest SES group (OR 3.9 95% CI 2.2–6.7) and people with no formal education (OR 5.4 95% CI 1.7–16.6). Cataract surgical coverage was 68% in the poorest SES tertile (68%) compared to 93% in the medium and 100% in the highest tertile. Conclusions The prevalence of blindness among people ≥50 years in Cape Town was lower than expected and the contribution of posterior segment diseases higher than previously reported in South Africa and Sub Saharan Africa. There were clear socio-economic disparities in prevalence of vision loss and cataract surgical coverage in this setting which need to be addressed in blindness prevention programs. PMID:22363476

  18. Health outcomes for children born to teen mothers in Cape Town, South Africa1

    PubMed Central

    Ardington, Cally; Leibbrandt, Murray

    2014-01-01

    This paper analyzes whether children born to teen mothers in Cape Town, South Africa are disadvantaged in terms of their health outcomes because their mother is a teen. Exploiting the longitudinal nature of the Cape Area Panel Study, we assess whether observable differences between teen mothers and slightly older mothers can explain why first-born children of teen mothers appear disadvantaged. Our balanced regressions indicate that observed characteristics cannot explain the full extent of disadvantage of being born to a teen mother, with children born to teen mothers continuing to have significantly worse child health outcomes, especially among coloured children. In particular, children born to teens are more likely to be underweight at birth and to be stunted with the disadvantage for coloured children four times the size for African children. PMID:26052156

  19. Health outcomes for children born to teen mothers in Cape Town, South Africa.

    PubMed

    Branson, Nicola; Ardington, Cally; Leibbrandt, Murray

    2015-04-01

    This paper analyzes whether children born to teen mothers in Cape Town, South Africa are disadvantaged in terms of their health outcomes because their mother is a teen. Exploiting the longitudinal nature of the Cape Area Panel Study, we assess whether observable differences between teen mothers and slightly older mothers can explain why first-born children of teen mothers appear disadvantaged. Our balanced regressions indicate that observed characteristics cannot explain the full extent of disadvantage of being born to a teen mother, with children born to teen mothers continuing to have significantly worse child health outcomes, especially among coloured children. In particular, children born to teens are more likely to be underweight at birth and to be stunted with the disadvantage for coloured children four times the size for African children.

  20. Healthcare experiences of lesbian and bisexual women in Cape Town, South Africa.

    PubMed

    Smith, Riley

    2015-01-01

    Understanding the health needs and experiences of South African lesbian and bisexual women is imperative for implementing effective and inclusive public health strategies. Such understanding, however, is limited due to the exclusion of these women from most existing research on healthcare access in the region. This paper bridges that gap by investigating the healthcare experiences of lesbian and bisexual women in Cape Town. Data were gathered from 22 interviews with self-identified lesbian and bisexual community members and university students in the Cape Town area. Interviews explored obstacles women face in accessing affirming services, different experiences with public and private healthcare, fear of stigma/discrimination, availability of relevant sexual health information and suggestions to improve existing programmes. Findings suggest that South African lesbians and bisexual women may have a range of both positive and negative experiences in public and private health services, that they use protective strategies when 'coming out' and that they find that sexual health information pertinent to them is largely unavailable. These discussions contribute to a more inclusive understanding of the experiences of lesbian and bisexual women accessing healthcare and other services and help to inform providers, thereby enabling them to deliver more meaningful care to lesbian, gay, bisexual and transgender persons in South Africa.

  1. Experiences of violence and association with decreased drug abstinence among women in Cape Town, South Africa.

    PubMed

    Reed, Elizabeth; Myers, Bronwyn; Novak, Scott P; Browne, Felicia A; Wechsberg, Wendee M

    2015-01-01

    Drug abuse is a contributing factor in women's HIV risk in low-income communities in Cape Town, South Africa. This study assessed whether experiencing violence is associated with reduced drug abstinence among adult women (n = 603) participating in a randomized field trial for an HIV prevention study in Cape Town. In relation to drug abstinence at 12-month follow-up, multivariable regression models were used to assess (1) baseline partner and non-partner victimization, and (2) victimization at 12-month follow-up among participants reporting baseline victimization. Baseline partner (AOR = 0.6; 95 % CI 0.4-0.9) and non-partner victimization (AOR = 0.6; 95 % CI 0.4-0.9) were associated with a reduced likelihood of drug abstinence at follow-up. Among participants who reported victimization at baseline, those no longer reporting victimization at follow-up did not differ significantly in drug abstinence compared with those who reported victimization at follow-up. The study findings highlight the lasting impact of victimization on women's drug use outcomes, persisting regardless of whether violence was no longer reported at follow-up. Overall, the findings support the need for the primary prevention of violence to address the cycle of violence, drug use, and HIV among women in this setting.

  2. Dating violence and self-efficacy for delayed sex among adolescents in Cape Town, South Africa.

    PubMed

    Boafo, Isaac M; Dagbanu, Emmanuel A; Asante, Kwaku Oppong

    2014-06-01

    In South Africa, dating violence is known to be widespread among adolescents, and is therefore a major public health issue because of its association with sexual risk behaviours. The objective of the study was to examine the relationship between dating violence and self-efficacy for delayed sex among school-going adolescents in Cape Town, South Africa. The study is based on analyses of data from a school-based health education programme targeting sexual and reproductive health issues.The study involved 3,655 school-going adolescents aged between 12 and 17 in Cape Town, South Africa. The data was collected by means of a self-administered questionnaire composed of 153 items on sexual and reproductive health, dating violence as well as sociodemographic characteristics. The results indicated that males showed a higher percentage of both dating violence victimization and perpetration, as compared to females. It was also found that adolescents from lower socio-economic backgrounds were more likely to be the victims of dating violence as compared to those from a higher socio-economic background. Female learners showed higher levels of self-efficacy for delayed sex than their male counterparts. Although the result revealed that there was a significant association between self-efficacy for delayed sex and socio-economic status, this link decreased with age. It is concluded that educational programmes aimed solely at improving self-efficacy for delayed sex is insufficient. Such programmes must also aim at preventing dating violence and equipping adolescents with the skills to negotiate their way out of dating violence.

  3. A Comparison of the Effects of Witnessing Community Violence and Direct Victimization among Children in Cape Town, South Africa

    ERIC Educational Resources Information Center

    Shields, Nancy; Nadasen, Kathy; Pierce, Lois

    2009-01-01

    This study is based on a sample of children from the Cape Town area in South Africa. The study compares the effects of witnessing school or neighborhood violence compared with being victimized in each context on psychological distress. The findings suggest that in the context of the school, victimization has a somewhat stronger effect on distress…

  4. Brief Report: Social and Neighbourhood Correlates of Adolescent Drunkenness--A Pilot Study in Cape Town, South Africa

    ERIC Educational Resources Information Center

    Parry, Charles D. H.; Morojele, Neo K.; Saban, Amina; Flisher, Alan J.

    2004-01-01

    Aim: To identify social and neighbourhood correlates of drunkenness among adolescents. Design: A cross-sectional, community study. Participants: A multi-stage cluster sampling strategy was used to select 90 adolescents aged 11-17 years from nine distinct communities in Cape Town, South Africa. The sample was stratified by race, income, and gender.…

  5. "Learning Service" in International Contexts: Partnership-Based Service-Learning and Research in Cape Town, South Africa

    ERIC Educational Resources Information Center

    McMillan, Janice; Stanton, Timothy K.

    2014-01-01

    In this paper we explore an approach to developing and implementing service-learning and community-based research in a study-abroad program in Cape Town, South Africa. Drawing on a notion of partnerships reflecting the values of accompaniment and transparency, and influenced by the importance of learning service, we outline an intentional, engaged…

  6. From Digital Divide to Digital Equity: Learners' ICT Competence in Four Primary Schools in Cape Town, South Africa

    ERIC Educational Resources Information Center

    Gudmundsdottir, G. B.

    2010-01-01

    This study explores factors influencing the digital divide in four schools in Cape Town, South Africa. Three of the schools are for disadvantaged learners whereas the fourth was previously for whites only. All the schools use ICT in their curriculum delivery and thereby support the emphasis of provincial educational authorities on ICT access for…

  7. Poverty and psychological health among AIDS-orphaned children in Cape Town, South Africa.

    PubMed

    Cluver, Lucie; Gardner, Frances; Operario, Don

    2009-06-01

    This study examined associations between AIDS-orphanhood status, poverty indicators, and psychological problems (depression, anxiety, post-traumatic stress, peer problems, delinquency, conduct problems) among children and adolescents in townships surrounding Cape Town, South Africa. One thousand and twenty-five children and adolescents completed standardized and culturally sensitive cross-sectional surveys. Children orphaned by AIDS had more psychological problems including depression, peer problems, post-traumatic stress, and conduct problems. Specific poverty indicators including food security, access to social welfare grants, employment in the household and access to school were associated with better psychological health. Poverty indicators mediated associations of AIDS-orphanhood with psychological problems. Food security showed the most consistent association with reduced psychological problems. Poverty alleviation measures have the potential to improve psychological health for AIDS-orphaned children in South African townships.

  8. Correlates of lifetime trauma exposure among pregnant women from Cape Town, South Africa.

    PubMed

    Myers, Bronwyn; Jones, Hendrée E; Doherty, Irene A; Kline, Tracy L; Key, Mary E; Johnson, Kim; Wechsberg, Wendee M

    2015-06-01

    A cross-sectional survey of 298 pregnant women from Cape Town, South Africa was conducted to examine socio-demographic, reproductive health, mental health, and relationship correlates of lifetime trauma exposure and whether these correlates vary as a function of age. Overall, 19.8% of participants reported trauma exposure. We found similarities and differences in correlates of trauma exposure among women in emerging adulthood and older women. Prior termination of pregnancy was associated with trauma exposure in both age groups. Difficulties in resolving arguments, lifetime substance use, and a prior sexually transmitted infection were associated with trauma exposure among women in emerging adulthood. In contrast, depression and awareness of substance abuse treatment programmes were associated with trauma exposure among older women. These findings highlight the need for interventions that prevent and treat trauma exposure among vulnerable women. Such interventions should be tailored to address the correlates of trauma exposure in each age group.

  9. Correlates of lifetime trauma exposure among pregnant women from Cape Town, South Africa

    PubMed Central

    Myers, Bronwyn; Jones, Hendrée E.; Doherty, Irene A.; Kline, Tracy L.; Key, Mary E.; Johnson, Kim; Wechsberg, Wendee M.

    2015-01-01

    A cross-sectional survey of 298 pregnant women from Cape Town, South Africa was conducted to examine socio-demographic, reproductive health, mental health, and relationship correlates of lifetime trauma exposure and whether these correlates vary as a function of age. Overall, 19.8% of participants reported trauma exposure. We found similarities and differences in correlates of trauma exposure among women in emerging adulthood and older women. Prior termination of pregnancy was associated with trauma exposure in both age groups. Difficulties in resolving arguments, lifetime substance use, and a prior sexually transmitted infection were associated with trauma exposure among women in emerging adulthood. In contrast, depression and awareness of substance abuse treatment programmes were associated with trauma exposure among older women. These findings highlight the need for interventions that prevent and treat trauma exposure among vulnerable women. Such interventions should be tailored to address the correlates of trauma exposure in each age group. PMID:27087804

  10. Developing a Strategic Approach to Social Responsiveness at the University of Cape Town, South Africa

    ERIC Educational Resources Information Center

    Favish, Judith; McMillan, Janice; Ngcelwane, Sonwabo V.

    2012-01-01

    Collaborative community-engaged scholarship has roots in many parts of the world, and engaged practitioners and researchers are increasingly finding each other and sharing resources globally. This article focuses on a "social responsiveness" initiative at the University of Cape Town. Its story, told here by three University of Cape Town…

  11. Mediators of interpersonal violence and drug addiction severity among methamphetamine users in Cape Town, South Africa.

    PubMed

    Hobkirk, Andréa L; Watt, Melissa H; Green, Kimberly T; Beckham, Jean C; Skinner, Donald; Meade, Christina S

    2015-03-01

    South Africa has high rates of interpersonal violence and a rapidly growing methamphetamine epidemic. Previous research has linked experiences of interpersonal violence to higher rates of substance use, and identified mental health constructs as potential mediators of this association. The aim of this study was to examine the relationship between interpersonal violence and addiction severity among active methamphetamine users in Cape Town, South Africa, and to explore symptoms of posttraumatic stress disorder (PTSD) and substance use coping as mediators of this relationship. A community sample of 360 methamphetamine users was recruited through respondent driven sampling and surveyed on their experiences of violence, mental health, coping, and drug use and severity. A series of one-way ANOVAs were conducted to examine the relationship of self-reported interpersonal violence with drug addiction severity, and multiple mediation analyses were used to determine if PTSD symptoms and substance use coping mediated this relationship. The majority (87%) of the sample reported experiencing at least one instance of interpersonal violence in their lifetime, and the number of violent experiences was associated with increased drug addiction severity. PTSD and substance use coping were significant mediators of this association. Only the indirect effect of substance use coping remained significant for the female sample when the mediation model was conducted separately for men and women. The findings point to the need for integrated treatments that address drug use and PTSD for methamphetamine users in South Africa and highlight the importance of coping interventions for women.

  12. Perceived vulnerability and HIV testing among youth in Cape Town, South Africa.

    PubMed

    Tenkorang, Eric Y

    2016-06-01

    The importance of perceived vulnerability to risk-reducing behaviors, including HIV testing, is fairly established, especially among youth in sub-Saharan Africa. Yet, the majority of studies that examined this important relationship used cross-sectional data that inherently assume that perceived vulnerability does not change. While these studies have been useful, the assumption of perceived vulnerability as time invariant is a major flaw and has largely limited the practical usefulness of this variable in AIDS prevention and programing. Using longitudinal data and applying random-effects logit models, this study makes a major contribution to scholarship by examining if changes in perceived vulnerability associate with a change to test for HIV among 857 young people in Cape Town, South Africa. Results show that female youth who changed their risk perceptions were more likely to also change to test for HIV, but the effects were completely attenuated after controlling for theoretically relevant variables. No significant relationships were observed for males. Also, females who were virgins at wave 2 but had sex between waves were significantly more likely to have changed to test for HIV. Of most importance was that sexual behavior eliminated the effects of change in risk perceptions suggesting that a change in perception may have occurred as a result of changes in sexual behavior. AIDS prevention programs must pay particular attention to helping youth become aware of their vulnerability to HIV risks, especially as these have implications for risk-reducing behaviors, especially for females who are burdened.

  13. HIV Risk Behavior Among Methamphetamine Users Entering Substance Abuse Treatment in Cape Town, South Africa.

    PubMed

    Meade, Christina S; Lion, Ryan R; Cordero, Daniella M; Watt, Melissa H; Joska, John A; Gouse, Hetta; Burnhams, Warren

    2016-10-01

    South Africa is experiencing a growing methamphetamine problem, and there is concern that methamphetamine use may accelerate HIV transmission. There has been little research on the HIV prevention needs of methamphetamine users receiving substance abuse treatment in South Africa. This study assessed the prevalence and correlates of HIV risk behaviors among 269 methamphetamine users entering substance abuse treatment in two clinics in Cape Town. The prevalence of sexual risk behaviors was high among sexually active participants: 34 % multiple partners, 26 % unprotected intercourse with a casual partner, and 24 % sex trading for money/methamphetamine. The strongest predictor of all sexual risk behaviors was concurrent other drug use. Over half had not been HIV tested in the past year, and 25 % had never been tested, although attitudes toward HIV testing were overwhelmingly positive. This population of primarily heterosexual, non-injecting methamphetamine users is a high-risk group in need of targeted HIV prevention interventions. Substance abuse treatment is an ideal setting in which to reach methamphetamine users for HIV services.

  14. New constraints on historical dipole field decay: Four centuries of archaeointensity from Cape Town, South Africa.

    NASA Astrophysics Data System (ADS)

    Hare, V. J.; Gallet, Y.; Genevey, A.

    2015-12-01

    Current global geomagnetic field models suffer from strong bias towards Northern Hemisphere data. Absolute intensity measurements from the Southern Hemisphere are key to understanding the evolution of the field over the historical era, especially recent strengthening of non-dipole contributions, and the appearance of the South Atlantic Magnetic Anomaly (SAMA). I present the first archaeointensity data for locally-fired historical bricks from several well-dated sites (1660-2009 AD) in Cape Town, South Africa. These data constitute the first archaeomagnetic intensity variation curve for southern Africa for the past few centuries. The ages of the sites are tightly constrained by historical and archaeological considerations. Archaeointensity data obtained by the Thellier and Thellier method (modified by Coe), are corrected for both TRM anisotropy and cooling rate dependence of TRM acquisition. Analysis of magnetic mineralogy was performed to aid selection of fragments. Reliable archaeointensity determinations were obtained for 48 of 80 specimens, and 45 were retained in the final analysis. Intensity results vary from 24.3 ± 0.6 μT (modern brick) to 40.7 ± 0.8 μT (1660 AD), corresponding to Virtual Axial Dipole Moments (VADMs) between 6.1 ± 0.2 and 10.2 ± 0.2 נ1022 Am2. Results are generally not in agreement with current field models, but are coherent with other archaeomagnetic datasets from the Southern Hemisphere. The possible reasons for this are discussed, as well as implications for the historical evolution of the field.

  15. HIV prevalence and risk behaviours among foreign migrant women residing in Cape Town, South Africa.

    PubMed

    Townsend, Loraine; Giorgio, Maggie; Zembe, Yanga; Cheyip, Mireille; Mathews, Catherine

    2014-10-01

    HIV prevalence and risk behaviour among foreign migrants in South Africa has not been explored. This paper describes the effectiveness of respondent-driven sampling (RDS) to recruit foreign migrant women residing in Cape Town, reports HIV prevalence, and describes key characteristics among them. We conducted a biological and behavioural surveillance survey using RDS. After written informed consent, participants completed an audio computer assisted self-interview and provided a dried blood sample for HIV analysis. HIV prevalence was estimated to be 7 % (CI 4.9-9.5) among 935 women. HIV sero-positivity was associated with older age (p = 0.001), country of origin (p < 0.000), being unmarried (p < 0.000), having lived in South Africa for 3-5 years (p = 0.023), sexual debut at ≥15 years (p = 0.047), and having used a condom at last sex with a main partner (p = 0.007). Few women reported early sexual debut, or multiple sexual partners. RDS was successful in recruiting foreign migrant women.

  16. Are elderly pedestrians allowed enough time at pedestrian crossings in Cape Town, South Africa?

    PubMed

    Amosun, S L; Burgess, T; Groeneveldt, L; Hodgson, T

    2007-01-01

    A descriptive, cross-sectional analytical study was conducted to determine whether the recommended walking speed of 1.2 ms(-1) would allow elderly pedestrians to safely clear pedestrian crossings in Cape Town, South Africa. Male and female volunteers (n = 47), aged 65-93 years and resident in four homes for older persons, were recruited. Pedestrian clearance intervals at 40 traffic lights within 5-km radius of the selected homes were measured. The mean walking speed required at these traffic lights was 0.86 +/- 0.32 ms(1). The maximal walking speed over 12 m was measured without carrying any load and when carrying a predetermined weight of an average shopping bag. Participants' emotions associated with pedestrian road safety were also assessed through an interview. The mean maximal unloaded and loaded walking speeds were 1.36 +/- 0.31 ms(-1) (0.73-2.03 ms(-1)), and 1.36 +/- 0.33 ms(-1) (0.58-2.12 ms(-1)), respectively. Over 30% of the participants walked slower than the recommended walking speed of 1.2 ms(-1). Participants felt that traffic lights did not allow for sufficient time to cross roads (51.1%) and reported emotions of apprehension (44.7%), anxiety (17.0%), and fear (10.6%) when crossing. A review of traffic planning and public policy is recommended to ensure older pedestrians safely clear pedestrian crossings.

  17. HIV Prevalence and Risk Factors Among Male Foreign Migrants in Cape Town, South Africa.

    PubMed

    Giorgio, Margaret; Townsend, Loraine; Zembe, Yanga; Cheyip, Mireille; Guttmacher, Sally; Carter, Rebecca; Mathews, Cathy

    2017-03-01

    While migration has been shown to be a risk factor for HIV, variation in HIV prevalence by subgroups of migrants needs further exploration. This paper documents the HIV prevalence and key characteristics among male foreign migrants in Cape Town, South Africa and the effectiveness of respondent-driven sampling (RDS) to recruit this population. Participants in this cross-sectional study completed a behavioral risk-factor questionnaire and provided a dried blood sample for HIV analysis. Overall HIV prevalence was estimated to be 8.7 % (CI 5.4-11.8) but varied dramatically by country of origin. After adjusting for country of origin, HIV sero-positivity was positively associated with older age (p = 0.001), completing high school (p = 0.025), not having enough money for food (p = 0.036), alcohol use (p = 0.049), and engaging in transactional sex (p = 0.022). RDS was successful in recruiting foreign migrant men. A better understanding of the timing of HIV acquisition is needed to design targeted interventions for migrant men.

  18. Routine programmatic delivery of isoniazid preventive therapy to children in Cape Town, South Africa

    PubMed Central

    Hesseling, A. C.; Beyers, N.; Enarson, D. A.; Rusen, I. D.; Lombard, C.; van Wyk, S. S.

    2013-01-01

    Setting: Fourteen primary health care facilities in Cape Town, South Africa. Objective: To determine the proportion and characteristics of infectious adult tuberculosis (TB) cases that identify children aged <5 years who qualify for isoniazid preventive therapy (IPT), and to determine the proportion of children who initiate and complete IPT. Design: A retrospective clinical record review conducted as a stratified cluster survey. Results: Of 1179 records of infectious adult cases, 33.3% had no documentation of contacts. Of the remaining 786 records, 525 contacts aged <5 years were identified, representing 0.7 child contacts per infectious adult case. Older age, male, human immunodeficiency virus (HIV) positive, smear-negative and retreatment TB cases were all associated with no documentation of contacts. Of the 525 child contacts identified, less than half were screened for TB, 141 initiated IPT and 19 completed it. Conclusion: Less than 67% of infectious TB case records had documentation of contacts. Younger, female, HIV-negative and new smear-positive TB cases were more likely to have had contacts identified. Less than 14% of children already initiated on IPT completed 6 months of treatment. PMID:26393029

  19. Urban catchment management in a developing country: the Lotus River project, Cape Town, South Africa.

    PubMed

    Grobicki, A M

    2001-01-01

    This paper describes a 2-year pilot project undertaken in an urban catchment in Cape Town, South Africa. The impermeable area of the Lotus River catchment has doubled over 15 years, from 17% in 1983 to 34% in 1997. Following the abolition of urban influx control in 1990, informal settlements in the catchment grew rapidly and now house about 90,000 out of the catchment's total population of 380,000 people. The informal areas are still largely unserviced, despite a commitment from local government to speed up service delivery to the poorest areas of the city. Within the Lotus River project, hydrological and ecological assessments of the urban watercourses were undertaken, through physico-chemical and microbiological sampling programmes, macro-invertebrate counts, and vegetation sampling. All available information regarding the catchment was integrated within a GIS platform, including demographic and socio-economic data on the various communities, and hydrogeological information on the underlying aquifer obtained from earlier studies. The integrated nature of the project allows a number of conclusions and recommendations to be drawn, regarding the management of this particular catchment. However, important general lessons have also been learned which can be applied by local authorities responsible for urban catchments in developing countries. The necessity of providing the required institutional structures cannot be overemphasised.

  20. Methamphetamine Use and Sexual Risk Behavior among High School Students in Cape Town, South Africa

    ERIC Educational Resources Information Center

    Pluddemann, Andreas; Flisher, Alan J.; McKetin, Rebecca; Parry, Charles D.; Lombard, Carl J.

    2012-01-01

    Objective: To investigate whether methamphetamine use is associated with sexual risk behavior among adolescents. Method: A cross-sectional survey of 1,561 male and female high school students in Cape Town (mean age 14.9 years) was conducted using items from the Problem Oriented Screening Instrument for Teenagers (POSIT) HIV Risk Scale. Results:…

  1. Coital frequency and condom use in monogamous and concurrent sexual relationships in Cape Town, South Africa

    PubMed Central

    Delva, Wim; Meng, Fei; Beauclair, Roxanne; Deprez, Nele; Temmerman, Marleen; Welte, Alex; Hens, Niel

    2013-01-01

    Introduction A decreased frequency of unprotected sex during episodes of concurrent relationships may dramatically reduce the role of concurrency in accelerating the spread of HIV. Such a decrease could be the result of coital dilution – the reduction in per-partner coital frequency from additional partners – and/or increased condom use during concurrency. To study the effect of concurrency on the frequency of unprotected sex, we examined sexual behaviour data from three communities with high HIV prevalence around Cape Town, South Africa. Methods We conducted a cross-sectional survey from June 2011 to February 2012 using audio computer-assisted self-interviewing to reconstruct one-year sexual histories, with a focus on coital frequency and condom use. Participants were randomly sampled from a previous TB and HIV prevalence survey. Mixed effects logistic and Poisson regression models were fitted to data from 527 sexually active adults reporting on 1210 relationship episodes to evaluate the effect of concurrency status on consistent condom use and coital frequency. Results The median of the per-partner weekly average coital frequency was 2 (IQR: 1–3), and consistent condom use was reported for 36% of the relationship episodes. Neither per-partner coital frequency nor consistent condom use changed significantly during episodes of concurrency (aIRR=1.05; 95% confidence interval (CI): 0.99–1.24 and aOR=1.01; 95% CI: 0.38–2.68, respectively). Being male, coloured, having a tertiary education, and having a relationship between 2 weeks and 9 months were associated with higher coital frequencies. Being coloured, and having a relationship lasting for more than 9 months, was associated with inconsistent condom use. Conclusions We found no evidence for coital dilution or for increased condom use during concurrent relationship episodes in three communities around Cape Town with high HIV prevalence. Given the low levels of self-reported consistent condom use, our

  2. Intentional injury and violence in Cape Town, South Africa: an epidemiological analysis of trauma admissions data

    PubMed Central

    Schuurman, Nadine; Cinnamon, Jonathan; Walker, Blake Byron; Fawcett, Vanessa; Nicol, Andrew; Hameed, Syed Morad; Matzopoulos, Richard

    2015-01-01

    Background Injury is a truly global health issue that has enormous societal and economic consequences in all countries. Interpersonal violence is now widely recognized as important global public health issues that can be addressed through evidence-based interventions. In South Africa, as in many low- and middle-income countries (LMIC), a lack of ongoing, systematic injury surveillance has limited the ability to characterize the burden of violence-related injury and to develop prevention programmes. Objective To describe the profile of trauma presenting to the trauma centre of Groote Schuur Hospital in Cape Town, South Africa – relating to interpersonal violence, using data collected from a newly implemented surveillance system. Particular emphasis was placed on temporal aspects of injury epidemiology, as well as age and sex differentiation. Design Data were collected prospectively using a standardized trauma admissions form for all patients presenting to the trauma centre. An epidemiological analysis was conducted on 16 months of data collected from June 2010 to October 2011. Results A total of 8445 patients were included in the analysis, in which the majority were violence-related. Specifically, 35% of records included violent trauma and, of those, 75% of victims were male. There was a clear temporal pattern: a greater proportion of intentional injuries occur during the night, while unintentional injury peaks late in the afternoon. In total, two-third of all intentional trauma is inflicted on the weekends, as is 60% of unintentional trauma. Where alcohol was recorded in the record, 72% of cases involved intentional injury. Sex was again a key factor as over 80% of all records involving alcohol or substance abuse were associated with males. The findings highlighted the association between violence, young males, substance use, and weekends. Conclusions This study provides the basis for evidence-based interventions to reduce the burden of intentional injury

  3. Intentional injury and violence in Cape Town, South Africa: an epidemiological analysis of trauma admissions data.

    PubMed

    Schuurman, Nadine; Cinnamon, Jonathan; Walker, Blake Byron; Fawcett, Vanessa; Nicol, Andrew; Hameed, Syed Morad; Matzopoulos, Richard

    2015-01-01

    Background Injury is a truly global health issue that has enormous societal and economic consequences in all countries. Interpersonal violence is now widely recognized as important global public health issues that can be addressed through evidence-based interventions. In South Africa, as in many low- and middle-income countries (LMIC), a lack of ongoing, systematic injury surveillance has limited the ability to characterize the burden of violence-related injury and to develop prevention programmes. Objective To describe the profile of trauma presenting to the trauma centre of Groote Schuur Hospital in Cape Town, South Africa - relating to interpersonal violence, using data collected from a newly implemented surveillance system. Particular emphasis was placed on temporal aspects of injury epidemiology, as well as age and sex differentiation. Design Data were collected prospectively using a standardized trauma admissions form for all patients presenting to the trauma centre. An epidemiological analysis was conducted on 16 months of data collected from June 2010 to October 2011. Results A total of 8445 patients were included in the analysis, in which the majority were violence-related. Specifically, 35% of records included violent trauma and, of those, 75% of victims were male. There was a clear temporal pattern: a greater proportion of intentional injuries occur during the night, while unintentional injury peaks late in the afternoon. In total, two-third of all intentional trauma is inflicted on the weekends, as is 60% of unintentional trauma. Where alcohol was recorded in the record, 72% of cases involved intentional injury. Sex was again a key factor as over 80% of all records involving alcohol or substance abuse were associated with males. The findings highlighted the association between violence, young males, substance use, and weekends. Conclusions This study provides the basis for evidence-based interventions to reduce the burden of intentional injury

  4. Nitrogen deposition in a southern hemisphere biodiversity hotspot within and surrounding Cape Town, South Africa

    NASA Astrophysics Data System (ADS)

    Angstmann, J. L.; Hall, S.; February, E.; West, A. G.; Allsopp, N.; Bond, W.

    2011-12-01

    Anthropogenic nitrogen (N) emissions have increased dramatically since the agricultural and industrial revolutions leading to N deposition in the northern hemisphere that is estimated to be an order of magnitude greater than preindustrial fluxes. N deposition rates of 5-15 kg N ha-1 yr-1 in Europe and N. America decrease plant species diversity, increase invasive species, and lead to eutrophication of surface waters. The southern hemisphere is home to over 50% of the world's biodiversity hotspots, including the 90,000 km2 Cape Floristic Region which houses 9,030 vascular plant species, 69% of which are endemic. However, to date, N deposition rates in the southern hemisphere are highly uncertain, with global models of N deposition based upon sparse datasets at best. Many terrestrial systems, such as fynbos shrublands, are adapted to low N availability and exhibit high species diversity and endemism, rendering them susceptible to ecological changes from N deposition. In this research, we quantified the spatial and temporal distribution of wet and dry N deposition across 30 protected fynbos ecosystems within the urban airshed of Cape Town, South Africa. We predicted that 1) total inorganic N deposition varies predictably along the urban-rural gradient (highest near the city centre), 2) N deposition varies seasonally, with higher fluxes in the winter months when atmospheric stability causes a build-up of N gases in and around the city, and 3) total inorganic N deposition will exceed the critical load of 10-15 kg N ha-1 yr-1 for Mediterranean shrublands, past which negative ecosystem effects have been shown to occur. Estimates of N deposition based on NO2 concentrations within the city suggest that total N deposition ranges from 8-13 kg N ha-1 yr-1 . However, we show that N deposition measured by ion-exchange resin collectors is far less than expected, averaging less than 2 kg N ha-1 yr-1 (range 0.5 - 5.5 kg N ha-1 yr-1 ), and is is dominated by NO3-, suggesting

  5. Afriflu2--second international workshop on influenza vaccination in the African continent--8 November 2012, Cape Town (South Africa).

    PubMed

    Schoub, Barry D; Gessner, Bradford D; Ampofo, William; Cohen, Adam L; Steffen, Christoph A

    2013-08-02

    The second meeting of the Afriflu conferences took place in Cape Town, South Africa, with over 60 participants from 15 countries in Africa and also outside the continent. Significant progress in surveillance has been made in better understanding the illness burden of influenza on the continent, which limited evidence suggests is greater than that in the developed world. In southern Africa HIV and TB coinfections play a major role in increasing hospitalisation and mortality, while elsewhere in Africa other cofactors still need to be determined. There is currently no indigenous vaccine production in sub-Saharan Africa and only one facility, based in South Africa, capable of filling imported bulk. Innovative vaccine strategies will need to be explored, such as maternal immunisation, and also the possibility of other influenza vaccine options, such as live attenuated influenza vaccine for young children. Sustained indigenous vaccine production is essential for the continent to have vaccine security in the event of a pandemic even though establishing local production faces considerable challenges especially ensuring adequate markets on the continent. There is an urgent need to develop effective communication messages for decision makers as well as healthcare workers addressing the importance of influenza even in the face of the major competing health burdens of the continent.

  6. Transport of atmospheric NOx and HNO3 over Cape Town

    NASA Astrophysics Data System (ADS)

    Abiodun, B. J.; Ojumu, A. M.; Jenner, S.; Ojumu, T. V.

    2013-05-01

    Cape Town, the most popular tourist city in Africa, usually experiences air pollution with unpleasant odour in winter. Previous studies have associated the pollution with local emission of pollutants within the city. The present study examines the transport of atmospheric pollutants (NOx and HNO3) over South Africa and shows how the transport of pollutants from the Mpumalanga Highveld may contribute to the pollution in Cape Town. The study analysed observation data (2001-2008) from Cape Town air quality network and simulation data (2001-2004) from regional climate model (RegCM4) over southern Africa. The simulation accounts for the influence of complex topography, atmospheric condition, and atmospheric chemistry on emission and transport of pollutants over southern Africa. Flux budget analysis was used to examine whether Cape Town is a source or sink for NOx and HNO3 during the extreme pollution events. The results show that extreme pollution events over Cape Town are associated with the low-level (surface-850 hPa) transport of NOx from the Mpumalanga Highveld to Cape Town, and with a tongue of high concentration of HNO3 that extends from the Mpumalanga Highveld to Cape Town along the south coast of South Africa. The prevailing atmospheric conditions during the extreme pollution events feature an upper-level (700 hPa) anticyclonic flow over South Africa and a low-level col over Cape Town. The anticyclonic flow induces a strong subsidence motion, which prevents vertical mixing of the pollutants and caps high concentration of pollutants close to the surface as they are transported from the Mpumalanga Highveld toward Cape Town, while the col accumulates the pollutants over the city. This study shows that Cape Town can be a sink for the NOx and HNO3 during extreme pollution events and suggests that the accumulation of pollutants transported from other areas (e.g. Mpumalanga Highveld) may contribute substantially to the air pollution in Cape Town.

  7. Men (and women) as "sellers" of sex in alcohol-serving venues in Cape Town, South Africa.

    PubMed

    Pitpitan, Eileen V; Kalichman, Seth C; Eaton, Lisa A; Watt, Melissa H; Sikkema, Kathleen J; Skinner, Donald; Pieterse, Desiree; Cain, Demetria

    2014-06-01

    The relationship between transactional sex, HIV risk, and partner violence has been well documented in South Africa, but research has focused primarily on women and has not been conducted in high-risk social contexts. The aim of this study was to examine associations between transactional sex and HIV risk among women and men in alcohol-serving venues in Cape Town, South Africa. We surveyed 1,989 women and 2,468 men attending alcohol-serving venues in Cape Town, South Africa to assess transactional sex behavior (i.e., receiving money or goods in exchange for sex), alcohol and drug use, history of childhood abuse, current relationship violence, and sexual risk behaviors. Among both women and men, trading sex was related to higher alcohol use, greater likelihood of drug use, substance use in sexual contexts, and a greater likelihood of experiencing physical and sexual violence. Compared to other women, women who traded sex reported a greater proportion of condom-unprotected sex; this relationship was not found for men. Analyses showed that men were almost twice as more likely to report trading sex for items, including money or alcohol, than women (9.7 vs. 5.8 %). Overall, men who traded sex were similar to their female counterparts. Similar associations between trading sex and different risk behaviors were found among women and men with limited economic means and substance use problems. Future research should more closely study transactional sex in high-risk venues as it relates to violence and should examine men who trade sex as a potential bridge population between heterosexual women and men who have sex with men.

  8. Complainants With Learning Disabilities In Sexual Abuse Cases: A 10-Year Review Of A Psycho-Legal Project In Cape Town, South Africa

    ERIC Educational Resources Information Center

    Dickman, Beverley Jo; Roux, Amanda Jane

    2005-01-01

    We describe a project established in 1990 to assist complainants with learning disabilities in sexual assault cases in Cape Town, South Africa. Complainants are prepared for court and psychologists advise investigating officers and prosecutors, and provide expert testimony. There has been an enormous increase in the utilization of the project by…

  9. Computer Applications in Information Systems. Proceedings of a Workshop (Cape Town, South Africa, November 26-27, 1985). Continuing Education Series Number 1.

    ERIC Educational Resources Information Center

    Bleimschein, Sue, Ed.

    Sixteen papers from a workshop on computer applications sponsored by the University of Cape Town (South Africa) School of Librarianship are presented in this volume: (1) "Introduction to the Use of Information Technology" (Sue Bleimschein); (2) "Searching Remote Databases" (Steve Rossouw); (3) "SABINET [South African Bibliographic and Information…

  10. The transport of atmospheric sulfur over Cape Town

    NASA Astrophysics Data System (ADS)

    Jenner, Samantha L.; Abiodun, Babatunde J.

    2013-11-01

    Cape Town, renowned for its natural beauty, is troubled by an unpleasant brown haze pollution, in which atmospheric sulfur plays a major role. This study investigates whether Cape Town is a net producer or recipient of anthropogenic sulfur pollution. In the study, two atmospheric chemistry-transport models (RegCM and WRF) are used to simulate atmospheric flow and chemistry transport over South Africa for two years (2001 and 2002). Both models reproduce the observed seasonal variability in the atmospheric flow and SO2 concentration over Cape Town. The models simulations agree on the seasonal pattern of SO2 over South Africa but disagree on that of SO4. The simulations show that ambient sulfur in Cape Town may be linked with pollutant emissions from the Mpumalanga Highveld, South Africa's most industrialized region. While part of atmospheric SO2 from the Highveld is transported at 700 hPa level toward the Indian Ocean (confirming previous studies), part is transported at low level from the Highveld toward Cape Town. In April, a band of high concentration SO2 extends between the Highveld and Cape Town, following the south coast. Extreme sulfur pollution events in Cape Town are associated with weak flow convergence or stagnant conditions over the city, both of which encourage the accumulation of pollution. However the study suggests that atmospheric sulfur is being advected from Mpumalanga Highveld to Cape Town and this may contribute to atmospheric pollution problems in Cape Town.

  11. The Institution of a Standardized Investigation Protocol for Sudden Infant Death in the Eastern Metropole, Cape Town, South Africa(,)().

    PubMed

    Dempers, Johan J; Coldrey, Jean; Burger, Elsie H; Thompson, Vonita; Wadee, Shabbir A; Odendaal, Hein J; Sens, Mary Ann; Randall, Brad B; Folkerth, Rebecca D; Kinney, Hannah C

    2016-11-01

    The rate for the sudden infant death syndrome (SIDS) in Cape Town, South Africa, is estimated to be among the highest in the world (3.41/1000 live births). In several of these areas, including those of extreme poverty, only sporadic, nonstandardized infant autopsy, and death scene investigation (DSI) occurred. In this report, we detail a feasibility project comprising 18 autopsied infants with sudden and unexpected death whose causes of death were adjudicated according to the 1991 NICHD definitions (SIDS, n = 7; known cause of death, n = 7; and unclassified, n = 4). We instituted a standardized autopsy and infant DSI through a collaborative effort of local forensic pathology officers and clinical providers. The high standard of forensic investigation met international standards, identified preventable disease, and allowed for incorporation of research. We conclude that an effective infant autopsy and DSI protocol can be established in areas with both high sudden unexpected infant death, and elsewhere. (SUID)/SIDS risk and infrastructure challenges.

  12. "Taking care of business": alcohol as currency in transactional sexual relationships among players in Cape Town, South Africa.

    PubMed

    Townsend, Loraine; Ragnarsson, Anders; Mathews, Catherine; Johnston, Lisa Grazina; Ekström, Anna Mia; Thorson, Anna; Chopra, Mickey

    2011-01-01

    In this article we examine the dynamics of social relationships in which alcohol use and risky sexual behaviors cooccur. As part of a larger biological and behavioral HIV surveillance survey, 20 men who lived in an urban, informal settlement on the outskirts of Cape Town, South Africa participated in in-depth interviews. Interview transcripts were analyzed according to a latent content analysis. Findings highlight the latent association between alcohol and transactional sex, and enable an in-depth examination of the normative role that alcohol plays in the formation of casual sexual partnerships characterized by exchange. We build on an existing conceptual model that traces the potential pathways by which alcohol use and transactional sex are linked to sexual risk behaviors. The study findings point to the need for multilevel HIV risk-reduction interventions among men to reduce excessive alcohol use, risky sexual behaviors, and underlying perceptions of ideal masculinity.

  13. The influence of male circumcision for HIV prevention on sexual behaviour among traditionally circumcised men in Cape Town, South Africa.

    PubMed

    Eaton, L A; Cain, D N; Agrawal, A; Jooste, S; Udemans, N; Kalichman, S C

    2011-11-01

    We examined the relationship between HIV prevention beliefs related to male circumcision and sexual behaviour/sexually transmitted infection (STI) acquisition among traditionally circumcised men in Cape Town, South Africa. HIV-negative men (n = 304), circumcised for cultural/religious reasons, attending a health clinic in Cape Town, South Africa, completed cross-sectional surveys. Generalized linear models were used to analyse the relationships between unprotected vaginal sex acts, number of female sexual partners, STI diagnoses and male circumcision-related beliefs and risk perceptions. Men who were aware that circumcision offers protection against HIV (relative risk [RR] = 1.19, 95% confidence interval [CI] = 1.06-1.32, P < 0.01), endorsed risk compensation related to male circumcision (RR = 1.15, 95% CI = 1.11-1.12, P < 0.01) and perceived lower risk of HIV infection when circumcised (RR = 1.08, 95% CI = 1.04-1.12, P < 0.01) were more likely to report unprotected vaginal sex acts. Similar patterns were also identified when predicting number of female sexual partners. Men who were more likely to endorse risk compensation related to male circumcision were also more likely to be diagnosed with a chronic STI (odds ratio [OR] = 1.64, 95% CI = 1.06-2.53, P < 0.05). Our findings suggest that we must not overlook the effects of beliefs towards male circumcision for HIV prevention among men traditionally circumcised; doing so may undermine current efforts to reduce HIV transmission through male circumcision.

  14. The MobiSan approach: informal settlements of Cape Town, South Africa.

    PubMed

    Naranjo, A; Castellano, D; Kraaijvanger, H; Meulman, B; Mels, A; Zeeman, G

    2010-01-01

    Pook se Bos informal settlement and the Cape Town Water & Sanitation Services Department are partnering on an urban sanitation project with a Dutch Consortium consisting of Lettinga Associates Foundation (LeAF), Landustrie Sneek and Vitens-Evides International. The aim of the project is to improve the basic sanitation services provided in informal settlements through the implementation of the MobiSan approach. The approach consists of a communal Urine-Diversion and Dehydration Toilet (UDDT) built in a former sea shipping container. The system is independent of water, electricity or sewerage connection and it is maintained by full-time community caretakers who also act as hygiene promoters. The project seeks to link sanitation services with hygiene promotion in informal settlements while enhancing user satisfaction and reducing costs in providing basic sanitation services. This paper describes the preliminary experiences and lessons learnt during the implementation and evaluation of the MobiSan prototype and discusses its potential for replication. The MobiSan has proved to be an appropriate option by means of dealing successfully with shallow groundwater table, land availability and high settlement densities. In addition it has been demonstrated to be cost-competitive in terms of operating cost compared to chemical toilets.

  15. Social and cultural contexts of concurrency in a township in Cape Town, South Africa.

    PubMed

    Mah, Timothy L; Maughan-Brown, Brendan

    2013-01-01

    Understanding the social and cultural context in which concurrent sexual partnerships exist is important, given recent interventions to reduce their prevalence. This qualitative study seeks to improve the understanding of concurrent partnerships and perceptions of the link between concurrency and HIV risk in a South African township in Cape Town. Small-group discussion and focus-group participants reported that concurrency was a common phenomenon in their township. The most commonly cited reasons for participating in concurrent partnerships were material and financial exchange or gain and sexual dissatisfaction with partners. Although participants believed that being in a concurrent relationship increases the risk of acquiring HIV, they did not believe this discourages many people from engaging in these behaviours. This study highlights that concurrency in this context may be a social norm that is resistant to change. The efficacy of current programmes aimed at reducing concurrency needs to be examined in this context. Our findings suggest that improving economic independence at the individual level and improving sexual satisfaction within partnerships may have some leverage for concurrency reduction. An alternative approach to strengthen combination HIV-prevention strategies could be to increase condom use with the additional/side partners, whose predominant role is often perceived in terms of sex, with messages centred on the notion that sex with additional partner(s) should not endanger the main partner.

  16. Family Ties and Young Fathers’ Engagement in Cape Town, South Africa

    PubMed Central

    Clark, Shelley; Cotton, Cassandra; Marteleto, Leticia J.

    2015-01-01

    Young South African fathers are often engaged in their children’s lives even if they do not live together. Using longitudinal data on children (n = 1,209) from the Cape Town area, the authors show that although only 26% of young fathers live with their children, 66% of nonresidential fathers maintain regular contact, and 61% provide financial support. The father–child relationship, however, is embedded in broader family ties. The type of father–mother relationship is strongly associated with whether fathers coreside with their children, but not with fathers’ contact with nonresidential children. Close mother and maternal grandmother bonds reduce the likelihood that fathers live with their children, whereas close ties between fathers and paternal grandmothers increase the chance that fathers visit nonresidential children. Family ties do not affect fathers’ financial contributions, which are driven by men’s current economic situation. These findings illustrate that father–child relationships are best understood in the context of interacting family systems. PMID:25774066

  17. Patients’ perceptions of the triage system in a primary healthcare facility, Cape Town, South Africa

    PubMed Central

    Adeniji, Adeloye Amoo

    2016-01-01

    Background In public healthcare facilities, where the patient numbers and the available resources are often disproportionate, triage is used to prioritise when patients are seen. Patients may not understand the triage process and have strong views on how to improve their experience. Aim This study explored the views of patients who had undergone triage in the emergency centre of a primary care facility. Setting Gugulethu Community Health Centre, Cape Town. Methods A purposive sample consisted of five women (one coded green, three orange, one yellow) and four men (one coded green and three yellow). A semi-structured qualitative interview was conducted in either Xhosa or English and the transcripts analysed using the framework method. Results All of the respondents complained of a lack of information and poor understanding of the triage process. Those coded green experienced the process as biased and unfair and reported that the triage nurse was rude and unprofessional. By contrast, those coded yellow or orange found the triage nurse to be helpful and professional. Most patients turned to support staff (e.g. security staff or cleaners) for assistance in dealing with the triage system. Most patients waited longer than the guidelines recommend and the green-coded patients complained about this issue. Conclusion Patients did not have a good experience of the triage system. Managers of the triage system need to design better strategies to improve patient acceptance and share information. The important role of support staff needs to be recognised and strengthened. PMID:27380788

  18. "Coming to town": the impact of urbanicity, cigarette advertising, and network norms on the smoking attitudes of black women in Cape Town, South Africa.

    PubMed

    Williams, Chyvette T; Grier, Sonya A; Marks, Amy Seidel

    2008-07-01

    This study was conducted to examine the effect of urban living on smoking attitudes among black African women in South Africa. We examine how urbanicity affects attitudes toward smoking and how it moderates the relationship between both advertising exposure and network norms on black women's smoking attitudes. Respondents were 975 black women currently living in Cape Town townships, some of which were raised in rural villages or small towns. Respondents completed a cross-sectional survey, which included data on smoking attitudes, norms, and exposure to cigarette advertising. Multiple linear regression analysis was performed with smoking attitudes as the response variable, and urbanicity, cigarette advertising exposure, and network smoking norms as primary explanatory variables. Interactions were tested to determine whether urbanicity modified the effect of advertising exposure and network norms on smoking attitudes. Independent effects of urbanicity, exposure to cigarette advertising, and greater smoking prevalence within women's networks were associated with more favorable smoking attitudes. In addition, urbanicity moderated the relationship between network smoking norms and smoking attitudes, but not cigarette advertising exposure and smoking attitudes. Urbanicity, cigarette advertising, and networks play important roles in women's attitudes toward smoking, and potentially, smoking behavior. Overall, our results suggest that strong and creative anti-smoking efforts are needed to combat the potential for a smoking epidemic among an increasingly urbanized population of black women in South Africa and similar emerging markets. Additional research is warranted.

  19. Gender-based violence, alcohol use, and sexual risk among female patrons of drinking venues in Cape Town, South Africa.

    PubMed

    Pitpitan, Eileen V; Kalichman, Seth C; Eaton, Lisa A; Cain, Demetria; Sikkema, Kathleen J; Skinner, Donald; Watt, Melissa H; Pieterse, Desiree

    2013-06-01

    Gender-based violence is a well-recognized risk factor for HIV infection among women. Alcohol use is associated with both gender-based violence and sexual risk behavior, but has not been examined as a correlate of both in a context of both high HIV risk and hazardous drinking. The purpose of this paper is to examine the association between recent abuse by a sex partner with alcohol and sexual risk behavior among female patrons of alcohol serving venues in South Africa. Specifically, the aim of this study is to determine whether sexual risk behaviors are associated with gender-based violence after controlling for levels of alcohol use. We surveyed 1,388 women attending informal drinking establishments in Cape Town, South Africa to assess recent history of gender-based violence, drinking, and sexual risk behaviors. Gender-based violence was associated with both drinking and sexual risk behaviors after controlling for demographics among the women. A hierarchical logistic regression analysis showed that after controlling for alcohol use sexual risk behavior remained significantly associated with gender-based violence, particularly with meeting a new sex partner at the bar, recent STI diagnosis, and engaging in transactional sex, but not protected intercourse or number of partners. In South Africa where heavy drinking is prevalent women may be at particular risk of physical abuse from intimate partners as well as higher sexual risk. Interventions that aim to reduce gender-based violence and sexual risk behaviors must directly work to reduce drinking behavior.

  20. Sensation seeking, alcohol use, and sexual behaviors among sexually transmitted infection clinic patients in Cape Town, South Africa.

    PubMed

    Kalichman, Seth C; Simbayi, Leickness C; Jooste, Sean; Cain, Demetria; Cherry, Charsey

    2006-09-01

    Alcohol use is associated with risks for HIV/AIDS. The association between alcohol and sexual risk may be accounted for by sensation seeking personality. However, sensation seeking in relation to substance use and HIV risk has not been examined in Africa. In this study, 292 men and 219 women receiving sexually transmitted infection (STI) diagnostic and treatment services in Cape Town, South Africa, completed anonymous behavioral surveys. Structural modeling was used to test a model of alcohol use and sensation seeking in relation to sexual risk behaviors. Results showed that sensation seeking and alcohol use in sexual contexts were related to HIV risks, controlling for gender and marital status. The association between sensation seeking and HIV risk was partly accounted for by alcohol use in proximity to sex. In contrast to studies conducted in the United States, sensation seeking was not related to alcohol-sex outcome expectancies. These findings suggest that alcohol use is an important HIV transmission risk factor for many STI clinic patients and that interventions for individuals who are characterized as sensation seekers are urgently needed in South Africa.

  1. Child pedestrian safety knowledge, behaviour and road injury in Cape Town, South Africa.

    PubMed

    Koekemoer, Karin; Van Gesselleen, Megan; Van Niekerk, Ashley; Govender, Rajen; Van As, Arjan Bastiaan

    2017-02-01

    Pedestrian injuries are a leading cause of death among South African children, and young children residing in low-income communities are more at risk, due to various factors such as inadequate road infrastructure, exposure to traffic due to reliance on walking as a means of transport, and lack of supervision. This study used a cross-sectional, non-randomized self-report survey to assess pedestrian safety knowledge, road-crossing behaviour and pedestrian injuries of primary school children in selected low-income settings in Cape Town. The survey focused on three primary schools that had joined the Safe Kids Worldwide Model School Zone Project and was administered to 536 children aged 6-15 years, in their home language of isiXhosa. Descriptive and bivariate analyses as well as multivariate regression analyses were conducted to investigate potential predictor variables for pedestrian collision severity and unsafe road-crossing behaviour. Walking was the sole form of travel for 81% of the children, with a large proportion regularly walking unsupervised. Children who walk to or from school alone were younger and reported riskier road-crossing behaviour, although children who walk accompanied tended to have higher pedestrian collision severity. "Negligent Behaviour" related to road-crossing was significantly associated with higher pedestrian collision severity, with predictors of "Negligent Behaviour" including the lack of pedestrian safety knowledge and greater exposure to traffic in terms of time spent walking. More than half of the reported pedestrian collisions involved a bicycle, and older boys (10-15 years) were most at risk of experiencing a severe pedestrian injury. The findings substantiate emerging evidence that children in low-income settings are at greater risk for child pedestrian injury, and emphasise the need for evidence-based safety promotion and injury prevention interventions in these settings.

  2. An evaluation of University of Cape Town medical students’ community placements in South Africa

    PubMed Central

    Zweigenthal, Virginia; Irlam, James; London, Leslie; Keikelame, Johannah

    2012-01-01

    Abstract Background Fourth-year medical students at the University of Cape Town (UCT) work closely with stakeholders in community teaching sites to conduct community-based research projects and follow-up health promotion interventions during their Public Health training. Objectives This study evaluated the placements as a learning experience from the perspectives of past students and community stakeholders. Methods A total of 32 projects were randomly selected out of 232 projects undertaken during 2006, 2008 and 2009. Two students and a stakeholder involved with each project were sampled. A standardised survey was emailed to students and in-depth interviews were held with stakeholders. Results Fifty two per cent of 64 students and 57% of 25 stakeholders responded. Most students felt that the placements enhanced their academic experience and confidence in research skills, and were an effective form of learning. Perceived challenges included time constraints and, for a minority, inadequately prepared settings and stakeholders. Stakeholders felt that the placements empowered the communities and prepared students for the realities of working as a medical professional. They viewed students as a valuable resource and believed that student projects addressed important community myths and health problems. Recommendations from students and stakeholders included more time for the Public Health block, follow-up interventions for greater continuity, and better alignment of projects with stakeholder programmes. Conclusion The evaluation reveals both the importance and challenges of community placements and identifies areas of improvement. Despite the limited duration of the placements, they offered valuable community-based learning experiences for the students and worthwhile benefits for the communities.

  3. Pricing landfill externalities: Emissions and disamenity costs in Cape Town, South Africa

    SciTech Connect

    Nahman, Anton

    2011-09-15

    Highlights: > The paper estimates landfill externalities associated with emissions, disamenities and transport. > Transport externalities vary from 24.22 to 31.42 Rands per tonne. > Costs of emissions (estimated using benefits transfer) vary from 0.07 to 28.91 Rands per tonne. > Disamenities (estimated using hedonic pricing) vary from 0.00 to 57.46 Rands per tonne. > Overall, external costs for urban landfills exceed those of a regional landfill. - Abstract: The external (environmental and social) costs of landfilling (e.g. emissions to air, soil and water; and 'disamenities' such as odours and pests) are difficult to quantify in monetary terms, and are therefore not generally reflected in waste disposal charges or taken into account in decision making regarding waste management options. This results in a bias against alternatives such as recycling, which may be more expensive than landfilling from a purely financial perspective, but preferable from an environmental and social perspective. There is therefore a need to quantify external costs in monetary terms, so that different disposal options can be compared on the basis of their overall costs to society (financial plus external costs). This study attempts to estimate the external costs of landfilling in the City of Cape Town for different scenarios, using the benefits transfer method (for emissions) and the hedonic pricing method (for disamenities). Both methods (in particular the process of transferring and adjusting estimates from one study site to another) are described in detail, allowing the procedures to be replicated elsewhere. The results show that external costs are currently R111 (in South African Rands, or approximately US$16) per tonne of waste, although these could decline under a scenario in which energy is recovered, or in which the existing urban landfills are replaced with a new regional landfill.

  4. "Nothing Is Free": A Qualitative Study of Sex Trading Among Methamphetamine Users in Cape Town, South Africa.

    PubMed

    Watt, Melissa H; Kimani, Stephen M; Skinner, Donald; Meade, Christina S

    2016-05-01

    South Africa is facing an established epidemic of methamphetamine, known locally as "tik." Globally, methamphetamine has been linked to high rates of sexual risk behaviors, including sex trading. The goal of this study was to qualitatively examine the experiences of sex trading among methamphetamine users in Cape Town, South Africa. Individual in-depth interviews were conducted with 30 active methamphetamine users (17 men and 13 women) recruited from the community. Interviews were conducted in local languages using a semi-structured guide that included questions on sex trading experiences and perceptions of sex trading among methamphetamine users. Interviews were audio-recorded, transcribed, and analyzed using analytic memos and coding with constant comparison techniques. The data revealed that in a setting of high levels of addiction and poverty, sex was an important commodity for acquiring methamphetamine. Women were more likely to use sex to acquire methamphetamine, but men reported opportunistic cases of trading sex for methamphetamine. Four models of sex trading emerged: negotiated exchange, implicit exchange, relationships based on resources, and facilitating sex exchange for others. The expectation of sex trading created a context in which sexual violence against female methamphetamine users was common. Multiple sexual partners and inconsistent condom use in acts of sex trading put methamphetamine users at high risk of HIV. Interventions in this setting should address addiction, which is the primary driver of sex trading among methamphetamine users. Harm reduction interventions may include education about HIV and other sexually transmitted infections, availability of condoms and HIV testing, and sexual violence prevention.

  5. Community perceptions of risk factors for interpersonal violence in townships in Cape Town, South Africa: A focus group study.

    PubMed

    Makanga, Prestige Tatenda; Schuurman, Nadine; Randall, Ellen

    2015-12-27

    Interpersonal violence is a major contributor to the burden of disease globally, and in South Africa, it is the leading cause of injury. There is an emerging consensus that the development of actionable policy and effective prevention strategies for interpersonal violence requires an understanding of the contextual matters that elevate risk for interpersonal violence. The objective of this study was to explore community perceptions of risks for interpersonal violence in five townships in Cape Town, South Africa, with high rates of violence. Focus group discussions were conducted with community members to identify key factors in that contributed to being either a perpetrator or victim of interpersonal violence. The ecological framework was used to classify the risk factors as occurring at individual, relationship, community or society levels. Some of the risk factors identified included alcohol abuse, poverty, informality of settlements and cultural norms. Differences in how each of these risk factors are expressed and experienced in the five communities are also elucidated. This approach enabled the collection of contextual community-based data that can complement conventional surveillance data in the development of relevant community-level strategies for interpersonal violence prevention.

  6. Ambient Air Pollution Exposure and Respiratory, Cardiovascular and Cerebrovascular Mortality in Cape Town, South Africa: 2001–2006

    PubMed Central

    Wichmann, Janine; Voyi, Kuku

    2012-01-01

    Little evidence is available on the strength of the association between ambient air pollution exposure and health effects in developing countries such as South Africa. The association between the 24-h average ambient PM10, SO2 and NO2 levels and daily respiratory (RD), cardiovascular (CVD) and cerebrovascular (CBD) mortality in Cape Town (2001–2006) was investigated with a case-crossover design. For models that included entire year data, an inter-quartile range (IQR) increase in PM10 (12 mg/m3) and NO2 (12 mg/m3) significantly increased CBD mortality by 4% and 8%, respectively. A significant increase of 3% in CVD mortality was observed per IQR increase in NO2 and SO2 (8 mg/m3). In the warm period, PM10 was significantly associated with RD and CVD mortality. NO2 had significant associations with CBD, RD and CVD mortality, whilst SO2 was associated with CVD mortality. None of the pollutants were associated with any of the three outcomes in the cold period. Susceptible groups depended on the cause-specific mortality and air pollutant. There is significant RD, CVD and CBD mortality risk associated with ambient air pollution exposure in South Africa, higher than reported in developed countries. PMID:23202828

  7. HIV testing attitudes, AIDS stigma, and voluntary HIV counselling and testing in a black township in Cape Town, South Africa

    PubMed Central

    Kalichman, S; Simbayi, L

    2003-01-01

    Objectives: A cornerstone of HIV prevention in South Africa is voluntary HIV antibody counselling and testing (VCT), but only one in five South Africans aware of VCT have been tested. This study examined the relation between HIV testing history, attitudes towards testing, and AIDS stigmas. Methods: Men (n = 224) and women (n = 276) living in a black township in Cape Town completed venue intercept surveys; 98% were black, 74% age 35 or younger. Results: 47% of participants had been tested for HIV. Risks for exposure to HIV were high and comparable among people tested and not tested. Comparisons on attitudes toward VCT, controlling for demographics and survey venue, showed that individuals who had not been tested for HIV and those tested but who did not know their results held significantly more negative testing attitudes than individuals who were tested, particularly people who knew their test results. Compared to people who had been tested, individuals who were not tested for HIV demonstrated significantly greater AIDS related stigmas; ascribing greater shame, guilt, and social disapproval to people living with HIV. Knowing test results among those tested was not related to stigmatising beliefs. Conclusions: Efforts to promote VCT in South Africa require education about the benefits of testing and, perhaps more important, reductions in stigmatising attitudes towards people living with AIDS. Structural and social marketing interventions that aim to reduce AIDS stigmas will probably decrease resistance to seeking VCT. PMID:14663117

  8. A qualitative exploration of HIV-positive pregnant women's decision-making regarding abortion in Cape Town, South Africa.

    PubMed

    Orner, Phyllis; de Bruyn, Maria; Harries, Jane; Cooper, Diane

    2010-08-01

    HIV-positive women's abortion decisions were explored by: (i) investigating influencing factors; (ii) determining knowledge of abortion policy and public health services; and (iii) exploring abortion experiences. In-depth interviews were held with 24 HIV-positive women (15 had an abortion; 9 did not), recruited at public health facilities in Cape Town, South Africa. Negative perceptions towards HIV-positive pregnant women were reported. Women wanted abortions due to socio-economic hardship in conjunction with HIV-positive status. Respondents were generally aware that women in South Africa had a right to free abortions in public health facilities. Both positive and negative abortion experiences were described. Respondents reported no discrimination by providers due to their HIV-positive status. Most respondents reported not using contraceptives, while describing their pregnancies as 'unexpected'. The majority of women who had abortions wanted to avoid another one, and would encourage other HIV-positive women to try to avoid abortion. However, most felt abortions were acceptable for HIV-positive women in some circumstances. Data suggested that stigma and discrimination affect connections between abortion, pregnancy and HIV/AIDS, and that abortion may be more stigmatised than HIV/AIDS. Study results provide important insights, and any revision of reproductive health policy, services, counselling for abortion and HIV/AIDS care should address these issues.

  9. Cost-effectiveness of a package of interventions for expedited antiretroviral therapy initiation during pregnancy in Cape Town, South Africa.

    PubMed

    Zulliger, Rose; Black, Samantha; Holtgrave, David R; Ciaranello, Andrea L; Bekker, Linda-Gail; Myer, Landon

    2014-04-01

    Initiating antiretroviral therapy (ART) early in pregnancy is an important component of effective interventions to prevent the mother-to-child transmission of HIV (PMTCT). The rapid initiation of ART in pregnancy(RAP) program was a package of interventions to expedite ART initiation in pregnant women in Cape Town, South Africa. Retrospective cost-effectiveness, sensitivity and threshold analyses were conducted of the RAP program to determine the cost-utility thresholds for rapid initiation of ART in pregnancy. Costs were drawn from a detailed micro-costing of the program. The overall programmatic cost was US$880 per woman and the base case cost-effectiveness ratio was US$1,160 per quality-adjusted lifeyear (QALY) saved. In threshold analyses, the RAP program remained cost-effective if mother-to-child transmission was reduced by C0.33 %; if C1.76 QALY were saved with each averted perinatal infection; or if RAP-related costs were under US$4,020 per woman. The package of rapid initiation services was very cost-effective, as compared to standard services in this setting. Threshold analyses demonstrated that the intervention required minimal reductions in perinatal infections in order to be cost-effective. Interventions for the rapid initiation of ART in pregnancy hold considerable potential as a cost-effective use of limited resources for PMTCT in sub-Saharan Africa.

  10. Completeness and accuracy of electronic recording of paediatric drug-resistant tuberculosis in Cape Town, South Africa

    PubMed Central

    Schaaf, H. S.; du Preez, K.; Seddon, J. A.; Garcia-Prats, A. J.; Zimri, K.; Dunbar, R.; Hesseling, A. C.

    2013-01-01

    Setting: Cape Town, South Africa. Objective: To assess the completeness and accuracy of electronic recording of drug-resistant tuberculosis (DR-TB) in children. Design: Retrospective cohort study. All children aged <15 years treated for DR-TB during 2012 were included, with clinical data collected from routine health services. Matching was performed between clinical data and an extracted data set from an electronic register for DR-TB (EDR.web), and data sources were compared. Results: Seventy-seven children were identified clinically, of whom only 49 (64%) were found in EDR.web. Most data in EDR.web were complete and accurate, but there were some internal inconsistencies for confirmed TB. Only 4.4% of all EDR.web entries were children. Conclusion: Only two thirds of children clinically treated for DR-TB were recorded in the electronic reporting system, suggesting under-reporting. We also found a lower than expected prevalence of childhood DR-TB, probably suggesting both under-diagnosis and under-recording of DR-TB in children. Clinicians at facility level should be able to access the electronic reporting system, and data transfer between clinical paper-based and electronic sources should be simplified. Cross-linking between electronic registers for drug-susceptible and DR-TB or consolidation of registers could improve the accuracy of recording. Improved recording and reporting of DR-TB in children is needed. PMID:26393032

  11. Language choice and sexual communication among Xhosa speakers in Cape Town, South Africa: implications for HIV prevention message development.

    PubMed

    Cain, Demetria; Schensul, Stephen; Mlobeli, Regina

    2011-06-01

    Communicating about sex is a vital component of human immunodeficiency virus (HIV) prevention and influences how HIV educators convey messages to communities and how couples negotiate safer sex practices. However, sexual communication inevitably confronts culturally based behavioral guidelines and linguistic taboos unique to diverse social contexts. The HIV interventionist needs to identify the appropriate language for sexual communication given the participants and the message. Ethnographic research can help facilitate the exploration of how sex terminology is chosen. A theoretical framework, developed to guide HIV interventionists, suggests that an individual's language choice for sexual communication is influenced by gender roles and power differentials. In-depth interviews, free listing and triadic comparisons were conducted with Xhosa men and women in Cape Town, South Africa, to determine the terms for male genitalia, female genitalia and sexual intercourse that are most appropriate for sexual communication. Results showed that sexual terms express cultural norms and role expectations where men should be powerful and resilient and women should be passive and virginal. For HIV prevention education, non-mother tongue (English and Zulu) terms were recommended as most appropriate because they are descriptive, but allow the speaker to communicate outside the restrictive limits of their mother tongue by reducing emotive cultural connotations.

  12. Costs and process of in-patient tuberculosis management at a central academic hospital, Cape Town, South Africa

    PubMed Central

    Marais, F.; Mehtar, S.; Baltussen, R. M. P. M.

    2012-01-01

    Setting: South Africa reports more cases of tuberculosis (TB) than any other country, but an up-to-date, precise estimate of the costs associated with diagnosing, treating and preventing TB at the in-patient level is not available. Objective: To determine the costs associated with TB management among in-patients and to study the use of personal protective equipment (PPE) at a central academic hospital in Cape Town. Design: Retrospective and partly prospective cost analysis of TB cases diagnosed between May 2008 and October 2009. Results: The average daily in-patient costs were US$238; the average length of stay was 9.7 days. Mean laboratory and medication costs per stay were respectively US$26.82 and US$8.68. PPE use per day cost US$0.99. The average total TB management costs were US$2373 per patient. PPE was not always properly used. Discussion: The costs of in-patient TB management are high compared to community-based treatment; the main reason for the high costs is the high number of in-patient days. An efficiency assessment is needed to reduce costs. Cost reduction per TB case prevented was approximately US$2373 per case. PPE use accounted for the lowest costs. Training is needed to improve PPE use. PMID:26392953

  13. Language choice and sexual communication among Xhosa speakers in Cape Town, South Africa: implications for HIV prevention message development

    PubMed Central

    Cain, Demetria; Schensul, Stephen; Mlobeli, Regina

    2011-01-01

    Communicating about sex is a vital component of human immunodeficiency virus (HIV) prevention and influences how HIV educators convey messages to communities and how couples negotiate safer sex practices. However, sexual communication inevitably confronts culturally based behavioral guidelines and linguistic taboos unique to diverse social contexts. The HIV interventionist needs to identify the appropriate language for sexual communication given the participants and the message. Ethnographic research can help facilitate the exploration of how sex terminology is chosen. A theoretical framework, developed to guide HIV interventionists, suggests that an individual's language choice for sexual communication is influenced by gender roles and power differentials. In-depth interviews, free listing and triadic comparisons were conducted with Xhosa men and women in Cape Town, South Africa, to determine the terms for male genitalia, female genitalia and sexual intercourse that are most appropriate for sexual communication. Results showed that sexual terms express cultural norms and role expectations where men should be powerful and resilient and women should be passive and virginal. For HIV prevention education, non-mother tongue (English and Zulu) terms were recommended as most appropriate because they are descriptive, but allow the speaker to communicate outside the restrictive limits of their mother tongue by reducing emotive cultural connotations. PMID:21059802

  14. The "Affective Place-Making" Practices of Girls at a High School in Cape Town, South Africa

    ERIC Educational Resources Information Center

    Rinquest, Elzahn; Fataar, Aslam

    2016-01-01

    This article focuses on the "affective place-making" practices of girls at a private high school on the outskirts of Cape Town. The article responds to the question: How do high school girls' affects and social bodies contribute to their place-making practices and to the type of place they make of their school? Our focus is on…

  15. Costs of measures to control tuberculosis/HIV in public primary care facilities in Cape Town, South Africa.

    PubMed Central

    Hausler, Harry Peter; Sinanovic, Edina; Kumaranayake, Lilani; Naidoo, Pren; Schoeman, Hennie; Karpakis, Barbara; Godfrey-Faussett, Peter

    2006-01-01

    OBJECTIVE: To measure the costs and estimate the cost-effectiveness of the ProTEST package of tuberculosis/human immunodeficiency virus (TB/HIV) interventions in primary health care facilities in Cape Town, South Africa. METHODS: We collected annual cost data retrospectively using ingredients-based costing in three primary care facilities and estimated the cost per HIV infection averted and the cost per TB case prevented. FINDINGS: The range of costs per person for the ProTEST interventions in the three facilities were: US$ 7-11 for voluntary counselling and testing (VCT), US$ 81-166 for detecting a TB case, US$ 92-183 for completing isoniazid preventive therapy (IPT) and US$ 20-44 for completing six months of cotrimoxazole preventive therapy. The estimated cost per HIV infection averted by VCT was US$ 67-112. The cost per TB case prevented by VCT (through preventing HIV) was US$ 129-215, by intensified case finding was US$ 323-664 and by IPT was US$ 486-962. Sensitivity analysis showed that the use of chest X-rays for IPT screening decreases the cost-effectiveness of IPT in preventing TB cases by 36%. IPT screening with or without tuberculin purified protein derivative screening was almost equally cost-effective. CONCLUSION: We conclude that the ProTEST package is cost saving. Despite moderate adherence, linking prevention and care interventions for TB and HIV resulted in the estimated costs of preventing TB being less than previous estimates of costs of treating it. VCT was less expensive than previously reported in Africa. PMID:16878226

  16. Opportunities for technology-based HIV prevention programming among high school students in Cape Town, South Africa.

    PubMed

    Ybarra, Michele L; Mwaba, Kelvin; Prescott, Tonya L; Roman, Nicolette V; Rooi, Bronwyn; Bull, Sheana

    2014-01-01

    One in three new cases of HIV in South Africa is among adolescents. Given that adolescents are particularly affected, scalable, and cost-effective prevention programs are urgently needed. This study aims to identify opportunities to integrate technology into youth HIV prevention efforts. In 2012, 1107 8th-11th graders completed a paper-and-pencil survey. Respondents were enrolled in one of three public high schools in Langa, a lower income community in Cape Town, South Africa. Eighty-nine percent of respondents have used text messaging (SMS) and 86% have gone online. If an HIV prevention program was offered online, 66% of youth would be somewhat or extremely likely to access it; slightly fewer (55%) felt the same about SMS-based programming. In comparison, 85% said they would be somewhat or extremely likely to access a school-based HIV prevention program. Interest in Internet- (60%) and SMS-based (54%) HIV prevention programming was similar for youth who had a self-appraised risk of HIV compared to youth who appraised their risk to be lower, as it was for youth who were tired of hearing messages about HIV prevention. Technology use is common - even among high school students who live in lower income communities. At the same time, these data reveal that it is not uncommon for youth to be tired of hearing messages about HIV prevention, and many of the typical topics key to HIV prevention have low interest levels among youth. HIV prevention researchers need to be mindful of the extent of existing programming that youth are exposed to. Technology-based programming may be especially amenable to meeting these requirements because of its novelty especially in developing countries, and because interactive functionality can be easily integrated into the program design. Given the preference for school- and Internet-based programming, it seems that a hybrid approach is likely feasible and acceptable.

  17. Caregivers’ Experiences of Pathways to Care for Seriously Ill Children in Cape Town, South Africa: A Qualitative Investigation

    PubMed Central

    Jones, Caroline H. D.; Ward, Alison; Hodkinson, Peter W.; Reid, Stephen J.; Wallis, Lee A.; Harrison, Sian; Argent, Andrew C.

    2016-01-01

    Purpose Understanding caregivers’ experiences of care can identify barriers to timely and good quality care, and support the improvement of services. We aimed to explore caregivers’ experiences and perceptions of pathways to care, from first access through various levels of health service, for seriously ill and injured children in Cape Town, South Africa, in order to identify areas for improvement. Methods Semi-structured, qualitative interviews were conducted with primary caregivers of children who were admitted to paediatric intensive care or died in the health system prior to intensive care admission. Interviews explored caregivers’ experiences from when their child first became ill, through each level of health care to paediatric intensive care or death. A maximum variation sample of transcripts was purposively sampled from a larger cohort study based on demographic characteristics, child diagnosis, and outcome at 30 days; and analysed using the method of constant comparison. Results Of the 282 caregivers who were interviewed in the larger cohort study, 45 interviews were included in this qualitative analysis. Some caregivers employed ‘tactics’ to gain quicker access to care, including bypassing lower levels of care, and negotiating or demanding to see a healthcare professional ahead of other patients. It was sometimes unclear how to access emergency care within facilities; and non-medical personnel informally judged illness severity and helped or hindered quicker access. Caregivers commonly misconceived ambulances to be slow to arrive, and were concerned when ambulance transfers were seemingly not prioritised by illness severity. Communication was often good, but some caregivers experienced language difficulties and/or criticism. Conclusions Interventions to improve child health care could be based on: reorganising the reception of seriously ill children and making the emergency route within healthcare facilities clear; promoting caregivers’ use of

  18. Women's experiences with cervical cancer screening in a colposcopy referral clinic in Cape Town, South Africa: a qualitative analysis

    PubMed Central

    Momberg, Mariette; Botha, Matthys H; Van der Merwe, Frederick H; Moodley, Jennifer

    2017-01-01

    Objective The aim of this study was to explore and understand women's experience with cervical cancer screening and with the referral pathways for abnormal Papanicolau (Pap) smears. Design and setting Focus group discussions were conducted with first time colposcopy clinic attendees at a tertiary hospital colposcopy clinic in Cape Town, South Africa during November 2014. A thematic analysis was conducted to identify key themes. Initial coding categories were drawn from the interview guide. Participants 27 women participated in 4 focus group discussions. Results Participants mean age was 34 years, most did not complete secondary level education and were unemployed. Negative community opinions relating to Pap smears and colposcopy referral might deter women from seeking treatment. Having a gynaecological symptom was the most commonly cited reason for having a Pap smear. Fear of having a HIV test performed at the same time as Pap smear and low encouragement from peers, were factors identified as potential access barriers. Participants commented on insufficient or lack of information from primary providers on referral to the colposcopy clinic and concerns and apprehension during waiting periods between receiving results and the colposcopy appointment were discussed. Conclusions There is a strong and urgent need to improve current knowledge about cervical cancer and Pap smears and the necessity and benefits of timely access to screening programmes, results and treatment. Strategies such as community health education programmes and mass media interventions could be employed to disseminate cervical cancer information and address negative community perceptions. Better training and support mechanisms to equip healthcare providers with the skills to convey cervical cancer information to women are needed. The use of short message service (SMS) to deliver Pap smear results and provide patients with more information should be considered to improve waiting times for results

  19. Dynamics of Indian Ocean Slavery Revealed through Isotopic Data from the Colonial Era Cobern Street Burial Site, Cape Town, South Africa (1750-1827)

    PubMed Central

    Morris, Alan G.; Kars, Henk; Davies, Gareth R.

    2016-01-01

    The Dutch East India Company (VOC) intended the Cape of Good Hope to be a refreshment stop for ships travelling between the Netherlands and its eastern colonies. The indigenous Khoisan, however, did not constitute an adequate workforce, therefore the VOC imported slaves from East Africa, Madagascar and Asia to expand the workforce. Cape Town became a cosmopolitan settlement with different categories of people, amongst them a non-European underclass that consisted of slaves, exiles, convicts and free-blacks. This study integrated new strontium isotope data with carbon and nitrogen isotope results from an 18th-19th century burial ground at Cobern Street, Cape Town, to identify non-European forced migrants to the Cape. The aim of the study was to elucidate individual mobility patterns, the age at which the forced migration took place and, if possible, geographical provenance. Using three proxies, 87Sr/86Sr, δ13Cdentine and the presence of dental modifications, a majority (54.5%) of the individuals were found to be born non-locally. In addition, the 87Sr/86Sr data suggested that the non-locally born men came from more diverse geographic origins than the migrant women. Possible provenances were suggested for two individuals. These results contribute to an improved understanding of the dynamics of slave trading in the Indian Ocean world. PMID:27309532

  20. Dynamics of Indian Ocean Slavery Revealed through Isotopic Data from the Colonial Era Cobern Street Burial Site, Cape Town, South Africa (1750-1827).

    PubMed

    Kootker, Lisette M; Mbeki, Linda; Morris, Alan G; Kars, Henk; Davies, Gareth R

    2016-01-01

    The Dutch East India Company (VOC) intended the Cape of Good Hope to be a refreshment stop for ships travelling between the Netherlands and its eastern colonies. The indigenous Khoisan, however, did not constitute an adequate workforce, therefore the VOC imported slaves from East Africa, Madagascar and Asia to expand the workforce. Cape Town became a cosmopolitan settlement with different categories of people, amongst them a non-European underclass that consisted of slaves, exiles, convicts and free-blacks. This study integrated new strontium isotope data with carbon and nitrogen isotope results from an 18th-19th century burial ground at Cobern Street, Cape Town, to identify non-European forced migrants to the Cape. The aim of the study was to elucidate individual mobility patterns, the age at which the forced migration took place and, if possible, geographical provenance. Using three proxies, 87Sr/86Sr, δ13Cdentine and the presence of dental modifications, a majority (54.5%) of the individuals were found to be born non-locally. In addition, the 87Sr/86Sr data suggested that the non-locally born men came from more diverse geographic origins than the migrant women. Possible provenances were suggested for two individuals. These results contribute to an improved understanding of the dynamics of slave trading in the Indian Ocean world.

  1. Tropospheric ozone and its regional transport over Cape Town

    NASA Astrophysics Data System (ADS)

    Nzotungicimpaye, Claude-Michel; Abiodun, Babatunde J.; Steyn, Douw G.

    2014-04-01

    As part of efforts to understand the sources of air pollution in Cape Town, this study investigates the local variation of tropospheric ozone (O3) and identifies possible advection paths of O3 pollution from a remote source to Cape Town. Measurements of O3 and wind from three sites in the Cape Town area were analyzed to study the local variations of O3. At each site, the diurnal variation of O3 is found to be mainly driven by photochemical production while the seasonal variation of O3 is mostly driven by wind conditions. The highest concentration of O3 is observed at the remote site (Cape Point) while lowest O3 concentration is observed at the sub-urban site (Goodwood), where there are chemical sinks of O3 such as NOx. Atmospheric pollution over southern Africa was simulated to study the regional transport of O3. The simulations show that extreme O3 levels in Cape Town can be caused by air pollution transported from the industrial Highveld of South Africa, in the lower troposphere. Such extreme O3 pollution events over Cape Town are simulated to occur in January (14%), March (44%), April (28%) and September (14%). Lagrangian trajectories suggest four paths by which air parcels can be transported from the industrial Highveld to Cape Town: a north-easterly path which is the most frequent route, a tropical deviation route, a deviation along the south coastline and an oceanic deviation path which is the less frequent route. The major advection paths associated with poor air quality in Cape Town are the north-easterly route and the path along the south coastline of the country. Hence the study suggests that emissions in the industrial Highveld may contribute to O3 concentration in the Cape Town area.

  2. HIV risk and prevention among men who have sex with men (MSM) in peri-urban townships in Cape Town, South Africa.

    PubMed

    Jobson, Geoffrey; de Swardt, Glenn; Rebe, Kevin; Struthers, Helen; McIntyre, James

    2013-05-01

    Current guidelines on HIV prevention for MSM emphasise the need for 'combination prevention' based on context-specific understandings of HIV risk. MSM in South Africa are a population with a high risk of HIV infection, however there is little research available on the drivers of this risk. In the context of a focus on combination prevention, this paper argues that effective HIV prevention for MSM in South Africa requires an understanding of the factors at multiple 'distances' from individuals that contribute to HIV risk. Based on qualitative research with MSM in Cape Town, South Africa, we situate HIV risk using a socio-ecological framework and identify factors at distal, proximal, and personal, levels that contribute to MSM's high risk of HIV infection. By understanding the interactions and linkages between risk environments and the risk situations in which HIV is transmitted, HIV prevention programmes will be more effectively able to address the multiple drivers of HIV risk in this population.

  3. Characterisation of Clostridium difficile strains isolated from Groote Schuur Hospital, Cape Town, South Africa.

    PubMed

    Kullin, B; Brock, T; Rajabally, N; Anwar, F; Vedantam, G; Reid, S; Abratt, V

    2016-10-01

    The C. difficile infection rate in South Africa is concerning. Many strains previously isolated from diarrhetic patients at Groote Schuur Hospital were ribotype 017. This study further characterised these strains with respect to their clonal relationships, antibiotic susceptibility, toxin production and various attributes impacting on pathogen colonisation. Multilocus variable-number tandem-repeat analysis (MLVA) was used to characterise all C. difficile isolates. Antibiotic susceptibility was determined by E-test and PCR-based analysis of the ermB, gyrA and gyrB genes. Auto-aggregation of cells was measured in broth, and biofilm formation observed in 24-well plates. Toxins were measured using the Wampole C DIFF TOX A/B II kit. Most isolates belonged to the ribotype 017 group. Identical MLVA types occurred in different wards over time, and several patients were infected with identical strains. All isolates were susceptible to vancomycin and metronidazole, but some ribotype 017 isolates showed reduced metronidazole susceptibility (≥2 mg l(-1)). Sixty-nine percent of ribotype 017 isolates were resistant to moxifloxacin, and 94 % to erythromycin, compared to 0 % and 17 % resistance, respectively, in non-ribotype 017 isolates. The ermB gene and mutations in the gyrA and/or gyrB genes were linked to erythromycin and moxifloxacin resistance, respectively. Ribotype 017 isolates auto-aggregated more strongly than other isolates and produced lower levels of the TcdB toxin than a reference strain. Certain strains produced strong biofilms. Patient-to-patient transfer and unique infection events could cause the predominance of ribotype 017 strains in the cohort. Multi-drug resistant strains are a potential reservoir for future infections.

  4. Illegal yet developmentally normative: a descriptive analysis of young, urban adolescents’ dating and sexual behaviour in Cape Town, South Africa

    PubMed Central

    2013-01-01

    Background In South Africa, it is illegal for adolescents under age 16 years to engage in any sexual behaviour whether kissing, petting, or penetrative sex, regardless of consent. This cross-sectional study investigated the extent to which young adolescents engage in various sexual behaviours and the associations between dating status and sexual behaviours. Method Grade 8 adolescents (N = 474, ages 12–15 years, mean = 14.14 years) recruited from Cape Town schools completed surveys providing information about their sociodemographic backgrounds, dating experience, sexual behaviour, and substance use. Results Lower hierarchy sexual behaviours, such as kissing (71.4% of girls; 88.4% of boys), were more common than oral (3.9% of girls; 13.8% of boys), vaginal (9.3% of girls; 30.0% of boys), or anal (1.4% of girls; 10.5% of boys) sex. Currently dating girls and boys were more likely to engage in sexual behaviours including several risk behaviours in comparison to their currently non-dating counterparts. These risk behaviours included penetrative sex (21.1% of dating vs. 4.5% of non-dating girls; 49.4% of dating vs. 20.2% of non-dating boys), sex with co-occurring substance use (22.2% of dating vs. 0 non-dating girls; 32.1% of dating vs. 40% of non-dating boys), and no contraceptive use (26.1% of sexually experienced girls; 44.4% of sexually experienced boys). Among girls, there were significant associations between ever having penetrative sex and SES (OR = 2.592, p = 0.017) and never dating (OR = 0.330, p = 0.016). Among boys, there were significant associations between ever having penetrative sex and never dating (OR = 0.162, p = 0.008). Although the currently dating group of young adolescents appear to be a precocious group in terms of risk behaviour relative to the currently non-dating group, teenagers in both groups had experience in the full range of sexual behaviours. Conclusions Many young adolescents are engaging in a variety

  5. Opportunities for technology-based HIV prevention programming among high school students in Cape Town, South Africa

    PubMed Central

    Mwaba, Kelvin; Prescott, Tonya L.; Roman, Nicolette V.; Rooi, Bronwyn; Bull, Sheana

    2014-01-01

    One in three new cases of HIV in South Africa is among adolescents. Given that adolescents are particularly affected, scalable and cost-effective prevention programs are urgently needed. This study aims to identify opportunities to integrate technology into youth HIV prevention efforts. In 2012, 1,107 8th – 11th graders completed a paper-and-pencil survey. Respondents were enrolled in one of three public high schools in Langa. Because it is the closest black township to Cape Town, Langa has the highest density of people in the region. Eighty-nine percent of respondents have used text messaging (SMS) and 86% have gone online. If an HIV prevention program was offered online, 66% of youth would be somewhat or extremely likely to access it; slightly fewer (55%) felt the same about SMS-based programming. In comparison, 85% said they would be somewhat or extremely likely to access a school-based HIV prevention program. Interest in Internet-(60%) and SMS-based (54%) HIV prevention programming was similar for youth who had a self-appraised risk for HIV compared to youth who appraised their risk to be lower, as it was for youth who were tired of hearing messages about HIV prevention. Technology use is common – even among high school students who live in lower income communities. At the same time, these data reveal that it is not uncommon for youth to be tired of hearing messages about HIV prevention, and many of the typical topics key to HIV prevention have low interest levels among youth. HIV prevention researchers need to be mindful of the extent of existing programming that youth are exposed to. Technology-based programming may be especially amenable to meeting these requirements because of its novelty especially in developing countries, and because interactive functionality can be easily integrated into the program design. Given the preference for school- and Internet-based programming, it seems that a hybrid approach is likely feasible and acceptable. PMID:25022287

  6. Nine-locus Y-STR profiles of Afrikaner Caucasian and mixed ancestry populations from Cape Town, South Africa.

    PubMed

    Ehrenreich, Liezle; Benjeddou, Mongi; Davison, Sean; D'Amato, Maria; Leat, Neil

    2008-07-01

    Samples were collected from 108 Afrikaner males and 114 males of mixed ancestry. The term mixed ancestry is being used to denote a complex community which was established with contributions from Asians, Caucasians and Indigenous populations and constitutes a significant proportion of the Cape Town metropolitan population. Allele and haplotype frequencies were determined for nine Y-STR loci (DYS19, DYS389-I, DYS389-II, DYS390, DYS391, DYS392, DYS393 and the duplicated locus DYS385). Unique haplotypes were obtained for 64 Afrikaner males and 90 males of mixed ancestry. Both population groups shared the same most common haplotype.

  7. Impact of Sexual Trauma on HIV Care Engagement: Perspectives of Female Patients with Trauma Histories in Cape Town, South Africa.

    PubMed

    Watt, Melissa H; Dennis, Alexis C; Choi, Karmel W; Ciya, Nonceba; Joska, John A; Robertson, Corne; Sikkema, Kathleen J

    2016-11-19

    South African women have disproportionately high rates of both sexual trauma and HIV. To understand how sexual trauma impacts HIV care engagement, we conducted in-depth qualitative interviews with 15 HIV-infected women with sexual trauma histories, recruited from a public clinic in Cape Town. Interviews explored trauma narratives, coping behaviors and care engagement, and transcripts were analyzed using a constant comparison method. Participants reported multiple and complex traumas across their lifetimes. Sexual trauma hindered HIV care engagement, especially immediately following HIV diagnosis, and there were indications that sexual trauma may interfere with future care engagement, via traumatic stress symptoms including avoidance. Disclosure of sexual trauma was limited; no women had disclosed to an HIV provider. Routine screening for sexual trauma in HIV care settings may help to identify individuals at risk of poor care engagement. Efficacious treatments are needed to address the psychological and behavioral sequelae of trauma.

  8. The transport of atmospheric NOx and HNO3 over Cape Town

    NASA Astrophysics Data System (ADS)

    Abiodun, B. J.; Ojumu, A. M.; Jenner, S.; Ojumu, T. V.

    2014-01-01

    Cape Town, the most popular tourist city in Africa, usually experiences air pollution with unpleasant odour in winter. Previous studies have associated the pollution with local emission of pollutants within the city. The present study examines the transport of atmospheric pollutants (NOx and HNO3) over South Africa and shows how the transport of pollutants from the Mpumalanga Highveld, a major South African industrial area, may contribute to the pollution in Cape Town. The study analysed observation data (2001-2008) from the Cape Town air-quality network and simulation data (2001-2004) from a regional climate model (RegCM) over southern Africa. The simulation accounts for the influence of complex topography, atmospheric conditions, and atmospheric chemistry on emission and transport of pollutants over southern Africa. Flux budget analysis was used to examine whether Cape Town is a source or sink for NOx and HNO3 during the extreme pollution events. The results show that extreme pollution events in Cape Town are associated with the lower level (surface - 850 hPa) transport of NOx from the Mpumalanga Highveld to Cape Town, and with a tongue of high concentration of HNO3 that extends from the Mpumalanga Highveld to Cape Town along the south coast of South Africa. The prevailing atmospheric conditions during the extreme pollution events feature an upper-level (700 hPa) anticyclone over South Africa and a lower-level col over Cape Town. The anticyclone induces a strong subsidence motion, which prevents vertical mixing of the pollutants and caps high concentration of pollutants close to the surface as they are transported from the Mpumalanga Highveld toward Cape Town. The col accumulates the pollutants over the city. This study shows that Cape Town can be a sink for the NOx and HNO3 during extreme pollution events and suggests that the accumulation of pollutants transported from other areas (e.g. the Mpumalanga Highveld) may contribute to the air pollution in Cape Town.

  9. The Impact of Densification by Means of Informal Shacks in the Backyards of Low-Cost Houses on the Environment and Service Delivery in Cape Town, South Africa

    PubMed Central

    Govender, Thashlin; Barnes, Jo M.; Pieper, Clarissa H.

    2011-01-01

    This paper investigates the state-sponsored low cost housing provided to previously disadvantaged communities in the City of Cape Town. The strain imposed on municipal services by informal densification of unofficial backyard shacks was found to create unintended public health risks. Four subsidized low-cost housing communities were selected within the City of Cape Town in this cross-sectional survey. Data was obtained from 1080 persons with a response rate of 100%. Illegal electrical connections to backyard shacks that are made of flimsy materials posed increased fire risks. A high proportion of main house owners did not pay for water but sold water to backyard dwellers. The design of state-subsidised houses and the unplanned housing in the backyard added enormous pressure on the existing municipal infrastructure and the environment. Municipal water and sewerage systems and solid waste disposal cannot cope with the increased population density and poor sanitation behaviour of the inhabitants of these settlements. The low-cost housing program in South Africa requires improved management and prudent policies to cope with the densification of state-funded low-cost housing settlements. PMID:21695092

  10. A multi-level analysis of risk perception, poverty and sexual risk-taking among young people in Cape Town, South Africa.

    PubMed

    Tenkorang, Eric Y; Maticka-Tyndale, Eleanor; Rajulton, Fernando

    2011-03-01

    Various studies have underscored the relevance of community-level factors to sexual behavior and HIV/AIDS prevention efforts in Africa. However, there is a paucity of research and theorizing in this area compared to the preponderance of prevention models that focus solely on individual-level factors. Using data from the Cape Area Panel Survey and hierarchical linear models, this study examines the effects of a combination of individual-level factors and community-level poverty on sexual behaviors. Male and female respondents who perceived themselves to be at great risk of HIV infection were less likely to indulge in risky sexual behaviors. For females, race and community-level poverty were confounded such that race mediated the effects of community-level poverty. Results from this study indicate that multiple rationalities affect sexual behaviors in Cape Town, South Africa and that there is a need to consider both the social embeddedness of sexual behaviors and the rational components of decision making when designing HIV/AIDS prevention programs.

  11. “Coming to Town”: The Impact of Urbanicity, Cigarette Advertising, and Network Norms on the Smoking Attitudes of Black Women in Cape Town, South Africa

    PubMed Central

    Williams, Chyvette T.; Marks, Amy Seidel

    2008-01-01

    This study was conducted to examine the effect of urban living on smoking attitudes among black African women in South Africa. We examine how urbanicity affects attitudes toward smoking and how it moderates the relationship between both advertising exposure and network norms on black women’s smoking attitudes. Respondents were 975 black women currently living in Cape Town townships, some of which were raised in rural villages or small towns. Respondents completed a cross-sectional survey, which included data on smoking attitudes, norms, and exposure to cigarette advertising. Multiple linear regression analysis was performed with smoking attitudes as the response variable, and urbanicity, cigarette advertising exposure, and network smoking norms as primary explanatory variables. Interactions were tested to determine whether urbanicity modified the effect of advertising exposure and network norms on smoking attitudes. Independent effects of urbanicity, exposure to cigarette advertising, and greater smoking prevalence within women’s networks were associated with more favorable smoking attitudes. In addition, urbanicity moderated the relationship between network smoking norms and smoking attitudes, but not cigarette advertising exposure and smoking attitudes. Urbanicity, cigarette advertising, and networks play important roles in women’s attitudes toward smoking, and potentially, smoking behavior. Overall, our results suggest that strong and creative anti-smoking efforts are needed to combat the potential for a smoking epidemic among an increasingly urbanized population of black women in South Africa and similar emerging markets. Additional research is warranted. PMID:18563573

  12. The kick with the kite: an analysis of kite surfing related off shore rescue missions in Cape Town, South Africa

    PubMed Central

    Exadaktylos, A; Sclabas, G; Blake, I; Swemmer, K; McCormick, G; Erasmus, P; Muhm, M; Curatolo, M

    2005-01-01

    Methods: The observation period for this study started on October 1, 2003 and ended on May 1, 2004 and included 30 air rescue missions. Data and information were collected prospectively. Results: The Air Mercy Service in Cape Town Province responded to 30 requests for help. Twenty five accidents were attributed to inability to detach the kite from the harness. Injuries occurred in five incidents and included fractures of the upper arm, ribs and ankle, and lacerations and contusions to the head and neck. Two patients suffered from hypothermia and one experienced severe exhaustion. All surfers were rescued successfully and there were no fatal accidents. Discussion: The risk potential of this new sport is unclear. Dangerous situations can occur despite proper training and safety precautions due to unpredictable conditions and difficulties with equipment. Safety should be stressed. Surfers should sailing with a fellow kiter and should wear a life vest. More efforts must be taken to make this booming new water sport safer. PMID:15849279

  13. Predictors of poor adherence among people on antiretroviral treatment in Cape Town, South Africa: A case-control study

    PubMed Central

    Dewing, Sarah F; Mathews, Cathy; Lurie, Mark; Kagee, Ashraf; Padayachee, Trishanta; Lombard, Carl J

    2015-01-01

    A case-control study was conducted to describe the frequency with which structural- and individual-level barriers to adherence are experienced by people receiving antiretroviral (ARV) treatment and to determine predictors of nonadherence. Three hundred adherent and 300 non-adherent patients from 6 clinics in Cape Town completed the LifeWindows Information-Motivation-Behavioral Skills ART Adherence Questionnaire, the Substance Abuse and Mental Illness Symptoms Screener and the Structural Barriers to Clinic Attendance (SBCA) and Medication-taking (SBMT) scales. Overall, information-related barriers were reported most frequently followed by motivation and behaviour skill defects. Structural barriers were reported least frequently. Logistic regression analyses revealed that gender, behaviour skill deficit scores, SBCA scores and SBMT scores predicted non-adherence. Despite the experience of structural barriers being reported least frequently, structural barriers to medication-taking had the greatest impact on adherence (OR: 2.32, 95% CI: 1.73 to 3.12), followed by structural barriers to clinic attendance (OR: 2.06, 95% CI: 1.58 to 2.69) and behaviour skill deficits (OR: 1.34, 95% CI: 1.05 to 1.71). Our data indicate the need for policy directed at the creation of a health-enabling environment that would enhance the likelihood of adherence among antiretroviral therapy users. Specifically, patient empowerment strategies aimed at increasing treatment literacy and management skills should be strengthened. Attempts to reduce structural barriers to antiretroviral treatment adherence should be expanded to include increased access to mental health care services and nutrition support. PMID:25559444

  14. A social network typology and sexual risk-taking among men who have sex with men in Cape Town and Port Elizabeth, South Africa.

    PubMed

    de Voux, Alex; Baral, Stefan D; Bekker, Linda-Gail; Beyrer, Chris; Phaswana-Mafuya, Nancy; Siegler, Aaron J; Sullivan, Patrick S; Winskell, Kate; Stephenson, Rob

    2016-01-01

    Despite the high prevalence of HIV among men who have sex with men in South Africa, very little is known about their lived realities, including their social and sexual networks. Given the influence of social network structure on sexual risk behaviours, a better understanding of the social contexts of men who have sex with men is essential for informing the design of HIV programming and messaging. This study explored social network connectivity, an understudied network attribute, examining self-reported connectivity between friends, family and sex partners. Data were collected in Cape Town and Port Elizabeth, South Africa, from 78 men who have sex with men who participated in in-depth interviews that included a social network mapping component. Five social network types emerged from the content analysis of these social network maps based on the level of connectivity between family, friends and sex partners, and ranged from disconnected to densely connected networks. The ways in which participants reported sexual risk-taking differed across the five network types, revealing diversity in social network profiles. HIV programming and messaging for this population can greatly benefit from recognising the diversity in lived realities and social connections between men who have sex with men.

  15. Depression, alcohol use, and stigma in younger versus older HIV-infected pregnant women initiating antiretroviral therapy in Cape Town, South Africa.

    PubMed

    Wong, Marcia; Myer, Landon; Zerbe, Allison; Phillips, Tamsin; Petro, Greg; Mellins, Claude A; Remien, Robert H; Shiau, Stephanie; Brittain, Kirsty; Abrams, Elaine J

    2017-02-01

    HIV-infected pregnant women in sub-Saharan Africa are at risk for depression and alcohol abuse. Young women may be more vulnerable, but little is known about the psychosocial functioning of this population. We compared younger (18-24 years old) and older (≥25 years old) HIV-infected pregnant women initiating antiretroviral therapy (ART) in Cape Town, South Africa. Women were assessed on a range of psychosocial measures, including the Alcohol Use Disorders Identification Test and the Edinburgh Postnatal Depression Scale (EPDS). Among 625 women initiating ART, 16 % reported risky alcohol use and 21 % alcohol-related harm; these percentages were similar across age groups. When younger women were stratified by age, 37 % of 18-21 years old versus 20 % of 22-24 years old reported alcohol-related harm (p = 0.02). Overall, 11 % of women had EPDS scores suggesting probable depression, and 6 % reported self-harming thoughts. Younger women reported more depressive symptoms. Report of self-harming thoughts was 11 % in younger and 4 % in older women (p = 0.002). In multivariable analysis, age remained significantly associated with depressive symptoms and report of self-harming thoughts. Level of HIV-related stigma and report of intimate partner violence modified the association between age and depressive symptoms. Young HIV-infected pregnant women in South Africa were more likely to report depressive symptoms and self-harming thoughts compared to older women, and the youngest women reported the highest levels of alcohol-related harm. HIV-related stigma and intimate partner violence may be moderating factors. These findings have implications for maternal and infant health, underscoring the urgent need for effective targeted interventions in this vulnerable population.

  16. Child road traffic crash injuries at the Red Cross War Memorial Children's Hospital in Cape Town, South Africa in 1992, 2002 and 2012.

    PubMed

    Isaac, Kihurani N; Van Niekerk, Ashley; Van As, Arjan Bastiaan

    2015-01-01

    Road traffic crashes are a significant cause of the disease burden among children, with the highest mortality in low- and middle-income countries. This observational study explores such injuries in Cape Town, South Africa through an analysis of data for cases in 1992, 2002 and 2012 at the Red Cross War Memorial Children's Hospital, a referral paediatric hospital for children younger than 13 years. Descriptive and time trend analysis of demographic data as well as of the causes, severity and place of injury was conducted. Logistic regression and generalised linear models described factors influencing hospital admission. In the years 1992, 2002 and 2012, a total of 4690 patients presented with injuries sustained as a result of a road traffic crash. Nearly 50% (n = 2201) of them were between five and nine years of age, with 1.7 males for every female. Three-quarters of those who got injured were pedestrians while the second most commonly injured ones were unrestrained passengers. The majority had minor injuries (58%), but with notably higher proportions with moderate to severe injuries in the years 2002 and 2012. Forty per cent were admitted for inpatient treatment, with the highest proportion (50%) in 2002. Admission was related to mechanism and severity. The epidemiological factors assessed remain largely unchanged over the assessment points calling into question the impact of local safety strategies.

  17. An Approach to Developing a Prediction Model of Fertility Intent Among HIV-Positive Women and Men in Cape Town, South Africa: A Case Study.

    PubMed

    Bai, Dan; Leu, Cheng-Shiun; Mantell, Joanne E; Exner, Theresa M; Cooper, Diane; Hoffman, Susie; Kelvin, Elizabeth A; Myer, Landon; Constant, Debbie; Moodley, Jennifer

    2017-02-01

    As a 'case-study' to demonstrate an approach to establishing a fertility-intent prediction model, we used data collected from recently diagnosed HIV-positive women (N = 69) and men (N = 55) who reported inconsistent condom use and were enrolled in a sexual and reproductive health intervention in public sector HIV care clinics in Cape Town, South Africa. Three theoretically-driven prediction models showed reasonable sensitivity (0.70-1.00), specificity (0.66-0.94), and area under the receiver operating characteristic curve (0.79-0.89) for predicting fertility intent at the 6-month visit. A k-fold cross-validation approach was employed to reduce bias due to over-fitting of data in estimating sensitivity, specificity, and area under the curve. We discuss how the methods presented might be used in future studies to develop a clinical screening tool to identify HIV-positive individuals likely to have future fertility intent and who could therefore benefit from sexual and reproductive health counseling around fertility options.

  18. Is Younger Really Safer? A Qualitative Study of Perceived Risks and Benefits of Age-Disparate Relationships among Women in Cape Town, South Africa

    PubMed Central

    Beauclair, Roxanne; Delva, Wim

    2013-01-01

    Young women in age-asymmetric relationships may be at an elevated risk for acquisition of HIV, since relationships with older men are also correlated with other risk behaviors like less condom use. Qualitative studies have shown that women are motivated to participate in these relationships for money and emotional support. However, there is a paucity of research on women’s perceived risks of these relationships, particularly in South Africa. To this end, we conducted in-depth interviews with 23 women recruited from three urban communities in Cape Town. A thematic question guide was used to direct the interviews. Thematic content analysis was used to explore women’s perceived risks of age-disparate and non-age-disparate relationships, the benefits of dating older men, and risk perceptions that influence decisions around beginning or ending a relationship. A plurality of women thought that dating an older man does not bring any adverse consequences, although some thought that older men do not use condoms and may be involved in concurrent partnerships. Many women were less inclined to date same-age or younger men, because they were viewed as being disrespectful and abusive. This study points to the need for more awareness raising about the risks of age-disparate relationships. In addition to these initiatives, there is an urgent need to implement holistic approaches to relationship health, in order to curb intimate partner violence, improve gender equity and make non-age-disparate relationships more attractive. PMID:24260585

  19. Feasibility and Acceptability of Screening and Brief Interventions to Address Alcohol and Other Drug Use among Patients Presenting for Emergency Services in Cape Town, South Africa

    PubMed Central

    Myers, Bronwyn; Stein, Dan J.; Mtukushe, Bulelwa; Sorsdahl, Katherine

    2012-01-01

    Despite evidence from high income countries, it is not known whether screening and brief interventions (SBI) for alcohol and other drug (AOD) use are feasible to implement in low and middle income countries. This paper describes the feasibility and acceptability of a peer-led SBI for AOD-using patients presenting with injuries at emergency services in Cape Town, South Africa. Data were extracted from program records on the number of eligible patients screened and the number of program refusals. A questionnaire examined preliminary responses to the intervention for 30 patients who had completed the program and 10 emergency personnel. Peer counselors were also interviewed to identify barriers to implementation. Of the 1458 patients screened, 21% (305) met inclusion criteria, of which 74% (225) were enrolled in the intervention. Of the 30 patients interviewed, most (83%) found the program useful. Emergency personnel were supportive of the program but felt that visibility and reach could improve. Peer counselors identified the need for better integration of the program into emergency services and for additional training and support. In conclusion, with limited additional resources, peer-led SBIs for AOD use are feasible to conduct in South African emergency services and are acceptable to patients and emergency personnel. PMID:23198159

  20. Introduction: Highlights of HeartWeek 2013 at the Sixth World Congress of Paediatric Cardiology and Cardiac Surgery in Cape Town South Africa.

    PubMed

    Jacobs, Jeffrey Phillip

    2013-12-01

    This December issue of Cardiology in the Young represents the 11th annual publication generated from the two meetings that compose "HeartWeek in Florida". "HeartWeek in Florida", the joint collaborative project sponsored by the Cardiac Center at the Children's Hospital of Philadelphia, Pennsylvania, together with Johns Hopkins All Children's Heart Institute of Saint Petersburg, Florida, averages over 1000 attendees every year and is now recognised as one of the major planks of continuing medical and nursing education for those working in the fields of diagnosis and treatment of cardiac disease in the foetus, neonate, infant, child,and adult. "HeartWeek in Florida" combines the International Symposium on Congenital Heart Disease,organised by All Children's Hospital and Johns Hopkins Medicine and entering its 14th year, with the Annual Postgraduate Course in Pediatric Cardiovascular Disease, organised by The Children's Hospital of Philadelphia and entering its 17th year.This December, 2013 issue of Cardiology in the Young highlights the sessions from HeartWeek 2013 that were held at The Sixth World Congress of Paediatric Cardiology and Cardiac Surgery in Cape Town, South Africa. We would like to acknowledge the tremendous contributions made to medicine by John Brown, and therefore we dedicate this HeartWeek 2013 issue of Cardiology in the Young to him.

  1. Staff Attitudes and Services Provided by Community-Based Organizations for Alcohol and Other Drug Users in Cape Town, South Africa: Implications for Training and Education

    ERIC Educational Resources Information Center

    Pasche, Sonja; Myers, Bronwyn; Louw, Johann

    2008-01-01

    Aims: The aims of this study were: (i) to describe the nature of and the extent to which community-based organizations (CBOs) in Cape Town provide services to people who have alcohol and other drug (AOD) problems; (ii) to examine the relationship between CBOs' attitudes towards individuals with AOD problems and the types of services provided; and…

  2. Addiction and treatment experiences among active methamphetamine users recruited from a township community in Cape Town, South Africa: a mixed-methods study

    PubMed Central

    Meade, Christina S.; Towe, Sheri L.; Watt, Melissa H.; Lion, Ryan R.; Myers, Bronwyn; Skinner, Donald; Kimani, Stephen; Pieterse, Desiree

    2015-01-01

    Background Since 2000, there has been a dramatic increase in methamphetamine use in South Africa, but little is known about the experiences of out-of-treatment users. This mixed-methods study describes the substance use histories, addiction symptoms, and treatment experiences of a community-recruited sample of methamphetamine users in Cape Town. Methods Using respondent driven sampling, 360 methamphetamine users (44% female) completed structured clinical interviews to assess substance abuse and treatment history and computerized surveys to assess drug-related risks. A sub-sample of 30 participants completed in-depth interviews to qualitatively explore experiences with methamphetamine use and drug treatment. Results Participants had used methamphetamine for an average of 7.06 years (SD=3.64). They reported using methamphetamine on an average of 23.49 of the past 30 days (SD=8.90); 60% used daily. The majority (90%) met ICD-10 criteria for dependence, and many reported severe social, financial, and legal consequences. While only 10% had ever received drug treatment, 90% reported that they wanted treatment. In the qualitative interviews, participants reported multiple barriers to treatment, including beliefs that treatment is ineffective and relapse is inevitable in their social context. They also identified important motivators, including desires to be drug free and improve family functioning. Conclusion This study yields valuable information to more effectively respond to emerging methamphetamine epidemics in South Africa and other low- and middle-income countries. Interventions to increase uptake of evidence-based services must actively seek out drug users and build motivation for treatment, and offer continuing care services to prevent relapse. Community education campaigns are also needed. PMID:25977205

  3. Discourse, Differentiation, and Agency: Muslim Community Schools in Postapartheid Cape Town

    ERIC Educational Resources Information Center

    Fataar, Aslam

    2005-01-01

    This article explores the establishment of schools set up by Muslim communities in Cape Town, South Africa, after 1994. Twelve schools have been set up across the city: four primary schools, three high schools, four schools that have grades 1-12, and one school that has grades 1-3 and 8-10. They are registered with the Western Cape Education…

  4. Toxin A-negative toxin B-positive ribotype 017 Clostridium difficile is the dominant strain type in patients with diarrhoea attending tuberculosis hospitals in Cape Town, South Africa.

    PubMed

    Kullin, B; Wojno, J; Abratt, V; Reid, S J

    2017-01-01

    The molecular epidemiology of C. difficile strains causing disease in South Africa is currently unknown. Previously, multidrug resistant ribotype (RT)017 strains were those most commonly isolated from patients with diarrhoea attending Groote Schuur Hospital in Cape Town, South Africa. This larger study aimed to investigate the molecular epidemiology and antibiotic susceptibility profiles of C. difficile strains in the greater Cape Town and regional areas. C. difficile strains were isolated from patients with diarrhoea attending hospitals in the Western Cape region of South Africa that tested positive using the GeneXpert CDiff diagnostic test. Ribotyping and multilocus variable-number tandem-repeat analysis (MLVA) were used to type isolates, and their susceptibilities to several antibiotics were determined by gradient diffusion test strips. A total of 269 non-repeat C. difficile isolates were obtained. A large proportion of isolates (64.3 %) belonged to the RT017 group, many of which were clonally related when investigated by MLVA. RT017 strains were particularly prevalent in patients attending specialist tuberculosis (TB) hospitals. The majority of RT017 isolates were co-resistant to moxifloxacin and rifampicin, two antibiotics which are used intensively during anti-TB therapy. Non-RT017 strains were generally susceptible to both antibiotics. Resistance to erythromycin was observed for both groups of strains. RT017 C. difficile strains are the most commonly isolated strains from patients attending healthcare facilities in the greater Cape Town and regional areas. The presence of multidrug resistant RT017 strains in patients with diarrhoea attending local TB hospitals reflects a potential reservoir for future infections.

  5. Suicidal ideation and behaviour among persons seeking HIV testing in peri-urban areas of Cape Town, South Africa: a lost opportunity for suicide prevention.

    PubMed

    Bantjes, Jason; Kagee, Ashraf; Saal, Wylene

    2016-12-28

    Suicidal ideation and behaviour (SIB) are among the psychiatric sequela of HIV/AIDS. Few studies have however examined the prevalence and correlates of SIB among persons seeking HIV testing. We set out to document the prevalence and correlates of SIB among people seeking HIV testing in peri-urban areas of Cape Town, South Africa (SA). A cross-sectional research design was used to recruit a sample (n = 500) of individuals seeking HIV testing. Self-report measures were used to assess two-week prevalence of SIB as well as life-time prevalence of suicide attempt. A structured clinical interview was used to assess common mental disorders (CMDs). Regression analysis was used to determine if CMD and socio-demographic variables predicted suicidal ideation. The mean age of the sample was 36 years, 51.6% were female and 46.6% were unemployed. The two-week prevalence of suicidal ideation was 24.27% while the two-week prevalence of suicide attempt and suicide plans was 2.8%. Suicidal ideation was not associated with age, gender, employment status, family income or household food insecurity. CMDs were significantly associated with suicidal ideation; individuals with depressive disorders were approximately 5.5 times more likely to report suicidal ideation, while those with generalised anxiety disorder, trauma-related disorders and alcohol use disorder were approximately 7, 4.7 and 2.8 times more likely to report suicidal ideation, respectively. Results suggest that persons seeking HIV testing may be a well-delineated group of persons at risk of suicide in this region of SA. Contact with the health care system during HIV testing provides an opportunity for targeted suicide prevention interventions in what appears to be a high risk group.

  6. Rapid assessment of drug use and sexual HIV risk patterns among vulnerable drug-using populations in Cape Town, Durban and Pretoria, South Africa.

    PubMed

    Parry, Charles; Petersen, Petal; Carney, Tara; Dewing, Sarah; Needle, Richard

    2008-09-01

    This exploratory study examines the links between drug use and high-risk sexual practices and HIV in vulnerable drug-using populations in South Africa, including commercial sex workers (CSWs), men who have sex with men (MSM), injecting drug users (IDUs) and non-injecting drug users who are not CSWs or MSM (NIDUs). A rapid assessment ethnographic study was undertaken using observation, mapping, key informant interviews and focus groups in known 'hotspots' for drug use and sexual risk in Cape Town, Durban and Pretoria. Key informant (KI) and focus group interviews involved drug users and service providers. Purposeful snowball sampling and street intercepts were used to recruit drug users. Outcome measures included drug-related sexual HIV risk behaviour, and risk behaviour related to injection drug use, as well as issues related to service use. HIV testing of drug-using KIs was conducted using the SmartCheck Rapid HIV-1 Antibody Test. Non-injection drug use (mainly cannabis, methaqualone, crack cocaine and crystal methamphetamine) and injection drug use (mainly heroin) was occurring in these cities. Drug users report selling sex for money to buy drugs, and CSWs used drugs before, during and after sex. Most (70%) of the drug-using KIs offered HIV testing accepted and 28% were positive, with rates highest among CSWs and MSM. IDUs reported engaging in needle sharing and needle disposal practices that put them and others at risk for contracting HIV. There was a widespread lack of awareness about where to access HIV treatment and preventive services, and numerous barriers to accessing appropriate HIV and drug-intervention services were reported. Multiple risk behaviours of vulnerable populations and lack of access to HIV prevention services could accelerate the diffusion of HIV. Targeted interventions could play an important role in limiting the spread of HIV in and through these under-reached and vulnerable populations.

  7. Exploring repeat HIV testing among men who have sex with men in Cape Town and Port Elizabeth, South Africa

    PubMed Central

    Siegler, Aaron J.; Sullivan, Patrick S.; de Voux, Alex; Phaswana-Mafuya, Nancy; Bekker, Linda-Gail; Baral, Stefan D.; Winskell, Kate; Kose, Zamakayise; Wirtz, Andrea L.; Brown, Ben; Stephenson, Rob

    2014-01-01

    Despite the high prevalence of HIV among men who have sex with men (MSM) – and the general adult population – in South Africa, there is little data regarding the extent to which MSM seek repeat testing for HIV. This study explores reported histories of HIV testing, and the rationales for test seeking, among a purposive sample of 34 MSM in two urban areas of South Africa. MSM participated in activity-based in-depth interviews that included a timeline element to facilitate discussion. Repeat HIV testing was limited among participants, with three-quarters having two or fewer lifetime HIV tests, and over one-third of the sample having one or fewer lifetime tests. For most repeat-testers, the time gap between their HIV tests was greater than the one-year interval recommended by national guidelines. Analysis of the reasons for seeking HIV testing revealed several types of rationale. The reasons for a first HIV test were frequently one-time occurrences, such as a requirement prior to circumcision, or were motivations likely satisfied by a single HIV test. For MSM who reported repeat testing at more timely intervals, the most common rationale was seeking test results with a sex partner. Results indicate a need to shift HIV test promotion messaging and programming for MSM in South Africa away from a one-off model to one that frames HIV testing as a repeated, routine health maintenance behavior. PMID:25134823

  8. Exploring repeat HIV testing among men who have sex with men in Cape Town and Port Elizabeth, South Africa.

    PubMed

    Siegler, Aaron J; Sullivan, Patrick S; de Voux, Alex; Phaswana-Mafuya, Nancy; Bekker, Linda-Gail; Baral, Stefan D; Winskell, Kate; Kose, Zamakayise; Wirtz, Andrea L; Brown, Ben; Stephenson, Rob

    2015-01-01

    Despite the high prevalence of HIV among men who have sex with men (MSM) - and the general adult population - in South Africa, there is little data regarding the extent to which MSM seek repeat testing for HIV. This study explores reported histories of HIV testing, and the rationales for test seeking, among a purposive sample of 34 MSM in two urban areas of South Africa. MSM participated in activity-based in-depth interviews that included a timeline element to facilitate discussion. Repeat HIV testing was limited among participants, with three-quarters having two or fewer lifetime HIV tests, and over one-third of the sample having one or fewer lifetime tests. For most repeat testers, the time gap between their HIV tests was greater than the one-year interval recommended by national guidelines. Analysis of the reasons for seeking HIV testing revealed several types of rationale. The reasons for a first HIV test were frequently one-time occurrences, such as a requirement prior to circumcision, or motivations likely satisfied by a single HIV test. For MSM who reported repeat testing at more timely intervals, the most common rationale was seeking test results with a sex partner. Results indicate a need to shift HIV test promotion messaging and programming for MSM in South Africa away from a one-off model to one that frames HIV testing as a repeated, routine health maintenance behavior.

  9. Tuberculosis in Cape Town: an age-structured transmission model

    PubMed Central

    Blaser, Nello; Zahnd, Cindy; Hermans, Sabine; Salazar-Vizcaya, Luisa; Estill, Janne; Morrow, Carl; Egger, Matthias; Keiser, Olivia; Wood, Robin

    2015-01-01

    Background Tuberculosis (TB) is the leading cause of death in South Africa. The burden of disease varies by age, with peaks in TB notification rates in the HIV-negative population at ages 0-5, 20-24 and 45-49 years. There is little variation between age groups in the rates in the HIV-positive population. The drivers of this age pattern remain unknown. Methods We developed an age-structured simulation model of Mycobacterium tuberculosis (Mtb) transmission in Cape Town, South Africa. We considered five states of TB progression: susceptible, infected (latent TB), active TB, treated TB and treatment default. Latently infected individuals could be re-infected; a previous Mtb infection slowed progression to active disease. We further considered three states of HIV progression: HIV negative, HIV positive, on antiretroviral therapy. To parameterize the model, we analysed treatment outcomes from the Cape Town electronic TB register, social mixing patterns from a Cape Town community and literature estimates for other parameters. To investigate the main drivers behind the age patterns, we conducted sensitivity analyses on all parameters related to the age structure. Results The model replicated the age patterns in HIV-negative TB notification rates of Cape Town in 2009. Simulated TB notification rate in HIV-negative patients was 1,000/100,000 person-years (pyrs) in children aged < 5 years and decreased to 51/100,000 in children 5-15 years. The peak in early adulthood occurred at 25-29 years (463/100,000 pyrs). After a subsequent decline, simulated TB notification rates gradually increased from the age of 30 years. Sensitivity analyses showed that the dip after the early adult peak was due to the protective effect of latent TB and that retreatment TB was mainly responsible for the rise in TB notification rates from the age of 30 years. Conclusion The protective effect of a first latent infection on subsequent infections and the faster progression in previously treated patients

  10. Adherence barriers and facilitators for cervical screening amongst currently disadvantaged women in the greater Cape Town region of South Africa

    PubMed Central

    De Abreu, Chantelle; Horsfall, Hannah

    2013-01-01

    Abstract Background In South Africa cervical cancer is the second most commonly occurring cancer amongst women, and black African women have the highest risk of developing this disease. Unfortunately, the majority of South African women do not adhere to recommended regular cervical screening. Objectives The purpose of this research was to explore the perceptions, experiences and knowledge regarding cervical screening of disadvantaged women in two informal settlements in South African urban areas. Method The Health Belief Model (HBM) provided a theoretical framework for this study. Four focus groups (n = 21) were conducted, using questions derived from the HBM, and thematic analysis was used to analyse the data. The ages of the women who participated ranged from 21 to 53 years. Results The analysis revealed lack of knowledge about screening as a key structural barrier to treatment. Other structural barriers were: time, age at which free screening is available, and health education. The psychosocial barriers that were identified included: fear of the screening procedure and of the stigmatisation in attending screening. The presence of physical symptoms, the perception that screening provides symptom relief, HIV status, and the desire to know one's physical health status were identified as facilitators of cervical screening adherence. Conclusion This knowledge has the potential to inform healthcare policy and services in South Africa. As globalisation persists and individuals continue to immigrate or seek refugee status in foreign countries, increased understanding and knowledge is required for successful acculturation and integration. Developed countries may therefore also benefit from research findings in developing countries.

  11. "Us" and "Them": The Discursive Construction of "the Other" in Greenmarket Square, Cape Town

    ERIC Educational Resources Information Center

    Dyers, Charlyn; Wankah, Foncha John

    2012-01-01

    This paper is based on research done on intercultural communication at Greenmarket Square in the heart of Cape Town, South Africa. The Square is well known as a market for informal traders (mainly from other parts of Africa), local people and tourists from all over the world. Using originally collected discursive evidence from market traders, the…

  12. From Biloxi to Cape Town: curricular integration of service learning.

    PubMed

    Richards, Elizabeth A Libby; Novak, Julie Cowan

    2010-01-01

    Team Reach Out started as a student-initiated service-learning project with the goal of providing on-going assistance to the victims of Hurricane Katrina. Four years after Hurricane Katrina, Team Reach Out refocused efforts to Cape Town, South Africa, where 4 senior nursing students and 1 science student integrated their leadership skills with the application of public health knowledge, compassion, and concern to work in partnership with several international health agencies. This article reviews the service-learning framework, course planning, and implementation of a recent service-learning project.

  13. Fifty years of porphyria at the University of Cape Town.

    PubMed

    Meissner, Peter N; Corrigall, Anne V; Hift, Richard J

    2012-03-02

    The porphyrias are a group of disorders resulting from defective haem biosynthesis. One form, variegate porphyria, is common in South Africa as a result of a founder effect. Over the past 50 years, the University of Cape Town Faculty of Health Sciences has built and maintained an international reputation for excellence in the field of porphyria. The porphyria group is respected for its research and for its accumulated experience in the management of these disorders. Equally important has been the comprehensive and holistic care offered to patients with porphyria, and to their families.

  14. A mixed-method analysis of free-time involvement and motivation among adolescents in Cape Town, South Africa

    PubMed Central

    Palen, Lori-Ann; Caldwell, Linda L.; Smith, Edward A.; Gleeson, Sarah L.; Patrick, Megan E.

    2012-01-01

    Using focus group (N = 114) and survey (N = 946) data, this study employed Self-Determination Theory (SDT) as an organizing framework to examine free-time use and motivation among predominantly mixed-race adolescents from one area in South Africa. Adolescents reported participating in a broad range of activities, with socializing, media use, sports, risk behaviour, and performing arts being most frequently mentioned. All of the motivation types proposed by SDT were spontaneously mentioned by focus group participants. Free time was most strongly characterized by intrinsic motivations, such as competence, relatedness, and positive affect. Activities were also seen as a way to achieve outside goals. With few exceptions, multiple motivations were identified for the same activities, and specific motivations were reported across multiple activity types. The findings suggest that positive motivational experiences were not limited to a specific subset of activities. However, future longitudinal research on participation, motivation, and outcomes is needed to determine the developmental implications of different forms of free-time motivation. PMID:23055820

  15. Acceptability and challenges of rapid ART initiation among pregnant women in a pilot programme, Cape Town, South Africa.

    PubMed

    Black, Samantha; Zulliger, Rose; Marcus, Rebecca; Mark, Daniella; Myer, Landon; Bekker, Linda-Gail

    2014-01-01

    Maternal antiretroviral therapy (ART) is a critical intervention in the prevention-of-mother-to child transmission (PMTCT) of HIV. In South Africa, many HIV-infected pregnant women commence ART late in pregnancy, and as a result, the duration of ART prior to delivery is often insufficient to prevent vertical transmission. To address this, we designed an intervention for the rapid initiation of ART in pregnancy (RAP), where patient's ART preparation occurred during rather than before treatment commencement. Here we report on the acceptability and the challenges of the RAP programme. We conducted 7 key informant and 27 semi-structured interviews with RAP participants. Participants were purposefully selected based on ART-eligibility and stage in the pregnancy to post-partum continuum. Interviews were conducted in participants' home language by trained fieldworkers, with key informant interviews conducted by the study investigators. The data were analysed using a framework analysis approach. Rapid initiation in pregnancy was acceptable to the majority of programme participants and protection of the woman's unborn child was the primary motivation for starting treatment. The key barrier was the limited time to accept the dual challenges of being diagnosed HIV-positive and eligible for life-long ART. Truncated time also limited the opportunity for disclosure to others. Despite these and other barriers, most women found the benefits of rapid ART commencement outweighed the challenges, with 91% of women initiated onto ART starting the same day treatment eligibility was determined. Many participants and key informants identified the importance of counseling and the need to make an informed, independent choice on the timing of ART initiation, based on individual circumstances. Acceptance of ART-eligibility improved with time on the programme, however, as women's principal reason for initiating ART was protection of the unborn child, monitoring and supporting adherence during

  16. Does identity shape leadership and management practice? Experiences of PHC facility managers in Cape Town, South Africa.

    PubMed

    Daire, Judith; Gilson, Lucy

    2014-09-01

    In South Africa, as elsewhere, Primary Health Care (PHC) facilities are managed by professional nurses. Little is known about the dimensions and challenges of their job, or what influences their managerial practice. Drawing on leadership and organizational theory, this study explored what the job of being a PHC manager entails, and what factors influence their managerial practice. We specifically considered whether the appointment of professional nurses as facility managers leads to an identity transition, from nurse to manager. The overall intention was to generate ideas about how to support leadership development among PHC facility managers. Adopting case study methodology, the primary researcher facilitated in-depth discussions (about their personal history and managerial experiences) with eight participating facility managers from one geographical area. Other data were collected through in-depth interviews with key informants, document review and researcher field notes/journaling. Analysis involved data triangulation, respondent and peer review and cross-case analysis. The experiences show that the PHC facility manager's job is dominated by a range of tasks and procedures focused on clinical service management, but is expected to encompass action to address the population and public health needs of the surrounding community. Managing with and through others, and in a complex system, requiring self-management, are critical aspects of the job. A range of personal, professional and contextual factors influence managerial practice, including professional identity. The current largely facility-focused management practice reflects the strong nursing identity of managers and broader organizational influences. However, three of the eight managers appear to self-identify an emerging leadership identity and demonstrate related managerial practices. Nonetheless, there is currently limited support for an identity transition towards leadership in this context. Better

  17. Does identity shape leadership and management practice? Experiences of PHC facility managers in Cape Town, South Africa

    PubMed Central

    Daire, Judith; Gilson, Lucy

    2014-01-01

    In South Africa, as elsewhere, Primary Health Care (PHC) facilities are managed by professional nurses. Little is known about the dimensions and challenges of their job, or what influences their managerial practice. Drawing on leadership and organizational theory, this study explored what the job of being a PHC manager entails, and what factors influence their managerial practice. We specifically considered whether the appointment of professional nurses as facility managers leads to an identity transition, from nurse to manager. The overall intention was to generate ideas about how to support leadership development among PHC facility managers. Adopting case study methodology, the primary researcher facilitated in-depth discussions (about their personal history and managerial experiences) with eight participating facility managers from one geographical area. Other data were collected through in-depth interviews with key informants, document review and researcher field notes/journaling. Analysis involved data triangulation, respondent and peer review and cross-case analysis. The experiences show that the PHC facility manager’s job is dominated by a range of tasks and procedures focused on clinical service management, but is expected to encompass action to address the population and public health needs of the surrounding community. Managing with and through others, and in a complex system, requiring self-management, are critical aspects of the job. A range of personal, professional and contextual factors influence managerial practice, including professional identity. The current largely facility-focused management practice reflects the strong nursing identity of managers and broader organizational influences. However, three of the eight managers appear to self-identify an emerging leadership identity and demonstrate related managerial practices. Nonetheless, there is currently limited support for an identity transition towards leadership in this context. Better

  18. Sexual risk behavior, alcohol use, and social media use among secondary school students in informal settlements in Cape Town and Port Elizabeth, South Africa.

    PubMed

    Kaufman, Z A; Braunschweig, E N; Feeney, J; Dringus, S; Weiss, H; Delany-Moretlwe, S; Ross, D A

    2014-09-01

    South Africa's HIV prevalence among young people remains among the highest in the world. A cross-sectional study was carried out in 2012 to estimate prevalences of sexual risk behavior and hazardous alcohol use (HAU) (via the Alcohol Use Disorder Identification Test) as well as to investigate potential associations between these outcomes and social media use. In all, 4485 students (mean age 15.66 years, SD 1.39) at 46 secondary schools in informal settlements in Cape Town and Port Elizabeth completed mobile-phone-assisted, self-administered baseline questionnaires within a cluster-randomized trial. In all, 312 females (12.5 %) and 468 males (23.5 %) screened positive for HAU (AOR = 1.98, 95 % CI 1.69-2.34). 730 males (39.9 %) and 268 females (11.8 %) reported having had two or more partners in the last year (AOR = 3.46, 95 % CI 2.87-4.16). Among females, having a Facebook account was associated with reported multiple partnerships in the last year (AOR = 1.81, 95 % CI 1.19-2.74), age-disparate sex in the last year (AOR = 1.96, 95 % CI 1.16-3.32) and HAU (AOR = 1.97, 95 % CI 1.41-2.74). Using Mxit-a popular mobile instant messaging application-was associated with higher odds of reported multiple partnerships in the last year among both males (AOR = 1.70, 95 % CI 1.35-2.14) and females (AOR = 1.45, 95 % CI 1.07-1.96) and with HAU among both males (AOR = 1.47, 95 % CI 1.14-1.90) and females (AOR = 1.50, 95 % CI 1.18-1.90). Further longitudinal and qualitative research should explore in more depth the observed links between social media and risk behavior.

  19. Heat effects of ambient apparent temperature on all-cause mortality in Cape Town, Durban and Johannesburg, South Africa: 2006-2010.

    PubMed

    Wichmann, Janine

    2017-06-01

    Due to climate change, an increase of 3-4°C in ambient temperature is projected along the South African coast and 6-7°C inland during the next 80years. The objective of this study was to investigate the association between daily ambient apparent temperature (Tapp) and daily all-cause non-accidental mortality (hereafter mortality) in Cape Town, Durban and Johannesburg during a 5-year study period (2006-2010). Susceptibility by sex and age groups (<15years, 15-64years and ≥65years) was also investigated. The associations were investigated with the time-stratified case-crossover epidemiological design. Models were controlled for PM10, public holidays and influenza epidemics. City-specific Tapp thresholds were determined using quasi-Poisson generalised additive models. The pooled estimates by sex and age groups were determined in meta-analyses. The city-specific Tapp thresholds were 18.6°C, 24.8°C and 18.7°C, respectively for Cape Town, Durban and Johannesburg. A 3.3%, 2.6% and 2.8% increase in mortality per IQR increase in Tapp (lag0-1) was observed in Cape Town, Durban and Johannesburg, respectively above the city-specific thresholds. The elderly were more at risk in Cape Town and Johannesburg. No difference in risk was observed for males and females in the three cities. In the meta-analysis an overall significant increase of 0.9% in mortality per 1°C increase in Tapp (lag0-1) was observed for all age groups combined in the three cities. For the ≥65year group a significant increase of 2.1% in mortality was observed. In conclusion, the risks for all age groups combined and the elderly are similar to those reported in studies from developed and developing countries. The results can be used in present-day early warning systems and in risk assessments to estimate the impact of increased Tapp in the country due to climate change. Future research should investigate the association between Tapp and cause-specific mortality and also morbidity.

  20. Outcomes of a community-based HIV-prevention pilot programme for township men who have sex with men in Cape Town, South Africa

    PubMed Central

    Batist, Elizabeth; Brown, Benjamin; Scheibe, Andrew; Baral, Stefan D; Bekker, Linda-Gail

    2013-01-01

    Introduction Men who have sex with men (MSM) in Cape Town's townships remain in need of targeted HIV-prevention services. In 2012, a pilot community-based HIV-prevention programme was implemented that aimed to reach MSM in five Cape Town townships, disseminate HIV-prevention information and supplies, and promote the use of condoms and HIV services. Methods Convenience sampling was used to recruit self-identified MSM who were 18 years old or older in five Cape Town townships. The six-month pilot programme trained five community leaders who, along with staff, provided HIV-prevention information and supplies to MSM through small-group meetings, community-based social activities and inter-community events. After the completion of the pilot programme, in-depth interviews and focus group discussions (FGDs) were conducted with a subset of conveniently sampled participants and with each of the community leaders. Qualitative data were then analyzed thematically. Results Overall, 98 mostly gay-identified black MSM consented to participate, 57 community-based activities were facilitated and 9 inter-community events were conducted. Following their enrolment, 60% (59/98) of participants attended at least one pilot activity. Of those participants, 47% (28/59) attended at least half of the scheduled activities. A total of 36 participants took part in FGDs, and five in-depth interviews were completed with community leaders. Participants reported gaining access to MSM-specific HIV-prevention information, condoms and water-based lubricant through the small-group meetings. Some participants described how their feelings of loneliness, social isolation, self-esteem and self-efficacy were improved after taking part. Conclusions The social activities and group meetings were viable strategies for disseminating HIV-prevention information, condoms and water-based lubricant to MSM in this setting. Many MSM were also able to receive social support, reduce social isolation and improve their

  1. Hepatitis E virus: Western Cape, South Africa

    PubMed Central

    Madden, Richie G; Wallace, Sebastian; Sonderup, Mark; Korsman, Stephen; Chivese, Tawanda; Gavine, Bronwyn; Edem, Aniefiok; Govender, Roxy; English, Nathan; Kaiyamo, Christy; Lutchman, Odelia; van der Eijk, Annemiek A; Pas, Suzan D; Webb, Glynn W; Palmer, Joanne; Goddard, Elizabeth; Wasserman, Sean; Dalton, Harry R; Spearman, C Wendy

    2016-01-01

    AIM To conduct a prospective assessment of anti-hepatitis E virus (HEV) IgG seroprevalence in the Western Cape Province of South Africa in conjunction with evaluating risk factors for exposure. METHODS Consenting participants attending clinics and wards of Groote Schuur, Red Cross Children’s Hospital and their affiliated teaching hospitals in Cape Town, South Africa, were sampled. Healthy adults attending blood donor clinics were also recruited. Patients with known liver disease were excluded and all major ethnic/race groups were included to broadly represent local demographics. Relevant demographic data was captured at the time of sampling using an interviewer-administered confidential questionnaire. Human immunodeficiency virus (HIV) status was self-disclosed. HEV IgG testing was performed using the Wantai® assay. RESULTS HEV is endemic in the region with a seroprevalence of 27.9% (n = 324/1161) 95%CI: 25.3%-30.5% (21.9% when age-adjusted) with no significant differences between ethnic groups or HIV status. Seroprevalence in children is low but rapidly increases in early adulthood. With univariate analysis, age ≥ 30 years old, pork and bacon/ham consumption suggested risk. In the multivariate analysis, the highest risk factor for HEV IgG seropositivity (OR = 7.679, 95%CI: 5.38-10.96, P < 0.001) was being 30 years or older followed by pork consumption (OR = 2.052, 95%CI: 1.39-3.03, P < 0.001). A recent clinical case demonstrates that HEV genotype 3 may be currently circulating in the Western Cape. CONCLUSION Hepatitis E seroprevalence was considerably higher than previously thought suggesting that hepatitis E warrants consideration in any patient presenting with an unexplained hepatitis in the Western Cape, irrespective of travel history, age or ethnicity. PMID:27956810

  2. The Cape Town Statement on Characteristic Elements of a Lifelong Learning Higher Education Institution.

    ERIC Educational Resources Information Center

    International Journal of Lifelong Education, 2001

    2001-01-01

    This statement from the Conference on Lifelong Learning, Higher Education, and Active Citizenship (Cape Town, South Africa, October 2000) outlines six elements necessary to support lifelong learning in higher education institutions: (1) overarching regulatory, financial, and sociocultural frameworks; (2) strategic partners; (3) research; (4)…

  3. An Islamic University in Cape Town Grows from Roots in East Asia

    ERIC Educational Resources Information Center

    Lindow, Megan

    2007-01-01

    This article features the International Peace University South Africa in Cape Town. The university, which was established in 2004, resulted from the merger of two local "madrassas", or religious colleges, yet seeks to prepare its students for success in the secular world. Its Islamic roots are not in the Middle East, but in East Asia.…

  4. Azanian: Zandi Zwane Talks about Being Black, Lesbian, and Activist in Cape Town

    ERIC Educational Resources Information Center

    Vaught, Sabina

    2006-01-01

    Zandi Zwane is a media activist and educator living and working in Cape Town, South Africa. She identifies herself as Black, Nguni, lesbian, female--and "Azanian: a term that was created in pre-colonial times by the members of the Black Consciousness Movement in resistance to colonialism." In this interview, Zwane explores the…

  5. Anaesthesia - what has the University of Cape Town contributed?

    PubMed

    Thomas, Jennifer M; Reed, Anthony R; Reed, Anthony R; Gordon, Peter C; Gordon, Peter C; Dyer, Robert A; Dyer, Robert A; James, Michael F; James, Michael F

    2012-03-23

    From humble beginnings, the University of Cape Town's Department of Anaesthesia has played a major role in the development of anaesthesia as a speciality, in South Africa and internationally. We highlight these contributions in clinical service, teaching and research, with particular emphasis on the department's leading role in the evolution of anaesthetic safety in adults and children: from the development of the treatment of malignant hyperthermia, to unique studies in mortality associated with anaesthesia, and modern contributions to improved drug safety. Innovations in anaesthetic techniques have contributed to significant surgical developments, including the first heart transplant. Furthermore, our research has contributed to major advances in obstetric and endocrine anaesthesia, and training in the department is recognised as being among the best in the world.

  6. Emtonjeni-A Structural Intervention to Integrate Sexual and Reproductive Health into Public Sector HIV Care in Cape Town, South Africa: Results of a Phase II Study.

    PubMed

    Mantell, J E; Cooper, D; Exner, T M; Moodley, J; Hoffman, S; Myer, L; Leu, C-S; Bai, D; Kelvin, E A; Jennings, K; Stein, Z A; Constant, D; Zweigenthal, V; Cishe, N; Nywagi, N

    2017-03-01

    Integration of sexual and reproductive health within HIV care services is a promising strategy for increasing access to family planning and STI services and reducing unwanted pregnancies, perinatal HIV transmission and maternal and infant mortality among people living with HIV and their partners. We conducted a Phase II randomized futility trial of a multi-level intervention to increase adherence to safer sex guidelines among those wishing to avoid pregnancy and adherence to safer conception guidelines among those seeking conception in newly-diagnosed HIV-positive persons in four public-sector HIV clinics in Cape Town. Clinics were pair-matched and the two clinics within each pair were randomized to either a three-session provider-delivered enhanced intervention (EI) (onsite contraceptive services and brief milieu intervention for staff) or standard-of-care (SOC) provider-delivered intervention. The futility analysis showed that we cannot rule out the possibility that the EI intervention has a 10 % point or greater success rate in improving adherence to safer sex/safer conception guidelines than does SOC (p = 0.573), indicating that the intervention holds merit, and a larger-scale confirmatory study showing whether the EI is superior to SOC has merit.

  7. 'When you visit a man you should prepare yourself': male community care worker approaches to working with men living with HIV in Cape Town, South Africa.

    PubMed

    Gittings, Lesley

    2016-08-01

    Caring is typically constructed as a feminised practice, resulting in women shouldering the burden of care-related work. Health-seeking behaviours are also constructed as feminine and men have poorer health outcomes globally. Employing men as carers may not only improve the health of the men they assist but also be transformative with regards to gendered constructions of caring. Using semi-structured interviews and observational home visits, this study explored the techniques that community care workers employ when working with male clients. The empirical analysis draws on the perspectives of eight care workers and three of their male clients from the Cape Town area. Interviews reveal how care workers and clients perform and negotiate masculinities as they navigate hegemonic masculine norms that require men to act tough, suppress emotions and deny weakness and sickness. Both parties bump up against ideals of what it means to be a man as they strive to provide care and receive support. Community care workers avoid rupturing client performances of hegemonic masculinities which inhibit confession and support. To do this, they use techniques of indirectly broaching sensitive subjects, acting in a friendly way and being clear about the intention of their work.

  8. E-Powering the People: South Africa's Smart Cape Access Project

    ERIC Educational Resources Information Center

    Valentine, Susan

    2004-01-01

    This document examines the launch of the Smart Cape Access Project in Cape Town, South Africa. In a city where more than 80 percent of the citizens do not have access to computers and fewer still can access the Internet, public officials set out to build a "smart city," where "informed people could connect to the world and to each other by the…

  9. Polybrominated diphenyl ethers (PBDEs) and 2,2',4,4',5,5'-hexabromobiphenyl (BB-153) in landfill leachate in Cape Town, South Africa.

    PubMed

    Daso, Adegbenro P; Fatoki, Olalekan S; Odendaal, James P; Olujimi, Olanrewaju O

    2013-01-01

    An assessment of the concentrations of selected polybrominated diphenyl ether (PBDE) congeners as well as BB 153 in leachate samples collected from three landfill sites within the city of Cape Town was conducted. A liquid-liquid extraction technique was employed for the isolation of all the target compounds from the leachate samples. Extracts obtained were further subjected to multi-layer column chromatography employing different forms of silica gel. The prepared samples were analysed using a high capillary gas chromatograph equipped with a micro-electron capture detector (GC-μECD). The overall mean concentrations of the total PBDEs, including BDE 209 ranged between 5.65 and 2,240, 0.28-20.5 and 1.66-1,170 ng/l for Bellville, Coastal Park, and Vissershok landfill sites, respectively. The mean concentrations of BB 153, which were generally low in most of the samples analysed, were 70.4, 7.14 and 8.16 ng/l for Bellville, Coastal Park and Vissershok sites, respectively. The influence of precipitation on the characteristics and quantity of leachate produced from the landfill sites investigated was most pronounced during the August/September sampling regime. Generally, the trend observed in this study clearly indicated a wide variation in the levels of these contaminants in all the landfill sites studied from one sampling period to the other. However, the principal component analysis revealed that the release of these contaminants might be associated with two or three possible sources. This study further confirmed the relevance of landfill leachate as an important source of PBDE contamination of the environment, especially the groundwater and surface water sources.

  10. A Cross Sectional Analysis of Gonococcal and Chlamydial Infections among Men-Who-Have-Sex-with-Men in Cape Town, South Africa

    PubMed Central

    Kamkuemah, Monika

    2015-01-01

    Background Men-who-have-sex-with-men (MSM) are at high risk of HIV and sexually transmitted infection (STI) transmission. Asymptomatic STIs are common in MSM and remain undiagnosed and untreated where syndromic management is advocated. Untreated STIs could be contributing to high HIV rates. This study investigated symptomatic (SSTI) and asymptomatic STIs (ASTIs) in MSM in Cape Town. Methods MSM, 18 years and above, were enrolled into this study. Participants underwent clinical and microbiological screening for STIs. Urine, oro-pharyngeal and anal swab specimens were collected for STI analysis, and blood for HIV and syphilis screening. A psychosocial and sexual questionnaire was completed. STI specimens were analysed for Neisseria gonorrhoeae (NG) and Chlamydia trachomatis (CT) infection. Results 200 MSM were recruited with a median age of 32 years (IQR 26–39.5). Their median number of sex partners within the last year was 5 (IQR 2–20). 155/200 (78%) reported only male sex partners while 45/200 (23%) reported sex with men and women. 77/200 (39%) reported transactional sex. At enrolment, 88/200 (44%) were HIV positive and 8/112 (7%) initially HIV-negative participants seroconverted during the study. Overall, 47/200 (24%) screened positive for either NG or CT. There were 32 MSM (16%) infected with NG and 7 (3.5%) of these men had NG infections at two anatomical sites (39 NG positive results in total). Likewise, there were 23 MSM (12%) infected with CT and all these men had infections at only one site. Eight of the 47 men (17%) were infected with both NG and CT. ASTI was more common than SSTI irrespective of anatomical site, 38 /200 (19%) versus 9/200 (5%) respectively (p<0.001). The anus was most commonly affected, followed by the oro-pharynx and then urethra. Asymptomatic infection was associated with transgender identity (OR 4.09 CI 1.60–5.62), ≥5 male sex partners in the last year (OR 2.50 CI 1.16–5.62) and transactional sex (OR 2.33 CI 1.13–4.79) but

  11. Electrocotyle whittingtoni n. gen., n. sp. (Monogenea: Monocotylidae: Heterocotylinae) from the gills of a captive onefin electric ray, Narke capensis (Narkidae) at Two Oceans Aquarium, Cape Town, South Africa.

    PubMed

    Vaughan, David B; Chisholm, Leslie A; Hansen, Haakon

    2016-09-01

    Electrocotyle whittingtoni n. gen., n. sp. (Monogenea: Monocotylidae) is described from the gills of a captive female onefin electric ray, Narke capensis, collected for exhibition at Two Oceans Aquarium in Cape Town, South Africa. Electrocotyle n. gen. is most similar to the heterocotyline genera Heterocotyle and Potamotrygonocotyle but could not be accommodated easily in either of these groups. The new genus is characterised by a haptor with one central and eight peripheral loculi, four unsclerotised structures on the dorsal surface of the haptor, a single unsclerotised non-sinous ridge on the ventral surface of the haptoral septa, large hamuli with a long handle and reduced guard, a vagina with sclerotised walls, and tetrahedral eggs. Molecular phylogenetic analyses based on 28S sequences strongly support the separate genus status of Electrocotyle n. gen and thus support our morphological conclusion. The Heterocotylinae is amended to accommodate the new genus, and the new species is fully described and illustrated herein. This is the first record of a monocotylid from the Narkidae. Electrocotyle whittingtoni n. gen. n. sp. is considered potentially pathogenic given its negative impact on the health of its captive host kept in the quarantine facility at Two Oceans Aquarium.

  12. A Fog Climatology for Cape Town International Airport

    NASA Astrophysics Data System (ADS)

    van Schalkwyk, L.; Dyson, L. L.

    2010-07-01

    Cape Town International Airport (CTIA) is situated off the cold Benguela current on the extreme southern side of the west coast of South Africa and experiences fog more frequently than any other international airport in South Africa. The aim of this research is ultimately to improve fog forecasts and to determine the characteristics of fog at CTIA by means of a comprehensive fog climatology. A fog climatology is derived making use of 06:00Z observations over a period of 31 years (1978-2008). The fog season for CTIA is observed to start in March and persists till August, while May is found to be the month with the highest frequency of fog events. Analysis of advection and radiation fog events shows that the occurrence of advection fog events dominate during the earlier part of the fog season, whilst radiation fog occurrences increase towards the latter part. Advection fog events at CTIA have been shown to occur frequently from a northwesterly and a southerly wind direction, but monthly wind roses for CTIA at 06:00Z show that a northeasterly wind (land breeze) is dominant during advection events in July and August. This suggests a third type of fog event, namely advected radiation fog, which accounts for fog that forms due to radiative processes to the east and northeast of the aerodrome, where after it is advected towards the airport when the land breeze is at its strongest prior to sunrise. The climatology is supplemented by an analysis of hourly data which are available for the limited period of 2004-2007. With the aid of hourly data, more accurate estimations of the average time of onset and dissipation of fog are determined as well as duration time: information critical to the aviation forecaster.

  13. Phylogenetic Exploration of Nosocomial Transmission Chains of 2009 Influenza A/H1N1 among Children Admitted at Red Cross War Memorial Children's Hospital, Cape Town, South Africa in 2011.

    PubMed

    Valley-Omar, Ziyaad; Nindo, Fredrick; Mudau, Maanda; Hsiao, Marvin; Martin, Darren Patrick

    2015-01-01

    Traditional modes of investigating influenza nosocomial transmission have entailed a combination of confirmatory molecular diagnostic testing and epidemiological investigation. Common hospital-acquired infections like influenza require a discerning ability to distinguish between viral isolates to accurately identify patient transmission chains. We assessed whether influenza hemagglutinin sequence phylogenies can be used to enrich epidemiological data when investigating the extent of nosocomial transmission over a four-month period within a paediatric Hospital in Cape Town South Africa. Possible transmission chains/channels were initially determined through basic patient admission data combined with Maximum likelihood and time-scaled Bayesian phylogenetic analyses. These analyses suggested that most instances of potential hospital-acquired infections resulted from multiple introductions of Influenza A into the hospital, which included instances where virus hemagglutinin sequences were identical between different patients. Furthermore, a general inability to establish epidemiological transmission linkage of patients/viral isolates implied that identified isolates could have originated from asymptomatic hospital patients, visitors or hospital staff. In contrast, a traditional epidemiological investigation that used no viral phylogenetic analyses, based on patient co-admission into specific wards during a particular time-frame, suggested that multiple hospital acquired infection instances may have stemmed from a limited number of identifiable index viral isolates/patients. This traditional epidemiological analysis by itself could incorrectly suggest linkage between unrelated cases, underestimate the number of unique infections and may overlook the possible diffuse nature of hospital transmission, which was suggested by sequencing data to be caused by multiple unique introductions of influenza A isolates into individual hospital wards. We have demonstrated a functional

  14. Phylogenetic Exploration of Nosocomial Transmission Chains of 2009 Influenza A/H1N1 among Children Admitted at Red Cross War Memorial Children’s Hospital, Cape Town, South Africa in 2011

    PubMed Central

    Hsiao, Marvin; Martin, Darren Patrick

    2015-01-01

    Traditional modes of investigating influenza nosocomial transmission have entailed a combination of confirmatory molecular diagnostic testing and epidemiological investigation. Common hospital-acquired infections like influenza require a discerning ability to distinguish between viral isolates to accurately identify patient transmission chains. We assessed whether influenza hemagglutinin sequence phylogenies can be used to enrich epidemiological data when investigating the extent of nosocomial transmission over a four-month period within a paediatric Hospital in Cape Town South Africa. Possible transmission chains/channels were initially determined through basic patient admission data combined with Maximum likelihood and time-scaled Bayesian phylogenetic analyses. These analyses suggested that most instances of potential hospital-acquired infections resulted from multiple introductions of Influenza A into the hospital, which included instances where virus hemagglutinin sequences were identical between different patients. Furthermore, a general inability to establish epidemiological transmission linkage of patients/viral isolates implied that identified isolates could have originated from asymptomatic hospital patients, visitors or hospital staff. In contrast, a traditional epidemiological investigation that used no viral phylogenetic analyses, based on patient co-admission into specific wards during a particular time-frame, suggested that multiple hospital acquired infection instances may have stemmed from a limited number of identifiable index viral isolates/patients. This traditional epidemiological analysis by itself could incorrectly suggest linkage between unrelated cases, underestimate the number of unique infections and may overlook the possible diffuse nature of hospital transmission, which was suggested by sequencing data to be caused by multiple unique introductions of influenza A isolates into individual hospital wards. We have demonstrated a functional

  15. Anti-retroviral Therapy Based HIV Prevention Among a Sample of Men Who Have Sex with Men in Cape Town, South Africa: Use of Post-exposure Prophylaxis and Knowledge on Pre-exposure Prophylaxis.

    PubMed

    Hugo, J M; Stall, R D; Rebe, K; Egan, J E; De Swardt, G; Struthers, H; McIntyre, J A

    2016-12-01

    Men who have Sex with Men (MSM) have been affected disproportionately by the global HIV pandemic. Rates of consistent condom-use are low and there is a need for further biomedical prevention interventions to prevent new HIV infections. Post exposure prophylaxis (PEP) can reduce the risk of HIV, but uptake among MSM is low. Pre-exposure prophylaxis (PrEP), an innovative anti-retroviral-based HIV prevention tool might be an appropriate intervention for MSM who have recently accessed PEP that involves HIV negative individuals taking daily tenofovir+emtricitabine for HIV prevention. 44 MSM, attending a primary health-care level MSM-focused sexual health clinic in Cape Town, South Africa, who had initiated PEP were enrolled in this study. Participants were followed up after 2, 4 and 12 weeks. Self-administered electronic surveys were completed at the initial, 4 and 12 week visit. Barriers and facilitators to accessing PEP and remaining adherent were examined, as was knowledge about PrEP. Thirty-two participants (80 %) were <40 years of age (range 20-65 years). 35 % of the participants reported their reason for requiring PEP as condomless receptive anal intercourse. A further 20 % required PEP following condomless penetrative anal intercourse; 27.5 % required PEP due to a broken condom during receptive anal sex and 2 participants during insertive anal sex. Three participants did not complete 28 days of PEP or were lost to follow up. Over half (58.5 %) of the participants reported being completely adherent to their regime; under a third (31.7 %) reported missing one PEP dose; and 9.8 % reported missing more than one dose. 36/40 (90 %) had heard of PrEP and 30/40 (75 %) indicated that they would use PrEP if it were accessible to them. That we enrolled 44 MSM who accessed PEP from a Department of Health affiliated clinic over 12 months, speaks to the low uptake by MSM of PEP services in South Africa. Adherence was high and demonstrates that adherence

  16. The Relationship Between Social Support, HIV Serostatus, and Perceived Likelihood of Being HIV Positive Among Self-Settled Female, Foreign Migrants in Cape Town, South Africa.

    PubMed

    Giorgio, Margaret; Townsend, Loraine; Zembe, Yanga; Cheyip, Mireille; Guttmacher, Sally; Kapadia, Farzana; Mathews, Cathy

    2016-10-19

    Female cross-border migrants experience elevated risks for HIV, and migrants in South Africa may face additional risks due to the country's underlying HIV prevalence. These risks may be mitigated by the receipt of social support. A behavioral risk-factor survey was administered using respondent-driven sampling. Multivariable regression models assessed the relationships between social support and two HIV outcomes: HIV serostatus and perceived HIV status. Low social support was not significantly associated with HIV status (aOR = 1.03, 95 % CI 0.43-2.46), but was significantly related to a perception of being HIV positive (aPR = 1.36, 95 % CI 1.04-1.78). Age, marital status, and education level were significantly associated with HIV serostatus. Illegal border-crossing, length of time in South Africa, anal sex, and transactional sex were significantly associated with aperception of being HIV positive. Future research should investigate how HIV risks and the receipt of social support change throughout the migration process.

  17. Perceptions of Community Members and Healthcare Workers on Male Involvement in Prevention of Mother-To-Child Transmission Services in Khayelitsha, Cape Town, South Africa

    PubMed Central

    Ladur, Alice Norah; Colvin, Christopher J.; Stinson, Kathryn

    2015-01-01

    Involving male partners of pregnant women accessing PMTCT programs has the potential to improve health outcomes for women and children. This study explored community members’ (men and women) and healthcare workers’ perceptions of male involvement in the prevention of mother-to-child transmission of HIV in Khayelitsha, South Africa. Two focus group discussions were held with 25 men of unknown HIV status and one focus group discussion held with 12 HIV-positive women in the community. In depth interviews were conducted with four HIV-positive couples and five service providers purposely sampled from the community and a health facility, respectively. Both men and women interviewed in this study were receptive towards male involvement in PMTCT. However, men were reluctant to engage with health services due to stigma and negative attitudes from nurses. This study also found HIV testing, disclosure and direct health worker engagement with men increases male involvement in PMTCT. Using men in the media and community to reach out to fellow men with prevention messages tailored to suit specific audiences may reduce perceptions of antenatal care as being a woman`s domain. PMID:26218065

  18. Narrative Methods and Sociocultural Linguistic Approaches in Facilitating In-depth Understanding of HIV Disclosure in a Cohort of Women and Men in Cape Town, South Africa

    PubMed Central

    Cooper, Diane; Mantell, Joanne E.; Nywagi, Ntobeko; Cishe, Nomazizi; Austin-Evelyn, Katherine

    2016-01-01

    The South African National Department of Health has rapidly extended free public-sector antiretroviral treatment for people living with HIV from 2007. Approximately 6 million people are living with HIV in South Africa, with 3.1 million currently on treatment. HIV disclosure stigma has been reduced in high prevalence, generalized epidemic settings, but some remains, including in research interviews. This paper documents the unexpected reactions of people living with HIV to interviewers. It highlights shifts over time from discussing daily events with researchers to later expressing distress and then relief at having an uninvolved, sympathetic person with whom to discuss HIV disclosure. While there are commonalities, women and men had gendered responses to interviewers. These are apparent in men’s uncharacteristic emotional responses and women’s shyness in revealing gendered aspects of HIV acquisition. Both women and men expressed stress at not being allowed or able to fulfill dominant expected masculine or feminine roles. The findings underline the role of research interviewers in study participants confiding and fully expressing their feelings. This greater confidence occurred in follow-up interviews with researchers in busy health facilities, where time of health-care providers is limited. It underlines the methodological value of narrative inquiries with research cohorts. These allowed richer data than cross-sectional interviews. They shaped the questions asked and the process of interview. They revealed participants’ increasing level of agency in expressing feelings that they find important. This research contributes to highlighting pivotal, relational aspects in research between empathetic, experienced researchers and study participants and how participant–researcher relationships progress over time. It highlights ethical dilemmas in roles of researchers as opposed to counselors, raising questions of possible blurring of lines between research and

  19. Narrative Methods and Sociocultural Linguistic Approaches in Facilitating In-depth Understanding of HIV Disclosure in a Cohort of Women and Men in Cape Town, South Africa.

    PubMed

    Cooper, Diane; Mantell, Joanne E; Nywagi, Ntobeko; Cishe, Nomazizi; Austin-Evelyn, Katherine

    2016-01-01

    The South African National Department of Health has rapidly extended free public-sector antiretroviral treatment for people living with HIV from 2007. Approximately 6 million people are living with HIV in South Africa, with 3.1 million currently on treatment. HIV disclosure stigma has been reduced in high prevalence, generalized epidemic settings, but some remains, including in research interviews. This paper documents the unexpected reactions of people living with HIV to interviewers. It highlights shifts over time from discussing daily events with researchers to later expressing distress and then relief at having an uninvolved, sympathetic person with whom to discuss HIV disclosure. While there are commonalities, women and men had gendered responses to interviewers. These are apparent in men's uncharacteristic emotional responses and women's shyness in revealing gendered aspects of HIV acquisition. Both women and men expressed stress at not being allowed or able to fulfill dominant expected masculine or feminine roles. The findings underline the role of research interviewers in study participants confiding and fully expressing their feelings. This greater confidence occurred in follow-up interviews with researchers in busy health facilities, where time of health-care providers is limited. It underlines the methodological value of narrative inquiries with research cohorts. These allowed richer data than cross-sectional interviews. They shaped the questions asked and the process of interview. They revealed participants' increasing level of agency in expressing feelings that they find important. This research contributes to highlighting pivotal, relational aspects in research between empathetic, experienced researchers and study participants and how participant-researcher relationships progress over time. It highlights ethical dilemmas in roles of researchers as opposed to counselors, raising questions of possible blurring of lines between research and service roles

  20. Implementing a provider-initiated testing and counselling (PITC) intervention in Cape town, South Africa: a process evaluation using the normalisation process model

    PubMed Central

    2013-01-01

    Background Provider-initiated HIV testing and counselling (PITC) increases HIV testing rates in most settings, but its effect on testing rates varies considerably. This paper reports the findings of a process evaluation of a controlled trial of PITC for people with sexually transmitted infections (STI) attending publicly funded clinics in a low-resource setting in South Africa, where the trial results were lower than anticipated compared to the standard Voluntary Counselling and Testing (VCT) approach. Method This longitudinal study used a variety of qualitative methods, including participant observation of project implementation processes, staff focus groups, patient interviews, and observation of clinical practice. Data were content analysed by identifying the main influences shaping the implementation process. The Normalisation Process Model (NPM) was used as a theoretical framework to analyse implementation processes and explain the trial outcomes. Results The new PITC intervention became embedded in practice (normalised) during a two-year period (2006 to 2007). Factors that promoted the normalising include strong senior leadership, implementation support, appropriate accountability mechanisms, an intervention design that was responsive to service needs and congruent with professional practice, positive staff and patient perceptions, and a responsive organisational context. Nevertheless, nurses struggled to deploy the intervention efficiently, mainly because of poor sequencing and integration of HIV and STI tasks, a focus on HIV education, tension with a patient-centred communication style, and inadequate training on dealing with the operational challenges. This resulted in longer consultation times, which may account for the low test coverage outcome. Conclusion Leadership and implementation support, congruent intervention design, and a responsive organisational context strengthened implementation. Poor compatibility with nurse skills on the level of the

  1. A medical geography of perinatal mortality in Metropolitan Cape Town.

    PubMed

    Rip, M R; Keen, C S; Kibel, M A

    1986-09-27

    An infant's weight at birth as well as its socio-economic environment are recognized as constituting two of the major risk factors associated with perinatal mortality. Spatial analyses of birth weight, socio-economic status and perinatal mortality in Metropolitan Cape Town for the year 1982 are presented in an attempt to assess the relationship between these variables at the suburb (or community) level. Variations in perinatal mortality for each suburb were found to be highly correlated with variations in the distribution of low birth weights. Overall, it would appear that the geography of the interrelationship between low birth weight and perinatal mortality tends, in part, to mirror long-standing gradients in socio-economic status--particularly for those coloured communities which show high perinatal death rates. To what extent these variations are associated with available antenatal and infant health care services can only be postulated. Points for possible community intervention are suggested.

  2. International interest in space assets under the Cape Town Convention

    NASA Astrophysics Data System (ADS)

    Ametova, Lutfiie

    2013-12-01

    Private human access to outer space is impossible without space equipment. Nowadays space equipment is increasingly being financed by private sector. Private sector financiers, naturally, seek to secure their interest in space equipment. At the same time, increasing international cooperation in space industry leads to some problems of legal character. Thus, space equipment involved in international cooperation programs crosses national borders and is subject to a certain jurisdiction in a given period of time. The problem is that when an interest is created in one jurisdiction, it may not necessarily be recognised in another one. In order to provide a unified approach to interests vested in space equipment an international legal instrument is necessary. The Cape Town Convention represents an international instrument designed to provide a unified approach to interests vested in mobile equipment, including space assets.

  3. The Role of Postgraduate Students in Co-Authoring Open Educational Resources to Promote Social Inclusion: A Case Study at the University of Cape Town

    ERIC Educational Resources Information Center

    Hodgkinson-Williams, Cheryl; Paskevicius, Michael

    2012-01-01

    Like many universities worldwide, the University of Cape Town (UCT) in South Africa has joined the open educational resources (OER) movement, making a selection of teaching and learning materials available through its OER directory, UCT OpenContent. However, persuading and then supporting busy academics to share their teaching materials as OER…

  4. Flexible Weaving: Investigating the Teaching and Learning Opportunities in the Practices of Theatre-Makers and Performers from Selected Townships in Cape Town

    ERIC Educational Resources Information Center

    Morris, Gay

    2013-01-01

    In 2005-2009, the author researched the theatre-making practices of young people in selected black townships near Cape Town, South Africa. Township theatre groups comprised secondary school learners and out-of-school youth who join together to learn about and make theatre, perform and watch each other. These theatre practitioners do not describe…

  5. Bricolage: Re-Discovering History through Intermediality and Performance. A Report on the UCT/CityVarsity Production of "A Day, Across" at the Cape Town Fringe 2014

    ERIC Educational Resources Information Center

    Muftic, Sanjin

    2016-01-01

    "A Day, Across," performed by the CityVarsity School of Creative Arts at the Cape Town Fringe 2014, was a student production that investigated the link between the youth of South Africa and the centennial of the start of World War I. This paper presents a brief analysis of the rehearsal process as well as certain performance sequences in…

  6. Making unhealthy places: The built environment and non-communicable diseases in Khayelitsha, Cape Town.

    PubMed

    Smit, Warren; de Lannoy, Ariane; Dover, Robert V H; Lambert, Estelle V; Levitt, Naomi; Watson, Vanessa

    2015-06-29

    In this paper, we examine how economic, social and political forces impact on NCDs in Khayelitsha (a predominantly low income area in Cape Town, South Africa) through their shaping of the built environment. The paper draws on literature reviews and ethnographic fieldwork undertaken in Khayelitsha. The three main pathways through which the built environment of the area impacts on NCDs are through a complex food environment in which it is difficult to achieve food security, an environment that is not conducive to safe physical activity, and high levels of depression and stress (linked to, amongst other factors, poverty, crime and fear of crime). All of these factors are at least partially linked to the isolated, segregated and monofunctional nature of Khayelitsha. The paper highlights that in order to effectively address urban health challenges, we need to understand how economic, social and political forces impact on NCDs through the way they shape built environments.

  7. Making unhealthy places: The built environment and non-communicable diseases in Khayelitsha, Cape Town.

    PubMed

    Smit, Warren; de Lannoy, Ariane; Dover, Robert V H; Lambert, Estelle V; Levitt, Naomi; Watson, Vanessa

    2016-05-01

    In this paper, we examine how economic, social and political forces impact on NCDs in Khayelitsha (a predominantly low income area in Cape Town, South Africa) through their shaping of the built environment. The paper draws on literature reviews and ethnographic fieldwork undertaken in Khayelitsha. The three main pathways through which the built environment of the area impacts on NCDs are through a complex food environment in which it is difficult to achieve food security, an environment that is not conducive to safe physical activity, and high levels of depression and stress (linked to, amongst other factors, poverty, crime and fear of crime). All of these factors are at least partially linked to the isolated, segregated and monofunctional nature of Khayelitsha. The paper highlights that in order to effectively address urban health challenges, we need to understand how economic, social and political forces impact on NCDs through the way they shape built environments.

  8. Stories of Change: e/merge @ the University of Cape Town

    NASA Astrophysics Data System (ADS)

    Carr, Tony

    The Center for Educational Technology (CET) is located at the University of Cape Town, which is a leading South African research and teaching university. This implies great opportunities and challenges since we are poised between the experience of and conditions faced by colleagues in other parts of Africa and those of the colleagues in first-world countries. We have access to the intellectual and professional networks of the first world and our university features on global rankings, yet our resourcing, while generous in terms of most other universities in our continent, is a fraction of that enjoyed by first-world universities of similar size and scope. Both globalization and developmental imperatives require us to rapidly extend the effective use of educational technology in our university for teaching and learning. The received models of e-Learning integration developed mostly in first-world countries need to be adapted for contexts with scarce resources.

  9. Urban infrastructure and natural resource flows: evidence from Cape Town.

    PubMed

    Hyman, Katherine

    2013-09-01

    The current economic development trajectory is fundamentally unsustainable. However, decoupling economic growth from excessive natural resource consumption can be adopted as a means to deviate from this current trajectory. Decoupling enables economic growth and human development through non-material growth, without the environmental and social casualties of the incumbent model. Cities are the current and future context for socio development as well as a significant part of the cause and solution to sustainability challenges. Cities account for the majority of production and consumption activities leading to environmental degradation, and they are also the primary location for economic, institutional, and human capital. Innovative responses to global challenges generally emerge during the interaction between these kinds of capital. This paper presents the case of three of Cape Town's resource flows namely; electricity, water and solid waste, as mediated by networked urban infrastructure, to demonstrate the possibility of urban scale decoupling. Conclusions indicate that while decoupling can occur at the city scale, it is unlikely to be sufficient for the realization of sustainable urban development. Purposive interventions are therefore critical for successful, sustainable urban transitions.

  10. AIDS conspiracy beliefs and unsafe sex in Cape Town.

    PubMed

    Grebe, Eduard; Nattrass, Nicoli

    2012-04-01

    This paper uses multivariate logistic regressions to explore: (1) potential socio-economic, cultural, psychological and political determinants of AIDS conspiracy beliefs among young adults in Cape Town; and (2) whether these beliefs matter for unsafe sex. Membership of a religious organisation reduced the odds of believing AIDS origin conspiracy theories by more than a third, whereas serious psychological distress more than doubled it and belief in witchcraft tripled the odds among Africans. Political factors mattered, but in ways that differed by gender. Tertiary education and relatively high household income reduced the odds of believing AIDS conspiracies for African women (but not men) and trust in President Mbeki's health minister (relative to her successor) increased the odds sevenfold for African men (but not women). Never having heard of the Treatment Action Campaign (TAC), the pro-science activist group that opposed Mbeki on AIDS, tripled the odds of believing AIDS conspiracies for African women (but not men). Controlling for demographic, attitudinal and relationship variables, the odds of using a condom were halved amongst female African AIDS conspiracy believers, whereas for African men, never having heard of TAC and holding AIDS denialist beliefs were the key determinants of unsafe sex.

  11. Inherited anaemias in the Greek community of Cape Town.

    PubMed Central

    Bonafede, R P; Botha, M C; Beighton, P

    1979-01-01

    Cape Town has a Greek community of about 5000, of whom approximately 75% originate from the island of Lesbos. In a survey of inherited haematological conditions in this population, 250 unrelated volunteers were investigated. The prevalence of heterozygous beta-thalassaemia was found to be 6.4%, with a gene frequency of 0.033. G6PD deficiency was detected in 10 males and it can be estimated that the prevalence in the male members of this population is 6.7%, with a gene frequency of 0.067. Hereditary spherocytosis was found in three respondents and this represents a prevalence of 1.2%, with a gene frequency of 0.006. One subject was heterozygous for the sickle cell trait (HbS) and another volunteer had haemoglobin Lepore, which had already been diagnosed in Greece. Our findings with respect to beta-thalassaemia and G6PD deficiency are similar to those reported from regions in Greece where malaria is not highly endemic. PMID:469897

  12. The cape triage score: a new triage system South Africa. Proposal from the cape triage group

    PubMed Central

    Gottschalk, S B; Wood, D; DeVries, S; Wallis, L A; Bruijns, S

    2006-01-01

    The Cape Triage Group (CTG) convened with the intention of producing a triage system for the Western Cape, and eventually South Africa. The group includes in-hospital and prehospital staff from varied backgrounds. The CTG triage protocol is termed the Cape Triage Score (CTG), and has been developed by a multi-disciplinary panel, through best available evidence and expert opinion. The CTS has been validated in several studies, and was launched across the Western Cape on 1 January 2006. The CTG would value feedback from readers of this journal, as part of the ongoing monitoring and evaluation process. PMID:16439753

  13. Managing HIV in the PICU--the experience at the Red Cross War Memorial Children's Hospital in Cape Town.

    PubMed

    Argent, A C

    2008-06-01

    The HIV pandemic has affected children throughout the developing world. This article describes the experience of the Paediatric Intensive Care Unit at the Red Cross War Memorial Children's Hospital in Cape Town, South Africa. Over the last 20 years we have improved our management of HIV infected children requiring intensive care admission. In the absence of anti-retroviral therapy, long term outcomes from PICU admission of HIV infected children have not improved significantly, and it is debatable whether PICU admission is justified. Once anti-retroviral therapy is available to children, there may be significant improvements in outcome and possible affected children should be admitted to the PICU if resources are available.

  14. Intergration of LiDAR Data with Aerial Imagery for Estimating Rooftop Solar Photovoltaic Potentials in City of Cape Town

    NASA Astrophysics Data System (ADS)

    Adeleke, A. K.; Smit, J. L.

    2016-06-01

    Apart from the drive to reduce carbon dioxide emissions by carbon-intensive economies like South Africa, the recent spate of electricity load shedding across most part of the country, including Cape Town has left electricity consumers scampering for alternatives, so as to rely less on the national grid. Solar energy, which is adequately available in most part of Africa and regarded as a clean and renewable source of energy, makes it possible to generate electricity by using photovoltaics technology. However, before time and financial resources are invested into rooftop solar photovoltaic systems in urban areas, it is important to evaluate the potential of the building rooftop, intended to be used in harvesting the solar energy. This paper presents methodologies making use of LiDAR data and other ancillary data, such as high-resolution aerial imagery, to automatically extract building rooftops in City of Cape Town and evaluate their potentials for solar photovoltaics systems. Two main processes were involved: (1) automatic extraction of building roofs using the integration of LiDAR data and aerial imagery in order to derive its' outline and areal coverage; and (2) estimating the global solar radiation incidence on each roof surface using an elevation model derived from the LiDAR data, in order to evaluate its solar photovoltaic potential. This resulted in a geodatabase, which can be queried to retrieve salient information about the viability of a particular building roof for solar photovoltaic installation.

  15. Language Policy as a Sociocultural Tool: Insights from the University of Cape Town

    ERIC Educational Resources Information Center

    Karjalainen, Magda

    2016-01-01

    This theoretically oriented article draws on the author's previous research, which examined language policy and planning (LPP) of the University of Cape Town within the context of post-apartheid transformation driven by need to redress inequalities of the past, and demands of globalization. Drawing on critical linguistics, but indicating…

  16. Anonymous Examination Marking at University of Cape Town: The Quest for an "Agonising-Free Zone"

    ERIC Educational Resources Information Center

    Shay, S.; Jones, B.

    2006-01-01

    In 2003 the University of Cape Town introduced an anonymous examination policy. This article reports on a study of the impact of the implementation of this policy on student performance. Comparisons of student results pre- and post policy implementation showed no evidence of negative or positive discrimination of students in the examination…

  17. Defying Monolingual Education: Alternative Bilingual Discourse Practices in Selected Coloured Schools in Cape Town

    ERIC Educational Resources Information Center

    Banda, Felix

    2010-01-01

    This paper explores how bilingual learners and teachers challenge the monolingual discourses prescribed in language education policy and models in pursuit of voice and agency in classroom interaction. Through an examination of observation, interview and classroom interaction data in selected coloured primary and secondary schools in Cape Town, the…

  18. Introductory Astronomy Course at the University of Cape Town: Probing Student Perspectives

    ERIC Educational Resources Information Center

    Rajpaul, Vinesh; Allie, Saalih; Blyth, Sarah-Louise

    2014-01-01

    We report on research carried out to improve teaching and student engagement in the introductory astronomy course at the University of Cape Town. This course is taken by a diverse range of students, including many from educationally disadvantaged backgrounds. We describe the development of an instrument, the Introductory Astronomy Questionnaire…

  19. Parental Investment, Club Membership, and Youth Sexual Risk Behavior in Cape Town

    ERIC Educational Resources Information Center

    Camlin, Carol S.; Snow, Rachel C.

    2008-01-01

    This study examines whether parental investment and membership in social clubs are associated with safer sexual behaviors among South African youth. Participants comprised 4,800 randomly selected adolescents age 14 to 22 living in the Cape Town area in 2002. Logistic regression was used to examine associations between measures of parental…

  20. The Tangled Web: Investigating Academics' Views of Plagiarism at the University of Cape Town

    ERIC Educational Resources Information Center

    de Jager, Karin; Brown, Cheryl

    2010-01-01

    This article considers the problematic question of student plagiarism, its causes and manifestations, and how it is addressed in academic environments. A literature survey was conducted to establish how higher education institutions approach these issues, and a twofold investigation was conducted at the University of Cape Town. Data was gathered…

  1. Intervening in Children's Involvement in Gangs: Views of Cape Town's Young People

    ERIC Educational Resources Information Center

    Ward, Catherine L.; Bakhuis, Karlijn

    2010-01-01

    Gangs have a long history in Cape Town and children tend to begin involvement around age 12. Children's views on causes of children's involvement in gangs and appropriate interventions, were sought for inclusion in policy recommendations. Thirty focus group discussions were held with in- and out-of-school youth in different communities.…

  2. Education for Democratic Participation. An Analysis of Self-Education Strategies within Certain Community Organisations in Cape Town in the 1980s. Adult and Non-Formal Education Thesis Series.

    ERIC Educational Resources Information Center

    Walters, Shirley

    This book describes self-education within community organizations in Cape Town (South Africa) where a primary concern was the promotion of democratic participation. Part I describes the participatory research approach. Part II focuses on the historical contexts in which voluntary associations have developed and the specific theory and practice…

  3. An Investigation into the Impact of School Context on Achievement: A Situational Analysis of Five Western Cape Schools in South Africa

    ERIC Educational Resources Information Center

    Mushayikwa, Emmanuel

    2009-01-01

    The purpose of this study was to generate a snapshot profile of the teaching and learning environment in each of five schools in Cape Town, South Africa. The generated profile would in turn facilitate the identification of critical, localized and systemic factors that might be targeted by a whole school intervention programme to improve the…

  4. The Impact of Computer and Mathematics Software Usage on Performance of School Leavers in the Western Cape Province of South Africa: A Comparative Analysis

    ERIC Educational Resources Information Center

    Smith, Garth Spencer; Hardman, Joanne

    2014-01-01

    In this study the impact of computer immersion on performance of school leavers Senior Certificate mathematics scores was investigated across 31 schools in the EMDC East education district of Cape Town, South Africa by comparing performance between two groups: a control and an experimental group. The experimental group (14 high schools) had access…

  5. Taxonomy and ecology of the Cape Town Spider Crab, Macropodia falcifera (Stimpson, 1858) (Crustacea: Decapoda: Brachyura: Inachidae).

    PubMed

    Ng, Peter K L; Richer De Forges, Bertrand; Jones, Georgina

    2013-01-01

    The nomenclature and taxonomy of the Cape Town Spider Crab, Macropodia falcifera Stimpson, 1858, is treated. The species is rediagnosed and figured, and its ecology discussed. A key is also provided of the Indo-West Pacific species of Macropodia.

  6. Determinants of cigarette smoking in the black township population of Cape Town.

    PubMed Central

    Strebel, P; Kuhn, L; Yach, D

    1989-01-01

    There is concern about the increasing tobacco consumption in developing countries, especially in urban communities. Little information is available on the prevalence and determinants of smoking in black townships in South Africa. We therefore conducted a survey of the smoking practices in three such townships in Cape Town, in which 673 higher primary schoolchildren and 1320 adults were interviewed using a WHO questionnaire translated into Xhosa. Results were analysed using a multiple logistic regression model. In higher primary schoolpupils, boys smoked much more than girls [adjusted odds ratio (ORa) = 17.8; 95% confidence interval (CI): 5.2-60.9]; and smoking prevalence increased with age (ORa = 1.6; 95% CI: 1.3-1.9), peer pressure (ORa = 4.4; 95% CI: 1.9-6.9), and poor health knowledge (ORa = 3.1; 95% CI: 1.6-5.8). In adults, smoking prevalence was 53% in men compared to 6% in women. In men, an urban experience of 6 or more years was significantly associated with smoking (ORa = 1.9; 95% CI: 1.2-3.0) after adjustment for age, health knowledge and occupation. No association was found between level of education and smoking prevalence. Men in higher paid occupations smoked more than those in low paid occupations (ORa = 1.7; 95% CI: 1.0-2.8). Unemployment, however, was not associated with smoking prevalence. The findings emphasise the need for primary prevention of smoking in women and boys. Urbanisation and increased earning power appear to boost tobacco consumption in the absence of active anti-smoking efforts. PMID:2607296

  7. "Stressed and Sexy": Lexical Borrowing in Cape Town Xhosa

    ERIC Educational Resources Information Center

    Dowling, Tessa

    2011-01-01

    Codeswitching by African language speakers in South Africa (whether speaking English or the first language) has been extensively commented on and researched. Many studies analyse the historical, political and sociolinguistic factors behind this growing phenomenon, but there appears to be a little urgency about establishing a database of new…

  8. Alcohol Expectancies and Inhibition Conflict as Moderators of the Alcohol-Unprotected Sex Relationship: Event-Level Findings from a Daily Diary Study Among Individuals Living with HIV in Cape Town, South Africa.

    PubMed

    Kiene, Susan M; Simbayi, Leickness C; Abrams, Amber; Cloete, Allanise

    2016-01-01

    Literature from sub-Saharan Africa and elsewhere supports a global association between alcohol and HIV risk. However, more rigorous studies using multiple event-level methods find mixed support for this association, suggesting the importance of examining potential moderators of this relationship. The present study explores the assumptions of alcohol expectancy theory and alcohol myopia theory as possible moderators that help elucidate the circumstances under which alcohol may affect individuals' ability to use a condom. Participants were 82 individuals (58 women, 24 men) living with HIV who completed daily phone interviews for 42 days which assessed daily sexual behavior and alcohol consumption. Logistic generalized estimating equation models were used to examine the potential moderating effects of inhibition conflict and sex-related alcohol outcome expectancies. The data provided some support for both theories and in some cases the moderation effects were stronger when both partners consumed alcohol.

  9. Alcohol expectancies and inhibition conflict as moderators of the alcohol-unprotected sex relationship: Event-level findings from a daily diary study among individuals living with HIV in Cape Town, South Africa

    PubMed Central

    Kiene, Susan M.; Simbayi, Leickness C.; Abrams, Amber; Cloete, Allanise

    2015-01-01

    Literature from sub-Saharan Africa and elsewhere supports a global association between alcohol and HIV risk. However, more rigorous studies using multiple event-level methods find mixed support for this association, suggesting the importance of examining potential moderators of this relationship. The present study explores the assumptions of alcohol expectancy theory and alcohol myopia theory as possible moderators that help elucidate the circumstances under which alcohol may affect individuals’ ability to use a condom. Participants were 82 individuals (58 women, 24 men) living with HIV who completed daily phone interviews for 42 days which assessed daily sexual behavior and alcohol consumption. Logistic generalized estimating equation models were used to examine the potential moderating effects of inhibition conflict and sex-related alcohol outcome expectancies. The data provided some support for both theories and in some cases the moderation effects were stronger when both partners consumed alcohol. PMID:26280530

  10. Temperature Variability and Occurrence of Diarrhoea in Children under Five-Years-Old in Cape Town Metropolitan Sub-Districts

    PubMed Central

    Musengimana, Gentille; Mukinda, Fidele K.; Machekano, Roderick; Mahomed, Hassan

    2016-01-01

    This paper describes the relationship between temperature change and diarrhoea in under five-year-old children in the Cape Town Metropolitan Area (CTMA) of South Africa. The study used climatic and aggregated surveillance diarrhoea incidence data of two peak periods of seven months each over two consecutive years. A Poisson regression model and a lagged Poisson model with autocorrelation was performed to test the relationship between climatic parameters (minimum and maximum temperature) and incidence of diarrhoea. In total, 58,617 cases of diarrhoea occurred in the CTMA, which is equivalent to 8.60 cases per 100 population under five years old for the study period. The mixed effect overdispersed Poisson model showed that a cluster adjusted effect of an increase of 5 °C in minimum and maximum temperature results in a 40% (Incidence risk ratio IRR: 1.39, 95% CI 1.31–1.48) and 32% (IRR: 1.32, 95% CI: 1.22–1.41) increase in incident cases of diarrhoea, respectively, for the two periods studied. Autocorrelation of one-week lag (Autocorrelation AC 1) indicated that a 5 °C increase in minimum and maximum temperature led to 15% (IRR: 1.46, 95% CI: 1.09–1.20) and 6% (IRR: 1.06, 95% CI: 1.01–1.12) increase in diarrhoea cases, respectively. In conclusion, there was an association between an increase in minimum and maximum temperature, and the rate at which diarrhoea affected children under the age of five years old in the Cape Town Metropolitan Area. This finding may have implications for the effects of global warming and requires further investigation. PMID:27589772

  11. A Survey of Music Education in the Primary Schools of South Africa's Cape Peninsula

    ERIC Educational Resources Information Center

    Herbst, Anri; Wet, Jacques de; Rijsdijk, Susan

    2005-01-01

    We investigated the state of music education in government primary schools in the Cape Peninsula (Western Cape Province, South Africa) as perceived by the general class teacher. Since the first democratic elections in South Africa (1994), the entire primary and secondary school education system has changed drastically in terms of content, and…

  12. The UNESCO biosphere reserve concept as a tool for urban sustainability: the CUBES Cape Town case study.

    PubMed

    Stanvliet, R; Jackson, J; Davis, G; De Swardt, C; Mokhoele, J; Thom, Q; Lane, B D

    2004-06-01

    The Cape Town Case Study (CTCS) was a multi-institutional collaborative project initiated by CUBES, a knowledge networking initiative of UNESCO's Ecological Sciences Division and the Earth Institute at Columbia University. Cape Town was selected as a CUBES site on the basis of its high biological and cultural significance, together with its demonstrated leadership in promoting urban sustainability. The CTCS was conducted by the Cape Town Urban Biosphere Group, a cross-disciplinary group of specialists drawn from national, provincial, municipal, and civil society institutions, mandated to examine the potential value of the UNESCO Biosphere Reserve concept as a tool for environmental management, social inclusion, and poverty alleviation in Cape Town. This article provides a contextualization of the CTCS and its collaborative process. It also reviews the biosphere reserve concept relative to urban sustainability objectives and proposes a more functional application of that concept in an urban context. A detailed analysis of key initiatives at the interface of conservation and poverty alleviation is provided in table format. Drawing on an examination of successful sustainability initiatives in Cape Town, specific recommendations are made for future application of the biosphere reserve concept in an urban context, as well as a model by which urban areas might affiliate with the UNESCO World Network of Biosphere Reserves, and criteria for such affiliation.

  13. Non-communicable disease risk factors and treatment preference of obese patients in Cape Town

    PubMed Central

    Manning, Kathryn; Senekal, Marjanne

    2016-01-01

    Background Insights into the characteristics of treatment seekers for lifestyle changes and treatment preferences are necessary for intervention planning. Aim To compile a profile of treatment-seeking obese patients with non-communicable diseases (NCDs) or NCD risk factors and to compare patients who choose group-based (facility-based therapeutic group [FBTG]) versus usual care (individual consultations) treatment. Setting A primary healthcare facility in Cape Town, South Africa. Methods One hundred and ninety-three patients were recruited in this cross-sectional study. Ninety six chose FBTG while 97 chose usual care. A questionnaire, the hospital database and patients’ folders were used to collect data. Weight, height and waist circumference were measured. STATA 11.0 was used for descriptive statistics and to compare the two groups. Results The subjects’ mean age was 50.4 years, 78% were women and of low education levels and income, and 41.5% had type 2 diabetes, 83.4% hypertension and 69.5% high cholesterol. Mean (s.d.) HbA1c was 9.1 (2.0)%, systolic BP 145.6 (21.0) mmHg, diastolic BP 84.5 (12.0) mmHg, cholesterol 5.4 (1.2) mmol/L), body mass indicator (BMI) 39.3 (7.3) kg/m2 and waist circumference 117 (12.6) cm). These figures were undesirable although pharmacological treatment for diabetes and hypertension was in place. Only 14% were physically active, while TV viewing was > 2h/day. Mean daily intake of fruit and vegetables (2.2 portions/day) was low while added sugar (5 teaspoons) and sugar-sweetened beverages (1.3 glasses) were high. Usual care patients had a higher smoking prevalence, HbA1c, number of NCD risk factors and refined carbohydrate intake, and a lower fruit and vegetable intake. Conclusion Treatment seekers were typically middle-aged, low income women with various modifiable and intermediate risk factors for NCDs. Patients choosing usual care could have more NCD risks. PMID:27380784

  14. Glucose-6-phosphate dehydrogenase deficiency in the Greek population of Cape Town.

    PubMed

    Bonafede, R P; Botha, M C; Beighton, P

    1984-04-07

    A sample of 250 unrelated members of the Greek community of Cape Town was studied in order to establish the prevalence of glucose-6-phosphate dehydrogenase (G-6-PD) deficiency in the community. A gene frequency of 0,067 in males and a prevalence of 6,7% are estimated for this group. It is recommended that persons with G-6-PD deficiency should have access to a list of medicinal agents which have the potential for precipitating acute haemolytic crises and that they should wear Medic-Alert discs bearing information concerning the disorder.

  15. Research to action to address inequities: the experience of the Cape Town Equity Gauge

    PubMed Central

    Scott, Vera; Stern, Ruth; Sanders, David; Reagon, Gavin; Mathews, Verona

    2008-01-01

    Background While the importance of promoting equity to achieve health is now recognised, the health gap continues to increase globally between and within countries. The description that follows looks at how the Cape Town Equity Gauge initiative, part of the Global Equity Gauge Alliance (GEGA) is endeavouring to tackle this problem. We give an overview of the first phase of our research in which we did an initial assessment of health status and the socio-economic determinants of health across the subdistrict health structures of Cape Town. We then describe two projects from the second phase of our research in which we move from research to action. The first project, the Equity Tools for Managers Project, engages with health managers to develop two tools to address inequity: an Equity Measurement Tool which quantifies inequity in health service provision in financial terms, and a Equity Resource Allocation Tool which advocates for and guides action to rectify inequity in health service provision. The second project, the Water and Sanitation Project, engages with community structures and other sectors to address the problem of diarrhoea in one of the poorest areas in Cape Town through the establishment of a community forum and a pilot study into the acceptability of dry sanitation toilets. Methods A participatory approach was adopted. Both quantitative and qualitative methods were used. The first phase, the collection of measurements across the health subdistricts of Cape Town, used quantitative secondary data to demonstrate the inequities. In the Equity Tools for Managers Project further quantitative work was done, supplemented by qualitative policy analysis to study the constraints to implementing equity. The Water and Sanitation Project was primarily qualitative, using in-depth interviews and focus group discussions. These were used to gain an understanding of the impact of the inequities, in this instance, inadequate sanitation provision. Results The studies both

  16. Occurrence of blood parasites in seabirds admitted for rehabilitation in the Western Cape, South Africa, 2001-2013.

    PubMed

    Parsons, N J; Voogt, N M; Schaefer, A M; Peirce, M A; Vanstreels, R E T

    2017-01-15

    Blood parasites are generally uncommon in seabirds, and knowledge on their epidemiology is further limited by the fact that they often inhabit remote locations that are logistically difficult or expensive to study. We present a long term data set of blood smear examinations of 1909 seabirds belonging to 27 species that were admitted to a rehabilitation centre in Cape Town (Western Cape, South Africa) between 2001 and 2013. Blood parasites were detected in 59% of species (16/27) and 29% of individuals examined (551/1909). The following blood parasites were recorded: Babesia ugwidiensis, Babesia peircei, Babesia sp., Plasmodium sp., Leucocytozoon ugwidi, Hepatozoon albatrossi, Haemoproteus skuae and Spirochaetales. Several of the records are novel host-parasite associations, demonstrating the potential of rehabilitation centres for parasite and disease surveillance, particularly for species infrequently sampled from which no host-specific parasites have been described.

  17. Providing local color?: "cape coloreds," "cockneys," and Cape Town's identity from the late nineteenth century to the 1970s.

    PubMed

    Bickford-Smith, Vivian

    2012-01-01

    Jim Dyos, founding-father of British urban history, argued that cities have commonly acknowledged “individual characteristics” that distinguish them. Such distinctive characteristics, though usually based on material realities, are promoted through literary and visual representations. This article argues that those who seek to convey a city’s distinctiveness will do so not only through describing its particular topography, architecture, history or functions but also by describing its “local colour”: the supposedly unique customs, manner of speech, dress, or other special features of its inhabitants. In colonial cities this process involved white racial stereotyping of “others”. In Cape Town, depictions of “Coloured” inhabitants as unique “city types” became part of the city’s “destination branding”. The article analyses change and continuity in such representations. To this end it draws on the insights of Gareth Stedman Jones into changing depictions of London’s “Cockneys” and the insights of Stephen Ward into historical “place-selling”.

  18. Introductory astronomy course at the University of Cape Town: Probing student perspectives

    NASA Astrophysics Data System (ADS)

    Rajpaul, Vinesh; Allie, Saalih; Blyth, Sarah-Louise

    2014-12-01

    We report on research carried out to improve teaching and student engagement in the introductory astronomy course at the University of Cape Town. This course is taken by a diverse range of students, including many from educationally disadvantaged backgrounds. We describe the development of an instrument, the Introductory Astronomy Questionnaire (IAQ), which we administered as pre- and posttests to students enrolled in the course. The instrument comprised a small number of questions which probed three areas of interest: student motivation and expectations, astronomy content, and worldview. Amongst our findings were that learning gains were made in several conceptual areas, and that students appeared to develop a more nuanced view of the nature of astronomy. There was some evidence that the course had a positive impact on students' worldviews, particularly their attitudes towards science. We also identified a promising predictor of course success that could in the future be used to identify students requiring special teaching intervention.

  19. Relationship between Urinary Pesticide Residue Levels and Neurotoxic Symptoms among Women on Farms in the Western Cape, South Africa

    PubMed Central

    Motsoeneng, Portia M.; Dalvie, Mohamed A.

    2015-01-01

    Background: This cross-sectional study aimed to investigate the relationship between urinary pesticide residue levels and neurotoxic symptoms amongst women working on Western Cape farms in South Africa. Method: A total of 211 women were recruited from farms (n = 121) and neighbouring towns (n = 90). Participant assessment was via a Q16 questionnaire, reporting on pesticide exposures and measurement of urinary OP metabolite concentrations of dialkyl phosphates (DAP) and chlorpyriphos, 3,5,6-trichloropyridinol (TCPY) and of pyrethroid (PYR) metabolite concentrations (3- phenoxybenzoic acid (3PBA), 4-fluoro-3-phenoxybenzoic acid (4F3PBA), cis-2,2-dibromovinyl-2,2-dimethylcyclopropane-1-carboxylic acid (DBCA), and the cis- and trans isomers of 2,2-dichlorovinyl-2,2-dimethylcyclopropane-1-carboxylic acid. Results: Median urinary pesticide metabolites were slightly (6%–49%) elevated in the farm group compared to the town group, with 2 metabolites significantly higher and some lower in the farm group. The prevalence of all Q16 symptoms was higher amongst farm women compared to town women. Three Q16 symptoms (problems with buttoning, reading and notes) were significantly positively associated with three pyrethroid metabolites (cis- and trans-DCCA and DBCA), although associations may due to chance as multiple comparisons were made. The strongest association for a pyrethroid metabolite was between problems with buttoning and DBCA (odds ratio (OR) = 8.93, 95% confidence interval (CI):1.71–46.5. There was no association between Q16 symptoms and OP metabolites. Conclusions: Women farm residents and rural women from neighbouring towns in the Western Cape are exposed to OP and PYR pesticides. The study did not provide strong evidence that pesticides are associated with neurotoxic symptoms but associations found could be explored further. PMID:26042367

  20. The first human heart transplant and further advances in cardiac transplantation at Groote Schuur Hospital and the University of Cape Town - with reference to : the operation. A human cardiac transplant : an interim report of a successful operation performed at Groote Schuur Hospital, Cape Town.

    PubMed

    Brink, J G; Hassoulas, J

    2009-01-01

    Christiaan (Chris) Barnard was born in 1922 and qualified in medicine at the University of Cape Town in 1946. Following surgical training in South Africa and the USA, Barnard established a successful open-heart surgery programme at Groote Schuur Hospital and the University of Cape Town in 1958. In 1967, he led the team that performed the world's first human-to-human heart transplant. The article describing this remarkable achievement was published in the South African Medical Journal just three weeks after the event and is one of the most cited articles in the cardiovascular field. In the lay media as well, this first transplant remains the most publicised event in world medical history. Although the first heart transplant patient survived only 18 days, four of Groote Schuur Hospital's first 10 patients survived for more than one year, two living for 13 and 23 years, respectively. This relative success amid many failures worldwide did much to generate guarded optimism that heart transplantation would eventually become a viable therapeutic option. This first heart transplant and subsequent ongoing research in cardiac transplantation at the University of Cape Town and in a few other dedicated centres over the subsequent 15 years laid the foundation for heart transplantation to become a well-established form of therapy for end-stage cardiac disease. During this period from 1968 to 1983, Chris Barnard and his team continued to make major contributions to organ transplantation, notably the development of the heterotopic ( 'piggy-back') heart transplants; advancing the concept of brain death, organ donation and other related ethical issues; better preservation and protection of the donor heart (including hypothermic perfusion storage of the heart; studies on the haemodynamic and metabolic effects of brain death; and even early attempts at xenotransplantation.

  1. Western Cape Primary Care Assessment Tool (PCAT) study: Measuring primary care organisation and performance in the Western Cape Province, South Africa (2013)

    PubMed Central

    Sayed, Abdul-Rauf; le Grange, Cynthia; Bhagwan, Susheela; Manga, Nayna; Hellenberg, Derek

    2016-01-01

    Background Major health sector reform and the need for baseline measures of performance to determine impact. Aim Baseline audit of primary healthcare (PHC) performance. Setting Cape Town and Cape Winelands (rural) PHC facilities (PCFs) in Western Cape Province, South Africa. Method The South African cross-culturally validated ZA PCAT to audit PHC performance on 11 subdomains associated with improved health and reduced costs. Adult PCF users systematically sampled. All full-time doctors and nurse practitioners in PCFs sampled and all PCF managers in sub-districts sampled invited into the study. Results Data from 1432 users, 100 clinicians and 64 managers from 13 PCFs in 10 sub-districts analysed (figures show stakeholder percentages scoring subdomain performance ‘acceptable to good’). 11.5% users scored access ‘acceptable to good’; community orientation and comprehensive services provided 20.8% and 39.9%, respectively. Total PHC score for users 50.2%; for managers and practitioners 82.8% and 88.0%, respectively. Among practitioners access was lowest (33.3%); PHC team (98.0%) and comprehensive services available (100.0%) highest. Among managers, access (13.5%) and family centredness (45.6%) are lowest; PHC team (85.9%) and comprehensive services available (90.6%) highest. Managers scored access, family centredness and cultural competence significantly lower than practitioners. Users scored comprehensive services available, comprehensive services provided and community orientation significantly lower than practitioners and managers. Conclusion Gaps between users’ experience and providers’ assessments of PHC performance are identified. Features that need strengthening and alignment with best practice, provincial and national, and health policies are highlighted with implications for practitioner and manager training, health policy, and research. PMID:27247157

  2. Mercury in the atmosphere and in rainwater at Cape Point, South Africa

    NASA Astrophysics Data System (ADS)

    Brunke, Ernst-Günther; Walters, Chavon; Mkololo, Thumeka; Martin, Lynwill; Labuschagne, Casper; Silwana, Bongiwe; Slemr, Franz; Weigelt, Andreas; Ebinghaus, Ralf; Somerset, Vernon

    2016-01-01

    Mercury measurements were concurrently made in air (Gaseous Elemental Mercury, i.e. GEM) as well as in precipitation samples (Total mercury, i.e. TotHg) over a seven year period (2007-2013) at Cape Point, South Africa, during the rainy seasons (May-October). Eighty-five rain events, almost exclusively associated with cold fronts, have been identified of which 75% reached the Cape Point observatory directly across the Atlantic Ocean from the south, while 19% moved in to the measuring site via the Cape Town metropolitan region. In statistic terms the GEM, TotHg, CO and 222Rn levels within the urban-marine events do not differ from those seen in the marine rain episodes. Over the 2007-2013 period, the May till Oct averages for GEM ranged from 0.913 ng m-3 to 1.108 ng m-3, while TotHg concentrations ranged from 0.03 to 52.5 ng L-1 (overall average: 9.91 ng L-1). A positive correlation (R2 = 0.49, n = 7) has been found between the average annual (May till October) GEM concentrations in air and TotHg concentration in rainwater suggesting a close relationship between the two species. The wetter years are normally associated with higher GEM and TotHg levels. Both GEM and TotHg annual means correlate positively with total annual (May till October) rain depths. If one or two outlier years are removed from the data set, the R2 values increase from 0.23 to 0.10 for GEM and TotHg to 0.97 (n = 5) and 0.89 (n = 5), respectively. The relationship between annual mean GEM and annual precipitation depth also holds for the period 1996-2004 (R2 = 0.6, n = 8) when GEM was measured manually (low resolution data). A positive correlation was also seen between annual average GEM concentrations and the El Niño Southern Oscillation (ENSO) Index (SOI), for the 1996-2004 period (R2 = 0.7, n = 8). For the 2007-2013 periods this relationship was also positive but less pronounced. The relationship between annual precipitation depth and annual SOI suggests that the inter-annual variations of GEM

  3. Shaded Relief of South Africa, Northern Cape Province

    NASA Technical Reports Server (NTRS)

    2000-01-01

    Located north of the Swartberg Mountains in South Africa's Northern Cape Province, this topographic image shows a portion of the Great Karoo region. Karoo is an indigenous word for 'dry thirst land.' The semi-arid area is known for its unique variety of flora and fauna. The topography of the area, with a total relief of 200 meters (650 feet), reveals much about the geologic history of the area. The linear features seen in the image are near-vertical walls of once-molten rock, or dikes, that have intruded the bedrock. The dikes are more resistant to weathering and, therefore, form the linear wall-like features seen in the image. In relatively flat arid areas such as this, small changes in the topography can have large impacts on the water resources and the local ecosystem. These data can be used by biologists to study the distribution and range of the different plants and animals. Geologists can also use the data to study the geologic history of this area in more detail.

    This shaded relief image was generated using topographic data from the Shuttle Radar Topography Mission. A computer-generated artificial light source illuminates the elevation data to produce a pattern of light and shadows. Slopes facing the light appear bright, while those facing away are shaded. On flatter surfaces, the pattern of light and shadows can reveal subtle features in the terrain. Colors show the elevation as measured by SRTM. Colors range from green at the lowest elevations to reddish at the highest elevations. Shaded relief maps are commonly used in applications such as geologic mapping and land use planning.

    The Shuttle Radar Topography Mission (SRTM), launched on February 11, 2000, uses the same radar instrument that comprised the Spaceborne Imaging Radar-C/X-Band Synthetic Aperture Radar (SIR-C/X-SAR) that flew twice on the Space Shuttle Endeavour in 1994. The mission is designed to collect three-dimensional measurements of the Earth's surface. To collect the 3-D data

  4. Making assessment locally relevant: measuring functioning for maternal depression in Khayelitsha, Cape Town

    PubMed Central

    Baron, Emily; Davies, Thandi; Bass, Judith; Lund, Crick

    2015-01-01

    Purpose We developed a locally relevant functioning assessment instrument (FAI) for pregnant women and mothers of young babies to complement a widely validated instrument—the World Health Organization’s Disability Assessment Schedule (WHODAS) 12-item version. The FAI is an outcome measure in a randomised controlled trial on the effectiveness of a lay counsellor administered intervention for distressed pregnant women in Khayelitsha, Cape Town. Methods Nine items most commonly reported by 40 pregnant women or mothers with young babies in qualitative interviews were selected for the instrument, with a 10th item ‘Other’. The FAI was validated with 142 pregnant women and mothers in Khayelitsha. Analysis was conducted to assess internal reliability, exploratory factor analysis and convergent validity. Results The FAI had good internal reliability (Cronbach’s alpha = 0.77) and the explanatory factor analysis showed a clear 3-factor solution, relating to domestic, childcare and social activities. The FAI scores showed floor effects, but were positively correlated with the two measures of functioning (WHODAS 2.0 and Washington Group Short Set). The FAI scores also correlated with the measure of depression (Edinburgh Postnatal Depression Scale—EPDS), reflecting increased functional limitations associated with increased depressive symptoms. Conclusion The results show that the FAI has good internal reliability, and good convergent and construct validity as a measure of functioning for this context. This paper reports on the process of developing an instrument and highlights the importance of using instruments that are locally relevant to ensure accurate measurement of functional status. PMID:25567235

  5. University Multilingualism: A Critical Narrative from the University of the Western Cape, South Africa

    ERIC Educational Resources Information Center

    Antia, Bassey E.

    2015-01-01

    This article offers a narrative of the University of the Western Cape, South Africa, from the prism of the duality of language as a co-modality (with people, protest, policy and practices) for constituting the institution in whole or in part and as a reflection of its co-modalities. For its framing, the narrative eclectically draws on language…

  6. Teacher Unionism and School Management: A Study of (Eastern Cape) Schools in South Africa

    ERIC Educational Resources Information Center

    Msila, Vuyisile

    2014-01-01

    This article reports on a study that was conducted in 10 urban schools, situated in the city of Port Elizabeth in the Eastern Cape Province of South Africa. The research explored the perceptions of school stakeholders with regard to the effects of power relations between teacher unions and school managers. It is assumed, within the context of this…

  7. Disempowerment and Psychological Distress in the Lives of Young People in Eastern Cape, South Africa

    ERIC Educational Resources Information Center

    Nduna, Mzikazi; Jewkes, Rachel

    2012-01-01

    A qualitative study was conducted in Butterworth, in the rural Eastern Cape Province of South Africa, to explore sources of distress for young people. Semi-structured, individual in-depth interviews were conducted with 16 men and 24 women aged 16-22 years. The findings revealed interconnections between structural factors such as death, poverty,…

  8. "The sun has set even though it is morning": Experiences and explanations of perinatal depression in an urban township, Cape Town.

    PubMed

    Davies, Thandi; Schneider, Marguerite; Nyatsanza, Memory; Lund, Crick

    2016-06-01

    This study examined experiences and explanations of depression amongst Xhosa-speaking pregnant women, mothers, and health workers in an urban township in Cape Town, South Africa. The study was conducted as part of formative research for a randomised controlled trial to develop and evaluate a task-sharing counselling intervention for maternal depression in this setting. We conducted qualitative semi-structured interviews with 12 depressed and 9 nondepressed pregnant women and mothers of young babies, and 13 health care providers. We employed an in-depth framework analysis approach to explore the idioms, descriptions, and perceived causes of depression particular to these women, and compared these with the ICD-10 and DSM-5 criteria for major depression. We found that symptoms of major depression are similar in this township to those described in international criteria (withdrawal, sadness, and poor concentration), but that local descriptions of these symptoms vary. In addition, all the symptoms described by participants were directly related to stressors occurring in the women's lives. These stressors included poverty, unemployment, lack of support from partners, abuse, and death of loved ones, and were exacerbated by unwanted or unplanned pregnancies and the discovery of HIV positive status at antenatal appointments. The study calls attention to the need for specifically designed counselling interventions for perinatal depression that are responsive to the lived experiences of these women and grounded in the broader context of poor socioeconomic conditions and living environments in South Africa, all of which have a direct impact on mental health.

  9. Age and origin of cold climate landforms from the Eastern Cape Drakensberg, southern Africa: palaeoclimatic implications

    NASA Astrophysics Data System (ADS)

    Mills, Stephanie C.; Barrows, Timothy T.; Fifield, L. Keith

    2014-05-01

    Reliable dating is crucial for resolving the nature and timing of cold events in southern Africa and the associated cold climate landforms produced. Evidence for glaciation has been proposed for the Eastern Cape Drakensberg, based on the identification of moraines that were presumed to be of last glacial maximum age. Temperature depressions of 10-17°C have been proposed for this region, based on the presence of these moraines (Lewis and Illgner, 2001) and the identification of a relict rock glacier. Such large temperature depressions are, however, unsupported by other palaeoclimatic proxies in southern Africa. Debate regarding the occurrence of glaciation in southern Africa has been ongoing for several decades. There is good evidence for small-scale glaciation during the last glacial cycle in Lesotho, at elevations exceeding 3000 m a.s.l., but these sites are more than 1000 m higher in elevation than those identified in the Eastern Cape, and suggest a temperature depression of only ~6°C and a change to a winter dominated precipitation regime during the last glacial cycle. This paper presents preliminary cosmogenic nuclide exposure ages for the Eastern Cape 'moraines' and a periglacial blockstream in this region. We discuss potential alternative interpretations for the formation of the landforms and suggest that glaciers were absent in the Eastern Cape Drakensberg during the last glacial period. However, there is widespread evidence for periglacial activity down to an elevation of ~1700 m a.s.l., as illustrated by extensive blockstreams, stone garlands and solifluction deposits. These periglacial deposits suggest that the climate was much colder (~6ºC) during the last glacial cycle, in keeping with other proxy records, but not cold enough to initiate or sustain glaciers at low elevations. References Lewis C. A., Illgner, P. M., 2001. Late Quaternary glaciation in Southern Africa: moraine ridges and glacial deposits at Mount Enterprise in the Drakensberg of the

  10. Beak and feather disease viruses circulating in Cape parrots (Poicepahlus robustus) in South Africa.

    PubMed

    Regnard, Guy L; Boyes, Rutledge S; Martin, Rowan O; Hitzeroth, Inga I; Rybicki, Edward P

    2015-01-01

    Captive and wild psittacines are vulnerable to the highly contagious psittacine beak and feather disease. The causative agent, beak and feather disease virus (BFDV), was recently detected in the largest remaining population of endangered Cape parrots (Poicepahlus robustus), which are endemic to South Africa. Full-length genomes were isolated and sequenced from 26 blood samples collected from wild and captive Cape parrots to determine possible origins of infection. All sequences had characteristic BFDV sequence motifs and were similar in length to those described in the literature. However, BFDV coat protein (CP) sequences from this study did not contain a previously identified bipartite nuclear localisation signal (NLS) within residues 39-56, which indicates that an alternate NLS is involved in shuttling the CP into the nucleus. Sequences from the wild population shared a high degree of similarity, irrespective of year or location, suggesting that the disease outbreak occurred close to the time when the samples were collected. Phylogenetic analysis of full-length genomes showed that the captive Cape parrot sequences cluster with those isolated from captive-bred budgerigars in KwaZulu-Natal Province, South Africa. Exposure to captive-bred Cape parrots from a breeding facility in KwaZulu-Natal is suggested as a possible source for the virus infection. Phylogenetic analysis of BFDV isolates from wild and captive Cape parrots indicated two separate infection events in different populations, which highlights the potential risk of introducing new strains of the virus into the wild population. The present study represents the first systematic investigation of BFDV virus diversity in the southern-most population of Cape parrots.

  11. Individual Grassroots Multilingualism in Africa Town in Guangzhou: The Role of States in Globalization

    ERIC Educational Resources Information Center

    Han, Huamei

    2013-01-01

    Drawing on the first phase of a larger sociolinguistic ethnography, this article explores how individual migrants of African and Chinese backgrounds expand their multilingual repertoires in Africa Town in Guangzhou, China. Focusing on two cases, I demonstrate how they maintain and develop transnational and translocal connections simultaneously…

  12. The influence of environmental variables on the presence of white sharks, Carcharodon carcharias at two popular Cape Town bathing beaches: a generalized additive mixed model.

    PubMed

    Weltz, Kay; Kock, Alison A; Winker, Henning; Attwood, Colin; Sikweyiya, Monwabisi

    2013-01-01

    Shark attacks on humans are high profile events which can significantly influence policies related to the coastal zone. A shark warning system in South Africa, Shark Spotters, recorded 378 white shark (Carcharodon carcharias) sightings at two popular beaches, Fish Hoek and Muizenberg, during 3690 six-hour long spotting shifts, during the months September to May 2006 to 2011. The probabilities of shark sightings were related to environmental variables using Binomial Generalized Additive Mixed Models (GAMMs). Sea surface temperature was significant, with the probability of shark sightings increasing rapidly as SST exceeded 14 °C and approached a maximum at 18 °C, whereafter it remains high. An 8 times (Muizenberg) and 5 times (Fish Hoek) greater likelihood of sighting a shark was predicted at 18 °C than at 14 °C. Lunar phase was also significant with a prediction of 1.5 times (Muizenberg) and 4 times (Fish Hoek) greater likelihood of a shark sighting at new moon than at full moon. At Fish Hoek, the probability of sighting a shark was 1.6 times higher during the afternoon shift compared to the morning shift, but no diel effect was found at Muizenberg. A significant increase in the number of shark sightings was identified over the last three years, highlighting the need for ongoing research into shark attack mitigation. These patterns will be incorporated into shark awareness and bather safety campaigns in Cape Town.

  13. ‘Why do an MPH?’ Motivations and intentions of physicians undertaking postgraduate public health training at the University of Cape Town

    PubMed Central

    Zweigenthal, Virginia E.M.; Marquez, Emma; London, Leslie

    2016-01-01

    Background Public health (PH) approaches underpin the management and transformation of health systems in low- and middle-income countries. Despite the Master of Public Health (MPH) rarely being a prerequisite for health service employment in South Africa, many physicians pursue MPH qualifications. Objectives This study identifies their motivations and career intentions and explored MPH programme strengths and gaps in under- and post-graduate PH training. Design A cross-sectional study using an online questionnaire was completed by physicians graduating with an MPH between 2000 and 2009 and those enrolled in the programme in 2010 at the University of Cape Town. Results Nearly a quarter of MPH students were physicians. Of the 65 contactable physicians, 48% responded. They were mid-career physicians who wished to obtain research training (55%), who wished to gain broader perspectives on health (32%), and who used the MPH to advance careers (90%) as researchers, policy-makers, or managers. The MPH widened professional opportunities, with 62% changing jobs. They believed that inadequate undergraduate exposure should be remedied by applying PH approaches to clinical problems in community settings, which would increase the attractiveness of postgraduate PH training. Conclusions The MPH allows physicians to transition from pure clinical to research, policy and/or management work, preparing them to innovate changes for effective health systems, responsive to the health needs of populations. Limited local job options and incentives are important constraining factors. Advocacy for positions requiring qualifications and benchmarking exit competencies of programmes nationally may promote enrolment. PMID:27741958

  14. A Comparison of the Motor Ability of 8 and 9 Year Old Primary School Children in Hamburg, Melbourne and Cape Town--An Exploratory Study

    ERIC Educational Resources Information Center

    Kretschmer, Jurgen; Saunders, John; Bressan, Liz; Erhorn, Jan; Wirszing, Daniel

    2013-01-01

    An increasing worldwide concern about a decline in the quality of the motor ability of children was the motivation for this exploratory comparative study. It involves a comparison of the motor ability of children aged 8 and 9 years from Hamburg (n = 774), Melbourne (n = 141) and Cape Town (n = 81). Since each of these global cities represents a…

  15. Cape diversification and repeated out-of-southern-Africa dispersal in paper daisies (Asteraceae-Gnaphalieae).

    PubMed

    Bergh, Nicola G; Linder, H Peter

    2009-04-01

    The large daisy tribe Gnaphalieae occurs in extra-tropical habitats worldwide, but is most diverse in southern Africa and in Australia. We explore the age and evolutionary history of the tribe by means of a phylogenetic hypothesis based on Bayesian analysis of plastid and nuclear DNA sequences, maximum likelihood reconstruction of ancestral areas, and relaxed Bayesian dating. Early diversification occurred in southern Africa in the Eocene-Oligocene, resulting in a grade of mostly Cape-centred lineages which subsequently began speciating in the Miocene, consistent with diversification times for many Cape groups. Gnaphalieae from other geographic regions are embedded within a southern African paraphylum, indicating multiple dispersals out of southern Africa since the Oligocene to Miocene which established the tribe in the rest of the world. Colonisation of Australia via direct long-distance trans-oceanic dispersal in the Miocene resulted in the radiation which produced the Australasian gnaphalioid flora. The similarly diverse regional gnaphalioid floras of Australasia and southern Africa thus exhibit very different temporal species accumulation histories. An examination of the timing and direction of trans-Indian Ocean dispersal events in other angiosperms suggests a role for the West Wind Drift in long-distance dispersal eastwards from southern Africa.

  16. Web-based Teaching Radio Interferometer for Africa

    NASA Astrophysics Data System (ADS)

    Carignan, Claude; Libert, Yannick

    2016-10-01

    This presentation describes the web-based Teaching Radio Interferometer being built on the campus of the University of Cape Town, in South Africa, to train the future users of the African VLBI (Very Long Baseline Interferometry) Network (AVN).

  17. Questioning the Pace and Pathway of E-Government Development in Africa: A Case Study of South Africa's Cape Gateway Project

    ERIC Educational Resources Information Center

    Maumbe, Blessing Mukabeta; Owei, Vesper; Alexander, Helen

    2008-01-01

    The paper examines e-government development in Africa. This study is based on the Cape Gateway project in South Africa, a leading e-government initiative on the continent. We observe that African countries have jumped on the e-government band wagon by looking mostly at the benefits without a clear risk assessment. We argue that African countries…

  18. Desertification of subtropical thicket in the Eastern Cape, South Africa: Are there alternatives?

    PubMed

    Kerley, G I; Knight, M H; de Kock, M

    1995-01-01

    The Eastern Cape Subtropical Thicket (ECST) froms the transition between forest, semiarid karroid shrublands, and grassland in the Eastern Cape, South Africa. Undegraded ECST forms an impenetrable, spiny thicket up to 3 m high consisting of a wealth of growth forms, including evergreen plants, succulent and deciduous shrubs, lianas, grasses, and geophytes. The thicket dynamics are not well understood, but elephants may have been important browsers and patch disturbance agents. These semiarid thickets have been subjected to intensive grazing by domestic ungulates, which have largely replaced indigenous herbivores over the last 2 centuries. Overgrazing has extensively degraded vegetation, resulting in the loss of phytomass and plant species and the replacement of perennials by annuals. Coupled with these changes are alterations of soil structure and secondary productivity. This rangeland degradation has largely been attributed to pastoralism with domestic herbivores. The impact of indigenous herbivores differs in scale, intensity, and nature from that of domestic ungulates. Further degradation of the ECST may be limited by alternative management strategies, including the use of wildlife for meat production and ecotourism. Producing meat from wildlife earns less income than from domestic herbivores but is ecologically sustainable. The financial benefits of game use can be improved by developing expertise, technology, and marketing. Ecotourism is not well developed in the Eastern Cape although the Addo Elephant National Park is a financial success and provides considerable employment benefits within an ecologically sustainable system. The density of black rhinoceros and elephant in these thickets is among the highest in Africa, with high population growth and the lowest poaching risk. The financial and ecological viability of ecotourism and the conservation status of these two species warrant expanding ecotourism in the Eastern Cape, thereby reducing the probability of

  19. Foraging potential of underground storage organ plants in the southern Cape, South Africa.

    PubMed

    Singels, Elzanne; Potts, Alastair J; Cowling, Richard M; Marean, Curtis W; De Vynck, Jan; Esler, Karen J

    2016-12-01

    Underground storage organs (USOs) serve as a staple source of carbohydrates for many hunter-gatherer societies and they feature prominently in discussions of diets of early modern humans. While the way of life of hunter-gatherers in South Africa's Cape no longer exists, there is extensive ethnographic, historical, and archaeological evidence of hunter-gatherers' use of USOs. This is to be expected, given that the Cape supports the largest concentration of plant species with USOs globally. The southern Cape is the location of several Middle Stone Age sites that are highly significant to research on the origins of behaviourally modern humans, and this provided the context for our research. Here, we evaluate the foraging potential of USOs by identifying how abundant edible biomass is in the southern Cape, how easily it is gathered, and how nutritious it is. One hundred 5 × 5 m plots were assessed in terms of USO species and abundance. Nearly all of the sites sampled (83%) contained edible USOs and some had high concentrations of edible biomass. Extrapolating from these sites suggests that the edible USO biomass falls within the range of biomass observed in areas supporting extant hunter-gatherer communities. The nutritional content for six USO species was assessed; these contained between 40 and 228 calories/100 g. Furthermore, foraging events were staged to provide an indication of the potential return rates for the same six USOs. The target species grow near the soil surface, mostly in sandy soils, and were gathered with minimal effort. Some 50% of the foraging events conducted yielded enough calories to meet the daily requirements of a hunter-gatherer within two hours. In conclusion, we demonstrate that USOs are a readily available source of carbohydrates in the southern Cape landscape and, therefore, there is a strong possibility that USOs played a critical role in providing food for early humans.

  20. The use of visual methods to explore how children construct and assign meaning to the “self” within two urban communities in the Western Cape, South Africa

    PubMed Central

    Benninger, Elizabeth; Savahl, Shazly

    2016-01-01

    This study aimed to explore how children construct and assign meaning to the “self” within two urban communities of Cape Town in South Africa. Using a child participation methodological framework data were collected using Photovoice and community maps with 54 participants between the ages of 9 and 12. Feelings of safety, social connectedness, and children's spaces were found to be central to the ways in which the participants constructed and assigned meaning to the “self.” The study provides implications for intervention programmes aimed at improving children's well-being to be inclusive of activities aimed at improving children's self-concept, including the construction of safe spaces for children to play, learn, and form meaningful relationships. PMID:27291161

  1. Phylogeography of the Cape velvet worm (Onychophora: Peripatopsis capensis) reveals the impact of Pliocene/Pleistocene climatic oscillations on Afromontane forest in the Western Cape, South Africa.

    PubMed

    McDonald, D E; Daniels, S R

    2012-05-01

    Habitat specialists such as soft-bodied invertebrates characterized by low dispersal capability and sensitivity to dehydration can be employed to examine biome histories. In this study, the Cape velvet worm (Peripatopsis capensis) was used to examine the impacts of climatic oscillations on historical Afromontane forest in the Western Cape, South Africa. Divergence time estimates suggest that the P. capensis species complex diverged during the Pliocene epoch. This period was characterized by dramatic climatic and topographical change. Subsequently, forest expansion and contraction cycles led to diversification within P. capensis. Increased levels of genetic differentiation were observed along a west-to-south-easterly trajectory because the south-eastern parts of the Cape Fold Mountain chain harbour larger, more stable fragments of forest patches, have more pronounced habitat heterogeneity and have historically received higher levels of rainfall. These results suggest the presence of three putative species within P. capensis, which are geographically discreet and genetically distinct.

  2. 'A thing full of stories': Traditional healers' explanations of epilepsy and perspectives on collaboration with biomedical health care in Cape Town.

    PubMed

    Keikelame, Mpoe Johannah; Swartz, Leslie

    2015-10-01

    The experience of epilepsy is profoundly culturally mediated and the meanings attributed to the condition can have a great impact on its social course. This qualitative study used Kleinman's Explanatory Model framework to explore traditional healers' perspectives on epilepsy in an urban township in Cape Town, South Africa. The healers who participated in the study were Xhosa-speaking, had experience caring for patients with epilepsy, and had not received any training on epilepsy. Six individual in-depth interviews and one focus group with nine traditional healers were conducted using a semi-structured interview guide. Traditional healers identified several different names referring to epilepsy. They explained epilepsy as a thing inside the body which is recognized by the way it presents itself during an epileptic seizure. According to these healers, epilepsy is difficult to understand because it is not easily detectable. Their biomedical explanations of the cause of epilepsy included, among others, lack of immunizations, child asphyxia, heredity, traumatic birth injuries and dehydration. These healers believed that epilepsy could be caused by amafufunyana (evil spirits) and that biomedical doctors could not treat the supernatural causes of epilepsy. However, the healers believed that western medicines, as well as traditional medicines, could be effective in treating the epileptic seizures. Traditional healers were supportive of collaboration with western-trained practitioners and highlighted that the strategy must have formal agreements in view of protection of intellectual property, accountability and respect of their indigenous knowledge. The findings suggest a need for interventions that promote cultural literacy among mental health practitioners. Research is urgently needed to assess the impact of such collaborations between biomedical services and traditional healers on epilepsy treatment and care.

  3. ‘A Thing Full of Stories’: Traditional healers’ explanations of epilepsy and perspectives on collaboration with biomedical health care in Cape Town

    PubMed Central

    Keikelame, Mpoe Johannah; Swartz, Leslie

    2015-01-01

    The experience of epilepsy is profoundly culturally mediated and the meanings attributed to the condition can have a great impact on its social course. This qualitative study used Kleinman’s Explanatory Model framework to explore traditional healers’ perspectives on epilepsy in an urban township in Cape Town, South Africa. The healers who participated in the study were Xhosa-speaking, had experience caring for patients with epilepsy, and had not received any training on epilepsy. Six individual in-depth interviews and one focus group with nine traditional healers were conducted using a semi-structured interview guide. Traditional healers identified several different names referring to epilepsy. They explained epilepsy as a thing inside the body which is recognized by the way it presents itself during an epileptic seizure. According to these healers, epilepsy is difficult to understand because it is not easily detectable. Their biomedical explanations of the cause of epilepsy included, among others, lack of immunizations, child asphyxia, heredity, traumatic birth injuries and dehydration. These healers believed that epilepsy could be caused by amafufunyana (evil spirits) and that biomedical doctors could not treat the supernatural causes of epilepsy. However, the healers believed that western medicines, as well as traditional medicines, could be effective in treating the epileptic seizures. Traditional healers were supportive of collaboration with western-trained practitioners and highlighted that the strategy must have formal agreements in view of protection of intellectual property, accountability and respect of their indigenous knowledge. The findings suggest a need for interventions that promote cultural literacy among mental health practitioners. Research is urgently needed to assess the impact of such collaborations between biomedical services and traditional healers on epilepsy treatment and care. PMID:25680366

  4. Tuberculosis Disease during Pregnancy and Treatment Outcomes in HIV-Infected and Uninfected Women at a Referral Hospital in Cape Town

    PubMed Central

    Bekker, Adrie; Schaaf, Hendrik S.; Draper, Heather R.; Kriel, Magdalena; Hesseling, Anneke C.

    2016-01-01

    Background Tuberculosis during pregnancy and treatment outcomes are poorly defined in high prevalence tuberculosis and HIV settings. Methods A prospective cohort study of pregnant and postpartum women identified to be routinely on antituberculosis treatment was conducted at Tygerberg Hospital, Cape Town, South Africa, from January 2011 through December 2011. Maternal tuberculosis disease spectrum and tuberculosis-exposed newborns were characterized by maternal HIV status. Maternal tuberculosis treatment outcomes were documented and a multivariable regression model identified predictors of unfavourable tuberculosis treatment outcomes. Infant outcomes were also described. Results Seventy-four women with tuberculosis, 53 (72%) HIV-infected, were consecutively enrolled; 35 (47%) were diagnosed at delivery or postpartum and 22 (30%) of women reported previous antituberculosis treatment. HIV-infected women were 5.67 times more likely to have extrapulmonary tuberculosis (95% CI 1.18–27.25, p = 0.03). All 5 maternal deaths were amongst HIV-infected women. Birth outcomes were available for 75 newborns (2 sets of twins, missing data for 1 stillbirth). Of the 75 newborns, 49 (65%) were premature and 44 (59%) were low birth weight (LBW; <2500 grams). All 6 infants who died and the 4 stillbirths were born to HIV-infected women. Unfavourable tuberculosis treatment outcomes were documented in 33/74 (45%) women. Unfavourable maternal tuberculosis outcome was associated with delivery of LBW infants (OR 3.83; 95% CI 1.40–10.53, p = 0.009). Conclusions A large number of pregnant women with tuberculosis presented at a provincial referral hospital. All maternal and infant deaths occurred in HIV-infected women and their newborns. Maternal tuberculosis treatment outcomes were poor. PMID:27812086

  5. Genome-wide analyses of HTLV-1aD strains from Cape Verde, Africa

    PubMed Central

    Zanella, Louise; de Pina-Araujo I, Isabel; Morgado, Mariza G; Vicente, Ana Carolina

    2016-01-01

    We characterised and reported the first full-length genomes of Human T-cell Lymphotropic Virus Type 1 subgroup HTLV-1aD (CV21 and CV79). This subgroup is one of the major determinants of HTLV-1 infections in North and West Africa, and recombinant strains involving this subgroup have been recently demonstrated. The CV21 and CV79 strains from Cape Verde/Africa were characterised as pure HTLV-1aD genomes, comparative analyses including HTLV-1 subtypes and subgroups revealed HTLV-1aD signatures in the envelope, pol, and pX regions. These genomes provide original information that will contribute to further studies on HTLV-1a epidemiology and evolution. PMID:27653363

  6. Racism and medical science in South Africa's Cape Colony in the mid- to late nineteenth century.

    PubMed

    Deacon, H

    2000-01-01

    Racism has been a particular focus of the history of Western medicine in colonial South Africa. Much of the research to date has paradoxically interpreted Western medicine as both a handmaiden of colonialism and as a racist gatekeeper to the benefits of Western medical science. This essay suggests that while these conclusions have some validity, the framework in which they have been devised is problematic. Not only is that framework contradictory in nature, it underplays differences within Western medicine, privileges the history of explicit and intentional racial discrimination in medicine, and encourages a separate analysis of racism in law, in the medical profession, and in medical theory and practice. Using the example of the Cape Colony in South Africa, this paper shows how legislation, class, institutional setting, and popular stereotypes could influence the form, timing, and degree of racism in the medical professional, and in medical theory and practice. It also argues for an analytical distinction between 'racist medicine' and 'medical racism.'

  7. Genome-wide analyses of HTLV-1aD strains from Cape Verde, Africa.

    PubMed

    Zanella, Louise; Pina-Araujo I, Isabel de; Morgado, Mariza G; Vicente, Ana Carolina

    2016-09-01

    We characterised and reported the first full-length genomes of Human T-cell Lymphotropic Virus Type 1 subgroup HTLV-1aD (CV21 and CV79). This subgroup is one of the major determinants of HTLV-1 infections in North and West Africa, and recombinant strains involving this subgroup have been recently demonstrated. The CV21 and CV79 strains from Cape Verde/Africa were characterised as pure HTLV-1aD genomes, comparative analyses including HTLV-1 subtypes and subgroups revealed HTLV-1aD signatures in the envelope, pol, and pX regions. These genomes provide original information that will contribute to further studies on HTLV-1a epidemiology and evolution.

  8. Topography as a driver of diversification in the Cape Floristic Region of South Africa.

    PubMed

    Verboom, G Anthony; Bergh, Nicola G; Haiden, Sarah A; Hoffmann, Vera; Britton, Matthew N

    2015-07-01

    The rugged topography of the Cape Floristic Region (CFR), South Africa, is frequently invoked to explain the spectacular radiation of the Cape flora, but the mechanisms involved remain unclear. Where recent authors emphasize the importance of elevation gradients as stimuli for ecological speciation, earlier workers stressed the role of topography as an isolating mechanism, particularly in montane lineages. Using six Cape plant lineages, we tested whether elevation niches are phylogenetically conserved. We then assessed whether high-elevation species are more consistently range-restricted than low-elevation species, and whether high-elevation sisters show stronger range exclusivity (allopatry) and weaker ecological and phenotypic differentiation, suggestive of nonecological speciation. Elevation niches tend to be phylogenetically conserved. Also, high-elevation species are more consistently range-restricted than low-elevation species, potentially explaining the generally stronger range exclusivity of high-elevation sisters. While the high-elevation zone is less homogeneous ecologically, more data are required to demonstrate that high-elevation sister species show generally weaker ecological and phenotypic differentiation. Topographic complexity promotes geographical isolation at high elevations, thereby providing opportunities for nonecological, vicariant speciation. While recognizing the need for additional data, we suggest that the upland and lowland floras of the CFR may differ with regard to predominant speciation mode.

  9. Incidence and Molecular Characterization of Hepatitis E Virus from Swine in Eastern Cape, South Africa

    PubMed Central

    Chuks Iweriebor, Benson; Nwodo, U. U.; Obi, Larry Chikwelu; Okoh, Anthony Ifeanyi

    2017-01-01

    Hepatitis E virus-mediated infection is a serious public health concern in economically developing nations of the world. Globally, four major genotypes of HEV have been documented. Hepatitis E has been suggested to be zoonotic owing to the increase of evidence through various studies. Thus far, this paper reports on prevalence of hepatitis E virus among swine herd in selected communal and commercial farms in the Eastern Cape Province of South Africa. A total of 160 faecal samples were collected from swine herds in Amathole and Chris Hani District Municipalities of Eastern Cape Province for the presence of HEV. Of the 160 faecal samples screened, only seven were positive (4.4%) for HEV. The nucleotide sequences analyses revealed the isolates as sharing 82% to 99% identities with other strains (KX896664, KX896665, KX896666, KX896667, KX896668, KX896669, and KX896670) from different regions of the world. We conclude that HEV is present among swine in the Eastern Cape Province, albeit in low incidence, and this does have public health implications. There is a need for maintenance of high hygienic standards in order to prevent human infections through swine faecal materials and appropriate cooking of pork is highly advised. PMID:28191016

  10. Immediate and long-term results of mitral valve replacement with University of Cape Town mitral valve prosthesis

    PubMed Central

    Schrire, Velva; Barnard, Christiaan N.

    1970-01-01

    We describe seven years' experience with the University of Cape Town lenticular mitral valve prosthesis in 122 patients. All the patients had severe mitral valve disease. In 98 severe mitral stenosis was present with or without incompetence and in 24 the dominant or sole lesion was mitral incompetence. Other valves, particularly the tricuspid, were also frequently affected. The disability was severe or total in almost every patient. One hundred and five patients were discharged from hospital, and in 90 per cent of these the clinical improvement was most gratifying, with the disappearance of pulmonary oedema, paroxysmal dyspnoea, angina pectoris, and congestive cardiac failure. Return to full normal activity including physical work was the rule. The hospital mortality was 14 per cent and a further 38 per cent died during the follow-up period. The major post-operative complication was systemic embolism which could occur at any time after operation. The most important factor influencing the frequency of this complication was the nature of the valve seat. A bare steel seat was associated with a 100 per cent embolism, and a significant reduction occurred when a cloth-covered seat of Dacron-velour was introduced. Anticoagulant therapy appeared to prevent large or fresh clots but had no effect on the deposition of fibrin or platelet thrombi. The only other factor of importance was the age of the patient: after the age of 50 life expectancy and trouble-free long-term survival was reduced. Images PMID:5440520

  11. Late Quaternary dietary shifts of the Cape grysbok ( Raphicerus melanotis) in southern Africa

    NASA Astrophysics Data System (ADS)

    Faith, J. Tyler

    2011-01-01

    The Cape grysbok is endemic to southern Africa's Cape Floral Region where it selectively browses various species of dicotyledonous vegetation. Fossil evidence indicates that the grysbok persisted under glacial and interglacial conditions throughout the late Quaternary and inhabited a range of environments. This study employs mesowear analysis to reconstruct grysbok diets over time and in response to changing environments at Nelson Bay Cave, Die Kelders Cave 1, Klasies River Mouth, and Swartklip 1. Results indicate that the amount of grasses (monocots) versus leafy vegetation (dicots) included in the diet fluctuated over time and largely in agreement with changes in faunal community structure. The case for dietary flexibility is particularly clear at Nelson Bay Cave, where there is a significant trend from mixed feeding towards increased browsing from the late Pleistocene (~ 18,500 14C yr BP) through the Holocene. Dietary shifts at Nelson Bay Cave are consistent with the hypothesis that declining grassland productivity is responsible for the terminal Pleistocene extinction of several large ungulates in southern Africa. Furthermore, the short-term dietary shifts demonstrated here (100s to 1000s of years) provide an important caution against relying on taxonomic uniformitarianism when reconstructing the dietary preferences of fossil ungulates, both extant and extinct.

  12. 'One Man Can': shifts in fatherhood beliefs and parenting practices following a gender-transformative programme in Eastern Cape, South Africa.

    PubMed

    van den Berg, Wessel; Hendricks, Lynn; Hatcher, Abigail; Peacock, Dean; Godana, Patrick; Dworkin, Shari

    2013-02-01

    'One Man Can' (OMC) is a rights-based gender equality and health programme implemented by Sonke Gender Justice in South Africa. It has been featured as an example of best practice by the World Health Organization, UNAIDS, and the UN Population Fund, and translated into nearly a dozen languages and implemented all across Africa. South Africa has strong gender and HIV-related policies, but the highest documented level of men's violence against women in the world, and the largest number of people living with HIV. In this context, OMC seeks to improve men's relationships with their partners, children, and families, reduce the spread and impact of HIV and AIDS, and reduce violence against women, men, and children. To understand whether and how OMC workshops brought about changes in men's attitudes and practices related to parenting, an academic-non-government organisation partnership was carried out with the University of California at San Francisco, the University of Cape Town, and Sonke. The workshops appear to have contributed powerfully to improved parenting and more involved and responsible fathering. This article shares our findings in more detail and discusses the promises and challenges of gender-transformative work with men, underscoring the implications of this work for the health and well-being of women, children, and men.

  13. ‘One Man Can’: shifts in fatherhood beliefs and parenting practices following a gender-transformative programme in Eastern Cape, South Africa

    PubMed Central

    van den Berg, Wessel; Hendricks, Lynn; Hatcher, Abigail; Peacock, Dean; Godana, Patrick; Dworkin, Shari

    2013-01-01

    ‘One Man Can’ (OMC) is a rights-based gender equality and health programme implemented by Sonke Gender Justice in South Africa. It has been featured as an example of best practice by the World Health Organization, UNAIDS, and the UN Population Fund, and translated into nearly a dozen languages and implemented all across Africa. South Africa has strong gender and HIV-related policies, but the highest documented level of men’s violence against women in the world, and the largest number of people living with HIV. In this context, OMC seeks to improve men’s relationships with their partners, children, and families, reduce the spread and impact of HIV and AIDS, and reduce violence against women, men, and children. To understand whether and how OMC workshops brought about changes in men’s attitudes and practices related to parenting, an academic–non-government organisation partnership was carried out with the University of California at San Francisco, the University of Cape Town, and Sonke. The workshops appear to have contributed powerfully to improved parenting and more involved and responsible fathering. This article shares our findings in more detail and discusses the promises and challenges of gender-transformative work with men, underscoring the implications of this work for the health and well-being of women, children, and men. PMID:24000276

  14. Substance abuse prevention in Cape Town's peri-urban settlements: local health trainers' perspectives

    PubMed Central

    Puljević, Cheneal; Learmonth, Despina

    2014-01-01

    South Africa currently experiences high levels of alcohol and other drug (AOD) abuse. As a result there is a need for the initiation of regional AOD abuse prevention programmes with a specific focus on youth prevention strategies. The Medical Knowledge Institute (MKI) is a non-profit organisation which develops and facilitates health information workshops to members of disadvantaged peri-urban communities in South Africa. This research investigated the views of eight local MKI health trainers on factors contributing to AOD abuse in their communities. Although the expected focus of the discussion was on prevention strategies and effective interventions, the trainers placed more emphasis on the individual and community factors influencing AOD abuse. The themes which emerged through the research included: status, government, (di)stress, gender, recreation, consequences and community. This research holds significance as it has the potential to assist further development of community-based AOD prevention workshops and to guide public health policy and service development for AOD abuse. PMID:25750776

  15. Risk factors for incident HIV infection among antenatal mothers in rural Eastern Cape, South Africa

    PubMed Central

    Businge, Charles Bitamazire; Longo-Mbenza, Benjamin; Mathews, Verona

    2016-01-01

    Background The prevalence of HIV among antenatal clients in South Africa has remained at a very high rate of about 29% despite substantial decline in several sub-Saharan countries. There is a paucity of data on risk factors for incident HIV infection among antenatal mothers and women within the reproductive age bracket in local settings in the Eastern Cape, South Africa. Objective To establish the risk factors for incident HIV infection among antenatal clients aged 18–49 years attending public antenatal clinics in rural Eastern Cape, South Africa. Design This was an unmatched case–control study carried out in public health antenatal clinics of King Sabata District Municipality between January and March 2014. The cases comprised 100 clients with recent HIV infection; the controls were 200 HIV-negative antenatal clients. Socio-demographic, sexual, and behavioral data were collected using interviewer-administered questionnaires adapted from the standard DHS5 women's questionnaire. Multivariate logistic regression models were used to identify the independent risk factors for HIV infection. A p<0.05 was considered statistically significant. Results The independent risk factors for incident HIV infection were economic dependence on the partner, having older male partners especially among women aged ≤20 years, and sex under the influence of alcohol. Conclusions Therefore, effective prevention of HIV among antenatal mothers in KSDM must target the improvement of the economic status of women, thereby reducing economic dependence on their sexual partners; address the prevalent phenomenon of cross-generation sex among women aged <20 years; and regulate the brewing, marketing, and consumption of alcohol. PMID:26800877

  16. Paleoenvironmental and Human Behavioral Implications of the Boegoeberg 1 Late Pleistocene Hyena Den, Northern Cape Province, South Africa

    NASA Astrophysics Data System (ADS)

    Klein, Richard G.; Cruz-Uribe, Kathryn; Halkett, David; Hart, Tim; Parkington, John E.

    1999-11-01

    Boegoeberg 1 (BOG1) is located on the Atlantic coast of South Africa, 850 km north of Cape Town. The site is a shallow rock shelter in the side of a sand-choked gully that was emptied by diamond miners. Abundant coprolites, chewed bones, and partially digested bones implicate hyenas as the bone accumulators. The location of the site, quantity of bones, and composition of the fauna imply it was a brown hyena nursery den. The abundance of Cape fur seal bones shows that the hyenas had ready access to the coast. Radiocarbon dates place the site before 37,000 14C yr ago, while the large average size of the black-backed jackals and the presence of extralimital ungulates imply cool, moist conditions, probably during the early part of the last glaciation (isotope stage 4 or stage 3 before 37,000 14C yr ago) or perhaps during one of the cooler phases (isotope substages 5d or 5b) within the last interglaciation. Comparisons of the BOG1 seal bones to those from regional Middle Stone Age (MSA) and Later Stone Age (LSA) archeological sites suggest (1) that hyena and human seal accumulations can be distinguished by a tendency for vertebrae to be much more common in a hyena accumulation and (2) that hyena and LSA accumulations can be distinguished by a tendency for hyena-accumulated seals to represent a much wider range of individual seal ages. Differences in the way hyenas and people dismember, transport, and consume seal carcasses probably explain the contrast in skeletal part representation, while differences in season of occupation explain the contrast in seal age representation. Like modern brown hyenas, the BOG1 hyenas probably occupied the coast year-round, while the LSA people focused their coastal visits on the August-October interval when nine-to-eleven-month-old seals were abundant. The MSA sample from Klasies River Mouth Cave 1 resembles BOG1 in seal age composition, suggesting that unlike LSA people, MSA people obtained seals more or less throughout the year.

  17. Diversity and Contested Social Identities in Multilingual and Multicultural Contexts of the University of the Western Cape, South Africa

    ERIC Educational Resources Information Center

    Banda, Felix; Peck, Amiena

    2016-01-01

    We draw on Rampton's "Crossing: Language and Ethnicity Among Adolescents" (2014. 2nd ed. New York: Routledge) notion of "crossing" to explore contestations in ethnolinguistic, cultural and racial affiliations at the University of the Western Cape (UWC), a university built for "Coloureds" in apartheid South Africa, but…

  18. Environmental monitoring of pesticide residues from farms at a neighbouring primary and pre-school in the Western Cape in South Africa.

    PubMed

    Dalvie, M A; Sosan, M B; Africa, A; Cairncross, E; London, L

    2014-01-01

    Concerns about pesticide drift from neighbouring vineyards affecting children attending school on a farm adjacent to an urban suburb of Cape Town, Western Cape in South Africa were investigated. The study involved a before-after design, measuring levels of environmental exposure before and during pesticide application activities on the neighbouring farms. Samples were collected in air, dust and grass cuttings at the preschool and primary school located on the farms during September-December in 2010 and tested for pesticides using multi-pesticide methods. Eleven different pesticides were detected in the various samples. Six of these chemicals (endosulfan, dimethomorph, penconazole, cyprodinil, boscalid and bromopropylate) were on the spraying schedules of the two farms neighbouring the schools and the timing and location of detection were generally consistent with farm application. Three pesticides detected (chlorpyrifos, cypermethrin, permethrin) are agents commonly used in household applications and one (pyriproxifen) is used in pet treatment agents. Kresoxim-methyl, the other pesticide detected, is likely to come from drift from other farms in the area. The concentration of pesticides was all lower than 0.1 μg/m(3) in air and 0.1 μg/kg in dust and grass apart from permethrin and cypermethrin. The findings confirm the presence of drift onto the school premises and concentrations found in this study were generally low in comparison to that detected in other studies. Regular monitoring to track the effectiveness of containment and mitigation measures that reduce drift is recommended.

  19. Impacts of drought on grape yields in Western Cape, South Africa

    NASA Astrophysics Data System (ADS)

    Araujo, Julio A.; Abiodun, Babatunde J.; Crespo, Olivier

    2016-01-01

    Droughts remain a threat to grape yields in South Africa. Previous studies on the impacts of climate on grape yield in the country have focussed on the impact of rainfall and temperature separately; meanwhile, grape yields are affected by drought, which is a combination of rainfall and temperature influences. The present study investigates the impacts of drought on grape yields in the Western Cape (South Africa) at district and farm scales. The study used a new drought index that is based on simple water balance (Standardized Precipitation Evapotranspiration Index; hereafter, SPEI) to identify drought events and used a correlation analysis to identify the relationship between drought and grape yields. A crop simulation model (Agricultural Production Systems sIMulator, APSIM) was applied at the farm scale to investigate the role of irrigation in mitigating the impacts of drought on grape yield. The model gives a realistic simulation of grape yields. The Western Cape has experienced a series of severe droughts in the past few decades. The severe droughts occurred when a decrease in rainfall occurred simultaneously with an increase in temperature. El Niño Southern Oscillation (ENSO) appears to be an important driver of drought severity in the Western Cape, because most of the severe droughts occurred in El Niño years. At the district scale, the correlation between drought index and grape yield is weak ( r≈-0.5), but at the farm scale, it is strong ( r≈-0.9). This suggests that many farmers are able to mitigate the impacts of drought on grape yields through irrigation management. At the farm scale, where the impact of drought on grape yields is high, poor yield years coincide with moderate or severe drought periods. The APSIM simulation, which gives a realistic simulation of grape yields at the farm scale, suggests that grape yields become more sensitive to spring and summer droughts in the absence of irrigation. Results of this study may guide decision-making on

  20. Water Sources in Cape Verde and West Africa. Water in Africa.

    ERIC Educational Resources Information Center

    Maher, Robert

    The Water in Africa Project was realized over a 2-year period by a team of Peace Corps volunteers, World Wise Schools (WWS) classroom teachers, and WWS staff members. As part of an expanded, detailed design, resources were collected from over 90 volunteers serving in African countries, photos and stories were prepared, and standards-based learning…

  1. Oxygen, hydrogen, and helium isotopes for investigating groundwater systems of the Cape Verde Islands, West Africa

    NASA Astrophysics Data System (ADS)

    Heilweil, Victor M.; Solomon, D. Kip; Gingerich, Stephen B.; Verstraeten, Ingrid M.

    2009-07-01

    Stable isotopes (δ18O, δ2H), tritium (3H), and helium isotopes (3He, 4He) were used for evaluating groundwater recharge sources, flow paths, and residence times of three watersheds in the Cape Verde Islands (West Africa). Stable isotopes indicate the predominance of high-elevation precipitation that undergoes little evaporation prior to groundwater recharge. In contrast to other active oceanic hotspots, environmental tracers show that deep geothermal circulation does not strongly affect groundwater. Low tritium concentrations at seven groundwater sites indicate groundwater residence times of more than 50 years. Higher tritium values at other sites suggest some recent recharge. High 4He and 3He/4He ratios precluded 3H/3He dating at six sites. These high 3He/4He ratios (R/Ra values of up to 8.3) are consistent with reported mantle derived helium of oceanic island basalts in Cape Verde and provided end-member constraints for improved dating at seven other locations. Tritium and 3H/3He dating shows that São Nicolau Island’s Ribeira Fajã Basin has groundwater residence times of more than 50 years, whereas Fogo Island’s Mosteiros Basin and Santo Antão Island’s Ribeira Paul Basin contain a mixture of young and old groundwater. Young ages at selected sites within these two basins indicate local recharge and potential groundwater susceptibility to surface contamination and/or salt-water intrusion.

  2. Oxygen, hydrogen, and helium isotopes for investigating groundwater systems of the Cape Verde Islands, West Africa

    USGS Publications Warehouse

    Heilweil, V.M.; Solomon, K.D.; Gingerich, S.B.; Verstraeten, Ingrid M.

    2009-01-01

    Stable isotopes (??18O, ??2H), tritium (3H), and helium isotopes (3He, 4He) were used for evaluating groundwater recharge sources, flow paths, and residence times of three watersheds in the Cape Verde Islands (West Africa). Stable isotopes indicate the predominance of high-elevation precipitation that undergoes little evaporation prior to groundwater recharge. In contrast to other active oceanic hotspots, environmental tracers show that deep geothermal circulation does not strongly affect groundwater. Low tritium concentrations at seven groundwater sites indicate groundwater residence times of more than 50 years. Higher tritium values at other sites suggest some recent recharge. High 4He and 3He/4He ratios precluded 3H/3He dating at six sites. These high 3He/4He ratios (R/Ra values of up to 8.3) are consistent with reported mantle derived helium of oceanic island basalts in Cape Verde and provided end-member constraints for improved dating at seven other locations. Tritium and 3H/3He dating shows that S??o Nicolau Island's Ribeira Faj?? Basin has groundwater residence times of more than 50 years, whereas Fogo Island's Mosteiros Basin and Santo Ant??o Island's Ribeira Paul Basin contain a mixture of young and old groundwater. Young ages at selected sites within these two basins indicate local recharge and potential groundwater susceptibility to surface contamination and/or salt-water intrusion. ?? Springer-Verlag 2009.

  3. Erosion-land use change-climate change nexus in the Eastern Cape Province, South Africa

    NASA Astrophysics Data System (ADS)

    Kakembo, Vincent

    2016-04-01

    Unlike many parts of the world where land recovery has been realised as a response to less dependence on land for a livelihood, soil erosion - mainly on abandoned cultivated and overgrazed communal lands in the Eastern Cape Province of South Africa - has intensified. Land abandonment is attributed by most elderly land users to drought that hit the area in the 1960s. The interaction among land-degradation drivers - ranging from soil properties, topography, land-use changes and vegetation to local climate - has given rise to a self-amplifying land degradation feedback loop that has perpetuated severe forms of soil erosion. This has rendered the degraded areas particularly vulnerable to climate change impacts on water. The perpetual degradation calls for developing a dedicated policy on the management and rehabilitation of eroded lands. Restoration approaches should entail promoting disconnectivity on eroded hillslopes. Communal farmers also have to be sensitised and empowered to take ownership of the land-restoration process.

  4. Phytotherapeutic Information on Plants Used for the Treatment of Tuberculosis in Eastern Cape Province, South Africa

    PubMed Central

    Lawal, I. O.; Grierson, D. S.; Afolayan, A. J.

    2014-01-01

    The current rate of deforestation in Africa constitutes a serious danger to the future of medicinal plants on this continent. Conservation of these medicinal plants in the field and the scientific documentation of our knowledge about them are therefore crucial. An ethnobotanical survey of plants used for the treatment of tuberculosis (TB) was carried out in selected areas of the Eastern Cape, South Africa. These areas were Hala, Ncera, Sheshegu, and Gquamashe, all within the Nkonkobe Municipality. One hundred informants were interviewed. The survey included the identification of scientific and vernacular names of the plants used for treatment of TB as well as the methods of preparation and administration, the part used, dosage, and duration of treatment. The survey revealed 30 plants belonging to 21 families which are commonly used by traditional healers for the treatment of TB and associated diseases. Of these plants Clausena anisata, Haemanthus albiflos, and Artemisia afra were the most cited. The leaves were the most common part used in the medicinal preparations. Our findings are discussed in relation to the importance of the documentation of medicinal plants. PMID:24864158

  5. Estimating the age of fire in the Cape flora of South Africa from an orchid phylogeny

    PubMed Central

    Bytebier, Benny; Antonelli, Alexandre; Bellstedt, Dirk U.; Linder, H. Peter

    2011-01-01

    Fire may have been a crucial component in the evolution of the Cape flora of South Africa, a region characterized by outstanding levels of species richness and endemism. However, there is, to date, no critical assessment of the age of the modern fire regime in this biome. Here, we exploit the presence of two obligate post-fire flowering clades in the orchid genus Disa, in conjunction with a robust, well-sampled and dated molecular phylogeny, to estimate the age by which fire must have been present. Our results indicate that summer drought (winter rainfall), the fire regime and the fynbos vegetation are several million years older than currently suggested. Summer drought and the fynbos vegetation are estimated to date back to at least the Early Miocene (ca 19.5 Ma). The current fire regime may have been established during a period of global cooling that followed the mid-Miocene Climatic Optimum (ca 15 Ma), which led to the expansion of open habitats and increased aridification. The first appearance of Disa species in the grassland biome, as well as in the subalpine habitat, is in striking agreement with reliable geological and palaeontological evidence of the age of these ecosystems, thus corroborating the efficacy of our methods. These results change our understanding of the historical mechanisms underlying botanical evolution in southern Africa, and confirm the potential of using molecular phylogenies to date events for which other information is lacking or inconclusive. PMID:20685712

  6. Estimating the age of fire in the Cape flora of South Africa from an orchid phylogeny.

    PubMed

    Bytebier, Benny; Antonelli, Alexandre; Bellstedt, Dirk U; Linder, H Peter

    2011-01-22

    Fire may have been a crucial component in the evolution of the Cape flora of South Africa, a region characterized by outstanding levels of species richness and endemism. However, there is, to date, no critical assessment of the age of the modern fire regime in this biome. Here, we exploit the presence of two obligate post-fire flowering clades in the orchid genus Disa, in conjunction with a robust, well-sampled and dated molecular phylogeny, to estimate the age by which fire must have been present. Our results indicate that summer drought (winter rainfall), the fire regime and the fynbos vegetation are several million years older than currently suggested. Summer drought and the fynbos vegetation are estimated to date back to at least the Early Miocene (ca 19.5 Ma). The current fire regime may have been established during a period of global cooling that followed the mid-Miocene Climatic Optimum (ca 15 Ma), which led to the expansion of open habitats and increased aridification. The first appearance of Disa species in the grassland biome, as well as in the subalpine habitat, is in striking agreement with reliable geological and palaeontological evidence of the age of these ecosystems, thus corroborating the efficacy of our methods. These results change our understanding of the historical mechanisms underlying botanical evolution in southern Africa, and confirm the potential of using molecular phylogenies to date events for which other information is lacking or inconclusive.

  7. Differing Patterns of Overweight and Obesity among Black Men and Women in Cape Town: The CRIBSA Study

    PubMed Central

    Peer, Nasheeta; Lombard, Carl; Steyn, Krisela; Gwebushe, Nomonde; Levitt, Naomi

    2014-01-01

    Objectives To ascertain the prevalence and determinants of overweight/obesity in the 25–74-year-old urban black population of Cape Town and examine the changes between 1990 and 2008/09. Methods In 2008/09, a representative cross-sectional sample, stratified for age and sex, was randomly selected from the same townships sampled in 1990. Data were collected by questionnaires, clinical measurements and biochemical analyses. Gender-specific linear regression models evaluated the associations with overweight/obesity. Results There were 1099 participants, 392 men and 707 women (response rate 86%) in 2008/09. Mean body mass index (BMI) and waist circumference (WC) were 23.7 kg/m2 (95% confidence interval (CI): 23.1–24.2) and 84.2 cm (95% CI: 82.8–85.6) in men, and 33.0 kg/m2 (95% CI: 32.3–33.7) and 96.8 cm (95% CI: 95.5–98.1) in women. Prevalence of BMI ≥25 kg/m2 and raised WC were 28.9% (95% CI: 24.1–34.3) and 20.1% (95% CI: 15.9–24.9) in men, and 82.8% (95% CI: 79.3–85.9) and 86.0% (95% CI: 82.9–88.6) in women. Among 25–64-year-olds, BMI ≥25 kg/m2 decreased between 1990 (37.3%, 95% CI: 31.7–43.1) and 2008/09 (27.7%, 95% CI: 22.7–33.4) in men but increased from 72.7% (95% CI: 67.6–77.2) to 82.6% (95% CI: 78.8–85.8) in women. In the regression models for men and women, higher BMI was directly associated with increasing age, wealth, hypertension and diabetes but inversely related to daily smoking. Also significantly associated with rising BMI were raised low-density lipoprotein cholesterol and being employed compared to unemployed in men, and having >7 years of education in women. Conclusions Overweight/obesity, particularly in urban black women, requires urgent action because of the associations with cardiovascular disease risk factors and their serious consequences. PMID:25221948

  8. Deaths Rates in Public Hospitals of Eastern Cape Province of South Africa

    PubMed Central

    Buso, DL; Longo-Mbenza, B; Bovet, P; van den Borne, B; Okwe, A Nge; Mzingelwa, M

    2012-01-01

    Background: South Africa (SA) is experiencing a rapid epidemiologic transition as a consequence of political, economic and social changes. In this study we described, based on hospital data, the mortality patterns of Non communicable Diseases (NCD), Communicable Diseases (CD), the NCD/CD ratios, and the trends of deaths. Methods: We conducted a cross-sectional survey of all deaths occurring in several public hospitals in the Eastern Cape Province of SA between 2002 and 2006. Causes of deaths were coded according to the ICD 10 Edition. Results: A total of 107380 admissions responded to the inclusion criteria between 2002 and 2006. The crude death rate was 4.3% (n=4566) with a mean age of 46±21 years and a sex ratio of 3.1 men (n=3453): 1 woman (n=1113). Out of all deaths, there were 62.9% NCD (n=2872) vs. 37.1% CD (n=1694) with NCD/CD ratio of 1.7. The ratio NCD/CD deaths in men was 1.3 (n=1951/1502) vs. NCD/CD deaths in women of 1.9 (n=735/378). The peak of deaths was observed in winter season. The majority of NCD deaths were at age of 30–64 years, whereas the highest rate of CD deaths was at age< 30 years. The trend of deaths including the majority of NCD, increased from 2002 to 2006. There was a tendency of increase in tuberculosis deaths, but a tendency of decrease in HIV/AIDS deaths was from 2002 to 2006. Conclusion: Non-communicable diseases are the leading causes of deaths in rural Eastern Cape province of SA facing Post-epidemiologic transition stages. We recommend overarching priority actions for the response to the Non-communicable Diseases: policy change, prevention, treatment, international cooperation, research, monitoring, accountability, and re-orientation of health systems. PMID:23641386

  9. A new species of Yola Gozis, 1886 from the Western Cape of South Africa (Coleoptera: Dytiscidae: Bidessini).

    PubMed

    Bilton, David T

    2015-01-13

    Yola matsikammae sp. nov. is described from the Matsikammaberg, an inselberg on the northern edge of the fynbos biome of the Western Cape, South Africa. A key is provided to separate the new species from other southern African members of the Yola bicarinata group. Y. matsikammae sp. nov. bears a superficial resemblance to Sharphydrus species, particularly Sharphydrus brincki Bilton, 2013 with which it was found to co-occur. Comparative notes to separate these taxa are also included. 

  10. Two new water beetles from the Hantamsberg, an inselberg in the Northern Cape of South Africa (Coleoptera, Hydraenidae).

    PubMed

    Bilton, David T

    2014-11-26

    Mesoceration hantam sp. nov. and Parhydraena faeni sp. nov., are described from the Hantamsberg plateau, an inselberg in the Northern Cape of South Africa. The new species are so far known only from temporary waters on the Hantamsberg summit, where they were both abundant. Sampling in these mountains also revealed an interesting accompanying water beetle fauna, including the northernmost known record of Hydropeplus montanus Omer-Cooper, a species characteristic of mountain fynbos further south in the region.

  11. Solid waste characterization in Ketao, a rural town in Togo, West Africa.

    PubMed

    Edjabou, Maklawe Essonanawe; Møller, Jacob; Christensen, Thomas H

    2012-07-01

    In Africa the majority of solid waste data is for big cities. Small and rural towns are generally neglected and waste data from these areas are often unavailable, which makes planning a proper solid waste management difficult. This paper presents the results from two waste characterization projects conducted in Kétao, a rural town in Togo during the rainy season and the dry season in 2010. The seasonal variation has a significant impact on the waste stream. The household waste generation rate was estimated at 0.22 kg person(-1) day(-1) in the dry season and 0.42 in the rainy season. Likewise, the waste moisture content was 4% in the dry season while it was 33-63% in the rainy season. The waste consisted mainly of soil and dirt characterized as 'other' (41%), vegetables and putrescibles (38%) and plastic (11%). In addition to these fractions, considerable amounts of material are either recycled or reused locally and do not enter the waste stream. The study suggests that additional recycling is not feasible, but further examination of the degradability of the organic fraction is needed in order to assess whether the residual waste should be composed or landfilled.

  12. New insights on the Karoo shale gas potential from borehole KZF-1 (Western Cape, South Africa)

    NASA Astrophysics Data System (ADS)

    Campbell, Stuart A.; Götz, Annette E.; Montenari, Michael

    2016-04-01

    A study on world shale reserves conducted by the Energy Information Agency (EIA) in 2013 concluded that there could be as much as 390 Tcf recoverable reserves of shale gas in the southern and south-western parts of the Karoo Basin. This would make it the 8th-largest shale gas resource in the world. However, the true extent and commercial viability is still unknown, due to the lack of exploration drilling and modern 3D seismic. Within the framework of the Karoo Research Initiative (KARIN), two deep boreholes were drilled in the Eastern and Western Cape provinces of South Africa. Here we report on new core material from borehole KZF-1 (Western Cape) which intersected the Permian black shales of the Ecca Group, the Whitehill Formation being the main target formation for future shale gas production. To determine the original source potential for shale gas we investigated the sedimentary environments in which the potential source rocks formed, addressing the research question of how much sedimentary organic matter the shales contained when they originally formed. Palynofacies indicates marginal marine conditions of a stratified basin setting with low marine phytoplankton percentages (acritarchs, prasinophytes), good AOM preservation, high terrestrial input, and a high spores:bisaccates ratio (kerogen type III). Stratigraphically, a deepening-upward trend is observed. Laterally, the basin configuration seems to be much more complex than previously assumed. Furthermore, palynological data confirms the correlation of marine black shales of the Prince Albert and Whitehill formations in the southern and south-western parts of the Karoo Basin with the terrestrial coals of the Vryheid Formation in the north-eastern part of the basin. TOC values (1-6%) classify the Karoo black shales as promising shale gas resources, especially with regard to the high thermal maturity (Ro >3). The recently drilled deep boreholes in the southern and south-western Karoo Basin, the first since the

  13. Collaboration or renunciation? The role of traditional medicine in mental health care in Rwanda and Eastern Cape Province, South Africa.

    PubMed

    Schierenbeck, Isabell; Johansson, Peter; Andersson, Lena M; Krantz, Gunilla; Ntaganira, Joseph

    2016-10-07

    Traditional medicine (TM) and biomedicine represent parallel health systems in many developing countries; the latter dominating in public policies, while the former still retain considerable influence among the general public. This study investigates how mental health care professionals responsible for mental health care implementation comprehend and relate to the intersection between TM and biomedicine in the cases of Rwanda and the Eastern Cape Province, South Africa. The material is based on semi-structured interviews with mental health care stakeholders in Eastern Cape, South Africa and Rwanda. The findings confirm an impact of TM in the treatment of mental health issues in Rwanda and South Africa due to TM being more accessible than biomedical medicine, widespread traditional perceptions of mental illness in society, and the lack of knowledge of biomedical treatments. Furthermore, the respondents identified three strategies to manage the impact of TM; improved accessibility of biomedical facilities, outreach education about mental illness, and, in the Eastern Cape case, collaboration between traditional healers and biomedicine. The study points to the necessity to take TM into consideration as an important component of health systems and policies in the Global south.

  14. Towards Multilingual Higher Education in South Africa: The University of Cape Town's Experience

    ERIC Educational Resources Information Center

    Madiba, Mbulungeni

    2010-01-01

    South African universities are required by the Language Policy for Higher Education adopted by the government on 6 November 2002 to implement multilingualism in their learning and teaching programmes. Multilingualism is recommended in this policy as a means to ensure equity of access and success in higher education, in contrast to past colonial…

  15. Predictors of Early First Sexual Intercourse among Adolescents in Cape Town, South Africa

    ERIC Educational Resources Information Center

    Mathews, Catherine; Aaro, Leif Edvard; Flisher, Alan J.; Mukoma, Wanjiru; Wubs, Annegreet G.; Schaalma, Herman

    2009-01-01

    Early coital debut is a risk factor for HIV. In this paper we investigate the predictors of young adolescents' transition to first intercourse using a social cognition theoretical framework. The analyses reported here were based on a longitudinal study of 2360 students in the schools allocated to the control arm of a cluster-randomized controlled…

  16. Leisure Boredom and High School Dropout in Cape Town, South Africa

    ERIC Educational Resources Information Center

    Wegner, Lisa; Flisher, Alan J.; Chikobvu, Perpetual; Lombard, Carl; King, Gary

    2008-01-01

    This prospective cohort study investigated whether leisure boredom predicts high school dropout. Leisure boredom is the perception that leisure experiences do not satisfy the need for optimal arousal. Participants completed a self-report questionnaire which included the Leisure Boredom Scale. The original cohort of grade 8 students (n=303) was…

  17. The Prevalence of Motor Delay among HIV Infected Children Living in Cape Town, South Africa

    ERIC Educational Resources Information Center

    Ferguson, Gillian; Jelsma, Jennifer

    2009-01-01

    Children living with HIV often display delayed motor performance owing to HIV infection of the central nervous system, the effects of opportunistic infections and, indirectly, owing to their social environments. Although these problems have been well documented, the impact of the virus on the development of South African children is less well…

  18. Exploring Entrepreneurial Activity at Cape Town and Stellenbosch Universities, South Africa

    ERIC Educational Resources Information Center

    Jafta, Rachel; Uctu, Ramazan

    2013-01-01

    Entrepreneurial activity at universities, especially spin-off formation, has emerged as an important mechanism for accelerating the transfer of technology and knowledge to commercial markets. With some exceptions, such as China, studies on university entrepreneurship have tended to concentrate on the experiences of developed countries. Perhaps…

  19. Time Series of SST Anomalies Off Western Africa

    DTIC Science & Technology

    2014-09-09

    of South Africa extending west-northwest from the vicinity of the Cape . b) Locations of surface drifting buoys over January-April 2014 superimposed...in the real ocean with accompanying estimates of forecast uncertainty. Assimilative ocean forecast around South Africa are evaluated from January to...GHRSST XV Proceedings Issue 1 Revision 0 2-6 June 2014, Cape Town , SA Date: 9th September 2014 Page 93 of 232 TIME SERIES OF SST ANOMALIES

  20. Africa Steps up Efforts to Train Top Scientists

    ERIC Educational Resources Information Center

    Lindow, Megan

    2008-01-01

    This article reports on new programs that focus on training skilled scientists and mathematicians who will help solve Africa's myriad problems. The African Institute for Mathematical Sciences, in Cape Town, South Africa, offers one of the first working examples of a growing effort to develop a cadre of highly trained, practically minded scientists…

  1. A new redfin species, Pseudobarbus skeltoni (Cyprinidae, Teleostei), from the Cape Floristic Region, South Africa.

    PubMed

    Chakona, Albert; Swartz, Ernst R

    2013-01-01

    A new cyprinid species, Pseudobarbus skeltoni sp. nov, is described from material recently collected in the upper Riviersonderend River (a major tributary of the Breede River system) and the Krom River (a tributary of the Molenaars River in the upper Breede River) in the Cape Floristic Region of South Africa. The new species is readily distinguished from congeners, except P. burgi and P burchelli, by having two pairs of prominent oral barbels. Pseudobarbus skeltoni can be distinguished from P. burgi and P burchelli by the following combination of characters: distinctive terminal (vs. subterminal) mouth in adults; mouth inferior in sub-adults and young adults of P skeltoni but lower lips are unretracted (vs. retracted) and lack a distinct cartilaginous plate; snout prominent; more slender head (head depth 64.2% of HL, vs. 70.1% of HL in P. burchelli and 74.1% of HL in P. burgi); and a longer head relative to standard length (30.5 % vs. 26.8% in P. burchelli and 25.8% in P. burgi). The new species attains the largest size of any Pseudobarbus. The restricted distribution and the small remaining population sizes of P skeltoni indicate that this species is highly threatened and requires immediate conservation attention.

  2. The impact of organophosphate pesticides in orchards on earthworms in the Western Cape, South Africa.

    PubMed

    Reinecke, S A; Reinecke, A J

    2007-02-01

    Earthworm population density was measured in and adjacent to an orchard in an agricultural area in the Western Cape, South Africa. Worm densities were very low in orchards (22/m(2)) compared to adjacent uncultivated fields (152/m(2)) at a distance from the orchards. The possible effect of organophosphate pesticides on the earthworms was investigated. Background soil concentrations of chlorpyrifos prior to the start of the spraying season were low (0.2-2.7 microg/kg) but persistent for up to 6 months after the last spraying event, and the pesticide was, as a result of rainfall, transported to nontarget areas by runoff. Background concentrations of azinphos methyl were higher than those of chlorpyrifos (1.6-9.8 microg/kg) but not detectable 2 weeks after a spraying event. Azinphos methyl was mostly transported by wind (spray drift) to adjacent areas. A microcosm study indicated effects of chlorpyrifos on earthworms as determined by measuring biomass change and Cholinesterase inhibition. It is concluded that earthworms were affected detrimentally by the pesticides due to chronic (chlorpyrifos) and intermittent (azinphos methyl) exposure.

  3. Trends in soil erosion and woody shrub encroachment in Ngqushwa district, Eastern Cape Province, South Africa.

    PubMed

    Manjoro, Munyaradzi; Kakembo, Vincent; Rowntree, Kate M

    2012-03-01

    Woody shrub encroachment severely impacts on the hydrological and erosion response of rangelands and abandoned cultivated lands. These processes have been widely investigated at various spatial scales, using mostly field experimentation. The present study used remote sensing to investigate spatial and temporal patterns of soil erosion and encroachment by a woody shrub species, Pteronia incana, in a catchment in Ngqushwa district, Eastern Cape Province, South Africa between 1998 and 2008. The extreme categories of soil erosion and shrub encroachment were mapped with higher accuracy than the intermediate ones, particularly where lower spatial resolution data were used. The results showed that soil erosion in the worst category increased simultaneously with dense woody shrub encroachment on the hill slopes. This trend is related to the spatial patterning of woody shrub vegetation that increases bare soil patches--leading to runoff connectivity and concentration of overland flow. The major changes in soil erosion and shrub encroachment analysed during the 10-year period took place in the 5-9° slope category and on the concave slope form. Multi-temporal analyses, based on remote sensing, can extend our understanding of the dynamics of soil erosion and woody shrub encroachment. They may help benchmark the processes and assist in upscaling field studies.

  4. Kalkkop crater, Eastern Cape: A new impact crater in South Africa

    NASA Technical Reports Server (NTRS)

    Reimold, W. U.; Leroux, F. G.; Koeberl, C.; Shirey, S. B.

    1993-01-01

    Reimold et al. suggested that the 640 m diameter Kalkkop crater, at 32 deg 43 min S/24 deg 34 min E in the Eastern Cape Province (South Africa), could possibly be of impact origin. This idea was based on the circularity of this structure, its regional uniqueness, lack of recent igneous activity in the region, and descriptions of drillcore indicating that the crater is not underlain by a salt dome and is partially filled with a breccia layer of a thickness which would agree with the dimensions expected for an impact structure of this size. Unfortunately the old drillcore was no longer available for detailed study, and in the absence of sufficient surface exposure only drilling could provide the evidence needed to solve the problem of the origin of Kalkkop. For this reason and to study the crater fill from a paleoenvironmental point of view, the S. African Geological Survey decided to sponsor a new research drilling project at the Kalkkop site. First petrographic and isotopic results from Kalkkop drill core studies confirming, without doubt, that this crater is of impact origin are presented.

  5. Host specificity and co-speciation in avian haemosporidia in the Western Cape, South Africa.

    PubMed

    Okanga, Sharon; Cumming, Graeme S; Hockey, Philip A R; Nupen, Lisa; Peters, Jeffrey L

    2014-01-01

    Host and pathogen ecology are often closely linked, with evolutionary processes often leading to the development of host specificity traits in some pathogens. Host specificity may range from 'generalist', where pathogens infect any available competent host; to 'specialist', where pathogens repeatedly infect specific host species or families. Avian malaria ecology in the region remains largely unexplored, despite the presence of vulnerable endemic avian species. We analysed the expression of host specificity in avian haemosporidia, by applying a previously developed host specificity index to lineages isolated from wetland passerines in the Western Cape, South Africa. Parasite lineages were isolated using PCR and identified when possible using matching lineages deposited in GenBank and in MalAvi. Parasitic clades were constructed from phylogenetic trees consisting of Plasmodium and Haemoproteus lineages. Isolated lineages matched some strains of Plasmodium relictum, P. elongatum, Haemoproteus sylvae and H. lanii. Plasmodium lineages infected a wide range of hosts from several avian families in a generalist pattern of infection. Plasmodium spp. also exhibited an infection trend according to host abundance rather than host species. By contrast, Haemoproteus lineages were typically restricted to one or two host species or families, and displayed higher host fidelity than Plasmodium spp. The findings confirm that a range of host specificity traits are exhibited by avian haemosporidia in the region. The traits show the potential to not only impact infection prevalence within specific host species, but also to affect patterns of infection at the community level.

  6. Host Specificity And Co-Speciation In Avian Haemosporidia In The Western Cape, South Africa

    PubMed Central

    Okanga, Sharon; Cumming, Graeme S.; Hockey, Philip A. R.; Nupen, Lisa; Peters, Jeffrey L.

    2014-01-01

    Host and pathogen ecology are often closely linked, with evolutionary processes often leading to the development of host specificity traits in some pathogens. Host specificity may range from ‘generalist’, where pathogens infect any available competent host; to ‘specialist’, where pathogens repeatedly infect specific host species or families. Avian malaria ecology in the region remains largely unexplored, despite the presence of vulnerable endemic avian species. We analysed the expression of host specificity in avian haemosporidia, by applying a previously developed host specificity index to lineages isolated from wetland passerines in the Western Cape, South Africa. Parasite lineages were isolated using PCR and identified when possible using matching lineages deposited in GenBank and in MalAvi. Parasitic clades were constructed from phylogenetic trees consisting of Plasmodium and Haemoproteus lineages. Isolated lineages matched some strains of Plasmodium relictum, P. elongatum, Haemoproteus sylvae and H. lanii. Plasmodium lineages infected a wide range of hosts from several avian families in a generalist pattern of infection. Plasmodium spp. also exhibited an infection trend according to host abundance rather than host species. By contrast, Haemoproteus lineages were typically restricted to one or two host species or families, and displayed higher host fidelity than Plasmodium spp. The findings confirm that a range of host specificity traits are exhibited by avian haemosporidia in the region. The traits show the potential to not only impact infection prevalence within specific host species, but also to affect patterns of infection at the community level. PMID:24498273

  7. Farmers' perceptions of goat kid mortality under communal farming in Eastern Cape, South Africa.

    PubMed

    Slayi, Mhlangabezi; Maphosa, Viola; Fayemi, Olutope Peter; Mapfumo, Lizwell

    2014-10-01

    Rearing of goats under communal farming conditions is characterised by high kid mortality and low weaning percentages. A survey was conducted to determine farmers' perceptions on the causes of kid mortality during summer under the communal farming system in Nkonkobe Local Municipality in the Eastern Cape, South Africa. This was done by administering questionnaires to a total of 162 respondents in 14 villages around Nkonkobe Local Municipality. The study showed that majority of farmers (75 %) keep flock sizes of less than 10 goats and kids, and this indicates that goat production in Nkonkobe Local Municipality is suppressed. According to the farmers, diseases (89 %), endo-parasites (72 %) and ecto-parasites (68 %) were perceived as the major causes of kid mortality. Other causes reported include starvation (15 %), extreme weather conditions (28 %), abortion (7 %), theft (35 %), diarrhoea (43 %), accidents (10 %) and wounds (9 %). The low number of goats could be attributed to high mortalities. It was also found that all causes reported by farmers played a role in high kid mortality in Nkonkobe Local Municipality. However, the causes which require more emphasis to formulate extension support were tick-borne diseases and parasites. This study provided baseline information on possible causes of kid mortalities in Nkonkobe Local Municipality. There is, however, a need to conduct further studies to determine actual causes of high kid mortalities so as to develop preventive strategies that would minimize kid mortality for good economic returns.

  8. A 700-year history of climate change and human impact on the southern Cape coast inferred from lake sediments of Eilandvlei, Wilderness Embayment, South Africa

    NASA Astrophysics Data System (ADS)

    Reinwarth, Bastian; Franz, Sarah; Baade, Jussi; Haberzettl, Torsten; Kasper, Thomas; Daut, Gerhard; Helmschrot, Jörg; Kirsten, Kelly; Quick, Lynne; Meadows, Michael E.; Mäusbacher, Roland

    2013-04-01

    The environment of the southern Cape coast, South Africa, is sensitive to climate fluctuations as it is influenced by different atmospheric and oceanic circulation systems. Paleoecological evidence of Holocene climate variations in this region is presently limited, due to climatic conditions not supporting the accumulation and preservation of suitable sedimentary deposits. Here, we present a lake sediment record spanning approximately the last 670 years from Eilandvlei, a brackish coastal lake situated mid-way between Cape Town and Port Elizabeth. The results from geochemical and sedimentological analyses point to an increase of minerogenic sediment input from the catchment starting ~AD 1400. Changes in the seasonal distribution of rainfall during the Little Ice Age (LIA) may have altered hydrological conditions and possibly caused a recession of afrotemperate forest vegetation, increased erosion rates and fluvial sediment transport. A rising mean lake level, possibly associated with relative sea level rise, may offer an additional explanation for the deposition of finer sediments at the coring site. After AD 1450, reduced burial flux of organic carbon, nitrogen, phosphorous and other elements associated with autochthonous sediment formation may have resulted from ecological changes in Eilandvlei whereby submerged macrophytes were potentially constrained to shallower waters. Enhanced sedimentation rates, increasing carbon, nitrogen, phosphorous and biogenic silica concentrations as well as high concentrations of indicators for allochthonous sediment input (e.g., aluminium, titanium, zirconium) point to increasing sediment and nutrient flux into Eilandvlei from the late 19th century onwards. The most likely factor involved in these recent changes would appear to be land-use change and other forms of human impact.

  9. Alpha-1-antitrypsin deficiency in the Cape Verde islands (Northwest Africa): High prevalence in a sub-Saharan population.

    PubMed

    Spínola, Carla; Brehm, António; Spínola, Hélder

    2010-07-01

    Alpha-1-antitrypsin (AAT) deficiency results from mutations on the Protease Inhibitor (PI) locus located in chromosome 14 and has been associated with pulmonary early-onset emphysema and chronic obstructive pulmonary disease (COPD). African populations show a lower prevalence of AAT deficiency compared to Europeans. Two hundred and two (202) unrelated samples from the Cape Verde archipelago (Northwest Africa) were genotyped for the two most common AAT deficiency alleles, PI*S and PI*Z, using PCR - Mediated Site-Directed Mutagenesis. PI*S mutation in Cape Verde (3.2%) presents one of the highest frequencies in sub-Saharans, similar to South Africa (3.3%) but lower than Angolans (18.8%), Namibians (14.7%), Nigerians (6.4%) and Botswains (4.5%). The PI*Z mutation shows lower values (0.2%) than other sub-Saharan populations, namely Somalia (1.15%), Mali (0.98%)or Nigeria (0.36%). However, many other sub-Saharan populations, like Botswana, Congo, Cameroon, Angola, Gambia, South Africa, Mozambique and Namibia, lack the PI*Z mutation. The frequency of all the AAT deficiency genotypes in the Cape Verde archipelago (PI*ZZ, PI*SS, and PI*SZ) was estimated to be one of the highest in sub-Saharans (15 per 1000), only lower than Angola (54 per 1000) and Namibia (22 per 1000). The results obtained show a high prevalence of the AAT deficiency in Cape Verdeans when compared to other sub-Saharans a condition that can be explained by a heavy European genetic influence, characteristic of that population.

  10. "It's important to take your medication everyday okay?" An evaluation of counselling by lay counsellors for ARV adherence support in the Western Cape, South Africa.

    PubMed

    Dewing, S; Mathews, C; Schaay, N; Cloete, A; Louw, J; Simbayi, L

    2013-01-01

    There is growing interest in standard care programmes for antiretroviral (ARV) adherence support. In South Africa, individual counselling following ARV initiation is a main strategy for supporting adherence in the public sector. Egan's client-centred "Skilled Helper" counselling model is the predominant model used in HIV counselling in this context. This study evaluated counselling delivered by lay ARV adherence counsellors in Cape Town in terms of adherence to Egan's model. Thirty-eight transcripts of counselling sessions with non-adherent patients were analysed based on the methods of content analysis. These sessions were conducted by 30 counsellors. Generally counsellors' practice adhered neither to Egan's model nor a client-centred approach. Inconsistent with evidence-based approaches to counselling for ARV adherence support, counsellors mainly used information-giving and advice as strategies for addressing clients' non-adherence. Recommendations for improving practice are made. The question as to how appropriate strategies from developed countries are for this setting is also raised.

  11. Juvenile idiopathic arthritis in two tertiary centres in the Western Cape, South Africa

    PubMed Central

    2012-01-01

    Background Juvenile idiopathic arthritis (JIA) is a disease that shows wide variations between differing populations. Since the recent international consensus on classification criteria, JIA has been widely described in many countries and population groups. There has been almost no data that describes JIA in an African, specifically Sub-Saharan African, setting. Therefore, the aim of this study is to describe disease characteristics, disease course, and functional disability in two tertiary centres in the Western Cape, South Africa and compare the findings to other JIA populations. Methods Eighty-six children were recruited during random clinic visits to rheumatology clinics at Tygerberg and Groote Schuur Hospital between April 2010 and April 2011. Children were diagnosed using International League of Associations for Rheumatology (ILAR) 2001 classification criteria. Consent was obtained and medical records examined. The Childhood Health Assessment Questionnaires (CHAQ) and visual analogue scales (VAS) for pain and general well-being were completed and all children were examined by a researcher in conjunction with a paediatric rheumatologist. HIV status as well as tuberculosis disease and treatment were investigated. Results A total of 86 children were enrolled. Eight children were excluded (2 HIV arthropathy, 1 TB arthritis, 1 SLE, 4 with insufficient data), leaving a total of 78 patients. There was an equal female to male ratio-39 males and 39 females. There were 6 systemic JIA patients (7.69%), 17 persistent oligoarthritis (21.79%), 4 extended oligoarthritis (5.12%), 11 polyarthritis rheumatoid factor (RF) positive (14.10%), 21 polyarthritis RF negative (26.9%), 1 psoriatic arthritis (1.28%), and 18 enthesitis-related arthritis (23%). The median CHAQ for the group was 0.5 (IQR 0.1-1.25), the median VAS for pain was 18 mm (IQR 4–42) and median VAS for general well-being was 25 mm (IQR 3–49). Enthesitis-related arthritis and polyarthritis disease subtypes in

  12. Exploration of Deaf People’s Health Information Sources and Techniques for Information Delivery in Cape Town: A Qualitative Study for the Design and Development of a Mobile Health App

    PubMed Central

    Glaser, Meryl; Tucker, William David; Diehl, Jan Carel

    2016-01-01

    Background Many cultural and linguistic Deaf people in South Africa face disparity when accessing health information because of social and language barriers. The number of certified South African Sign Language interpreters (SASLIs) is also insufficient to meet the demand of the Deaf population in the country. Our research team, in collaboration with the Deaf communities in Cape Town, devised a mobile health app called SignSupport to bridge the communication gaps in health care contexts. We consequently plan to extend our work with a Health Knowledge Transfer System (HKTS) to provide Deaf people with accessible, understandable, and accurate health information. We conducted an explorative study to prepare the groundwork for the design and development of the system. Objectives To investigate the current modes of health information distributed to Deaf people in Cape Town, identify the health information sources Deaf people prefer and their reasons, and define effective techniques for delivering understandable information to generate the groundwork for the mobile health app development with and for Deaf people. Methods A qualitative methodology using semistructured interviews with sensitizing tools was used in a community-based codesign setting. A total of 23 Deaf people and 10 health professionals participated in this study. Inductive and deductive coding was used for the analysis. Results Deaf people currently have access to 4 modes of health information distribution through: Deaf and other relevant organizations, hearing health professionals, personal interactions, and the mass media. Their preferred and accessible sources are those delivering information in signed language and with communication techniques that match Deaf people’s communication needs. Accessible and accurate health information can be delivered to Deaf people by 3 effective techniques: using signed language including its dialects, through health drama with its combined techniques, and accompanying

  13. Shale Gas characteristics of Permian black shales (Ecca group, Eastern Cape, South Africa)

    NASA Astrophysics Data System (ADS)

    Geel, Claire; Booth, Peter; Schulz, Hans-Martin; Horsfield, Brian; de Wit, Maarten

    2013-04-01

    This study involves a comprehensive and detailed lithological, sedimentalogical, structural and geochemical description of the lower Ecca Group in the Eastern Cape, South Africa. The Ecca group hosts a ~ 245 million year old organic-rich black shale, which has recently been the focus of interest of petroleum companies worldwide. The shale was deposited under anoxic conditions in a setting which formed as a consequence of retro-arc foreland basin development related to the Cape Fold Belt. This sedimentary/tectonic environment provided the conditions for deeply buried black shales to reach maturity levels for development in the gas window. The investigation site is called the Greystone Area and is situated north of Wolwefontein en route to Jansenville. The area has outcrops of the Dwyka, the Ecca and the lower Beaufort Groups. The outcrops were mapped extensively and the data was used in conjunction with GIS software to produce a detailed geological map. North-south cross sections were drawn to give indication of bed thicknesses and formation depths. Using the field work, data two boreholes were accurately sited on the northern limb of a shallow easterly plunging syncline. The first borehole reached 100m and the second was drilled to 292m depth (100m percussion and 192m core). The second borehole was drilled 200m south of the first, to penetrate the formations at a greater depth and to avoid surface weathering. Fresh core from the upper Dwyka Group, the Prince Albert Formation, the Whitehill Formation, Collingham Formation and part of the Ripon Formation were successfully extracted and a detailed stratigraphic log has been drawn up. The core was sampled during extraction and the samples were immediately sent to the GFZ in Potsdam, Germany, for geochemical analyses. As suspected the black shales of the the Whitehill Formation are high in organic carbon and have an average TOC value of 4.5%, whereas the Prince Albert and Collingham Formation are below 1%. Tmax values

  14. Psoralea margaretiflora (Psoraleeae, Fabaceae): A new species from the Sneeuberg Centre of Floristic Endemism, Eastern Cape, South Africa

    PubMed Central

    Stirton, Charles H.; Clark, V. Ralph; Barker, Nigel P.; Muasya, A. Muthama

    2011-01-01

    Abstract A new species of Psoralea is described. Psoralea margaretiflora C.H. Stirton & V.R. Clark is endemic to the Sneeuberg Centre of Floristic Endemism, Eastern Cape, South Africa. This resprouter is characterised by its small greenish-white flowers with a small trifid purple nectar patch and translucent veins; 5(–7)-pinnate leaflets; multi-branching erect short seasonal flowering shoots; and tall habit of many stiff bare stems with the seasonal shoots massed at the apex. It is most similar to Psoralea oligophylla Eckl. & Zeyh., a widespread species found in the Eastern Cape. The reseeder Psoralea oligophylla differs in its lax virgate spreading habit with numerous long glaucous seasonal shoots; single stem, 1(–3)- glaucous leaflets; more numerous white flowers; and standard petals with a purple ring surrounding a bright yellow nectar patch. PMID:22171191

  15. Psoralea margaretiflora (Psoraleeae, Fabaceae): A new species from the Sneeuberg Centre of Floristic Endemism, Eastern Cape, South Africa.

    PubMed

    Stirton, Charles H; Clark, V Ralph; Barker, Nigel P; Muasya, A Muthama

    2011-01-01

    A new species of Psoralea is described. Psoralea margaretiflora C.H. Stirton & V.R. Clark is endemic to the Sneeuberg Centre of Floristic Endemism, Eastern Cape, South Africa. This resprouter is characterised by its small greenish-white flowers with a small trifid purple nectar patch and translucent veins; 5(-7)-pinnate leaflets; multi-branching erect short seasonal flowering shoots; and tall habit of many stiff bare stems with the seasonal shoots massed at the apex. It is most similar to Psoralea oligophylla Eckl. & Zeyh., a widespread species found in the Eastern Cape. The reseeder Psoralea oligophylla differs in its lax virgate spreading habit with numerous long glaucous seasonal shoots; single stem, 1(-3)- glaucous leaflets; more numerous white flowers; and standard petals with a purple ring surrounding a bright yellow nectar patch.

  16. Climatic controls on ecosystem resilience: Postfire regeneration in the Cape Floristic Region of South Africa.

    PubMed

    Wilson, Adam M; Latimer, Andrew M; Silander, John A

    2015-07-21

    Conservation of biodiversity and natural resources in a changing climate requires understanding what controls ecosystem resilience to disturbance. This understanding is especially important in the fire-prone Mediterranean systems of the world. The fire frequency in these systems is sensitive to climate, and recent climate change has resulted in more frequent fires over the last few decades. However, the sensitivity of postfire recovery and biomass/fuel load accumulation to climate is less well understood than fire frequency despite its importance in driving the fire regime. In this study, we develop a hierarchical statistical framework to model postfire ecosystem recovery using satellite-derived observations of vegetation as a function of stand age, topography, and climate. In the Cape Floristic Region (CFR) of South Africa, a fire-prone biodiversity hotspot, we found strong postfire recovery gradients associated with climate resulting in faster recovery in regions with higher soil fertility, minimum July (winter) temperature, and mean January (summer) precipitation. Projections using an ensemble of 11 downscaled Coupled Model Intercomparison Project Phase 5 (CMIP5) general circulation models (GCMs) suggest that warmer winter temperatures in 2080-2100 will encourage faster postfire recovery across the region, which could further increase fire frequency due to faster fuel accumulation. However, some models project decreasing precipitation in the western CFR, which would slow recovery rates there, likely reducing fire frequency through lack of fuel and potentially driving local biome shifts from fynbos shrubland to nonburning semidesert vegetation. This simple yet powerful approach to making inferences from large, remotely sensed datasets has potential for wide application to modeling ecosystem resilience in disturbance-prone ecosystems globally.

  17. Climatic controls on ecosystem resilience: Postfire regeneration in the Cape Floristic Region of South Africa

    PubMed Central

    Wilson, Adam M.; Latimer, Andrew M.; Silander, John A.

    2015-01-01

    Conservation of biodiversity and natural resources in a changing climate requires understanding what controls ecosystem resilience to disturbance. This understanding is especially important in the fire-prone Mediterranean systems of the world. The fire frequency in these systems is sensitive to climate, and recent climate change has resulted in more frequent fires over the last few decades. However, the sensitivity of postfire recovery and biomass/fuel load accumulation to climate is less well understood than fire frequency despite its importance in driving the fire regime. In this study, we develop a hierarchical statistical framework to model postfire ecosystem recovery using satellite-derived observations of vegetation as a function of stand age, topography, and climate. In the Cape Floristic Region (CFR) of South Africa, a fire-prone biodiversity hotspot, we found strong postfire recovery gradients associated with climate resulting in faster recovery in regions with higher soil fertility, minimum July (winter) temperature, and mean January (summer) precipitation. Projections using an ensemble of 11 downscaled Coupled Model Intercomparison Project Phase 5 (CMIP5) general circulation models (GCMs) suggest that warmer winter temperatures in 2080–2100 will encourage faster postfire recovery across the region, which could further increase fire frequency due to faster fuel accumulation. However, some models project decreasing precipitation in the western CFR, which would slow recovery rates there, likely reducing fire frequency through lack of fuel and potentially driving local biome shifts from fynbos shrubland to nonburning semidesert vegetation. This simple yet powerful approach to making inferences from large, remotely sensed datasets has potential for wide application to modeling ecosystem resilience in disturbance-prone ecosystems globally. PMID:26150521

  18. Taphonomic and paleoecological change in the large mammal sequence from Boomplaas Cave, western Cape, South Africa.

    PubMed

    Faith, J Tyler

    2013-12-01

    Excavations conducted by H.J. Deacon in the 1970s at Boomplaas Cave (BPA) uncovered a stratified sequence of Middle Stone Age (MSA) and Later Stone Age (LSA) deposits spanning the last >65,000 years. This study provides the first comprehensive and integrated taphonomic and paleoecological analysis of the BPA large mammals, with a focus on its implications for understanding human adaptations and environmental changes in southern Africa's Cape Floristic Region (CFR), an area that features prominently in understanding modern human origins. Taphonomic data indicate a complex history of human, carnivore, and raptor accumulation of the large mammal assemblage. The anthropogenic signal is largely absent from the bottom of the sequence (>65,000 years ago), intermediate in MSA and LSA assemblages from ~50,000 to 20,000 years ago, and strong in LSA deposits post-dating the Last Glacial Maximum (LGM). When viewed in the broader CFR context, the inferred occupation history of BPA is consistent with the hypothesis that both MSA and LSA human populations were concentrated on the submerged coastline from ~60,000 to ~20,000 years ago. Intensive occupation following the LGM parallels an apparent increase in regional population densities, which may have been driven in part by rising sea levels. The BPA ungulate assemblage is characterized by the rise and decline of a taxonomically diverse grazing community, which peaks during the LGM. These changes are not correlated with taphonomic shifts, meaning that they are likely driven by environmental factors, namely the expansion and contraction of grassland habitats. Changes in ungulate diversity indicate that effective precipitation was highest during the LGM, corresponding with an intensified winter rainfall system. This is consistent with recent arguments that the LGM in this region may not have been extremely harsh and arid.

  19. Risk Factors of Porcine Cysticercosis in the Eastern Cape Province, South Africa

    PubMed Central

    Krecek, Rosina Claudia; Mohammed, Hamish; Michael, Lynne Margaret; Schantz, Peter Mullineaux; Ntanjana, Lulama; Morey, Liesl; Werre, Stephen Rakem; Willingham, Arve Lee

    2012-01-01

    There is a high prevalence of Taenia solium taeniosis/cysticercosis in humans and pigs in the Eastern Cape Province (ECP) of South Africa. The objective of this study was to identify risk factors of porcine cysticercosis in select districts of the ECP. Data were collected in 2003 by interviewing 217 pig producers from the area. Blood samples were collected from 261 of their pigs, which were tested using two enzyme-linked immunosorbent assays (ELISA) for the presence of antibodies to cysticercosis. Frequencies of both owner- and pig-level characteristics were determined. For pig-level analysis, all bivariable and multivariable associations were determined using the surveylogistic procedure of the SAS/STAT® software to accommodate for the intraclass correlation that exists for clusters of pigs within one owner and for clusters of owners within a district. All tests for significance were performed at the α = 0.05 level, and adjusted odds ratios (aOR) and 95% confidence intervals (CI) were determined. Among the respondents, 48% of their households lacked a latrine, 98% slaughtered pigs at home, and 99% indicated that meat inspection services were not available. On bivariable analysis, there was a significant association between porcine infection and district (p = 0.003), breed (p = 0.041) and the absence of a latrine (p = 0.006). On multivariable analysis, the absence of a latrine was the only variable significantly associated with porcine infection (aOR = 1.89; 95% CI = 1.07, 3.35) (p = 0.028). The increased odds of porcine infection with households lacking a latrine contributes to our understanding of the transmission of this parasite in the ECP. Determining and addressing the risk factors for T. solium infection can potentially lower the very high prevalence in humans and pigs in this endemic area. PMID:22655065

  20. Luminescence- and Infrared-Radiofluorescence dating of the Acheulean- to Middle Stone Age sedimentary sequence at Montagu Cave, Western Cape Provence, South Africa

    NASA Astrophysics Data System (ADS)

    Lauer, Tobias; Archer, Will; Sumner, Alexandra

    2016-04-01

    Montagu Cave is an archaeological site located on the edge of the Langeberg mountain range, about 160 km NE of Cape Town, in South Africa. The archaeological and sedimentary units at Montagu Cave comprise two Acheulean sequences which are separated from one another by a substantial archaeological hiatus. There is an additional Middle Stone Age sequence which overlies the Acheulean horizons, and contains layers attributed to the Howiesons Poort, as well as multiple other Middle Stone Age sub-stages. Hence, Montagu Cave provides a unique opportunity to investigate quite complex population level questions concerning the behavioral differences between modern and pre-modern populations in southern Africa. However, thus far, the chronological context of the sediment-layers at the site remains unclear. It is therefore critical to provide a resilient chronological framework for the timing of human activity at the site. This study concerns the potential of luminescence dating for the sedimentary sequence preserved at Montagu cave. The collected samples are tested on their quartz- and feldspar luminescence signal properties. Various optical dating techniques (quartz OSL; pIRIR290) will be applied, and the results of each compared in order to obtain information on the suitability of the material for luminescence dating, and to establish a chronological framework for this important archaeological site. Furthermore, the infrared-radiofluorescence (IR-RF) signal behavior will be tested on potassium feldspars, as IR-RF is a method being able to date back up to > 600 ka. IR-RF therefore has the potential to cover the expected time-frame of the sediments at Montagu-cave.

  1. The Foraging Ecology of the Endangered Cape Verde Shearwater, a Sentinel Species for Marine Conservation off West Africa.

    PubMed

    Paiva, Vitor H; Geraldes, Pedro; Rodrigues, Isabel; Melo, Tommy; Melo, José; Ramos, Jaime A

    2015-01-01

    Large Marine Ecosystems such as the Canary Current system off West Africa sustains high abundance of small pelagic prey, which attracts marine predators. Seabirds are top predators often used as biodiversity surrogates and sentinel species of the marine ecosystem health, thus frequently informing marine conservation planning. This study presents the first data on the spatial (GPS-loggers) and trophic (stable isotope analysis) ecology of a tropical seabird-the endangered Cape Verde shearwater Calonectris edwardsii-during both the incubation and the chick-rearing periods of two consecutive years. This information was related with marine environmental predictors (species distribution models), existent areas of conservation concern for seabirds (i.e. marine Important Bird Areas; marine IBAs) and threats to the marine environment in the West African areas heavily used by the shearwaters. There was an apparent inter-annual consistency on the spatial, foraging and trophic ecology of Cape Verde shearwater, but a strong alteration on the foraging strategies of adult breeders among breeding phases (i.e. from incubation to chick-rearing). During incubation, birds mostly targeted a discrete region off West Africa, known by its enhanced productivity profile and thus also highly exploited by international industrial fishery fleets. When chick-rearing, adults exploited the comparatively less productive tropical environment within the islands of Cape Verde, at relatively close distance from their breeding colony. The species enlarged its trophic niche and increased the trophic level of their prey from incubation to chick-rearing, likely to provision their chicks with a more diversified and better quality diet. There was a high overlap between the Cape Verde shearwaters foraging areas with those of European shearwater species that overwinter in this area and known areas of megafauna bycatch off West Africa, but very little overlap with existing Marine Important Bird Areas. Further

  2. The Foraging Ecology of the Endangered Cape Verde Shearwater, a Sentinel Species for Marine Conservation off West Africa

    PubMed Central

    Paiva, Vitor H.; Geraldes, Pedro; Rodrigues, Isabel; Melo, Tommy; Melo, José; Ramos, Jaime A.

    2015-01-01

    Large Marine Ecosystems such as the Canary Current system off West Africa sustains high abundance of small pelagic prey, which attracts marine predators. Seabirds are top predators often used as biodiversity surrogates and sentinel species of the marine ecosystem health, thus frequently informing marine conservation planning. This study presents the first data on the spatial (GPS-loggers) and trophic (stable isotope analysis) ecology of a tropical seabird—the endangered Cape Verde shearwater Calonectris edwardsii–during both the incubation and the chick-rearing periods of two consecutive years. This information was related with marine environmental predictors (species distribution models), existent areas of conservation concern for seabirds (i.e. marine Important Bird Areas; marine IBAs) and threats to the marine environment in the West African areas heavily used by the shearwaters. There was an apparent inter-annual consistency on the spatial, foraging and trophic ecology of Cape Verde shearwater, but a strong alteration on the foraging strategies of adult breeders among breeding phases (i.e. from incubation to chick-rearing). During incubation, birds mostly targeted a discrete region off West Africa, known by its enhanced productivity profile and thus also highly exploited by international industrial fishery fleets. When chick-rearing, adults exploited the comparatively less productive tropical environment within the islands of Cape Verde, at relatively close distance from their breeding colony. The species enlarged its trophic niche and increased the trophic level of their prey from incubation to chick-rearing, likely to provision their chicks with a more diversified and better quality diet. There was a high overlap between the Cape Verde shearwaters foraging areas with those of European shearwater species that overwinter in this area and known areas of megafauna bycatch off West Africa, but very little overlap with existing Marine Important Bird Areas

  3. Microstratigraphic evidence of in situ fire in the Acheulean strata of Wonderwerk Cave, Northern Cape province, South Africa.

    PubMed

    Berna, Francesco; Goldberg, Paul; Horwitz, Liora Kolska; Brink, James; Holt, Sharon; Bamford, Marion; Chazan, Michael

    2012-05-15

    The ability to control fire was a crucial turning point in human evolution, but the question when hominins first developed this ability still remains. Here we show that micromorphological and Fourier transform infrared microspectroscopy (mFTIR) analyses of intact sediments at the site of Wonderwerk Cave, Northern Cape province, South Africa, provide unambiguous evidence--in the form of burned bone and ashed plant remains--that burning took place in the cave during the early Acheulean occupation, approximately 1.0 Ma. To the best of our knowledge, this is the earliest secure evidence for burning in an archaeological context.

  4. Nematode parasites of some reptiles (Sauria: Testudines: Ophidia) from the northern and Western Cape Provinces, South Africa.

    PubMed

    McAllister, Chris T; Bursey, Charles R; Freed, Paul S

    2010-10-01

    One hundred and seven reptiles (11 families, 32 species) from the Northern and Western Cape Provinces of South Africa were examined for helminths. Twenty-three (22%) individual reptiles were found to harbor at least 1 species of nematode; 3 (7%) reptiles harbored multiple infections of 2 nematode species. Eight species within 5 families of Nematoda were found in the reptiles surveyed including 1 atractid, 1 diaphanocephalid, 1 heterakid, 3 pharyngodonids, and 2 physalopterans. Ten new host records are reported. A summary of the nematode parasites identified from South African reptiles is provided.

  5. Anthropometric Measurements, Serum Reproductive Hormonal Levels and Sexual Development among Boys in the Rural Western Cape, South Africa

    PubMed Central

    Mao, Jun; Dalvie, Mohamed Aqiel

    2016-01-01

    Data on growth and sexual maturation among boys from the rural Western Cape in South Africa is limited. A cross-sectional study of 269 school boys was conducted testing for serum luteinizing hormone (LH), follicle stimulating hormone (FSH), testosterone, sex hormone binding globulin (SHBG) and estradiol (E2); height, weight and body mass index (BMI); sexual maturity (using Tanner Stages) and a questionnaire (demographic and medical history). The median age at pubertal onset (Tanner Stage 2) and Tanner Stage 5 was 11.6 and 14.7 years, respectively. The median testicular volume was 5.5 mL at Tanner Stage 2 increasing from 2.5 mL at Tanner Stage 1 to 14.7 mL at Tanner Stage 5. Height and weight measurements were <25th & 50th percentile references at Tanner Stages 1–3. Controlling for confounders, serum FSH and LH increased (p < 0.05) from Tanner Stage 1 to 4 (by 4.1 and 3 mL respectively), and serum testosterone and estradiol increased after Tanner Stage 2 (by 12.7 nmol/L and 59.5 pmol/L respectively). These results indicate some delays in pubertal development of boys in the rural Western Cape when compared to boys from other settings possibly due to nutritional, socio-economic and environmental exposures. Changes in serum hormone levels were consistent with other populations. Initiatives to improve nutrition amongst Western Cape rural communities are recommended. PMID:27916832

  6. South Africa, the Arts and Youth in Conflict with the Law

    ERIC Educational Resources Information Center

    Woodward, Sheila C.; Sloth-Nielsen, Julia; Mathiti, Vuyisile

    2007-01-01

    This article describes the Diversion into Music Education (DIME) youth intervention programme that originated in South Africa in 2001. DIME offers instruction in African marimba and djembe ensemble performance to juvenile offenders. Conceived as community collaboration among organizations in the cities of Cape Town, South Africa and Tampa, United…

  7. Biogeography and molar morphology of Pleistocene African elephants: new evidence from Elandsfontein, Western Cape Province, South Africa

    NASA Astrophysics Data System (ADS)

    Smith, Kathlyn M.; Stynder, Deano D.

    2015-05-01

    Elandsfontein (EFT) is a Middle Pleistocene archaeological/paleontological site located in the Western Cape Province of South Africa. The largest herbivore in the assemblage is Loxodonta atlantica zulu, an extinct member of the genus that includes modern African elephants. No Elephas recki specimens were recovered at EFT, despite their common occurrence in other regions of Africa at the same time. Because E. recki and L. atlantica molars are similar in appearance, but the two species are traditionally viewed as dominating different regions of Africa during the Pleistocene, isolated molars may on occasions have been assessed to species level on the basis of geography rather than morphology. The last morphologic evaluation of EFT elephants was conducted in the 1970s, and revisiting this issue with new specimens provides added insight into the evolution of elephants in Africa. Reevaluating morphological characteristics of EFT elephant molars, through qualitative and quantitative description and comparison with Middle Pleistocene E. recki recki, L. atlantica atlantica, and L. atlantica zulu molar morphology, corroborates assessment of EFT elephants as L. a. zulu. Two recently discovered, previously undescribed molars from EFT show that molars of L. a. zulu exhibit greater variation in enamel thickness, lamellar frequency, and occlusal surface morphology than previously reported. An update of the Pleistocene biogeography of Loxodonta and Elephas indicates that fossil remains of both are often found at the same localities in eastern Africa. Their rare co-occurrences in the north and south, however, suggest geographic separation of the two genera in at least some regions of Africa, which may have been based on habitat preference.

  8. Groundwater resources of Mosteiros basin, island of Fogo, Cape Verde, West Africa

    USGS Publications Warehouse

    Heilweil, Victor M.; Gingerich, Stephen B.; Plummer, L. Niel; Verstraeten, Ingrid M.

    2010-01-01

    Groundwater resources in Cape Verde provide water for agriculture, industry, and human consumption. These resources are limited and susceptible to contamination. Additional groundwater resources are needed for continued agricultural development, particularly during times of drought, but increased use and (or) climatic change may have adverse effects on the quantity and quality of freshwater available. In volcanic island aquifers such as those of Cape Verde, a lens of fresh groundwater typically ?floats? upon a layer of brackish water at the freshwater/saltwater boundary, and increased pumping may cause salt water intrusion or other contamination. A recent U.S. Geological Survey study assessed baseline groundwater conditions in watersheds on three islands of Cape Verde to provide the scientific basis for sustainably developing water resources and minimizing future groundwater depletion and contamination.

  9. Knowledge of High School Learners Regarding Substance Use within High School Premises in the Buffalo Flats of East London, Eastern Cape Province, South Africa

    ERIC Educational Resources Information Center

    Manu, Emmanuel; Maluleke, Xavela T.; Douglas, Mbuyiselo

    2017-01-01

    South Africa has a high rate of substance abuse among youths both in and out of school with East London in the Eastern Cape Province experiencing an increase in young people ages 20 years and below seeking treatment for substance abuse. The purpose of the study was to explore the knowledge of high school learners (grades 10 to 12) regarding…

  10. Establishing a Computerized Substance Abuse Surveillance System for District Social Workers in the Western Cape Province, South Africa: Methods, Successes and Challenges

    ERIC Educational Resources Information Center

    Burnhams, Nadine Harker; Myers, Bronwyn; Fakier, Nuraan; Parry, Charles; Carelse, Jermaine

    2011-01-01

    The provision of accurate, in-depth data on substance abuse trends and service needs has become increasingly important in light of the growing wave of substance abuse in South Africa and particularly in the Western Cape Province. This article describes the design and implementation of an electronic substance abuse surveillance system (SASS)…

  11. Developing a spatially and temporally resolved emission inventory for photochemical modeling in the City of Cape Town and assessing its uncertainty

    NASA Astrophysics Data System (ADS)

    Sowden, Miles; Cairncross, Eugene; Wilson, Gary; Zunckel, Mark; Kirillova, Elena; Reddy, Vis; Hietkamp, Sibbele

    In an urban environment where reactive pollutants are emitted, it is critically important that atmospheric chemistry be considered in modeling and air quality management including the evaluation of secondary pollutants such as ozone. This may be achieved through photochemical modeling, which is reliant on detailed, grid resolved emissions inventories. The US-EPA's approved Emissions Processing System (EPS) is used to develop a temporally and spatially resolved emissions inventory for the City of Cape Town for use in the Dynamic Air Pollution Prediction System (DAPPS). Included in this inventory are large and small point sources, mobile sources, and emissions from residential fuel burning and biogenic sources. Large point sources are usually well defined unlike the other source types that can have large uncertainties associated with them. In these circumstances, surrogate data are used to estimate emission rates. The FRamework for the Assessment of Uncertainties in Large-scale Emission INventories (FRAULEIN) approach to assessing uncertainty in the emissions inventory is adapted for DAPPS. A reasonable level of confidence exists for the characterization of large point sources but the two biggest source contributors namely vehicle and biogenic emissions, needs improvement.

  12. Prevalence of Anaemia and Associated Factors among Children below Five Years of Age in Cape Verde, West Africa

    PubMed Central

    Semedo, Rosa M.L.; Santos, Marta M.A.S.; Baião, Mirian R.; Luiz, Ronir R.

    2014-01-01

    ABSTRACT This study estimated the prevalence of anaemia and associated factors in a probability sample of 993 children aged 6-59 months in Cape Verde, West Africa. Odds ratio (OR) and 95% confidence interval (95% CI) were estimated from a hierarchical model for multiple analysis to assess the association between anaemia and explanatory variables. The prevalence of anaemia was 51.8% (95% CI 47.7-55.8). Children who resided within poor household conditions (OR 1.99; 95% CI 1.06-3.71) were below 24 months of age (OR 3.23; 95% CI 2.03-5.15) and recently experienced diarrhoea (OR 1.58; 95% CI 0.99-2.50) were at high risk of anaemia. Anaemia should be considered a serious public-health concern in Cape Verde, mainly for children below 24 months. Further, special consideration should be given to children who have experienced recent diarrhoea and belong to families residing in poor household conditions. PMID:25895198

  13. Ecology and distribution of large branchiopods (Crustacea, Branchiopoda, Anostraca, Notostraca, Laevicaudata, Spinicaudata) of the Eastern Cape Karoo, South Africa

    PubMed Central

    Mabidi, Annah; Bird, Matthew S.; Perissinotto, Renzo; Rogers, D. Christopher

    2016-01-01

    Abstract A survey of the large branchiopod fauna of the Eastern Cape Karoo region of South Africa was undertaken to provide baseline biodiversity information in light of impending shale gas development activities in the region. Twenty-two waterbodies, including nine dams and thirteen natural depression wetlands, were sampled during November 2014 and April 2015. A total of 13 species belonging to four orders were collected, comprising five anostracans, one notostracan, six spinicaudatans and one laevicaudatan. Cyzicus australis was most common, occurring in 46% of the waterbodies. Species co-occurred in 87% of the waterbodies, with a maximum number of six species recorded from the same waterbody. Our new distribution records for Lynceus truncatus, Streptocephalus spinicaudatus and Streptocephalus indistinctus represent substantial expansions of the previously known ranges for these species. Tarkastad is now the westernmost record for Streptocephalus spinicaudatus, while Jansenville now constitutes the southernmost record for Streptocephalus indistinctus. Large branchiopod distribution data from previous Eastern Cape records were combined with our current data, demonstrating that a total of 23 large branchiopod species have been recorded from the region to date. As the Karoo is one of the few major shale basins in the world where the natural baseline is still largely intact, this survey forms a basis for future reference and surface water quality monitoring during the process of shale gas exploration/extraction. PMID:27853398

  14. Prevalence of anaemia and associated factors among children below five years of age in Cape Verde, West Africa.

    PubMed

    Semedo, Rosa M L; Santos, Marta M A S; Baião, Mirian R; Luiz, Ronir R; da Veiga, Gloria V

    2014-12-01

    This study estimated the prevalence of anaemia and associated factors in a probability sample of 993 chil- dren aged 6-59 months in Cape Verde, West Africa. Odds ratio (OR) and 95% confidence interval (95% CI) were estimated from a hierarchical model for multiple analysis to assess the association between anaemia and explanatory variables. The prevalence of anaemia was 51.8% (95% CI 47.7-55.8). Children who resided within poor household conditions (OR 1.99; 95% CI 1.06-3.71) were below 24 months of age (OR 3.23; 95% CI 2.03-5.15) and recently experienced diarrhoea (OR 1.58; 95% CI 0.99-2.50) were at high risk of anaemia. Anaemia should be considered a serious public-health concern in Cape Verde, mainly for chil- dren below 24 months. Further, special consideration should be given to children who have experienced recent diarrhoea and belong to families residing in poor household conditions.

  15. Diversity and distribution of nematodes associated with terrestrial slugs in the Western Cape Province of South Africa.

    PubMed

    Ross, J L; Ivanova, E S; Sirgel, W F; Malan, A P; Wilson, M J

    2012-06-01

    A survey of nematodes associated with native and introduced species of terrestrial slugs was conducted in the Western Cape Province of South Africa, in order to gather new data regarding diversity and distribution. A total of 521 terrestrial slugs were collected from 35 localities throughout the Western Cape. All slugs were dissected and examined for the presence of internal nematodes. Extracted nematodes were identified using a combination of molecular (18S rRNA gene sequencing) and morphological techniques. Nematodes were found parasitizing slugs at 14 of the 35 sites examined, amounting to 40% of sample sites. Of all slugs, 6% were infected with nematodes. A total of seven species of nematode were identified in the province, including Agfa flexilis, Angiostoma sp., Phasmarhabditis sp. SA1, Phasmarhabditis sp. SA2, Caenorhabditis elegans, Panagrolaimus sp. and Rhabditis sp. Of these species, four were thought to be parasitic to slugs (A. flexilis, Angiostoma sp., Phasmarhabditis sp. SA1 and Phasmarhabditis sp. SA2), as opposed to forming necromenic or phoretic associations. Three new species of slug-parasitic nematode were identified during this study (Angiostoma sp., Phasmarhabditis sp. SA1 and Phasmarhabditis sp. SA2).

  16. Ecology and distribution of large branchiopods (Crustacea, Branchiopoda, Anostraca, Notostraca, Laevicaudata, Spinicaudata) of the Eastern Cape Karoo, South Africa.

    PubMed

    Mabidi, Annah; Bird, Matthew S; Perissinotto, Renzo; Rogers, D Christopher

    2016-01-01

    A survey of the large branchiopod fauna of the Eastern Cape Karoo region of South Africa was undertaken to provide baseline biodiversity information in light of impending shale gas development activities in the region. Twenty-two waterbodies, including nine dams and thirteen natural depression wetlands, were sampled during November 2014 and April 2015. A total of 13 species belonging to four orders were collected, comprising five anostracans, one notostracan, six spinicaudatans and one laevicaudatan. Cyzicus australis was most common, occurring in 46% of the waterbodies. Species co-occurred in 87% of the waterbodies, with a maximum number of six species recorded from the same waterbody. Our new distribution records for Lynceus truncatus, Streptocephalus spinicaudatus and Streptocephalus indistinctus represent substantial expansions of the previously known ranges for these species. Tarkastad is now the westernmost record for Streptocephalus spinicaudatus, while Jansenville now constitutes the southernmost record for Streptocephalus indistinctus. Large branchiopod distribution data from previous Eastern Cape records were combined with our current data, demonstrating that a total of 23 large branchiopod species have been recorded from the region to date. As the Karoo is one of the few major shale basins in the world where the natural baseline is still largely intact, this survey forms a basis for future reference and surface water quality monitoring during the process of shale gas exploration/extraction.

  17. What are we measuring? Comparison of household food security indicators in the Eastern Cape Province, South Africa.

    PubMed

    Hendriks, Sheryl L; van der Merwe, Corné; Ngidi, Mjabuliseni S; Manyamba, Christopher; Mbele, Mondli; McIntyre, Angela M; Mkandawire, Elizabeth; Molefe, Queeneth N; Mphephu, Mulalo Q; Ngwane, Lithle

    2016-01-01

    The development of national food security information systems is constrained by a lack of guidance on which indicators to use. This paper compares food security indicators across two seasons (summer and winter) in one of the most deprived areas of the Eastern Cape province of South Africa. The results show that only anthropometric indicators are sensitive enough to differentiate levels of food insecurity. The lack of consistent classification across indicators means that surveys must use a combination of food consumption and experience of hunger measures backed up by anthropometric measures. Targeting interventions is difficult if the measures cannot be relied on. Further investigation is needed to identify a suite of appropriate indicators for a national information and surveillance system.

  18. Initial review and analysis of the direct environmental impacts of CSP in the northern Cape, South Africa

    NASA Astrophysics Data System (ADS)

    Rudman, Justine; Gauché, Paul; Esler, Karen J.

    2016-05-01

    The Integrated Resource Plan (IRP) of 2010 and the IRP Update provide the most recent guidance to the electricity generation future of South Africa (SA) and both plans include an increased proportion of renewable energy generation capacity. Given that SA has abundant renewable energy resource potential, this inclusion is welcome. Only 600 MW of the capacity allocated to concentrating solar power (CSP) has been committed to projects in the Northern Cape and represents roughly a fifth of the capacity that has been included in the IRP. Although CSP is particularly new in the electricity generation system of the country, the abundant solar resources of the region with annual DNI values of above 2900 kWh/m2 across the arid Savannah and Nama-Karoo biomes offer a promising future for the development of CSP in South Africa. These areas have largely been left untouched by technological development activities and thus renewable energy projects present a variety of possible direct and indirect environmental, social and economic impacts. Environmental Impact Assessments do focus on local impacts, but given that ecological processes often extend to regional- and landscape scales, understanding this scaled context is important to the alignment of development- and conservation priorities. Given the capacities allocated to CSP for the future of SA's electricity generation system, impacts on land, air, water and biodiversity which are associated with CSP are expected to increase in distribution and the understanding thereof deems valuable already from this early point in CSP's future in SA. We provide a review of direct impacts of CSP on the natural environment and an overview of the anticipated specific significance thereof in the Northern Cape.

  19. Seasonal availability of edible underground and aboveground carbohydrate resources to human foragers on the Cape south coast, South Africa.

    PubMed

    De Vynck, Jan C; Cowling, Richard M; Potts, Alastair J; Marean, Curtis W

    2016-01-01

    The coastal environments of South Africa's Cape Floristic Region (CFR) provide some of the earliest and most abundant evidence for the emergence of cognitively modern humans. In particular, the south coast of the CFR provided a uniquely diverse resource base for hunter-gatherers, which included marine shellfish, game, and carbohydrate-bearing plants, especially those with Underground Storage Organs (USOs). It has been hypothesized that these resources underpinned the continuity of human occupation in the region since the Middle Pleistocene. Very little research has been conducted on the foraging potential of carbohydrate resources in the CFR. This study focuses on the seasonal availability of plants with edible carbohydrates at six-weekly intervals over a two-year period in four vegetation types on South Africa's Cape south coast. Different plant species were considered available to foragers if the edible carbohydrate was directly (i.e. above-ground edible portions) or indirectly (above-ground indications to below-ground edible portions) visible to an expert botanist familiar with this landscape. A total of 52 edible plant species were recorded across all vegetation types. Of these, 33 species were geophytes with edible USOs and 21 species had aboveground edible carbohydrates. Limestone Fynbos had the richest flora, followed by Strandveld, Renosterveld and lastly, Sand Fynbos. The availability of plant species differed across vegetation types and between survey years. The number of available USO species was highest for a six-month period from winter to early summer (Jul-Dec) across all vegetation types. Months of lowest species' availability were in mid-summer to early autumn (Jan-Apr); the early winter (May-Jun) values were variable, being highest in Limestone Fynbos. However, even during the late summer carbohydrate "crunch," 25 carbohydrate bearing species were visible across the four vegetation types. To establish a robust resource landscape will require

  20. A survey of the physical health status of pupils aged 10-14 years in Standards 3-5 at three schools in New Crossroads, near Cape Town in the Western Cape.

    PubMed

    Ramphele, M A; Heap, M; Trollip, D K

    1995-10-01

    Although adolescence is most commonly associated with risk-taking behaviour, mortality due to poverty-related conditions is high among black African children aged 10-14 years. This paper describes a study carried out in October 1991 to assess the physical health status of 860 underprivileged pupils aged 10-14 years in Standards 3-5 at three schools in New Crossroads, near Cape Town. Data on nutritional status, age at menarche, blood pressure, eyesight, physical abnormalities, injuries and use of hospitals were obtained. The response rate was 90%. Of all the children, 7.2% were below the 5th percentile weight-for-age. The proportion of boys (13.1%) below the 5th percentile weight-for-age was significantly higher than that of girls (3.7%). Of all the children, 19.5% were below the 5th percentile height-for-age. The proportion of boys (24.4%) below the 5th percentile height-for-age was also significantly higher than that of girls (16.7%). The average age at menarche was 13 years, similar to that (12.8 years) reported for the UK. In 5% of the children, the diastolic blood pressure was > 90 mmHg and the findings show some increase with age. Red Cross War Memorial Children's Hospital accounted for 30.9% of hospital attendances. 'Chest' complaints (19.5%) were frequent reasons for consultations, while 15.2% of the children reported being injured, with car accidents (16.0%), fractures (27.5%) and burns (20.6%) being the most common injuries. It is suggested that the provision of a 24-hour day hospital will ease the load on the referral hospital, i.e. Red Cross War Memorial Children's Hospital.(ABSTRACT TRUNCATED AT 250 WORDS)

  1. Ectoparasite burdens of the common mole-rat (Cryptomys hottentotus hottentotus) from the Cape Provinces of South Africa.

    PubMed

    Archer, Elizabeth K; Bennett, Nigel C; Ueckermann, Edward A; Lutermann, Heike

    2014-02-01

    The members of the African mole-rat family Bathyergidae are widely distributed across sub-Saharan Africa. Despite their well-studied biology and reproductive physiology, the current knowledge of their ectoparasite fauna is limited and ambiguous due to recent revisions of the bathyergid taxonomy. The common mole-rat (Cryptomys hottentotus hottentotus) is 1 of the most widely distributed species of these subterranean rodents. Ectoparasites were collected from 268 common mole-rats at 2 localities (Western and Northern Cape provinces) in South Africa over the course of 18 mo with the aim to document species richness, prevalence, and abundance of these ectoparasites. The aggregation of parasite species, sex bias within a species, and seasonal variation in ectoparasite burdens were investigated. A total of 4,830 individual parasites from 4 mite species (Androlaelaps scapularis, Androlaelaps capensis, Radfordia ensifera, and 1 undetermined chigger [family Trombiculidae]), 1 flea species (Cryptopsylla ingrami), and 1 louse species (Eulinognathus hilli) were collected. With the exception of R. ensifera and the chigger, all of these ectoparasites appear to be host specific either for the host species or the Bathyergidae. Aggregation indices indicated that with the exception of E. hilli, the distribution of all parasite species was highly aggregated among hosts and sex biased. Seasonal variation in prevalence, abundance, and species richness was apparent, with greater burdens in the rainy winter season. This is likely related to seasonal variation in abiotic factors but may also be affected by the timing of host reproduction and dispersal behavior.

  2. An HIV/AIDS Knowledge Scale for Adolescents: Item Response Theory Analyses Based on Data from a Study in South Africa and Tanzania

    ERIC Educational Resources Information Center

    Aaro, Leif E.; Breivik, Kyrre; Klepp, Knut-Inge; Kaaya, Sylvia; Onya, Hans E.; Wubs, Annegreet; Helleve, Arnfinn; Flisher, Alan J.

    2011-01-01

    A 14-item human immunodeficiency virus/acquired immunodeficiency syndrome knowledge scale was used among school students in 80 schools in 3 sites in Sub-Saharan Africa (Cape Town and Mankweng, South Africa, and Dar es Salaam, Tanzania). For each item, an incorrect or don't know response was coded as 0 and correct response as 1. Exploratory factor…

  3. Two new species of Indigofera L. (Leguminosae) from the Sneeuberg Centre of Floristic Endemism, Great Escarpment (Eastern and Western Cape, South Africa).

    PubMed

    Clark, V Ralph; Schrire, Brian D; Barker, Nigel P

    2015-01-01

    Two new species of Indigofera L. (Leguminosae) are described from the Sneeuberg Centre of Floristic Endemism on the southern Great Escarpment, Eastern and Western Cape Provinces, South Africa. Both species are localised high-altitude endemics. Indigoferamagnifica Schrire & V.R. Clark is confined to the summit plateau of the Toorberg-Koudeveldberg-Meelberg west of Graaff-Reinet, and complements other western Sneeuberg endemics such as Ericapasserinoides (Bolus) E.G.H. Oliv. and Faurearecondita Rourke & V.R. Clark. Indigoferaasantasanensis Schrire & V.R. Clark is confined to a small area east of Graaff-Reinet, and complements several other eastern Sneeuberg endemics such as Euryopsexsudans B. Nord & V.R. Clark and Euryopsproteoides B. Nord. & V.R. Clark. Based on morphology, both new species belong to the Cape Clade of Indigofera, supporting a biogeographical link between the Cape Floristic Region and the Sneeuberg, as well as with the rest of the eastern Great Escarpment.

  4. Activated carbon fiber felt and polymer fiber as biofilm carrier in a modified University of Cape Town process for sewage treatment.

    PubMed

    Zhou, Dongkai

    2013-01-01

    Biofilms on fiber-based carriers have attracted much concern in wastewater treatment processes recently. In this study: (1) a novel sandwich structure fiber-based biofilm carrier was produced, which consisted of an inner core composed of polyacrylonitrile-based activated carbon fiber felt (PAN-ACFF) and an outer coat made of polyester reticular cloth with polypropylene fiber loops; (2) the novel carrier was filled in a step-feeding pilot-scale modified University of Cape Town process (MUCT) for sewage treatment; the MUCT contained a series of pre-anoxic/anaerobic/anoxic-1/anoxic-2/oxic tanks, wherein nitrification liquor was recycled to the anoxic-2 tank and an extra liquor return from the anoxic-1 to the pre-anoxic tank was set up; and (3) the removal efficiencies of chemical oxygen demand (COD), total nitrogen (TN) and total phosphorus (TP) were continuously tested for two periods as operational parameters alternated. The optimum values were collected in Period II, when the influent loads were 2,100.6 ± 120.3 gCOD/(d m(3)), 205.5 ± 20.4 gTN/(d m(3)), 39.9 ± 3.9 gTP/(d m(3)), the removal percentages were 93.1 ± 1.1% of COD, 39.4 ± 3.5% of TN, and 84.6 ± 3.4% of TP. For COD, NH4(+)-N, and TP, the specific removal loads of filler were 291.5 ± 18.2, 22.9 ± 3.1, 4.8 ± 0.5 (g d)/kg.

  5. Coastal lake sediments from the southern Cape, South Africa - Implications for sea level and climate variations during the Holocene

    NASA Astrophysics Data System (ADS)

    Wündsch, M.; Haberzettl, T.; Kirsten, K. L.; Meschner, S.; Frenzel, P.; Baade, J.; Daut, G.; Mäusbacher, R.; Kasper, T.; Quick, L. J.; Meadows, M. E.; Zabel, M.

    2015-12-01

    Within the RAIN project (Regional Archives for Integrated iNvestigations) interdisciplinary investigations on climate evolution and environmental change in southern Africa during the Late Quaternary are being conducted. For this purpose, spatial and temporal variations of the three major rainfall zones covering South Africa (winter-, summer- and year-round rainfall zone) are studied using both marine and terrestrial archives. Here we present results inferred from sediment records from lakes Groenvlei and Eilandvlei located on the southern Cape coast within the year-round rainfall zone. From Eilandvlei, a brackish lake that is connected to the Indian Ocean via an estuary, a 30.5 m sediment core was recovered. Reservoir-corrected radiocarbon ages reveal a continuous sedimentation and a maximum age of about 8,900 cal BP. This ultra-high-resolution record of environmental change during the Holocene represents a unique discovery for entire southern Africa. Geochemical data reveal different phases of marine and terrestrial sediment deposition throughout the covered time span. Hence, this record reflects changes in sea level, but also variations in terrestrial sediment transport and thus changing climatic conditions. The sediment core from Groenvlei, which today is isolated from the Indian Ocean, covers the past 4,200 cal BP. Sediments from this lake are predominantly composed of autochthonous carbonates. Mineralogical investigations reveal alternating deposition of calcite and aragonite/dolomite, pointing to variable Mg/Ca ratios and thus variations in lake water salinity. These changes can be linked to sea level variations as well as to changes in the precipitation/evaporation balance, and hence climate. Based on these results, the Groenvlei record reveals a decreasing marine influence and a trend from generally drier to wetter conditions within the last 4,200 yrs. Moreover, several layers of enhanced allochtonous input were detected in this record, which can be

  6. Soekor, partners explore possibilities in Bredasdorp basin off South Africa

    SciTech Connect

    Burden, P.L.A. Ltd., Parow, )

    1992-12-21

    This paper reports on the Bredasdorp basin, situated off the south coast of the Republic of South Africa, southeast of Cape Town and west-southwest of Port Elizabeth. Both cities have modern deepwater harbor facilities. Infrastructure along the coast includes well developed road, air, and rail links. A petrochemical plant for the conversion of off-shore gas and condensate to hydrocarbon fuels as well as certain chemical feedstocks has recently been completed at Mossel Bay about 100 km north of the Bredasdorp basin. Refineries are situated at Cape Town and Durban.

  7. Habitat type and nursery function for coastal marine fish species, with emphasis on the Eastern Cape region, South Africa

    NASA Astrophysics Data System (ADS)

    Whitfield, Alan K.; Pattrick, Paula

    2015-07-01

    A considerable amount of research has been undertaken to document and assess the nursery function of a variety of coastal habitats for marine fish species around the world. Most of these studies have focused on particular habitats and have generally been confined to a limited range of fish species associated with specific nursery areas. In this review we conduct a general assessment of the state of knowledge of coastal habitats in fulfilling the nursery-role concept for marine fishes, with particular emphasis on biotic and abiotic factors that influence nursery value. A primary aim was to synthesize information that can be used to drive sound conservation planning and provide a conceptual framework so that new marine protected areas (MPAs) incorporate the full range of nursery areas that are present within the coastal zone. We also use published data from a coastal section in the Eastern Cape Province, South Africa, to highlight the differential use of shallow aquatic habitats by a range of juvenile marine fish species within this region. Although the Eastern Cape case study does not assess the relative growth, food availability or predation in nursery and non-nursery areas within the coastal zone, it does document which habitats are important to the juveniles of dominant marine species within each area. These habitats, which range from intertidal pools, subtidal gulleys and surf zones to estuaries, do appear to perform a key role in the biological success of species assemblages, with the juveniles of particular marine fishes tending to favour specific nursery areas. According to a multivariate analysis of nursery habitat use within this region, marine species using estuaries tend to differ considerably from those using nearshore coastal waters, with a similar pattern likely to occur elsewhere in the world.

  8. Cape of Good Hope

    Atmospheric Science Data Center

    2013-04-16

    article title:  Aerosol retrieval over Cape of Good Hope   ... Da image in the southern part of South Africa - the aerosol retrieval picks it up, and also the slightly clearer area in the middle. Also, ... MISR Science Teams Aug 23, 2000 - Aerosol retrieval over Cape of Good Hope. project:  MISR ...

  9. Poverty and human immunodeficiency virus in children: a view from the Western Cape, South Africa.

    PubMed

    Marais, Barend Jacobus; Esser, Monika; Godwin, Sarah; Rabie, Helena; Cotton, Mark Fredric

    2008-01-01

    Sub-Saharan Africa is the region affected worst by human immunodeficiency virus (HIV), with the most southern countries, including Botswana, Zimbabwe, Swaziland, and South Africa, carrying the highest disease burden. This geographic distribution represents a complex interaction among virological, political, social, cultural, and economic forces. In South Africa the HIV epidemic is seemingly unchecked, with 18% of the adult population infected. Although South Africa is a mid-developed country, there is a large chasm between the wealthy and the poor, with many living in moderate to extreme poverty. Poverty creates conditions that fuel the HIV epidemic while HIV exacerbates the multiple interlinking causes of poverty. Children are the most vulnerable members of society, severely affected by all components of the poverty cycle. Although improved health education and access to care will alleviate many problems, sustainable poverty alleviation should form an essential component of the response to AIDS. The formulation of the United Nations Millennium Developmental Goals is an important step in the right direction, but global and local political commitment is essential for success.

  10. Poverty and Disability in Eastern and Western Cape Provinces, South Africa

    ERIC Educational Resources Information Center

    Loeb, Mitchell; Eide, Arne H.; Jelsma, Jennifer; Toni, Mzolisi ka; Maart, Soraya

    2008-01-01

    The impact of disability on the living conditions of people living in specifically resource-poor areas in South Africa has not previously been addressed. This paper presents a comparison of people with a disability and their non-disabled peers with respect to some key poverty indicators among a sample of Xhosa speaking individuals in resource-poor…

  11. Condom use at last sexual relationship among adolescents of Santiago Island, Cape Verde, - West Africa

    PubMed Central

    2012-01-01

    Objective To estimate factors associated with condom use at last sexual intercourse among adolescents. Methods Cross-sectional study of a representative sample of 368 sexually active adolescents aged 13–17 years from eight public high schools on Santiago Island, Cape Verde, 2007. The level of significance was 5.0% obtained from logistic regression, considering the association between condom use and socio-demographic, sexual and reproductive variables. Results The prevalence of condom use at last sexual intercourse was 94.9%. Factors associated with condom use at last sexual relationship were: non-Catholic religion (OR=0.68, 95%CI: 0.52; 0.88) and affective-sexual partnership before the interview (OR=5.15, 95%CI: 1.79; 14.80). Conclusions There was a high prevalence of condom use at last sexual intercourse of adolescents. PMID:23153259

  12. Factors affecting treatment outcomes in drug-resistant tuberculosis cases in the Northern Cape, South Africa.

    PubMed

    Elliott, E; Draper, H R; Baitsiwe, P; Claassens, M M

    2014-09-21

    The Northern Cape Province has low cure rates (21%) for multidrug-resistant tuberculosis (TB). We audited the programme to identify factors affecting treatment outcomes. Cases admitted to two drug-resistant TB units from 2007 to 2009 had data extracted from clinical folders. Unfavourable treatment outcomes were found in 58% of the 272 cases. A multivariable regression analysis found that male sex was associated with unfavourable outcome (P = 0.009). Weight at diagnosis (P < 0.001) and oral drug adherence (P < 0.001) were also associated with an unfavourable outcome; however, injectable drug adherence was not (P = 0.395). Positive baseline smear and human immunodeficiency virus positive status were not associated with unfavourable outcome. Shorter, more patient-friendly regimens may go a long way to improving adherence and outcomes.

  13. Detection of Transgenes in Local Maize Varieties of Small-Scale Farmers in Eastern Cape, South Africa

    PubMed Central

    Iversen, Marianne; Grønsberg, Idun M.; van den Berg, Johnnie; Fischer, Klara; Aheto, Denis Worlanyo; Bøhn, Thomas

    2014-01-01

    Small-scale subsistence farmers in South Africa have been introduced to genetically modified (GM) crops for more than a decade. Little is known about i) the extent of transgene introgression into locally recycled seed, ii) what short and long-term ecological and socioeconomic impacts such mixing of seeds might have, iii) how the farmers perceive GM crops, and iv) to what degree approval conditions are followed and controlled. This study conducted in the Eastern Cape, South Africa, aims primarily at addressing the first of these issues. We analysed for transgenes in 796 individual maize plants (leaves) and 20 seed batches collected in a village where GM insect resistant maize was previously promoted and grown as part of an governmental agricultural development program over a seven year period (2001–2008). Additionally, we surveyed the varieties of maize grown and the farmers’ practices of recycling and sharing of seed in the same community (26 farmers were interviewed). Recycling and sharing of seeds were common in the community and may contribute to spread and persistence of transgenes in maize on a local or regional level. By analysing DNA we found that the commonly used transgene promoter p35s occurred in one of the 796 leaf samples (0.0013%) and in five of the 20 seed samples (25%). Three of the 20 seed samples (15%) included herbicide tolerant maize (NK603) intentionally grown by the farmers from seed bought from local seed retailers or acquired through a currently running agricultural development program. The two remaining positive seed samples (10%) included genes for insect resistance (from MON810). In both cases the farmers were unaware of the transgenes present. In conclusion, we demonstrate that transgenes are mixed into seed storages of small-scale farming communities where recycling and sharing of seeds are common, i.e. spread beyond the control of the formal seed system. PMID:25551616

  14. Taxi 'sugar daddies' and taxi queens: male taxi driver attitudes regarding transactional relationships in the Western Cape, South Africa.

    PubMed

    Potgieter, Cheryl; Strebel, Anna; Shefer, Tamara; Wagner, Claire

    2012-11-01

    Media reports are emerging on the phenomenon of young girls who travel with older mini-bus taxi drivers, and who are thought to have sex with the drivers in exchange for gifts and money. The extent to which such relationships might facilitate unsafe sexual practices and increased risks for both the men and the young women, often referred to as taxi queens, remains an important question in the light of the current challenges of HIV/AIDS in sub-Saharan Africa. However, very little research has been undertaken on this issue, especially regarding the perceptions and experiences of taxi drivers. Thus this paper aims to provide some preliminary findings on taxi drivers' attitudes and beliefs about taxi queens and their relationships with taxi drivers. A 22-item questionnaire was administered to 223 male taxi drivers in two regions in the Western Cape Province, South Africa. Taxi drivers in this study largely saw the relationship between taxi drivers and the young girls who ride with them as providing status for both the girls and drivers, and there seemed to be recognition of the transactional nature of the relationship between taxi drivers and taxi queens. The stigmatisation of young girls who ride with taxi drivers was evident. Drivers had knowledge and awareness of the risks of unsafe sex and supported condom use, although there appeared to be some uncertainty and confusion about the likelihood of HIV infection between drivers and girls. While taxi drivers recognised the role of alcohol in relationships with young girls, they seemed to deny that the abuse of drugs was common. The study highlights a number of key areas that need to be explored with men in the taxi industry, in order to address risk behaviours for both taxi drivers and the girls who ride with them.

  15. Contraceptive practices among women seeking termination of pregnancy in one public hospital in Eastern Cape, South Africa

    PubMed Central

    Oluwole, Ebenezer O.

    2016-01-01

    Background There is significantly high contraceptive knowledge in South Africa, but the uptake of contraceptives is average to low with resultant soaring of unplanned pregnancy and rising statistics of termination of pregnancy (TOP) services. This study aimed to establish the contraceptive practices among women in the South African population seeking TOP in one public hospital in Eastern Cape, South Africa. Methods A cross-sectional study was carried out among women seeking TOP in a women’s clinic. Self-administered questionnaires were used as data collection tool, and the data collected were entered into SPSS software for analysis, using descriptive statistics to calculate frequencies and percentages while chi-square test was used to determine the associations between the socio-demography and contraceptive practices of the participants. Results Majority of the women were aged between 20 and 29 years, had secondary education, unemployed, single and resided in townships. Contraceptive uptake prior to termination of pregnancy (CTOP) among them was 44.1%, but 85.8% had good contraceptives knowledge. Their contraceptive practices are determined by partner’s opinion, source and availability of contraceptives, previous CTOP, side effect of contraceptives and having children. Age group, educational level and employment status were found to be related to the contraceptive practices of the participants but were not statistically significant. Conclusion To reduce unplanned pregnancies and subsequent number of women seeking CTOP, the socio-economic factors associated with contraceptive practices as well as the programmes, policies and guidelines of contraceptives need to be improved on for any improvement on the factors determining contraceptive practices. PMID:27608676

  16. A survey of the Cape Floristic Region of South Africa for the presence of cyst nematodes (Nematoda: Heteroderidae).

    PubMed

    Knoetze, Rinus; Swart, Antoinette

    2014-12-09

    A survey was performed to detect the presence of cyst nematodes in the Cape Floristic Region of South Africa. Soil was collected in the rhizosphere of the dominant plant species within blocks of indigenous vegetation and cysts were extracted from them. A total of 81 blocks of indigenous vegetation were sampled as described. Cysts were detected in 7 of these samples, representing 6 different vegetation types. One set of primers was used to amplify the ITS regions from these cysts, including the 5.8S ribosomal gene, as well as short parts of the 18S and 28S ribosomal genes. ITS-rDNA sequences from the indigenous isolates were aligned with selected sequences of other species from the Heteroderidae. Phylogenetic analyses to resolve the relationships between indigenous isolates and selected representatives of the Heteroderidae were conducted using the Maximum Parsimony method. The consensus tree resulting from alignment of the circumfenestrate cysts revealed that isolates SK18, WK1 and WK26 are included in a clade of Globodera species that parasitise non-solanaceous plants, forming a monophyletic group with G. millefolii, G. artemisiae, and an unidentified Globodera sp. from Portugal. In a tree resulting from the alignment of the Heterodera spp., isolates OK14 and WK2 are included in the Afenestrata group, forming a monophyletic group with H. orientalis.This survey unearthed at least four potentially new species of cyst nematodes, which may prove invaluable for the study of the evolution and biogeography of the group.

  17. Functional Traits in Parallel Evolutionary Radiations and Trait-Environment Associations in the Cape Floristic Region of South Africa.

    PubMed

    Mitchell, Nora; Moore, Timothy E; Mollmann, Hayley Kilroy; Carlson, Jane E; Mocko, Kerri; Martinez-Cabrera, Hugo; Adams, Christopher; Silander, John A; Jones, Cynthia S; Schlichting, Carl D; Holsinger, Kent E

    2015-04-01

    Evolutionary radiations with extreme levels of diversity present a unique opportunity to study the role of the environment in plant evolution. If environmental adaptation played an important role in such radiations, we expect to find associations between functional traits and key climatic variables. Similar trait-environment associations across clades may reflect common responses, while contradictory associations may suggest lineage-specific adaptations. Here, we explore trait-environment relationships in two evolutionary radiations in the fynbos biome of the highly biodiverse Cape Floristic Region (CFR) of South Africa. Protea and Pelargonium are morphologically and evolutionarily diverse genera that typify the CFR yet are substantially different in growth form and morphology. Our analytical approach employs a Bayesian multiple-response generalized linear mixed-effects model, taking into account covariation among traits and controlling for phylogenetic relationships. Of the pairwise trait-environment associations tested, 6 out of 24 were in the same direction and 2 out of 24 were in opposite directions, with the latter apparently reflecting alternative life-history strategies. These findings demonstrate that trait diversity within two plant lineages may reflect both parallel and idiosyncratic responses to the environment, rather than all taxa conforming to a global-scale pattern. Such insights are essential for understanding how trait-environment associations arise and how they influence species diversification.

  18. Measuring evapotranspiration using an eddy covariance system over the Albany Thicket of the Eastern Cape, South Africa

    NASA Astrophysics Data System (ADS)

    Gwate, O.; Mantel, Sukhmani K.; Palmer, Anthony R.; Gibson, Lesley A.

    2016-10-01

    Determining water and carbon fluxes over a vegetated surface is important in a context of global environmental changes and the fluxes help in understanding ecosystem functioning. Pursuant to this, the study measured evapotranspiration (ET) using an eddy covariance (EC) system installed over an intact example of the Albany Thicket (AT) vegetation in the Eastern Cape, South Africa. Environmental constraints to ET were also assessed by examining the response of ET to biotic and abiotic factors. The EC system comprised of an open path Infrared Gas Analyser and Sonic anemometer and an attendant weather station to measure bi-meteorological variables. Post processing of eddy covariance data was conducted using EddyPro software. Quality assessment of fluxes was also performed and rejected and missing data were filled using the method of mean diurnal variations (MDV). Much of the variation in ET was accounted for by the leaf area index (LAI, p < 0.001, 41%) and soil moisture content (SWC, p < 0.001, 32%). Total measured ET during the experiment was greater than total rainfall received owing to the high water storage capacity of the vegetation and the possibility of vegetation accessing ground water. Most of the net radiation was consumed by sensible heat flux and this means that ET in the area is essentially water limited since abundant energy was available to drive turbulent transfers of energy. Understanding the environmental constraints to ET is crucial in predicting the ecosystem response to environmental forces such as climate change.

  19. Evaluation of a safer male circumcision training programme for traditional surgeons and nurses in the Eastern Cape, South Africa.

    PubMed

    Peltzer, Karl; Nqeketo, Ayanda; Petros, George; Kanta, Xola

    2008-06-18

    Training designed to improve circumcision knowledge, attitude and practice was delivered over 5 days to 34 traditional surgeons and 49 traditional nurses in the Eastern Cape, South Africa. Training included the following topics: initiation rites; statutory regulation of traditional male circumcision and initiation into Manhood (TCIM); structure and function of the male sex organs; procedure of safe circumcision, infection control; sexually transmitted infections (STIs); HIV/AIDS; infection control measures; aftercare of the initiate including after care of the circumcision wound and initiate as a whole; detection and early management of common complications of circumcision; nutrition and fluid management; code of conduct and ethics; and sexual health education. The evaluation of the training consisted of a prospective assessment of knowledge and attitude immediately prior to and after training. Significant improvement in knowledge and/or attitudes was observed in legal aspects, STI, HIV and environmental aspects, attitudes in terms of improved collaboration with biomedical health care providers, normal and abnormal anatomy and physiology, sexually transmitted infections and including HIV, circumcision practice and aftercare of initiates. We concluded that safer circumcision training can be successfully delivered to traditional surgeons and nurses.

  20. Middle and Later Stone Age large mammal and tortoise remains from Die Kelders Cave 1, Western Cape Province, South Africa.

    PubMed

    Klein, R G; Cruz-Uribe, K

    2000-01-01

    Die Kelders Cave 1, South Africa, has provided more than 150,000 taxonomically identifiable mammal and tortoise bones from Middle Stone Age (MSA) and Later Stone Age (LSA) deposits. Cape dune mole-rats dominate the mammal sample, and they appear to have been accumulated mainly by people during the LSA occupation and mainly by eagle owls in the MSA. In sharp contrast to the LSA fauna, the MSA sample contains extralimital ungulates that imply relatively moist, grassy conditions. The large mean size of the MSA mole-rats also points to greater humidity, while the large size of the gray mongooses implies cooler temperatures. The sum supports luminescence and ESR dates that place the MSA occupation within the early part of the Last Glaciation (global isotope stage 4). The Die Kelders ungulate bones support those from Klasies River Mouth in suggesting that MSA people obtained dangerous terrestrial prey much less frequently than their LSA successors, probably because MSA people lacked the bow and arrow and other projectile weapons. The Die Kelders tortoise bones constrain the extent of climatic change, since their abundance indicates that warm, dry days remained common, at least seasonally. The tortoises tend to be much larger in the MSA layers than in the LSA ones, suggesting that MSA people collected tortoises less intensively, probably because MSA populations were relatively sparse.

  1. Pressed flowers: notions of indigenous and alien vegetation in South Africa's Western Cape, c. 1902-1945.

    PubMed

    Pooley, Simon

    2010-01-01

    In the early twentieth century, botanists in South Africa's Western Cape sought urgently to popularise and protect the region's unique indigenous Fynbos flora. Plants imported from the 1840s, some of which proved invasive, became a physical and symbolic focus for their advocacy. The botanists' efforts resonated with political attempts to forge a common white South African national identity that drew on notions of landscape and the indigenous flora for symbolism and that consciously exploited the politically integrative potential of the new science of ecology. Introduced by overseas-trained experts, ecological theory was, however, inappropriate for the local flora, and had unfortunate consequences for the scientifically-informed research and management particularly of the fire-maintained Fynbos. While botanists and conservationists were united in defending the local flora against invasive introduced plants, they drew distinctions between what was 'indigenous' and what was 'natural' that further complicated their attitudes to the local flora. These historical debates illuminate agendas and policies on introduced ('alien') and indigenous flora in the region today.

  2. Farmers' perceptions and knowledge of cattle adaptation to heat stress and tick resistance in the eastern cape, South Africa.

    PubMed

    Katiyatiya, C L F; Muchenje, V; Mushunje, A

    2014-11-01

    The objective of this study was to determine the perceptions and knowledge of farmers of heat stress and tick resistance in cattle. A cross-sectional survey was conducted and 110 farmers in four villages in the sour and sweet velds of the Eastern Cape Province, South Africa were interviewed. The associations among area (municipality), gender, age, level of education, employment and religion were computed using Chi-square tests. The majority of the respondents had on average 4 bulls, 4 cows, 4 heifers, 4 calves, and 4 oxen. Milk was considered as the major (28.3%) reason for keeping cattle. Most farmers owned non-descript (72.6%), and Nguni (45.3%) cattle because of their heat tolerance (54.7%), tick resistance (54.7%), and milking ability (28.2%) traits. Excessive panting (56.6%) and disease transmission (76%) were regarded as the major effects of heat stress and tick infestation in cattle, respectively. About 50% of the respondents agreed that hair length influences tick resistance and 47.17% considered coat colour when acquiring cattle. In the sampled areas, ticks were prevalent in the summer season (93%), and 77.36% of the respondents use acaricides every fortnight. Gall sickness was reported to be a major problem in the cattle herds by 36.79% of the respondents. Our results showed that farmers in the two municipalities had knowledge of cattle adaptation to heat stress and tick resistance.

  3. Environmental, ecological, and paleoanthropological implications of the late Pleistocene mammalian fauna from Equus Cave, northern Cape Province, South Africa

    NASA Astrophysics Data System (ADS)

    Klein, Richard G.; Cruz-Uribe, Kathryn; Beaumont, Peter B.

    1991-07-01

    The late Pleistocene deposits of Equus Cave, northern Cape Province, South Africa, have provided more than 30,000 taxonomically identifiable mammal bones from 48 species. Context, associations, and features of the bone assemblage implicate brown hyenas as the main accumulators. The fauna is significant mainly because (1) it supplements previous evidence that regional climate was cooler and possibly also somewhat moister during part(s) of the late Pleistocene, but deviated less from the historic norm than in areas farther south; (2) it shows that Bond's springbok, which became extinct in the early Holocene, differed from the surviving common springbok not only in important morphological respects but also in reproductive pattern; and (3) it sustains earlier suggestions that an abundance of carnivores, a paucity of small hard bones, and increase in the cranial/postcranial ratio with species size, and exclusively attritional mortality profiles are features that tend to differentiate assemblages accumulated by brown hyenas from those accumulated by people. In addition, pending firmer dating, the fragmentary human fossils from Equus Cave may support an exclusively African origin for anatomically modern humans.

  4. New geological estimates of Pliocene sea levels from the Western and Northern Cape Provinces, Republic of South Africa

    NASA Astrophysics Data System (ADS)

    Hearty, P. J.; O'Leary, M.; Raymo, M. E.; Rovere, A.; Inglis, J.; Roberts, D.; Bergh, E.

    2012-12-01

    The mid-late Pliocene warm period (MPWP) is the most recent geologic interval when global atmospheric CO2 reached ~400 ppmv. The MPWP is of great interest to paleoclimatologists and modelers because accurate geological data would help to explain the behavior of sea level (SL) and ice sheets in a past warmer climates. Our modern industrial Earth is rapidly approaching this ominous benchmark (395.77 ppmv 6/2012). The trailing continental margin and far-field sites of western and southern Republic of South Africa (RSA) yield abundant coastal imprints of Miocene to Pleistocene seastands. Existing literature identifies zone fossils, and a few unpublished Sr-isotope ages that correlate these shoreline deposits with Pliocene highstands. Younger Pleistocene SL benchmarks provide indications of the regional tectonic stability, with MIS 5e (125 ka) deposits widely correlated along RSA coasts at about +3 m asl. Precise elevations of geomorphic, sedimentary, and biological SL indicators were measured in Western and Northern Cape Provinces of RSA with decimeter accuracy using an OmniStar differential GPS. High-resolution SL indicators (within 0.5 m of paleo-SL) include abrasion platforms (Fig 1), marine terraces, sub-, inter-, and supratidal sedimentary structures, and in situ marine invertebrates such as shallow water oysters and intertidal barnacles. The coastal geomorphic expression of the MPWP is profound. For more than 0.5 Ma, we hypothesize that high frequency (20-40 ka), low amplitude oscillations of Pliocene SL acted as a shoreline "buzz saw", laterally incising older bedrock, forming extensive planation surfaces along the coastline. We propose these broad geomorphic features are diagnostic of this prolonged interval of low amplitude but consistent SL along relatively stable, non-sediment-dominated coastlines of the world. Although currently uncorrected for post-depositional effects including GIA and dynamic topography, our PLIOMAX team (www.pliomax.org) has documented

  5. Teachers as Memory Makers: Testimony in the Making of a New History in South Africa

    ERIC Educational Resources Information Center

    Dryden-Peterson, Sarah; Sieborger, Rob

    2006-01-01

    This article examines the use of testimony in the making of a new history in South Africa, situating this phenomenon in the context of public construction of memory and identifying history teachers as critical to the process. Through an ethnographic study of 16 schools that illuminates the use of teacher testimony in Cape Town history classrooms,…

  6. Translational Research in South Africa: Evaluating Implementation Quality Using a Factorial Design

    ERIC Educational Resources Information Center

    Caldwell, Linda L.; Smith, Edward A.; Collins, Linda M.; Graham, John W.; Lai, Mary; Wegner, Lisa; Vergnani, Tania; Matthews, Catherine; Jacobs, Joachim

    2012-01-01

    Background: HealthWise South Africa: Life Skills for Adolescents (HW) is an evidence-based substance use and sexual risk prevention program that emphasizes the positive use of leisure time. Since 2000, this program has evolved from pilot testing through an efficacy trial involving over 7,000 youth in the Cape Town area. Beginning in 2011, through…

  7. Project Lungisela: Supporting Young People Leaving State Care in South Africa

    ERIC Educational Resources Information Center

    Tanur, Carly

    2012-01-01

    This paper focuses on appropriate responses to the unique challenges faced by young people at risk who are transitioning out of state care in South Africa. Specific lessons are drawn from Project Lungisela, a youth leaving care programme created to assist young people leaving state care in Khayelitsha, Cape Town. Project Lungisela was initiated by…

  8. The Relationship between Substance Use and Delinquency among High-School Students in Cape Town, South Africa

    ERIC Educational Resources Information Center

    Carney, Tara; Myers, Bronwyn J.; Louw, Johann; Lombard, Carl; Flisher, Alan J.

    2013-01-01

    Research has shown a positive relationship between substance use and delinquent-type behaviours among adolescents. The aim of this study is to explore the temporal relationships between these outcomes through secondary data analysis of a longitudinal study of high-school students' risk behaviours. Two regression models were compared and gender,…

  9. Language Choice and Sexual Communication among Xhosa Speakers in Cape Town, South Africa: Implications for HIV Prevention Message Development

    ERIC Educational Resources Information Center

    Cain, Demetria; Schensul, Stephen; Mlobeli, Regina

    2011-01-01

    Communicating about sex is a vital component of human immunodeficiency virus (HIV) prevention and influences how HIV educators convey messages to communities and how couples negotiate safer sex practices. However, sexual communication inevitably confronts culturally based behavioral guidelines and linguistic taboos unique to diverse social…

  10. Kribbella karoonensis sp. nov. and Kribbella swartbergensis sp. nov., isolated from soil from the Western Cape, South Africa.

    PubMed

    Kirby, Bronwyn M; Le Roes, Marilize; Meyers, Paul R

    2006-05-01

    Two novel nocardioform actinomycetes, strains Q41T and HMC25T, were isolated from soil samples collected in the Western Cape province, South Africa. Rapid genus identification revealed that the isolates belonged to the genus Kribbella (based on single-digestion restriction analysis of the 16S rRNA gene sequences with MboI, VspI, SphI, SnaBI, SalI and AgeI). Both isolates had ll-diaminopimelic acid and glycine in their cell-wall peptidoglycan, and contained mannose and ribose as whole-cell sugars. Strain HMC25T is able to grow at 45 degrees C and in the presence of NaCl (3 %), cephaloridine (10 microg ml(-1)) and gentamicin sulphate (10 microg ml(-1)). Strain Q41T grows in the presence of NaCl (2 %). Neither strain was able to grow under anaerobic conditions, whereas Kribbella flavida KACC 20248T, Kribbella jejuensis HD9T, Kribbella koreensis KACC 20250T and Kribbella sandramycini KACC 20249T exhibited weak but distinct growth under anaerobic conditions. Physiological test results and 16S rRNA gene sequence analysis allowed Q41T and HMC25T to be distinguished from other members of the genus with validly published names. Strains HMC25T (=NRRL B-24426T=DSM 17345T) and Q41T (=NRRL B-24425T=DSM 17344T) therefore represent the type strains of novel species, for which the names Kribbella swartbergensis sp. nov. and Kribbella karoonensis sp. nov., respectively, are proposed.

  11. Filling the gap: a learning network for health an human rights in the Western Cape, South Africa.

    PubMed

    London, Leslie; Fick, Nicole; Tram, Khai Hoan; Stuttaford, Maria

    2012-06-15

    We draw on the experience of a Learning Network for Health and Human Rights (LN) involving collaboration between academic institutions and civil society organizations in the Western Cape, South Africa, aimed at identifying and disseminating best practice related to the right to health. The LN's work in materials development, participatory research, training and capacity-building for action, and advocacy for intervention illustrates important lessons for human rights practice. These include (i) the importance of active translation of knowledge and awareness into action for rights to be made real; (ii) the potential tension arising from civil society action, which might relieve the state of its obligations by delivering services that should be the state's responsibility-and hence the importance of emphasizing civil society's role in holding services accountable in terms of the right to health; (iii) the role of civil society organizations in filling a gap related to obligations to promote rights; (iv) the critical importance of networking and solidarity for building civil society capacity to act for health rights. Evidence from evaluation of the LN is presented to support the argument that civil society can play a key role in bridging a gap between formal state commitment to creating a human rights culture and realizing services and policies that enable the most vulnerable members of society to advance their health. Through access to information and the creation of spaces, both for participation and as a safe environment in which learning can be turned into practice, the agency of those most affected by rights violations can be redressed. We argue that civil society agency is critical to such action.

  12. DNA barcodes successfully identified Macaronesian Lotus (Leguminosae) species within early diverged lineages of Cape Verde and mainland Africa

    PubMed Central

    Ojeda, Dario I.; Santos-Guerra, Arnoldo; Oliva-Tejera, Felicia; Jaen-Molina, Ruth; Caujapé-Castells, Juli; Marrero-Rodríguez, Águedo; Cronk, Quentin

    2014-01-01

    Plant DNA barcoding currently relies on the application of a two-locus combination, matK + rbcL. Despite the universality of these two gene regions across plants, it is suspected that this combination might not have sufficient variation to discriminate closely related species. In this study, we tested the performance of this two-locus plant barcode along with the additional plastid regions trnH-psbA, rpoC1 and rpoB and the nuclear region internal transcribed spacer (nrITS) in a group of 38 species of Lotus from the Macaronesian region. The group has radiated into the five archipelagos within this region from mid-Miocene to early Pleistocene, and thus provides both early divergent and recent radiations that pose a particularly difficult challenge for barcoding. The group also has 10 species considered under different levels of conservation concern. We found different levels of species discrimination depending on the age of the lineages. We obtained 100 % of the species identification from mainland Africa and Cape Verde when all six regions were combined. These lineages radiated >4.5 Mya; however, in the most recent radiations from the end of the Pliocene to the mid-Pleistocene (3.5–1.5 Mya), only 30 % of the species were identified. Of the regions examined, the intergenic region trnH-psbA was the most variable and had the greatest discriminatory power (18 %) of the plastid regions when analysed alone. The nrITS region was the best region when analysed alone with a discriminatory power of 26 % of the species. Overall, we identified 52 % of the species and 30 % of the endangered or threatened species within this group when all six regions were combined. Our results are consistent with those of other studies that indicate that additional approaches to barcoding will be needed in recently evolved groups, such as the inclusion of faster evolving regions from the nuclear genome. PMID:25147310

  13. DNA barcodes successfully identified Macaronesian Lotus (Leguminosae) species within early diverged lineages of Cape Verde and mainland Africa.

    PubMed

    Ojeda, Dario I; Santos-Guerra, Arnoldo; Oliva-Tejera, Felicia; Jaen-Molina, Ruth; Caujapé-Castells, Juli; Marrero-Rodríguez, Aguedo; Cronk, Quentin

    2014-08-21

    Plant DNA barcoding currently relies on the application of a two-locus combination, matK + rbcL. Despite the universality of these two gene regions across plants, it is suspected that this combination might not have sufficient variation to discriminate closely related species. In this study, we tested the performance of this two-locus plant barcode along with the additional plastid regions trnH-psbA, rpoC1 and rpoB and the nuclear region internal transcribed spacer (nrITS) in a group of 38 species of Lotus from the Macaronesian region. The group has radiated into the five archipelagos within this region from mid-Miocene to early Pleistocene, and thus provides both early divergent and recent radiations that pose a particularly difficult challenge for barcoding. The group also has 10 species considered under different levels of conservation concern. We found different levels of species discrimination depending on the age of the lineages. We obtained 100 % of the species identification from mainland Africa and Cape Verde when all six regions were combined. These lineages radiated >4.5 Mya; however, in the most recent radiations from the end of the Pliocene to the mid-Pleistocene (3.5-1.5 Mya), only 30 % of the species were identified. Of the regions examined, the intergenic region trnH-psbA was the most variable and had the greatest discriminatory power (18 %) of the plastid regions when analysed alone. The nrITS region was the best region when analysed alone with a discriminatory power of 26 % of the species. Overall, we identified 52 % of the species and 30 % of the endangered or threatened species within this group when all six regions were combined. Our results are consistent with those of other studies that indicate that additional approaches to barcoding will be needed in recently evolved groups, such as the inclusion of faster evolving regions from the nuclear genome.

  14. Seismicity and neotectonic uplift in the Augrabies Falls National Park, Namaqualand, Northern Cape, South Africa

    NASA Astrophysics Data System (ADS)

    Madi, Kakaba

    2016-10-01

    Gneissic rocks in the Augrabies Falls National Park are part of the Proterozoic Namaqua-Natal mobile belt. Finding neotectonic evidence in old terranes is always not an easy task. In South Africa, the mid-Miocene is believed to be the beginning of neotectonics. This study investigated the occurrence and recurrence of earthquake activity, occurrence of faulting, jointing, uplift, and potholes in the gneisses cropping out around the Augrabies Falls area that may account for neotectonics. A historic seismic event obtained from the United States Geological Survey (USGS), and seismic epicenters downloaded in October 2015 from IRIS earthquake browser and overlaid on a satellite image with digitised faults and lineaments, indicates that the area is seismically active and is a zone of seismic risk. Potholes occurring today on a dry surface at approximately 613 m above sea level are a direct consequence of the Griqualand-Transvaal neotectonic uplift, which generated a major fault along which water flows continuously. It is concluded that the Augrabies Falls National Park area is a zone of neotectonics. This zone should not be considered for the storage of nuclear wastes.

  15. Realist evaluation of the antiretroviral treatment adherence club programme in selected primary healthcare facilities in the metropolitan area of Western Cape Province, South Africa: a study protocol

    PubMed Central

    Mukumbang, Ferdinand C; Van Belle, Sara; Marchal, Bruno; Van Wyk, Brian

    2016-01-01

    Introduction Suboptimal retention in care and poor treatment adherence are key challenges to antiretroviral therapy (ART) in sub-Saharan Africa. Community-based approaches to HIV service delivery are recommended to improve patient retention in care and ART adherence. The implementation of the adherence clubs in the Western Cape province of South Africa was with variable success in terms of implementation and outcomes. The need for operational guidelines for its implementation has been identified. Therefore, understanding the contexts and mechanisms for successful implementation of the adherence clubs is crucial to inform the roll-out to the rest of South Africa. The protocol outlines an evaluation of adherence club intervention in selected primary healthcare facilities in the metropolitan area of the Western Cape Province, using the realist approach. Methods and analysis In the first phase, an exploratory study design will be used. Document review and key informant interviews will be used to elicit the programme theory. In phase two, a multiple case study design will be used to describe the adherence clubs in five contrastive sites. Semistructured interviews will be conducted with purposively selected programme implementers and members of the clubs to assess the context and mechanisms of the adherence clubs. For the programme's primary outcomes, a longitudinal retrospective cohort analysis will be conducted using routine patient data. Data analysis will involve classifying emerging themes using the context-mechanism-outcome (CMO) configuration, and refining the primary CMO configurations to conjectured CMO configurations. Finally, we will compare the conjectured CMO configurations from the cases with the initial programme theory. The final CMOs obtained will be translated into middle range theories. Ethics and dissemination The study will be conducted according to the principles of the declaration of Helsinki (1964). Ethics clearance was obtained from the

  16. Trends in Adolescent Alcohol and Other Drug Use: Findings from Three Sentinel Sites in South Africa (1997-2001)

    ERIC Educational Resources Information Center

    Parry, Charles D. H.; Myers, Bronwyn; Morojele, Neo K.; Flisher, Alan J.; Bhana, Arvin; Donson, Hilton; Pluddemann, Andreas

    2004-01-01

    This paper aims to provide surveillance information about the extent and consequences of alcohol and other drug (AOD) use by adolescents for three sentinel sites in South Africa (Cape Town, Durban and Gauteng province). From 1997 to 2001, data were gathered from multiple sources, including specialist treatment centres, trauma units, school…

  17. South Africa

    NASA Technical Reports Server (NTRS)

    2002-01-01

    This true-color image of South Africa was acquired on May 14, 2000, by NASA's Moderate-resolution Imaging Spectroradiometer, or MODIS. The image was produced using a combination of the sensor's 250-m and 500-m resolution visible wavelength bands. As part of the opening ceremony to begin the joint U.S.-South Africa SAFARI Field Experiment, NASA presented print copies of this image as GIFts to Dr. Ben Ngubane, Minister of Arts, Science and Technology, and Honorable Advocate Ngoaka Ramathlodi, Premier of the Northern Province, South Africa. The area shown in this image encompasses seven capital cities and a number of the region's distinctive geological features can be seen clearly. Toward the northern (top) central part of the image, the browns and tans comprise the Kalahari Desert of southern Botswana. The Tropic of Capricorn runs right through the heart of the Kalahari and the Botswanan capital city of Gaborone sits on the Limpopo River, southeast of the Kalahari. Along the western coastline of the continent is the country of Namibia, where the Namib Desert is framed against the sea by the Kaokoveld Mountains. The Namibian capital of Windhoek is obscured by clouds. Looking closely in the center of the image, the Orange River can be seen running from east to west, demarcating the boundary between Namibia and South Africa. On the southwestern corner of the continent is the hook-like Cape of Good Hope peninsula and Cape Town, the parliamentary capital of South Africa. Running west to east away from Cape Town are the Great Karroo Mountains. The shadow in this image conveys a sense of the very steep grade of the cliffs along the southern coast of South Africa. Port Elizabeth sits on the southeasternmost point of South Africa, and a large phytoplankton bloom can be seen in the water about 100 miles east of there. Moving northward along the east coast, the Drakensberg Mountains are visible. The two small nations of Lesotho and Swaziland are in this region, completely

  18. Cranes and Crops: Investigating Farmer Tolerances toward Crop Damage by Threatened Blue Cranes ( Anthropoides paradiseus) in the Western Cape, South Africa

    NASA Astrophysics Data System (ADS)

    van Velden, Julia L.; Smith, Tanya; Ryan, Peter G.

    2016-12-01

    The Western Cape population of Blue Cranes ( Anthropoides paradiseus) in South Africa is of great importance as the largest population throughout its range. However, Blue Cranes are strongly associated with agricultural lands in the Western Cape, and therefore may come into conflict with farmers who perceive them as damaging to crops. We investigated the viability of this population by exploring farmer attitudes toward crane damage in two regions of the Western Cape, the Swartland and Overberg, using semi-structured interviews. Perceptions of cranes differed widely between regions: farmers in the Swartland perceived crane flocks to be particularly damaging to the feed crop sweet lupin (65 % of farmers reported some level of damage by cranes), and 40 % of these farmers perceived cranes as more problematic than other common bird pests. Farmers in the Overberg did not perceive cranes as highly damaging, although there was concern about cranes eating feed at sheep troughs. Farmers who had experienced large flocks on their farms and farmers who ranked cranes as more problematic than other bird pests more often perceived cranes to be damaging to their livelihoods. Biographical variables and crop profiles could not be related to the perception of damage, indicating the complexity of this human-wildlife conflict. Farmers' need for management alternatives was related to the perceived severity of damage. These results highlight the need for location-specific management solutions to crop damage by cranes, and contribute to the management of this vulnerable species.

  19. Two new species of Indigofera L. (Leguminosae) from the Sneeuberg Centre of Floristic Endemism, Great Escarpment (Eastern and Western Cape, South Africa)

    PubMed Central

    Clark, V. Ralph; Schrire, Brian D.; Barker, Nigel P.

    2015-01-01

    Abstract Two new species of Indigofera L. (Leguminosae) are described from the Sneeuberg Centre of Floristic Endemism on the southern Great Escarpment, Eastern and Western Cape Provinces, South Africa. Both species are localised high-altitude endemics. Indigofera magnifica Schrire & V.R. Clark is confined to the summit plateau of the Toorberg–Koudeveldberg–Meelberg west of Graaff-Reinet, and complements other western Sneeuberg endemics such as Erica passerinoides (Bolus) E.G.H. Oliv. and Faurea recondita Rourke & V.R. Clark. Indigofera asantasanensis Schrire & V.R. Clark is confined to a small area east of Graaff-Reinet, and complements several other eastern Sneeuberg endemics such as Euryops exsudans B. Nord & V.R. Clark and Euryops proteoides B. Nord. & V.R. Clark. Based on morphology, both new species belong to the Cape Clade of Indigofera, supporting a biogeographical link between the Cape Floristic Region and the Sneeuberg, as well as with the rest of the eastern Great Escarpment. PMID:25941448

  20. Seasonality and Trend Forecasting of Tuberculosis Prevalence Data in Eastern Cape, South Africa, Using a Hybrid Model

    PubMed Central

    Azeez, Adeboye; Obaromi, Davies; Odeyemi, Akinwumi; Ndege, James; Muntabayi, Ruffin

    2016-01-01

    Background: Tuberculosis (TB) is a deadly infectious disease caused by Mycobacteria tuberculosis. Tuberculosis as a chronic and highly infectious disease is prevalent in almost every part of the globe. More than 95% of TB mortality occurs in low/middle income countries. In 2014, approximately 10 million people were diagnosed with active TB and two million died from the disease. In this study, our aim is to compare the predictive powers of the seasonal autoregressive integrated moving average (SARIMA) and neural network auto-regression (SARIMA-NNAR) models of TB incidence and analyse its seasonality in South Africa. Methods: TB incidence cases data from January 2010 to December 2015 were extracted from the Eastern Cape Health facility report of the electronic Tuberculosis Register (ERT.Net). A SARIMA model and a combined model of SARIMA model and a neural network auto-regression (SARIMA-NNAR) model were used in analysing and predicting the TB data from 2010 to 2015. Simulation performance parameters of mean square error (MSE), root mean square error (RMSE), mean absolute error (MAE), mean percent error (MPE), mean absolute scaled error (MASE) and mean absolute percentage error (MAPE) were applied to assess the better performance of prediction between the models. Results: Though practically, both models could predict TB incidence, the combined model displayed better performance. For the combined model, the Akaike information criterion (AIC), second-order AIC (AICc) and Bayesian information criterion (BIC) are 288.56, 308.31 and 299.09 respectively, which were lower than the SARIMA model with corresponding values of 329.02, 327.20 and 341.99, respectively. The seasonality trend of TB incidence was forecast to have a slightly increased seasonal TB incidence trend from the SARIMA-NNAR model compared to the single model. Conclusions: The combined model indicated a better TB incidence forecasting with a lower AICc. The model also indicates the need for resolute

  1. The cold climate geomorphology of the Eastern Cape Drakensberg: A reevaluation of past climatic conditions during the last glacial cycle in Southern Africa

    NASA Astrophysics Data System (ADS)

    Mills, S. C.; Barrows, T. T.; Telfer, M. W.; Fifield, L. K.

    2017-02-01

    Southern Africa is located in a unique setting for investigating past cold climate geomorphology over glacial-interglacial timescales. It lies at the junction of three of the world's major oceans and is affected by subtropical and temperate circulation systems, therefore recording changes in Southern Hemisphere circulation patterns. Cold climate landforms are very sensitive to changes in climate and thus provide an opportunity to investigate past changes in this region. The proposed existence of glaciers in the high Eastern Cape Drakensberg mountains, together with possible rock glaciers, has led to the suggestion that temperatures in this region were as much as 10-17 °C lower than present. Such large temperature depressions are inconsistent with many other palaeoclimatic proxies in Southern Africa. This paper presents new field observations and cosmogenic nuclide exposure ages from putative cold climate landforms. We discuss alternative interpretations for the formation of the landforms and confirm that glaciers were absent in the Eastern Cape Drakensberg during the last glaciation. However, we find widespread evidence for periglacial activity down to an elevation of 1700 m asl, as illustrated by extensive solifluction deposits, blockstreams, and stone garlands. These periglacial deposits suggest that the climate was significantly colder ( 6 °C) during the Last Glacial Maximum, in keeping with other climate proxy records from the region, but not cold enough to initiate or sustain glaciers or rock glaciers.

  2. Assessment of the impact of family physicians in the district health system of the Western Cape, South Africa

    PubMed Central

    Mash, Bob; Naledi, Tracey

    2014-01-01

    Background: In 2007, South Africa made family medicine a new speciality. Family physicians that have trained for this new speciality have been employed in the district health system since 2011. The aim of the present study was to explore the perceptions of district managers on the impact of family physicians on clinical processes, health system performance and health outcomes in the district health system (DHS) of the Western Cape. Methods: Nine in-depth interviews were performed: seven with district managers and two with the chief directors of the metropolitan and rural DHS. Interviews were recorded, transcribed and analysed using the ATLAS-ti and the framework method. Results: There was a positive impact on clinical processes for HIV/AIDS, TB, trauma, non-communicable chronic diseases, mental health, maternal and child health. Health system performance was positively impacted in terms of access, coordination, comprehensiveness and efficiency. An impact on health outcomes was anticipated. The impact was not uniform throughout the province due to different numbers of family physicians and different abilities to function optimally. There was also a perception that the positive impact attributed to family physicians was in the early stages of development. Unanticipated effects included concerns with their roles in management and training of students, as well as tensions with career medical officers. Conclusion: Early feedback from district managers suggests that where family physicians are employed and able to function optimally, they are making a significant impact on health system performance and the quality of clinical processes. In the longer term, this is likely to impact on health outcomes. Evaluation de l'impact des médecins de famille dans le système de santé du district du Western Cape, en Afrique du Sud. Contexte: En 2007, l'Afrique du Sud a institué une nouvelle spécialité, la médecine de famille. Les médecins de famille qui se sont sp

  3. Knowledge and use of emergency contraception among women in the Western Cape province of South Africa: a cross-sectional study

    PubMed Central

    Myer, Landon; Mlobeli, Regina; Cooper, Di; Smit, Jennifer; Morroni, Chelsea

    2007-01-01

    Background Emergency contraception (EC) is widely available free of charge at public sector clinics in South Africa. At the same time, rates of teenage and unintended pregnancy in South Africa remain high, and there are few data on knowledge of EC in the general population in South Africa, as in other resource-limited settings. Methods We conducted a cross-sectional, interviewer-administered survey among 831 sexually active women at 26 randomly selected public sector clinics in the Western Cape province. Results Overall, 30% of the women had ever heard of EC when asked directly, after the method was described to them. Only 15% mentioned EC by name or description spontaneously. Knowledge of EC was independently associated with higher education, being married, and living in an urban setting. Four percent of women had ever used EC. Discussion These data suggest that knowledge of EC in this setting is more common among women of higher socioeconomic status living in urban areas. For EC to play a role in decreasing unintended pregnancy in South Africa, specific interventions are necessary to increase knowledge of the method, where to get it, and the appropriate time interval for its use before the need for EC arises. Future health promotion campaigns should target rural and low socioeconomic status communities. PMID:17850659

  4. The Cape Observatory: all Categories of Heritage

    NASA Astrophysics Data System (ADS)

    Glass, Ian S.

    2012-09-01

    In this presentation I will give an outline of the various types of heritage related to the Royal Observatory, Cape of Good Hope, established in 1820 and now the headquarters campus of the South African Astronomical Observatory, located quite close to downtown Cape Town. In terms of tangible, fixed heritage, the campus itself, the domes and the various other buildings are obviously relevant. This category includes the Classical Revival Main Building of 1828 and the McClean dome of 1895 by the leading colonial architect Herbert Baker as well as many other buildings and even the graves of two directors. Tangible movable items include, in principle, the telescopes, the accessory instruments and many pieces of apparatus that have been preserved. In addition, extensive collections of antique paintings, drawings, furniture and books add to the site's cultural significance. Many of the Observatory's archives are still kept locally. The intangible heritage of the Observatory consists for example of its history, its major discoveries, its interaction with the City, its central role in the history of science in South Africa and its appeal as a living cultural institution. Especially notable were the observations by Henderson (ca 1831) leading to the distance of a Cen and the early sky survey known as the Cape Photographic Durchmusterung.

  5. Artificial Recharge Of Urban Wastewater, The Key Component In The Development Of An Industrial Town On The Arid West Coast Of South Africa

    NASA Astrophysics Data System (ADS)

    Wright, A.; du Toit, I.

    1996-01-01

    Atlantis, an industrial town on the somewhat bleak and undeveloped west coast of South Africa, is entirely dependent on groundwater resources for its water supply. With a population of more than 67,000 people and about 140 factories, Atlantis requires a reliable supply of potable water of about 1.5×106m3/a. The demand is met through artificial recharge of a local, shallow, sandy aquifer that supplies the town's water. A well designed stormwater drainage system and scientifically based water-quality management strategy allow for the recharge of all urban stormwater runoff and treated domestic sewage effluent. Extensive research and sound planning have meant that no water is wasted, for even the water that is unacceptable for recharge in the main aquifer is recharged in strategic localities to counter saline intrusion. The Atlantis Water Resource Management Scheme serves as a good example of what can be achieved when hydrogeologists, engineers, and urban managers integrate their skills.

  6. Groundwater resources of Ribeira Paúl basin, island of Santo Antão, Cape Verde, West Africa

    USGS Publications Warehouse

    Heilweil, Victor M.; Gingerich, Stephen B.; Verstraeten, Ingrid M.

    2010-01-01

    Groundwater resources in Cape Verde provide water for agriculture, industry, and human consumption. These resources are limited and susceptible to contamination. Additional groundwater resources are needed for continued agricultural development, particularly during times of drought, but increased use and (or) climatic change may have adverse effects on the quantity and quality of freshwater available. In volcanic island aquifers such as those of Cape Verde, a lens of fresh groundwater typically ?floats? upon a layer of brackish water at the freshwater/saltwater boundary, and increased pumping may cause salt water intrusion or other contamination. A recent U.S. Geological Survey study assessed baseline groundwater conditions in watersheds on three islands of Cape Verde to provide the scientific basis for sustainably developing water resources and minimizing future groundwater depletion and contamination.

  7. Groundwater resources of Ribeira Fajã basin, island of São Nicolau, Cape Verde, West Africa

    USGS Publications Warehouse

    Heilweil, Victor M.; Gingerich, Stephen B.; Plummer, L. Niel; Verstraeten, Ingrid M.

    2010-01-01

    Groundwater resources in Cape Verde provide water for agriculture, industry, and human consumption. These resources are limited and susceptible to contamination. Additional groundwater resources are needed for continued agricultural development, particularly during times of drought, but increased use and (or) climatic change may have adverse effects on the quantity and quality of freshwater available. In volcanic island aquifers such as those of Cape Verde, a lens of fresh groundwater typically ?floats? upon a layer of brackish water at the freshwater/saltwater boundary, and increased pumping may cause salt water intrusion or other contamination. A recent U.S. Geological Survey study assessed baseline groundwater conditions in watersheds on three islands of Cape Verde to provide the scientific basis for sustainably developing water resources and minimizing future groundwater depletion and contamination.

  8. Outsourcing vaccine logistics to the private sector: The evidence and lessons learned from the Western Cape Province in South-Africa.

    PubMed

    Lydon, Patrick; Raubenheimer, Ticky; Arnot-Krüger, Michelle; Zaffran, Michel

    2015-06-26

    With few exceptions, immunization supply chains in developing countries continue to face chronic difficulties in providing uninterrupted availability of potent vaccines up to service delivery levels, and in the most efficient manner possible. As these countries struggle to keep pace with an ever growing number of vaccines, more and more Ministries of Health are considering options of engaging the private sector to manage vaccine storage, handling and distribution on their behalf. Despite this emerging trend, there is limited evidence on the benefits or challenges of this option to improve public supply chain performance for national immunization programmes. To bridge this knowledge gap, this study aims to shed light on the value proposition of outsourcing by documenting the specific experience of the Western Cape Province of South Africa. The methodology for this review rested on conducting two key supply chain assessments which allowed juxtaposing the performance of the government managed segments of the vaccine supply chain against those managed by the private sector. In particular, measures of effective vaccine management best practice and temperature control in the cold chain were analysed. In addition, the costs of engaging the private sector were analysed to get a better understanding of the economics underpinning outsourcing vaccine logistics. The results from this analysis confirmed some of the theoretical benefits of outsourcing to the private sector. Yet, if the experience in the Western Cape can be deemed a successful one, there are several policy and practice implications that developing countries should be mindful of when considering engaging the private sector. While outsourcing can help improve the performance of the vaccine supply chain, it has the potential to do the reverse if done incorrectly. The findings and lessons learnt from the Western Cape experience can serve as a step towards understanding the role of the private sector in immunization

  9. Genetic and Morphological Characterization of Freshwater Shrimps (Caridina africana Kingsley, 1882) Reveals the Presence of Alien Shrimps in the Cape Floristic Region, South Africa.

    PubMed

    Mirimin, Luca; Kitchin, Natasha; Impson, Dean N; Clark, Paul F; Richard, Jasmine; Daniels, Savel R; Roodt-Wilding, Rouvay

    2015-01-01

    Morphological identification and molecular data (mtDNA COI) were used to resolve the taxonomic identity of a non-native freshwater shrimp in the Cape Floristic Region (CFR) of South Africa and to evaluate levels of genetic diversity and differentiation in the species' core natural distribution. The species was morphologically and genetically identified as Caridina africana Kingsley, 1882, whose main natural distribution is in the KwaZulu-Natal (KZN) Province, more than 1200 km from the point of new discovery. Subsequently, sequence data from natural populations occurring in seven rivers throughout KZN showed the presence of nuclear copies of the mtDNA COI gene (NUMTs) in 46 out of 140 individuals. Upon removal of sequences containing NUMTs, levels of genetic diversity were low in the alien population (possibly as a consequence of a bottleneck event), while varying levels of genetic diversity and differentiation were found in natural populations, indicating habitat heterogeneity, fragmentation and restricted gene flow between rivers. Following the present study, the alien shrimp has survived the Western Cape's winter and dispersed into a nearby tributary of the Eerste River System, hence posing an additional potential threat to endangered endemics. Understanding the biology of this alien species will aid detection and eradication procedures.

  10. Retinitis pigmentosa in southern Africa.

    PubMed

    Greenberg, J; Bartmann, L; Ramesar, R; Beighton, P

    1993-11-01

    Retinitis pigmentosa (RP) is a heterogeneous group of inherited retinal disorders which are a common cause of genetic blindness. The relative frequencies of the different forms of RP in South Africa, as determined from the register at the DNA banking centre for RP at the Department of Human Genetics, University of Cape Town, are presented and discussed. Of the 125 families analysed, 29 (23%) showed autosomal dominant, 33 (27%) autosomal recessive and 3 (3%) X-linked inheritance. In 10 families the pedigree data were insufficient to allow accurate genetic subtyping and a further 50 patients were sporadic without a family history of RP or other syndromic features which would allow categorization.

  11. Protozoan Fauna and Abundance in Aeration Tanks of Three Municipal Wastewater Treatment Plants in the Eastern Cape Province of South Africa

    NASA Astrophysics Data System (ADS)

    Sibewu, M.; Momba, M. N. B.; Okoh, A. L.

    This study focuses on the assessment of the protozoan fauna and abundance in the mixed liquors of aeration tanks of the three municipal wastewater treatment plants located in Fort Beaufort, Dimbaza and East London in the Eastern Cape Province of South Africa and their implication to the production of effluents of good quality. The samples were collected between September and December 2005 and protozoa species were identified by direct microscopic observations at x400 magnification by comparison with existing protozoa gallery collections. A total of 68 protozoan genera made up of 44 ciliates, 16 flagellates and 8 others were identified in wastewater treatment plants. Although in all aerobic zones the average density of ciliates was 104 cells mL-1, which indicated that these plants were able to produce clear effluent of good quality, a better performance was found in Dimbaza and East London, which had total protozoan genera of 27 and 26, respectively.

  12. Stable isotope and 14C study of biogenic calcrete in a termite mound, Western Cape, South Africa, and its palaeoenvironmental significance

    NASA Astrophysics Data System (ADS)

    Potts, Alastair J.; Midgley, Jeremy J.; Harris, Chris

    2009-09-01

    Late Quaternary terrestrial climate records from the semi-arid zone of the Western Cape of South Africa are rare. However, palaeoenvironmental information may be inferred from ancient termite mounds of the region. Calcrete lenses in these mounds have δ 13C and δ 18O values that show systematic changes with radiocarbon dates, which range from 33,629-36,709 to 21,676-23,256 cal yr BP. These dates confirm that these heuweltjies had been present in the landscape since the last glacial period. The decrease in δ 13C and δ 18O from 33,629-36,709 to 21,676-23,256 cal yr BP indicates that climate information is recorded by the calcretes. It is suggested that a progressive decline in air temperature and an increase in moisture availability, and a decline in abundance of C 4 or CAM plants, occurred in the region during the time heuweltjie calcite precipitated.

  13. The perceived benefit of the disability grant for persons living with HIV in an informal settlement community in the Western Cape, South Africa.

    PubMed

    Woolgar, Helen Louise; Mayers, Pat M

    2014-01-01

    For persons living with HIV (PLWH) in limited socioeconomic circumstances in South Africa, social grants for disability have contributed significantly to alleviate poverty, yet there is a risk that recipients may lose these grants once they are clinically stable on antiretroviral therapy (ART). Our qualitative research explored perceptions and experiences of PLWH on ART concerning the social grant for disability and its contribution to health. Three focus groups were conducted with 15 purposively selected participants who attended a primary care clinic in the Western Cape. A thematic data analysis approach revealed two themes: (a) disability grants as a means of survival and (b) disability grants and ART adherence. The disability grant was considered an essential source of income and, for some, the sole means of survival. Participants valued their health more than the income, however, and, despite the risk of losing the grant, remained adherent to ART.

  14. Rumen ciliates in the African (Cape) buffalo (Syncerus caffer caffer) living in the vicinity of the Orpen Gate entrance into Kruger National Park, South Africa.

    PubMed

    Booyse, Dirk G; Dehority, Burk A; Reininghaus, Björn

    2014-07-31

    Samples of rumen contents were obtained from 10 African (Cape) buffalo living in the vicinity of the Orpen Gate entrance into Kruger National Park in South Africa. Total number of ciliate protozoa per animal ranged from 3.15 to 23.25 x 103. Forty three different species and forms were observed, of which 35 are a new host record. The total number of species and forms per animal varied from 10 to 17. Eudiplodinium maggii occurred in all 10 animals, followed by Dasytricha ruminantium in nine animals. Diplodinium posterovesiculatum, Eudiplodinium magnodentatum and Ostracodinium mammosum were present in seven animals with all other species and forms occurring in five or less animals. 

  15. Post break-up tectonic inversion across the southwestern cape of South Africa: New insights from apatite and zircon fission track thermochronometry

    NASA Astrophysics Data System (ADS)

    Wildman, Mark; Brown, Roderick; Watkins, Ron; Carter, Andrew; Gleadow, Andrew; Summerfield, Michael

    2015-07-01

    The south-west African margin is regarded as an example of a passive continental margin formed by continental rifting following a phase of lithospheric extension and thinning. Recent attention focused on this margin has included theoretical modelling studies of rift processes, plate kinematic studies of the opening geometry and timing, and empirical studies focused on documenting the crustal structure and offshore sedimentary record. Here, we examine the onshore geomorphic and tectonic response to rifting and breakup, with a specific focus on the SW Cape of South Africa. We present 75 new apatite and 8 new zircon fission track analyses from outcrop samples and onshore borehole profiles along the western margin of South Africa. The data are used to derive robust thermal histories that record two discrete phases of accelerated erosional cooling during the Early Cretaceous (150-130 Ma) and Late Cretaceous (100-80 Ma), respectively. Both periods of enhanced erosion are regional in extent, involved km-scale erosion, and extend well inland of the current escarpment zone, albeit with spatially variable intensity and style. The Late Cretaceous episode is also expressed more locally by tectonic reactivation and inversion of major faults causing km-scale differential displacement and erosion. The new AFT data do not exclude the possibility of modest surface uplift occurring during the Cenozoic, but they restrict the depth of regional Cenozoic erosion on the western margin to less than c. 1 km. The inferred pattern and chronology of erosion onshore is consistent with the key features and sediment accumulation patterns within the offshore Orange and Bredasdorp basins. It is suggested that the Late Cretaceous event was triggered by a combination of regional dynamic uplift augmented along the western margin and in the SW Cape by local tectonic forces arising from dextral displacement of the Falkland Plateau along the Falkland-Agulhas Fracture Zone.

  16. A comparative assessment of the price, brands and pack characteristics of illicitly traded cigarettes in five cities and towns in South Africa

    PubMed Central

    Wherry, Anna E; McCray, Cheyenne A; Adedeji-Fajobi, Temidayo I; Sibiya, Xolani; Ucko, Peter; Lebina, Limakatso; Golub, Jonathan E; Cohen, Joanna E; Martinson, Neil A

    2014-01-01

    Objective The prevalence of illicitly traded cigarettes in South Africa has been reported to be 40–50%. However, these estimates do not account for the more nuanced characteristics of the illicit cigarette trade. With the goal of better understanding contraband cigarettes in South Africa, this study piloted three methods for assessing the price, brands, pack features and smoker's views about illicit cigarettes in five cities/towns. Data were collected in June and July 2012. Setting A convenience sample of three South African cities (Johannesburg, Durban and Nelspruit) and two smaller towns (Musina and Ficksburg) were chosen for this study. Outcome measures Three cross-sectional approaches were used to assess the characteristics of contraband cigarettes: (1) a dummy purchase of cigarettes from informal retailers, (2) the collection of discarded cigarette packs and (3) a survey of tobacco smokers. Participants For the purposes of the survey, 40 self-reported smokers were recruited at taxi ranks in each downtown site. Adults who were over the age of 18 were asked to verbally consent to participate in the study and answer a questionnaire administered by a researcher. Results The leading reason for labelling a pack as illicit in each city/town was the absence of an excise stamp (28.6% overall), and the least common reason was an illegal tar or nicotine level (11.1% overall). The overall proportion of informal vendors who sold illicit cigarettes was 41%. Singles and packs of 20 were consistently cheaper at informal vendors. Survey participants’ responses reflected varied perspectives on illicit cigarettes and purchasing preferences. Conclusions Each approach generated an interesting insight into physical aspects of illicit cigarettes. While this pilot study cannot be used to generate generalisable statistics on illicit cigarettes, more systematic surveys of this nature could inform researchers’ and practitioners’ initiatives to combat illicit and legal cigarette

  17. Small mammal utilization by Middle Stone Age humans at Die Kelders Cave 1 and Pinnacle Point Site 5-6, Western Cape Province, South Africa.

    PubMed

    Armstrong, Aaron

    2016-12-01

    Reported here are the results of a taphonomic analysis of the small mammals (between 0.75 kg and 4.5 kg adult body weight) and size 1 bovids (≤20 kg adult body weight) from the Middle Stone Age (MSA) sites of Die Kelders Cave 1 (DK1) and Pinnacle Point Site 5-6 (PP5-6), Western Cape Province, South Africa. This study provides a comprehensive taphonomic analysis of MSA small mammals with a focus on discerning the role of humans in their accumulation and the implications for human behavioral adaptations. Based on comparisons with control assemblages of known accumulation, it is evident that humans accumulated many of the Cape dune mole-rats, hares, and size 1 bovids at DK1. The patterning of cut-marked and burned mole-rat remains at DK1 provides evidence in the MSA for the systematic utilization of small mammals for their skins and as a protein source. Unlike DK1, small mammals and size 1 bovids constitute only a small portion of the PP5-6 mammals and they exhibit little evidence of human accumulation. Nocturnal and diurnal raptors accumulated most of the small fauna at PP5-6. The nominal presence of small mammals in the PP5-6 fauna is atypical of MSA sites in the Cape Floristic Region, where they are abundant and often constitute large portions of MSA archaeofaunas. DK1 humans maximized the environmental yield by exploiting low-quality resources, a strategy employed possibly in response to localized environmental conditions and to greater human population densities. In comparison, the MIS5-4 humans at PP5-6 did not exploit small mammals and instead focused on higher-quality resources like shellfish and large ungulates. Humans and predators accumulated few small mammals at PP5-6, suggesting that these taxa may have been less abundant near the site and/or that humans could afford to concentrate on high-quality resources, perhaps because of a higher-yield local environment. This study suggests that an adaptive response to the environmental conditions of MIS4 was

  18. South Africa, Namibia, and Botswana

    NASA Technical Reports Server (NTRS)

    2002-01-01

    Pale green vegetation and red-brown deserts dominate this MODIS image of Namibia (left), Botswana (upper right), and the Republic of South Africa (bottom) acquired on June3, 2002. In central Namibia the mountainous terrain of Namaqualand is sandwiched between the Namib Desert on the Atlantic Coast and the Kalahari Desert to the interior, where white dots mark the location of small, impermanent lakes and ponds. Namaqualand is home to numerous rare succulent plants that can survive on the region.s scant rainfall as well as fog that blows in off the ocean. Namaqualand extends south of the Orange River, which runs along the border of Namibia and South Africa and into that country.s Northern Cape region. The Orange River extends almost all the way back through the country, and where it makes a sharp southward dip in this image (at lower right), it runs through the Asbestos Mountains, names for the naturally-occurring asbestos they contain. In southwestern South Africa, high plateaus, such as the Great Karoo become mountain ridges near the coast, and the city of Cape Town is visible as a grayish area of pixels on the north shores of the horseshoe-shaped False Bay at the Cape of Good Hope. Credit: Jacques Descloitres, MODIS Land Rapid Response Team, NASA/GSFC

  19. An Africanised Study of Astronomical History in the Northern Cape South Africa, for Purposes of Secondary and Higher Education Programmes

    NASA Astrophysics Data System (ADS)

    de Beer, K. J.; Hoffman, M. J.

    2007-07-01

    Dr M.J. Hoffman, Head of the Department Physics, University of the Free State (UFS), presented a paper at the Duineveld Secondary School in Upington, to enhance the idea of a natural observatory centre in the Northern Cape. Quite aptly, the National Institute for Higher Education: Northern Cape (NIHE) also invited a renowned African astronomer, Dr T Medupe, to address their graduation ceremony in 2005. However, Dr Albert Strydom, Programme Head of Tourism Management at the Central University for Technology, Free State (CUT), is very much aware of the delicate nature of this type of high scientific profile in Tourism Management. It is foreseen by Dr Kallie de Beer, Director of Distance Education, that teaching and learning in this field will predominantly be conducted via Open and Distance e-Learning (ODeL). Consequently, it is also important to understand the philosophy of ODeL within global and Africanized perspectives. Astronomy, in this case, offers excellent examples of Africanised science in practice to add scientific value to tourist packages in the Northern Cape. (www.saao.ac.za/assa/aahs).

  20. Provenance and reconnaissance study of detrital zircons of the Palaeozoic Cape Supergroup in South Africa: revealing the interaction of the Kalahari and Río de la Plata cratons

    NASA Astrophysics Data System (ADS)

    Fourie, Pieter H.; Zimmermann, Udo; Beukes, Nicolas J.; Naidoo, Thanusha; Kobayashi, Katsuro; Kosler, Jan; Nakamura, Eizo; Tait, Jenny; Theron, Johannes N.

    2011-04-01

    In order to facilitate the understanding of the geological evolution of the Kalahari Craton and its relation to South America, the provenance of the first large-scale cratonic cover sequence of the craton, namely the Ordovician to Carboniferous Cape Supergroup was studied through geochemical analyses of the siliciclastics, and age determinations of detrital zircon. The Cape Supergroup comprises mainly quartz-arenites and a Hirnantian tillite in the basal Table Mountain Group, subgreywackes and mudrocks in the overlying Bokkeveld Group, while siltstones, interbedded shales and quartz-arenites are typical for the Witteberg Group at the top of the Cape Supergroup. Palaeocurrent analyses indicate transport of sediment mainly from northerly directions, off the interior of the Kalahari Craton with subordinate transport from a westerly source in the southwestern part of the basin near Cape Town. Geochemical provenance data suggest mainly sources from passive to active continental margin settings. The reconnaissance study of detrital zircons reveals a major contribution of Mesoproterozoic sources throughout the basin, reflecting the dominance of the Namaqua-Natal Metamorphic Belt, situated immediately north of the preserved strata of Cape Supergroup, as a source with Archaean-aged zircons being extremely rare. We interpret the Namaqua-Natal Metamorphic Belt to have been a large morphological divide at the time of deposition of the Cape Supergroup that prevented input of detrital zircons from the interior early Archaean Kaapvaal cratonic block of the Kalahari Craton. Neoproterozoic and Cambrian zircons are abundant and reflect the basement geology of the outcrops of Cape strata. Exposures close to Cape Town must have received sediment from a cratonic fragment that was situated off the Kalahari Craton to the west and that has subsequently drifted away. This cratonic fragment predominantly supplied Meso- to Neoproterozoic, and Cambrian-aged zircon grains in addition to minor

  1. Knowledge and perceptions of risk for cardiovascular disease: Findings of a qualitative investigation from a low-income peri-urban community in the Western Cape, South Africa

    PubMed Central

    Steyn, Krisela; Everett-Murphy, Katherine; Gaziano, Thomas A.; Levitt, Naomi

    2015-01-01

    Background South Africa currently faces an increasing burden of cardiovascular disease. Although referred to clinics after community screening initiatives, few individuals who are identified to be at high risk for developing cardiovascular disease attend. Low health literacy and risk perception have been identified as possible causes. We investigated the knowledge and perceptions about risk for cardiovascular disease in a community. Method We conducted a series of focus group discussions with individuals from a low-income peri-urban community in the Western Cape, South Africa. Different methods of presenting risk were explored. The data were organised into themes and analysed to find associations between themes to provide explanations for our findings. Results Respondents’ knowledge of cardiovascular disease and its risk factors varied, but most were familiar with the terms used to describe cardiovascular disease. In contrast, understanding of the concept of risk was poor. Risk was perceived as a binary concept and evaluation of different narrative and visual methods of presenting risk was not possible. Conclusion Understanding cardiovascular disease and its risk factors requires a different set of skills from that needed to understand uncertainty and risk. The former requires knowledge of facts, whereas understanding of risk requires numerical and computational skills. Without a better understanding of risk, risk assessments for cardiovascular disease may fail in this community. PMID:26842511

  2. Sedimentology of granite boulder conglomerates and associated clastics in the onshore section of the late Mesozoic Pletmos Basin (Western Cape, South Africa)

    NASA Astrophysics Data System (ADS)

    Bordy, Emese M.; America, Travis

    2016-07-01

    Along the southern margin of South Africa, intermountain rift successions, which comprise unusually large, rounded granite boulders and other coarse clastics, reveal an important geological history about the mid-Mesozoic extensional tectonics that lead to the break-up of Gondwana. These strata, mapped as part of the Mid to Upper Jurassic Enon Formation, allow the assessment of the nature, intensity and mode of sediment transport in onshore section of the Pletmos Basin, which is one of the late Mesozoic basins in southern Africa. Based on sedimentary facies analysis, palaeocurrent measurements and semi-quantitative palaeohydraulic calculations, the results suggest that the abundant coarse sediment was deposited by debris-flows and stream-flow floods on a proximal alluvial fan with high gradient alluvial channels. The floods were intense with mean flow velocity of ˜6 m3/s and peak discharge of ˜450 m3/s. While the role of climate in the sedimentation dynamics remains unknown, syn-sedimentary rift tectonics were likely significant and caused, north of the major boundary fault, the unroofing and denudation of the uplifted mountainous source areas, including the Late Ediacaran-Cambrian Maalgaten Granite Suite and the Siluro-Ordovician Table Mountain Group (Cape Supergroup).

  3. Royden McIntosh Muir and His Anesthetic Links Between South Africa, London, and the United States.

    PubMed

    Gordon, Peter Crichton

    2016-07-01

    New Zealand born, Dr. Royden McIntosh Muir, MBChB(Edin), DA(RCS&RCP), emigrated to Cape Town in 1921 having specialized in anesthesia in London after World War 1 and became one of South Africa's earliest and leading anesthesiologists. He was appointed honorary anesthetist and clinical teacher by the University of Cape Town at South Africa's first medical school in 1922, and lecturer in 1927. Aware of Cape Town's isolation at the southern tip of Africa, he undertook extensive tours studying anesthetic practice at major hospitals in London, the United States and Canada in 1933 and 1938. He became a lifelong friend of Ralph Waters in Madison, who coached him in the use of cyclopropane, and he subsequently introduced cyclopropane into England and South Africa. In the United States, he met Richard von Foregger, founder of the New York based Foregger Company, from whom he later commissioned a purpose-built anesthetic machine marketed by Foregger as "The Muir Midget." Muir was a founder member of the South African Society of Anaesthetists in 1943 and was elected as its second president the following year. Based on what he had seen in academic hospitals in the United States and England, he fought until his retirement for the improved recognition of the specialty in South Africa and the establishment of adequately staffed departments of anesthesia at teaching hospitals in that country.

  4. Making COD statistics useful for public health at local level in the city of Cape Town: utilidad para la salud pública a nivel local en Ciudad del Cabo.

    PubMed Central

    Bradshaw, Debbie; Groenewald, Pamela; Bourne, David E.; Mahomed, Hassan; Nojilana, Beatrice; Daniels, Johan; Nixon, Jo

    2006-01-01

    OBJECTIVE: To review the quality of the coding of the cause of death (COD) statistics and assess the mortality information needs of the City of Cape Town. METHODS: Using an action research approach, a study was set up to investigate the quality of COD information, the accuracy of COD coding and consistency of coding practices in the larger health subdistricts. Mortality information needs and the best way of presenting the statistics to assist health managers were explored. FINDINGS: Useful information was contained in 75% of death certificates, but nearly 60% had only a single cause certified; 55% of forms were coded accurately. Disagreement was mainly because routine coders coded the immediate instead of the underlying COD. An abridged classification of COD, based on causes of public health importance, prevalent causes and selected combinations of diseases was implemented with training on underlying cause. Analysis of the 2001 data identified the leading causes of death and premature mortality and illustrated striking differences in the disease burden and profile between health subdistricts. CONCLUSION: Action research is particularly useful for improving information systems and revealed the need to standardize the coding practice to identify underlying cause. The specificity of the full ICD classification is beyond the level of detail on the death certificates currently available. An abridged classification for coding provides a practical tool appropriate for local level public health surveillance. Attention to the presentation of COD statistics is important to enable the data to inform decision-makers. PMID:16583080

  5. Cape Cod

    Atmospheric Science Data Center

    2014-05-15

    article title:  Cape Cod, Massachusetts     View Larger ... Pilgrims landed, is located on the west side of Cape Cod Bay, shown in this Multi-angle Imaging SpectroRadiometer (MISR) ... Terra orbit 1708. South of the distinctively-shaped Cape Cod are Nantucket Island and Martha's Vineyard. Further west is Block Island, ...

  6. Cape Cod

    Atmospheric Science Data Center

    2014-05-15

    article title:  Winter in Cape Cod     View Larger Image Cape Cod extends over 50 miles into the Atlantic Ocean. Its rugged coastline, ... February 18, 2001 - Snow and thin clouds over Cape Cod. project:  MISR category:  gallery ...

  7. Genetic polymorphisms of the organic cation transporter 1 gene (SLC22A1) within the Cape Admixed population of South Africa.

    PubMed

    Du Plessis, Morne; Pearce, Brendon; Jacobs, Clifford; Hoosain, Nisreen; Benjeddou, Mongi

    2015-03-01

    Human organic cation transporter 1 (hOCT1) is expressed primarily in hepatocytes and mediate the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for hOCT1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response of individual patients to clinical drugs which are substrates for this transporter. The aim of this study was to investigate the allele and genotype frequencies of single-nucleotide polymorphisms (SNPs) of SLC22A1 in the Cape Admixed population of South Africa. The genotypic and allelic distributions of nineteen nonsynonomous and one intronic SLC22A1 SNPs were determined in 100 healthy Cape Admixed participants, using a SNaPshot(®) multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F, P341L, S189L, G220V, V519F, M440I, G465R and the rs622342 intronic variant were 1.0, 0.5, 1.0, 1.0, 1.5, 0.5, 0.5 and 18.0%, respectively. None of the participants carried the variant allele for R61C, C88R, P283L, R287G and G401S. In addition, no variant alleles were observed for A306T, A413V, M420V, I421F, C436F, V501E, and I542V in the population. Twelve haplotypes were inferred from the genotypic data. The frequencies for most common haplotypes CCTCGGCGCGCTAGAGCTGA, CCTCGGCGCGCTAGCGCTGA and CCTCGGCGCGCGAGCGCTGA were 80, 9.9, and 3.5%, respectively.

  8. The association between healed skeletal fractures indicative of interpersonal violence and alcoholic liver disease in a cadaver cohort from the Western Cape, South Africa.

    PubMed

    Geldenhuys, Elsje-Márie; Burger, Elsie H; Alblas, Amanda; Greyling, Linda M; Kotzé, Sanet H

    2016-05-01

    Interpersonal violence (IPV) and heavy alcohol consumption are major problems in the Western Cape Province of South Africa. Cranio-maxillofacial fractures, particularly nasal and zygomatic bone fractures, as well as isolated radial fractures (Colles fractures) and ulnar shaft fractures (parry fractures), are indicative of IPV, while alcoholic liver disease (ALD) is the consequence of chronic alcohol abuse. We therefore aim to investigate whether a significant association exists between the prevalence of cranio-maxillofacial fractures and parry fractures and ALD in a Western Cape population. Embalmed cadavers (n = 124) used for medical students' anatomy training at the Division of Anatomy and Histology, Faculty of Medicine and Health Sciences, Stellenbosch University were studied. The cadavers were dissected according to departmental protocol. The liver of each cadaver was investigated for macroscopic pathology lesions. Tissue samples were removed, processed to wax, and sectioned and stained with hematoxylin and eosin (H&E). All soft tissue was removed from the skulls, radii, and ulnae, which were then investigated for healed skeletal trauma. The results showed 37/124 (29.8%) cadavers had healed cranio-maxillofacial fractures and 24/124 (19.4%) cadavers had morphologic features of ALD. A total of 12/124 (9.7%) cadavers showed signs of both ALD and healed cranio-maxillofacial trauma. More males were affected than females, and left-sided facial fractures were statistically more common compared to the right side. This study illustrated a significant trend between alcohol abuse and cranio-maxillofacial fractures in individuals from communities with a low socio-economic status (SES) where IPV is a major problem.

  9. Historical Notes on Three Exceptional Iron Meteorites of Southern Africa: The Cape of Good Hope, Gibeon, and Hoba

    NASA Astrophysics Data System (ADS)

    Marvin, Ursula B.

    2000-01-01

    Africa, is among the richest of continents in meteorites from hot deserts. Namibia is the site of the world's largest individual meteorite, the 60-ton Hoba Ni-rich ataxite, and the largest known meteorite strewn field, that of the Gibeon fine octahedrite. In Egypt, history goes back at least as far as approx. 1340 B.C when an iron dagger with a small content of nickel was placed in the tomb of King Tutankhamen. History also comes up-to-date in northern Africa with recoveries in recent years of thousands of meteorites in the reaches of the Sahara from Libya to Mauretania. This paper will review the histories of three exceptional meteorites from southern Africa.

  10. Seasonal availability of edible underground and aboveground carbohydrate resources to human foragers on the Cape south coast, South Africa

    PubMed Central

    Cowling, Richard M.; Potts, Alastair J.; Marean, Curtis W.

    2016-01-01

    The coastal environments of South Africa’s Cape Floristic Region (CFR) provide some of the earliest and most abundant evidence for the emergence of cognitively modern humans. In particular, the south coast of the CFR provided a uniquely diverse resource base for hunter-gatherers, which included marine shellfish, game, and carbohydrate-bearing plants, especially those with Underground Storage Organs (USOs). It has been hypothesized that these resources underpinned the continuity of human occupation in the region since the Middle Pleistocene. Very little research has been conducted on the foraging potential of carbohydrate resources in the CFR. This study focuses on the seasonal availability of plants with edible carbohydrates at six-weekly intervals over a two-year period in four vegetation types on South Africa’s Cape south coast. Different plant species were considered available to foragers if the edible carbohydrate was directly (i.e. above-ground edible portions) or indirectly (above-ground indications to below-ground edible portions) visible to an expert botanist familiar with this landscape. A total of 52 edible plant species were recorded across all vegetation types. Of these, 33 species were geophytes with edible USOs and 21 species had aboveground edible carbohydrates. Limestone Fynbos had the richest flora, followed by Strandveld, Renosterveld and lastly, Sand Fynbos. The availability of plant species differed across vegetation types and between survey years. The number of available USO species was highest for a six-month period from winter to early summer (Jul–Dec) across all vegetation types. Months of lowest species’ availability were in mid-summer to early autumn (Jan–Apr); the early winter (May–Jun) values were variable, being highest in Limestone Fynbos. However, even during the late summer carbohydrate “crunch,” 25 carbohydrate bearing species were visible across the four vegetation types. To establish a robust resource landscape

  11. Health Systems Readiness to Manage the Hypertension Epidemic in Primary Health Care Facilities in the Western Cape, South Africa: A Study Protocol

    PubMed Central

    Yaya, Sanni; Labonté, Ronald

    2016-01-01

    Background Developing countries are undergoing a process of epidemiological transition from infectious to noncommunicable diseases, described by the United Nations Secretary General Ban Ki-Moon as ‘‘a public health emergency in slow motion.” One of the most prevalent in sub-Saharan Africa is hypertension, which is a complex chronic condition often referred to as a “silent killer” and key contributor to the development of cardiovascular and cerebrovascular diseases. Hypertensive patients in this setting are estimated to increase from 74.7 million in 2008 to 125.5 million in 2025, a 68% increase. However, there is an important gap between emerging high-level policies and recommendations, and the near-absence of practical guidance and experience delivering long-term medical care for noncommunicable diseases within resource-limited health systems. Objective To address this gap, our study will consist of field investigations to determine the minimum health systems requirements to ensure successful delivery of antihypertensive medications when scaling-up interventions to control the hypertension epidemic. Methods A cross-sectional analytic study will be conducted in the Western Cape using a mixed-method approach with two semistructured interview guides. The first will be for health professionals involved in the care of hypertensive patients within at least 6 community health centers (3 urban and 3 rural) to understand the challenges associated with their care. The second will be to map and assess the current supply chain management system of antihypertensive medications by interviewing key informants at different levels of the processes. Finally, modeling and simulation tools will be used to understand how to estimate minimum numbers of health workers required at each supply chain interval to ensure successful delivery of medications when scaling-up interventions. Results Funding for the study was secured through a Doctoral Research Award in October 2014 from

  12. A review of the Pseudobarbus afer (Peters, 1864) species complex (Teleostei, Cyprinidae) in the eastern Cape Fold Ecoregion of South Africa

    PubMed Central

    Chakona, Albert; Skelton, Paul H.

    2017-01-01

    Abstract The Eastern Cape redfin, Pseudobarbus afer, has long been considered to be a single widespread and variable species occurring in multiple isolated river systems in the Cape Fold Ecoregion (CFE) at the southern tip of Africa. Mitochondrial cytochrome b and control region sequence data of individuals from populations currently assigned to Pseudobarbus afer across the species’ distribution range revealed existence of four deeply divergent taxonomic units: (i) the Mandela lineage confined to the Sundays, Swartkops and Baakens river systems, (ii) the Krom lineage endemic to the Krom River system, (iii) the St Francis lineage occurring in the Gamtoos and adjacent river systems, and (iv) the Forest lineage occurring in several coastal river systems from the Tsitsikamma to the Klein Brak River system. The Forest lineage is closely related to Pseudobarbus phlegethon from the Olifants River system on the west coast of South Africa, suggesting that it does not belong to Pseudobarbus afer s.l. Herein we focus on the three lineages within the Pseudobarbus afer s.l. complex and provide new diagnosis for Pseudobarbus afer s.s (Mandela lineage), revalidate Pseudobarbus senticeps (Krom lineage) as a distinct species, and describe a new species Pseudobarbus swartzi (St Francis lineage). The three species exhibit subtle differences, which explains why they were previously considered to represent a single variable and widespread species. Pseudobarbus senticeps differs from both Pseudobarbus afer and Pseudobarbus swartzi by having fewer (i.e. larger) scales (25–33, mode 29 lateral line scale series; 10–12, mode 11 circumpeduncular scales) and presence of a lateral stripe which terminates in a conspicuous triangular blotch at the base of the caudal fin. Long barbels which reach or surpass the vertical through the posterior edge of the eye further separate Pseudobarbus senticeps from Pseudobarbus afer s.s. which possesses simple short barbels which do not reach the

  13. Women in Educational Leadership: The Case of Hope High School in the Eastern Cape Province, South Africa

    ERIC Educational Resources Information Center

    Diko, Nolutho

    2014-01-01

    The Constitution of the Republic of South Africa, 1996 confers equality on all South African citizens regardless of race and gender. It has been reported that, under apartheid, gender inequality was a way of life and even social liberation movements observed it. Education is not exempt from gender inequality; the Department of Education in 2003…

  14. ICT applications as e-health solutions in rural healthcare in the Eastern Cape Province of South Africa.

    PubMed

    Ruxwana, Nkqubela L; Herselman, Marlien E; Conradie, D Pieter

    2010-01-01

    Information and Communication Technology (ICT) solutions (e.g. e-health, telemedicine, e-education) are often viewed as vehicles to bridge the digital divide between rural and urban healthcare centres and to resolve shortcomings in the rural health sector. This study focused on factors perceived to influence the uptake and use of ICTs as e-health solutions in selected rural Eastern Cape healthcare centres, and on structural variables relating to these facilities and processes. Attention was also given to two psychological variables that may underlie an individual&s acceptance and use of ICTs: usefulness and ease of use. Recommendations are made with regard to how ICTs can be used more effectively to improve health systems at fi ve rural healthcare centres where questionnaire and interview data were collected: St. Lucy&s Hospital, Nessie Knight Hospital, the Tsilitwa Clinic, the Madzikane Ka-Zulu Memorial Hospital and the Nelson Mandela General Hospital.

  15. Socio-economic status and self-reported tuberculosis: a multilevel analysis in a low-income township in the Eastern Cape, South Africa

    PubMed Central

    Cramm, Jane M.; Koolman, Xander; Møller, Valerie; Nieboer, Anna P.

    2011-01-01

    Few studies have investigated the interplay of multiple factors affecting the prevalence of tuberculosis in developing countries. The compositional and contextual factors that affect health and disease patterns must be fully understood to successfully control tuberculosis. Experience with tuberculosis in South Africa was examined at the household level (overcrowding, a leaky roof, social capital, unemployment, income) and at the neighbourhood level (Gini coefficient of inequality, unemployment rate, headcount poverty rate). A hierarchical random-effects model was used to assess household-level and neighbourhood-level effects on self-reported tuberculosis experience. Every tenth household in each of the 20 Rhini neighbourhoods was selected for inclusion in the sample. Eligible respondents were at least 18 years of age and had been residents of Rhini for at least six months of the previous year. A Kish grid was used to select one respondent from each targeted household, to ensure that all eligible persons in the household stood an equal chance of being included in the survey. We included 1,020 households within 20 neighbourhoods of Rhini, a suburb of Grahamstown in the Eastern Cape, South Africa. About one-third of respondents (n=329; 32%) reported that there had been a tuberculosis case within the household. Analyses revealed that overcrowding (P≤0.05) and roof leakage (P≤0.05) contributed significantly to the probability of a household tuberculosis experience experience, whereas higher social capital (P≤0.01) significantly reduced this probability. Overcrowding, roof leakage and the social environment affected tuberculosis prevalence in this economically disadvantaged community. Policy makers should consider the possible benefits of programs that deal with housing and social environments when addressing the spread of tuberculosis in economically poor districts. PMID:28299075

  16. The cultural and community-level acceptance of antiretroviral therapy (ART) among traditional healers in Eastern Cape, South Africa.

    PubMed

    Shuster, Justin M; Sterk, Claire E; Frew, Paula M; del Rio, Carlos

    2009-02-01

    The HIV/AIDS epidemic has profoundly impacted South Africa's healthcare system, greatly hampering its ability to scale-up the provision of antiretroviral therapy (ART). While one way to provide comprehensive care and prevention in sub-Saharan African countries has been through collaboration with traditional healers, long-term support specifically for ART has been low within this population. An exploratory, qualitative research project was conducted among 25 self-identified traditional healers between June and August of 2006 in the Lukhanji District of South Africa. By obtaining the opinions of traditional healers currently interested in biomedical approaches to HIV/AIDS care and prevention, this formative investigation identified a range of motivational factors that were believed to promote a deeper acceptance of and support for ART. These factors included cultural consistencies between traditional and biomedical medicine, education, as well as legal and financial incentives to collaborate. Through an incorporation of these factors into future HIV/AIDS treatment programs, South Africa and other sub-Saharan countries may dramatically strengthen their ability to provide ART in resource-poor settings.

  17. IN and CCN Measurements on RV Polarstern and Cape Verde

    NASA Astrophysics Data System (ADS)

    Welti, André; Herenz, Paul; Henning, Silvia; Stratmann, Frank

    2016-04-01

    Two field campaigns, one situated on RV Polarstern (Oct. - Dec. 2015) and one on the Cape Verde islands (Jan. - Feb. 2016) measuring ice nuclei (IN) and cloud condensation nuclei (CCN) concentrations as a function of supersaturation and temperature are presented. The Polarstern cruise from Bremerhaven to Cape Town yields a cross section of IN and CCN concentrations from 54°N to 35°S and passes the Cape Verde Islands at 15°N. Measurements were conducted using the commercial CCNC and SPIN instruments from DMT. During both campaigns, a comprehensive set of aerosol characterization data including size distribution, optical properties and chemical information were measured in parallel. The ship based measurements provide a measure of variability in IN/CCN concentration with geographic position. As an example a clear influence on IN and CCN number concentration of the Saharan desert dust outflow between the Canary Islands and Cape Verde or the continental aerosol from Europe and South Africa was observed. The measurements on Cape Verde provide information on the temporal variability at a fixed position varying between clean marine and dust influenced conditions. Both datasets are related to auxiliary data of aerosol size distribution and chemical composition. The datasets are used to distinguish the influence of local sources and background concentration of IN/CCN. By combining of the geographically fix measurements with the geographical cross section, typical ranges of IN and CCN concentration are derived. The datasets will be part of the BACCHUS database thereby providing valuable input for future climate modeling activities.

  18. Geophysical evidence for the intersection of the St Paul, Cape Palmas and Grand Cess fracture zones with the continental margin of Liberia, West Africa

    USGS Publications Warehouse

    Behrendt, John C.; Schlee, J.; Robb, James M.

    1974-01-01

    PUBLISHED reconstructions of Gondwana continent1 (Fig. la) show a gap in fit near the junction of the Americas and Africa. To study this critical area, the Unitedgeo I made geophysical measurements and collected rock samples across the continental margin of Liberia (USGS-IDOE cruise leg 5) in November 1971. Figure Ib indicates the location of the 5,400 km of ship track on a generalised bathymetric map2. We shall discuss the data in detail elsewhere. Here we present the evidence for the existence of three fracture zones, two of which have not been reported previously, intersecting the continental margin at the north end of the South Atlantic, which remained closed probably until Cretaceous time. We suggest that Precambrian structures on the African continent controlled the location of these fracture zones. Figure Ic compares gravity and magnetic profiles and interpretations of the seismic profiles for three selected lines (27, 30 and 34) crossing the Grand Cess, Cape Palmas and St Paul fracture zones, respectively. ?? 1974 Nature Publishing Group.

  19. Serum Oxidized LDL Levels in Type 2 Diabetic Patients with Retinopathy in Mthatha Region of the Eastern Cape Province of South Africa

    PubMed Central

    2016-01-01

    Oxidized low-density lipoprotein (ox-LDL) is a powerful natural prooxidant derived from native LDL by cell-mediated oxidation. Such oxidation occurs more easily in glycated LDL as observed in diabetes mellitus. We evaluated and compared selected biomarkers of oxidative stress and total antioxidant (TAO) levels in type 2 diabetes mellitus (T2DM) patients with and without retinopathy in the Mthatha region of the Eastern Cape Province, South Africa. The participants totaled to 140 and this number comprised 98 diabetic patients on treatment, stratified by diabetes (54) and diabetes with retinopathy (44). Forty-two nondiabetic healthy controls made up the 140. Fasting plasma glucose (FPG), glycosylated hemoglobin (HbA1c), lipid profile, serum ox-LDL, thiobarbituric acid reactive substances (TBARS), and TAO levels were measured. A statistically significant increase in FPG, HbA1c, TBARS, and ox-LDL and a significant decrease in TAO levels were seen in T2DM patients with retinopathy as compared to controls. A significant negative correlation was observed between TAO and ox-LDL levels in the diabetic group. In multiple linear regression analyses, duration of diabetes, triglyceride, TAO, and LDL cholesterol were found to be significantly associated with ox-LDL. In multiple logistic regression analyses, ox-LDL [OR 1.02 (1.01–1.03), P = 0.005] was the only risk factor and was significantly associated with the presence of retinopathy. PMID:27433285

  20. Stigma, Culture, and HIV and AIDS in the Western Cape, South Africa: An Application of the PEN-3 Cultural Model for Community-Based Research

    PubMed Central

    Airhihenbuwa, Collins; Okoror, Titilayo; Shefer, Tammy; Brown, Darigg; Iwelunmor, Juliet; Smith, Ed; Adam, Mohamed; Simbayi, Leickness; Zungu, Nompumelelo; Dlakulu, Regina; Shisana, Olive

    2012-01-01

    HIV- and AIDS-related stigma has been reported to be a major factor contributing to the spread of HIV. In this study, the authors explore the meaning of stigma and its impact on HIV and AIDS in South African families and health care centers. They conducted focus group and key informant interviews among African and Colored populations in Khayelitsha, Gugulethu, and Mitchell’s Plain in the Western Cape province. The audio-recorded interviews were transcribed and coded using NVivo. Using the PEN-3 cultural model, the authors analyzed results showing that participants’ shared experiences ranged from positive/nonstigmatizing, to existential/unique to the contexts, to negative/stigmatizing. Families and health care centers were found to have both positive nonstigmatizing values and negative stigmatizing characteristics in addressing HIV/AIDS-related stigma. The authors conclude that a culture-centered analysis, relative to identity, is central to understanding the nature and contexts of HIV/AIDS-related stigma in South Africa. PMID:22505784

  1. ERTS-1 imagery as an aid to the understanding of the regional setting of base metal deposits in the North West Cape Province, South Africa. [mineral exploration

    NASA Technical Reports Server (NTRS)

    Viljoen, R. P.

    1974-01-01

    A number of base metal finds have recently focussed attention on the North Western Cape Province of South Africa as an area of great potential mineral wealth. From the point of view of competitive mineral exploration it was essential that an insight into the regional geological controls of the base metal mineralization of the area be obtained as rapidly as possible. Conventional methods of producing a suitable regional geological map were considered to be too time-consuming and ERTS-1 imagery was consequently examined. This imagery has made a significant contribution in the compilation of a suitable map on which to base further mineral exploration programmes. The time involved in the compilation of maps of this nature was found to be only a fraction of the time necessary for the production of similar maps using other methods. ERTS imagery is therefore considered to be valuable in producing accurate regional maps in areas where little or no geological data are available, or in areas of poor access. Furthermore, these images have great potential for rapidly defining the regional extent of metallogenic provinces.

  2. Investigation into the bacterial pollution levels at various sites along the Diep and Plankenburg river systems, 3 Western Cape, South Africa.

    PubMed

    Alegbeleye, O O; Opeolu, B O; Jackson, V A

    2016-01-01

    This study sought to investigate and compare bacterial contamination levels at six different sites along the Diep and Plankenburg river systems in the Western Cape, South Africa. Surface water and sediment samples were collected monthly from the six selected sampling sites along both river courses between January 2014 and December 2014 and were evaluated for bacterial contaminants. Microbial isolation, characterisation and identification were done using conventional techniques (serial dilution, Gram staining, and biochemical testing) and molecular identification techniques (polymerase chain reaction and DNA sequencing). A total of 19 bacterial isolates belonging to the genera Raoultella, Bacillus, Pseudomonas, Klebsiella, Escherichia, Enterobacter, Exiguobacterium, Acinetobacter, Serratia, Aeromonas, Staphylococcus and Citrobacter were isolated from the surface water and sediment samples at the end of the survey. Higher microbial load was obtained from sediment samples compared to surface water samples. Seasonal variation was also observed in terms of microbial counts. Higher microbial counts were obtained during summer sampling time compared to winter sampling time. The most contaminated site was located on Plankenburg River with average bacterial counts ranging between 3.1 × 10(5)-6.9 × 10(8) CFU/ml and 3.9 × 10(6)-2.88 × 10(9) CFU/ml from surface water and sediment, respectively, recorded at this site during winter and summer. Although lower microbial counts were recorded along the Diep River course, most of the bacterial counts recorded along both rivers exceeded the acceptable maximum limits for river water.

  3. Factors associated with sexual initiation and condom use among adolescents on Santiago Island, Cape Verde, West Africa.

    PubMed

    Tavares, Carlos Mendes; Schor, Néia; França, Ivan; Diniz, Simone Grilo

    2009-09-01

    The current study focuses on factors associated with sexual initiation and condom use among teenagers on Santiago Island, Cape Verde, according to gender. This was a representative, probabilistic sample of 13-to-17-year-olds (n = 768) attending public secondary schools on Santiago Island in 2007. Associations were tested by test of proportion, Pearson's chi-square, or Fisher's exact test and logistic regression. Factors related to sexual initiation among boys were: age over 14 years, Catholic religion, and alcohol consumption. For girls, the factors included: > 9 years of schooling and involvement in an affective-sexual relationship. Unlike other Sub-Saharan countries, this study showed a high prevalence of condom use during initial sexual activity. Adolescents are able to safely begin sexually active life if they have access to information, sex education, and other STD prevention and contraceptive methods. This study provides insights on the development of policies to reduce the vulnerability of the young population to STD/AIDS and the limits and challenges related to the promotion of condom use and sex education, focusing on unequal gender relations.

  4. Plant responses to climate in the Cape Floristic Region of South Africa: evidence for adaptive differentiation in the Proteaceae.

    PubMed

    Carlson, Jane E; Holsinger, Kent E; Prunier, Rachel

    2011-01-01

    Local adaptation along environmental gradients may drive plant species radiation within the Cape Floristic Region (CFR), yet few studies examine the role of ecologically based divergent selection within CFR clades. In this study, we ask whether populations within the monophyletic white protea clade (Protea section Exsertae, Proteaceae) differ in key functional traits along environmental gradients and whether differences are consistent with local adaptation. Using seven taxa, we measured trait-environment associations and selection gradients across 35 populations of wild adults and their offspring grown in two common gardens. Focal traits were leaf size and shape, specific leaf area (SLA), stomatal density, growth, and photosynthetic rate. Analyses on wild and common garden plants revealed heritable trait differences that were associated with gradients in rainfall seasonality, drought stress, cold stress, and less frequently, soil fertility. Divergent selection between gardens generally matched trait-environment correlations and literature-based predictions, yet variation in selection regimes among wild populations generally did not. Thus, selection via seedling survival may promote gradient-wide differences in SLA and leaf area more than does selection via adult fecundity. By focusing on the traits, life stages, and environmental clines that drive divergent selection, our study uniquely demonstrates adaptive differentiation among plant populations in the CFR.

  5. Community health worker perspectives on a new primary health care initiative in the Eastern Cape of South Africa

    PubMed Central

    Rabkin, Miriam; Macheka, Tonderayi; Mutiti, Anthony; Mwansa-Kambafwile, Judith; Dlamini, Thomas; El-Sadr, Wafaa M.

    2017-01-01

    Background In 2010, South Africa’s National Department of Health launched a national primary health care (PHC) initiative to strengthen health promotion, disease prevention, and early disease detection. The strategy, called Re-engineering Primary Health Care (rPHC), aims to provide a preventive and health-promoting community-based PHC model. A key component of rPHC is the use of community-based outreach teams staffed by generalist community health workers (CHWs). Methods We conducted focus group discussions and surveys on the knowledge and attitudes of 91 CHWs working on community-based rPHC teams in the King Sabata Dalindyebo (KSD) sub-district of Eastern Cape Province. Results The CHWs we studied enjoyed their work and found it meaningful, as they saw themselves as agents of change. They also perceived weaknesses in the implementation of outreach team oversight, and desired field-based training and more supervision in the community. Conclusions There is a need to provide CHWs with basic resources like equipment, supplies and transport to improve their acceptability and credibility to the communities they serve. PMID:28301609

  6. A framework for effective collaboration: a case study of collaboration in nursing education in the Western Cape, South Africa.

    PubMed

    Daniels, Felicity M; Khanyile, Thembisile D

    2013-09-01

    A fundamental purpose of mergers between higher education institutions (HEIs) in 2002 was to enable sharing of scarce resources between more advanced universities and those historically disadvantaged by the apartheid system of the South African Government. A common teaching platform for undergraduate nursing education in the Western Cape was established in 2005, in line with the transformation of the higher education system, as a collaborative initiative between three universities. In order to evaluate the common teaching platform, Stuffelbeam's context, input, process, product (CIPP) research model was employed. A sample of 108 participants was selected through stratified purposive sampling, and included three deputy vice-chancellors, three deans, three heads of department, 18 lecturers and 81 students. Semi-structured interviews were held with the staff members, whilst the students participated in focus group interviews. Open-ended questions informed by literature and the CIPP evaluation model were developed and used to guide the interviews. This enabled the researcher to obtain a rich description of the participants' experiences. The data were analysed inductively. The results revealed that the main purpose of collaboration was not achieved due to the lack of a common understanding of the concept of collaboration and its purpose; a lack of readiness to collaborate and a lack of sharing of resources. A framework for effective collaboration was developed based on the results.

  7. Trends in vegetation degradation in relation to land tenure, rainfall, and population changes in Peddie district, Eastern Cape, South Africa.

    PubMed

    Kakembo, V

    2001-07-01

    Spatial and temporal variations in vegetation are examined in relation to land tenure, population increase, and rainfall variation in a part of Peddie district, Eastern Cape. Sequential aerial photographs between 1938 and 1988 are analyzed to determine trends in vegetation and population change in three different land-tenure units. The areal extent at each date of four distinct vegetation categories is determined using PC ARC/INFO GIS. Long-term annual rainfall trends for the area are analyzed and juxtaposed with vegetation changes. Extensive ground-truthing exercises are carried out to verify the present condition of vegetation condition in terms of cover and species composition. Differences in land-tenure systems are discerned as the dominant factor controlling variations in vegetation degradation. The study also reveals that neither population changes nor rainfall variations can explain the observed trends in vegetation degradation. Earlier injudicious land-use practices, sustained since the turn of the last century, may provide plausible explanations for the trends and present status of vegetation degradation in the area.

  8. Persistent organic contaminants in Saharan dust air masses in West Africa, Cape Verde and the eastern Caribbean.

    PubMed

    Garrison, V H; Majewski, M S; Foreman, W T; Genualdi, S A; Mohammed, A; Massey Simonich, S L

    2014-01-15

    Anthropogenic semivolatile organic compounds (SOCs) that persist in the environment, bioaccumulate, are toxic at low concentrations, and undergo long-range atmospheric transport (LRT) were identified and quantified in the atmosphere of a Saharan dust source region (Mali) and during Saharan dust incursions at downwind sites in the eastern Caribbean (U.S. Virgin Islands, Trinidad and Tobago) and Cape Verde. More organochlorine and organophosphate pesticides (OCPPs), polycyclic aromatic hydrocarbons (PAHs), and polychlorinated biphenyl (PCB) congeners were detected in the Saharan dust region than at downwind sites. Seven of the 13 OCPPs detected occurred at all sites: chlordanes, chlorpyrifos, dacthal, dieldrin, endosulfans, hexachlorobenzene (HCB), and trifluralin. Total SOCs ranged from 1.9-126 ng/m(3) (mean = 25 ± 34) at source and 0.05-0.71 ng/m(3) (mean = 0.24 ± 0.18) at downwind sites during dust conditions. Most SOC concentrations were 1-3 orders of magnitude higher in source than downwind sites. A Saharan source was confirmed for sampled air masses at downwind sites based on dust particle elemental composition and rare earth ratios, atmospheric back trajectory models, and field observations. SOC concentrations were considerably below existing occupational and/or regulatory limits; however, few regulatory limits exist for these persistent organic compounds. Long-term effects of chronic exposure to low concentrations of SOCs are unknown, as are possible additive or synergistic effects of mixtures of SOCs, biologically active trace metals, and mineral dust particles transported together in Saharan dust air masses.

  9. Prospects for biological control of Cape-ivy with the Cape-ivy fly and the cape-ivy moth

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cape-ivy (Delairea odorata, Asteraceae), native to coastal floodplains and mountain riparian zones in eastern South Africa, is an invasive vine in coastal riparian, woodland and scrub habitats in California and southern Oregon. Cape-ivy smothers native vegetation and may impair water flow in coastal...

  10. Pathology and immunohistochemistry of papillomavirus-associated cutaneous lesions in Cape mountain zebra, giraffe, sable antelope and African buffalo in South Africa.

    PubMed

    Williams, J H; van Dyk, E; Nel, P J; Lane, E; Van Wilpe, E; Bengis, R G; de Klerk-Lorist, L M; van Heerden, J

    2011-06-01

    Skin lesions associated with papillomaviruses have been reported in many animal species and man. Bovine papillomavirus (BVP) affects mainly the epidermis, but also the dermis in several species including bovine, the best-known example being equine sarcoid, which is associated with BVP types 1 and 2. This publication describes and illustrates the macroscopic and histological appearance of BPV-associated papillomatous, fibropapillomatous or sarcoid-like lesions in Cape mountain zebra (Equus zebra zebra) from the Gariep Dam Nature Reserve, 2 giraffes (Giraffa camelopardalis) from the Kruger National Park, and a sable antelope (Hippotragus niger) from the Kimberley area of South Africa. An African buffalo (Syncerus caffer) cow from Kruger National Park also had papillomatous lesions but molecular characterisation of lesional virus was not done. Immunohistochemical staining using polyclonal rabbit antiserum to chemically disrupted BPV-1, which cross-reacts with the L1 capsid of most known papillomaviruses, was positive in cells of the stratum granulosum of lesions in Giraffe 1, the sable and the buffalo and negative in those of the zebra and Giraffe 2. Fibropapillomatous and sarcoid-like lesions from an adult bovine were used as positive control for the immunohistochemistry and are described and the immunohistochemistry illustrated for comparison. Macroscopically, both adult female giraffe had severely thickened multifocal to coalescing nodular and occasionally ulcerated lesions of the head, neck and trunk with local poorly-circumscribed invasion into the subcutis. Necropsy performed on the 2nd giraffe revealed neither internal metastases nor serious underlying disease. Giraffe 1 had scattered, and Giraffe 2 numerous, large, anaplastic, at times indistinctly multinucleated dermal fibroblasts with bizarre nuclei within the sarcoid-like lesions, which were BPV-1 positive in Giraffe 1 and BPV-1 and -2 positive in Giraffe 2 by RT-PCR. The sable antelope presented with a

  11. Antibiotic Susceptibilities of Enterococcus Species Isolated from Hospital and Domestic Wastewater Effluents in Alice, Eastern Cape Province of South Africa

    PubMed Central

    Iweriebor, Benson Chuks; Gaqavu, Sisipho; Obi, Larry Chikwelu; Nwodo, Uchechukwu U.; Okoh, Anthony I.

    2015-01-01

    Background: Antimicrobial resistance in microorganisms are on the increase worldwide and are responsible for substantial cases of therapeutic failures. Resistance of species of Enterococcus to antibiotics is linked to their ability to acquire and disseminate antimicrobial resistance determinants in nature, and wastewater treatment plants (WWTPs) are considered to be one of the main reservoirs of such antibiotic resistant bacteria. We therefore determined the antimicrobial resistance and virulence profiles of some common Enterococcus spp that are known to be associated with human infections that were recovered from hospital wastewater and final effluent of the receiving wastewater treatment plant in Alice, Eastern Cape. Methods: Wastewater samples were simultaneously collected from two sites (Victoria hospital and final effluents of a municipal WWTP) in Alice at about one to two weeks interval during the months of July and August 2014. Samples were screened for the isolation of enterococci using standard microbiological methods. The isolates were profiled molecularly after targeted generic identification and speciation for the presence of virulence and antibiotic resistance genes. Results: Out of 66 presumptive isolates, 62 were confirmed to belong to the Enterococcus genusof which 30 were identified to be E. faecalis and 15 E. durans. The remaining isolates were not identified by the primers used in the screening procedure. Out of the six virulence genes that were targeted only three of them; ace, efaA, and gelE were detected. There was a very high phenotypic multiple resistance among the isolates and these were confirmed by genetic analyses. Conclusions: Analyses of the results obtained indicated that hospital wastewater may be one of the sources of antibiotic resistant bacteria to the receiving WWTP. Also, findings revealed that the final effluent discharged into the environment was contaminated with multi-resistant enterococci species thus posing a health hazard

  12. Persistent organic contaminants in Saharan dust air masses in West Africa, Cape Verde and the eastern Caribbean

    USGS Publications Warehouse

    Garrison, Virginia H.; Majewski, Michael S.; Foreman, William T.; Genualdi, Susan A.; Mohammed, Azad; Massey Simonich, Stacy L.

    2014-01-01

    Anthropogenic semivolatile organic compounds (SOCs) that persist in the environment, bioaccumulate, are toxic at low concentrations, and undergo long-range atmospheric transport (LRT) were identified and quantified in the atmosphere of a Saharan dust source region (Mali) and during Saharan dust incursions at downwind sites in the eastern Caribbean (U.S. Virgin Islands, Trinidad and Tobago) and Cape Verde. More organochlorine and organophosphate pesticides (OCPPs), polycyclic aromatic hydrocarbons (PAHs), and polychlorinated biphenyl (PCB) congeners were detected in the Saharan dust region than at downwind sites. Seven of the 13 OCPPs detected occurred at all sites: chlordanes, chlorpyrifos, dacthal, dieldrin, endosulfans, hexachlorobenzene (HCB), and trifluralin. Total SOCs ranged from 1.9–126 ng/m3 (mean = 25 ± 34) at source and 0.05–0.71 ng/m3 (mean = 0.24 ± 0.18) at downwind sites during dust conditions. Most SOC concentrations were 1–3 orders of magnitude higher in source than downwind sites. A Saharan source was confirmed for sampled air masses at downwind sites based on dust particle elemental composition and rare earth ratios, atmospheric back trajectory models, and field observations. SOC concentrations were considerably below existing occupational and/or regulatory limits; however, few regulatory limits exist for these persistent organic compounds. Long-term effects of chronic exposure to low concentrations of SOCs are unknown, as are possible additive or synergistic effects of mixtures of SOCs, biologically active trace metals, and mineral dust particles transported together in Saharan dust air masses.

  13. Studies on the bacteriological qualities of the Buffalo River and three source water dams along its course in the Eastern Cape Province of South Africa.

    PubMed

    Chigor, Vincent N; Sibanda, Timothy; Okoh, Anthony I

    2013-06-01

    The Buffalo River and its dams are major surface water sources used for fresh produce irrigation, raw water abstraction and recreation in parts of the Eastern Cape Province in South Africa. Over a 12-month period (August 2010 to July 2011), we assessed the bacteriological qualities of water from the river and 3 source water dams along its course. Faecal indicator bacteria (FIB), including total coliform (TC), faecal coliform (FC) and enterococci (ENT) counts, were high and ranged as follows: 1.9 × 10(2)-3.8 × 10(7), 0-3.0 × 10(5) and 0-5.3 × 10(5) cfu/100 ml for TC, FC and ENT, respectively. Significantly (P<0.05) higher concentrations of FC and ENT were observed at the sampling sites located at the lower reaches of the river compared to the upper reaches, and at Bridle Drift Dam compared to the other two dams. FIB counts mostly exceeded the recommended maximum values suggested by national and international guidelines for safe fresh produce irrigation, domestic applications, full-contact recreation and livestock watering. These results show that the bacteriological qualities of the Buffalo River and dams were poor, and suggest that sewage was dumped into the Buffalo River during the study period. Urban runoffs and effluents of wastewater treatment plants appear to be important sources of faecal contamination in the river. We conclude that these water bodies represent significant public health hazards. Provision of adequate sanitary infrastructure will help prevent source water contamination, and public health education aimed at improving personal, household and community hygiene is imperative.

  14. Bioremediation of polycyclic aromatic hydrocarbon (PAH) compounds: (acenaphthene and fluorene) in water using indigenous bacterial species isolated from the Diep and Plankenburg rivers, Western Cape, South Africa.

    PubMed

    Alegbeleye, Oluwadara Oluwaseun; Opeolu, Beatrice Olutoyin; Jackson, Vanessa

    This study was conducted to investigate the occurrence of PAH degrading microorganisms in two river systems in the Western Cape, South Africa and their ability to degrade two PAH compounds: acenaphthene and fluorene. A total of 19 bacterial isolates were obtained from the Diep and Plankenburg rivers among which four were identified as acenaphthene and fluorene degrading isolates. In simulated batch scale experiments, the optimum temperature for efficient degradation of both compounds was determined in a shaking incubator after 14 days, testing at 25°C, 30°C, 35°C, 37°C, 38°C, 40°C and 45°C followed by experiments in a Stirred Tank Bioreactor using optimum temperature profiles from the batch experiment results. All experiments were run without the addition of supplements, bulking agents, biosurfactants or any other form of biostimulants. Results showed that Raoultella ornithinolytica, Serratia marcescens, Bacillus megaterium and Aeromonas hydrophila efficiently degraded both compounds at 37°C, 37°C, 30°C and 35°C respectively. The degradation of fluorene was more efficient and rapid compared to that of acenaphthene and degradation at Stirred Tank Bioreactor scale was more efficient for all treatments. Raoultella ornithinolytica, Serratia marcescens, Bacillus megaterium and Aeromonas hydrophila degraded a mean total of 98.60%, 95.70%, 90.20% and 99.90% acenaphthene, respectively and 99.90%, 97.90%, 98.40% and 99.50% fluorene, respectively. The PAH degrading microorganisms isolated during this study significantly reduced the concentrations of acenaphthene and fluorene and may be used on a larger, commercial scale to bioremediate PAH contaminated river systems.

  15. An Economic Valuation Of The Water Footprint: A Case Study Of The Citrus Sector In The Lower Sundays River Valley, Eastern Cape, South Africa.

    NASA Astrophysics Data System (ADS)

    Munro, S. A.; Fraser, G. C. G.; Snowball, J. D.

    2014-12-01

    With the implementation of the South African National Water Act (NWA) currently underway, water intensive sectors, such as the irrigated agriculture sector, can expect reduced water allocations and an increase in water prices. Water footprints (WFs) are increasingly being recognised as a meaningful way by which to represent human appropriation of water resources. This study examines the green and blue WFs of a variety of citrus cultivars in the lower Sundays River Valley, Eastern Cape, South Africa. WFs were calculated across dry, humid and long-term average climates and comparisons were made to available global average benchmark WFs. An number of indicators were also explored including; water productivity (ton/m3), economic land productivity (R/ha) and economic water productivity (R/m3) across all three climatic years. Most applications of WF sustainability assessments have focused on examining physical water scarcity as a measure for determining environmental hotspots. This study, therefore, also calculates the marginal product value for the irrigation water using a non-parametric linear programming approach. Marginal product value of irrigation water is not only useful in assisting with water-allocation decision making, but also useful in demonstrating the effects of resource depletion and degradation, and is therefore a useful measure for determining economic water scarcity. The study highlights that both farmers and governments could reduce blue WF's through adopting measures to increase water efficiency and considering economic water and land productivity. It also demonstrates the importance of including both environmental and economic scarcity indicators into water management and planning strategies, and the importance of conducting WF assessments using more accurate, site specific data.

  16. A questionnaire survey on diseases and problems affecting sheep and goats in communal farming regions of the Eastern Cape province, South Africa.

    PubMed

    Bath, Gareth F; Penrith, Mary-Louise; Leask, Rhoda

    2016-08-31

    A questionnaire of 15 questions was completed by four categories of respondents with the aim of establishing the experience and opinions of these groups on the constraints including animal health problems for communal, small-scale sheep and goat farming in the Eastern Cape province of South Africa. The questionnaires were completed independently and categories were representative of the areas investigated. Analysis of responses was done by means, ranges, votes and clusters of responses. Comparisons between the responses of the four categories were made to identify similarities or contrasts. The results revealed that of non-veterinary concerns, stock theft was the major problem for these farms. Nutrition was a further major constraint. A third area of significant concern was the provision or availability of facilities like fences, water troughs, dips and sheds. Lack of marketing and business skills were also seen as important deficiencies to be rectified so as to promote profitable farming. Of the most important veterinary problems identified, the provision, availability, cost and care of drugs and vaccines were seen as major stumbling blocks to effective disease control, as well as lack of access to veterinary services. The most important diseases that constrain small-ruminant livestock farming in the farming systems investigated were sheep scab and other ectoparasites, heart water, enterotoxaemia, internal parasites and bluetongue. A lack of knowledge in key areas of small-stock farming was revealed and should be rectified by an effective training and support programme to improve the contribution of small-ruminant farming to livelihoods in these communities.

  17. Healthcare provider views on the health effects of biomass fuel collection and use in rural Eastern Cape, South Africa: an ethnographic study.

    PubMed

    Matinga, Margaret Njirambo; Annegarn, Harold J; Clancy, Joy S

    2013-11-01

    Policymakers at global level recognise that household biomass use in developing countries has significant health consequences. However, it is unclear how local-level health professionals perceive and respond to such health effects. This paper which is derived from the findings of a larger study on perceptions and responses to the harmful health effects of carrying heavy firewood loads and to smoke from cooking fires is based on a study conducted in South Africa among managers of health programmes and community nurses of Qaukeni and Mhlontlo municipalities in rural Eastern Cape. Interviews and participant observations were conducted in 2009 using ethnographic grounded theory approaches. In addition to a 10-month period of ethnographic fieldwork, ten programme managers and nurses in two villages were interviewed about health patterns in the villages that they serve, their perceptions of, and responses to the health effects of carrying heavy firewood loads, and inhalation of smoke from wood and dung cooking fires, their professional qualifications and experience, their own household energy use; and observations made as they served clinic clients. Results show that these programme managers and nurses perceive the health effects of carrying heavy loads of firewood and of cooking smoke as minor. Sometimes, nurses give women symptomatic relief for musculoskeletal pain resulting from carrying heavy loads. We posit that their perceptions are derived from customary neglect of work-related health and non-communicable diseases, cultural interpretations of womanhood, limited access to relevant information, and limited interactions between health and energy sector professionals. We conclude that culturally and gender-sensitive awareness programmes are needed for local-level health professionals to effectively address health effects of biomass collection and use. This paper provides new insights into overlooked differences between globally-driven initiatives to address health

  18. A Case Study of Landholder Attitudes and Behaviour Toward the Conservation of Renosterveld, a Critically Endangered Vegetation Type in Cape Floral Kingdom, South Africa

    NASA Astrophysics Data System (ADS)

    Winter, Susan J.; Prozesky, Heidi; Esler, Karen J.

    2007-07-01

    The attitudes and behaviours of private landholders toward the conservation of a highly transformed and critically endangered habitat, Overberg Coastal Renosterveld (OCR) (a grassy shrubland of the Cape Floral Region, South Africa) are described. Personal, semistructured interviews were conducted with landholders, representing 40 properties in the Overberg region, on topics such as management and utilisation of OCR, the depth of their knowledge of its conservation importance, what they perceive its value to be, and the extent of their willingness to conserve it. General attitudes toward conservation incentives and provincial conservation authorities were also investigated. Farmers more willing to conserve were younger, did not necessarily have a better education, and owned larger farms (>500 ha) with a greater amount of remnant renosterveld (>300 ha) than those less willing to conserve. Attitudes toward the OCR were largely negative, related to associated problem plants and animals and the fact that it is believed not to be economically advantageous to retain it. However, farmers are of the opinion that provision of incentives and increased extension support will provide practical positive inducements for conservation. Landholder education is paramount to prevent further transformation of critically endangered habitats. The success of private-conservation programs depends on the attitudes of landowners toward (1) the particular habitat or species to be conserved (which can vary depending on the type of land use practised and the associated benefits and disadvantages of that habitat type); (2) the conservation agency or extension officers responsible for that area; and (3) willingness of landowners to participate in a conservation program, which is influenced by landowner age, farm size, and the amount of natural habitat left to conserve.

  19. Use of sediment source fingerprinting to assess the role of subsurface erosion in the supply of fine sediment in a degraded catchment in the Eastern Cape, South Africa.

    PubMed

    Manjoro, Munyaradzi; Rowntree, Kate; Kakembo, Vincent; Foster, Ian; Collins, Adrian L

    2016-08-04

    Sediment source fingerprinting has been successfully deployed to provide information on the surface and subsurface sources of sediment in many catchments around the world. However, there is still scope to re-examine some of the major assumptions of the technique with reference to the number of fingerprint properties used in the model, the number of model iterations and the potential uncertainties of using more than one sediment core collected from the same floodplain sink. We investigated the role of subsurface erosion in the supply of fine sediment to two sediment cores collected from a floodplain in a small degraded catchment in the Eastern Cape, South Africa. The results showed that increasing the number of individual fingerprint properties in the composite signature did not improve the model goodness-of-fit. This is still a much debated issue in sediment source fingerprinting. To test the goodness-of-fit further, the number of model repeat iterations was increased from 5000 to 30,000. However, this did not reduce uncertainty ranges in modelled source proportions nor improve the model goodness-of-fit. The estimated sediment source contributions were not consistent with the available published data on erosion processes in the study catchment. The temporal pattern of sediment source contributions predicted for the two sediment cores was very different despite the cores being collected in close proximity from the same floodplain. This highlights some of the potential limitations associated with using floodplain cores to reconstruct catchment erosion processes and associated sediment source contributions. For the source tracing approach in general, the findings here suggest the need for further investigations into uncertainties related to the number of fingerprint properties included in un-mixing models. The findings support the current widespread use of ≤5000 model repeat iterations for estimating the key sources of sediment samples.

  20. Seasonal abundance and distribution of Vibrio species in the treated effluent of wastewater treatment facilities in suburban and urban communities of Eastern Cape Province, South Africa.

    PubMed

    Igbinosa, Etinosa O; Obi, Chikwelu L; Okoh, Anthony I

    2011-04-01

    We assessed the seasonal abundance and distribution of Vibrio species as well as some selected environmental parameters in the treated effluents of two wastewater treatment plants (WWTP), one each located in a suburban and urban community of Eastern Cape Province, South Africa. Vibrio population density ranged from 2.1 × 10(5) to 4.36 × 10(4) CFU/ml in the suburban community and from 2.80 × 10(5) to 1.80 × 10(5) CFU/ml in the urban community. Vibrio species associated with 180 μ, 60 μ, and 20 μ plankton sizes were observed at densities of 0-136 × 10(3) CFU/ml, 0-8.40 × 10(2) CFU/ml, and 0-6.80 × 10(2) CFU/ml, respectively at the suburban community's WWTP. In the urban community, observed densities of culturable Vibrio were 0-2.80 × 10(2) CFU/ml (180 μ), 0-6.60 × 10(2) CFU/ml (60 μm), and 0-1.80 × 10(3) CFU/ml (20 μm). The abundance of free-living Vibrio species ranged from 0 to 1.0 × 10(2) and 1.0 × 10(3) CFU/ml in the suburban and urban communities' WWTPs, respectively. Molecular confirmation of the presumptive Vibrio isolates revealed the presence of V. fluvialis (41.38%), V. vulnificus (34.48%), and V. parahaemolyticus (24.14%) in the suburban community effluents. In the urban community molecular confirmation revealed that the same species were present at slightly different percentages, V. fluvialis (40%), V. vulnificus (36%), and V. parahaemolyticus (24%). There was no significant correlation between Vibrio abundance and season, either as free-living or plankton-associated entities, but Vibrio species abundance was positively correlated with temperature (r=0.565; p<0.01), salinity, and dissolved oxygen (p<0.05). Turbidity and pH showed significant seasonal variation (p<0.05) across the seasons in both locations. This study underscores the potential of WWTPs to be sources of Vibrio pathogens in the watershed of suburban and urban communities in South Africa.

  1. Treatment Outcomes for Patients with Extensively Drug-Resistant Tuberculosis, KwaZulu-Natal and Eastern Cape Provinces, South Africa

    PubMed Central

    Cegielski, J. Peter; van der Walt, Martie L.

    2016-01-01

    We analyzed data for a retrospective cohort of patients treated for extensively drug-resistant tuberculosis in 2 provinces in South Africa and compared predictors of treatment outcome in HIV-positive patients who received or had not received antiretroviral drugs with those for HIV-negative patients. Overall, 220 (62.0%) of 355 patients were HIV positive. After 2 years, 34 (10.3%) of 330 patients with a known HIV status and known outcome had a favorable outcome. Multivariate analysis showed that predictors of favorable outcome were negative results for acid-fast bacilli by sputum microscopy at start of treatment and weight >50 kg. HIV-positive patients were more likely to have an unfavorable outcome. The strongest predictor of unfavorable outcome was weight <50 kg. Overall outcomes were poor. HIV status was not a predictor of favorable outcome, but HIV-positive patients were more likely to have an unfavorable outcome. These results underscore the need for timely and adequate treatment for tuberculosis and HIV infection. PMID:27538119

  2. The diets of ungulates from the hominid fossil-bearing site of Elandsfontein, Western Cape, South Africa

    NASA Astrophysics Data System (ADS)

    Stynder, Deano D.

    2009-01-01

    The dietary regimes of 15 ungulate species from the middle Pleistocene levels of the hominid-bearing locality of Elandsfontein, South Africa, are investigated using the mesowear technique. Previous studies, using taxonomic analogy, classified twelve of the studied species as grazers ( Redunca arundinum, Hippotragus gigas, Hippotragus leucophaeus, Antidorcas recki, Homoiceras antiquus, Damaliscus aff. lunatus, Connochaetes gnou laticornutus, Rabaticerus arambourgi, Damaliscus niro, Damaliscus sp. nov., an unnamed "spiral horn" antelope and Equus capensis), one as a mixed feeder ( Taurotragus oryx) and two as browsers ( Tragelaphus strepsiceros and Raphicerus melanotis). Although results from mesowear analysis sustain previous dietary classifications in the majority of cases, five species were reclassified. Three species previously classified as grazers, were reclassified as mixed feeders ( H. gigas, D. aff. lunatus and R. arambourgi), one previously classified as a grazer, was reclassified as a browser (the "spiral horn" antelope), and one previously classified as a mixed feeder, was reclassified as a browser ( T. oryx). While current results broadly support previous reconstructions of the Elandsfontein middle Pleistocene environment as one which included a substantial C 3 grassy component, the reclassifications suggest that trees, broad-leaved bush and fynbos were probably more prominent than what was previously thought.

  3. Seasonal changes of macroinvertebrate communities in a Western cape river, South Africa, receiving nonpoint-source insecticide pollution.

    PubMed

    Bollmohr, Silke; Schulz, Ralf

    2009-04-01

    A field study was conducted at three different sites along the Lourens River (South Africa) to assess aquatic macroinvertebrate abundances and community structures in relation to seasonal changes in rainfall and particle-associated organophosphorous (OP) insecticide contamination. Redundancy analysis indicated OP insecticide contamination (azinphos-methyl and chlorpyrifos) as the only significant variable determining the community composition. Principal response curves indicated that the invertebrate community dynamics of the Lourens River at the most-contaminated site, Lourens River 3 (38 +/- 23.0 microg total OP/ kg suspended particles), differed significantly from the less-contaminated site, Lourens River 2 (8.0 +/- 4.9 microg total OP/kg in suspended particles) during the dry season (October-December; pesticide application period), whereas no difference was found during the wet season (July-September). Ephemeroptera abundances increased significantly (p = 0.0021) at the control site, Lourens River 1, from the wet to dry season, whereas abundances significantly decreased (p = 0.0011) at Lourens River 3. Two-by-three factorial analysis of variance demonstrated a significant interaction of site and season for the three most abundant mayfly taxa, Baetis sp., Demoreptus sp., and Castanophlebia sp., confirming a possible OP effect. Lourens River 3, however, differed significantly from the other two sites in flow, ortho-phosphate, and algae growth, which may partly explain the lower abundance of sensitive species. Apart from the OP contamination, only flow velocities showed significant differences between the wet and dry season at some sites. In conclusion, the present study suggests that particle-associated OPs affected community structure in the Lourens River at levels greater than 30 microg total OP/kg, whereas levels less then 10 microg total OP/kg yielded no significant effects.

  4. The impact of patient demographics and comorbidities upon burns admitted to Tygerberg Hospital Burns Unit, Western Cape, South Africa.

    PubMed

    Cloake, T; Haigh, T; Cheshire, J; Walker, D

    2017-03-01

    In South Africa, burns are a major public health problem responsible for significant morbidity and long-term physical disability. This is, in part, due to a significant proportion of the urban population living in poorly constructed, combustible accommodation. The presence of co-morbid diseases such as diabetes and malignancy in patients with burns has been associated with a poorer outcome. The impact of other diseases such as HIV has yet to be defined. A retrospective data collection study analysed the 221 patients admitted to Tygerberg Hospital Burns Unit in 2011 and the first six months of 2013. Using hospital records, patient demographic data was collected alongside burn agent, ICU admission, complications, and patient outcome in terms of length of stay and mortality. The most common burn agent was hot liquid (45.7%). A significant proportion of patients were subject to intentional attacks (34.3%). Shack fires and flame accounted cumulatively for 85% of total inhalational burns, the highest rates of admission to ICU (85.5%), the highest rate of complications, as well as 92.3% of all total fatalities. HIV+ patients had a higher mortality (13.3% vs 5%, p=0.22) and a higher complication rate (46.7% vs 30%, p=0.21). There was no difference in length of stay between the HIV+ and HIV- cohort (12days vs. 15.5 days, p=0.916). Burns are a significant yet preventable cause of mortality and morbidity. The rising number of shack fires, responsible for extensive burns and resultant mortality is concerning and indicates urgent attention and action. HIV complicates the recovery from burn and is responsible for an increased rate of in hospital mortality.

  5. “It is always HIV/AIDS and TB”: Home-based carers’ perspectives on epilepsy in Cape Town, South Africa

    PubMed Central

    Keikelame, Mpoe Johannah; Swartz, Leslie

    2016-01-01

    The study highlights the complex cultural religious factors affecting epilepsy and a need for integrated home-based care services. Two focus group discussions exploring home-based carers’ (HBCs) perspectives on epilepsy were conducted using a semi-structured focus group interview guide, which was based on Kleinman's explanatory model framework. The audio-recorded data were transcribed verbatim, and a thematic analysis was done. The three main themes were epilepsy names and metaphors, religious beliefs about the cause and treatment of epilepsy, and HBCs’ perceived roles and strategies for engaging in epilepsy care. Findings provide some insights for research, policy, and practice. PMID:27258583

  6. EPA Cape Cod 208 Plan 2015 Update Approval Letter

    EPA Pesticide Factsheets

    EPA approval letter re: certification by the Governor of MA that the Cape Cod WQM Plan Update is consistent with CWA section 208(b)(3) & accepted the Commonwealth’s reaffirmation of the existing designations of Cape Cod Towns as waste management agencies.

  7. A subregional analysis of epidemiologic and genetic characteristics of influenza A(H1N1)pdm09 in Africa: Senegal, Cape Verde, Mauritania, and Guinea, 2009-2010.

    PubMed

    Dia, Ndongo; Ndiaye, Mbayame Niang; Monteiro, Maria de Lourdes; Koivogui, Lamine; Bara, Mohamed Ould; Diop, Ousmane M

    2013-05-01

    During the pandemic 2009 episode, we conducted laboratory-based surveillance in four countries from West Africa: Senegal, Mauritania, Cape Verde, and Guinea. Specimens were obtained from 3,155 patients: 2,264 patients from Senegal, 498 patients from Cape Verde, 227 patients from Mauritania, and 166 patients from Guinea; 911 (28.9%) patients were positive for influenza, 826 (90.7%) patients were positive for influenza A, and 85 (9.3%) patients were positive for influenza B. Among the influenza A positives, 503 (60.9%) positives were H1N1pdm09, 314 (38.0%) positives were H3N2, and 9 (1.1%) positives were seasonal H1N1. The highest detection rate for seasonal influenza viruses (17.1%) occurred in the 5-14 years age group. However, for A(H1N1)pdm09, the detection rate was highest in the 15-24 years age group (35.8%). Based on the present study data, the timeline of detection of A(H1N1)pdm09 viruses in these four countries should be Cape Verde, Guinea, Mauritania, and finally, Senegal. Genetic and antigenic analyses were performed in some isolates.

  8. Mapping SLCO1B1 Genetic Variation for Global Precision Medicine in Understudied Regions in Africa: A Focus on Zulu and Cape Admixed Populations.

    PubMed

    Hoosain, Nisreen; Pearce, Brendon; Jacobs, Clifford; Benjeddou, Mongi

    2016-09-01

    The U.S. President Barack Obama has announced, in his State of the Union address on January 20, 2015, the Precision Medicine Initiative, a US$215-million program. For global precision medicine to become a reality, however, biological and environmental "variome" in previously understudied populations ought to be mapped and catalogued. Chief among the molecular targets that warrant global mapping is the organic anion-transporting polypeptide 1B1 (OATP1B1), encoded by solute carrier organic anion transporter family member 1B1 (SLCO1B1), a hepatic uptake transporter predominantly expressed in the basolateral side of hepatocytes. Human OATP1B1 plays a crucial role in the transport of a wide variety of substrates. This includes endogenous compounds such as bile salts as well as medicines, including benzylpenicillin, methotrexate, pravastatin, and rifampicin, and natural toxins microcystin and phalloidin. Genetic variations observed in the SLCO1B1 gene have been associated with altered in vitro and in vivo OATP1B1 transport activity, and consequently influencing patients' response to medicines, toxins, and susceptibility to common complex diseases. Well-characterized haplotypes, *5 (RS4149056C) and *15 (RS4149056T), have been associated with a strikingly reduced uptake of multiple OATP1B1 substrates, including estrone-3-sulfate, estradiol-17β-d-glucuronide, atorvastatin, cerivastatin, pravastatin, and rifampicin. In particular, RS4149056C is observed in 60% of the Cape admixed (CA) population and is associated with increased plasma concentrations of many statins as well as fexofenadine and repaglinide. We designed and optimized a SNaPshot minisequencing panel to characterize the variants of relevance for precision medicine in the clinic. We report here the first study on allele and genotype frequencies for 10 nonsynonymous, 4 synonymous, and 6 intronic single-nucleotide polymorphisms of SLCO1B1 in the Zulu and CA populations of South Africa. These variants are further

  9. Africa.

    ERIC Educational Resources Information Center

    Martz, Carlton

    2001-01-01

    This publication explores issues related to Africa. It examines the U.S. response to the Barbary pirate states (Morocco, Algiers, Tunis, Tripoli) in the early 19th century; the current AIDS crisis in Africa; and 14th century Mali and other Islamic lands through the eyes of Ibn Battuta, who traveled throughout the Muslim world. Each article…

  10. Africa.

    ERIC Educational Resources Information Center

    Happel, Sue; Loeb, Joyce

    Although the activities in this unit are designed primarily for students in the intermediate grades, the document's text, illustrations, and bibliographic references are suitable for anyone interested in learning about Africa. Following a brief introduction and map work, the document is arranged into six sections. Section 1 traces Africa's history…

  11. The unsuspected killer: Liquefied petroleum gas overexposure in South Africa.

    PubMed

    Sampson, L W J; van der Schyff, N; Cupido, C

    2014-12-14

    A 21-year-old woman with no past medical history of note was found unconscious together with five of her family members after prolonged exposure to liquefied petroleum gas. She was admitted to the intensive care unit at Victoria Hospital, Wynberg, Cape Town, South Africa, following resuscitation for pulseless electrical activity. On examination the following was found: coma without focal neurology; shock requiring fluid resuscitation and adrenaline; probable pneumonitis or aspiration pneumonia; acute rhabdomyolysis with severe metabolic acidosis; and raised serum K+. A carboxyhaemoglobin test was unable to confirm or exclude carbon monoxide poisoning.

  12. NeuroAIDS in Africa.

    PubMed

    Robertson, Kevin; Liner, Jeff; Hakim, James; Sankalé, Jean-Louis; Grant, Igor; Letendre, Scott; Clifford, David; Diop, Amadou Gallo; Jaye, Assan; Kanmogne, Georgette; Njamnshi, Alfred; Langford, T Dianne; Weyessa, Tufa Gemechu; Wood, Charles; Banda, Mwanza; Hosseinipour, Mina; Sacktor, Ned; Nakasuja, Noeline; Bangirana, Paul; Paul, Robert; Joska, John; Wong, Joseph; Boivin, Michael; Holding, Penny; Kammerer, Betsy; Van Rie, Annelies; Ive, Prudence; Nath, Avindra; Lawler, Kathy; Adebamowo, Clement; Royal, Walter; Joseph, Jeymohan

    2010-05-01

    In July 2009, the Center for Mental Health Research on AIDS at the National Institute of Mental Health organized and supported the meeting "NeuroAIDS in Africa." This meeting was held in Cape Town, South Africa, and was affiliated with the 5th IAS Conference on HIV Pathogenesis, Treatment and Prevention. Presentations began with an overview of the epidemiology of HIV in sub-Saharan Africa, the molecular epidemiology of HIV, HIV-associated neurocognitive disorders (HANDs), and HAND treatment. These introductory talks were followed by presentations on HAND research and clinical care in Botswana, Cameroon, Ethiopia, The Gambia, Kenya, Malawi, Nigeria, Senegal, South Africa, Uganda, and Zambia. Topics discussed included best practices for assessing neurocognitive disorders, patterns of central nervous system (CNS) involvement in the region, subtype-associated risk for HAND, pediatric HIV assessments and neurodevelopment, HIV-associated CNS opportunistic infections and immune reconstitution syndrome, the evolving changes in treatment implementation, and various opportunities and strategies for NeuroAIDS research and capacity building in the region.

  13. In Brief: New atlas of Africa

    NASA Astrophysics Data System (ADS)

    Showstack, Randy

    2008-07-01

    A newly revised atlas of Africa features more than 300 satellite images that show striking before and after photographs of environmental changes spanning about 35 years. Africa: Atlas of Our Changing Environment, compiled by the United Nations Environment Programme (UNEP), provides visual evidence of how development choices, population growth, climate change, and, in some cases, conflicts affect Africa, often negatively. The book includes photographs of shrinking glaciers on Mount Kilimanjaro as well as on Uganda's Rwenzori Mountains; deforestation along an expanding road system in the Congo; the drying up of Lake Chad; and the expansion of urban areas such as Cape Town, South Africa, and Dakar, Senegal. Satellite images also indicate some positive signs of environmental management, including action to stop overgrazing in a Tunisian national park, the effects of a management plan for a dam in Zambia that has helped restore seasonal flooding, and positive impacts of wetlands expansion around a national park in Mauritania. For more information, visit http://www.unep.org/dewa/africa/AfricaAtlas.

  14. Cape Verde

    NASA Technical Reports Server (NTRS)

    2007-01-01

    This Mars Exploration Rover Opportunity Pancam 'super resolution' mosaic of the approximately 6 m (20 foot) high cliff face of the Cape Verde promontory was taken by the rover from inside Victoria Crater, during the rover's descent into Duck Bay. Super-resolution is an imaging technique which utilizes information from multiple pictures of the same target in order to generate an image with a higher resolution than any of the individual images. Cape Verde is a geologically rich outcrop and is teaching scientists about how rocks at Victoria crater were modified since they were deposited long ago. This image complements super resolution mosaics obtained at Cape St. Mary and Cape St. Vincent and is consistent with the hypothesis that Victoria crater is located in the middle of what used to be an ancient sand dune field. Many rover team scientists are hoping to be able to eventually drive the rover closer to these layered rocks in the hopes of measuring their chemistry and mineralogy.

    This is a Mars Exploration Rover Opportunity Panoramic Camera image mosaic acquired on sols 1342 and 1356 (November 2 and 17, 2007), and was constructed from a mathematical combination of 64 different blue filter (480 nm) images.

  15. South Africa as seen from STS-63 Discovery

    NASA Technical Reports Server (NTRS)

    1995-01-01

    The southwest coast of southern Africa from St. Helena Bay (large bay at center), to Table Bay at Cape Town (bottom, with Robben Island near entrance). The pier at the naval base and fishing port of Saldhanaha Bay can be seen in the small bay (center). False Bay is cut off by the bottom edge of the frame. What NASA scientists think to be a phytoplankton bloom appears offshore in the cold upwelled water off the Atlantic coast. Farmland, especially that used for wine growing, is found near the coast occupying the Mediterranian-like climate of the Southwest Cape Province; but inland of the mountains of the Karroo Desert is home to sheep farmers and little agriculture.

  16. "It's Not Their Job to Share Content": A Case Study of the Role of Senior Students in Adapting Teaching Materials as Open Educational Resources at the University of Cape Town

    ERIC Educational Resources Information Center

    Hodgkinson-Williams, Cheryl; Paskevicius, Michael

    2013-01-01

    Inspired by the Massachusetts Institute of Technology's landmark decision to make its teaching and learning materials freely available to the public as OpenCourseWare (OCW), many other higher education institutions have followed suit sharing resources now more generally referred to as Open Educational Resources (OER). The University of Cape Town…

  17. Terrorism in South Africa.

    PubMed

    MacFarlane, Campbell

    2003-01-01

    The Republic of South Africa lies at the southern tip of the African continent. The population encompasses a variety of races, ethnic groups, religions, and cultural identities. The country has had a turbulent history from early tribal conflicts, colonialisation, the apartheid period, and post-apartheid readjustment. Modern terrorism developed mainly during the apartheid period, both by activities of the state and by the liberation movements that continued to the time of the first democratic elections in 1994, which saw South Africa evolve into a fully representative democratic state with equal rights for all. Since 1994, terrorist acts have been criminal-based, evolving in the Cape Town area to political acts, largely laid at the feet of a predominantly Muslim organisation, People against Gangsterism and Drugs, a vigilant organisation allegedly infiltrated by Muslim fundamentalists. Along with this, has been terrorist activities, mainly bombings by disaffected members of white, right-wing groups. In the apartheid era, a Draconian series of laws was enacted to suppress liberation activities. After 1994, most of these were repealed and new legislation was enacted, particularly after the events of 11 September 2001; this legislation allows the government to act against terrorism within the constraints of a democratic system. Disaster management in South Africa has been largely local authority-based, with input from provincial authorities and Civil Defence. After 1994, attempts were made to improve this situation, and national direction was provided. After 11 September 2001, activity was increased and the Disaster Management Act 2002 was brought into effect. This standardized disaster management system at national, provincial, and local levels, also facilites risk assessment and limitation as well as disaster mitigation. The potential still exists for terrorism, mainly from right-wing and Muslim fundamentalist groups, but the new legislation should stimulate disaster

  18. Cape of Storms or Cape of Good Hope? Educational Technology in a Changing Environment

    ERIC Educational Resources Information Center

    Czerniewicz, Laura

    2004-01-01

    This article locates and describes the work of the Multimedia Education Group (MEG) at the University of Cape Town (UCT). This work is contextualised by three national and international challenges, these being (1) the need to increase access to new technologies and overcome the digital divide, (2) the need to respond to a new communication order,…

  19. Phylogenetic relatedness limits co-occurrence at fine spatial scales: evidence from the schoenoid sedges (Cyperaceae: Schoeneae) of the Cape Floristic Region, South Africa.

    PubMed

    Slingsby, Jasper A; Verboom, G Anthony

    2006-07-01

    Species co-occurrence at fine spatial scales is expected to be nonrandom with respect to phylogeny because of the joint effects of evolutionary (trait convergence and conservatism) and ecological (competitive exclusion and habitat filtering) processes. We use data from 11 existing vegetation surveys to test whether co-occurrence in schoenoid sedge assemblages in the Cape Floristic Region shows significant phylogenetic structuring and to examine whether this changes with the phylogenetic scale of the analysis. We provide evidence for phylogenetic overdispersion in an alliance of closely related species (the reticulate-sheathed Tetraria clade) using both quantile regression analysis and a comparison between the mean observed and expected phylogenetic distances between co-occurring species. Similar patterns are not evident when the analyses are performed at a broader phylogenetic scale. Examination of six functional traits suggests a general pattern of trait conservatism within the reticulate-sheathed Tetraria clade, suggesting a potential role for interspecific competition in structuring co-occurrence within this group. We suggest that phylogenetic overdispersion of communities may be common throughout many of the Cape lineages, since interspecific interactions are likely intensified in lineages with large numbers of species restricted to a small geographic area, and we discuss the potential implications for patterns of diversity in the Cape.

  20. Amateur Optical Tracking in South Africa During 1957-2014. Part 4

    NASA Astrophysics Data System (ADS)

    Roberts, Greg

    2014-08-01

    This article covers the activities of the Cape Town MOONWATCH team that was situated in the grounds of the then Royal Observatory at the Cape (later the South African Astronomical Observatory) and operated from 1957 to about 1968.

  1. Terrace Town

    ERIC Educational Resources Information Center

    Sabin, Heather

    2010-01-01

    The "Terrace Town" program brings architecture and city planning curriculum to elementary schools in Madison, Wisconsin, and surrounding areas. Over eight weeks, classrooms discuss what makes a community livable, sustainable, and kid-friendly. Throughout the process, students gain a better understanding of their own city environments and…

  2. Our Town

    ERIC Educational Resources Information Center

    Robinson, Amanda

    2015-01-01

    This article outlines an issue-based lesson for a physical science course in which students investigate potential alternative energy sources for Alternatown, a fictitious city. Students are randomly selected to serve as town council members or as representatives of different alternative energy source options put before the council. The…

  3. Beak and feather disease virus: correlation between viral load and clinical signs in wild Cape parrots (Poicepahlus robustus) in South Africa.

    PubMed

    Regnard, Guy L; Boyes, Rutledge S; Martin, Rowan O; Hitzeroth, Inga I; Rybicki, Edward P

    2015-01-01

    Psittacine beak and feather disease (PBFD), the most prevalent viral disease affecting psittacines, is caused by beak and feather disease virus (BFDV). This study assessed viral load using qPCR in a wild Cape parrot population affected by PBFD and compared it to overall physical condition based on clinical signs attributable to PBFD. A significant inverse correlation between viral load and overall physical condition was found, which confirmed that clinical signs may confidently be used to diagnose the relative severity of BFDV infections in wild populations. This is the first assessment of BFDV viral load in a wild psittacine population.

  4. The 'medical humanities' in health sciences education in South Africa.

    PubMed

    Reid, S

    2014-02-01

    A new masters-level course, 'Medicine and the Arts" will be offered in 2014 at the University of Cape Town, setting a precedent for interdisciplinary education in the field of medical humanities in South Africa. The humanities and social sciences have always been an implicit part of undergraduate and postgraduate education in the health sciences, but increasingly they are becoming an explicit and essential component of the curriculum, as the importance of graduate attributes and outcomes in the workplace is acknowledged. Traditionally, the medical humanities have included medical ethics, history, literature and anthropology. Less prominent in the literature has been the engagement with medicine of the disciplines of sociology, politics, philosophy, linguistics, education, and law, as well as the creative and expressive arts. The development of the medical humanities in education and research in South Africa is set to expand over the next few years, and it looks as if it will be an exciting inter-disciplinary journey.

  5. John Herschel and the Cape flora, 1834 - 1839.

    NASA Astrophysics Data System (ADS)

    Rourke, J. P.

    John Herschel's interest in botany was stimulated by his contact with the species-rich Cape flora while resident in Cape Town, 1834 - 1838. The comparative study of his extensive living collection of bulbous plants, mainly of the Iridaceae, Liliaceae, Amarayllidaceae and Orchidaceae led him to consider some basic aspects of the origin of species and of taxonomic theory, in letters to colleagues in Europe.

  6. Strontium isotope investigation of ungulate movement patterns on the Pleistocene Paleo-Agulhas Plain of the Greater Cape Floristic Region, South Africa

    SciTech Connect

    Copeland, Sandi R.; Cawthra, Hayley C.; Fisher, Erich C.; Lee-Thorp, Julia A.; Cowling, Richard M.; le Roux, Petrus J.; Hodgkins, Jamie; Marean, Curtis W.

    2016-04-16

    Middle Stone Age sites located within the Greater Cape Floristic Region on the South African southern coast have material culture with early evidence for key modern human behaviors such as projectile weaponry, large animal hunting, and symbolic behavior. In order to interpret how and why these changes evolved, it is necessary to understand their ecological context as it has direct relevance to foraging behavior. During periods of lowered sea level, a largely flat and vast expanse of land existed south of the modern coastline, but it is now submerged by higher sea levels. This exposed area, the Paleo-Agulhas Plain, likely created an ecological context unlike anything in the region today, as evidenced by fossil assemblages dominated by migratory ungulates. One hypothesis is that the Paleo-Agulhas Plain supported a migration ecosystem of large grazers driven by summer rainfall, producing palatable forage during summer in the east, and winter rainfall, producing palatable forage during winter in the west. Furthermore, ungulates may have been moving from the coastal plain in the south to the interior north of the Cape Fold Mountains, as observed for elephants in historic times.

  7. Strontium isotope investigation of ungulate movement patterns on the Pleistocene Paleo-Agulhas Plain of the Greater Cape Floristic Region, South Africa

    DOE PAGES

    Copeland, Sandi R.; Cawthra, Hayley C.; Fisher, Erich C.; ...

    2016-04-16

    Middle Stone Age sites located within the Greater Cape Floristic Region on the South African southern coast have material culture with early evidence for key modern human behaviors such as projectile weaponry, large animal hunting, and symbolic behavior. In order to interpret how and why these changes evolved, it is necessary to understand their ecological context as it has direct relevance to foraging behavior. During periods of lowered sea level, a largely flat and vast expanse of land existed south of the modern coastline, but it is now submerged by higher sea levels. This exposed area, the Paleo-Agulhas Plain, likelymore » created an ecological context unlike anything in the region today, as evidenced by fossil assemblages dominated by migratory ungulates. One hypothesis is that the Paleo-Agulhas Plain supported a migration ecosystem of large grazers driven by summer rainfall, producing palatable forage during summer in the east, and winter rainfall, producing palatable forage during winter in the west. Furthermore, ungulates may have been moving from the coastal plain in the south to the interior north of the Cape Fold Mountains, as observed for elephants in historic times.« less

  8. 77 FR 29929 - Safety Zone; Town of Cape Charles Fireworks, Cape Charles Harbor, Cape Charles, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-21

    ... stamped, self-addressed postcard or envelope. We will consider all comments and material received during... falling hot embers or other debris, vessel traffic will be temporarily restricted within 420 feet of...

  9. Description of adult and third instar larva of Trichostetha curlei sp. n. (Coleoptera, Scarabaeidae, Cetoniinae) from the Cape region of South Africa

    PubMed Central

    Perissinotto, Renzo; Šípek, Petr; Ball, Jonathan B.

    2014-01-01

    Abstract A new high altitude montane species of Trichostetha Burmeister, 1842 is described from the Elandsberg range of the Western Cape interior. This represents the 14th species of the genus and the first to be reported with a description of its larva. It is a significant addition to the growing number of species that exhibit no adult feeding behaviour and a short period of activity restricted to the onset of summer. Larvae dwell in rock crevices, feeding on decomposing plant matter. The genus Trichostetha is heterogeneous and the complex variability observed in some species, especially T. capensis (Linnaeus, 1767), requires the re-instatement of taxa that were recently synonymised. Thus, T. bicolor Péringuey, 1907 is here re-proposed as a separate species and T. capensis hottentotta (Gory & Percheron, 1833) as a separate subspecies. Conversely, T. alutacea Allard, 1994 is recognised as a dark variety of T. signata (Fabricius, 1775) and is, consequently, synonymised with this species. PMID:25161367

  10. Techno-Cultural Characterization of the MIS 5 (c. 105 - 90 Ka) Lithic Industries at Blombos Cave, Southern Cape, South Africa.

    PubMed

    Douze, Katja; Wurz, Sarah; Henshilwood, Christopher Stuart

    2015-01-01

    Blombos Cave is well known as an important site for understanding the evolution of symbolically mediated behaviours among Homo sapiens during the Middle Stone Age, and during the Still Bay in particular. The lower part of the archaeological sequence (M3 phase) contains 12 layers dating to MIS 5 with ages ranging from 105 to 90 ka ago (MIS 5c to 5b) that provide new perspectives on the technological behaviour of these early humans. The new data obtained from our extensive technological analysis of the lithic material enriches our currently limited knowledge of this time period in the Cape region. By comparing our results with previously described lithic assemblages from sites south of the Orange River, we draw new insights on the extent of the techno-cultural ties between these sites and the M3 phase at Blombos Cave and highlight the importance of this phase within the Middle Stone Age cultural stratigraphy.

  11. Techno-Cultural Characterization of the MIS 5 (c. 105 – 90 Ka) Lithic Industries at Blombos Cave, Southern Cape, South Africa

    PubMed Central

    Douze, Katja; Wurz, Sarah; Henshilwood, Christopher Stuart

    2015-01-01

    Blombos Cave is well known as an important site for understanding the evolution of symbolically mediated behaviours among Homo sapiens during the Middle Stone Age, and during the Still Bay in particular. The lower part of the archaeological sequence (M3 phase) contains 12 layers dating to MIS 5 with ages ranging from 105 to 90 ka ago (MIS 5c to 5b) that provide new perspectives on the technological behaviour of these early humans. The new data obtained from our extensive technological analysis of the lithic material enriches our currently limited knowledge of this time period in the Cape region. By comparing our results with previously described lithic assemblages from sites south of the Orange River, we draw new insights on the extent of the techno-cultural ties between these sites and the M3 phase at Blombos Cave and highlight the importance of this phase within the Middle Stone Age cultural stratigraphy. PMID:26580219

  12. Strontium isotope investigation of ungulate movement patterns on the Pleistocene Paleo-Agulhas Plain of the Greater Cape Floristic Region, South Africa

    NASA Astrophysics Data System (ADS)

    Copeland, Sandi R.; Cawthra, Hayley C.; Fisher, Erich C.; Lee-Thorp, Julia A.; Cowling, Richard M.; le Roux, Petrus J.; Hodgkins, Jamie; Marean, Curtis W.

    2016-06-01

    Middle Stone Age sites located within the Greater Cape Floristic Region on the South African southern coast have material culture with early evidence for key modern human behaviors such as projectile weaponry, large animal hunting, and symbolic behavior. In order to interpret how and why these changes evolved, it is necessary to understand their ecological context as it has direct relevance to foraging behavior. During periods of lowered sea level, a largely flat and vast expanse of land existed south of the modern coastline, but it is now submerged by higher sea levels. This exposed area, the Paleo-Agulhas Plain, likely created an ecological context unlike anything in the region today, as evidenced by fossil assemblages dominated by migratory ungulates. One hypothesis is that the Paleo-Agulhas Plain supported a migration ecosystem of large grazers driven by summer rainfall, producing palatable forage during summer in the east, and winter rainfall, producing palatable forage during winter in the west. Alternatively, ungulates may have been moving from the coastal plain in the south to the interior north of the Cape Fold Mountains, as observed for elephants in historic times. In this study, we assess ungulate movement patterns with inter- and intra-tooth enamel samples for strontium isotopes in fossil fauna from Pinnacle Point sites PP13B and PP30. To accomplish our goals we created a bioavailable 87Sr/86Sr isoscape for the region by collecting plants at 171 sampling sites and developing a geospatial model. The strontium isotope results indicate that ungulates spent most of their time on the Paleo-Agulhas Plain and avoided dissected plain, foothill, and mountain habitats located more than about 15 km north of the modern coastline. The results clearly exclude a north-south (coastal-interior) movement or migration pattern, and cannot falsify the east-west movements hypothesized in the south coast migration ecosystem hypothesis.

  13. Prevalence and predictors of problematic alcohol use, risky sexual practices and other negative consequences associated with alcohol use among safety and security employees in the Western Cape, South Africa

    PubMed Central

    2014-01-01

    Introduction Harmful alcohol use can compromise worker health and productivity. Persons employed in safety-sensitive occupations are particularly vulnerable to hazardous alcohol use and its associated risks. This study describes the patterns of harmful alcohol use, related HIV risks and risk factors for the harmful use of alcohol among a sample of employees in South Africa working in the safety and security sector. Methods A cross-sectional study that formed the baseline for a clustered randomized control trial was undertaken in 2011. A random sample of 325 employees employed within a safety and security sector of a local municipality in the Western Cape Province of South Africa participated in the study. Data were collected by means of an 18-page self-administered structured questionnaire and analyzed using SAS/STAT software version 9.2. For all significance testing, the F-statistic and p-values are reported. Results Three hundred and twenty-five employees were surveyed. Findings suggest that more than half (76.1%) of the 78.9% of participants who consumed alcohol engaged in binge drinking, with close to a quarter reporting a CAGE score greater than the cut-off of 2, indicating potentially hazardous drinking patterns. The study further found that employees who use alcohol are more likely to engage in risky sexual practices when under the influence. A favorable drinking climate (p < 0.001) and poor levels of group cohesion (p = 0.009) were significantly correlated to binge drinking. Conclusion This study identifies alcohol-related behaviors and associated risks in the context of safety-sensitive occupations at the workplace. It suggests that persons employed within such positions are at high risk for developing alcohol-related disorders and for contracting HIV. This study highlights the need for testing a comprehensive package of services designed to prevent hazardous alcohol use among safety and security employees. PMID:24593946

  14. Towards Developing an Initial Programme Theory: Programme Designers and Managers Assumptions on the Antiretroviral Treatment Adherence Club Programme in Primary Health Care Facilities in the Metropolitan Area of Western Cape Province, South Africa

    PubMed Central

    Mukumbang, Ferdinand C.; van Belle, Sara; Marchal, Bruno; van Wyk, Brian

    2016-01-01

    Background The antiretroviral adherence club intervention was rolled out in primary health care facilities in the Western Cape province of South Africa to relieve clinic congestion, and improve retention in care, and treatment adherence in the face of growing patient loads. We adopted the realist evaluation approach to evaluate what aspects of antiretroviral club intervention works, for what sections of the patient population, and under which community and health systems contexts, to inform guidelines for scaling up of the intervention. In this article, we report on a step towards the development of a programme theory—the assumptions of programme designers and health service managers with regard to how and why the adherence club intervention is expected to achieve its goals and perceptions on how it has done so (or not). Methods We adopted an exploratory qualitative research design. We conducted a document review of 12 documents on the design and implementation of the adherence club intervention, and key informant interviews with 12 purposively selected programme designers and managers. Thematic content analysis was used to identify themes attributed to the programme actors, context, mechanisms, and outcomes. Using the context-mechanism-outcome configurational tool, we provided an explanatory focus of how the adherence club intervention is roll-out and works guided by the realist perspective. Results We classified the assumptions of the adherence club designers and managers into the rollout, implementation, and utilisation of the adherence club programme, constructed around the providers, management/operational staff, and patients, respectively. Two rival theories were identified at the patient-perspective level. We used these perspectives to develop an initial programme theory of the adherence club intervention, which will be tested in a later phase. Conclusion The perspectives of the programme designers and managers provided an important step towards developing

  15. Influence of physico-chemistry and mineralogy on the occurrence of geohelminths in geophagic soils from selected communities in the Eastern Cape, South Africa, and their possible implication on human health.

    PubMed

    Sumbele, Irene U; Ngole, Veronica Mpode; Ekosse, Georges-Ivo E

    2014-01-01

    Geophagic soils from selected communities in Eastern Cape, South Africa were characterised to determine their properties and geohelminth content. The soils were coarse-textured with cation exchange capacity values ranging from 6.35 to 18.94 cmol (+)/kg. Quartz was the dominant mineral in the samples with SiO2, Al2O3, and Fe2O3(t) having the highest concentrations among major element oxides. The soil properties, mineralogical composition, and low amounts of particle binding substances may favour the survival of geohelminth ova in the soils. Seven of the samples contained at least one of the following geohelminths: Ascaris lumbricoides, Trichuris trichiura, Necator americanus, Ancylostoma duodenale and Strongyloides stercoralis. The presence of these geohelminths in the soils was attributed to agricultural and sanitary practices inherent in the communities and the soil properties. Communities need to be sensitised on the importance of safe sanitary and animal husbandry practices to reduce the prevalence of helminth infection among geophagists.

  16. Multidimensional GIS modeling of magnetic mineralogy as a proxy for fire use and spatial patterning: evidence from the Middle Stone Age bearing sea cave of Pinnacle Point 13B (Western Cape, South Africa).

    PubMed

    Herries, Andy I R; Fisher, Erich C

    2010-01-01

    This paper aims to identify the spatial patterning of burning and occupation within an early Middle Stone Age (MSA) sea cave in the Western Cape Province of South Africa by creating a multidimensional model of archaeomagnetic data recovered from all excavated units. Magnetic susceptibility and other mineral magnetic parameters are shown to provide an excellent proxy for the anthropogenic alteration and spread of burnt material into the surrounding unaltered cave deposits. The identification of combustion features and areas of occupation or different activities within the site can be determined because the movement of people throughout the cave mixes magnetically strong hearth material with magnetically weak unaltered sediments. This is also indicated by micromorphological analysis. The degree of enhancement is also shown to indicate the extent to which a deposit has been altered, and therefore, intensity of occupation, because multiple heatings of deposits are needed to form the concentrations of iron minerals occurring in some layers. This is further supported by a comparison with artifact density for the layers. Variation in the magnetic values between different areas of the site is noted with major occupation or fire building occurring in the front of the cave during earlier MIS 6 periods, while during later MIS 5 periods the entire cave is occupied intensively. The oldest, MIS 11 deposits at the rear of the cave indicate no evidence of enhancement and an apparent absence of any anthropogenic signature.

  17. The structure of planktonic communities under variable coastal upwelling conditions off Cape Ghir (31°N) in the Canary Current System (NW Africa)

    NASA Astrophysics Data System (ADS)

    Anabalón, V.; Arístegui, J.; Morales, C. E.; Andrade, I.; Benavides, M.; Correa-Ramírez, M. A.; Espino, M.; Ettahiri, O.; Hormazabal, S.; Makaoui, A.; Montero, M. F.; Orbi, A.

    2014-01-01

    Cape Ghir (∼31°N), in the Canary Current System, is an area of permanent coastal upwelling with maximum intensity in summer-autumn, when a strong across-shore thermal gradient and increased mesoscale activity are present. The effects of spatial (cross-shore transect with 7 stations) and temporal (5 dates: from December 2008 to October 2009) variations in upwelling conditions on the structure of planktonic communities (functional groups, size and taxa composition, abundance and carbon biomass) were investigated. Multivariate analysis of the environmental variables enabled both spatial separation of the stations, based primarily on differences in nutrient concentration, and a temporal distinction of upwelling phases, based mostly on differences in sea surface temperature and number of days favourable to upwelling. These clusters were also representative of the time-space variability in the planktonic communities, suggesting that upwelling conditions directly influence their structure. For most of the cruises, the microplankton (mainly diatoms and auto/mixotrophic dinoflagellates) made the highest contributions to photoautotrophic carbon (C) biomass but the nanoplankton (mainly flagellates and dinoflagellates) made the largest contributions to total chlorophyll-a (Chl-a). Mean heterotrophic:autotrophic biomass ratios (from pico-to microplankton during three cruises) were mostly ⩽1 (normal pyramid), as expected for productive coastal areas, only when the contribution of mixotrophy was considered. A mixed composition of functional groups of autotrophs/mixotrophs in the coastal and coastal transition zones off C. Ghir is probably the result of the nutrient contents in the upwelled waters since potential silicate or nitrate limitation together with a relatively high C:Chl-a in the micro-phytoplankton were detected during some of the cruises. Temporal changes in diatom taxa with different nutrient requirements also suggested a strong influence of nutrients. The

  18. Racial differences in seroprevalence of HAV and HEV in blood donors in the Western Cape, South Africa: a clue to the predominant HEV genotype?

    PubMed

    Lopes, T; Cable, R; Pistorius, C; Maponga, T; Ijaz, S; Preiser, W; Tedder, R; Andersson, M I

    2017-03-30

    Hepatitis E virus (HEV) infection is a major cause of acute hepatitis worldwide. This infection causes major water-borne outbreaks in low- and middle-income countries, whilst in industrialised countries this infection is zoonotic. These differences in epidemiology are related to different HEV genotypes. HEV genotype 3 is a zoonotic infection, whilst genotype 2 causes large outbreaks. This study determined the seroprevalence of HEV in blood donors from the Western Cape. Anti-hepatitis A virus (anti-HAV) antibody was detected in 184/300 (61%) donors. Antibody to HEV (anti-HEV) was detected in 78 of 300 donors (26%). It was highest in mixed race donors (62/100), followed by white donors (23/100) and lowest in black donors (19/100) P = 0.019. Since it is thought that genotypes 1 and 2 predominate both viruses would be acquired by the oro-faecal route, it is surprising that HEV seroprevalence does not mirror that of HAV. We postulate that this may reflect differences in socio-economic status and consumption of dietary meat. So the marked divergence between HEV and HAV seroprevalence may be the result of different routes of transmission. Further data are needed to explore the risk factors associated with HEV infection.

  19. Using Remote Sensing and GIS Techniques to Detect Changes to the Prince Alfred Hamlet Conservation Area in the Western Cape, South Africa

    NASA Astrophysics Data System (ADS)

    Duncan, P.; Lewarne, M.

    2016-06-01

    Understanding and identifying the spatial-temporal changes in the natural environment is crucial for monitoring and evaluating conservation efforts, as well as understanding the impact of human activities on natural resources, informing responsible land management, and promoting better decision-making. Conservation areas are often under pressure from expanding farming and related industry, invasive alien vegetation, and an ever-increasing human settlement footprint. This study focuses on detecting changes to the Prince Alfred Hamlet commonage, near Ceres in the Cape Floral Kingdom. It was chosen for its high conservation value and significance as a critical water source area. The study area includes a fast-growing human settlement footprint in a highly productive farming landscape. There are conflicting development needs as well as risks to agricultural production, and both of these threaten the integrity of the ecosystems which supply underlying services to both demands on the land. Using a multi-disciplinary approach and high-resolution satellite imagery, land use and land cover changes can be detected and classified, and the results used to support the conservation of biodiversity and wildlife, and protect our natural resources. The aim of this research is to study the efficacy of using remote sensing and GIS techniques to detect changes to critical conservation areas where disturbances can be understood, and therefore better managed and mitigated before these areas are degraded beyond repair.

  20. Ethnoveterinary uses of medicinal plants: a survey of plants used in the ethnoveterinary control of gastro-intestinal parasites of goats in the Eastern Cape Province, South Africa.

    PubMed

    Maphosa, Viola; Masika, Patrick Julius

    2010-06-01

    Conventional drugs have become expensive and therefore unaffordable to resource-limited farmers, causing farmers to seek low cost alternatives, such as use of medicinal plants. In this study, a survey was conducted in order to document information on medicinal plants used by farmers in the control of internal parasites in goats in the Eastern Cape Province. Structured questionnaires and general conversation were used to collect the information from farmers and herbalists. The survey revealed 28 plant species from 20 families that are commonly used in the treatment of gastro-intestinal parasites in goats. The plant family Asphodelaceae was frequent in usage, comprising 21.4% of the plants, and the Aloe was the most utilized species (50%). Leaves were the most frequently used plant parts (45.9%), and decoctions constituted the majority of medicinal preparations (70%). Medicinal plants are generally used in combination with other plants, and/or non-plant substances, but a few plants are used on their own. These medicinal plant remedies are administered orally, mainly by use of bottles and this is done twice in summer at intervals of one month, only once in winter and when need arises thereafter. Some of the mentioned plants have been reported in literature to possess anthelmintic properties, while others possess activities ranging from anti-inflammatory, analgesic, antimicrobial, purgative, anti-edema to immuno-regulation. If their safety and efficacy could be confirmed, these plants could form an alternative cost effective strategy in managing helminthiasis in the province.

  1. Cape Verde and Its People: A Short History, Part I [And] Folk Tales of the Cape Verdean People.

    ERIC Educational Resources Information Center

    Almeida, Raymond A.; Nyhan, Patricia

    Two booklets provide an overview of the history and folklore of Cape Verde, a group of islands lying 370 miles off the west coast of Africa. One booklet describes the history of the islands which were probably settled initially by Africans from the west coast of Africa. By the 15th century the islands were colonized by Portuguese and other…

  2. Quantitative Study of Vulnerability / Damage Curves in South Africa

    NASA Astrophysics Data System (ADS)

    Pule, Tebogo

    2014-05-01

    Southern Africa is considered a stable continental region in spite of several cases of reported earthquakes, which caused considerable damage and casualties particularly in the mining industry. Most buildings and structures in South Africa are not designed to resist any intensity of earthquake and most architects, engineers and builders in the country do not consider seismic resistance as a design requirement. This is mainly because the region has not experienced any large and serious destructive earthquake in recent years. The most destructive earthquake recorded in South Africa is the Ceres earthquake of 1969. The earthquake with a magnitude of 6.3 occurred on September 29, 1969 in the Ceres-Tulbagh region of the Western Cape Province about 100 km northeast of Cape Town. Serious damage occurred to certain buildings in the area (amounting to a total of U.S. 24 million). The structural damage varied from almost total destruction of old and poorly constructed buildings to large cracks in the better-built ones, twelve people were killed and many more were injured. Another event that caused severe damage to infrastructure occurred on March 9, 2005 at Stilfontein near Klerksdorp. It is known that up to 40 or more tremors are recorded monthly in Southern Africa, the locations are predominantly in the places surrounding the gold mining areas with many events around the Carletonville and Klerksdorp areas. Recent years have seen at least four mining induced tremors causing significant damage (Welkom 1976, Klerksdorp 1977, Welkom 1989 and Carletonville 1992). Such events show that it is very necessary to take seismic events into account in the design of any infrastructure. Assessing and understanding the risk facing the South African cities as a result of major seismic activity has been paid little attention. The main focus of this study is to use results of a deterministic hazard assessment to develop the most suitable damage curves for twelve of the most common building

  3. Antibiotic susceptibility profiles of some Vibrio strains isolated from wastewater final effluents in a rural community of the Eastern Cape Province of South Africa

    PubMed Central

    2010-01-01

    Background To evaluate the antibiogram and antibiotic resistance genes of some Vibrio strains isolated from wastewater final effluents in a rural community of South Africa. V. vulnificus (18), V. metschnikovii (3), V. fluvialis (19) and V. parahaemolyticus (12) strains were isolated from final effluents of a wastewater treatment plant (WWTP) located in a rural community of South Africa. The disk diffusion method was used for the characterization of the antibiogram of the isolates. Polymerase chain reaction (PCR) was employed to evaluate the presence of established antibiotic resistance genes using specific primer sets. Results The Vibrio strains showed the typical multidrug-resistance phenotype of an SXT element. They were resistant to sulfamethoxazole (Sul), trimethoprim (Tmp), cotrimoxazole (Cot), chloramphenicol (Chl), streptomycin (Str), ampicillin (Amp), tetracycline (Tet) nalidixic acid (Nal), and gentamicin (Gen). The antibiotic resistance genes detected includes dfr18 and dfrA1 for trimethoprim; floR, tetA, strB, sul2 for chloramphenicol, tetracycline, streptomycin and sulfamethoxazole respectively. Some of these genes were only recently described from clinical isolates, demonstrating genetic exchange between clinical and environmental Vibrio species. Conclusions These results demonstrate that final effluents from wastewater treatment plants are potential reservoirs of various antibiotics resistance genes. Moreover, detection of resistance genes in Vibrio strains obtained from the wastewater final effluents suggests that these resistance determinants might be further disseminated in habitats downstream of the sewage plant, thus constituting a serious health risk to the communities reliant on the receiving waterbodies. PMID:20470419

  4. Characterization of the village goat production systems in the rural communities of the Eastern Cape, KwaZulu-Natal, Limpopo and North West Provinces of South Africa.

    PubMed

    Mdladla, Khanyisile; Dzomba, Edgar Farai; Muchadeyi, Farai Catherine

    2017-03-01

    Expansion of goat improvement programs requires exploration of the factors that influence the production system and breeding initiatives. Characterization of goat breeds or populations is crucial in providing information on prevalent goat types and their attributes and may suffice as a guideline on conservation, development, and selection for improved productivity. This study investigated the existing village goat production system and phenotypic diversity of the different village populations from four South African provinces. The study further investigated the use of phenotypic attributes to classify goats to breeds or populations. Data was collected from 142 households in 26 villages of the Eastern Cape (n = 2 villages), KwaZulu-Natal (n = 6 villages), Limpopo (n = 13 villages), and North West (n = 5 villages) provinces through a survey. Individual interviews and focus group discussions revealed that the mean goat herd size per household was least in Limpopo at 13.2 ± 12.40 and highest in Eastern Cape (34.18 ± 28.36). Flocks had more (p < 0.05) adults than kids, and the distribution of breeding animals was biased towards does and less bucks. Goats were kept mainly for meat, for selling, and for ritual ceremonies. The goat production system was mainly scavenging. Goat health was a major challenge across households and villages. Qualitative traits such coat, horn, ears, and wattle characteristics were recorded for populations of village goats (n = 319) and a feral Tankwa breed (n = 50). The dominant coat pattern was plain (74.53%) with black as the most common coat color (31.98%). Across breeds, a majority (88.08%) of the goats had horns, and 7.59% had wattles while 56.64% had beard. Adult goats (<3 years; n = 398) were further analyzed for five quantitative traits of chest girth, height, length, and pin bone and there were significant (p < 0.05) breed differences in all. A stepwise discriminatory procedure was used to

  5. Mechanisms for the export of archaeal lipids down the water column in the upwelling area off Cape Blanc, North-West Africa

    NASA Astrophysics Data System (ADS)

    Ebersbach, Friederike; Goldenstein, Nadine; Iversen, Morten; Mollenhauer, Gesine; Hinrichs, Kai-Uwe

    2016-04-01

    Transport mechanisms of microbial membrane lipids from surface waters to the seafloor are poorly understood. In particular, pelagic archaeal glycerol dibiphytanyl glycerol tetraethers (GDGTs) from planktonic archaea are frequently used for reconstruction of ancient sea surface temperatures (Schouten et al. 2013). Because planktonic archaea are too small and neutrally buoyant to sink independently, transport vehicles for efficient export of fossil archaeal biomarkers to the sediment are required. The surface ocean is coupled with the deep ocean through biogenic sinking particles, a process known as the biological pump (Volk and Hoffert 1985). Two different pathways for particle formation, mainly taking place in the mesopelagic zone, are distinguished: Direct aggregation of phytoplankton blooms or grazing, resulting in phyto-detrital aggregates or reprocessed faecal material, respectively. Grazing and packaging into sinking particles is a possible export mechanism for GDGTs (Huguet et al. 2006). Moreover, it is assumed that phyto-detrital aggregates also play an important role in transporting GDGTs to the deep (Mollenhauer et al. 2015), but processes behind this pathway remain unclear. However, there are only few studies that link GDGT signals in sinking particles to the composition of the exported particulate matter (e.g. Yamamoto et al., 2012; Mollenhauer et al. 2015). Here we investigate sinking particles and suspended particulate matter (SPM) from spring blooms in 2012 and 2013 in the upwelling region in the Atlantic Ocean off Cape Blanc, Mauritania. We compare for the first time material from free-floating sediment traps (100, 200 and 400 m; purely sinking particles) with sinking particles and SPM from size fractionated in-situ pump (ISP) filters (several depths between 40 and 2350 m). This setup allows to relate the signal from archaeal lipids to (i) the flux of particulate organic carbon and the particle assemblages as revealed by the characterisation of

  6. Environmental change at the southern Cape coast of South Africa as inferred from a high-resolution Holocene sediment record from Eilandvlei

    NASA Astrophysics Data System (ADS)

    Wündsch, Michael; Haberzettl, Torsten; Meadows, Michael E.; Kirsten, Kelly L.; Meschner, Stephanie; Frenzel, Peter; Baade, Jussi; Daut, Gerhard; Mäusbacher, Roland; Kasper, Thomas; Quick, Lynne J.; Cawthra, Hayley C.; Zabel, Matthias

    2016-04-01

    The RAIN project (Regional Archives for Integrated iNvestigations), funded by the German Federal Ministry of Education and Research (BMBF), focuses on closely integrated investigations of terrestrial and marine geoarchives from southern Africa in order to assess environmental changes during the late Quaternary. For this purpose, various marine and terrestrial sediment records from the three major rainfall zones of South Africa (winter-, summer- and year-round rainfall zone) were recovered and analysed applying a wide range of methods (e.g., sedimentology, seismic stratigraphy, geochronology, organic and inorganic geochemistry, mineralogy, stable isotopes, micropalaeontology, palynology). In this contribution, we present results and interpretations obtained from a 30.5 m sediment core retrieved from the coastal lake Eilandvlei located within the year-round rainfall zone. Geochemical investigations (Ca, Sr, total inorganic carbon) indicate major changes in the sediment carbonate contents which were linked to variations in the marine influence received at the site throughout the covered period. The interpretation of carbonates reflecting a varying marine influence is corroborated by micropalaeontological analyses (viz. ostracod and diatom assemblages) which reveal strong similarities with the geochemical data. In order to establish a reliable radiocarbon (14C) chronology for this record, it is of particular importance to consider the impact of 14C-depleted ("old") marine carbon contained in the measured samples causing reservoir effects. Therefore, two marine molluscan shells collected alive before AD 1950 ("pre-bomb") were analysed to determine the regional marine reservoir offset (ΔR). The obtained ΔR values of 134 ± 38 and 161 ± 38 14C yrs represent the first data available for the south coast of South Africa. However, the application of the resulting average ΔR = 148 ± 54 14C yrs for the calibration of the entire Eilandvlei record underestimates the

  7. Exploring Our Cosmic Dawn from South Africa

    NASA Astrophysics Data System (ADS)

    Parsons, Aaron; PAPER; Kilimetre Array South Africa, Square

    2014-01-01

    The Precision Array to Probe the Epoch of Reionization (PAPER) is a dedicated experiment for using radio emission from neutral hydrogen to access one of the last major phase transitions in our Universe --- the epoch when the first luminous objects ionized the bulk of the hydrogen in the universe. PAPER has been deployed in the Karoo desert of South Africa since 2009, and has been co-developed with the help of Square Kilometre Array South Africa (SKASA), students and researchers at the University of Cape Town, and many interns from local technical colleges. Shared efforts between SKASA and UC Berkeley developing digital signal processing hardware for PAPER helped begin the Collaboration for Astronomy Signal Processing and Electronics Research (CASPER), which now includes hundreds of organizations around the world who use CASPER technology in a wide range of astronomy applications. We discuss the history and current status of collaboration between PAPER and organizations in South Africa, its numerous synergistic benefits, and the prospects for broadening and enriching this collaboration as part of a next-generation instrument to succeed PAPER: the Hydrogen Epoch of Reionization Array (HERA).

  8. Patterns of plant speciation in the Cape floristic region.

    PubMed

    van der Niet, Timotheüs; Johnson, Steven D

    2009-04-01

    Plant species have accumulated in the Cape region of southern Africa to a much greater degree than in areas of equivalent size in the rest of the subcontinent. Although this could be a consequence simply of lower extinction rates in the Cape, most researchers have invoked high rates of ecological speciation, driven by unique aspects of the Cape environment, as the primary explanation for this richness. To assess these ideas, we analyzed the frequencies of ecological shifts among 188 sister species pairs obtained from molecular phylogenies of eight Cape clades. Ecological shifts were evident in 80% of sister species pairs, with general habitat, pollinator, and fire-survival strategy shifts being especially frequent. Contrary to an established idea that shifts in soil type are frequently associated with speciation of Cape taxa, these shifts were relatively rare, occurring in just 17% of species pairs. More cases of sister species divergence are accompanied solely by floral than by vegetative diversification, suggesting an important role for pollinator-driven speciation. In an analysis of two large orchid genera that have radiated in both the Cape and the rest of southern Africa, the frequency of ecological shifts (general habitat, soil type, altitude and flowering time), did not differ between sister species pairs in the Cape region and those outside it. Despite suggestions that Cape plants tend to have small range sizes and show fine-scale patterns of speciation, range size did not differ significantly between species in the Cape and those outside it. We conclude that ecological speciation is likely to have been important for radiation of the Cape flora, but there is no evidence as yet for special "Cape" patterns of ecological speciation.

  9. Efficacy of SISTA South Africa on sexual behavior, HIV stigma and relationship control among isiXhosa women in the Western Cape Province, South Africa: Results of a Randomized Controlled Trial

    PubMed Central

    Wingood, Gina M.; Reddy, Priscilla; Lang, Delia L.; Saleh-Onoya, Dorina; Braxton, Nikia; Sifunda, Sibusiso; DiClemente, Ralph J

    2013-01-01

    Background The HIV epidemic has a devastating impact among South-African women. The current study evaluated the efficacy of SISTA South Africa, a culturally congruent HIV intervention for isiXhosa women in South Africa that was adapted from SISTA, an HIV intervention for African American women. Methods A randomized controlled trial recruited 342 isiXhosa women 18 – 35 years of age. Participants were randomized to the general health comparison or the SISTA South Africa intervention. Xhosa speaking peer health educators tailored the SISTA South Africa curriculum, while maintaining the core elements of the original SiSTA intervention. Participants completed assessments at baseline and 6 months follow-up. Results Relative to participants in the comparison, participants in the HIV intervention reduced the frequency of unprotected vaginal intercourse acts (adjusted mean difference = 1.06; p = .02), were more likely to report not desiring dry sex (AOR = .229; 95% CI = .10, .47; p = .0001) and, were more likely to perceive that their main sexual partner did not desire dry sex (AOR = .24; 95% CI = .11, .52; p = .0001). Additionally, women randomized to the intervention also reported an increase in HIV knowledge, greater relationship control and had more accepting attitudes towards HIV stigma. The HIV intervention did not reduce STI incidence. Conclusions This trial demonstrates that an HIV intervention which is adapted to enhance its gender and cultural relevance for rural isiXhosa women can reduce self-reported sexual risk behaviors and enhance mediators of HIV among this vulnerable population. PMID:23673889

  10. Symbiotic functioning, structural adaptation, and subcellular organization of root nodules from Psoralea pinnata (L.) plants grown naturally under wetland and upland conditions in the Cape Fynbos of South Africa.

    PubMed

    Kanu, Sheku A; Dakora, Felix D

    2017-01-01

    In the Cape Fynbos of South Africa, Psoralea pinnata (L.) plants occur naturally in both wetland and well-drained soils and yet effectively fix N2 under the two contrasting conditions. In this study, nodule structure and functioning in P. pinnata plants from the two habitats were evaluated using light and transmission electron microscopy (TEM), as well as the (15)N natural abundance technique. The results showed that, structurally, fully developed P. pinnata nodules were spherical in shape with six components (namely, lenticels, periderm, outer cortex, middle cortex, inner cortex, and a central bacteria-infected medulla region). Morphometric analysis revealed 44 and 84 % increase in cell area and volume of wetland nodules compared to those from upland. The percentage area of nodules occupied by the middle cortex in wetland nodules was twice that of upland nodules. As a result, the size of the medulla region in wetland nodules was significantly reduced compared to upland nodules. Additionally, the average area of medulla occupied by intercellular air spaces in wetland nodules was about five times that of upland nodules (about 431 % increase in wetland over upland nodules). TEM data also showed more bacteroids in symbiosomes of upland nodules when compared to wetland nodules. However, isotopic analysis of above-ground plant parts revealed no differences in symbiotic parameters such as N concentration, ∂(15)N and %Ndfa between wetland and upland P. pinnata plants. These results suggest that, under limiting O2 conditions especially in wetlands, nodules make structural and functional adjustments to meet the O2 demands of N2-fixing bacteroids.

  11. The Influence of Second-Hand Cigarette Smoke Exposure during Childhood and Active Cigarette Smoking on Crohn’s Disease Phenotype Defined by the Montreal Classification Scheme in a Western Cape Population, South Africa

    PubMed Central

    Chivese, Tawanda; Esterhuizen, Tonya M.; Basson, Abigail Raffner

    2015-01-01

    Background Smoking may worsen the disease outcomes in patients with Crohn’s disease (CD), however the effect of exposure to second-hand cigarette smoke during childhood is unclear. In South Africa, no such literature exists. The aim of this study was to investigate whether disease phenotype, at time of diagnosis of CD, was associated with exposure to second-hand cigarette during childhood and active cigarette smoking habits. Methods A cross sectional examination of all consecutive CD patients seen during the period September 2011-January 2013 at 2 large inflammatory bowel disease centers in the Western Cape, South Africa was performed. Data were collected via review of patient case notes, interviewer-administered questionnaire and clinical examination by the attending gastroenterologist. Disease phenotype (behavior and location) was evaluated at time of diagnosis, according to the Montreal Classification scheme. In addition, disease behavior was stratified as ‘complicated’ or ‘uncomplicated’, using predefined definitions. Passive cigarette smoke exposure was evaluated during 3 age intervals: 0–5, 6–10, and 11–18 years. Results One hundred and ninety four CD patients were identified. Cigarette smoking during the 6 months prior to, or at time of diagnosis was significantly associated with ileo-colonic (L3) disease (RRR = 3.63; 95%CI, 1.32–9.98, p = 0.012) and ileal (L1) disease (RRR = 3.54; 95%CI, 1.06–11.83, p = 0.040) compared with colonic disease. In smokers, childhood passive cigarette smoke exposure during the 0–5 years age interval was significantly associated with ileo-colonic CD location (RRR = 21.3; 95%CI, 1.16–391.55, p = 0.040). No significant association between smoking habits and disease behavior at diagnosis, whether defined by the Montreal scheme, or stratified as ‘complicated’ vs ‘uncomplicated’, was observed. Conclusion Smoking habits were associated with ileo-colonic (L3) and ileal (L1) disease at time of diagnosis in

  12. Climate, Environment and Early Human Innovation: Stable Isotope and Faunal Proxy Evidence from Archaeological Sites (98-59ka) in the Southern Cape, South Africa.

    PubMed

    Roberts, Patrick; Henshilwood, Christopher S; van Niekerk, Karen L; Keene, Petro; Gledhill, Andrew; Reynard, Jerome; Badenhorst, Shaw; Lee-Thorp, Julia

    2016-01-01

    The Middle Stone Age (MSA) of southern Africa, and in particular its Still Bay and Howiesons Poort lithic traditions, represents a period of dramatic subsistence, cultural, and technological innovation by our species, Homo sapiens. Climate change has frequently been postulated as a primary driver of the appearance of these innovative behaviours, with researchers invoking either climate instability as a reason for the development of buffering mechanisms, or environmentally stable refugia as providing a stable setting for experimentation. Testing these alternative models has proved intractable, however, as existing regional palaeoclimatic and palaeoenvironmental records remain spatially, stratigraphically, and chronologically disconnected from the archaeological record. Here we report high-resolution records of environmental shifts based on stable carbon and oxygen isotopes in ostrich eggshell (OES) fragments, faunal remains, and shellfish assemblages excavated from two key MSA archaeological sequences, Blombos Cave and Klipdrift Shelter. We compare these records with archaeological material remains in the same strata. The results from both sites, spanning the periods 98-73 ka and 72-59 ka, respectively, show significant changes in vegetation, aridity, rainfall seasonality, and sea temperature in the vicinity of the sites during periods of human occupation. While these changes clearly influenced human subsistence strategies, we find that the remarkable cultural and technological innovations seen in the sites cannot be linked directly to climate shifts. Our results demonstrate the need for scale-appropriate, on-site testing of behavioural-environmental links, rather than broader, regional comparisons.

  13. Foodborne pathogens recovered from ready-to-eat foods from roadside cafeterias and retail outlets in Alice, Eastern Cape Province, South Africa: public health implications.

    PubMed

    Nyenje, Mirriam E; Odjadjare, Collins E; Tanih, Nicoline F; Green, Ezekiel; Ndip, Roland N

    2012-08-01

    This study assessed the microbiological quality of various ready-to-eat foods sold in Alice, South Africa. Microbiological analysis was conducted on 252 samples which included vegetables, potatoes, rice, pies, beef and chicken stew. The isolates were identified using biochemical tests and the API 20E, API 20NE and API Listeria kits; results were analyzed using the one-way-ANOVA test. Bacterial growth was present in all the food types tested; high levels of total aerobic count were observed in vegetables, 6.8 ± 0.07 followed by rice, 6.7 ± 1.7 while pies had the lowest count (2.58 ± 0.24). Organisms isolated included: Listeria spp. (22%), Enterobacter spp. (18%), Aeromonas hydrophila (12%), Klebsiella oxytoca (8%), Proteus mirabilis (6.3%), Staphylococcus aureus (3.2%) and Pseudomonas luteola (2.4%). Interestingly, Salmonella spp. and Escherichia coli were not isolated in any of the samples. There was a statistically significant difference (p < 0.05) in the prevalence of foodborne pathogens from hygienic and unhygienic cafeterias. The results indicated that most of the ready-to-eat food samples examined in this study did not meet bacteriological quality standards, therefore posing potential risks to consumers. This should draw the attention of the relevant authorities to ensure that hygienic standards are improved to curtain foodborne infections.

  14. Local Wood Demand, Land Cover Change and the State of Albany Thicket on an Urban Commonage in the Eastern Cape, South Africa

    NASA Astrophysics Data System (ADS)

    Stickler, M. M.; Shackleton, C. M.

    2015-02-01

    Understanding the rates and causes of land-use change is crucial in identifying solutions, especially in sensitive landscapes and ecosystems, as well as in places undergoing rapid political, socioeconomic or ecological change. Despite considerable concern at the rate of transformation and degradation of the biodiversity-rich Albany Thicket biome in South Africa, most knowledge is gleaned from private commercial lands and state conservation areas. In comparison, there is limited work in communal areas where land uses include biomass extraction, especially for firewood and construction timber. We used aerial photographs to analyze land use and cover change in the high- and low-use zones of an urban commonage and an adjacent protected area over almost six decades, which included a major political transition. Field sampling was undertaken to characterize the current state of the vegetation and soils of the commonage and protected area and to determine the supply and demand for firewood and construction timber. Between the 1950s and 1980s, there was a clear increase in woody vegetation cover, which was reversed after the political transition in the mid-1990s. However, current woody plant standing stocks and sustainable annual production rates are well above current firewood demand, suggesting other probable causes for the decline in woody plant cover. The fragmentation of woody plant cover is paralleled by increases in grassy areas and bare ground, an increase in soil compaction, and decreases in soil moisture, carbon, and nutrients.

  15. Climate, Environment and Early Human Innovation: Stable Isotope and Faunal Proxy Evidence from Archaeological Sites (98-59ka) in the Southern Cape, South Africa

    PubMed Central

    Keene, Petro; Gledhill, Andrew; Reynard, Jerome; Badenhorst, Shaw

    2016-01-01

    The Middle Stone Age (MSA) of southern Africa, and in particular its Still Bay and Howiesons Poort lithic traditions, represents a period of dramatic subsistence, cultural, and technological innovation by our species, Homo sapiens. Climate change has frequently been postulated as a primary driver of the appearance of these innovative behaviours, with researchers invoking either climate instability as a reason for the development of buffering mechanisms, or environmentally stable refugia as providing a stable setting for experimentation. Testing these alternative models has proved intractable, however, as existing regional palaeoclimatic and palaeoenvironmental records remain spatially, stratigraphically, and chronologically disconnected from the archaeological record. Here we report high-resolution records of environmental shifts based on stable carbon and oxygen isotopes in ostrich eggshell (OES) fragments, faunal remains, and shellfish assemblages excavated from two key MSA archaeological sequences, Blombos Cave and Klipdrift Shelter. We compare these records with archaeological material remains in the same strata. The results from both sites, spanning the periods 98–73 ka and 72–59 ka, respectively, show significant changes in vegetation, aridity, rainfall seasonality, and sea temperature in the vicinity of the sites during periods of human occupation. While these changes clearly influenced human subsistence strategies, we find that the remarkable cultural and technological innovations seen in the sites cannot be linked directly to climate shifts. Our results demonstrate the need for scale-appropriate, on-site testing of behavioural-environmental links, rather than broader, regional comparisons. PMID:27383620

  16. In search of a viable IAU-OAD Regional Node: A case for Africa

    NASA Astrophysics Data System (ADS)

    Okere, B. I.; Okoh, D. C.; Obi, I. A.; Okeke, P. N.; Opara, F. E.

    2015-03-01

    The establishment of the IAU Office of Astronomy for Development (OAD) in Cape Town, South Africa, with the aim of using astronomy to stimulate development at all levels including primary, secondary and tertiary education, science research and the public understanding of science is a welcome development to consolidate the gains of IYA2009. To assist the IAU OAD office in achieving its goal of using astronomy as a tool for development, there is need to have OAD regional nodes. In this paper, we present the astronomy activities/programs required of such a Regional Node in Africa and how the Node can play a significant role to realise the vision of Astronomy for a better world!

  17. Factors that Influence Teenage Antenatal Care Utilization in John Taolo Gaetsewe (JTG) District of Northern Cape Province, South Africa: Underscoring the Need for Tackling Social Determinants of Health

    PubMed Central

    Worku, Eshetu Bekele; Woldesenbet, Selamawit Alemu

    2016-01-01

    Background and Objectives: In resource-limited settings, the uptake of antenatal care visits among women, especially teenage pregnant women, is disturbingly low. Factors that influence the uptake of ANC services among teenage women is largely understudied and poorly understood in John Taolo Gaetsewe (JTG), a predominantly rural and poor district of South Africa. The aim of this study was to determine the factors that influence uptake of ANC services among teenage mothers in JTG district. Methods: A cross-sectional health facility-based study utilising mixed method was conducted in all public health facilities (n=44) at JTG district. Mother-infant pairs (n=383) who brought their infants for six-week first DPT immunisation during the study period were enrolled in the study. Structured questionnaires were used to collect data on demographic, socio-economic and uptake of ANC indicators. Results: Out of 272 respondent mothers, 18.68% were adolescent mothers (13-19 years). The logistic regression analysis shows that mother’s age (OR=2.11; 95%CI = 1.04 - 4.27); distance to the nearest health facility (OR=3.38; 95%CI = 1.45-7.87); and client service satisfaction (OR=8.58; 95%CI =2.10-34.95 are significantly associated with poor uptake of ANC services. Conclusion and Global Health Implications: There is a need to improve the quality of adolescent reproductive health services tailored to their health and developmental needs. Moreover, addressing the social determinants of health that affect individual’s healthy life style and health seeking behavior is critical. PMID:28058200

  18. The African Pediatric Fellowship Program: Training in Africa for Africans.

    PubMed

    Wilmshurst, Jo M; Morrow, Brenda; du Preez, Avril; Githanga, David; Kennedy, Neil; Zar, Heather J

    2016-01-01

    Africa has a significant burden of childhood disease, with relatively few skilled health care professionals. The African Paediatric Fellowship Programme was developed by the Department of Pediatrics and Child Health at the University of Cape Town to provide relevant training for African child health professionals, by Africans, within Africa. Trainees identified by partner academic institutions spend 6 months to 2 years training in the Department of Pediatrics and allied disciplines. They then return to their home institution to build practice, training, research, and advocacy. From 2008 to 2015, 73 physicians have completed or are completing training in general pediatrics or a pediatric subspecialty. At 1 year posttraining, 98% to 100% are practicing back in their home institution. The impact of the returning fellows is evident from their practice interventions, research collaborations, and positions as stakeholders who can change health care policies. Thirty-three centers in 13 African countries are partners with the program, and the program template is now followed by other partner sites in Africa. Increasing and retaining the skills pool of African child health specialists is building a network of motivated, highly skilled clinicians who are equipped to advance child health in Africa.

  19. Evaluation of baseline ground-water conditions in the Mosteiros, Ribeira Paul, and Ribeira Fajã Basins, Republic of Cape Verde, West Africa, 2005-06

    USGS Publications Warehouse

    Heilweil, Victor M.; Earle, John D.; Cederberg, Jay R.; Messer, Mickey M.; Jorgensen, Brent E.; Verstraeten, Ingrid M.; Moura, Miguel A.; Querido, Arrigo; Spencer,; Osorio, Tatiana

    2006-01-01

    This report documents current (2005-06) baseline ground-water conditions in three basins within the West African Republic of Cape Verde (Mosteiros on Fogo, Ribeira Paul on Santo Antão, and Ribeira Fajã on São Nicolau) based on existing data and additional data collected during this study. Ground-water conditions (indicators) include ground-water levels, ground-water recharge altitude, ground-water discharge amounts, ground-water age (residence time), and ground-water quality. These indicators are needed to evaluate (1) long-term changes in ground-water resources or water quality caused by planned ground-water development associated with agricultural projects in these basins, and (2) the feasibility of artificial recharge as a mitigation strategy to offset the potentially declining water levels associated with increased ground-water development.Ground-water levels in all three basins vary from less than a few meters to more than 170 meters below land surface. Continuous recorder and electric tape measurements at three monitoring wells (one per basin) showed variations between August 2005 and June 2006 of as much as 1.8 meters. Few historical water-level data were available for the Mosteiros or Ribeira Paul Basins. Historical records from Ribeira Fajã indicate very large ground-water declines during the 1980s and early 1990s, associated with dewatering of the Galleria Fajã tunnel. More-recent data indicate that ground-water levels in Ribeira Fajã have reached a new equilibrium, remaining fairly constant since the late 1990s.Because of the scarcity of observation wells within each basin, water-level data were combined with other techniques to evaluate ground-water conditions. These techniques include the quantification of ground-water discharge (well withdrawals, spring discharge, seepage to springs, and gallery drainage), field water-quality measurements, and the use of environmental tracers to evaluate sources of aquifer recharge, flow paths, and ground

  20. Family Instability and Pathways to Adulthood in Urban South Africa.

    PubMed

    Goldberg, Rachel E

    2013-06-01

    Social, political, epidemiological, and economic forces have produced family instability during childhood for many young people transitioning to adulthood in South Africa. This study identifies pathways to adulthood for youth in Cape Town that capture the timing and sequencing of role transitions across the life domains of school, work, and family formation. It then uses these pathways to investigate the relationship between childhood family instability and the way young people's lives unfold during the transition to adulthood. Results indicate that changes in co-residence with parents are associated with following less advantageous pathways into adulthood, independent of particular family structure or orphan status. Overall, the findings suggest that family instability influences not only single transitions for youth, but also combinations of transitions. They also indicate the value of a multi-dimensional conceptualization of the transition to adulthood in empirical work.

  1. Family Instability and Pathways to Adulthood in Urban South Africa

    PubMed Central

    Goldberg, Rachel E.

    2014-01-01

    Social, political, epidemiological, and economic forces have produced family instability during childhood for many young people transitioning to adulthood in South Africa. This study identifies pathways to adulthood for youth in Cape Town that capture the timing and sequencing of role transitions across the life domains of school, work, and family formation. It then uses these pathways to investigate the relationship between childhood family instability and the way young people’s lives unfold during the transition to adulthood. Results indicate that changes in co-residence with parents are associated with following less advantageous pathways into adulthood, independent of particular family structure or orphan status. Overall, the findings suggest that family instability influences not only single transitions for youth, but also combinations of transitions. They also indicate the value of a multi-dimensional conceptualization of the transition to adulthood in empirical work. PMID:25067862

  2. Ozone maxima over Southern Africa: A mid-latitude link

    NASA Technical Reports Server (NTRS)

    Barsby, Jane; Diab, Roseanne D.

    1994-01-01

    The relationship between patterns of total ozone and day-to-day weather was explored over South Africa for the period 1987 to 1988. Generally, there was a fairly poor relationship (variance less than 20 percent) between total ozone and the heights of the 100, 300 and 500 hPa geopotential heights at 5 South African stations. However, over a shorter period, October to December 1988, fluctuations in the height of the 300 hPa surface accounted for 53 percent of the variance in total ozone at Cape Town. High ozone amounts are associated with the lowering of the 300 hPa surface in the presence of an upper-air trough. The role of the mid-latitude westerly waves in this respect is discussed.

  3. Two new water beetles from the South African Cape (Coleoptera, Hydraenidae).

    PubMed

    Bilton, David T

    2016-07-13

    Pterosthetops nitidus sp. nov. and Oomtelecopon namaqum sp. nov. are described from the Western and Northern Cape Provinces of South Africa respectively. Diagnostic notes are provided for each species, together with details of occupied microhabitats.

  4. Cape of Good Hope

    Atmospheric Science Data Center

    2016-08-24

    article title:  Aerosol retrieval over Cape of Good Hope (Enlargement)     ... (MISR) image is an enlargement of the  aerosol retrieval over Cape of Good Hope, August 23, 2000 , showing a more detailed ... energy, so MISR's contribution is not only the aerosol retrieval necessary to do the correction, but the multi-angular integration. ...

  5. Urbanisation and women's health in South Africa.

    PubMed

    Pick, W; Cooper, D

    1997-03-01

    For many decades the migrant labor system and the influx control legislation in South Africa exacerbated male-dominant patterns of migration typical of Africa. In recent years, however, and especially following the easing of influx control legislation in 1986, migration in South Africa has increasingly involved women. This paper reports on a study conducted in Khayelitsha, Cape Town, which explored the relationship between urbanisation and the health of women. The objectives were to relate age, migration, length of stay in urban areas, employment status, and occupation to the health, including reproductive health, of women living in Khayelitsha. Interviews with 659 women (61 households had no senior woman) revealed that women enjoyed considerable social support through their neighbours, church organisations, and women's organisations. Women who lived in the most deprived section of Khayelitsha enjoyed more support from their neighbours but reported less satisfaction with the area in which they lived. Child-care support was poor and a considerable proportion of the women were disempowered by their male partners. More than 90 percent of the women had access to antenatal care. Recent immigrants had more pregnancies, were less aware of screening for cervical cancer, less likely to have had a Pap smear, less knowledgeable about where to have a Pap smear done, and less likely to have heard AIDS. More women were aware of AIDS (86%) than Pap smears (45%). More than half of those of childbearing age used contraception, mainly intramuscular hormones (76%). A significant proportion (53%) of the women reported that they had had their first pregnancy as teenagers and younger, less educated women were more likely to have had adolescent pregnancies. Policy makers are confronted by a compelling need to redress well-known urban-rural inequalities in health care in South Africa. Policy attention must also be given to the increasing urbanisation of women and the growing health care

  6. Prevalence of symptoms of asthma, rhinitis and eczema in 13- to 14-year-old children in Africa: the International Study of Asthma and Allergies in Childhood Phase III.

    PubMed

    Ait-Khaled, N; Odhiambo, J; Pearce, N; Adjoh, K S; Maesano, I A; Benhabyles, B; Bouhayad, Z; Bahati, E; Camara, L; Catteau, C; El Sony, A; Esamai, F O; Hypolite, I E; Melaku, K; Musa, O A; Ng'ang'a, L; Onadeko, B O; Saad, O; Jerray, M; Kayembe, J M; Koffi, N B; Khaldi, F; Kuaban, C; Voyi, K; M'Boussa, J; Sow, O; Tidjani, O; Zar, H J

    2007-03-01

    Phase I of the International Study of Asthma and Allergies in Childhood has provided valuable information regarding international prevalence patterns and potential risk factors in the development of asthma, allergic rhinoconjunctivitis and eczema. However, in Phase I, only six African countries were involved (Algeria, Tunisia, Morocco, Kenya, South Africa and Ethiopia). Phase III, conducted 5-6 years later, enrolled 22 centres in 16 countries including the majority of the centres involved in Phase I and new centres in Morocco, Tunisia, Democratic Republic of Congo, Togo, Sudan, Cameroon, Gabon, Reunion Island and South Africa. There were considerable variations between the various centres of Africa in the prevalence of the main symptoms of the three conditions: wheeze (4.0-21.5%), allergic rhinoconjunctivitis (7.2-27.3%) and eczema (4.7-23.0%). There was a large variation both between countries and between centres in the same country. Several centres, including Cape Town (20.3%), Polokwane (18.0%), Reunion Island (21.5%), Brazzaville (19.9%), Nairobi (18.0%), Urban Ivory Coast (19.3%) and Conakry (18.6%) showed relatively high asthma symptom prevalences, similar to those in western Europe. There were also a number of centres showing high symptom prevalences for allergic rhinoconjunctivitis (Cape Town, Reunion Island, Brazzaville, Eldoret, Urban Ivory Coast, Conakry, Casablanca, Wilays of Algiers, Sousse and Eldoret) and eczema (Brazzaville, Eldoret, Addis Ababa, Urban Ivory Coast, Conakry, Marrakech and Casablanca).

  7. Game Changers? Multilingual Learners in a Cape Town Primary School

    ERIC Educational Resources Information Center

    Kerfoot, Caroline; Bello-Nonjengele, Basirat Olayemi

    2016-01-01

    This article engages with Bourdieu's notion of field as a "space of play" to explore what happens to the educational field and the linguistic regimes operating within it in a site in which new discourses and practices of identity, language, "race", and ethnicity become entangled with local economies of meaning. The context is a…

  8. Assessment of completion of early medical abortion using a text questionnaire on mobile phones compared to a self-administered paper questionnaire among women attending four clinics, Cape Town, South Africa.

    PubMed

    Constant, Deborah; de Tolly, Katherine; Harries, Jane; Myer, Landon

    2015-02-01

    In-clinic follow-up to assess completion of medical abortion is no longer a requirement according to World Health Organization guidance, provided adequate counselling is given. However, timely recognition of ongoing pregnancy, complications or incomplete abortion, which require treatment, is important. As part of a larger trial, this study aimed to establish whether women having a medical abortion could self-assess whether their abortion was complete using an automated, interactive questionnaire on their mobile phones. All 469 participants received standard abortion care and all returnees filled in a self-assessment on paper at clinic follow-up 2-3 weeks later. The 234 women allocated to receive the phone messages were also asked to do a mobile phone assessment at home ten days post-misoprostol. Completion of the mobile assessment was tracked by computer and all completed assessments, paper and mobile, were compared to providers' assessments at clinic follow-up. Of the 226 women able to access the mobile phone assessment, 176 (78%) completed it; 161 of them (93%) reported it was easy to do so. Neither mobile nor paper self-assessments predicted all cases needing additional treatment at follow-up. Prediction of complete procedures was good; 71% of mobile assessments and 91% of paper assessments were accurate. We conclude that an interactive questionnaire assessing completion of medical abortion on mobile phones is feasible in the South African setting; however, it should be done later than day 10 and combined with an appropriate pregnancy test to accurately detect incomplete procedures.

  9. International Symposium on Special Topics in Chemical Propulsion (8th): Advancements in Energetic Materials and Chemical Propulsion Held in Cape Town, South Africa on 2-6 November 2009

    DTIC Science & Technology

    2009-11-06

    Nicolich, and L.I. Stiel 12:00 12:20 Formic Acid Investigation for the Prediction of High Explosive Detonation Properties and Performance...directions of the reaction. Debenzylation of 4,10-dibenzyl-2,6,8,12-tetraacetyl-2,4,6,8,10,12- hexaazaisowurtzitane in a mixture of formic acid with...2,6,8,12-tetracaetyl-2,4,6,8,10,12-hexaazaisowurtzitane. In aqueous solutions of formic acid , there is formed a mixture of the same products, but the

  10. High incidence of antimicrobial resistant organisms including extended spectrum beta-lactamase producing Enterobacteriaceae and methicillin-resistant Staphylococcus aureus in nasopharyngeal and blood isolates of HIV-infected children from Cape Town, South Africa

    PubMed Central

    Cotton, Mark F; Wasserman, Elizabeth; Smit, Juanita; Whitelaw, Andrew; Zar, Heather J

    2008-01-01

    Background There is little information on nasopharyngeal (NP) flora or bacteremia in HIV-infected children. Our aim was to describe the organisms and antimicrobial resistance patterns in children enrolled in a prospective study comparing daily and three times weekly trimethoprim-sulfamethoxazole (TMP-SMX) and isoniazid (INH) or placebo prophylaxis. Methods NP swabs were taken at baseline from HIV-infected children enrolled in the study. Standard microbiological techniques were used. Children were grouped according to previous or current exposure to TMP-SMX and whether enrolled to the study during a period of hospitalization. Blood culture results were also recorded within 12 months of baseline. Results Two hundred and three children, median age 1.8 (Interquartile [IQ]: 0.7–4) years had NP swabs submitted for culture. One hundred and eighty-four (90.7%) had either stage B or C HIV disease. One hundred and forty-one (69.8%) were receiving TMP-SMX and 19 (9.4%) were on antiretroviral therapy. The majority, 168 (82%) had a history of hospitalization and 91 (44.8%) were enrolled during a period of hospitalization. Thirty-two subjects (16.2%) died within 12 months of study entry. One hundred and eighty-one potential pathogens were found in 167 children. The most commonly isolated organisms were Streptococcus pneumoniae (48: 22.2%), Gram-negative respiratory organisms (Haemophilus influenzae and Moraxella catarrhalis) (47: 21.8%), Staphylococcus aureus (44: 20.4%), Enterobacteriaceae 32 (14.8%) and Pseudomonas 5 (2.3%). Resistance to TMP-SMX occurred in > 80% of pathogens except for M. catarrhalis (2: 18.2% of tested organisms). TMP-SMX resistance tended to be higher in those receiving it at baseline (p = 0.065). Carriage of Methicillin resistant S. aureus (MRSA) was significantly associated with being on TMP-SMX at baseline (p = 0.002). Minimal inhibitory concentrations (MIC) to penicillin were determined for 18 S. pneumoniae isolates: 7 (38.9%) were fully sensitive (MIC ≤ 0.06 μg/ml), 9 (50%) had intermediate resistance (MIC 0.12 – 1 μg/ml) and 2 (11.1%) had high level resistance (MIC ≥2 μg/ml). Fifty percent of Enterobacteriaceae produced extended spectrum beta-lactamases (ESBL) (resistant to third generation cephalosporins) and 56% were resistant to gentamicin. Seventy-seven percent of S. aureus were MRSA. Carriage of resistant organisms was not associated with hospitalization. On multivariate logistic regression, risk factors for colonization with Enterobacteriaceae were age ≤ one year (Odds ratio 4.4; 95% Confidence Interval 1.9–10.9; p = 0.0008) and CDC stage C disease (Odds ratio 3.6; 95% Confidence Interval 1.5–8.6; p = 0.005) Nineteen (9.4%) subjects had 23 episodes of bacteremia. Enterobacteriaceae were most commonly isolated (13 of 25 isolates), of which 6 (46%) produced ESBL and were resistant to gentamicin. Conclusion HIV-infected children are colonized with potential pathogens, most of which are resistant to commonly used antibiotics. TMP-SMX resistance is extremely common. Antibiotic resistance is widespread in colonizing organisms and those causing invasive disease. Antibiotic recommendations should take cognizance of resistance patterns. Antibiotics appropriate for ESBL-producing Enterobacteriaceae and MRSA should be used for severely ill HIV-infected children in our region. Further study of antibiotic resistance patterns in HIV-infected children from other areas is needed. PMID:18380900

  11. Occurrence of selected polybrominated diphenyl ethers and 2,2',4,4',5,5'-hexabromobiphenyl (BB-153) in sewage sludge and effluent samples of a wastewater-treatment plant in Cape Town, South Africa.

    PubMed

    Daso, Adegbenro P; Fatoki, Olalekan S; Odendaal, James P; Olujimi, Olanrewaju O

    2012-04-01

    The reuse of treated effluent from wastewater treatment plants (WWTPs) as alternative water source for sport-field or landscape irrigation, agricultural, and other industrial purposes is growing significantly. Similarly, the application of treated sludge (biosolid) to agricultural soils is now being considered globally as the most economic means of sludge disposal. However, the presence of emerging organic contaminants in these matrices, including polybrominated diphenyl ethers (PBDEs), which are potential endocrine disruptors, portends a high health risk to humans and the environment in general. In this study, effluent and sewage sludge samples collected from a WWTP were analysed for some selected PBDE congeners (BDE congeners 28, 47, 99 100 153 154 183, and 209) as well as BB-153 using a high-capillary gas chromatograph equipped with an electron capture detector. The sum of the eight PBDE congeners ranged from 369 to 4370, 19.2 to 2640, and 90.4 to 15,100 ng/l for raw water, secondary effluent, and final effluent, respectively. A similar result was observed for sewage sludge samples, which ranged between 13.1 and 652 ng/g dry weight (dw). The results obtained for BB-153 were generally lower compared with those found for most PBDE congeners. These ranged from ND to 18.4 ng/l and ND to 9.97 ng/g dw for effluents and sewage sludge, respectively. In both matrices, BDE 47 and 209 congeners were found to contribute significantly to the overall sum of PBDEs. The reuse of the treated effluent, particularly for agricultural purposes, could enhance the possibility of these contaminants entering into the food chain, thus causing undesirable health problems in exposed subjects.

  12. Townes-Brocks syndrome

    PubMed Central

    Powell, C.; Michaelis, R.

    1999-01-01

    Townes-Brocks syndrome (TBS) is an autosomal dominant disorder with multiple malformations and variable expression. Major findings include external ear anomalies, hearing loss, preaxial polydactyly and triphalangeal thumbs, imperforate anus, and renal malformations. Most patients with Townes-Brocks syndrome have normal intelligence, although mental retardation has been noted in a few.


Keywords: Townes-Brocks syndrome; chromosome 16q12.1; SALL1 PMID:10051003

  13. SERVIR Town Hall - Connecting Space to Village

    NASA Technical Reports Server (NTRS)

    Limaye, Ashutosh S.; Searby, Nancy D.; Irwin, Daniel; Albers, Cerese

    2013-01-01

    SERVIR, a joint NASA-USAID project, strives to improve environmental decision making through the use of Earth observations, models, and geospatial technology innovations. SERVIR connects these assets with the needs of end users in Mesoamerica, East Africa, and Hindu Kush-Himalaya regions. This Town Hall meeting will engage the AGU community by exploring examples of connecting Space to Village with SERVIR science applications.

  14. Transit of Venus Observations and Relics in South Africa

    NASA Astrophysics Data System (ADS)

    Koorts, W.

    2006-02-01

    Apart from local observations, two international expeditions observed the 1882 Transit of Venus from South Africa. The British/South African efforts obseved from four stations, using a total of 11 telescopes while the Americans employed 7 instruments, including the telescope of the Ladies Seminary where they stayed. Very few relics survive to this day. Most well known are the two concrete piers in Touws River. A Dallmeyer equatorial mount was recently discovered at a school in Somerset West, which may have originated at the Touws River site. At SAAO Cape Town, a typical "transit of Venus" 6-inch Grubb equatorial, used by Sir David Gill, is still in working condition. The wooden tube 7-inch Merz refractor, used by George Maclear (son of Sir Thomas) today serves as a finder telescope and an original "cannon ball bearing" dome and equtorial mount still exist. The site at Aberdeen Road in the Eastern Cape was recently located using a GPS fix and the area examined for possible relics. Unfortunately none were found but the position of the site with respect to Aberdeen Road raises some questions. The position of the site of the American expedition to Wellington could since be located within metres after obtaining Simon Newcomb's report, showing that my previously assumed position was wrong. His report further revealed some interesting details not known before.

  15. Father Absence, Childhood Stress, and Reproductive Maturation in South Africa.

    PubMed

    Anderson, Kermyt G

    2015-12-01

    The hypothesis that father absence during childhood, as well as other forms of childhood psychosocial stress, might influence the timing of sexual maturity and adult reproductive behaviors has been the focus of considerable research. However, the majority of studies that have examined this prediction have used samples of women of European descent living in industrialized, low-fertility nations. This paper tests the father-absence hypothesis using the Cape Area Panel Study (CAPS), which samples young adults in Cape Town, South Africa. The sample contains multiple racial groups (blacks, coloureds [mixed race], and whites) and includes both males and females. Dependent variables include age at menarche, age at first sexual intercourse, and age at first pregnancy. Childhood stress is measured by father absence by age six (either never lived with father or lived with father some but not all years) and an index of childhood exposure to violence (measuring threatened or actual verbal or physical abuse). The hypothesis received no support for effect on age at menarche but was supported for age at first sex and first pregnancy. The model showed stronger support for coloureds and whites than blacks and had no predictive power at all for black males.

  16. Panorama from 'Cape Verde'

    NASA Technical Reports Server (NTRS)

    2007-01-01

    NASA's Mars Exploration Rover Opportunity captured this vista of 'Victoria Crater' from the viewpoint of 'Cape Verde,' one of the promontories that are part of the scalloped rim of the crater. Opportunity drove onto Cape Verde shortly after arriving at the rim of Victoria in September 2006. The view combines hundreds of exposures taken by the rover's panoramic camera (Pancam). The camera began taking the component images during Opportunity's 970th Martian day, or sol, on Mars (Oct. 16, 2006). Work on the panorama continued through the solar conjunction period, when Mars was nearly behind the sun from Earth's perspective and communications were minimized. Acquisition of images for this panorama was completed on Opportunity's 991st sol (Nov. 7, 2006).

    The top of Cape Verde is in the immediate foreground at the center of the image. To the left and right are two of the more gradually sloped bays that alternate with the cliff-faced capes or promontories around the rim of the crater. 'Duck Bay,' where Opportunity first reached the rim, is to the right. Beyond Duck Bay counterclockwise around the rim, the next promontory is 'Cabo Frio,' about 150 meters (500 feet) from the rover. On the left side of the panorama is 'Cape St. Mary,' the next promontory clockwise from Cape Verde and about 40 meters (130 feet) from the rover. The vantage point atop Cape Verde offered a good view of the rock layers in the cliff face of Cape St. Mary, which is about 15 meters or 50 feet tall. By about two weeks after the Pancam finished collecting the images for this panorama, Opportunity had driven to Cape St. Mary and was photographing Cape Verde's rock layers.

    The far side of the crater lies about 800 meters (half a mile) away, toward the southeast.

    This approximately true-color view combines images taken through three of the Pancam's filters, admitting light with wavelengths centered at 750 nanometers (near infrared), 530 nanometers (green) and 430 nanometers (violet).

  17. Atlantic and Indian Oceans Pollution in Africa

    NASA Astrophysics Data System (ADS)

    Abubakar, B.

    2007-05-01

    Africa is the second largest and most populated continent after Asia. Geographically it is located between the Atlantic and Indian Oceans. Most of the Africa's most populated and industrialized cities are located along the coast of the continent facing the Atlantic and Indian Oceans, example of such cities include Casablanca, Dakar, Accra, Lagos, Luanda and Cape town all facing the Atlantic Ocean and cities like East London, Durban, Maputo, Dar-es-salaam and Mogadishu are all facing the Indian Ocean. As a result of the geographical locations of African Coastal Cities plus increase in their population, industries, sea port operations, petroleum exploration activities, trafficking of toxic wastes and improper waste management culture lead to the incessant increase in the pollution of the two oceans. NATURE OF POLLUTION OF THE ATLANTIC OCEAN i. The petroleum exploration activities going on along the coast of "Gulf of Guinea" region and Angola continuously causes oil spillages in the process of drilling, bunkering and discharging of petroleum products in the Atlantic Ocean. ii. The incessant degreasing of the Sea Ports "Quay Aprons" along the Coastal cities of Lagos, Luanda, Cape Town etc are continuously polluting the Atlantic Ocean with chemicals. iii. Local wastes generated from the houses located in the coastal cities are always finding their ways into the Atlantic Ocean. NATURE OF POLLUTION OF THE INDIAN OCEAN i. Unlike the Atlantic ocean where petroleum is the major pollutant, the Indian Ocean is polluted by Toxic / Radioactive waste suspected to have been coming from the developed nations as reported by the United Nations Environmental Programme after the Tsunami disaster in December 2004 especially along the coast of Somalia. ii. The degreasing of the Quay Aprons at Port Elizabeth, Maputo, Dar-es-Salaam and Mongolism Sea Ports are also another major source polluting the Indian Ocean. PROBLEMS GENERATED AS A RESULT OF THE OCEANS POLLUTION i. Recent report

  18. Hydrodynamics between Africa and Antarctica during Austral Summer 2008

    NASA Astrophysics Data System (ADS)

    Luis, Alvarinho J.; Pednekar, S. M.

    2010-10-01

    Under the International Polar Year endorsed project (IPY#70), the southwest Indian Ocean sector of the Southern Ocean was surveyed during the austral summer of 2008 by deploying expendable CTD probes along the ship tracks : Cape Town-India Bay, Antarctica (Track-1) and Prydz Bay, Antarctica-Cape Town (Track-2). The meteorological data revealed that the unstable marine atmosphere boundary layer (MABL) facilitated a turbulent heat loss of 45 Wm -2 on average, in conditions of variable wind intensity north of 43°S along Track-1; south of 63°S and north of 51°S the ocean was conducive to higher turbulent heat loss amounting to 95 Wm - 2 (on average) along Track-2. Surface imprints of hydrological fronts were determined by using surface gradient and subsurface temperature and salinity indicators. The core of Agulhas Current was identified between 36.5° and 37.5°S along Track-2, while the Agulhas Retroflection (AR) Front was located at 39.7°S south of Cape Town. The Subtropical (STF), Subantarctic (SAF) and Polar Fronts (PF) exhibited double frontal structures, whose meridional meandering is governed by bottom topography and modulated by planetary vorticity. A large southward deviation in the position of southern PF by 3.5° latitude on Track-1 was observed. Northern and southern SAF and southern STF meander by 2°-3.5° northward; their merger just north of Crozet Island facilitate an enhanced baroclinic transport of 12 Sv in the upper 1000 m. Three anticyclones that detach from the AR transport 17 Sv into the southeast Atlantic. The baroclinic transport contributed by AC and its retroflection across Track-2 amounted to 17.6 Sv. More than 50% of the ACC transport was confined to the 100-500 m depth layer. Water masses have been identified and their zonal extent quantified along the tracks. Strong convective cooling is responsible for the production of Subtropical Mode Water in the eastern Crozet Basin, which was detected near 43.5° and 41.5°S along Track-1 and

  19. "Blame it on the weeds": politics, poverty, and ecology in the new South Africa.

    PubMed

    Neely, Abigail H

    2010-01-01

    In January of 2000, spectacular fires burned in the natural veld of Cape Town, South Africa. As the fire-fighting effort finished, a theory emerged: invasive alien species, trees from other countries, such as Australia and the United States, were to blame for the fires. While the invasive alien hypothesis captured the attention of media and policy makers alike, there was little ecological evidence to support it. This article places the fires of 2000 in a longer history of post-apartheid policy and science surrounding invasive alien floral species, arguing that the fires allowed for a synergy between concerns over poverty relief, nature conservation, and scientific research. The most visible example of this synergy was an increased commitment to the Working for Water programme on the Cape Peninsula, a large-scale employment programme utilising unskilled labour to clear invasive alien species in order to conserve South African water resources. In addition to providing employment for South Africa's poorest citizens, Working for Water provided funding for ecological research about invasive alien species. The studies that resulted from this funding focused on gathering information to make practical suggestions for invasive species control. Although the focus of these studies was on management, the science used was itself as rigorous as it had ever been. In the post-apartheid era, as poverty relief and nature conservation came together, scientists ensured that they would continue to play a role in nature conservation by making their research relevant to both invasive species control and to poverty relief.

  20. Space Radar Image of Cape Cod, Massachusetts

    NASA Technical Reports Server (NTRS)

    1994-01-01

    This spaceborne radar image shows the famous 'hook' of Cape Cod, Massachusetts. The Cape, which juts out into the Atlantic Ocean about 100 kilometers (62 miles) southeast of Boston, actually consists of sandy debris left behind by the great continental ice sheets when they last retreated from southern New England about 20,000 years ago. Today's landscape consists of sandy forests, fields of scrub oak and other bushes and grasses, salt marshes, freshwater ponds, as well as the famous beaches and sand dunes. In this image, thickly forested areas appear green, marshes are dark blue, ponds and sandy areas are black, and developed areas are mostly pink. The dark L-shape in the lower center is the airport runways in Hyannis, the Cape's largest town. The dark X-shape left of the center is Otis Air Force Base. The Cape Cod Canal, above and left of center, connects Buzzards Bay on the left with Cape Cod Bay on the right. The northern tip of the island of Martha's Vineyard is seen in the lower left. The tip of the Cape, in the upper right, includes the community of Provincetown, which appears pink, and the protected National Seashore areas of sand dunes that parallel the Atlantic coast east of Provincetown. Scientists are using radar images like this one to study delicate coastal environments and the effects of human activities on the ecosystem and landscape. This image was acquired by Spaceborne Imaging Radar-C/X-band Synthetic Aperture Radar (SIR-C/X-SAR) onboard the space shuttle Endeavour on April 15, 1994. The image is 81.7 kilometers by 43.1 kilometers (50.7 miles by 26.7 miles) and is centered at 41.8 degrees north latitude, 70.3 degrees west longitude. North is toward the upper right. The colors are assigned to different radar frequencies and polarizations of the radar as follows: red is L-band, horizontally transmitted and received; green is C-band, horizontally transmitted, vertically received; and blue is C-band, horizontally transmitted and received. SIR

  1. An analysis of key stakeholders' attitudes and beliefs about barriers and facilitating factors in the development of a cervical cancer prevention program in South Africa.

    PubMed

    Francis, Shelley A; Leser, Kendall A; Esmont, Emma E; Griffith, Fareeda M

    2013-03-01

    Cervical cancer is the leading cause of cancer related deaths among women. Each year there are approximately 250,000 deaths; most of which occurred in Sub-Saharan Africa, South Asia, and Latin America. The purpose of this report is to examine key stakeholders experience and knowledge of HPV and cervical cancer, examine their experiences with the current cervical cancer screening and treatment policy, and identify barriers and facilitating factors to vaccine implementation and uptake. Fifteen indepth interviews were conducted with key stakeholders in Cape Town and Johannesburg, South Africa. The interviews revealed several key findings including: 1) knowledge about HPV and cervical cancer varied across participants, 2) knowledge about cervical cancer was also mixed while knowledge about the relationship between HPV and cervical cancer was low among participants. Our findings indicate that key stakeholders are concerned about women's health and wellbeing. In addition, they believe that the government, families, and the media need to play a prominent role in prevention efforts.

  2. UNESCO’s New Earth Science Education Initiative for Africa

    NASA Astrophysics Data System (ADS)

    Missotten, R.; Gaines, S. M.; de Mulder, E. F.

    2009-12-01

    The United Nations Education Science Culture and Communication Organization (UNESCO) has recently launched a new Earth Science Education Initiative in Africa. The overall intention of this Initiative is to support the development of the next generation of earth scientists in Africa who are equipped with the necessary tools, networks and perspectives to apply sound science to solving and benefiting from the challenges and opportunities of sustainable development. The opportunities in the earth sciences are great, starting with traditional mineral extraction and extending into environmental management such as climate change adaptation, prevention of natural hazards, and ensuring access to drinking water. The Earth Science Education Initiative has received strong support from many different types of partners. Potential partners have indicated an interest to participate as organizational partners, content providers, relevant academic institutes, and funders. Organizational partners now include the Geological Society of Africa (GSAf), International Center for Training and Exchanges in the Geosciences (CIFEG), Association of African Women Geoscientists (AAWG), International Year of Planet Earth (IYPE), and International Union of Geological Sciences (IUGS). The activities and focus of the Initiative within the overall intention is being developed in a participatory manner through a series of five regional workshops in Africa. The objective of these workshops is to assess regional capacities and needs in earth science education, research and industry underlining existing centers of excellence through conversation with relevant regional and international experts and plotting the way ahead for earth science education. This talk will provide an update on the outcomes of the first three workshops which have taken place in Luanda, Angola; Assiut, Egypt; and Cape Town; South Africa.

  3. Exploring the Factors Influencing the Adoption of Open Source Software in Western Cape Schools

    ERIC Educational Resources Information Center

    Johnston, Kevin; Begg, Shameemah; Tanner, Maureen

    2013-01-01

    Open Source Software (OSS) presents many benefits to both the private and the public sectors, and has proven to be a viable solution in schools. Although a policy mandating the use of OSS exists in the Western Cape province of South Africa, very few schools in the province have adopted OSS. The education system in South Africa is currently facing…

  4. Company Town Shutdown.

    ERIC Educational Resources Information Center

    Turnage, Martha A.

    Saltville, Virginia, is a former company town whose main employer, a soda ash plant, shut down on July 1, 1971. The closure of the chemical plant displaced 700 workers, and created a crisis that threatened not only the existence of the town, but of the entire region. In response, Virginia Highlands Community College (VHCC), in cooperation with the…

  5. Student perspectives of a graduate bridging course in astronomy and astrophysics in South Africa

    NASA Astrophysics Data System (ADS)

    Nwosu, Victoria; Demaree, Dedra; Li, Sissi; Allie, Saalih

    2011-10-01

    Astronomy and Astrophysics have been designated the flagship areas of research in South Africa. To this end, a national postgraduate structure, the National Astrophysics and Space Science Programme was established at the University of Cape Town. Despite overall success the programme has failed to recruit and retain Black South African students. In order to address this postgraduate bridging program, the Extended Honours Programme, was established to address the issue. An important part of the EHP includes a research component investigating the reasons for the lack of successful participation. In general, a numbers of issues have been identified including for example s specific difficulties with intermediate level physics, general learning problems and affective issues. We present preliminary results from recent interviews carried out with each cohort of students that entered the EHP over the past four years. Prior to each group interview each student completed a personal meaning map and an identity survey. Preliminary results of these data and the interviews will be discussed.

  6. South Africa's salt reduction strategy: Are we on track, and what lies ahead?

    PubMed

    Webster, J; Crickmore, C; Charlton, K; Steyn, K; Wentzel-Viljoen, E; Naidoo, P

    2016-12-21

    On 2 September 2016, 25 local and international participants from various sectors met in Cape Town to take stock of South Africa (SA)'s progress in salt reduction and develop a roadmap for action. SA is centre stage on salt reduction globally, being the first country to mandate salt reduction across a wide range of processed foods. Excessive salt intake contributed by processed foods and discretionary sources motivated SA to implement a public awareness campaign in parallel with legislation to reduce salt intake to the World Health Organization target of 5 g per day. Five priority areas were identified for continued action on salt reduction, including obtaining research funds for continued monitoring and compliance of salt reduction targets. Determining the contribution of foods eaten out of home to total salt intake and implementing strategies to address this sector were also highlighted as key actions. Lastly, implementing the next stage of the Salt Watch awareness campaign to change.

  7. Memories of Charles Townes

    NASA Astrophysics Data System (ADS)

    Garmire, Elsa

    2015-06-01

    Charles Townes, the Nobel laureate acclaimed for his pioneering work on lasers and nonlinear optics, sadly passed away in January this year. Here I offer personal reflections of working with him as one of his graduate students.

  8. Town Square for Kids.

    ERIC Educational Resources Information Center

    Parker, Dan

    2001-01-01

    Presents design features of the Dawson Elementary School (Corpus Chriti, Texas) where an atmosphere of an old town square and the feeling of community have been created. Photos and a floor plan are provided. (GR)

  9. Sub-Saharan Africa Report

    DTIC Science & Technology

    1986-12-29

    people. A forthcoming festival in Cape Town, spearheaded by the End Conscription Campaign and the UDF, takes as its title "Towards a People’s Culture...34.. Similarly motivated rallies, festivals and events have proliferated despite, or perhaps because of, the State of Emergency. Invitations are...the enemy is the ethnic one. Says Hlatshwayo, "We take traditional sayings and recitations that people use at their festivals ... that are dear to

  10. Learning from the Past: Supporting Teaching through the "Facing the Past" History Project in South Africa

    ERIC Educational Resources Information Center

    Tibbitts, Felisa

    2006-01-01

    This article presents an innovative professional development project, "Facing the Past-Transforming Our Future," developed collaboratively by the Western Cape Educational Department, the Cape Town Holocaust Centre (CTHC), and the US-based teacher professional development organization Facing History and Ourselves (FHAO). "Facing the…

  11. 33 CFR 80.525 - Cape Lookout, NC to Cape Fear, NC.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 33 Navigation and Navigable Waters 1 2012-07-01 2012-07-01 false Cape Lookout, NC to Cape Fear, NC... INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Fifth District § 80.525 Cape Lookout, NC to Cape Fear... southeast side of the Inlet. (g) Except as provided elsewhere in this section from Cape Lookout to Cape...

  12. 33 CFR 80.525 - Cape Lookout, NC to Cape Fear, NC.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 33 Navigation and Navigable Waters 1 2013-07-01 2013-07-01 false Cape Lookout, NC to Cape Fear, NC... INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Fifth District § 80.525 Cape Lookout, NC to Cape Fear...) Except as provided elsewhere in this section from Cape Lookout to Cape Fear, lines drawn parallel...

  13. 33 CFR 80.525 - Cape Lookout, NC to Cape Fear, NC.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 33 Navigation and Navigable Waters 1 2014-07-01 2014-07-01 false Cape Lookout, NC to Cape Fear, NC... INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Fifth District § 80.525 Cape Lookout, NC to Cape Fear...) Except as provided elsewhere in this section from Cape Lookout to Cape Fear, lines drawn parallel...

  14. 33 CFR 80.525 - Cape Lookout, NC to Cape Fear, NC.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Cape Lookout, NC to Cape Fear, NC... INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Fifth District § 80.525 Cape Lookout, NC to Cape Fear... southeast side of the Inlet. (g) Except as provided elsewhere in this section from Cape Lookout to Cape...

  15. 33 CFR 80.525 - Cape Lookout, NC to Cape Fear, NC.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Cape Lookout, NC to Cape Fear, NC... INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Fifth District § 80.525 Cape Lookout, NC to Cape Fear... southeast side of the Inlet. (g) Except as provided elsewhere in this section from Cape Lookout to Cape...

  16. Cape Baleia, Caravelas, Brazil

    NASA Technical Reports Server (NTRS)

    1993-01-01

    Cape Baleia (17.5N, 39.0W), on the north central coast of Brazil illustrates a good example of multiple coastal sand spits. Over a several thousand year time period, shifting regimes of wave and current patterns have piled up sand onto a series of beach ridges and tidal lagoons. Offshore, several prominent reefs and sandbanks can be seen paralleling the coast. The largest is the Recife da Pedra Grande (Big Rocks Reef).

  17. Social grants, welfare, and the incentive to trade-off health for income among individuals on HAART in South Africa.

    PubMed

    Venkataramani, Atheendar S; Maughan-Brown, Brendan; Nattrass, Nicoli; Ruger, Jennifer Prah

    2010-12-01

    South Africa's government disability grants are considered important in providing income support to low-income AIDS patients. Indeed, anecdotal evidence suggests that some individuals may opt to compromise their health by foregoing Highly Active Antiretroviral Treatment (HAART) to remain eligible for the grant. In this study, we examined the disability grant's importance to individual and household welfare, and the impact of its loss using a unique longitudinal dataset of HAART patients in Khayelitsha, Cape Town. We found that grant loss was associated with sizeable declines in income and changes in household composition. However, we found no evidence of individuals choosing poor health over grant loss. Our analysis also suggested that though the grants officially target those too sick to work, some people were able to keep grants longer than expected, and others received grants while employed. This has helped cushion people on HAART, but other welfare measures need consideration.

  18. The evolution of our knowledge of HIV-associated kidney disease in Africa.

    PubMed

    Swanepoel, Charles R; Wearne, Nicola; Duffield, Maureen S; Okpechi, Ikechi G

    2012-10-01

    Human immunodeficiency virus (HIV) infection started in Africa circa 1930. South Africa has the highest prevalence rate in the world. Although reports of HIV-associated nephropathy (HIVAN) appeared in the early 1980s, the earliest report from sub-Saharan Africa (SSA) came in 1994. Geographical, socioeconomic, political, and ethical factors have worked in concert to shape the character of HIV disease as it is seen in SSA. Political leaders within SSA have, through their actions, significantly contributed to the incidence of HIV infection. Black females, who often face cultural suppression and disadvantage, have a higher prevalence of HIV than males. Too few studies and outcomes data have bedeviled the statistics in SSA in relation to HIVAN prevalence and its management. Much of what is written is approximation and anecdotal. The largest reliable biopsy series comes from the University of Cape Town, where a workable classification of HIVAN has been developed to enable standardization of terminology. Histologic and clinical prognostic indicators with outcomes have been evaluated using this classification. Patients with HIV who present with acute kidney injury appear to have mainly acute tubular necrosis due to sepsis, dehydration, and nephrotoxic drugs. Since the rollout of combination antiretroviral therapy, the extent of HIV infection and kidney disease continues to be modified and possibly retarded.

  19. Edinburgh, the Scottish pioneers of anatomy and their lasting influence in South Africa.

    PubMed

    Correia, J C; Wessels, Q; Vorster, W

    2013-11-01

    The history of the origin of anatomy education in South Africa is the history of an arduous journey through time. The lasting influence of Edinburgh came in the form of Robert Black Thomson. He was a student and assistant of Sir William Turner who gave rise to the first chair of anatomy and the establishment of a department at the South African College, known today as University of Cape Town. Thomson was later succeeded by Matthew Drennan, a keen anthropologist, who was revered by his students. This Scottish link prevailed over time with the appointment of Edward Philip Stibbe as the chair of anatomy at the South African School of Mines and Technology, which later became the University of the Witwatersrand. Stibbe's successor, Raymond Arthur Dart, a graduate of the University of Sydney, was trained in an anatomy department sculpted on that of Edinburgh by Professor James Thomas Wilson. Wilson's influence at the University of Sydney can be traced back to Edinburgh and William Turner through Thomas Anderson Stuart. Both Dart and Robert Broom, another Scot, were considered as Africa's wild men by the late Professor Tobias. Here, the authors explore the Scottish link and origins of anatomy pedagogy in South Africa.

  20. Promoting sexual and reproductive health among adolescents in southern and eastern Africa (PREPARE): project design and conceptual framework

    PubMed Central

    2014-01-01

    Background Young people in sub-Saharan Africa are affected by the HIV pandemic to a greater extent than young people elsewhere and effective HIV-preventive intervention programmes are urgently needed. The present article presents the rationale behind an EU-funded research project (PREPARE) examining effects of community-based (school delivered) interventions conducted in four sites in sub-Saharan Africa. One intervention focuses on changing beliefs and cognitions related to sexual practices (Mankweng, Limpopo, South Africa). Another promotes improved parent-offspring communication on sexuality (Kampala, Uganda). Two further interventions are more comprehensive aiming to promote healthy sexual practices. One of these (Western Cape, South Africa) also aims to reduce intimate partner violence while the other (Dar es Salaam, Tanzania) utilises school-based peer education. Methods/design A modified Intervention Mapping approach is used to develop all programmes. Cluster randomised controlled trials of programmes delivered to school students aged 12–14 will be conducted in each study site. Schools will be randomly allocated (after matching or stratification) to intervention and delayed intervention arms. Baseline surveys at each site are followed by interventions and then by one (Kampala and Limpopo) or two (Western Cape and Dar es Salaam) post-intervention data collections. Questionnaires include questions common for all sites and are partly based on a set of social cognition models previously applied to the study of HIV-preventive behaviours. Data from all sites will be merged in order to compare prevalence and associations across sites on core variables. Power is set to .80 or higher and significance level to .05 or lower in order to detect intervention effects. Intraclass correlations will be estimated from previous surveys carried out at each site. Discussion We expect PREPARE interventions to have an impact on hypothesized determinants of risky sexual behaviour

  1. Gender, Development and Power. Some Issues and Methods for Gender Trainers. Report on a Workshop for Gender Trainers Held in the Western Cape, South Africa (August 29-September 1, 1993).

    ERIC Educational Resources Information Center

    Mackenzie, Liz

    Seventeen people from various parts of South Africa gathered at the Workshop for Gender Trainers to enhance their training and to focus on the gender and development approach. Sessions 1-2 on the second day dealt with gender training nightmares. During session 3, participants discussed what could have been done either to avoid the problems that…

  2. 77 FR 52106 - Shipping Coordinating Committee; Notice of Committee Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-28

    ... for the Safety of Fishing Vessels to be held at the Cape Town International Convention Centre (CTICC), Convention Square, 1 Lower Long Street, Cape Town, South Africa, from October 9- 11, 2012. The agenda...

  3. Biology and host range of the moth Digitivalva delaireae as one of two candidate agents for biological control of Cape-ivy

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cape-ivy (Delairea odorata, Asteraceae), native to coastal floodplains and mountains in eastern South Africa, is an invasive vine in coastal riparian, woodland and scrub habitats in California and southern Oregon, as well as mid-elevation regions on some of the Hawaiian Islands. Cape-ivy smothers na...

  4. Sexual behavior, pregnancy, and schooling among young people in urban South Africa.

    PubMed

    Marteleto, Letícia; Lam, David; Ranchhod, Vimal

    2008-12-01

    This study examines transitions in schooling, sexual activity, and pregnancy among adolescents and young adults in urban South Africa. Data are analyzed from the Cape Area Panel Study (CAPS), a recently collected longitudinal survey of young adults and their families in metropolitan Cape Town. We find that teen pregnancy is not entirely inconsistent with continued schooling, especially for African (black) women. More than 50 percent of African women who were pregnant at age 16 or 17 were enrolled in school the following year. We estimate probit regressions to identify the impact of individual and household characteristics on sexual debut, pregnancy, and school dropout between 2002 and 2005. We find that male and female students who performed well on a literacy and numeracy exam admin