Science.gov

Sample records for african gene pool

  1. Multiple and differentiated contributions to the male gene pool of pastoral and farmer populations of the African Sahel.

    PubMed

    Bučková, Jana; Cerný, Viktor; Novelletto, Andrea

    2013-05-01

    The African Sahel is conducive to studies of divergence/admixture genetic events as a result of its population history being so closely related with past climatic changes. Today, it is a place of the co-existence of two differing food-producing subsistence systems, i.e., that of sedentary farmers and nomadic pastoralists, whose populations have likely been formed from several dispersed indigenous hunter-gatherer groups. Using new methodology, we show here that the male gene pool of the extant populations of the African Sahel harbors signatures of multiple and differentiated contributions from different genetic sources. We also show that even if the Fulani pastoralists and their neighboring farmers share high frequencies of four Y chromosome subhaplogroups of E, they have drawn on molecularly differentiated subgroups at different times. These findings, based on combinations of SNP and STR polymorphisms, add to our previous knowledge and highlight the role of differences in the demographic history and displacements of the Sahelian populations as a major factor in the segregation of the Y chromosome lineages in Africa. Interestingly, within the Fulani pastoralist population as a whole, a differentiation of the groups from Niger is characterized by their high presence of R1b-M343 and E1b1b1-M35. Moreover, the R1b-M343 is represented in our dataset exclusively in the Fulani group and our analyses infer a north-to-south African migration route during a recent past.

  2. Linking the sub-Saharan and West Eurasian gene pools: maternal and paternal heritage of the Tuareg nomads from the African Sahel

    PubMed Central

    Pereira, Luísa; Černý, Viktor; Cerezo, María; Silva, Nuno M; Hájek, Martin; Vašíková, Alžběta; Kujanová, Martina; Brdička, Radim; Salas, Antonio

    2010-01-01

    The Tuareg presently live in the Sahara and the Sahel. Their ancestors are commonly believed to be the Garamantes of the Libyan Fezzan, ever since it was suggested by authors of antiquity. Biological evidence, based on classical genetic markers, however, indicates kinship with the Beja of Eastern Sudan. Our study of mitochondrial DNA (mtDNA) sequences and Y chromosome SNPs of three different southern Tuareg groups from Mali, Burkina Faso and the Republic of Niger reveals a West Eurasian-North African composition of their gene pool. The data show that certain genetic lineages could not have been introduced into this population earlier than ∼9000 years ago whereas local expansions establish a minimal date at around 3000 years ago. Some of the mtDNA haplogroups observed in the Tuareg population were involved in the post-Last Glacial Maximum human expansion from Iberian refugia towards both Europe and North Africa. Interestingly, no Near Eastern mtDNA lineages connected with the Neolithic expansion have been observed in our population sample. On the other hand, the Y chromosome SNPs data show that the paternal lineages can very probably be traced to the Near Eastern Neolithic demic expansion towards North Africa, a period that is otherwise concordant with the above-mentioned mtDNA expansion. The time frame for the migration of the Tuareg towards the African Sahel belt overlaps that of early Holocene climatic changes across the Sahara (from the optimal greening ∼10 000 YBP to the extant aridity beginning at ∼6000 YBP) and the migrations of other African nomadic peoples in the area. PMID:20234393

  3. Decrypting the Mitochondrial Gene Pool of Modern Panamanians

    PubMed Central

    Angerhofer, Norman; Ekins, Jayne E.; Olivieri, Anna; Woodward, Scott R.; Pascale, Juan Miguel; Cooke, Richard; Motta, Jorge; Achilli, Alessandro

    2012-01-01

    The Isthmus of Panama–the narrow neck of land connecting the northern and southern American landmasses–was an obligatory corridor for the Paleo-Indians as they moved into South America. Archaeological evidence suggests an unbroken link between modern natives and their Paleo-Indian ancestors in some areas of Panama, even if the surviving indigenous groups account for only 12.3% of the total population. To evaluate if modern Panamanians have retained a larger fraction of the native pre-Columbian gene pool in their maternally-inherited mitochondrial genome, DNA samples and historical records were collected from more than 1500 volunteer participants living in the nine provinces and four indigenous territories of the Republic. Due to recent gene-flow, we detected ∼14% African mitochondrial lineages, confirming the demographic impact of the Atlantic slave trade and subsequent African immigration into Panama from Caribbean islands, and a small European (∼2%) component, indicating only a minor influence of colonialism on the maternal side. The majority (∼83%) of Panamanian mtDNAs clustered into native pan-American lineages, mostly represented by haplogroup A2 (51%). These findings reveal an overwhelming native maternal legacy in today's Panama, which is in contrast with the overall concept of personal identity shared by many Panamanians. Moreover, the A2 sub-clades A2ad and A2af (with the previously named 6 bp Huetar deletion), when analyzed at the maximum level of resolution (26 entire mitochondrial genomes), confirm the major role of the Pacific coastal path in the peopling of North, Central and South America, and testify to the antiquity of native mitochondrial genomes in Panama. PMID:22675545

  4. Decrypting the mitochondrial gene pool of modern Panamanians.

    PubMed

    Perego, Ugo A; Lancioni, Hovirag; Tribaldos, Maribel; Angerhofer, Norman; Ekins, Jayne E; Olivieri, Anna; Woodward, Scott R; Pascale, Juan Miguel; Cooke, Richard; Motta, Jorge; Achilli, Alessandro

    2012-01-01

    The Isthmus of Panama--the narrow neck of land connecting the northern and southern American landmasses--was an obligatory corridor for the Paleo-Indians as they moved into South America. Archaeological evidence suggests an unbroken link between modern natives and their Paleo-Indian ancestors in some areas of Panama, even if the surviving indigenous groups account for only 12.3% of the total population. To evaluate if modern Panamanians have retained a larger fraction of the native pre-Columbian gene pool in their maternally-inherited mitochondrial genome, DNA samples and historical records were collected from more than 1500 volunteer participants living in the nine provinces and four indigenous territories of the Republic. Due to recent gene-flow, we detected ~14% African mitochondrial lineages, confirming the demographic impact of the Atlantic slave trade and subsequent African immigration into Panama from Caribbean islands, and a small European (~2%) component, indicating only a minor influence of colonialism on the maternal side. The majority (~83%) of Panamanian mtDNAs clustered into native pan-American lineages, mostly represented by haplogroup A2 (51%). These findings reveal an overwhelming native maternal legacy in today's Panama, which is in contrast with the overall concept of personal identity shared by many Panamanians. Moreover, the A2 sub-clades A2ad and A2af (with the previously named 6 bp Huetar deletion), when analyzed at the maximum level of resolution (26 entire mitochondrial genomes), confirm the major role of the Pacific coastal path in the peopling of North, Central and South America, and testify to the antiquity of native mitochondrial genomes in Panama.

  5. Possible effect of biotechnology on plant gene pools in Turkey

    PubMed Central

    Demir, Aynur

    2015-01-01

    The recent rapid developments in biotechnology have made great contributions to the study of plant gene pools. The application of in vitro methods in freeze storage and DNA protection techniques in fast production studies has made major advances. From that aspect, biotechnology is an indispensable means for the protection of plant gene pools, which includes the insurance of sustainable agriculture and development of species. Besides all the positive developments, one of the primary risks posed by the uncontrolled spreading of genetically modified organisms is the possibility for other non-target organisms to be negatively affected. Genes of plant origin should be given priority in this type of studies by taking into consideration such negative effects that may result in disruption of ecological balance and damage to plant genetic pools. Turkey, due to its ecological conditions and history, has a very important position in terms of plant gene pools. This richness ought to be protected without corrupting its natural quality and natural evolution process in order to provide the sources of species that will be required for future sustainable agricultural applications. Thus, attention should be paid to the use of biotechnological methods, which play an important role especially in the protection and use of local and original plant gene pools. PMID:26019612

  6. A pooled analysis of body mass index and mortality among African Americans.

    PubMed

    Cohen, Sarah S; Park, Yikyung; Signorello, Lisa B; Patel, Alpa V; Boggs, Deborah A; Kolonel, Laurence N; Kitahara, Cari M; Knutsen, Synnove F; Gillanders, Elizabeth; Monroe, Kristine R; Berrington de Gonzalez, Amy; Bethea, Traci N; Black, Amanda; Fraser, Gary; Gapstur, Susan; Hartge, Patricia; Matthews, Charles E; Park, Song-Yi; Purdue, Mark P; Singh, Pramil; Harvey, Chinonye; Blot, William J; Palmer, Julie R

    2014-01-01

    Pooled analyses among whites and East Asians have demonstrated positive associations between all-cause mortality and body mass index (BMI), but studies of African Americans have yielded less consistent results. We examined the association between BMI and all-cause mortality in a sample of African Americans pooled from seven prospective cohort studies: NIH-AARP, 1995-2009; Adventist Health Study 2, 2002-2008; Black Women's Health Study, 1995-2009; Cancer Prevention Study II, 1982-2008; Multiethnic Cohort Study, 1993-2007; Prostate, Lung, Colorectal and Ovarian Screening Trial, 1993-2009; Southern Community Cohort Study, 2002-2009. 239,526 African Americans (including 100,175 never smokers without baseline heart disease, stroke, or cancer), age 30-104 (mean 52) and 71% female, were followed up to 26.5 years (mean 11.7). Hazard ratios (HR) and 95% confidence intervals (CI) for mortality were derived from multivariate Cox proportional hazards models. Among healthy, never smokers (11,386 deaths), HRs (CI) for BMI 25-27.4, 27.5-29.9, 30-34.9, 35-39.9, 40-49.9, and 50-60 kg/m(2) were 1.02 (0.92-1.12), 1.06 (0.95-1.18), 1.32 (1.18-1.47), 1.54 (1.29-1.83), 1.93 (1.46-2.56), and 1.93 (0.80-4.69), respectively among men and 1.06 (0.99-1.15), 1.15 (1.06-1.25), 1.24 (1.15-1.34), 1.58 (1.43-1.74), 1.80 (1.60-2.02), and 2.31 (1.74-3.07) respectively among women (reference category 22.5-24.9). HRs were highest among those with the highest educational attainment, longest follow-up, and for cardiovascular disease mortality. Obesity was associated with a higher risk of mortality in African Americans, similar to that observed in pooled analyses of whites and East Asians. This study provides compelling evidence to support public health efforts to prevent excess weight gain and obesity in African Americans.

  7. First Detection of Mycobacteria in African Rodents and Insectivores, Using Stratified Pool Screening▿ †

    PubMed Central

    Durnez, Lies; Eddyani, Miriam; Mgode, Georgies F.; Katakweba, Abdul; Katholi, Charles R.; Machang'u, Robert R.; Kazwala, Rudovik R.; Portaels, Françoise; Leirs, Herwig

    2008-01-01

    With the rising number of patients with human immunodeficiency virus (HIV)/AIDS in developing countries, the control of mycobacteria is of growing importance. Previous studies have shown that rodents and insectivores are carriers of mycobacteria. However, it is not clear how widespread mycobacteria are in these animals and what their role is in spreading them. Therefore, the prevalence of mycobacteria in rodents and insectivores was studied in and around Morogoro, Tanzania. Live rodents were trapped, with three types of live traps, in three habitats. Pieces of organs were pooled per habitat, species, and organ type (stratified pooling); these sample pools were examined for the presence of mycobacteria by PCR, microscopy, and culture methods. The mycobacterial isolates were identified using phenotypic techniques and sequencing. In total, 708 small mammals were collected, 31 of which were shrews. By pool prevalence estimation, 2.65% of the animals were carriers of mycobacteria, with a higher prevalence in the urban areas and in Cricetomys gambianus and the insectivore Crocidura hirta. Nontuberculous mycobacteria (Mycobacterium chimaera, M. intracellulare, M. arupense, M. parascrofulaceum, and Mycobacterium spp.) were isolated from C. gambianus, Mastomys natalensis, and C. hirta. This study is the first to report findings of mycobacteria in African rodents and insectivores and the first in mycobacterial ecology to estimate the prevalence of mycobacteria after stratified pool screening. The fact that small mammals in urban areas carry more mycobacteria than those in the fields and that potentially pathogenic mycobacteria were isolated identifies a risk for other animals and humans, especially HIV/AIDS patients, that have a weakened immune system. PMID:18065608

  8. First detection of mycobacteria in African rodents and insectivores, using stratified pool screening.

    PubMed

    Durnez, Lies; Eddyani, Miriam; Mgode, Georgies F; Katakweba, Abdul; Katholi, Charles R; Machang'u, Robert R; Kazwala, Rudovik R; Portaels, Françoise; Leirs, Herwig

    2008-02-01

    With the rising number of patients with human immunodeficiency virus (HIV)/AIDS in developing countries, the control of mycobacteria is of growing importance. Previous studies have shown that rodents and insectivores are carriers of mycobacteria. However, it is not clear how widespread mycobacteria are in these animals and what their role is in spreading them. Therefore, the prevalence of mycobacteria in rodents and insectivores was studied in and around Morogoro, Tanzania. Live rodents were trapped, with three types of live traps, in three habitats. Pieces of organs were pooled per habitat, species, and organ type (stratified pooling); these sample pools were examined for the presence of mycobacteria by PCR, microscopy, and culture methods. The mycobacterial isolates were identified using phenotypic techniques and sequencing. In total, 708 small mammals were collected, 31 of which were shrews. By pool prevalence estimation, 2.65% of the animals were carriers of mycobacteria, with a higher prevalence in the urban areas and in Cricetomys gambianus and the insectivore Crocidura hirta. Nontuberculous mycobacteria (Mycobacterium chimaera, M. intracellulare, M. arupense, M. parascrofulaceum, and Mycobacterium spp.) were isolated from C. gambianus, Mastomys natalensis, and C. hirta. This study is the first to report findings of mycobacteria in African rodents and insectivores and the first in mycobacterial ecology to estimate the prevalence of mycobacteria after stratified pool screening. The fact that small mammals in urban areas carry more mycobacteria than those in the fields and that potentially pathogenic mycobacteria were isolated identifies a risk for other animals and humans, especially HIV/AIDS patients, that have a weakened immune system.

  9. Novel recurrently mutated genes in African American colon cancers

    PubMed Central

    Guda, Kishore; Veigl, Martina L.; Varadan, Vinay; Nosrati, Arman; Ravi, Lakshmeswari; Lutterbaugh, James; Beard, Lydia; Willson, James K. V.; Sedwick, W. David; Wang, Zhenghe John; Molyneaux, Neil; Miron, Alexander; Adams, Mark D.; Elston, Robert C.; Markowitz, Sanford D.; Willis, Joseph E.

    2015-01-01

    We used whole-exome and targeted sequencing to characterize somatic mutations in 103 colorectal cancers (CRC) from African Americans, identifying 20 new genes as significantly mutated in CRC. Resequencing 129 Caucasian derived CRCs confirmed a 15-gene set as a preferential target for mutations in African American CRCs. Two predominant genes, ephrin type A receptor 6 (EPHA6) and folliculin (FLCN), with mutations exclusive to African American CRCs, are by genetic and biological criteria highly likely African American CRC driver genes. These previously unsuspected differences in the mutational landscapes of CRCs arising among individuals of different ethnicities have potential to impact on broader disparities in cancer behaviors. PMID:25583493

  10. Somatic mutation spectrum of non-small cell lung cancer in African Americans: a pooled analysis

    PubMed Central

    Araujo, Luiz H.; Lammers, Philip E.; Matthews-Smith, Velmalia; Eisenberg, Rosana; Gonzalez, Adriana; Schwartz, Ann G.; Timmers, Cynthia; Shilo, Konstantin; Zhao, Weiqiang; Natarajan, Thanemozhi G.; Zhang, Jianying; Yilmaz, Ayse Selen; Liu, Tom; Coombes, Kevin; Carbone, David P.

    2015-01-01

    Introduction The mutational profile of non-small cell lung cancer (NSCLC) has become an important tool in tailoring therapy to patients, with clear differences according to the population of origin. African Americans have higher lung cancer incidence and mortality than Caucasians, yet discrepant results have been reported regarding the frequency of somatic driver mutations. We hypothesized that NSCLC has a distinct mutational profile in this group. Methods We collected NSCLC samples resected from self-reported African Americans in five sites from Tennessee, Michigan, and Ohio. Gene mutations were assessed by either SNaPshot or next generation sequencing, and ALK translocations were evaluated by fluorescence in situ hybridization. Results Two hundred sixty patients were included, mostly males (62.3%) and smokers (86.6%). Eighty-one samples (31.2%) were squamous cell carcinomas. The most frequently mutated genes were KRAS (15.4%), EGFR (5.0%), PIK3CA (0.8%), BRAF, NRAS, ERBB2, and AKT1 (0.4% each). ALK translocations were detected in 2 non-squamous tumors (1.7%), totaling 61 cases (23.5%) with driver oncogenic alterations. Among 179 non-squamous samples, 54 (30.2%) presented a driver alteration. The frequency of driver alterations altogether was lower than that reported in Caucasians, while no difference was detected in either EGFR or KRAS mutations. Overall survival was longer among patients with EGFR mutations. Conclusions We demonstrated that NSCLC from African Americans has a different pattern of somatic driver mutations than from Caucasians. The majority of driver alterations in this group are yet to be described, which will require more comprehensive panels and assessment of non-canonical alterations. PMID:26301800

  11. Frozen gene pools - A future for species otherwise destined for extinction

    USGS Publications Warehouse

    Gee, G.F.

    1986-01-01

    Conclusion: Semen banks and ova and embryo banks can be practical methods to maintain gene pools. Gene pool preservation is desperately needed today due to the rapid decline in number of species and their habitat, a matter that is of concern to.biologists, economists, and politicians worldwide. Techniques are available for the cryopreservation of semen from many animals (and embryos from a few mammals) and adaptations of these techniques to other animals should be possible. A frozen gene pool in conjunction with existing programs makes it possible to preserve gene pools at less cost or in.some cases where no other alternative to extinction existed.

  12. [The gene pool of native inhabitants of the Samburg tundra].

    PubMed

    Osipova, L P; Posukh, O L; Ivakin, E A; Kriukov, Iu A; Karafet, T M

    1996-06-01

    This study continues a series of investigations of the gene pool of native Siberian ethnic groups. In a population of Tundra Nentsi (Northern Samoyeds) and a group of Komi-Zyryans (Finno-Ugrian) (Samburg settlement, Tyumenskaya oblast, Yamalo-Nenetskii Autonomous okrug), gene markers of the following genetic systems were studied: blood groups (ABO, MNSs, Rhesus, Kell, Duffy, and P), erythrocyte acid phosphatase (AcP), phosphoglucomutase 1 (PGM 1), haptoglobin (Hp), and transferrin (Tf). The population of Samburg Tundra Nentsi was shown to have a close genetic relationship with the "core" of the Forest Nentsi population. In Northern Samoyeds, three carriers of the rare allele K (blood group Kell) were found for the first time. It is suggested that this allele was transferred into the population of Tundra Nentsi from Komi. Samburg Tundra Nentsi are found to have the maximum frequency of the allele PGM 1 (Posphoglucomutase 1) among aboriginal populations of northern Asia. Analysis of original data and the literature revealed a significant genetic distance between the Komi and Northern Samoyed populations. It was shown that Samburg Komi occupy an intermediate position between the clusters of Nenets populations and Finno-Ugrians (Komi) living in Komi Republic.

  13. Ethiopian genetic diversity reveals linguistic stratification and complex influences on the Ethiopian gene pool.

    PubMed

    Pagani, Luca; Kivisild, Toomas; Tarekegn, Ayele; Ekong, Rosemary; Plaster, Chris; Gallego Romero, Irene; Ayub, Qasim; Mehdi, S Qasim; Thomas, Mark G; Luiselli, Donata; Bekele, Endashaw; Bradman, Neil; Balding, David J; Tyler-Smith, Chris

    2012-07-13

    Humans and their ancestors have traversed the Ethiopian landscape for millions of years, and present-day Ethiopians show great cultural, linguistic, and historical diversity, which makes them essential for understanding African variability and human origins. We genotyped 235 individuals from ten Ethiopian and two neighboring (South Sudanese and Somali) populations on an Illumina Omni 1M chip. Genotypes were compared with published data from several African and non-African populations. Principal-component and STRUCTURE-like analyses confirmed substantial genetic diversity both within and between populations, and revealed a match between genetic data and linguistic affiliation. Using comparisons with African and non-African reference samples in 40-SNP genomic windows, we identified "African" and "non-African" haplotypic components for each Ethiopian individual. The non-African component, which includes the SLC24A5 allele associated with light skin pigmentation in Europeans, may represent gene flow into Africa, which we estimate to have occurred ~3 thousand years ago (kya). The non-African component was found to be more similar to populations inhabiting the Levant rather than the Arabian Peninsula, but the principal route for the expansion out of Africa ~60 kya remains unresolved. Linkage-disequilibrium decay with genomic distance was less rapid in both the whole genome and the African component than in southern African samples, suggesting a less ancient history for Ethiopian populations.

  14. Ethiopian Genetic Diversity Reveals Linguistic Stratification and Complex Influences on the Ethiopian Gene Pool

    PubMed Central

    Pagani, Luca; Kivisild, Toomas; Tarekegn, Ayele; Ekong, Rosemary; Plaster, Chris; Gallego Romero, Irene; Ayub, Qasim; Mehdi, S. Qasim; Thomas, Mark G.; Luiselli, Donata; Bekele, Endashaw; Bradman, Neil; Balding, David J.; Tyler-Smith, Chris

    2012-01-01

    Humans and their ancestors have traversed the Ethiopian landscape for millions of years, and present-day Ethiopians show great cultural, linguistic, and historical diversity, which makes them essential for understanding African variability and human origins. We genotyped 235 individuals from ten Ethiopian and two neighboring (South Sudanese and Somali) populations on an Illumina Omni 1M chip. Genotypes were compared with published data from several African and non-African populations. Principal-component and STRUCTURE-like analyses confirmed substantial genetic diversity both within and between populations, and revealed a match between genetic data and linguistic affiliation. Using comparisons with African and non-African reference samples in 40-SNP genomic windows, we identified “African” and “non-African” haplotypic components for each Ethiopian individual. The non-African component, which includes the SLC24A5 allele associated with light skin pigmentation in Europeans, may represent gene flow into Africa, which we estimate to have occurred ∼3 thousand years ago (kya). The non-African component was found to be more similar to populations inhabiting the Levant rather than the Arabian Peninsula, but the principal route for the expansion out of Africa ∼60 kya remains unresolved. Linkage-disequilibrium decay with genomic distance was less rapid in both the whole genome and the African component than in southern African samples, suggesting a less ancient history for Ethiopian populations. PMID:22726845

  15. Microclimatic differentiation of gene pools in the Lobaria pulmonaria symbiosis in a primeval forest landscape.

    PubMed

    Nadyeina, Olga; Dymytrova, Lyudmyla; Naumovych, Anna; Postoyalkin, Sergyi; Werth, Silke; Cheenacharoen, Saran; Scheidegger, Christoph

    2014-11-01

    Population genetics of the tree-colonizing lichen Lobaria pulmonaria were studied in the largest primeval beech forest of Europe, covering 10 000 ha. During an intensive survey of the area, we collected 1522 thallus fragments originating from 483 trees, which were genotyped with eight mycobiont- and 14 photobiont-specific microsatellite markers. The mycobiont and photobiont of L. pulmonaria were found to consist of two distinct gene pools, which are co-existing within small areas of 3-180 ha in a homogeneous beech forest. The small-scale distribution pattern of the symbiotic gene pools show habitat partitioning of lineages associated with either floodplains or mountain forests. Using approximate Bayesian computation (ABC), we dated the divergence of the two fungal gene pools of L. pulmonaria as the Early Pleistocene. Both fungal gene pools survived the Pleistocene glacial cycles in the Carpathians, although possibly in climatically different refugia. Fungal diversification prior to these cycles and the selection of photobionts with different altitudinal distributions explain the current sympatric, but ecologically differentiated habitat partitioning of L. pulmonaria. In addition, the habitat preferences of the mycobiont are determined by other factors and are rather independent of those of the photobiont at the landscape level. The distinct gene pools should be considered evolutionarily significant units and deserve specific conservation priorities in the future, for example gene pool A, which is a Pliocene relict.

  16. Short-term benefits from central unit commitment and dispatch: Application to the Southern African Power Pool

    NASA Astrophysics Data System (ADS)

    Bowen, Brian Hugh

    1998-12-01

    Electricity utilities in the Southern African region are conscious that gains could be made from more economically efficient trading but have had no tools with which to analyze the effects of a change in policy. This research is the first to provide transparent quantitative techniques to quantify the impacts of new trading arrangements in this region. The study poses a model of the recently formed Southern African Power Pool, built with the collaboration of the region's national utilities to represent each country's demand and generation/transmission system. The multi-region model includes commitment and dispatch from diverse hydrothermal sources over a vast area. Economic gains are determined by comparing the total costs under free-trade conditions with those from the existing fixed-trade bilateral arrangements. The objective function minimizes production costs needed to meet total demand, subject to each utility's constraints for thermal and hydro generation, transmission, load balance and losses. Linearized thermal cost functions are used along with linearized input output hydropower plant curves and hydrothermal on/off status variables to formulate a mixed-integer programming problem. Results from the modeling show that moving to optimal trading patterns could save between 70 million and 130 million per year. With free-trade policies the quantity of power flow between utilities is doubled and maximum usage is made of the hydropower stations thus reducing costs and fuel use. In electricity exporting countries such as Zambia and Mozambique gains from increased trade are achieved which equal 16% and 18% respectively of the value of their total manufactured exports. A sensitivity analysis is conducted on the possible effects of derating generation, derating transmission and reducing water inflows but gains remain large. Maximum economic gains from optimal trading patterns can be achieved by each country allowing centralized control through the newly founded SAPP

  17. Genetic diversity, inter-gene pool introgression and nutritional quality of common beans (Phaseolus vulgaris L.) from Central Africa.

    PubMed

    Blair, Matthew W; González, Laura F; Kimani, Paul M; Butare, Louis

    2010-07-01

    The Great Lakes region of Central Africa is a major producer of common beans in Africa. The region is known for high population density and small average farm size. The common bean represents the most important legume crop of the region, grown on over a third of the cultivated land area, and the per capita consumption is among the highest in the world for the food crop. The objective of this study was to evaluate the genetic diversity in a collection of 365 genotypes from the Great Lakes region of Central Africa, including a large group of landraces from Rwanda as well as varieties from primary centers of diversity and from neighboring countries of Central Africa, such as the Democratic Republic of Congo and Uganda, using 30 fluorescently labeled microsatellite markers and automated allele detection. In addition, the landraces were evaluated for their seed iron and zinc concentration to determine if genetic diversity influenced nutritional quality. Principal coordinate and neighbor-joining analyses allowed the separation of the landraces into 132 Andean and 195 Mesoamerican (or Middle American) genotypes with 32 landraces and 6 varieties intermediate between the gene pools and representing inter-gene pool introgression in terms of seed characteristics and alleles. Genetic diversity and the number of alleles were high for the collection, reflecting the preference for a wide range of seed types in the region and no strong commercial class preference, although red, red mottled and brown seeded beans were common. Observed heterozygosity was also high and may be explained by the common practice of maintaining seed and plant mixtures, a coping strategy practiced by Central African farmers to reduce the effects of abiotic and biotic stresses. Finally, nutritional quality differed between the gene pools with respect to seed iron and zinc concentration, while genotypes from the intermediate group were notably high in both minerals. In conclusion, this study has shown that

  18. Deinococcus geothermalis: The Pool of Extreme Radiation Resistance Genes Shrinks

    SciTech Connect

    Makarova, Kira S.; Omelchenko, Marina V.; Gaidamakova, Elena K.; Matrosova, Vera Y.; Vasilenko, Alexander; Zhai, Min; Lapidus, Alla; Copeland, Alex; Kim, Edwin; Land, Miriam; Mavrommatis, Konstantinos; Pitluck, Samuel; Richardson, Paul M.; Detter, Chris; Brettin, Thomas; Saunders, Elizabeth; Lai, Barry; Ravel, Bruce; Kemner, Kenneth M.; Wolf, Yuri I.; Sorokin, Alexander; Gerasimova, Anna V.; Gelfand, Mikhail S.; Fredrickson, James K.; Koonin, Eugene V.; Daly, Michael J.

    2007-07-24

    Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR), ultraviolet light (UV) and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at itsoptimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and contribute to

  19. Deinococcus geothermalis: The Pool of Extreme Radiation Resistance Genes Shrinks

    SciTech Connect

    Makarova, Kira S.; Omelchenko, Marina; Gaidamakova, Elena; Matrosova, Vera; Vasilenko, Alexander; Zhai, Min; Lapidus, Alla L.; Copeland, A; Kim, Edwin; Land, Miriam L; Mavromatis, K; Pitluck, Samual; Richardson, P M; Detter, J. Chris; Brettin, Tom; Saunders, Elizabeth H; Lai, Barry; Ravel, Bruce; Kemner, Kenneth M; Wolf, Yuri; Sorokin, Alexei; Gerasimova, Anna; Gelfand, Mikhail; Fredrickson, James K; Koonin, Eugene; Daly, Michael

    2007-01-01

    Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR), ultraviolet light (UV) and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at its optimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and contribute to

  20. Origins of pandemic Vibrio cholerae from environmental gene pools.

    PubMed

    Shapiro, B Jesse; Levade, Inès; Kovacikova, Gabriela; Taylor, Ronald K; Almagro-Moreno, Salvador

    2016-12-19

    Some microorganisms can transition from an environmental lifestyle to a pathogenic one(1-3). This ecological switch typically occurs through the acquisition of horizontally acquired virulence genes(4,5). However, the genomic features that must be present in a population before the acquisition of virulence genes and emergence of pathogenic clones remain unknown. We hypothesized that virulence adaptive polymorphisms (VAPs) circulate in environmental populations and are required for this transition. We developed a comparative genomic framework for identifying VAPs, using Vibrio cholerae as a model. We then characterized several environmental VAP alleles to show that while some of them reduced the ability of clinical strains to colonize a mammalian host, other alleles conferred efficient host colonization. These results show that VAPs are present in environmental bacterial populations before the emergence of virulent clones. We propose a scenario in which VAPs circulate in the environment and become selected and enriched under certain ecological conditions, and finally a genomic background containing several VAPs acquires virulence factors that allow for its emergence as a pathogenic clone.

  1. Parts & pools: a framework for modular design of synthetic gene circuits.

    PubMed

    Marchisio, Mario Andrea

    2014-01-01

    Published in 2008, Parts & Pools represents one of the first attempts to conceptualize the modular design of bacterial synthetic gene circuits with Standard Biological Parts (DNA segments) and Pools of molecules referred to as common signal carriers (e.g., RNA polymerases and ribosomes). The original framework for modeling bacterial components and designing prokaryotic circuits evolved over the last years and brought, first, to the development of an algorithm for the automatic design of Boolean gene circuits. This is a remarkable achievement since gene digital circuits have a broad range of applications that goes from biosensors for health and environment care to computational devices. More recently, Parts & Pools was enabled to give a proper formal description of eukaryotic biological circuit components. This was possible by employing a rule-based modeling approach, a technique that permits a faithful calculation of all the species and reactions involved in complex systems such as eukaryotic cells and compartments. In this way, Parts & Pools is currently suitable for the visual and modular design of synthetic gene circuits in yeast and mammalian cells too.

  2. Life Styles of African Women [And] A Swimming Pool for Mansa Musa's Wife [And] A Yoruba Naming Ceremony [And] Metropolis: African and American Style. Mini-Modules.

    ERIC Educational Resources Information Center

    African-American Inst., New York, NY. School Services Div.

    Four modules dealing with African culture are combined in this document. The first module discusses various life-styles of African women, including warrior, queen, ruler, and matriarch. A lesson plan uses a question-and-answer format to encourage discussion of the effects of tradition, society, and nation upon African women. Questions asked…

  3. From single-cell to cell-pool transcriptomes: stochasticity in gene expression and RNA splicing.

    PubMed

    Marinov, Georgi K; Williams, Brian A; McCue, Ken; Schroth, Gary P; Gertz, Jason; Myers, Richard M; Wold, Barbara J

    2014-03-01

    Single-cell RNA-seq mammalian transcriptome studies are at an early stage in uncovering cell-to-cell variation in gene expression, transcript processing and editing, and regulatory module activity. Despite great progress recently, substantial challenges remain, including discriminating biological variation from technical noise. Here we apply the SMART-seq single-cell RNA-seq protocol to study the reference lymphoblastoid cell line GM12878. By using spike-in quantification standards, we estimate the absolute number of RNA molecules per cell for each gene and find significant variation in total mRNA content: between 50,000 and 300,000 transcripts per cell. We directly measure technical stochasticity by a pool/split design and find that there are significant differences in expression between individual cells, over and above technical variation. Specific gene coexpression modules were preferentially expressed in subsets of individual cells, including one enriched for mRNA processing and splicing factors. We assess cell-to-cell variation in alternative splicing and allelic bias and report evidence of significant differences in splice site usage that exceed splice variation in the pool/split comparison. Finally, we show that transcriptomes from small pools of 30-100 cells approach the information content and reproducibility of contemporary RNA-seq from large amounts of input material. Together, our results define an experimental and computational path forward for analyzing gene expression in rare cell types and cell states.

  4. Pooled Sequencing of Candidate Genes Implicates Rare Variants in the Development of Asthma Following Severe RSV Bronchiolitis in Infancy.

    PubMed

    Torgerson, Dara G; Giri, Tusar; Druley, Todd E; Zheng, Jie; Huntsman, Scott; Seibold, Max A; Young, Andrew L; Schweiger, Toni; Yin-Declue, Huiqing; Sajol, Geneline D; Schechtman, Kenneth B; Hernandez, Ryan D; Randolph, Adrienne G; Bacharier, Leonard B; Castro, Mario

    2015-01-01

    Severe infection with respiratory syncytial virus (RSV) during infancy is strongly associated with the development of asthma. To identify genetic variation that contributes to asthma following severe RSV bronchiolitis during infancy, we sequenced the coding exons of 131 asthma candidate genes in 182 European and African American children with severe RSV bronchiolitis in infancy using anonymous pools for variant discovery, and then directly genotyped a set of 190 nonsynonymous variants. Association testing was performed for physician-diagnosed asthma before the 7th birthday (asthma) using genotypes from 6,500 individuals from the Exome Sequencing Project (ESP) as controls to gain statistical power. In addition, among patients with severe RSV bronchiolitis during infancy, we examined genetic associations with asthma, active asthma, persistent wheeze, and bronchial hyperreactivity (methacholine PC20) at age 6 years. We identified four rare nonsynonymous variants that were significantly associated with asthma following severe RSV bronchiolitis, including single variants in ADRB2, FLG and NCAM1 in European Americans (p = 4.6x10-4, 1.9x10-13 and 5.0x10-5, respectively), and NOS1 in African Americans (p = 2.3x10-11). One of the variants was a highly functional nonsynonymous variant in ADRB2 (rs1800888), which was also nominally associated with asthma (p = 0.027) and active asthma (p = 0.013) among European Americans with severe RSV bronchiolitis without including the ESP. Our results suggest that rare nonsynonymous variants contribute to the development of asthma following severe RSV bronchiolitis in infancy, notably in ADRB2. Additional studies are required to explore the role of rare variants in the etiology of asthma and asthma-related traits following severe RSV bronchiolitis.

  5. Pooled Sequencing of Candidate Genes Implicates Rare Variants in the Development of Asthma Following Severe RSV Bronchiolitis in Infancy

    PubMed Central

    Torgerson, Dara G.; Giri, Tusar; Druley, Todd E.; Zheng, Jie; Huntsman, Scott; Seibold, Max A.; Young, Andrew L.; Schweiger, Toni; Yin-Declue, Huiqing; Sajol, Geneline D.; Schechtman, Kenneth B; Hernandez, Ryan D.; Randolph, Adrienne G.; Bacharier, Leonard B.; Castro, Mario

    2015-01-01

    Severe infection with respiratory syncytial virus (RSV) during infancy is strongly associated with the development of asthma. To identify genetic variation that contributes to asthma following severe RSV bronchiolitis during infancy, we sequenced the coding exons of 131 asthma candidate genes in 182 European and African American children with severe RSV bronchiolitis in infancy using anonymous pools for variant discovery, and then directly genotyped a set of 190 nonsynonymous variants. Association testing was performed for physician-diagnosed asthma before the 7th birthday (asthma) using genotypes from 6,500 individuals from the Exome Sequencing Project (ESP) as controls to gain statistical power. In addition, among patients with severe RSV bronchiolitis during infancy, we examined genetic associations with asthma, active asthma, persistent wheeze, and bronchial hyperreactivity (methacholine PC20) at age 6 years. We identified four rare nonsynonymous variants that were significantly associated with asthma following severe RSV bronchiolitis, including single variants in ADRB2, FLG and NCAM1 in European Americans (p = 4.6x10-4, 1.9x10-13 and 5.0x10-5, respectively), and NOS1 in African Americans (p = 2.3x10-11). One of the variants was a highly functional nonsynonymous variant in ADRB2 (rs1800888), which was also nominally associated with asthma (p = 0.027) and active asthma (p = 0.013) among European Americans with severe RSV bronchiolitis without including the ESP. Our results suggest that rare nonsynonymous variants contribute to the development of asthma following severe RSV bronchiolitis in infancy, notably in ADRB2. Additional studies are required to explore the role of rare variants in the etiology of asthma and asthma-related traits following severe RSV bronchiolitis. PMID:26587832

  6. Apparent variation in Neanderthal admixture among African populations is consistent with gene flow from Non-African populations.

    PubMed

    Wang, Shuoguo; Lachance, Joseph; Tishkoff, Sarah A; Hey, Jody; Xing, Jinchuan

    2013-01-01

    Recent studies have found evidence of introgression from Neanderthals into modern humans outside of sub-Saharan Africa. Given the geographic range of Neanderthals, the findings have been interpreted as evidence of gene exchange between Neanderthals and modern humans descended from the Out-of-Africa (OOA) migration. Here, we examine an alternative interpretation in which the introgression occurred earlier within Africa, between ancestors or relatives of Neanderthals and a subset of African modern humans who were the ancestors of those involved in the OOA migration. Under the alternative model, if the population structure among present-day Africans predates the OOA migration, we might find some African populations show a signal of Neanderthal introgression whereas others do not. To test this alternative model, we compiled a whole-genome data set including 38 sub-Saharan Africans from eight populations and 25 non-African individuals from five populations. We assessed differences in the amount of Neanderthal-like single-nucleotide polymorphism alleles among these populations and observed up to 1.5% difference in the number of Neanderthal-like alleles among African populations. Further analyses suggest that these differences are likely due to recent non-African admixture in these populations. After accounting for recent non-African admixture, our results do not support the alternative model of older (e.g., >100 kya) admixture between modern humans and Neanderthal-like hominids within Africa.

  7. Scalable gene synthesis by selective amplification of DNA pools from high-fidelity microchips.

    PubMed

    Kosuri, Sriram; Eroshenko, Nikolai; Leproust, Emily M; Super, Michael; Way, Jeffrey; Li, Jin Billy; Church, George M

    2010-12-01

    Development of cheap, high-throughput and reliable gene synthesis methods will broadly stimulate progress in biology and biotechnology. Currently, the reliance on column-synthesized oligonucleotides as a source of DNA limits further cost reductions in gene synthesis. Oligonucleotides from DNA microchips can reduce costs by at least an order of magnitude, yet efforts to scale their use have been largely unsuccessful owing to the high error rates and complexity of the oligonucleotide mixtures. Here we use high-fidelity DNA microchips, selective oligonucleotide pool amplification, optimized gene assembly protocols and enzymatic error correction to develop a method for highly parallel gene synthesis. We tested our approach by assembling 47 genes, including 42 challenging therapeutic antibody sequences, encoding a total of ∼35 kilobase pairs of DNA. These assemblies were performed from a complex background containing 13,000 oligonucleotides encoding ∼2.5 megabases of DNA, which is at least 50 times larger than in previously published attempts.

  8. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.

    2008-01-01

    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  9. Bone mineral density-affecting genes in Africans.

    PubMed Central

    Gong, Gordon; Haynatzki, Gleb; Haynatzka, Vera; Howell, Ryan; Kosoko-Lasaki, Sade; Fu, Yun-Xin; Yu, Fei; Gallagher, John C.; Wilson, M. Roy

    2006-01-01

    BACKGROUND: We have recently reported the role of environmental exposure in the ethnic diversity of bone mineral density (BMD). Potential genetic difference has not been adequately assessed. PURPOSE: To determine allele frequencies of BMD-affecting genes and their association with BMD in Africans. METHODS: Allele frequencies at 18 polymorphic sites in 13 genes that affect BMD in Asians and/or Caucasians were determined in 143 recent immigrants (55 men and 88 women, 18-51 years of age) from sub-Saharan Sudan to the United States. Genetic association studies were performed. RESULTS: Among the 14 single-nucleotide polymorphisms (SNPs), 10 were significantly different in allele frequency between Sudanese and Asians, and 10 between Sudanese and Caucasians. Only the osteocalcin gene was not significantly different in allele frequency among Sudanese, Asians and Caucasians. Allele frequencies in the TGFB, COL1A1 and CSR genes were extremely low (<0.04) in the Sudanese. Frequencies of microsatellite alleles in four genes were significantly different among Sudanese, Asians and Caucasians. SNPs in the VDR and ERalpha genes were associated with BMD and/or BMC (bone mineral content) at several bone sites. CONCLUSIONS: Genetic difference may play a role in the ethnic diversity in BMD and/or BMC. PMID:16895279

  10. Demographic history of Canary Islands male gene-pool: replacement of native lineages by European

    PubMed Central

    Fregel, Rosa; Gomes, Verónica; Gusmão, Leonor; González, Ana M; Cabrera, Vicente M; Amorim, António; Larruga, Jose M

    2009-01-01

    Background The origin and prevalence of the prehispanic settlers of the Canary Islands has attracted great multidisciplinary interest. However, direct ancient DNA genetic studies on indigenous and historical 17th–18th century remains, using mitochondrial DNA as a female marker, have only recently been possible. In the present work, the analysis of Y-chromosome polymorphisms in the same samples, has shed light on the way the European colonization affected male and female Canary Island indigenous genetic pools, from the conquest to present-day times. Results Autochthonous (E-M81) and prominent (E-M78 and J-M267) Berber Y-chromosome lineages were detected in the indigenous remains, confirming a North West African origin for their ancestors which confirms previous mitochondrial DNA results. However, in contrast with their female lineages, which have survived in the present-day population since the conquest with only a moderate decline, the male indigenous lineages have dropped constantly being substituted by European lineages. Male and female sub-Saharan African genetic inputs were also detected in the Canary population, but their frequencies were higher during the 17th–18th centuries than today. Conclusion The European colonization of the Canary Islands introduced a strong sex-biased change in the indigenous population in such a way that indigenous female lineages survived in the extant population in a significantly higher proportion than their male counterparts. PMID:19650893

  11. Comparison of nifH Gene Pools in Soils and Soil Microenvironments with Contrasting Properties

    PubMed Central

    Poly, Franck; Ranjard, Lionel; Nazaret, Sylvie; Gourbière, François; Monrozier, Lucile Jocteur

    2001-01-01

    The similarities and differences in the structures of the nifH gene pools of six different soils (Montrond, LCSA-p, Vernon, Dombes, LCSA-c, and Thysse Kaymor) and five soil fractions extracted from LCSA-c were studied. Bacterial DNA was directly extracted from the soils, and a region of the nifH gene was amplified by PCR and analyzed by restriction. Soils were selected on the basis of differences in soil management, plant cover, and major physicochemical properties. Microenvironments differed on the basis of the sizes of the constituent particles and the organic carbon and clay contents. Restriction profiles were subjected to principal-component analysis. We showed that the composition of the diazotrophic communities varied both on a large scale (among soils) and on a microscale (among microenvironments in LCSA-c soil). Soil management seemed to be the major parameter influencing differences in the nifH gene pool structure among soils by controlling inorganic nitrogen content and its variation. However, physicochemical parameters (texture and total C and N contents) were found to correlate with differences among nifH gene pools on a microscale. We hypothesize that the observed nifH genetic structures resulted from the adaptation to fluctuating conditions (cultivated soil, forest soil, coarse fractions) or constant conditions (permanent pasture soil, fine fractions). We attempted to identify a specific band within the profile of the clay fraction by cloning and sequencing it and comparing it with the gene databases. Unexpectedly, the nifH sequences of the dominant bacteria were most similar to sequences of unidentified marine eubacteria. PMID:11319109

  12. Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression

    PubMed Central

    Papadopoulou, Charikleia; Guilbaud, Guillaume; Schiavone, Davide; Sale, Julian E.

    2015-01-01

    Summary Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU) can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer. PMID:26686635

  13. [Book review] Fish Gene Pools: preservation of genetic resources in relation to wild fish stocks, edited by N. Ryman

    USGS Publications Warehouse

    Simon, R.C.

    1984-01-01

    Review of: Fish Gene Pools: Preservation of Genetic Resources in Relation to Wild Fish Stocks. Edited by N. Ryman. The Editorial Service/FRN, Box 6710, S-11385, Stockholm, Sweden. 1981. 111 pages. $16.00 (paper).

  14. The impact of Atlas Mountain cold-pool events on the position and intensity of the summertime West African heat low

    NASA Astrophysics Data System (ADS)

    Schuster, Robert; Fink, Andreas H.; Knippertz, Peter; Marsham, John H.; Parker, Douglas J.; Flamant, Cyrille

    2014-05-01

    Recently discovered fluctuations of the summertime West African heat low on different time scales are still not fully understood, but of major importance for an improved prediction of the West African Monsoon system in weather and climate models. It has recently been demonstrated that the cold-pool outflows from convection form a significant component of the West African monsoon and that in a global model the failure to represent these adequately is a major cause of thermodynamic model-bias in the monsoon-ventilated heat-low region. Here we focus on the extratropical flank of the heat low, which often reaches to the Saharan foothills of the Atlas Mountains in Morocco and Algeria during the summer months. Strong, often orographically triggered convective events over the Atlas Mountains and at their southern flanks are a regularly observed feature during this time. Such events are often associated with evaporatively driven cold-pools, resulting in haboob dust storms in the Saharan Desert. The leading edge of these density currents can reach lengths of several hundreds to a thousand kilometres; its movement is visible on satellite images for up to twelve hours and affects the core region of the heat low. Significant amounts of moisture are transported into the desert this way and can lead to the production of new convective systems there. We use the Weather Research and Forecast (WRF) model driven by the operational analysis of the European Centre for Medium-Range Weather Forecasting (ECMWF) to investigate the impact of these events on the positions and strength of the heat low in convection-permitting simulations. The aim is to improve the understanding of the involved processes and to quantify the errors that are expected in models that are not able to generate cold pools effectively due to their parametrisations of moist convection. The cases used for this study have been selected based on station measurements and on infrared as well as microwave satellite data

  15. Phenotype Sequencing: Identifying the Genes That Cause a Phenotype Directly from Pooled Sequencing of Independent Mutants

    PubMed Central

    Harper, Marc A.; Chen, Zugen; Toy, Traci; Machado, Iara M. P.; Nelson, Stanley F.; Liao, James C.; Lee, Christopher J.

    2011-01-01

    Random mutagenesis and phenotype screening provide a powerful method for dissecting microbial functions, but their results can be laborious to analyze experimentally. Each mutant strain may contain 50–100 random mutations, necessitating extensive functional experiments to determine which one causes the selected phenotype. To solve this problem, we propose a “Phenotype Sequencing” approach in which genes causing the phenotype can be identified directly from sequencing of multiple independent mutants. We developed a new computational analysis method showing that 1. causal genes can be identified with high probability from even a modest number of mutant genomes; 2. costs can be cut many-fold compared with a conventional genome sequencing approach via an optimized strategy of library-pooling (multiple strains per library) and tag-pooling (multiple tagged libraries per sequencing lane). We have performed extensive validation experiments on a set of E. coli mutants with increased isobutanol biofuel tolerance. We generated a range of sequencing experiments varying from 3 to 32 mutant strains, with pooling on 1 to 3 sequencing lanes. Our statistical analysis of these data (4099 mutations from 32 mutant genomes) successfully identified 3 genes (acrB, marC, acrA) that have been independently validated as causing this experimental phenotype. It must be emphasized that our approach reduces mutant sequencing costs enormously. Whereas a conventional genome sequencing experiment would have cost $7,200 in reagents alone, our Phenotype Sequencing design yielded the same information value for only $1200. In fact, our smallest experiments reliably identified acrB and marC at a cost of only $110–$340. PMID:21364744

  16. Two endornaviruses show differential infection patterns between gene pools of Phaseolus vulgaris.

    PubMed

    Khankhum, Surasak; Valverde, Rodrigo A; Pastor-Corrales, Marcial A; Osorno, Juan M; Sabanadzovic, Sead

    2015-04-01

    We investigated the occurrence of two plant endornaviruses, Phaseolus vulgaris endornavirus 1 and Phaseolus vulgaris endornavirus 2, in breeding lines, cultivars, landraces, and wild genotypes of common bean (Phaseolus vulgaris) collected from the two centers of common bean domestication: Mesoamerica and the Andes. The two endornaviruses were detected in many genotypes of Mesoamerican origin but rarely in genotypes of Andean origin. The results suggest that these two endornaviruses were introduced into the Mesoamerican modern genotypes during common bean domestication and provide more evidence for the existence of two divergent gene pools of common bean.

  17. Gene targets of mouse miR-709: regulation of distinct pools

    PubMed Central

    Surendran, Sneha; Jideonwo, Victoria N.; Merchun, Chris; Ahn, Miwon; Murray, John; Ryan, Jennifer; Dunn, Kenneth W.; Kota, Janaiah; Morral, Núria

    2016-01-01

    MicroRNA (miRNA) are short non-coding RNA molecules that regulate multiple cellular processes, including development, cell differentiation, proliferation and death. Nevertheless, little is known on whether miRNA control the same gene networks in different tissues. miR-709 is an abundant miRNA expressed ubiquitously. Through transcriptome analysis, we have identified targets of miR-709 in hepatocytes. miR-709 represses genes implicated in cytoskeleton organization, extracellular matrix attachment, and fatty acid metabolism. Remarkably, none of the previously identified targets in non-hepatic tissues are silenced by miR-709 in hepatocytes, even though several of these genes are abundantly expressed in liver. In addition, miR-709 is upregulated in hepatocellular carcinoma, suggesting it participates in the genetic reprogramming that takes place during cell division, when cytoskeleton remodeling requires substantial changes in gene expression. In summary, the present study shows that miR-709 does not repress the same pool of genes in separate cell types. These results underscore the need for validating gene targets in every tissue a miRNA is expressed. PMID:26743462

  18. Genome-wide signatures of male-mediated migration shaping the Indian gene pool.

    PubMed

    ArunKumar, GaneshPrasad; Tatarinova, Tatiana V; Duty, Jeff; Rollo, Debra; Syama, Adhikarla; Arun, Varatharajan Santhakumari; Kavitha, Valampuri John; Triska, Petr; Greenspan, Bennett; Wells, R Spencer; Pitchappan, Ramasamy

    2015-09-01

    Multiple questions relating to contributions of cultural and demographical factors in the process of human geographical dispersal remain largely unanswered. India, a land of early human settlement and the resulting diversity is a good place to look for some of the answers. In this study, we explored the genetic structure of India using a diverse panel of 78 males genotyped using the GenoChip. Their genome-wide single-nucleotide polymorphism (SNP) diversity was examined in the context of various covariates that influence Indian gene pool. Admixture analysis of genome-wide SNP data showed high proportion of the Southwest Asian component in all of the Indian samples. Hierarchical clustering based on admixture proportions revealed seven distinct clusters correlating to geographical and linguistic affiliations. Convex hull overlay of Y-chromosomal haplogroups on the genome-wide SNP principal component analysis brought out distinct non-overlapping polygons of F*-M89, H*-M69, L1-M27, O2a-M95 and O3a3c1-M117, suggesting a male-mediated migration and expansion of the Indian gene pool. Lack of similar correlation with mitochondrial DNA clades indicated a shared genetic ancestry of females. We suggest that ancient male-mediated migratory events and settlement in various regional niches led to the present day scenario and peopling of India.

  19. Genomics of crop wild relatives: expanding the gene pool for crop improvement.

    PubMed

    Brozynska, Marta; Furtado, Agnelo; Henry, Robert J

    2016-04-01

    Plant breeders require access to new genetic diversity to satisfy the demands of a growing human population for more food that can be produced in a variable or changing climate and to deliver the high-quality food with nutritional and health benefits demanded by consumers. The close relatives of domesticated plants, crop wild relatives (CWRs), represent a practical gene pool for use by plant breeders. Genomics of CWR generates data that support the use of CWR to expand the genetic diversity of crop plants. Advances in DNA sequencing technology are enabling the efficient sequencing of CWR and their increased use in crop improvement. As the sequencing of genomes of major crop species is completed, attention has shifted to analysis of the wider gene pool of major crops including CWR. A combination of de novo sequencing and resequencing is required to efficiently explore useful genetic variation in CWR. Analysis of the nuclear genome, transcriptome and maternal (chloroplast and mitochondrial) genome of CWR is facilitating their use in crop improvement. Genome analysis results in discovery of useful alleles in CWR and identification of regions of the genome in which diversity has been lost in domestication bottlenecks. Targeting of high priority CWR for sequencing will maximize the contribution of genome sequencing of CWR. Coordination of global efforts to apply genomics has the potential to accelerate access to and conservation of the biodiversity essential to the sustainability of agriculture and food production.

  20. The Polynesian gene pool: an early contribution by Amerindians to Easter Island.

    PubMed

    Thorsby, Erik

    2012-03-19

    It is now generally accepted that Polynesia was first settled by peoples from southeast Asia. An alternative that eastern parts of Polynesia were first inhabited by Amerindians has found little support. There are, however, many indications of a 'prehistoric' (i.e. before Polynesia was discovered by Europeans) contact between Polynesia and the Americas, but genetic evidence of a prehistoric Amerindian contribution to the Polynesian gene pool has been lacking. We recently carried out genomic HLA (human leucocyte antigen) typing as well as typing for mitochondrial DNA (mtDNA) and Y chromosome markers of blood samples collected in 1971 and 2008 from reputedly non-admixed Easter Islanders. All individuals carried HLA alleles and mtDNA types previously found in Polynesia, and most of the males carried Y chromosome markers of Polynesian origin (a few had European Y chromosome markers), further supporting an initial Polynesian population on Easter Island. The HLA investigations revealed, however, that some individuals also carried HLA alleles which have previously almost only been found in Amerindians. We could trace the introduction of these Amerindian alleles to before the Peruvian slave trades, i.e. before the 1860s, and provide suggestive evidence that they were introduced already in prehistoric time. Our results demonstrate an early Amerindian contribution to the Polynesian gene pool on Easter Island, and illustrate the usefulness of typing for immunogenetic markers such as HLA to complement mtDNA and Y chromosome analyses in anthropological investigations.

  1. Parallel evolution of opsin gene expression in African cichlid fishes.

    PubMed

    O'Quin, Kelly E; Hofmann, Christopher M; Hofmann, Hans A; Carleton, Karen L

    2010-12-01

    Phenotypic evolution may occur either through alterations to the structure of protein-coding genes or their expression. Evidence for which of these two mechanisms more commonly contribute to the evolution of a phenotype can be garnered from examples of parallel and convergent evolution. The visual system of East African cichlid fishes is an excellent system with which to address this question. Cichlid fishes from Lakes Malawi (LM) and Victoria together exhibit three diverse palettes of coexpressed opsins and several important protein-coding mutations that both shift spectral sensitivity. Here we assess both opsin expression and protein-coding diversity among cichlids from a third rift lake, Lake Tanganyika (LT). We found that Tanganyikan cichlids exhibit three palettes of coexpressed opsins that largely overlap the short-, middle-, and long-wavelength-sensitive palettes of LM cichlids. Bayesian phenotypic clustering and ancestral state reconstructions both support the parallel evolution of the short- and middle-wavelength palettes among cichlids from LT and LM. In each case, these transitions occurred from different ancestors that expressed the same long-wavelength palette. We also identified similar but distinct patterns of correlated evolution between opsin expression, diet, and lens transmittance among cichlids from LT and LM as well. In contrast to regulatory changes, we identified few functional or potentially functional mutations in the protein-coding sequences of three variable opsins, with the possible exception of the SWS1 (ultraviolet) opsin. These results underscore the important contribution that gene regulation can make to rapid phenotypic evolution and adaptation.

  2. Genetic variation and risks of introgression in the wild Coffea arabica gene pool in south-western Ethiopian montane rainforests

    PubMed Central

    Aerts, Raf; Berecha, Gezahegn; Gijbels, Pieter; Hundera, Kitessa; Glabeke, Sabine; Vandepitte, Katrien; Muys, Bart; Roldán-Ruiz, Isabel; Honnay, Olivier

    2013-01-01

    The montane rainforests of SW Ethiopia are the primary centre of diversity of Coffea arabica and the origin of all Arabica coffee cultivated worldwide. This wild gene pool is potentially threatened by forest fragmentation and degradation, and by introgressive hybridization with locally improved coffee varieties. We genotyped 703 coffee shrubs from unmanaged and managed coffee populations, using 24 microsatellite loci. Additionally, we genotyped 90 individuals representing 23 Ethiopian cultivars resistant to coffee berry disease (CBD). We determined population genetic diversity, genetic structure, and admixture of cultivar alleles in the in situ gene pool. We found strong genetic differentiation between managed and unmanaged coffee populations, but without significant differences in within-population genetic diversity. The widespread planting of coffee seedlings including CBD-resistant cultivars most likely offsets losses of genetic variation attributable to genetic drift and inbreeding. Mixing cultivars with original coffee genotypes, however, leaves ample opportunity for hybridization and replacement of the original coffee gene pool, which already shows signs of admixture. In situ conservation of the wild gene pool of C. arabica must therefore focus on limiting coffee production in the remaining wild populations, as intensification threatens the genetic integrity of the gene pool by exposing wild genotypes to cultivars. PMID:23798974

  3. Further evidence of an Amerindian contribution to the Polynesian gene pool on Easter Island.

    PubMed

    Thorsby, E; Flåm, S T; Woldseth, B; Dupuy, B M; Sanchez-Mazas, A; Fernandez-Vina, M A

    2009-06-01

    Available evidence suggests a Polynesian origin of the Easter Island population. We recently found that some native Easter Islanders also carried some common American Indian (Amerindian) human leukocyte antigen (HLA) alleles, which probably were introduced before Europeans discovered the island in 1722. In this study, we report molecular genetic investigations of 21 other selected native Easter Islanders. Analysis of mitochondrial DNA and Y chromosome markers showed no traces of an Amerindian contribution. However, high-resolution genomic HLA typing showed that two individuals carried some other common Amerindian HLA alleles, different from those found in our previous investigations. The new data support our previous evidence of an Amerindian contribution to the gene pool on Easter Island.

  4. High-density SNP genotyping array for hexaploid wheat and its secondary and tertiary gene pool.

    PubMed

    Winfield, Mark O; Allen, Alexandra M; Burridge, Amanda J; Barker, Gary L A; Benbow, Harriet R; Wilkinson, Paul A; Coghill, Jane; Waterfall, Christy; Davassi, Alessandro; Scopes, Geoff; Pirani, Ali; Webster, Teresa; Brew, Fiona; Bloor, Claire; King, Julie; West, Claire; Griffiths, Simon; King, Ian; Bentley, Alison R; Edwards, Keith J

    2016-05-01

    In wheat, a lack of genetic diversity between breeding lines has been recognized as a significant block to future yield increases. Species belonging to bread wheat's secondary and tertiary gene pools harbour a much greater level of genetic variability, and are an important source of genes to broaden its genetic base. Introgression of novel genes from progenitors and related species has been widely employed to improve the agronomic characteristics of hexaploid wheat, but this approach has been hampered by a lack of markers that can be used to track introduced chromosome segments. Here, we describe the identification of a large number of single nucleotide polymorphisms that can be used to genotype hexaploid wheat and to identify and track introgressions from a variety of sources. We have validated these markers using an ultra-high-density Axiom(®) genotyping array to characterize a range of diploid, tetraploid and hexaploid wheat accessions and wheat relatives. To facilitate the use of these, both the markers and the associated sequence and genotype information have been made available through an interactive web site.

  5. Pre-breeding for diversification of primary gene pool and genetic enhancement of grain legumes

    PubMed Central

    Sharma, Shivali; Upadhyaya, H. D.; Varshney, R. K.; Gowda, C. L. L.

    2013-01-01

    The narrow genetic base of cultivars coupled with low utilization of genetic resources are the major factors limiting grain legume production and productivity globally. Exploitation of new and diverse sources of variation is needed for the genetic enhancement of grain legumes. Wild relatives with enhanced levels of resistance/tolerance to multiple stresses provide important sources of genetic diversity for crop improvement. However, their exploitation for cultivar improvement is limited by cross-incompatibility barriers and linkage drags. Pre-breeding provides a unique opportunity, through the introgression of desirable genes from wild germplasm into genetic backgrounds readily used by the breeders with minimum linkage drag, to overcome this. Pre-breeding activities using promising landraces, wild relatives, and popular cultivars have been initiated at International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) to develop new gene pools in chickpea, pigeonpea, and groundnut with a high frequency of useful genes, wider adaptability, and a broad genetic base. The availability of molecular markers will greatly assist in reducing linkage drags and increasing the efficiency of introgression in pre-breeding programs. PMID:23970889

  6. Gene Flow Among Different Teosinte Taxa and Into the Domesticated Maize Gene Pool

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Maize (Zea mays ssp. mays) was domesticated from one wild species ancestor, the Balsas teosinte (Zea mays ssp. parviglumis) about 9000 years ago. Higher levels of gene diversity are found in teosinte taxa compared to maize following domestication and selection bottlenecks. Diversity in maize can b...

  7. Integron-associated gene cassettes in Halifax Harbour: assessment of a mobile gene pool in marine sediments.

    PubMed

    Koenig, J E; Boucher, Yan; Charlebois, Robert L; Nesbø, Camilla; Zhaxybayeva, Olga; Bapteste, Eric; Spencer, Matthew; Joss, Michael J; Stokes, H W; Doolittle, W F

    2008-04-01

    The integron/gene cassette systems identified in bacteria comprise a class of genetic elements that allow adaptation by acquisition of gene cassettes. Integron gene cassettes have been shown to facilitate the spread of drug resistance in human pathogens but their role outside a clinical setting has not been explored extensively. We sequenced 2145 integron gene cassettes from four marine sediment samples taken from the vicinity of Halifax Nova Scotia, Canada, increasing the number of gene cassettes obtained from environmental microbial communities by 10-fold. Sequence analyses reveals that the majority of these cassettes encode novel proteins and that this study is consistent with previous claims of high cassette diversity as we estimate a Chao1 diversity index of approximately 3000 cassettes from these samples. The functional distribution of environmental cassettes recovered in this study, when compared with that of cassettes from the only other source with significant sampling (Vibrio genomes) suggests that alternate selection regimes might be acting on these two gene pools. The majority of cassettes recovered in this study encode novel, unknown proteins. In instances where we obtained multiple alleles of a novel protein we demonstrate that non-synonymous versus synonymous substitution rates ratios suggest relaxed selection. Cassette-encoded proteins with known homologues represent a variety of functions and prevalent among these are isochorismatases; proteins involved in iron scavenging. Phylogenetic analysis of these isochorismatases as well as of cassette-encoded acetyltransferases reveals a patchy distribution, suggesting multiple sources for the origin of these cassettes. Finally, the two most environmentally similar sample sites considered in this study display the greatest overlap of cassette types, consistent with the hypothesis that cassette genes encode adaptive proteins.

  8. Distinction between wild and cultivated enset (Ensete ventricosum) gene pools in Ethiopia using RAPD markers.

    PubMed

    Birmeta, Genet; Nybom, Hilde; Bekele, Endashaw

    2004-01-01

    In southwest Ethiopia, the cultivation area of Ensete ventricosum (enset) overlaps with the natural distribution area of this species. Analyses of genetic diversity were undertaken using RAPD to provide information for conservation strategies as well as evidence of possible gene flow between the different gene pools, which can be of interest for future improvement of cultivated enset. The extent of RAPD variation in wild enset was investigated in 5 populations in the Bonga area (Kefficho administrative region) and 9 cultivated clones. Comparisons were also made with some Musa samples of potential relevance for crop improvement. Nine oligonucleotide primers amplified 72 polymorphic loci. Population differentiation was estimated with the Shannon index (G'(ST)=0.10), Nei's G(ST) (0.12) and AMOVA (Phi(ST)=0.12), and appears to be relatively low when compared with outbreeding, perennial species in general. Cluster analysis (UPGMA) and principal component analysis (PCA) similarly indicated low population differentiation, and also demonstrated that cultivated clones essentially clustered distinctly from wild enset samples, suggesting that the present-day cultivated enset clones have been introduced to domestication from a limited number of wild progenitors. In addition, subsequent gene flow between wild and cultivated enset may have been prohibited by differences between modes of propagation and harvesting time; cultivated enset is propagated vegetatively through sucker production and the plant is generally harvested before maturity or flower set, thereby hindering pollination by wild enset or vice versa. A significant correlation was not found between genetic and geographical distances. The relatively high total RAPD diversity suggests that wild enset populations in the Bonga area harbour genetic variability which could potentially act as a source for useful or rare genes in the improvement of cultivated enset. As expected, E. ventricosum was clearly differentiated from

  9. Changes in gravity affect gene expression, protein modulation and metabolite pools of arabidopsis

    NASA Astrophysics Data System (ADS)

    Hampp, R.; Martzivanou, M.; Maier, R. M.; Magel, E.

    ), we investigated samples from sounding rocket experiments (5 min μ g) and show increased transcript levels for signalling proteins. By means of 2-dimensional SDS polyacrylamide gelelectrophoresis, coupled to spot identification after tryptic digest (MALDI-TOF), we further show that metabolic short-term responses can be adjusted by protein phosphorylation/dephosphorylation. Changes in gene expression / protein modulation are mirrored by respective alterations in metabolite pools. (Supported by a grant from the Deutsches Zentrum für Luft- und Raumfahrt (DLR, 50WB0143)).

  10. Clines of nuclear DNA markers suggest a largely neolithic ancestry of the European gene pool.

    PubMed

    Chikhi, L; Destro-Bisol, G; Bertorelle, G; Pascali, V; Barbujani, G

    1998-07-21

    Comparisons between archaeological findings and allele frequencies at protein loci suggest that most genes of current Europeans descend from populations that have been expanding in Europe in the last 10, 000 years, in the Neolithic period. Recent mitochondrial data have been interpreted as indicating a much older, Paleolithic ancestry. In a spatial autocorrelation study at seven hypervariable loci in Europe (four microsatellites, two larger, tandem-repeat loci, and a sequence polymorphism) broad clinal patterns of DNA variation were recognized. The observed clines closely match those described at the protein level, in agreement with a possible Near Eastern origin for the ancestral population. Separation times between populations were estimated on the basis of a stepwise mutation model. Even assuming low mutation rates and long generation times, we found no evidence for population splits older than 10,000 years, with the predictable exception of Saami (Lapps). The simplest interpretation of these results is that the current nuclear gene pool largely reflects the westward and northward expansion of a Neolithic group. This conclusion is now supported by purely genetic evidence on the levels and patterns of microsatellite diversity, rather than by correlations of biological and nonbiological data. We argue that many mitochondrial lineages whose origin has been traced back to the Paleolithic period probably reached Europe at a later time.

  11. A common gene pool for the Neisseria FetA antigen.

    PubMed

    Bennett, Julia S; Thompson, Emily A L; Kriz, Paula; Jolley, Keith A; Maiden, Martin C J

    2009-02-01

    Meningococcal FetA is an iron-regulated, immunogenic outer membrane protein and vaccine component. The most diverse region of this protein is a previously defined variable region (VR) that has been shown to be immunodominant. In this analysis, a total of 275 Neisseria lactamica isolates, collected during studies of nasopharyngeal bacterial carriage in infants, were examined for the presence of a fetA gene. The fetA VR nucleotide sequence was determined for 217 of these isolates, with fetA apparently absent from 58 isolates, the majority of which belonged to the ST-624 clonal complex. The VR in N. lactamica was compared to the same region in N. meningitidis, N. gonorrhoeae, and a number of other commensal Neisseria. Identical fetA variable region sequences were identified among commensal and pathogenic Neisseria, suggesting a common gene pool, differing from other antigens in this respect. Carriage of commensal Neisseria species, such as N. lactamica, that express FetA may be involved in the development of natural immunity to meningococcal disease.

  12. A common gene pool for the Neisseria FetA antigen

    PubMed Central

    Bennett, Julia S.; Thompson, Emily A. L.; Kriz, Paula; Jolley, Keith A.; Maiden, Martin C. J.

    2014-01-01

    Meningococcal FetA is an iron-regulated, immunogenic outer membrane protein and vaccine component. The most diverse region of this protein is a previously defined variable region (VR) that has been shown to be immunodominant. In this analysis, a total of 275 Neisseria lactamica isolates, collected during studies of nasopharyngeal bacterial carriage in infants were examined for the presence of a fetA gene. The fetA VR nucleotide sequence was determined for 217 of these isolates, with fetA apparently absent from 58 isolates, the majority of which belonged to the ST-624 clonal complex. The VR in N. lactamica was compared to the same region in Neisseria meningitidis, Neisseria gonorrhoeae and a number of other commensal Neisseria. Identical fetA variable region sequences were identified among commensal and pathogenic Neisseria, suggesting a common gene pool, differing from other antigens in this respect. Carriage of commensal Neisseria species, such as N. lactamica, that express FetA may be involved in the development of natural immunity to meningococcal disease. PMID:18718812

  13. Training Quantitative Thinkers by Using Spreadsheets as Simulation Drivers for Biology Classes: Selective Predation Effect on Prey Gene Pool.

    ERIC Educational Resources Information Center

    Porter, Tom

    1996-01-01

    Describes the use of a spreadsheet in running a hands-on prey/predator simulation that enables students to see the effect of selection pressure on one allele in a gene pool. Discusses setting up and running the simulation, class discussion issues, exploring assumptions, and extensions. (JRH)

  14. Extensive SSR genotyping of potato landraces supports a drastic revaluation of their gene pool structure and classification

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The cultivated potato is one of the most important food plants worldwide, yet knowledge of the gene pool structure of the native South American landraces remains largely uninvestigated and is controversial. As a result, contrasting taxonomic treatments of the landraces have continued over the last c...

  15. Use of Redundant Exclusion PCR To Identify a Novel Bacillus thuringiensis Cry8 Toxin Gene from Pooled Genomic DNA

    PubMed Central

    Zhang, Fengjiao; Shu, Changlong; Crickmore, Neil; Li, Yanqiu; Song, Fuping; Liu, Chunqin

    2016-01-01

    ABSTRACT With the aim of optimizing the cloning of novel genes from a genomic pool containing many previously identified homologous genes, we designed a redundant exclusion PCR (RE-PCR) technique. In RE-PCR, a pair of generic amplification primers are combined with additional primers that are designed to specifically bind to redundant, unwanted genes that are a subset of those copied by the amplification primers. During RE-PCR, the specific primer blocks amplification of the full-length redundant gene. Using this method, we managed to clone a number of cry8 or cry9 toxin genes from a pool of Bacillus thuringiensis genomic DNA while excluding amplicons for cry9Da, cry9Ea, and cry9Eb. The method proved to be very efficient at increasing the number of rare genes in the resulting library. One such rare (and novel) cry8-like gene was expressed, and the encoded toxin was shown to be toxic to Anomala corpulenta. IMPORTANCE Protein toxins from the bacterium Bacillus thuringiensis are being increasingly used as biopesticides against a wide range of insect pests, yet the search for new or improved toxins is becoming more difficult, as traditional methods for gene discovery routinely isolate previously identified clones. This paper describes an approach that we have developed to increase the success rate for novel toxin gene identification through reducing or eliminating the cloning of previously characterized genes. PMID:27084017

  16. Africanization in the United States

    PubMed Central

    Pinto, M. Alice; Rubink, William L.; Patton, John C.; Coulson, Robert N.; Johnston, J. Spencer

    2005-01-01

    The expansion of Africanized honeybees from South America to the southwestern United States in <50 years is considered one of the most spectacular biological invasions yet documented. In the American tropics, it has been shown that during their expansion Africanized honeybees have low levels of introgressed alleles from resident European populations. In the United States, it has been speculated, but not shown, that Africanized honeybees would hybridize extensively with European honeybees. Here we report a continuous 11-year study investigating temporal changes in the genetic structure of a feral population from the southern United States undergoing Africanization. Our microsatellite data showed that (1) the process of Africanization involved both maternal and paternal bidirectional gene flow between European and Africanized honeybees and (2) the panmitic European population was replaced by panmitic mixtures of A. m. scutellata and European genes within 5 years after Africanization. The post-Africanization gene pool (1998–2001) was composed of a diverse array of recombinant classes with a substantial European genetic contribution (mean 25–37%). Therefore, the resulting feral honeybee population of south Texas was best viewed as a hybrid swarm. PMID:15937139

  17. Wheat Landraces Are Better Qualified as Potential Gene Pools at Ultraspaced rather than Densely Grown Conditions

    PubMed Central

    Ninou, Elissavet G.; Mylonas, Ioannis G.; Tokatlidis, Ioannis S.

    2014-01-01

    The negative relationship between the yield potential of a genotype and its competitive ability may constitute an obstacle to recognize outstanding genotypes within heterogeneous populations. This issue was investigated by growing six heterogeneous wheat landraces along with a pure-line commercial cultivar under both dense and widely spaced conditions. The performance of two landraces showed a perfect match to the above relationship. Although they lagged behind the cultivar by 64 and 38% at the dense stand, the reverse was true with spaced plants where they succeeded in out-yielding the cultivar by 58 and 73%, respectively. It was concluded that dense stand might undervalue a landrace as potential gene pool in order to apply single-plant selection targeting pure-line cultivars, attributable to inability of plants representing high yielding genotypes to exhibit their capacity due to competitive disadvantage. On the other side, the yield expression of individuals is optimized when density is low enough to preclude interplant competition. Therefore, the latter condition appears ideal to identify the most promising landrace for breeding and subsequently recognize the individuals representing the most outstanding genotypes. PMID:24955427

  18. Echoes from Sepharad: signatures on the maternal gene pool of crypto-Jewish descendants

    PubMed Central

    Nogueiro, Inês; Teixeira, João; Amorim, António; Gusmão, Leonor; Alvarez, Luis

    2015-01-01

    The majority of genetic studies on Jewish populations have been focused on Ashkenazim, and genetic data from the Sephardic original source, the Iberian Peninsula, are particularly scarce. Regarding the mitochondrial genome, the available information is limited to a single Portuguese village, Belmonte, where just two different lineages (a single one corresponding to 93.3%) were found in 30 individuals. Aiming at disclosing the ancestral maternal background of the Portuguese Jewry, we enlarged the sampling to other crypto-Jewish descendants in the Bragança district (NE Portugal). Fifty-seven complete mtDNA genomes were newly sequenced and — in contrast with Belmonte — a high level of diversity was found, with five haplogroups (HV0b, N1, T2b11, T2e and U2e) being putatively identified as Sephardic founding lineages. Therefore — in sharp contrast with Belmonte — these communities have managed to escape the expected inbreeding effects caused by centuries of religious repression and have kept a significant proportion of the Sephardic founder gene pool. This deeper analysis of the surviving Sephardic maternal lineages allowed a much more comprehensive and detailed perspective on the origins and survival of the Sephardic genetic heritage. In line with previously published results on Sephardic paternal lineages, our findings also show a surprising resistance to the erosion of genetic diversity in the maternal lineages. PMID:25074462

  19. Nonblack patients with sickle cell disease have African. beta. sup s gene cluster haplotypes

    SciTech Connect

    Rogers, Z.R.; Powars, D.R.; Williams, W.D. ); Kinney, T.R. ); Schroeder, W.A. )

    1989-05-26

    Of 18 nonblack patients with sickle cell disease, 14 had sickle cell anemia, 2 had hemoglobin SC disease, and 2 had hemoglobin S-{beta}{sup o}-thalassemia. The {beta}{sup s} gene cluster haplotypes that were determined in 7 patients were of African origin and were identified as Central African Republic, Central African Republic minor II, Benin, and Senegal. The haplotype Central African Republic minor II was present on the {beta}{sup o}-thalassemia chromosome in 2 patients. None of 10 patients whose {alpha}-gene status was determined had {alpha}-thalassemia-2. These data strongly support the concept that the {beta}{sup s} gene on chromosome 11 of these individuals is of African origin and that the {alpha}-gene locus on chromosome 16 is of white or native American origin. The clinical severity of the disease in these nonblack patients is appropriate to their haplotype without {alpha}-thalassemia-2 and is comparable with that of black patients. All persons with congenital hemolytic anemia should be examined for the presence of sickle cell disease regardless of physical appearance or ethnic background.

  20. The history of African gene flow into Southern Europeans, Levantines, and Jews.

    PubMed

    Moorjani, Priya; Patterson, Nick; Hirschhorn, Joel N; Keinan, Alon; Hao, Li; Atzmon, Gil; Burns, Edward; Ostrer, Harry; Price, Alkes L; Reich, David

    2011-04-01

    Previous genetic studies have suggested a history of sub-Saharan African gene flow into some West Eurasian populations after the initial dispersal out of Africa that occurred at least 45,000 years ago. However, there has been no accurate characterization of the proportion of mixture, or of its date. We analyze genome-wide polymorphism data from about 40 West Eurasian groups to show that almost all Southern Europeans have inherited 1%-3% African ancestry with an average mixture date of around 55 generations ago, consistent with North African gene flow at the end of the Roman Empire and subsequent Arab migrations. Levantine groups harbor 4%-15% African ancestry with an average mixture date of about 32 generations ago, consistent with close political, economic, and cultural links with Egypt in the late middle ages. We also detect 3%-5% sub-Saharan African ancestry in all eight of the diverse Jewish populations that we analyzed. For the Jewish admixture, we obtain an average estimated date of about 72 generations. This may reflect descent of these groups from a common ancestral population that already had some African ancestry prior to the Jewish Diasporas.

  1. DNA polymorphism and selection at the melanocortin-1 receptor gene in normally pigmented southern African individuals.

    PubMed

    John, Premila R; Makova, Kateryna; Li, Wen-Hsiung; Jenkins, Trefor; Ramsay, Michele

    2003-06-01

    Skin pigmentation is a polygenic multifactorial trait determined by the cumulative effects of multiple genetic variants and environmental factors. Melanocortin-1 receptor (MC1R) is one of the genes involved in pigmentation, and has been implicated in the red hair and pale skin phenotype in human Caucasoid individuals. The present study was undertaken to identify variation at the MC1R locus in normally pigmented individuals in two African populations, sub-Saharan Negroids (22 unrelated individuals) and the San (17 unrelated individuals). The study showed considerable MC1R gene sequence variation with the detection of eight synonymous and three nonsynonymous mutations. This is the first report of nonsynonymous mutations in African individuals in the MC1R gene: L99I was found in a single San individual, S47I was detected in a single Negroid individual, and F196L was detected in five Negroid individuals (5/44; 0.11). The functional significance of these mutations is not known. Three of the eight synonymous mutations found, L106L (CTG --> CTA), F300F (TTC --> TTT), and T314T (ACA --> ACG) (also known as A942G), have been reported previously. T314T was the only variant that showed a significant difference between the Negroid and San populations (0.477 and 0.059, respectively; P = 1.6 x 10(-5)). Its low frequency in the San may be the result of random genetic drift in a population of small size, or selection. Several tests of neutrality of the MC1R coding region in these and other African populations were significant, suggesting that purifying selection (functional constraint) had occurred at this gene locus in Africans. This demonstrates that although some nonsynonymous MC1R mutations are tolerated in individuals with dark skin, this gene has likely played a significant role in the maintenance of dark pigmentation in Africans and normal pigment variation in non-African populations.

  2. Genomic Evidence Establishes Anatolia as the Source of the European Neolithic Gene Pool.

    PubMed

    Omrak, Ayça; Günther, Torsten; Valdiosera, Cristina; Svensson, Emma M; Malmström, Helena; Kiesewetter, Henrike; Aylward, William; Storå, Jan; Jakobsson, Mattias; Götherström, Anders

    2016-01-25

    Anatolia and the Near East have long been recognized as the epicenter of the Neolithic expansion through archaeological evidence. Recent archaeogenetic studies on Neolithic European human remains have shown that the Neolithic expansion in Europe was driven westward and northward by migration from a supposed Near Eastern origin [1-5]. However, this expansion and the establishment of numerous culture complexes in the Aegean and Balkans did not occur until 8,500 before present (BP), over 2,000 years after the initial settlements in the Neolithic core area [6-9]. We present ancient genome-wide sequence data from 6,700-year-old human remains excavated from a Neolithic context in Kumtepe, located in northwestern Anatolia near the well-known (and younger) site Troy [10]. Kumtepe is one of the settlements that emerged around 7,000 BP, after the initial expansion wave brought Neolithic practices to Europe. We show that this individual displays genetic similarities to the early European Neolithic gene pool and modern-day Sardinians, as well as a genetic affinity to modern-day populations from the Near East and the Caucasus. Furthermore, modern-day Anatolians carry signatures of several admixture events from different populations that have diluted this early Neolithic farmer component, explaining why modern-day Sardinian populations, instead of modern-day Anatolian populations, are genetically more similar to the people that drove the Neolithic expansion into Europe. Anatolia's central geographic location appears to have served as a connecting point, allowing a complex contact network with other areas of the Near East and Europe throughout, and after, the Neolithic.

  3. Role of genetic refuges in the restoration of native gene pools of brown trout.

    PubMed

    Araguas, Rosa M; Sanz, Núria; Fernández, Raquel; Utter, Fred M; Pla, Carles; García-Marín, José-Luis

    2009-08-01

    Captive-bred animals derived from native, alien, or hybrid stocks are often released in large numbers in natural settings with the intention of augmenting harvests. In brown trout (Salmo trutta), stocking with hatchery-reared non-native fish has been the main management strategy used to maintain or improve depleted wild brown trout populations in Iberian and other Mediterranean regions. This measure has become a serious threat to the conservation of native genetic diversity, mainly due to introgressive hybridization. Aware of this risk, the agency responsible for management of brown trout in the eastern Pyrenees (Spain) created "brown trout genetic refuges" to preserve the integrity of brown trout gene pools in this region. Within refuge areas, the prerefuge status with respect to fishing activities has been maintained, but hatchery releases have been banned completely. We evaluated this management strategy through a comparison of the stocking impact on native populations that accounted for stocking histories before and after refuge designations and fishing activities. In particular we examined the relevant scientific, cultural, and political challenges encountered. Despite agency willingness to change fishery policies to balance exploitation and conservation, acceptance of these new policies by anglers and genetic monitoring of refuge populations should also be considered. To improve management supported by genetic refuges, we suggest focusing on areas where the public is more receptive, considering the situation of local native diversity, and monitoring of adjacent introgressed populations. We recommend the use of directional supportive breeding only when a population really needs to be enhanced. In any case, management strategies should be developed to allow for protection within the context of human use.

  4. Gene-gene interaction between tuberculosis candidate genes in a South African population.

    PubMed

    de Wit, Erika; van der Merwe, Lize; van Helden, Paul D; Hoal, Eileen G

    2011-02-01

    In a complex disease such as tuberculosis (TB) it is increasingly evident that gene-gene interactions play a far more important role in an individual's susceptibility to develop the disease than single polymorphisms on their own, as one gene can enhance or hinder the expression of another gene. Gene-gene interaction analysis is a new approach to elucidate susceptibility to TB. The possibility of gene-gene interactions was assessed, focusing on 11 polymorphisms in nine genes (DC-SIGN, IFN-γ, IFNGR1, IL-8, IL-1Ra, MBL, NRAMP1, RANTES, and SP-D) that have been associated with TB, some repeatedly. An optimal model, which best describes and predicts TB case-control status, was constructed. Significant interactions were detected between eight pairs of variants. The models fitted the observed data extremely well, with p < 0.0001 for all eight models. A highly significant interaction was detected between INFGR1 and NRAMP1, which is not surprising because macrophage activation is greatly enhanced by IFN-γ and IFN-γ response elements that are present in the human NRAMP1 promoter region, providing further evidence for their interaction. This study enabled us to test the theory that disease outcome may be due to interaction of several gene effects. With eight instances of statistically significant gene-gene interactions, the importance of epistasis is clearly identifiable in this study. Methods for studying gene-gene interactions are based on a multilocus and multigene approach, consistent with the nature of complex-trait diseases, and may provide the paradigm for future genetic studies of TB.

  5. Gene-centric meta-analysis of lipid traits in African, East Asian and Hispanic populations

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Meta-analyses of European populations has successfully identified genetic variants in over 100 loci associated with lipid levels, but our knowledge in other ethnicities remains limited. To address this, we performed dense genotyping of circa 2,000 candidate genes in 7,657 African Americans, 1,315 Hi...

  6. Detecting the existence of gene flow between Spanish and North African goats through a coalescent approach.

    PubMed

    Martínez, Amparo; Manunza, Arianna; Delgado, Juan Vicente; Landi, Vincenzo; Adebambo, Ayotunde; Ismaila, Muritala; Capote, Juan; El Ouni, Mabrouk; Elbeltagy, Ahmed; Abushady, Asmaa M; Galal, Salah; Ferrando, Ainhoa; Gómez, Mariano; Pons, Agueda; Badaoui, Bouabid; Jordana, Jordi; Vidal, Oriol; Amills, Marcel

    2016-12-14

    Human-driven migrations are one of the main processes shaping the genetic diversity and population structure of domestic species. However, their magnitude and direction have been rarely analysed in a statistical framework. We aimed to estimate the impact of migration on the population structure of Spanish and African goats. To achieve this goal, we analysed a dataset of 1,472 individuals typed with 23 microsatellites. Population structure of African and Spanish goats was moderate (mean FST = 0.07), with the exception of the Canarian and South African breeds that displayed a significant differentiation when compared to goats from North Africa and Nigeria. Measurement of gene flow with Migrate-n and IMa coalescent genealogy samplers supported the existence of a bidirectional gene flow between African and Spanish goats. Moreover, IMa estimates of the effective number of migrants were remarkably lower than those calculated with Migrate-n and classical approaches. Such discrepancies suggest that recent divergence, rather than extensive gene flow, is the main cause of the weak population structure observed in caprine breeds.

  7. Detecting the existence of gene flow between Spanish and North African goats through a coalescent approach

    PubMed Central

    Martínez, Amparo; Manunza, Arianna; Delgado, Juan Vicente; Landi, Vincenzo; Adebambo, Ayotunde; Ismaila, Muritala; Capote, Juan; El Ouni, Mabrouk; Elbeltagy, Ahmed; Abushady, Asmaa M.; Galal, Salah; Ferrando, Ainhoa; Gómez, Mariano; Pons, Agueda; Badaoui, Bouabid; Jordana, Jordi; Vidal, Oriol; Amills, Marcel

    2016-01-01

    Human-driven migrations are one of the main processes shaping the genetic diversity and population structure of domestic species. However, their magnitude and direction have been rarely analysed in a statistical framework. We aimed to estimate the impact of migration on the population structure of Spanish and African goats. To achieve this goal, we analysed a dataset of 1,472 individuals typed with 23 microsatellites. Population structure of African and Spanish goats was moderate (mean FST = 0.07), with the exception of the Canarian and South African breeds that displayed a significant differentiation when compared to goats from North Africa and Nigeria. Measurement of gene flow with Migrate-n and IMa coalescent genealogy samplers supported the existence of a bidirectional gene flow between African and Spanish goats. Moreover, IMa estimates of the effective number of migrants were remarkably lower than those calculated with Migrate-n and classical approaches. Such discrepancies suggest that recent divergence, rather than extensive gene flow, is the main cause of the weak population structure observed in caprine breeds. PMID:27966592

  8. Pooled Enrichment Sequencing Identifies Diversity and Evolutionary Pressures at NLR Resistance Genes within a Wild Tomato Population

    PubMed Central

    Stam, Remco; Scheikl, Daniela; Tellier, Aurélien

    2016-01-01

    Nod-like receptors (NLRs) are nucleotide-binding domain and leucine-rich repeats containing proteins that are important in plant resistance signaling. Many of the known pathogen resistance (R) genes in plants are NLRs and they can recognize pathogen molecules directly or indirectly. As such, divergence and copy number variants at these genes are found to be high between species. Within populations, positive and balancing selection are to be expected if plants coevolve with their pathogens. In order to understand the complexity of R-gene coevolution in wild nonmodel species, it is necessary to identify the full range of NLRs and infer their evolutionary history. Here we investigate and reveal polymorphism occurring at 220 NLR genes within one population of the partially selfing wild tomato species Solanum pennellii. We use a combination of enrichment sequencing and pooling ten individuals, to specifically sequence NLR genes in a resource and cost-effective manner. We focus on the effects which different mapping and single nucleotide polymorphism calling software and settings have on calling polymorphisms in customized pooled samples. Our results are accurately verified using Sanger sequencing of polymorphic gene fragments. Our results indicate that some NLRs, namely 13 out of 220, have maintained polymorphism within our S. pennellii population. These genes show a wide range of πN/πS ratios and differing site frequency spectra. We compare our observed rate of heterozygosity with expectations for this selfing and bottlenecked population. We conclude that our method enables us to pinpoint NLR genes which have experienced natural selection in their habitat. PMID:27189991

  9. Metastatic progression and gene expression between breast cancer cell lines from African American and Caucasian women

    PubMed Central

    Yancy, Haile F; Mason, Jacquline A; Peters, Sharla; Thompson, Charles E; Littleton, George K; Jett, Marti; Day, Agnes A

    2007-01-01

    African American (AA) women have a lower overall incidence of breast cancer than do Caucasian (CAU) women, but a higher overall mortality. Little is known as to why the incidence of breast cancer is lower yet mortality is higher in AA women. Many studies speculate that this is only a socio-economical problem. This investigation suggests the possibility that molecular mechanisms contribute to the increased mortality of AA women with breast cancer. This study investigates the expression of 14 genes which have been shown to play a role in cancer metastasis. Cell lines derived from AA and CAU patients were analyzed to demonstrate alterations in the transcription of genes known to be involved in cancer and the metastatic process. Total RNA was isolated from cell lines and analyzed by RT-PCR analysis. Differential expression of the 14 targeted genes between a spectrum model (6 breast cancer cell lines and 2 non-cancer breast cell lines) and a metastasis model (12 metastatic breast cancer cell lines) were demonstrated. Additionally, an in vitro comparison of the expression established differences in 5 of the 14 biomarker genes between African American and Caucasian breast cell lines. Results from this study indicates that altered expression of the genes Atp1b1, CARD 10, KLF4, Spint2, and Acly may play a role in the aggressive phenotype seen in breast cancer in African American women. PMID:17472751

  10. Swimming Pools.

    ERIC Educational Resources Information Center

    Ministry of Housing and Local Government, London (England).

    Technical and engineering data are set forth on the design and construction of swimming pools. Consideration is given to site selection, pool construction, the comparative merits of combining open air and enclosed pools, and alternative uses of the pool. Guidelines are presented regarding--(1) pool size and use, (2) locker and changing rooms, (3)…

  11. Epidemic Clones, Oceanic Gene Pools, and Eco-LD in the Free Living Marine Pathogen Vibrio parahaemolyticus.

    PubMed

    Cui, Yujun; Yang, Xianwei; Didelot, Xavier; Guo, Chenyi; Li, Dongfang; Yan, Yanfeng; Zhang, Yiquan; Yuan, Yanting; Yang, Huanming; Wang, Jian; Wang, Jun; Song, Yajun; Zhou, Dongsheng; Falush, Daniel; Yang, Ruifu

    2015-06-01

    We investigated global patterns of variation in 157 whole-genome sequences of Vibrio parahaemolyticus, a free-living and seafood associated marine bacterium. Pandemic clones, responsible for recent outbreaks of gastroenteritis in humans, have spread globally. However, there are oceanic gene pools, one located in the oceans surrounding Asia and another in the Mexican Gulf. Frequent recombination means that most isolates have acquired the genetic profile of their current location. We investigated the genetic structure in the Asian gene pool by calculating the effective population size in two different ways. Under standard neutral models, the two estimates should give similar answers but we found a 27-fold difference. We propose that this discrepancy is caused by the subdivision of the species into a hundred or more ecotypes which are maintained stably in the population. To investigate the genetic factors involved, we used 51 unrelated isolates to conduct a genome-wide scan for epistatically interacting loci. We found a single example of strong epistasis between distant genome regions. A majority of strains had a type VI secretion system associated with bacterial killing. The remaining strains had genes associated with biofilm formation and regulated by cyclic dimeric GMP signaling. All strains had one or other of the two systems and none of isolate had complete complements of both systems, although several strains had remnants. Further "top down" analysis of patterns of linkage disequilibrium within frequently recombining species will allow a detailed understanding of how selection acts to structure the pattern of variation within natural bacterial populations.

  12. Bacterial intra-species gene loss occurs in a largely clocklike manner mostly within a pool of less conserved and constrained genes

    PubMed Central

    Bolotin, Evgeni; Hershberg, Ruth

    2016-01-01

    Gene loss is a major contributor to the evolution of bacterial gene content. Gene loss may occur as a result of shifts in environment leading to changes in the intensity and/or directionality of selection applied for the maintenance of specific genes. Gene loss may also occur in a more neutral manner, when gene functions are lost that were not subject to strong selection to be maintained, irrespective of changes to environment. Here, we used a pangenome-based approach to investigate patterns of gene loss across 15 bacterial species. We demonstrate that gene loss tends to occur mostly within a pool of genes that are less constrained within species, even in those strains from which they are not lost, and less conserved across bacterial species. Our results indicate that shifts in selection, resulting from shifts in environment are not required to explain the majority of gene loss events occurring within a diverse collection of bacterial species. Caution should therefore be taken when attributing differences in gene content to differences in environment. PMID:27734920

  13. A GENOME WIDE ASSOCIATION STUDY FOR DIABETIC NEPHROPATHY GENES IN AFRICAN AMERICANS

    PubMed Central

    McDonough, Caitrin W.; Palmer, Nicholette D.; Hicks, Pamela J.; Roh, Bong H.; An, S. Sandy; Cooke, Jessica N.; Hester, Jessica M.; Wing, Maria R.; Bostrom, Meredith A.; Rudock, Megan E.; Lewis, Joshua P.; Talbert, Matthew E.; Blevins, Rebecca A.; Lu, Lingyi; Ng, Maggie C.Y.; Sale, Michele M.; Divers, Jasmin; Langefeld, Carl D.; Freedman, Barry I.; Bowden, Donald W.

    2011-01-01

    A genome-wide association study was performed using the Affymetrix 6.0 chip to identify genes associated with diabetic nephropathy in African Americans. Association analysis was performed adjusting for admixture in 965 type 2 diabetic African American patients with end-stage renal disease (ESRD) and in 1029 African Americans without type 2 diabetes or kidney disease as controls. The top 724 single nucleotide polymorphisms (SNPs) with evidence of association to diabetic nephropathy were then genotyped in a replication sample of an additional 709 type 2 diabetes-ESRD patients and 690 controls. SNPs with evidence of association in both the original and replication studies were tested in additional African American cohorts consisting of 1246 patients with type 2 diabetes without kidney disease and 1216 with non-diabetic ESRD to differentiate candidate loci for type 2 diabetes-ESRD, type 2 diabetes, and/or all-cause ESRD. Twenty-five SNPs were significantly associated with type 2 diabetes-ESRD in the genome-wide association and initial replication. Although genome-wide significance with type 2 diabetes was not found for any of these 25 SNPs, several genes, including RPS12, LIMK2, and SFI1 are strong candidates for diabetic nephropathy. A combined analysis of all 2890 patients with ESRD showed significant association SNPs in LIMK2 and SFI1 suggesting that they also contribute to all-cause ESRD. Thus, our results suggest that multiple loci underlie susceptibility to kidney disease in African Americans with type 2 diabetes and some may also contribute to all-cause ESRD. PMID:21150874

  14. Diversity in the Toll-Like Receptor Genes of the African Penguin (Spheniscus demersus)

    PubMed Central

    Dalton, Desiré Lee; Vermaak, Elaine; Roelofse, Marli; Kotze, Antoinette

    2016-01-01

    The African penguin, Spheniscus demersus, is listed as Endangered by the IUCN Red List of Threatened Species due to the drastic reduction in population numbers over the last 20 years. To date, the only studies on immunogenetic variation in penguins have been conducted on the major histocompatibility complex (MHC) genes. It was shown in humans that up to half of the genetic variability in immune responses to pathogens are located in non-MHC genes. Toll-like receptors (TLRs) are now increasingly being studied in a variety of taxa as a broader approach to determine functional genetic diversity. In this study, we confirm low genetic diversity in the innate immune region of African penguins similar to that observed in New Zealand robin that has undergone several severe population bottlenecks. Single nucleotide polymorphism (SNP) diversity across TLRs varied between ex situ and in situ penguins with the number of non-synonymous alterations in ex situ populations (n = 14) being reduced in comparison to in situ populations (n = 16). Maintaining adaptive diversity is of vital importance in the assurance populations as these animals may potentially be used in the future for re-introductions. Therefore, this study provides essential data on immune gene diversity in penguins and will assist in providing an additional monitoring tool for African penguin in the wild, as well as to monitor diversity in ex situ populations and to ensure that diversity found in the in situ populations are captured in the assurance populations. PMID:27760133

  15. Diversity in the Toll-Like Receptor Genes of the African Penguin (Spheniscus demersus).

    PubMed

    Dalton, Desiré Lee; Vermaak, Elaine; Roelofse, Marli; Kotze, Antoinette

    2016-01-01

    The African penguin, Spheniscus demersus, is listed as Endangered by the IUCN Red List of Threatened Species due to the drastic reduction in population numbers over the last 20 years. To date, the only studies on immunogenetic variation in penguins have been conducted on the major histocompatibility complex (MHC) genes. It was shown in humans that up to half of the genetic variability in immune responses to pathogens are located in non-MHC genes. Toll-like receptors (TLRs) are now increasingly being studied in a variety of taxa as a broader approach to determine functional genetic diversity. In this study, we confirm low genetic diversity in the innate immune region of African penguins similar to that observed in New Zealand robin that has undergone several severe population bottlenecks. Single nucleotide polymorphism (SNP) diversity across TLRs varied between ex situ and in situ penguins with the number of non-synonymous alterations in ex situ populations (n = 14) being reduced in comparison to in situ populations (n = 16). Maintaining adaptive diversity is of vital importance in the assurance populations as these animals may potentially be used in the future for re-introductions. Therefore, this study provides essential data on immune gene diversity in penguins and will assist in providing an additional monitoring tool for African penguin in the wild, as well as to monitor diversity in ex situ populations and to ensure that diversity found in the in situ populations are captured in the assurance populations.

  16. Review of studies on metabolic genes and cancer in populations of African descent

    PubMed Central

    Ragin, Camille C.; Langevin, Scott; Rubin, Scott; Taioli, Emanuela

    2010-01-01

    Genetic polymorphisms described for a number of enzymes involved in the metabolism of tobacco carcinogens and alcohol have been linked to increase cancer risk. Racial disparities in cancer between Whites and populations of African descent are well documented. In addition to differences in access to health care, both environment and genetic factors and their interaction may contribute to the increased cancer risk in minority populations. We reviewed the literature to identify case-control studies that included subjects of African descent. Meta analyses investigating the association of genetic polymorphisms in tobacco metabolic genes and cancer were performed. While several genes and cancers have been studied, only one or two studies per gene for each cancer site have been published, with the exception of breast (CYP1A1 and CYP1B1), lung (GSTM1, CYP1A1, and NQO1) and prostate (CYP3A4 A293G and CYP17). Marginal statistically significant associations were observed for CYP3A4 A293G and CYP17 5'UTR polymorphisms and prostate cancer. Our findings support the need for additional genetic association studies of breast, prostate and lung cancers that include a larger number of minority participants. Since incidence and mortality rates for these cancers rank highest among populations of African descent concentrated research in these areas are warranted. PMID:20027111

  17. Contrasting historical and recent gene flow among African buffalo herds in the Caprivi Strip of Namibia.

    PubMed

    Epps, Clinton W; Castillo, Jessica A; Schmidt-Küntzel, Anne; du Preez, Pierre; Stuart-Hill, Greg; Jago, Mark; Naidoo, Robin

    2013-03-01

    Population genetic structure is often used to infer population connectivity, but genetic structure may largely reflect historical rather than recent processes. We contrasted genetic structure with recent gene-flow estimates among 6 herds of African buffalo (Syncerus caffer) in the Caprivi Strip, Namibia, using 134 individuals genotyped at 10 microsatellite loci. We tested whether historical and recent gene flows were influenced by distance, potential barriers (rivers), or landscape resistance (distance from water). We also tested at what scales individuals were more related than expected by chance. Genetic structure across the Caprivi Strip was weak, indicating that historically, gene flow was strong and was not affected by distance, barriers, or landscape resistance. Our analysis of simulated data suggested that genetic structure would be unlikely to reflect human disturbances in the last 10-20 generations (75-150 years) because of slow predicted rates of genetic drift, but recent gene-flow estimates would be affected. Recent gene-flow estimates were not consistently affected by rivers or distance to water but showed that isolation by distance appears to be developing. Average relatedness estimates among individuals exceeded random expectations only within herds. We conclude that historically, African buffalo moved freely throughout the Caprivi Strip, whereas recent gene flow has been more restricted. Our findings support efforts to maintain the connectivity of buffalo herds across this region and demonstrate the utility of contrasting genetic inferences from different time scales.

  18. Gene-environment interactions on mental development in African American, Dominican, and Caucasian Mothers and Newborns

    PubMed Central

    Wang, Shuang; Chanock, Stephen; Tang, Deliang; Li, Zhigang; Edwards, Susan; Jedrychowski, Wieslaw; Perera, Frederica P.

    2009-01-01

    The health impact of environmental toxins has gained increasing recognition over the years. Polycyclic aromatic hydrocarbons (PAHs) and environmental tobacco smoke (ETS) are known to affect nervous system development in children, but no studies have investigated how polymorphisms in PAH metabolic or detoxification genes affect child cognitive development following PAH exposure during pregnancy. In two parallel prospective cohort studies of nonsmoking African American and Dominican mothers and children in New York City and of Caucasian mothers and children in Krakow, Poland, we explored the effect of gene-PAH interaction on child mental development index (MDI), as measured by the Bayley Scales of Infant Development-Revised (BSID-II). Genes known to play important roles in the metabolic activation or detoxification of PAHs were selected. Genetic variations in these genes could influence susceptibility to adverse effects of PAHs in polluted air. We explored the effects of interactions between prenatal PAH exposure and 21 polymorphisms or haplotypes in these genes on MDI at 12, 24, and 36 months among 547 newborns and 806 mothers from three different ethnic groups: African Americans, Dominicans, and Caucasians. PAHs were measured by personal air monitoring of mothers during pregnancy. Significant interaction effects between haplotypes and PAHs were observed in mothers and their newborns in all three ethnic groups after Bonferroni correction for multiple comparisons. The strongest and most consistent effect observed was between PAH and haplotype ACCGGC of the CYP1B1 gene. PMID:19860743

  19. Expression and characterization of the thymidine kinase gene of African swine fever virus.

    PubMed Central

    Martin Hernandez, A M; Tabares, E

    1991-01-01

    The thymidine kinase (TK) gene of African swine fever virus (ASFV) was located within the viral genome by using two degenerate oligonucleotide probes derived from sequences of the vaccinia virus and cellular TK genes. The TK gene was mapped within a 0.72-kbp BglII-XhoI fragment (0.242 to 0.246 map units) derived from a 23.9-kbp SalI-B fragment of the ASFV genome. Identification of this region as the ASFV TK gene was confirmed by expression of TK in Escherichia coli and by the synthesis of active TK in a cell-free system programmed with RNA synthesized in vitro. The sequenced gene for TK includes an open reading frame of 588 nucleotides encoding a protein of 196 amino acids. The deduced amino acid sequence shows 32.4% identity with the TK of vaccinia virus. Images PMID:1987368

  20. Globin gene-associated restriction-fragment-length polymorphisms in southern African peoples.

    PubMed Central

    Ramsay, M; Jenkins, T

    1987-01-01

    The combination of polymorphic restriction-enzyme sites in the 3' region of the beta-globin gene cluster shows very little variation in southern-African Bantu-speaking black and Kalahari !Kung San populations. The sites of the 5' region, on the other hand, show marked variation, and two common haplotypes are present--the "Negro" type (- - - - +) and the "San" type (- + - - +)--in frequencies of .404 and .106, respectively, in the Bantu-speakers and .262 and .405, respectively, in the San. Twenty of 23 beta s-associated haplotypes in southern-African Bantu-speaking black subjects were the same as that found commonly in the Central African Republic (CAR)--i.e., the "Bantu" type--a finding providing the first convincing biological evidence for the common ancestry of geographically widely separated speakers of languages belonging to the Bantu family. The (-alpha) haplotype has a frequency of .21 in the Venda, .07 in both the Sotho-Tswana and the Nguni, and .06 among the !Kung San. These data are interpreted in the light of Plasmodium falciparum malaria selection and population movements in the African subcontinent. PMID:2891298

  1. A preliminary analysis of the immunoglobulin genes in the African elephant (Loxodonta africana).

    PubMed

    Guo, Yongchen; Bao, Yonghua; Wang, Hui; Hu, Xiaoxiang; Zhao, Zhihui; Li, Ning; Zhao, Yaofeng

    2011-02-25

    The genomic organization of the IgH (Immunoglobulin heavy chain), Igκ (Immunoglobulin kappa chain), and Igλ (Immunoglobulin lambda chain) loci in the African elephant (Loxodonta africana) was annotated using available genome data. The elephant IgH locus on scaffold 57 spans over 2,974 kb, and consists of at least 112 V(H) gene segments, 87 D(H) gene segments (the largest number in mammals examined so far), six J(H) gene segments, a single μ, a δ remnant, and eight γ genes (α and ε genes are missing, most likely due to sequence gaps). The Igκ locus, found on three scaffolds (202, 50 and 86), contains a total of 153 V(κ) gene segments, three J(κ) segments, and a single C(κ) gene. Two different transcriptional orientations were determined for these V(κ) gene segments. In contrast, the Igλ locus on scaffold 68 includes 15 V(λ) gene segments, all with the same transcriptional polarity as the downstream J(λ)-C(λ) cluster. These data suggest that the elephant immunoglobulin gene repertoire is highly diverse and complex. Our results provide insights into the immunoglobulin genes in a placental mammal that is evolutionarily distant from humans, mice, and domestic animals.

  2. A Preliminary Analysis of the Immunoglobulin Genes in the African Elephant (Loxodonta africana)

    PubMed Central

    Guo, Yongchen; Bao, Yonghua; Wang, Hui; Hu, Xiaoxiang; Zhao, Zhihui; Li, Ning; Zhao, Yaofeng

    2011-01-01

    The genomic organization of the IgH (Immunoglobulin heavy chain), Igκ (Immunoglobulin kappa chain), and Igλ (Immunoglobulin lambda chain) loci in the African elephant (Loxodonta africana) was annotated using available genome data. The elephant IgH locus on scaffold 57 spans over 2,974 kb, and consists of at least 112 VH gene segments, 87 DH gene segments (the largest number in mammals examined so far), six JH gene segments, a single μ, a δ remnant, and eight γ genes (α and ε genes are missing, most likely due to sequence gaps). The Igκ locus, found on three scaffolds (202, 50 and 86), contains a total of 153 Vκ gene segments, three Jκ segments, and a single Cκ gene. Two different transcriptional orientations were determined for these Vκ gene segments. In contrast, the Igλ locus on scaffold 68 includes 15 Vλ gene segments, all with the same transcriptional polarity as the downstream Jλ-Cλ cluster. These data suggest that the elephant immunoglobulin gene repertoire is highly diverse and complex. Our results provide insights into the immunoglobulin genes in a placental mammal that is evolutionarily distant from humans, mice, and domestic animals. PMID:21364892

  3. High Temperature Inhibits Ascorbate Recycling and Light Stimulation of the Ascorbate Pool in Tomato despite Increased Expression of Biosynthesis Genes

    PubMed Central

    Massot, Capucine; Bancel, Doriane; Lopez Lauri, Félicie; Truffault, Vincent; Baldet, Pierre; Stevens, Rebecca; Gautier, Hélène

    2013-01-01

    Understanding how the fruit microclimate affects ascorbate (AsA) biosynthesis, oxidation and recycling is a great challenge in improving fruit nutritional quality. For this purpose, tomatoes at breaker stage were harvested and placed in controlled environment conditions at different temperatures (12, 17, 23, 27 and 31°C) and irradiance regimes (darkness or 150 µmol m-2 s-1). Fruit pericarp tissue was used to assay ascorbate, glutathione, enzymes related to oxidative stress and the AsA/glutathione cycle and follow the expression of genes coding for 5 enzymes of the AsA biosynthesis pathway (GME, VTC2, GPP, L-GalDH, GLDH). The AsA pool size in pericarp tissue was significantly higher under light at temperatures below 27°C. In addition, light promoted glutathione accumulation at low and high temperatures. At 12°C, increased AsA content was correlated with the enhanced expression of all genes of the biosynthesis pathway studied, combined with higher DHAR and MDHAR activities and increased enzymatic activities related to oxidative stress (CAT and APX). In contrast, at 31°C, MDHAR and GR activities were significantly reduced under light indicating that enzymes of the AsA/glutathione cycle may limit AsA recycling and pool size in fruit pericarp, despite enhanced expression of genes coding for AsA biosynthesis enzymes. In conclusion, this study confirms the important role of fruit microclimate in the regulation of fruit pericarp AsA content, as under oxidative conditions (12°C, light) total fruit pericarp AsA content increased up to 71%. Moreover, it reveals that light and temperature interact to regulate both AsA biosynthesis gene expression in tomato fruits and AsA oxidation and recycling. PMID:24367665

  4. Identification of resistance to new virulent races of rust in sunflowers and validation of DNA markers in the gene pool.

    PubMed

    Qi, Lili; Gulya, Tom; Seiler, Gerald J; Hulke, Brent S; Vick, Brady A

    2011-02-01

    Sunflower rust, caused by Puccinia helianthi, is a prevalent disease in many countries throughout the world. The U.S. Department of Agriculture (USDA)-Agricultural Research Service, Sunflower Research Unit has released rust resistant breeding materials for several decades. However, constantly coevolving rust populations have formed new virulent races to which current hybrids have little resistance. The objectives of this study were to identify resistance to race 336, the predominant race in North America, and to race 777, the most virulent race currently known, and to validate molecular markers known to be linked to rust resistance genes in the sunflower gene pool. A total of 104 entries, including 66 released USDA inbred lines, 14 USDA interspecific germplasm lines, and 24 foreign germplasms, all developed specifically for rust resistance, were tested for their reaction to races 336 and 777. Only 13 of the 104 entries tested were resistant to both races, whereas another six were resistant only to race 336. The interspecific germplasm line, Rf ANN-1742, was resistant to both races and was identified as a new rust resistance source. A selection of 24 lines including 19 lines resistant to races 777 and/or 336 was screened with DNA markers linked to rust resistance genes R(1), R(2), R(4u), and R(5). The results indicated that the existing resistant lines are diverse in rust resistance genes. Durable genetic resistance through gene pyramiding will be effective for the control of rust.

  5. A network of autism linked genes stabilizes two pools of synaptic GABAA receptors

    PubMed Central

    Tong, Xia-Jing; Hu, Zhitao; Liu, Yu; Anderson, Dorian; Kaplan, Joshua M

    2015-01-01

    Changing receptor abundance at synapses is an important mechanism for regulating synaptic strength. Synapses contain two pools of receptors, immobilized and diffusing receptors, both of which are confined to post-synaptic elements. Here we show that immobile and diffusing GABAA receptors are stabilized by distinct synaptic scaffolds at C. elegans neuromuscular junctions. Immobilized GABAA receptors are stabilized by binding to FRM-3/EPB4.1 and LIN-2A/CASK. Diffusing GABAA receptors are stabilized by the synaptic adhesion molecules Neurexin and Neuroligin. Inhibitory post-synaptic currents are eliminated in double mutants lacking both scaffolds. Neurexin, Neuroligin, and CASK mutations are all linked to Autism Spectrum Disorders (ASD). Our results suggest that these mutations may directly alter inhibitory transmission, which could contribute to the developmental and cognitive deficits observed in ASD. DOI: http://dx.doi.org/10.7554/eLife.09648.001 PMID:26575289

  6. Race structure within the Mesoamerican gene pool of common bean (Phaseolus vulgaris L.) as determined by microsatellite markers.

    PubMed

    Díaz, L M; Blair, M W

    2006-12-01

    Common bean (Phaseolus vulgaris L.) cultivars are distinguished morphologically, agronomically and ecologically into specific races within each of the two gene pools found for the species (Andean and Mesoamerican). The objective of this study was to describe the race structure of the Mesoamerican gene pool using microsatellite markers. A total of 60 genotypes previously described as pertaining to specific Mesoamerican races as well as two Andean control genotypes were analyzed with 52 markers. A total of 267 bands were generated with an average of 5.1 alleles per marker and 0.297 heterozygosity across all microsatellites. Correspondence analysis identified two major groups equivalent to the Mesoamerica race and a group containing both Durango and Jalisco race genotypes. Two outlying individuals were classified as potentially of the Guatemala race although this race does not have a defined structure and previously classified members of this race were classified with other races. Population structure analysis with K = 1-4 agreed with this classification. The genetic diversity based on Nei's index for the entire set of genotypes was 0.468 while this was highest for the Durango-Jalisco group (0.414), intermediate for race Mesoamerica (0.340) and low for race Guatemala (0.262). Genetic differentiation (G (ST)) between the Mesoamerican races was 0.27 while genetic distance and identity showed race Durango and Jalisco individuals to be closely related with high gene flow (N (m)) both between these two races (1.67) and between races Durango and Mesoamerica (1.58). Observed heterozygosity was low in all the races as would be expected for an inbreeding species. The analysis with microsatellite markers identified subgroups, which agreed well with commercial class divisions, and seed size was the main distinguishing factor between the two major groups identified.

  7. Analysis of the influenza virus gene pool of avian species from southern China.

    PubMed

    Lin, Y P; Shu, L L; Wright, S; Bean, W J; Sharp, G B; Shortridge, K F; Webster, R G

    1994-02-01

    Although Southern China has been considered the epicenter of human influenza pandemics, little is known about the genetic composition of influenza viruses in lower mammals or birds in that region. To provide information on the molecular epidemiology of these viruses, we used dot blot hybridization and phylogenetic methods to study the internal genes (PB1, PB2, PA, NP, M, and NS) of 106 avian influenza A viruses isolated from a total of 11,798 domestic ducks, chickens, and geese raised in Southern China including Hong Kong. All 636 genes examined were characteristic of avian influenza viruses; no human or swine influenza genes were detected. Thus, influenza virus reassortants do not appear to be maintained in the domesticated birds of Southeast Asia, eliminating opportunities for further gene reassortment. Phylogenetic analysis showed that the internal genes of these viruses belong to the Eurasian avian lineage, supporting geographical separation of the major avian lineages. The PB1 genes were most similar to A/Singapore/57 (H2N2) and Hong Kong (H3N2) viral genes, supporting an avian origin for the recent human H2N2 and H3N2 pandemic strains. The majority of internal genes from avian influenza viruses in Southern China belong to the Eurasian lineage and are similar to viruses that have recently been transmitted to humans, swine, and horses. This study provides evidence that the transmission of avian influenza viruses and their genes to other species is unidirectional and that the transmission of mammalian influenza virus strains to domestic poultry is probably not a factor in the generation of new pandemic strains.

  8. Multiple episodic evolution events in V1R receptor genes of East-African cichlids.

    PubMed

    Nikaido, Masato; Ota, Tomoki; Hirata, Tadashi; Suzuki, Hikoyu; Satta, Yoko; Aibara, Mitsuto; Mzighani, Semvua I; Sturmbauer, Christian; Hagino-Yamagishi, Kimiko; Okada, Norihiro

    2014-05-06

    Fish use olfaction to detect a variety of nonvolatile chemical signals, and thus, this sense is key to survival and communication. However, the contribution of the olfactory sense to social-especially reproductive-interactions in cichlids is still controversial. To obtain insights into this issue, we investigated the genes encoding V1Rs-possible candidates for reproductive pheromone receptors-among East-African cichlids. Interestingly, we found an excess of nonsynonymous over synonymous substitutions in four of six V1R genes in multiple cichlid lineages. First, we found that highly dimorphic V1R2 allele groups were shared among the cichlids inhabiting all East-African Great Lakes emerged through the episodic accumulation of the nonsynonymous substitutions prior to the radiation of the Lake Tanganyika species flock. We further detected such episodic events in V1R1 of the tribe Tropheini, and in V1R3 and V1R6 of the tribe Trematocarini. The excess of nonsynonymous substitutions in these examples were indicated as dN/dS > 1, which were all statistically significant by Fisher's exact test. Furthermore, we speculate that the amino acid changes in these episodic events are likely functional switch because they occurred in the putative ligand-binding pocket. Our finding of the occurrence of multiple episodic events and the unexpected gene diversity in one unique gene family is suggestive of the contribution of the V1R to the species diversification and the social interaction in cichlids.

  9. Gene polymorphisms in African buffalo associated with susceptibility to bovine tuberculosis infection.

    PubMed

    le Roex, Nikki; Koets, Ad P; van Helden, Paul D; Hoal, Eileen G

    2013-01-01

    Bovine tuberculosis (BTB) is a chronic, highly infectious disease that affects humans, cattle and numerous species of wildlife. In developing countries such as South Africa, the existence of extensive wildlife-human-livestock interfaces poses a significant risk of Mycobacterium bovis transmission between these groups, and has far-reaching ecological, economic and public health impacts. The African buffalo (Syncerus caffer), acts as a maintenance host for Mycobacterium bovis, and maintains and transmits the disease within the buffalo and to other species. In this study we aimed to investigate genetic susceptibility of buffalo for Mycobacterium bovis infection. Samples from 868 African buffalo of the Cape buffalo subspecies were used in this study. SNPs (n = 69), with predicted functional consequences in genes related to the immune system, were genotyped in this buffalo population by competitive allele-specific SNP genotyping. Case-control association testing and statistical analyses identified three SNPs associated with BTB status in buffalo. These SNPs, SNP41, SNP137 and SNP144, are located in the SLC7A13, DMBT1 and IL1α genes, respectively. SNP137 remained significantly associated after permutation testing. The three genetic polymorphisms identified are located in promising candidate genes for further exploration into genetic susceptibility to BTB in buffalo and other bovids, such as the domestic cow. These polymorphisms/genes may also hold potential for marker-assisted breeding programmes, with the aim of breeding more BTB-resistant animals and herds within both the national parks and the private sector.

  10. Exciting Pools

    ERIC Educational Resources Information Center

    Wright, Bradford L.

    1975-01-01

    Advocates the creation of swimming pool oscillations as part of a general investigation of mechanical oscillations. Presents the equations, procedure for deriving the slosh modes, and methods of period estimation for exciting swimming pool oscillations. (GS)

  11. Interethnic diversity of the CD209 (rs4804803) gene promoter polymorphism in African but not American sickle cell disease

    PubMed Central

    Noble, Jenelle A.; Duru, Kimberley C.; Guindo, Aldiouma; Yi, Li; Imumorin, Ikhide G.; Diallo, Dapa A.

    2015-01-01

    Elucidating the genomic diversity of CD209 gene promoter polymorphism could assist in clarifying disease pathophysiology as well as contribution to co-morbidities. CD209 gene promoter polymorphism has been shown to be associated with susceptibility to infection. We hypothesize that CD209 mutant variants occur at a higher frequency among Africans and in sickle cell disease. We analyzed the frequency of the CD209 gene (rs4804803) in healthy control and sickle cell disease (SCD) populations and determined association with disease. Genomic DNA was extracted from blood samples collected from 145 SCD and 231 control Africans (from Mali), 331 SCD and 379 control African Americans and 159 Caucasians. Comparative analysis among and between groups was carried out by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Per ethnic diversification, we found significant disparity in genotypic (23.4% versus 16.9% versus 3.2%) and allelic frequencies (48.7% versus 42.1% versus 19.8%) of the homozygote mutant variant of the CD209 (snp 309A/G) gene promoter between Africans, African Americans and Caucasians respectively. Comparative evaluation between disease and control groups reveal a significant difference in genotypic (10.4% versus 23.4%; p = 0.002) and allelic frequencies (39.7% versus 48.7%; p = 0.02) of the homozygote mutant variant in African SCD and healthy controls respectively, an observation that is completely absent among Americans. Comparing disease groups, we found no difference in the genotypic (p = 0.19) or allelic (p = 0.72) frequencies of CD209 homozygote mutant variant between Africans and Americans with sickle cell disease. The higher frequency of CD209 homozygote mutant variants in the African control group reveals a potential impairment of the capacity to mount an immune response to infectious diseases, and possibly delineate susceptibility to or severity of infectious co-morbidities within and between groups. PMID:25755928

  12. Recent Historical Migrations Have Shaped the Gene Pool of Arabs and Berbers in North Africa.

    PubMed

    Arauna, Lara R; Mendoza-Revilla, Javier; Mas-Sandoval, Alex; Izaabel, Hassan; Bekada, Asmahan; Benhamamouch, Soraya; Fadhlaoui-Zid, Karima; Zalloua, Pierre; Hellenthal, Garrett; Comas, David

    2017-02-01

    North Africa is characterized by its diverse cultural and linguistic groups and its genetic heterogeneity. Genomic data has shown an amalgam of components mixed since pre-Holocean times. Though no differences have been found in uniparental and classical markers between Berbers and Arabs, the two main ethnic groups in the region, the scanty genomic data available have highlighted the singularity of Berbers. We characterize the genetic heterogeneity of North African groups, focusing on the putative differences of Berbers and Arabs, and estimate migration dates. We analyze genome-wide autosomal data in five Berber and six Arab groups, and compare them to Middle Easterns, sub-Saharans, and Europeans. Haplotype-based methods show a lack of correlation between geographical and genetic populations, and a high degree of genetic heterogeneity, without strong differences between Berbers and Arabs. Berbers enclose genetically diverse groups, from isolated endogamous groups with high autochthonous component frequencies, large homozygosity runs and low effective population sizes, to admixed groups with high frequencies of sub-Saharan and Middle Eastern components. Admixture time estimates show a complex pattern of recent historical migrations, with a peak around the 7th century C.E. coincident with the Arabization of the region; sub-Saharan migrations since the 1st century B.C. in agreement with Roman slave trade; and a strong migration in the 17th century C.E., coincident with a huge impact of the trans-Atlantic and trans-Saharan trade of sub-Saharan slaves in the Modern Era. The genetic complexity found should be taken into account when selecting reference groups in population genetics and biomedical studies.

  13. Gene-centric analysis of serum cotinine levels in African and European American populations.

    PubMed

    Hamidovic, Ajna; Goodloe, Robert J; Bergen, Andrew W; Benowitz, Neal L; Styn, Mindi A; Kasberger, Jay L; Choquet, Helene; Young, Taylor R; Meng, Yan; Palmer, Cameron; Pletcher, Mark; Kertesz, Stefan; Hitsman, Brian; Spring, Bonnie; Jorgenson, Eric

    2012-03-01

    To date, most genetic association studies of tobacco use have been conducted in European American subjects using the phenotype of smoking quantity (cigarettes per day). However, smoking quantity is a very imprecise measure of exposure to tobacco smoke constituents. Analyses of alternate phenotypes and populations may improve our understanding of tobacco addiction genetics. Cotinine is the major metabolite of nicotine, and measuring serum cotinine levels in smokers provides a more objective measure of nicotine dose than smoking quantity. Previous genetic association studies of serum cotinine have focused on individual genes. We conducted a genetic association study of the biomarker in African American (N=365) and European American (N=315) subjects from the Coronary Artery Risk Development in Young Adults study using a chip containing densely-spaced tag SNPs in ∼2100 genes. We found that rs11187065, located in the non-coding region (intron 1) of insulin-degrading enzyme (IDE), was the most strongly associated SNP (p=8.91 × 10(-6)) in the African American cohort, whereas rs11763963, located on chromosome 7 outside of a gene transcript, was the most strongly associated SNP in European Americans (p=1.53 × 10(-6)). We then evaluated how the top variant association in each population performed in the other group. We found that the association of rs11187065 in IDE was also associated with the phenotype in European Americans (p=0.044). Our top SNP association in European Americans, rs11763963 was non-polymorphic in our African American sample. It has been previously shown that psychostimulant self-administration is reduced in animals with lower insulin because of interference with dopamine transmission in the brain reward centers. Our finding provides a platform for further investigation of this, or additional mechanisms, involving the relationship between insulin and self-administered nicotine dose.

  14. Distinct cholesterogenic and lipidogenic gene expression patterns in ovarian cancer - a new pool of biomarkers

    PubMed Central

    Pampalakis, Georgios; Politi, Angeliki-Louiza; Papanastasiou, Anastasios; Sotiropoulou, Georgia

    2015-01-01

    Cancer cells display different metabolic requirements compared to nonmalignant cells imposed by their need for rapid proliferation. Alterations in cellular metabolic pathways of lipid and cholesterol synthesis have been linked to tumorigenesis and cancer progression but have not been exploited in clinical diagnosis. Here, the expression of genes related to cholesterol/lipid metabolism was measured with semiquantitative and real-time RT-PCR in RNA isolated from normal, benign and cancer ovarian tissues. We found that both SREBF2 and its target gene DHCR7 are downregulated in ovarian cancer tissues. On the contrary, SREBF1c and its target SCD1 were upregulated. The steroidogenesis regulator PDE8B was found downregulated. Oncomine analysis supported these findings, and further revealed that in ovarian cancers, the SREBF1-regulated lipidogenic pathway is activated while the SREBF2-regulated cholesterogenic pathway is repressed based on expression profiles of HMGCR and DHCR7. In conclusion, we show that ovarian cancer cells display distinct lipidogenic and cholesterogenic gene expression profiles with potential applications in the development of new biomarkers and/or treatment of ovarian cancer. Reduced cholesterol and enhanced lipid synthesis and SCD1 expression may provide an explanation for the previously reported increased membrane fluidity of ovarian cancer cells, a finding that merits further investigation. PMID:26807200

  15. One-year experience with modified BD GeneOhm MRSA assay for detection of methicillin-resistant Staphylococcus aureus from pooled nasal, skin, and throat samples.

    PubMed

    Svent-Kucina, Natasa; Pirs, Mateja; Mueller-Premru, Manica; Cvitkovic-Spik, Vesna; Kofol, Romina; Seme, Katja

    2009-02-01

    We report our 1-year experience with modified GeneOhm MRSA assay (formerly IDI-MRSA) for pooled surveillance specimens in low methicillin-resistant Staphylococcus aureus (MRSA) prevalence clinical setting. We have successfully modified the GeneOhm MRSA assay protocol during the specimen preparation step by adding an extra washing step followed by pooling of up to 3 samples per patient (nose, skin, with or without throat) at the lysis step. The sensitivity of the modified assay compared with conventional cultivation was 94.3%, specificity 99.2%, negative predictive value 99.2%, and positive predictive value 94.3%. The modified test is reliable and performed well compared with conventional culture methods in our clinical setting with low-level prevalence of MRSA colonization. Our findings support the use of pooling of the patients samples as a cost-effective way of screening for MRSA colonization.

  16. Positive selection of a gene family during the emergence of humans and African apes.

    PubMed

    Johnson, M E; Viggiano, L; Bailey, J A; Abdul-Rauf, M; Goodwin, G; Rocchi, M; Eichler, E E

    2001-10-04

    Gene duplication followed by adaptive evolution is one of the primary forces for the emergence of new gene function. Here we describe the recent proliferation, transposition and selection of a 20-kilobase (kb) duplicated segment throughout 15 Mb of the short arm of human chromosome 16. The dispersal of this segment was accompanied by considerable variation in chromosomal-map location and copy number among hominoid species. In humans, we identified a gene family (morpheus) within the duplicated segment. Comparison of putative protein-encoding exons revealed the most extreme case of positive selection among hominoids. The major episode of enhanced amino-acid replacement occurred after the separation of human and great-ape lineages from the orangutan. Positive selection continued to alter amino-acid composition after the divergence of human and chimpanzee lineages. The rapidity and bias for amino-acid-altering nucleotide changes suggest adaptive evolution of the morpheus gene family during the emergence of humans and African apes. Moreover, some genes emerge and evolve very rapidly, generating copies that bear little similarity to their ancestral precursors. Consequently, a small fraction of human genes may not possess discernible orthologues within the genomes of model organisms.

  17. Discovery of nucleotide polymorphisms in the Musa gene pool by Ecotilling.

    PubMed

    Till, Bradley J; Jankowicz-Cieslak, Joanna; Sági, László; Huynh, Owen A; Utsushi, Hiroe; Swennen, Rony; Terauchi, Ryohei; Mba, Chikelu

    2010-11-01

    Musa (banana and plantain) is an important genus for the global export market and in local markets where it provides staple food for approximately 400 million people. Hybridization and polyploidization of several (sub)species, combined with vegetative propagation and human selection have produced a complex genetic history. We describe the application of the Ecotilling method for the discovery and characterization of nucleotide polymorphisms in diploid and polyploid accessions of Musa. We discovered over 800 novel alleles in 80 accessions. Sequencing and band evaluation shows Ecotilling to be a robust and accurate platform for the discovery of polymorphisms in homologous and homeologous gene targets. In the process of validating the method, we identified two single nucleotide polymorphisms that may be deleterious for the function of a gene putatively important for phototropism. Evaluation of heterozygous polymorphism and haplotype blocks revealed a high level of nucleotide diversity in Musa accessions. We further applied a strategy for the simultaneous discovery of heterozygous and homozygous polymorphisms in diploid accessions to rapidly evaluate nucleotide diversity in accessions of the same genome type. This strategy can be used to develop hypotheses for inheritance patterns of nucleotide polymorphisms within and between genome types. We conclude that Ecotilling is suitable for diversity studies in Musa, that it can be considered for functional genomics studies and as tool in selecting germplasm for traditional and mutation breeding approaches.

  18. Novel variants of major drug-metabolising enzyme genes in diverse African populations and their predicted functional effects

    PubMed Central

    2009-01-01

    Pharmacogenetics enables personalised therapy based on genetic profiling and is increasingly applied in drug discovery. Medicines are developed and used together with pharmacodiagnostic tools to achieve desired drug efficacy and safety margins. Genetic polymorphism of drug-metabolising enzymes such as cytochrome P450s (CYPs) and N-acetyltransferases (NATs) has been widely studied in Caucasian and Asian populations, yet studies on African variants have been less extensive. The aim of the present study was to search for novel variants of CYP2C9, CYP2C19, CYP2D6 and NAT2 genes in Africans, with a particular focus on their prevalence in different populations, their relevance to enzyme functionality and their potential for personalised therapy. Blood samples from various ethnic groups were obtained from the AiBST Biobank of African Populations. The nine exons and exon-intron junctions of the CYP genes and exon 2 of NAT2 were analysed by direct DNA sequencing. Computational tools were used for the identification, haplotype analysis and prediction of functional effects of novel single nucleotide polymorphisms (SNPs). Novel SNPs were discovered in all four genes, grouped to existing haplotypes or assigned new allele names, if possible. The functional effects of non-synonymous SNPs were predicted and known African-specific variants were confirmed, but no significant differences were found in the frequencies of SNPs between African ethnicities. The low prevalence of our novel variants and most known functional alleles is consistent with the generally high level of diversity in gene loci of African populations. This indicates that profiles of rare variants reflecting interindividual variability might become the most relevant pharmacodiagnostic tools explaining Africans' diversity in drug response. PMID:19164093

  19. Genetic diversity and structure of the zombi pea (Vigna vexillata (L.) A. Rich) gene pool based on SSR marker analysis.

    PubMed

    Dachapak, Sujinna; Somta, Prakit; Poonchaivilaisak, Supalak; Yimram, Tarika; Srinives, Peerasak

    2017-04-01

    Zombi pea (Vigna vexillata (L.) A. Rich) is an underutilized legume species and a useful gene source for resistance to biotic and abiotic stresses, although there is little understanding on its genetic diversity and structure. In this study, 422 (408 wild and 14 cultivated) accessions of zombi pea from diverse origins (201 from Africa, 126 from America, 85 from Australia, 5 from Asia and 5 from unknown origin) were analyzed with 20 simple sequence repeat (SSR) markers to determine its genetic diversity and genetic structure. The SSR markers detected 273 alleles in total with a mean of 13.6 alleles per locus. Polymorphism information content values of the markers varied from 0.58 to 0.90 with an average of 0.76. Overall gene diversity was 0.715. Gene diversity and average allelic richness was highest in Africa (0.749 and 8.08, respectively) and lowest in America (0.435 and 4.10, respectively). Nei's genetic distance analysis revealed that the highest distance was between wild Australia and cultivated Africa (0.559), followed by wild West Africa and wild Australia (0.415). STRUCTURE, neighbor-joining (NJ), and principal coordinate analyses consistently showed that these zombi pea accessions were clustered into three major groups, viz. America, Africa and Asia, and Australia. NJ tree also suggested that American and Australian accessions are originated from East African zombi peas, and that the cultivated accessions from Africa and Asia were genetically distinct, while those from America were clustered with some cultivated accessions from Africa. These results suggest that Africa is the center of origin and diversity of zombi pea, and that domestication of this pea took place more than once in different regions.

  20. Resolution of the African hominoid trichotomy by use of a mitochondrial gene sequence

    SciTech Connect

    Ruvolo, M.; Disotell, T.R.; Allard, M.W. ); Brown, W.M. ); Honeycutt, R.L. )

    1991-02-15

    Mitochondrial DNA sequences encoding the cytochrome oxidase subunit II gene have been determined for five primate species, siamang (Hylobates syndactylus), lowland gorilla (Gorilla gorilla), pygmy chimpanzee (Pan paniscus), crab-eating macaque (Macaca fascicularis), and green monkey (Cercopithecus aethiops), and compared with published sequences of other primate and nonprimate species. Comparisons of cytochrome oxidase subunit II gene sequences provide clear-cut evidence from the mitochondrial genome for the separation of the African ape trichotomy into two evolutionary lineages, one leading to gorillas and the other to humans and chimpanzees. Several different tree-building methods support this same phylogenetic tree topology. The comparisons also yield trees in which a substantial length separates the divergence point of gorillas from that of humans and chimpanzees, suggesting that the lineage most immediately ancestral to humans and chimpanzees may have been in existence for a relatively long time.

  1. Parallel polyploid speciation: distinct sympatric gene-pools of recurrently derived allo-octoploid Asplenium ferns.

    PubMed

    Perrie, Leon R; Shepherd, Lara D; De Lange, Peter J; Brownsey, Patrick J

    2010-07-01

    Although polyploidy is widespread, its significance to the generation of biodiversity remains unclear. Many polyploids have been derived recurrently. For a particular polyploid, gene-flow between the products of independent origin is typical where they come into contact. Here, we use AFLP DNA-fingerprinting and chloroplast DNA sequences to demonstrate parallel polyploid speciation within both of the ferns Asplenium cimmeriorum and A. gracillimum. Both of these taxa comprise at least two allopolyploids, recurrently derived from the same progenitor pair. Each of these allopolyploids remain genetically distinguishable even with extensive sympatry, and could therefore be considered distinct species. To our knowledge, parallel speciation on this scale amongst recurrent polyploids has not been previously reported. With their parallel origins, these 'evolutionary replicates' provide an unrivalled opportunity to investigate how the reproductive barriers and ecological differentiation necessary for speciation arise following polyploidy.

  2. Discovery of nucleotide polymorphisms in the Musa gene pool by Ecotilling

    PubMed Central

    Jankowicz-Cieslak, Joanna; Sági, László; Huynh, Owen A.; Utsushi, Hiroe; Swennen, Rony; Terauchi, Ryohei; Mba, Chikelu

    2010-01-01

    Musa (banana and plantain) is an important genus for the global export market and in local markets where it provides staple food for approximately 400 million people. Hybridization and polyploidization of several (sub)species, combined with vegetative propagation and human selection have produced a complex genetic history. We describe the application of the Ecotilling method for the discovery and characterization of nucleotide polymorphisms in diploid and polyploid accessions of Musa. We discovered over 800 novel alleles in 80 accessions. Sequencing and band evaluation shows Ecotilling to be a robust and accurate platform for the discovery of polymorphisms in homologous and homeologous gene targets. In the process of validating the method, we identified two single nucleotide polymorphisms that may be deleterious for the function of a gene putatively important for phototropism. Evaluation of heterozygous polymorphism and haplotype blocks revealed a high level of nucleotide diversity in Musa accessions. We further applied a strategy for the simultaneous discovery of heterozygous and homozygous polymorphisms in diploid accessions to rapidly evaluate nucleotide diversity in accessions of the same genome type. This strategy can be used to develop hypotheses for inheritance patterns of nucleotide polymorphisms within and between genome types. We conclude that Ecotilling is suitable for diversity studies in Musa, that it can be considered for functional genomics studies and as tool in selecting germplasm for traditional and mutation breeding approaches. Electronic supplementary material The online version of this article (doi:10.1007/s00122-010-1395-5) contains supplementary material, which is available to authorized users. PMID:20589365

  3. Evidence for introduction bottleneck and extensive inter-gene pool (Mesoamerica x Andes) hybridization in the European common bean (Phaseolus vulgaris L.) germplasm.

    PubMed

    Gioia, Tania; Logozzo, Giuseppina; Attene, Giovanna; Bellucci, Elisa; Benedettelli, Stefano; Negri, Valeria; Papa, Roberto; Spagnoletti Zeuli, Pierluigi

    2013-01-01

    Common bean diversity within and between Mesoamerican and Andean gene pools was compared in 89 landraces from America and 256 landraces from Europe, to elucidate the effects of bottleneck of introduction and selection for adaptation during the expansion of common bean (Phaseolus vulgaris L.) in Europe. Thirteen highly polymorphic nuclear microsatellite markers (nuSSRs) were used to complement chloroplast microsatellite (cpSSRs) and nuclear markers (phaseolin and Pv-shatterproof1) data from previous studies. To verify the extent of the introduction bottleneck, inter-gene pool hybrids were distinguished from "pure" accessions. Hybrids were identified on the basis of recombination of gene pool specific cpSSR, phaseolin and Pv-shatterproof1 markers with a Bayesian assignments based on nuSSRs, and with STRUCTURE admixture analysis. More hybrids were detected than previously, and their frequency was almost four times larger in Europe (40.2%) than in America (12.3%). The genetic bottleneck following the introduction into Europe was not evidenced in the analysis including all the accessions, but it was significant when estimated only with "pure" accessions, and five times larger for Mesoamerican than for Andean germplasm. The extensive inter-gene pool hybridization generated a large amount of genotypic diversity that mitigated the effects of the bottleneck that occurred when common bean was introduced in Europe. The implication for evolution and the advantages for common bean breeding are discussed.

  4. A Genome-Wide Association Search for Type 2 Diabetes Genes in African Americans

    PubMed Central

    Palmer, Nicholette D.; McDonough, Caitrin W.; Hicks, Pamela J.; Roh, Bong H.; Wing, Maria R.; An, S. Sandy; Hester, Jessica M.; Cooke, Jessica N.; Bostrom, Meredith A.; Rudock, Megan E.; Talbert, Matthew E.; Lewis, Joshua P.; Ferrara, Assiamira; Lu, Lingyi; Ziegler, Julie T.; Sale, Michele M.; Divers, Jasmin; Shriner, Daniel; Adeyemo, Adebowale; Rotimi, Charles N.; Ng, Maggie C. Y.; Langefeld, Carl D.; Freedman, Barry I.; Bowden, Donald W.

    2012-01-01

    African Americans are disproportionately affected by type 2 diabetes (T2DM) yet few studies have examined T2DM using genome-wide association approaches in this ethnicity. The aim of this study was to identify genes associated with T2DM in the African American population. We performed a Genome Wide Association Study (GWAS) using the Affymetrix 6.0 array in 965 African-American cases with T2DM and end-stage renal disease (T2DM-ESRD) and 1029 population-based controls. The most significant SNPs (n = 550 independent loci) were genotyped in a replication cohort and 122 SNPs (n = 98 independent loci) were further tested through genotyping three additional validation cohorts followed by meta-analysis in all five cohorts totaling 3,132 cases and 3,317 controls. Twelve SNPs had evidence of association in the GWAS (P<0.0071), were directionally consistent in the Replication cohort and were associated with T2DM in subjects without nephropathy (P<0.05). Meta-analysis in all cases and controls revealed a single SNP reaching genome-wide significance (P<2.5×10−8). SNP rs7560163 (P = 7.0×10−9, OR (95% CI) = 0.75 (0.67–0.84)) is located intergenically between RND3 and RBM43. Four additional loci (rs7542900, rs4659485, rs2722769 and rs7107217) were associated with T2DM (P<0.05) and reached more nominal levels of significance (P<2.5×10−5) in the overall analysis and may represent novel loci that contribute to T2DM. We have identified novel T2DM-susceptibility variants in the African-American population. Notably, T2DM risk was associated with the major allele and implies an interesting genetic architecture in this population. These results suggest that multiple loci underlie T2DM susceptibility in the African-American population and that these loci are distinct from those identified in other ethnic populations. PMID:22238593

  5. Resistance gene pool to co-trimoxazole in non-susceptible Nocardia strains

    PubMed Central

    Valdezate, Sylvia; Garrido, Noelia; Carrasco, Gema; Villalón, Pilar; Medina-Pascual, María J.; Saéz-Nieto, Juan A.

    2015-01-01

    The soil-borne pathogen Nocardia sp. causes severe cutaneous, pulmonary, and central nervous system infections. Against them, co-trimoxazole (SXT) constitutes the mainstay of antimicrobial therapy. However, some Nocardia strains show resistance to SXT, but the underlying genetic basis is unknown. We investigated the presence of genetic resistance determinants and class 1–3 integrons in 76 SXT-resistant Nocardia strains by PCR and sequencing. By E test, these clinical strains showed SXT minimum inhibitory concentrations of ≥32:608 mg/L (ratio of 1:19 for trimethoprim: sulfamethoxazole). They belonged to 12 species, being the main representatives Nocardia farcinica (32%), followed by N. flavorosea (6.5%), N. nova (11.8%), N. carnea (10.5%), N. transvalensis (10.5%), and Nocardia sp. (6.5%). The prevalence of resistance genes in the SXT-resistant strains was as follows: sul1 and sul2 93.4 and 78.9%, respectively, dfrA(S1) 14.7%, blaTEM-1 and blaZ 2.6 and 2.6%, respectively, VIM-2 1.3%, aph(3′)-IIIa 40.8%, ermA, ermB, mefA, and msrD 2.6, 77.6, 14.4, and 5.2%, respectively, and tet(O), tet(M), and tet(L) 48.6, 25.0, and 3.9%, respectively. Detected amino acid changes in GyrA were not related to fluoroquinolone resistance, but probably linked to species polymorphism. Class 1 and 3 integrons were found in 93.42 and 56.57% strains, respectively. Class 2 integrons and sul3 genes were not detected. Other mechanisms, different than dfrA(S1), dfrD, dfrF, dfrG, and dfrK, could explain the strong trimethoprim resistance shown by the other 64 strains. For first time, resistance determinants commonly found in clinically important bacteria were detected in Nocardia sp. sul1, sul2, erm(B), and tet(O) were the most prevalent in the SXT-resistant strains. The similarity in their resistome could be due to a common genetic platform, in which these determinants are co-transferred. PMID:25972856

  6. Resistance gene pool to co-trimoxazole in non-susceptible Nocardia strains.

    PubMed

    Valdezate, Sylvia; Garrido, Noelia; Carrasco, Gema; Villalón, Pilar; Medina-Pascual, María J; Saéz-Nieto, Juan A

    2015-01-01

    The soil-borne pathogen Nocardia sp. causes severe cutaneous, pulmonary, and central nervous system infections. Against them, co-trimoxazole (SXT) constitutes the mainstay of antimicrobial therapy. However, some Nocardia strains show resistance to SXT, but the underlying genetic basis is unknown. We investigated the presence of genetic resistance determinants and class 1-3 integrons in 76 SXT-resistant Nocardia strains by PCR and sequencing. By E test, these clinical strains showed SXT minimum inhibitory concentrations of ≥32:608 mg/L (ratio of 1:19 for trimethoprim: sulfamethoxazole). They belonged to 12 species, being the main representatives Nocardia farcinica (32%), followed by N. flavorosea (6.5%), N. nova (11.8%), N. carnea (10.5%), N. transvalensis (10.5%), and Nocardia sp. (6.5%). The prevalence of resistance genes in the SXT-resistant strains was as follows: sul1 and sul2 93.4 and 78.9%, respectively, dfrA(S1) 14.7%, blaTEM-1 and blaZ 2.6 and 2.6%, respectively, VIM-2 1.3%, aph(3')-IIIa 40.8%, ermA, ermB, mefA, and msrD 2.6, 77.6, 14.4, and 5.2%, respectively, and tet(O), tet(M), and tet(L) 48.6, 25.0, and 3.9%, respectively. Detected amino acid changes in GyrA were not related to fluoroquinolone resistance, but probably linked to species polymorphism. Class 1 and 3 integrons were found in 93.42 and 56.57% strains, respectively. Class 2 integrons and sul3 genes were not detected. Other mechanisms, different than dfrA(S1), dfrD, dfrF, dfrG, and dfrK, could explain the strong trimethoprim resistance shown by the other 64 strains. For first time, resistance determinants commonly found in clinically important bacteria were detected in Nocardia sp. sul1, sul2, erm(B), and tet(O) were the most prevalent in the SXT-resistant strains. The similarity in their resistome could be due to a common genetic platform, in which these determinants are co-transferred.

  7. The putative promoter for a metacyclic VSG gene in African trypanosomes.

    PubMed

    Nagoshi, Y L; Alarcon, C M; Donelson, J E

    1995-06-01

    During their metacyclic developmental stage, African trypanosomes are coated with one of 12-15 variant surface glycoproteins (VSGs) that define different metacyclic variant antigen types (MVATs). The MVAT VSG genes are located near telomeres of large chromosomes and are expressed without rearrangement in the metacyclic stage. We have cloned and examined the telomere-linked MVAT5 VSG gene and its upstream expression site associated gene (ESAG I) which are separated by 4.5 kb. Within this 4.5-kb intergenic region is an 87-bp sequence that serves as a strong promoter for a luciferase reporter gene in transient transfection assays. This 87-bp sequence is similar, but not identical, to the promoter for another MVAT VSG gene. UV irradiation experiments were used to detect RNA synthesis from this MVAT5 promoter in bloodstream trypanosomes expressing an unrelated VSG. We propose that this sequence is a specific promoter for the MVAT5 VSG mRNA that occurs in about 10% of the trypanosome population during the metacyclic stage of the parasites' life cycle.

  8. Pool Purification

    NASA Technical Reports Server (NTRS)

    1988-01-01

    Caribbean Clear, Inc. used NASA's silver ion technology as a basis for its automatic pool purifier. System offers alternative approach to conventional purification chemicals. Caribbean Clear's principal markets are swimming pool owners who want to eliminate chlorine and bromine. Purifiers in Caribbean Clear System are same silver ions used in Apollo System to kill bacteria, plus copper ions to kill algae. They produce spa or pool water that exceeds EPA Standards for drinking water.

  9. Swimming in the deep end of the gene pool: global population structure of an oceanic giant.

    PubMed

    Bradshaw, Corey J A

    2007-12-01

    Despite the impression held by some that few biological mysteries remain, even evocative species such as humpback whales (Megaptera novaeangliae), white sharks (Carcharodon carcharias) and green turtles (Chelonia mydas) have poorly documented movement patterns, reproductive strategies and population dynamics despite years of dedicated research. This is largely due to the difficulty of observing wide-ranging marine species over the majority of their life cycle. The advent of powerful tracking devices has certainly improved our understanding, but it is usually only with molecular tools that the nature of population structure becomes apparent. In this issue of Molecular Ecology, Castro and colleagues have provided the first global-scale assessment of population structure for the largest fish--whale sharks (Rhincodon typus). Whale sharks can reach lengths > 12 m and are a popular tourist attraction at places where they aggregate, yet for most of their life cycle, we know little indeed of where they go and how they interact with other populations. Previous tracking studies imply a high dispersal capacity, but only now have Castro and colleagues demonstrated high gene flow and haplotype diversity among the major ocean basins where they are found.

  10. Identifying currents in the gene pool for bacterial populations using an integrative approach.

    PubMed

    Tang, Jing; Hanage, William P; Fraser, Christophe; Corander, Jukka

    2009-08-01

    The evolution of bacterial populations has recently become considerably better understood due to large-scale sequencing of population samples. It has become clear that DNA sequences from a multitude of genes, as well as a broad sample coverage of a target population, are needed to obtain a relatively unbiased view of its genetic structure and the patterns of ancestry connected to the strains. However, the traditional statistical methods for evolutionary inference, such as phylogenetic analysis, are associated with several difficulties under such an extensive sampling scenario, in particular when a considerable amount of recombination is anticipated to have taken place. To meet the needs of large-scale analyses of population structure for bacteria, we introduce here several statistical tools for the detection and representation of recombination between populations. Also, we introduce a model-based description of the shape of a population in sequence space, in terms of its molecular variability and affinity towards other populations. Extensive real data from the genus Neisseria are utilized to demonstrate the potential of an approach where these population genetic tools are combined with an phylogenetic analysis. The statistical tools introduced here are freely available in BAPS 5.2 software, which can be downloaded from http://web.abo.fi/fak/mnf/mate/jc/software/baps.html.

  11. Targeted high-throughput growth hormone 1 gene sequencing reveals high within-breed genetic diversity in South African goats.

    PubMed

    Ncube, K T; Mdladla, K; Dzomba, E F; Muchadeyi, F C

    2016-06-01

    This study assessed the genetic diversity in the growth hormone 1 gene (GH1) within and between South African goat breeds. Polymerase chain reaction-targeted gene amplification together with Illumina MiSeq next-generation sequencing (NGS) was used to generate the full length (2.54 kb) of the growth hormone 1 gene and screen for SNPs in the South African Boer (SAB) (n = 17), Tankwa (n = 15) and South African village (n = 35) goat populations. A range of 27-58 SNPs per population were observed. Mutations resulting in amino acid changes were observed at exons 2 and 5. Higher within-breed diversity of 97.37% was observed within the population category consisting of SA village ecotypes and the Tankwa goats. Highest pairwise FST values ranging from 0.148 to 0.356 were observed between the SAB and both the South African village and Tankwa feral goat populations. Phylogenetic analysis indicated nine genetic clusters, which reflected close relationships between the South African populations and the other international breeds with the exception of the Italian Sarda breeds. Results imply greater potential for within-population selection programs, particularly with SA village goats.

  12. Association between SLC2A9 transporter gene variants and uric acid phenotypes in African American and white families

    PubMed Central

    de Andrade, Mariza; Matsumoto, Martha; Mosley, Tom H.; Kardia, Sharon; Turner, Stephen T.

    2011-01-01

    Objectives. SLC2A9 gene variants associate with serum uric acid in white populations, but little is known about African American populations. Since SLC2A9 is a transporter, gene variants may be expected to associate more closely with the fractional excretion of urate, a measure of renal tubular transport, than with serum uric acid, which is influenced by production and extrarenal clearance. Methods. Genotypes of single nucleotide polymorphisms (SNPs) distributed across the SLC2A9 gene were obtained in the Genetic Epidemiology Network of Arteriopathy cohorts. The associations of SNPs with serum uric acid, fractional excretion of urate and urine urate-to-creatinine ratio were assessed with adjustments for age, sex, diuretic use, BMI, homocysteine and triglycerides. Results. We identified SLC2A9 gene variants that were associated with serum uric acid in 1155 African American subjects (53 SNPs) and 1132 white subjects (63 SNPs). The most statistically significant SNPs in African American subjects (rs13113918) and white subjects (rs11723439) were in the latter half of the gene and explained 2.7 and 2.8% of the variation in serum uric acid, respectively. After adjustment for this SNP in African Americans, 0.9% of the variation in serum uric acid was explained by an SNP (rs1568318) in the first half of the gene. Unexpectedly, SLC2A9 gene variants had stronger associations with serum uric acid than with fractional excretion of urate. Conclusions. These findings support two different loci by which SLC2A9 variants affect uric acid levels in African Americans and suggest SLC2A9 variants affect serum uric acid level via renal and extrarenal clearance. PMID:21186168

  13. Evaluation of pooled ocular and vaginal swabs by the Cepheid GeneXpert CT/NG assay for the detection of Chlamydia trachomatis and Neisseria gonorrhoeae compared to the GenProbe Aptima Combo 2 Assay

    PubMed Central

    Dize, L.; West, S.K.; Mkocha, H.; Quinn, T.C.; Gaydos, C.A.

    2015-01-01

    Ocular swabs from Tanzania were tested for Chlamydia trachomatis (CT), and self-collected vaginal swabs collected through a home collection program, iwantthekit.org, were tested for Neisseria gonorrhoeae and CT to evaluate Cepheid GeneXpert for the use of pooling multiple specimens before testing. GeneXpert shows to be a promising test for pooling. PMID:25497459

  14. One haploid parent contributes 100% of the gene pool for a widespread species in northwest North America.

    PubMed

    Karlin, E F; Andrus, R E; Boles, S B; Shaw, A J

    2011-02-01

    The monoicous peatmoss Sphagnum subnitens has a tripartite distribution that includes disjunct population systems in Europe (including the Azores), northwestern North America and New Zealand. Regional genetic diversity was highest in European S. subnitens but in northwestern North America, a single microsatellite-based multilocus haploid genotype was detected across 16 sites ranging from Coos County, Oregon, to Kavalga Island in the Western Aleutians (a distance of some 4115 km). Two multilocus haploid genotypes were detected across 14 sites on South Island, New Zealand. The microsatellite-based regional genetic diversity detected in New Zealand and North American S. subnitens is the lowest reported for any Sphagnum. The low genetic diversity detected in both of these regions most likely resulted from a founder event associated with vegetative propagation and complete selfing, with one founding haploid plant in northwest North America and two in New Zealand. Thus, one plant appears to have contributed 100% of the gene pool for the population systems of S. subnitens occurring in northwest North America, and this is arguably the most genetically uniform group of plants having a widespread distribution yet detected. Although having a distribution spanning 12.5° of latitude and 56° of longitude, there was no evidence of any genetic diversification in S. subnitens in northwest North America. No genetic structure was detected among the three regions, and it appears that European plants of S. subnitens provided the source for New Zealand and northwest North American populations.

  15. Intraclass diversification of immunoglobulin heavy chain genes in the African lungfish.

    PubMed

    Zhang, Tianyi; Tacchi, Luca; Wei, Zhiguo; Zhao, Yaofeng; Salinas, Irene

    2014-05-01

    Lungfish (Dipnoi) are the closest living relatives to tetrapods, and they represent the transition from water to land during vertebrate evolution. Lungfish are armed with immunoglobulins (Igs), one of the hallmarks of the adaptive immune system of jawed vertebrates, but only three Ig forms have been characterized in Dipnoi to date. We report here a new diversity of Ig molecules in two African lungfish species (Protopterus dolloi and Protopterus annectens). The African lungfish Igs consist of three IgMs, two IgWs, three IgNs, and an IgQ, where both IgN and IgQ originated evidently from the IgW lineage. Our data also suggest that the IgH genes in the lungfish are organized in a transiting form from clusters (IgH loci in cartilaginous fish) to a translocon configuration (IgH locus in tetrapods). We propose that the intraclass diversification of the two primordial gnathostome Ig classes (IgM and IgW) as well as acquisition of new isotypes (IgN and IgQ) has allowed lungfish to acquire a complex and functionally diverse Ig repertoire to fight a variety of microorganisms. Furthermore, our results support the idea that "tetrapod-specific" Ig classes did not evolve until the vertebrate adaptation to land was completed ~360 million years ago.

  16. Phylogeographic analysis of African swine fever virus based on the p72 gene sequence.

    PubMed

    Muangkram, Y; Sukmak, M; Wajjwalku, W

    2015-05-04

    African swine fever virus (ASFV) outbreak has been considered as an emerging and re-emerging disease for almost a century. Diagnostically, simple polymerase chain reaction and sequencing-based molecular detection could be employed for both viral identification and genotyping. This study established a novel phylogenetic analysis and epidemiology comparison based on 205 bp of p72 gene sequences. Based on this partial p72 fragment, an updated list of 44 different genotypes from a total of 516 ASFV sequences compiled from GenBank was generated. Nucleotide diversity was 0.04325 ± 0.00231. The analysis of spatial genetic variation divided the ASFV populations of the African continent into four clades (clade A: central and upper eastern Africa; clade B: eastern Africa; clade C: eastern and southern Africa; and clade D: southern Africa). These results and the developed protocol could serve as useful molecular tools for ASFV diagnosis from degraded DNA or putrefied samples, and also provide the phylogeographic perspective to identify the origin of viral outbreaks, facilitating the decision planning to limit their spread.

  17. Intraclass diversification of immunoglobulin heavy chain genes in the African lungfish

    PubMed Central

    Zhang, Tianyi; Tacchi, Luca; Wei, Zhiguo

    2015-01-01

    Lungfish (Dipnoi) are the closest living relatives to tetrapods, and they represent the transition from water to land during vertebrate evolution. Lungfish are armed with immunoglobulins (Igs), one of the hallmarks of the adaptive immune system of jawed vertebrates, but only three Ig forms have been characterized in Dipnoi to date. We report here a new diversity of Ig molecules in two African lungfish species (Protopterus dolloi and Protopterus annectens). The African lungfish Igs consist of three IgMs, two IgWs, three IgNs, and an IgQ, where both IgN and IgQ originated evidently from the IgW lineage. Our data also suggest that the IgH genes in the lungfish are organized in a transiting form from clusters (IgH loci in cartilaginous fish) to a translocon configuration (IgH locus in tetrapods). We propose that the intraclass diversification of the two primordial gnathostome Ig classes (IgM and IgW) as well as acquisition of new isotypes (IgN and IgQ) has allowed lungfish to acquire a complex and functionally diverse Ig repertoire to fight a variety of microorganisms. Furthermore, our results support the idea that “tetrapod-specific” Ig classes did not evolve until the vertebrate adaptation to land was completed ∼360 million years ago. PMID:24676685

  18. Identification of novel causative genes determining the complex trait of high ethanol tolerance in yeast using pooled-segregant whole-genome sequence analysis.

    PubMed

    Swinnen, Steve; Schaerlaekens, Kristien; Pais, Thiago; Claesen, Jürgen; Hubmann, Georg; Yang, Yudi; Demeke, Mekonnen; Foulquié-Moreno, María R; Goovaerts, Annelies; Souvereyns, Kris; Clement, Lieven; Dumortier, Françoise; Thevelein, Johan M

    2012-05-01

    High ethanol tolerance is an exquisite characteristic of the yeast Saccharomyces cerevisiae, which enables this microorganism to dominate in natural and industrial fermentations. Up to now, ethanol tolerance has only been analyzed in laboratory yeast strains with moderate ethanol tolerance. The genetic basis of the much higher ethanol tolerance in natural and industrial yeast strains is unknown. We have applied pooled-segregant whole-genome sequence analysis to map all quantitative trait loci (QTL) determining high ethanol tolerance. We crossed a highly ethanol-tolerant segregant of a Brazilian bioethanol production strain with a laboratory strain with moderate ethanol tolerance. Out of 5974 segregants, we pooled 136 segregants tolerant to at least 16% ethanol and 31 segregants tolerant to at least 17%. Scoring of SNPs using whole-genome sequence analysis of DNA from the two pools and parents revealed three major loci and additional minor loci. The latter were more pronounced or only present in the 17% pool compared to the 16% pool. In the locus with the strongest linkage, we identified three closely located genes affecting ethanol tolerance: MKT1, SWS2, and APJ1, with SWS2 being a negative allele located in between two positive alleles. SWS2 and APJ1 probably contained significant polymorphisms only outside the ORF, and lower expression of APJ1 may be linked to higher ethanol tolerance. This work has identified the first causative genes involved in high ethanol tolerance of yeast. It also reveals the strong potential of pooled-segregant sequence analysis using relatively small numbers of selected segregants for identifying QTL on a genome-wide scale.

  19. Analysis of variance, normal quantile-quantile correlation and effective expression support of pooled expression ratio of reference genes for defining expression stability.

    PubMed

    Priyadarshi, Himanshu; Das, Rekha; Kumar, Shivendra; Kishore, Pankaj; Kumar, Sujit

    2017-01-01

    Identification of a reference gene unaffected by the experimental conditions is obligatory for accurate measurement of gene expression through relative quantification. Most existing methods directly analyze variability in crossing point (Cp) values of reference genes and fail to account for template-independent factors that affect Cp values in their estimates. We describe the use of three simple statistical methods namely analysis of variance (ANOVA), normal quantile-quantile correlation (NQQC) and effective expression support (EES), on pooled expression ratios of reference genes in a panel to overcome this issue. The pooling of expression ratios across the genes in the panel nullify the sample specific effects uniformly affecting all genes that are falsely reflected as instability. Our methods also offer the flexibility to include sample specific PCR efficiencies in estimations, when available, for improved accuracy. Additionally, we describe a correction factor from the ANOVA method to correct the relative fold change of a target gene if no truly stable reference gene could be found in the analyzed panel. The analysis is described on a synthetic data set to simplify the explanation of the statistical treatment of data.

  20. Africanization in the United States: replacement of feral European honeybees (Apis mellifera L.) by an African hybrid swarm.

    PubMed

    Pinto, M Alice; Rubink, William L; Patton, John C; Coulson, Robert N; Johnston, J Spencer

    2005-08-01

    The expansion of Africanized honeybees from South America to the southwestern United States in <50 years is considered one of the most spectacular biological invasions yet documented. In the American tropics, it has been shown that during their expansion Africanized honeybees have low levels of introgressed alleles from resident European populations. In the United States, it has been speculated, but not shown, that Africanized honeybees would hybridize extensively with European honeybees. Here we report a continuous 11-year study investigating temporal changes in the genetic structure of a feral population from the southern United States undergoing Africanization. Our microsatellite data showed that (1) the process of Africanization involved both maternal and paternal bidirectional gene flow between European and Africanized honeybees and (2) the panmitic European population was replaced by panmitic mixtures of A. m. scutellata and European genes within 5 years after Africanization. The post-Africanization gene pool (1998-2001) was composed of a diverse array of recombinant classes with a substantial European genetic contribution (mean 25-37%). Therefore, the resulting feral honeybee population of south Texas was best viewed as a hybrid swarm.

  1. Long-term balancing selection at the antiviral gene OAS1 in Central African chimpanzees.

    PubMed

    Ferguson, William; Dvora, Shira; Fikes, Ronald W; Stone, Anne C; Boissinot, Stéphane

    2012-04-01

    Oligoadenylate synthetases (OAS) are interferon-induced enzymes that participate in the first line of defense against a wide range of viral infection in animals. Upon activation by viral double-stranded RNA, OAS synthesizes (2-5) oligoadenylates, which activate RNase L, leading to the nonspecific degradation of cellular and viral RNA. Some association studies in humans suggest that variation at one of the OAS genes, OAS1, could be influencing host susceptibility to viral infection. We assessed the diversity of OAS1 in hominoid primates with a focus on chimpanzees. We found that the OAS1 gene is extremely polymorphic in Central African chimpanzee and exhibits levels of silent and replacement diversity much higher than neutral regions of the chimpanzee genome. This level of variation strongly suggests that balancing selection is acting on OAS1, and indeed, this conclusion was validated by several tests of neutrality. We further demonstrated that balancing selection has been acting at this locus since the split between chimpanzees, humans, and gorillas (~8.6 Ma) and caused the persistence of two deeply divergent allelic lineages in Central African chimpanzees. These two groups of OAS1 alleles differ by a large number of amino acids (a.a.), including several a.a. putatively involved in RNA binding. It is therefore very likely that variation at the OAS1 locus affects the innate immune response of individuals to specific viral infection. Our data strongly suggest that interactions between viral RNA and OAS1 are responsible for the maintenance of ancestral polymorphisms at this locus for at least 13.2 My.

  2. Asymmetric introgression of African genes in honeybee populations (Apis mellifera L.) in Central Mexico.

    PubMed

    Kraus, F B; Franck, P; Vandame, R

    2007-08-01

    The Africanization of the honeybee (Apis mellifera) in South America is one of the most spectacular examples of biological invasions. In this study, we analyzed the Africanization process in Central Mexico along an altitudinal transect from 72 to 2800 m, using both mitochondrial and nuclear DNA markers. The mitochondrial analysis revealed that the two high-altitude populations had a significantly greater percentage of African mitotypes (95%) than the three lowland populations (67%), indicating successful spreading of Africanized swarms to these altitudes. All populations (highland and lowland) had a similar overall proportion of African alleles at nuclear loci (58%). Thus, all populations showed an asymmetric introgression of African nuclear and mtDNA. Colonies with African mitotypes had, on average, significantly more African nuclear alleles (60%) than those with European mitotypes (51%). Furthermore, the three lowland populations showed clear signs of linkage disequilibrium, while the two high-altitude populations did not, indicating recent genetic introgression events into the lowland populations.

  3. Pooled sequencing of 531 genes in inflammatory bowel disease identifies an associated rare variant in BTNL2 and implicates other immune related genes.

    PubMed

    Prescott, Natalie J; Lehne, Benjamin; Stone, Kristina; Lee, James C; Taylor, Kirstin; Knight, Jo; Papouli, Efterpi; Mirza, Muddassar M; Simpson, Michael A; Spain, Sarah L; Lu, Grace; Fraternali, Franca; Bumpstead, Suzannah J; Gray, Emma; Amar, Ariella; Bye, Hannah; Green, Peter; Chung-Faye, Guy; Hayee, Bu'Hussain; Pollok, Richard; Satsangi, Jack; Parkes, Miles; Barrett, Jeffrey C; Mansfield, John C; Sanderson, Jeremy; Lewis, Cathryn M; Weale, Michael E; Schlitt, Thomas; Mathew, Christopher G

    2015-02-01

    The contribution of rare coding sequence variants to genetic susceptibility in complex disorders is an important but unresolved question. Most studies thus far have investigated a limited number of genes from regions which contain common disease associated variants. Here we investigate this in inflammatory bowel disease by sequencing the exons and proximal promoters of 531 genes selected from both genome-wide association studies and pathway analysis in pooled DNA panels from 474 cases of Crohn's disease and 480 controls. 80 variants with evidence of association in the sequencing experiment or with potential functional significance were selected for follow up genotyping in 6,507 IBD cases and 3,064 population controls. The top 5 disease associated variants were genotyped in an extension panel of 3,662 IBD cases and 3,639 controls, and tested for association in a combined analysis of 10,147 IBD cases and 7,008 controls. A rare coding variant p.G454C in the BTNL2 gene within the major histocompatibility complex was significantly associated with increased risk for IBD (p = 9.65x10-10, OR = 2.3[95% CI = 1.75-3.04]), but was independent of the known common associated CD and UC variants at this locus. Rare (<1%) and low frequency (1-5%) variants in 3 additional genes showed suggestive association (p<0.005) with either an increased risk (ARIH2 c.338-6C>T) or decreased risk (IL12B p.V298F, and NICN p.H191R) of IBD. These results provide additional insights into the involvement of the inhibition of T cell activation in the development of both sub-phenotypes of inflammatory bowel disease. We suggest that although rare coding variants may make a modest overall contribution to complex disease susceptibility, they can inform our understanding of the molecular pathways that contribute to pathogenesis.

  4. Epidermal gene expression and ethnic pigmentation variations among individuals of Asian, European and African ancestry.

    PubMed

    Yin, Lanlan; Coelho, Sergio G; Ebsen, Dominik; Smuda, Christoph; Mahns, Andre; Miller, Sharon A; Beer, Janusz Z; Kolbe, Ludger; Hearing, Vincent J

    2014-10-01

    Differences in visible skin pigmentation give rise to the wide variation of skin colours seen in racial/ethnic populations. Skin pigmentation is important not only from cosmetic and psychological points of view, but more importantly because of its implications for the risk of all types of skin cancers, on photoaging, etc. Despite differences in those parameters in Caucasian and Asian skin types, they are remarkably similar in their production and distribution of melanins, and the mechanism(s) underlying their different characteristics have remained obscure. In this study, we used microarray analysis of skin suction blisters to investigate molecular differences underlying the determination of pigmentation in various skin types, and we used immunohistochemistry to validate the expression patterns of several interesting targets that were identified. Intriguingly, Caucasian and Asian skins had highly similar gene expression patterns that differed significantly from the pattern of African skin. The results of this study suggest the dynamic interactions of different types of cells in human skin that regulate its pigmentation, reveal that the known pigmentation genes have a limited contribution and uncover a new array of genes, including NINL and S100A4, that might be involved in that regulation.

  5. Variants of estrogen-related genes and breast cancer risk in European and African American women.

    PubMed

    Quan, Lei; Hong, Chi-Chen; Zirpoli, Gary; Roberts, Michelle R; Khoury, Thaer; Sucheston-Campbell, Lara E; Bovbjerg, Dana H; Jandorf, Lina; Pawlish, Karen; Ciupak, Gregory; Davis, Warren; Bandera, Elisa V; Ambrosone, Christine B; Yao, Song

    2014-01-01

    It has been observed previously that compared with women of European ancestry (EA), those of African ancestry (AA) are more likely to develop estrogen receptor (ER)-negative breast cancer, although the mechanisms have not been elucidated. We tested the associations between breast cancer risk and a targeted set of 20 genes known to be involved in estrogen synthesis, metabolism, and response and potential gene-environment interactions using data and samples from 1307 EA (658 cases) and 1365 AA (621 cases) participants from the Women's Circle of Health Study (WCHS). Multivariable logistic regression found evidence of associations with single-nucleotide polymorphisms (SNPs) in the ESR1 gene in EA women (rs1801132, odds ratio (OR)=1.47, 95% CI=1.20-1.80, P=0.0002; rs2046210, OR=1.24, 95% CI=1.04-1.47, P=0.02; and rs3020314, OR=1.43, 95% CI=1.19-1.70, P=0.00009), but not in AA women. The only other gene associated with breast cancer risk was CYP1A2 in AA women (rs2470893, OR=1.42, 95% CI=1.00-2.02, P=0.05), but not in EA women. When stratified by ER status, ESR1 rs1801132, rs2046210, and rs3020314 showed stronger associations in ER-positive than in ER-negative breast cancer in only EA women. Associations with the ESR1 SNPs in EA women also appeared to be stronger with longer endogenous estrogen exposure or hormonal replacement therapy use. Our results indicate that there may be differential genetic influences on breast cancer risk in EA compared with AA women and that these differences may be modified by tumor subtype and estrogen exposures. Future studies with a larger sample size may determine the full contribution of estrogen-related genes to racial/ethnic differences in breast cancer.

  6. Polymorphisms of Estrogen Metabolism-Related Genes and Prostate Cancer Risk in Two Populations of African Ancestry

    PubMed Central

    Emeville, Elise; Ferdinand, Séverine; Punga, Augustin; Lufuma, Simon; Blanchet, Pascal; Romana, Marc; Multigner, Luc

    2016-01-01

    Background Estrogens are thought to play a critical role in prostate carcinogenesis. It has been suggested that polymorphisms of genes encoding enzymes involved in estrogen metabolism are risk factors for prostate cancer. However, few studies have been performed on populations of African ancestry, which are known to have a high risk of prostate cancer. Objective We investigated whether functional polymorphisms of CYP17, CYP19, CYP1B1, COMT and UGT1A1 affected the risk of prostate cancer in two different populations of African ancestry. Methods In Guadeloupe (French West Indies), we compared 498 prostate cancer patients and 565 control subjects. In Kinshasa (Democratic Republic of Congo), 162 prostate cancer patients were compared with 144 controls. Gene polymorphisms were determined by the SNaPshot technique or short tandem repeat PCR analysis. Logistic regression was used to estimate adjusted odds ratios (OR) and 95% confidence intervals (CI). Results The AA genotype and the A allele of rs4680 (COMT) appeared to be inversely associated with the risk of prostate cancer in adjusted models for both Afro-Caribbean and native African men. For the A allele, a significant inverse association was observed among cases with low-grade Gleason scores and localized clinical stage, in both populations. Conclusions These preliminary results support the hypothesis that polymorphisms of genes encoding enzymes involved in estrogen metabolism may modulate the risk of prostate cancer in populations of African ancestry. PMID:27074016

  7. The contribution of Escherichia coli from human and animal sources to the integron gene pool in coastal waters

    PubMed Central

    Moura, Alexandra; Araújo, Susana; Alves, Marta S.; Henriques, Isabel; Pereira, Anabela; Correia, António C. M.

    2014-01-01

    To understand the contribution of animal- and human-derived fecal pollution sources in shaping integron prevalence and diversity in beach waters, 414 Escherichia coli strains were collected from beach waters (BW, n = 166), seagull feces (SF, n = 179), and wastewaters (WW, n = 69), on the World Biosphere Reserve of the Berlenga Island, Portugal. Statistical differences were found between the prevalence of integrons in BW (21%) and WW (10%), but not between BW and SF (19%). The majority of integrase-positive (intI+)-strains affiliated to commensal phylogroups B1 (37%), A0 (24%), and A1 (20%). Eighteen different gene cassette arrays were detected, most of them coding for resistances to aminoglycosides, trimethoprim, chloramphenicol, and quaternary ammonia compounds. Common arrays were found among strains from different sources. Multi-resistance to three or more different classes of antibiotics was observed in 89, 82, and 57% of intI+-strains from BW, SF and WW, respectively. Plasmids were detected in 79% of strains (60/76) revealing a high diversity of replicons in all sources, mostly belonging to IncF (Frep, FIA, and FIB subgroups), IncI1, IncN, IncY, and IncK incompatibility groups. In 20% (15/76) of strains, integrons were successfully mobilized through conjugation to E. coli CV601. Results obtained support the existence of a diverse integron pool in the E. coli strains from this coastal environment, associated with different resistance traits and plasmid incompatibility groups, mainly shaped by animal fecal pollution inputs. These findings underscore the role of wild life in dissemination of integrons and antibiotic resistance traits in natural environments. PMID:25161650

  8. Pilus gene pool variation and the virulence of Corynebacterium diphtheriae clinical isolates during infection of a nematode.

    PubMed

    Broadway, Melissa M; Rogers, Elizabeth A; Chang, Chungyu; Huang, I-Hsiu; Dwivedi, Prabhat; Yildirim, Suleyman; Schmitt, Michael P; Das, Asis; Ton-That, Hung

    2013-08-01

    Toxigenic Corynebacterium diphtheriae strains cause diphtheria in humans. The toxigenic C. diphtheriae isolate NCTC13129 produces three distinct heterotrimeric pili that contain SpaA, SpaD, and SpaH, making up the shaft structure. The SpaA pili are known to mediate bacterial adherence to pharyngeal epithelial cells. However, to date little is known about the expression of different pili in various clinical isolates and their importance in bacterial pathogenesis. Here, we characterized a large collection of C. diphtheriae clinical isolates for their pilin gene pool by PCR and for the expression of the respective pilins by immunoblotting with antibodies against Spa pilins. Consistent with the role of a virulence factor, the SpaA-type pili were found to be prevalent among the isolates, and most significantly, corynebacterial adherence to pharyngeal epithelial cells was strictly correlated with isolates that were positive for the SpaA pili. By comparison, the isolates were heterogeneous for the presence of SpaD- and SpaH-type pili. Importantly, using Caenorhabditis elegans as a model host for infection, we show here that strain NCTC13129 rapidly killed the nematodes, the phenotype similar to isolates that were positive for toxin and all pilus types. In contrast, isogenic mutants of NCTC13129 lacking SpaA-type pili or devoid of toxin and SpaA pili exhibited delayed killing of nematodes with similar kinetics. Consistently, nontoxigenic or toxigenic isolates that lack one, two, or all three pilus types were also attenuated in virulence. This work signifies the important role of pili in corynebacterial pathogenesis and provides a simple host model to identify additional virulence factors.

  9. Domestication of the neotropical tree Chrysophyllum cainito from a geographically limited yet genetically diverse gene pool in Panama

    PubMed Central

    Petersen, Jennifer J; Parker, Ingrid M; Potter, Daniel

    2014-01-01

    Species in the early stages of domestication, in which wild and cultivated forms co-occur, provide important opportunities to develop and test hypotheses about the origins of crop species. Chrysophyllum cainito (Sapotaceae), the star apple or caimito, is a semidomesticated tree widely cultivated for its edible fruits; it is known to be native to the neotropics, but its precise geographic origins have not been firmly established. Here, we report results of microsatellite marker analyses supporting the hypothesis that the center of domestication for caimito was the Isthmus of Panama, a region in which few crop species are believed to have originated, despite its importance as a crossroads for the dispersal of domesticated plants between North and South America. Our data suggest that caimito was domesticated in a geographically restricted area while incorporating a diverse gene pool. These results refute the generally accepted Antillean origin of caimito, as well as alternative hypotheses that the species was domesticated independently in the two areas or over a broad geographic range including both. Human-mediated dispersal from Panama to the north and east was accompanied by strong reductions in both genotypic and phenotypic diversity. Within Panama, cultivated and wild trees show little neutral genetic divergence, in contrast to striking phenotypic differentiation in fruit and seed traits. In addition to providing a rare example of data that support the hypothesis of a narrow geographic origin on the Isthmus of Panama for a now widespread cultivated plant species, this study is one of the first investigations of the origins of an edible species of the large pantropical family Sapotaceae. PMID:25035796

  10. Gene Fusion Analysis in the Battle against the African Endemic Sleeping Sickness

    PubMed Central

    Trimpalis, Philip; Koumandou, Vassiliki Lila; Pliakou, Evangelia; Anagnou, Nicholas P.; Kossida, Sophia

    2013-01-01

    The protozoan Trypanosoma brucei causes African Trypanosomiasis or sleeping sickness in humans, which can be lethal if untreated. Most available pharmacological treatments for the disease have severe side-effects. The purpose of this analysis was to detect novel protein-protein interactions (PPIs), vital for the parasite, which could lead to the development of drugs against this disease to block the specific interactions. In this work, the Domain Fusion Analysis (Rosetta Stone method) was used to identify novel PPIs, by comparing T. brucei to 19 organisms covering all major lineages of the tree of life. Overall, 49 possible protein-protein interactions were detected, and classified based on (a) statistical significance (BLAST e-value, domain length etc.), (b) their involvement in crucial metabolic pathways, and (c) their evolutionary history, particularly focusing on whether a protein pair is split in T. brucei and fused in the human host. We also evaluated fusion events including hypothetical proteins, and suggest a possible molecular function or involvement in a certain biological process. This work has produced valuable results which could be further studied through structural biology or other experimental approaches so as to validate the protein-protein interactions proposed here. The evolutionary analysis of the proteins involved showed that, gene fusion or gene fission events can happen in all organisms, while some protein domains are more prone to fusion and fission events and present complex evolutionary patterns. PMID:23874788

  11. Multi-Sample Pooling and Illumina Genome Analyzer Sequencing Methods to Determine Gene Sequence Variation for Database Development

    PubMed Central

    Margraf, Rebecca L.; Durtschi, Jacob D.; Dames, Shale; Pattison, David C.; Stephens, Jack E.; Mao, Rong; Voelkerding, Karl V.

    2010-01-01

    Determination of sequence variation within a genetic locus to develop clinically relevant databases is critical for molecular assay design and clinical test interpretation, so multisample pooling for Illumina genome analyzer (GA) sequencing was investigated using the RET proto-oncogene as a model. Samples were Sanger-sequenced for RET exons 10, 11, and 13–16. Ten samples with 13 known unique variants (“singleton variants” within the pool) and seven common changes were amplified and then equimolar-pooled before sequencing on a single flow cell lane, generating 36 base reads. For comparison, a single “control” sample was run in a different lane. After alignment, a 24-base quality score-screening threshold and 3` read end trimming of three bases yielded low background error rates with a 27% decrease in aligned read coverage. Sequencing data were evaluated using an established variant detection method (percent variant reads), by the presented subtractive correction method, and with SNPSeeker software. In total, 41 variants (of which 23 were singleton variants) were detected in the 10 pool data, which included all Sanger-identified variants. The 23 singleton variants were detected near the expected 5% allele frequency (average 5.17%±0.90% variant reads), well above the highest background error (1.25%). Based on background error rates, read coverage, simulated 30, 40, and 50 sample pool data, expected singleton allele frequencies within pools, and variant detection methods; ≥30 samples (which demonstrated a minimum 1% variant reads for singletons) could be pooled to reliably detect singleton variants by GA sequencing. PMID:20808642

  12. Analysis of betaS and betaA genes in a Mexican population with African roots.

    PubMed

    Magaña, María Teresa; Ongay, Zoyla; Tagle, Juan; Bentura, Gilberto; Cobián, José G; Perea, F Javier; Casas-Castañeda, Maricela; Sánchez-López, Yoaly J; Ibarra, Bertha

    2002-01-01

    To investigate the origin of the beta(A) and beta(S) genes in a Mexican population with African roots and a high frequency of hemoglobin S, we analyzed 467 individuals (288 unrelated) from different towns in the states of Guerrero and Oaxaca in the Costa Chica region. The frequency of the sickle-cell trait was 12.8%, which may represent a public health problem. The frequencies of the beta-haplotypes were determined from 350 nonrelated chromosomes (313 beta(A) and 37 beta(S)). We observed 15 different beta(A) haplotypes, the most common of which were haplotypes 1 (48.9%), 2 (13.4%), and 3 (13.4%). The calculation of pairwise distributions and Nei's genetic distance analysis using 32 worldwide populations showed that the beta(A) genes are more closely related to those of Mexican Mestizos and North Africans. Bantu and Benin haplotypes and haplotype 9 were related to the beta(S) genes, with frequencies of 78.8, 18.2, and 3.0%, respectively. Comparison of these haplotypes with 17 other populations revealed a high similitude with the population of the Central African Republic. These data suggest distinct origins for the beta(A) and beta(S) genes in Mexican individuals from the Costa Chica region.

  13. Analyzing the Association of Polymorphisms in the CRYBB2 Gene with Prostate Cancer Risk in African Americans

    PubMed Central

    FARUQUE, MEZBAH U.; PAUL, RABINDRA; RICKS-SANTI, LUISEL; JINGWI, EMMANUEL Y.; AHAGHOTU, CHILEDUM A.; DUNSTON, GEORGIA M.

    2016-01-01

    Background/Aim Prostate cancer (PCa) shows disproportionately higher incidence and disease-associated mortality in African Americans. The human crystallin beta B2 (CRYBB2) gene has been reported as one tumor signature gene differentially expressed between African American and European American cancer patients. We investigated the role of CRYBB2 genetic variants in PCa in African Americans. Materials and Methods Subjects comprised of 233 PCa cases and 294 controls. Nine haplotype-tagged single nucleotide polymorphisms (SNPs) in and around the CRYBB2 gene were genotyped by pyrosequencing. Association analyses were performed for PCa with adjustment for age and prostate-specific antigen (PSA), under an additive genetic model. Results Out of the nine SNPs examined, rs9608380 was found to be nominally associated with PCa (odds ratio (OR)=2.619 (95% confidence interval (CI)=1.156–5.935), p=0.021). rs9306412 was in strong linkage disequilibrium with rs9608380 that showed an association p-value of 0.077. Using ENCODE data, we found rs9608380 mapped to a region annotated with regulatory motifs, such as DNase hypersensitive sites and histone modifications. Conclusion This is the first study to analyze the association between genetic variations in the CRYBB2 gene with PCa. rs9608380, associated with PCa, is a potentially functional variant. PMID:25964531

  14. Mining a database of single amplified genomes from Red Sea brine pool extremophiles-improving reliability of gene function prediction using a profile and pattern matching algorithm (PPMA).

    PubMed

    Grötzinger, Stefan W; Alam, Intikhab; Ba Alawi, Wail; Bajic, Vladimir B; Stingl, Ulrich; Eppinger, Jörg

    2014-01-01

    Reliable functional annotation of genomic data is the key-step in the discovery of novel enzymes. Intrinsic sequencing data quality problems of single amplified genomes (SAGs) and poor homology of novel extremophile's genomes pose significant challenges for the attribution of functions to the coding sequences identified. The anoxic deep-sea brine pools of the Red Sea are a promising source of novel enzymes with unique evolutionary adaptation. Sequencing data from Red Sea brine pool cultures and SAGs are annotated and stored in the Integrated Data Warehouse of Microbial Genomes (INDIGO) data warehouse. Low sequence homology of annotated genes (no similarity for 35% of these genes) may translate into false positives when searching for specific functions. The Profile and Pattern Matching (PPM) strategy described here was developed to eliminate false positive annotations of enzyme function before progressing to labor-intensive hyper-saline gene expression and characterization. It utilizes InterPro-derived Gene Ontology (GO)-terms (which represent enzyme function profiles) and annotated relevant PROSITE IDs (which are linked to an amino acid consensus pattern). The PPM algorithm was tested on 15 protein families, which were selected based on scientific and commercial potential. An initial list of 2577 enzyme commission (E.C.) numbers was translated into 171 GO-terms and 49 consensus patterns. A subset of INDIGO-sequences consisting of 58 SAGs from six different taxons of bacteria and archaea were selected from six different brine pool environments. Those SAGs code for 74,516 genes, which were independently scanned for the GO-terms (profile filter) and PROSITE IDs (pattern filter). Following stringent reliability filtering, the non-redundant hits (106 profile hits and 147 pattern hits) are classified as reliable, if at least two relevant descriptors (GO-terms and/or consensus patterns) are present. Scripts for annotation, as well as for the PPM algorithm, are available

  15. Mining a database of single amplified genomes from Red Sea brine pool extremophiles—improving reliability of gene function prediction using a profile and pattern matching algorithm (PPMA)

    PubMed Central

    Grötzinger, Stefan W.; Alam, Intikhab; Ba Alawi, Wail; Bajic, Vladimir B.; Stingl, Ulrich; Eppinger, Jörg

    2014-01-01

    Reliable functional annotation of genomic data is the key-step in the discovery of novel enzymes. Intrinsic sequencing data quality problems of single amplified genomes (SAGs) and poor homology of novel extremophile's genomes pose significant challenges for the attribution of functions to the coding sequences identified. The anoxic deep-sea brine pools of the Red Sea are a promising source of novel enzymes with unique evolutionary adaptation. Sequencing data from Red Sea brine pool cultures and SAGs are annotated and stored in the Integrated Data Warehouse of Microbial Genomes (INDIGO) data warehouse. Low sequence homology of annotated genes (no similarity for 35% of these genes) may translate into false positives when searching for specific functions. The Profile and Pattern Matching (PPM) strategy described here was developed to eliminate false positive annotations of enzyme function before progressing to labor-intensive hyper-saline gene expression and characterization. It utilizes InterPro-derived Gene Ontology (GO)-terms (which represent enzyme function profiles) and annotated relevant PROSITE IDs (which are linked to an amino acid consensus pattern). The PPM algorithm was tested on 15 protein families, which were selected based on scientific and commercial potential. An initial list of 2577 enzyme commission (E.C.) numbers was translated into 171 GO-terms and 49 consensus patterns. A subset of INDIGO-sequences consisting of 58 SAGs from six different taxons of bacteria and archaea were selected from six different brine pool environments. Those SAGs code for 74,516 genes, which were independently scanned for the GO-terms (profile filter) and PROSITE IDs (pattern filter). Following stringent reliability filtering, the non-redundant hits (106 profile hits and 147 pattern hits) are classified as reliable, if at least two relevant descriptors (GO-terms and/or consensus patterns) are present. Scripts for annotation, as well as for the PPM algorithm, are available

  16. Adaptive genomic divergence under high gene flow between freshwater and brackish-water ecotypes of prickly sculpin (Cottus asper) revealed by Pool-Seq.

    PubMed

    Dennenmoser, Stefan; Vamosi, Steven M; Nolte, Arne W; Rogers, Sean M

    2017-01-01

    Understanding the genomic basis of adaptive divergence in the presence of gene flow remains a major challenge in evolutionary biology. In prickly sculpin (Cottus asper), an abundant euryhaline fish in northwestern North America, high genetic connectivity among brackish-water (estuarine) and freshwater (tributary) habitats of coastal rivers does not preclude the build-up of neutral genetic differentiation and emergence of different life history strategies. Because these two habitats present different osmotic niches, we predicted high genetic differentiation at known teleost candidate genes underlying salinity tolerance and osmoregulation. We applied whole-genome sequencing of pooled DNA samples (Pool-Seq) to explore adaptive divergence between two estuarine and two tributary habitats. Paired-end sequence reads were mapped against genomic contigs of European Cottus, and the gene content of candidate regions was explored based on comparisons with the threespine stickleback genome. Genes showing signals of repeated differentiation among brackish-water and freshwater habitats included functions such as ion transport and structural permeability in freshwater gills, which suggests that local adaptation to different osmotic niches might contribute to genomic divergence among habitats. Overall, the presence of both repeated and unique signatures of differentiation across many loci scattered throughout the genome is consistent with polygenic adaptation from standing genetic variation and locally variable selection pressures in the early stages of life history divergence.

  17. Analysis of 5' flanking regions of the gamma globin genes from major African haplotype backgrounds associated with sickle cell disease.

    PubMed

    Month, S R; Wood, R W; Trifillis, P T; Orchowski, P J; Sharon, B; Ballas, S K; Surrey, S; Schwartz, E

    1990-02-01

    There are at least three major African haplotype backgrounds on which the beta s mutation arises. Sequence changes in the immediate 5' flanking area of the gamma-globin genes may account for differences in fetal hemoglobin expression among the three haplotypes. We determined the sequence from -350 to 10 bp 5' of the G gamma and A gamma fetal globin genes from one beta s-containing chromosome on each of the three major haplotype backgrounds. The Senegal chromosome had a T at -158 5' to the G gamma gene; the Benin (BEN) chromosome had an A to G change at -309 5' to the G gamma gene; and the Central African Republic (CAR) chromosome had a C to T change at -271 5' to the A gamma gene. Genomic DNA from patients with sickle cell disease was analyzed using the polymerase chain reaction and radiolabeled allele-specific oligonucleotide probes. The -309 G variant 5' to the G gamma gene is associated with BEN chromosomes, and the -271 T variant 5' to A gamma with CAR. The -309 change was also found on beta A-containing chromosomes, while the -271 change was not. The -309 change may have predated the beta s mutation on the BEN chromosome.

  18. Extreme expansion of the olfactory receptor gene repertoire in African elephants and evolutionary dynamics of orthologous gene groups in 13 placental mammals

    PubMed Central

    Matsui, Atsushi; Touhara, Kazushige

    2014-01-01

    Olfactory receptors (ORs) detect odors in the environment, and OR genes constitute the largest multigene family in mammals. Numbers of OR genes vary greatly among species—reflecting the respective species' lifestyles—and this variation is caused by frequent gene gains and losses during evolution. However, whether the extent of gene gains/losses varies among individual gene lineages and what might generate such variation is unknown. To answer these questions, we used a newly developed phylogeny-based method to classify >10,000 intact OR genes from 13 placental mammal species into 781 orthologous gene groups (OGGs); we then compared the OGGs. Interestingly, African elephants had a surprisingly large repertoire (∼2000) of functional OR genes encoded in enlarged gene clusters. Additionally, OR gene lineages that experienced more gene duplication had weaker purifying selection, and Class II OR genes have evolved more dynamically than those in Class I. Some OGGs were highly expanded in a lineage-specific manner, while only three OGGs showed complete one-to-one orthology among the 13 species without any gene gains/losses. These three OGGs also exhibited highly conserved amino acid sequences; therefore, ORs in these OGGs may have physiologically important functions common to every placental mammal. This study provides a basis for inferring OR functions from evolutionary trajectory. PMID:25053675

  19. Extreme expansion of the olfactory receptor gene repertoire in African elephants and evolutionary dynamics of orthologous gene groups in 13 placental mammals.

    PubMed

    Niimura, Yoshihito; Matsui, Atsushi; Touhara, Kazushige

    2014-09-01

    Olfactory receptors (ORs) detect odors in the environment, and OR genes constitute the largest multigene family in mammals. Numbers of OR genes vary greatly among species--reflecting the respective species' lifestyles--and this variation is caused by frequent gene gains and losses during evolution. However, whether the extent of gene gains/losses varies among individual gene lineages and what might generate such variation is unknown. To answer these questions, we used a newly developed phylogeny-based method to classify >10,000 intact OR genes from 13 placental mammal species into 781 orthologous gene groups (OGGs); we then compared the OGGs. Interestingly, African elephants had a surprisingly large repertoire (∼ 2000) of functional OR genes encoded in enlarged gene clusters. Additionally, OR gene lineages that experienced more gene duplication had weaker purifying selection, and Class II OR genes have evolved more dynamically than those in Class I. Some OGGs were highly expanded in a lineage-specific manner, while only three OGGs showed complete one-to-one orthology among the 13 species without any gene gains/losses. These three OGGs also exhibited highly conserved amino acid sequences; therefore, ORs in these OGGs may have physiologically important functions common to every placental mammal. This study provides a basis for inferring OR functions from evolutionary trajectory.

  20. Pooled Resequencing of 122 Ulcerative Colitis Genes in a Large Dutch Cohort Suggests Population-Specific Associations of Rare Variants in MUC2

    PubMed Central

    Visschedijk, Marijn C.; Alberts, Rudi; Mucha, Soren; Deelen, Patrick; de Jong, Dirk J.; Pierik, Marieke; Spekhorst, Lieke M.; Imhann, Floris; van der Meulen-de Jong, Andrea E.; van der Woude, C. Janneke; van Bodegraven, Adriaan A.; Oldenburg, Bas; Löwenberg, Mark; Dijkstra, Gerard; Ellinghaus, David; Schreiber, Stefan; Wijmenga, Cisca; Rivas, Manuel A.; Franke, Andre

    2016-01-01

    Genome-wide association studies have revealed several common genetic risk variants for ulcerative colitis (UC). However, little is known about the contribution of rare, large effect genetic variants to UC susceptibility. In this study, we performed a deep targeted re-sequencing of 122 genes in Dutch UC patients in order to investigate the contribution of rare variants to the genetic susceptibility to UC. The selection of genes consists of 111 established human UC susceptibility genes and 11 genes that lead to spontaneous colitis when knocked-out in mice. In addition, we sequenced the promoter regions of 45 genes where known variants exert cis-eQTL-effects. Targeted pooled re-sequencing was performed on DNA of 790 Dutch UC cases. The Genome of the Netherlands project provided sequence data of 500 healthy controls. After quality control and prioritization based on allele frequency and pathogenicity probability, follow-up genotyping of 171 rare variants was performed on 1021 Dutch UC cases and 1166 Dutch controls. Single-variant association and gene-based analyses identified an association of rare variants in the MUC2 gene with UC. The associated variants in the Dutch population could not be replicated in a German replication cohort (1026 UC cases, 3532 controls). In conclusion, this study has identified a putative role for MUC2 on UC susceptibility in the Dutch population and suggests a population-specific contribution of rare variants to UC. PMID:27490946

  1. Saturation of an intra-gene pool linkage map: towards a unified consensus linkage map for fine mapping and synteny analysis in common bean.

    PubMed

    Galeano, Carlos H; Fernandez, Andrea C; Franco-Herrera, Natalia; Cichy, Karen A; McClean, Phillip E; Vanderleyden, Jos; Blair, Matthew W

    2011-01-01

    Map-based cloning and fine mapping to find genes of interest and marker assisted selection (MAS) requires good genetic maps with reproducible markers. In this study, we saturated the linkage map of the intra-gene pool population of common bean DOR364 × BAT477 (DB) by evaluating 2,706 molecular markers including SSR, SNP, and gene-based markers. On average the polymorphism rate was 7.7% due to the narrow genetic base between the parents. The DB linkage map consisted of 291 markers with a total map length of 1,788 cM. A consensus map was built using the core mapping populations derived from inter-gene pool crosses: DOR364 × G19833 (DG) and BAT93 × JALO EEP558 (BJ). The consensus map consisted of a total of 1,010 markers mapped, with a total map length of 2,041 cM across 11 linkage groups. On average, each linkage group on the consensus map contained 91 markers of which 83% were single copy markers. Finally, a synteny analysis was carried out using our highly saturated consensus maps compared with the soybean pseudo-chromosome assembly. A total of 772 marker sequences were compared with the soybean genome. A total of 44 syntenic blocks were identified. The linkage group Pv6 presented the most diverse pattern of synteny with seven syntenic blocks, and Pv9 showed the most consistent relations with soybean with just two syntenic blocks. Additionally, a co-linear analysis using common bean transcript map information against soybean coding sequences (CDS) revealed the relationship with 787 soybean genes. The common bean consensus map has allowed us to map a larger number of markers, to obtain a more complete coverage of the common bean genome. Our results, combined with synteny relationships provide tools to increase marker density in selected genomic regions to identify closely linked polymorphic markers for indirect selection, fine mapping or for positional cloning.

  2. Identification of a novel dehydration responsive gene, drp10, from the African clawed frog, Xenopus laevis.

    PubMed

    Biggar, Kyle K; Biggar, Yulia; Storey, Kenneth B

    2015-07-01

    During periods of environmental stress a number of different anuran species employ adaptive strategies to promote survival. Our study found that in response to dehydration (i.e., loss of total body water content), the African clawed frog (Xenopus laevis) increased the expression of a novel gene (drp10) that encodes a structural homolog of the freeze-responsive FR10 protein found in wood frogs. Similar to FR10, the DRP10 protein was found to also contain a highly conserved N-terminal cleavable signal peptide. Furthermore, DRP10 was found to have high structural homology to the available crystal structures of type A and E apolipoproteins in Homo sapiens, and a type IV LS-12 anti-freeze protein in the longhorn sculpin, Myoxocephalus octodecemspinosis. In response to dehydration, the transcript expression of drp10 was found to increase 1.52 ± 0.16-fold and 1.97 ± 0.11-fold in response to medium (15%) and high (30%) dehydration stresses in the liver tissue of X. laevis, respectively, while drp10 expression increased 2.12 ± 0.12-fold and 1.46 ± 0.16-fold in kidney tissue. Although the molecular function of both dehydration-responsive DRP10 and the freeze-responsive FR10 have just begun to be elucidated, it is likely that both are frog-specific proteins that likely share a similar purpose during water-related stresses.

  3. Determining the optimal number of individual samples to pool for quantification of average herd levels of antimicrobial resistance genes in Danish pig herds using high-throughput qPCR.

    PubMed

    Clasen, Julie; Mellerup, Anders; Olsen, John Elmerdahl; Angen, Øystein; Folkesson, Anders; Halasa, Tariq; Toft, Nils; Birkegård, Anna Camilla

    2016-06-30

    The primary objective of this study was to determine the minimum number of individual fecal samples to pool together in order to obtain a representative sample for herd level quantification of antimicrobial resistance (AMR) genes in a Danish pig herd, using a novel high-throughput qPCR assay. The secondary objective was to assess the agreement between different methods of sample pooling. Quantification of AMR was achieved using a high-throughput qPCR method to quantify the levels of seven AMR genes (ermB, ermF, sulI, sulII, tet(M), tet(O) and tet(W)). A large variation in the levels of AMR genes was found between individual samples. As the number of samples in a pool increased, a decrease in sample variation was observed. It was concluded that the optimal pooling size is five samples, as an almost steady state in the variation was observed when pooling this number of samples. Good agreement between different pooling methods was found and the least time-consuming method of pooling, by transferring feces from each individual sample to a tube using a 10μl inoculation loop and adding 3.5ml of PBS, approximating a 10% solution, can therefore be used in future studies.

  4. Next generation semiconductor based sequencing of bitter taste receptor genes in different pig populations and association analysis using a selective DNA pool-seq approach.

    PubMed

    Ribani, A; Bertolini, F; Schiavo, G; Scotti, E; Utzeri, V J; Dall'Olio, S; Trevisi, P; Bosi, P; Fontanesi, L

    2017-02-01

    Taste perception in animals affects feed intake and may influence production traits. In particular, bitter is sensed by receptors encoded by the family of TAS2R genes. In this research, using a DNA pool-seq approach coupled with next generation semiconductor based target resequencing, we analysed nine porcine TAS2R genes (TAS2R1, TAS2R3, TAS2R4, TAS2R7, TAS2R9, TAS2R10, TAS2R16, TAS2R38 and TAS2R39) to identify variability and, at the same time, estimate single nucleotide polymorphism (SNP) allele frequencies in several populations and testing differences in an association analysis. Equimolar DNA pools were prepared for five pig breeds (Italian Duroc, Italian Landrace, Pietrain, Meishan and Casertana) and wild boars (5-10 individuals each) and for two groups of Italian Large White pigs with extreme and divergent back fat thickness (50 + 50 pigs). About 1.8 million reads were obtained by sequencing amplicons generated from these pools. A total of 125 SNPs were identified, of which 37 were missense mutations. Three of them (p.Ile53Phe and p.Trp85Leu in TAS2R4; p.Leu37Ser in TAS2R39) could have important effects on the function of these bitter taste receptors, based on in silico predictions. Variability in wild boars seems lower than that in domestic breeds potentially as a result of selective pressure in the wild towards defensive bitter taste perception. Three SNPs in TAS2R38 and TAS2R39 were significantly associated with back fat thickness. These results may be important to understand the complexity of taste perception and their associated effects that could be useful to develop nutrigenetic approaches in pig breeding and nutrition.

  5. Molecular genetic studies of natives on Easter Island: evidence of an early European and Amerindian contribution to the Polynesian gene pool.

    PubMed

    Lie, B A; Dupuy, B M; Spurkland, A; Fernández-Viña, M A; Hagelberg, E; Thorsby, E

    2007-01-01

    Most archaeological and linguistic evidence suggest a Polynesian origin of the population of Easter Island (Rapanui), and this view has been supported by the identification of Polynesian mitochondrial DNA (mtDNA) polymorphisms in prehistoric skeletal remains. However, some evidence of an early South American contact also exists (the sweet potato, bottle gourd etc.), but genetic studies have so far failed to show an early Amerindian contribution to the gene pool on Easter Island. To address this issue, we analyzed mtDNA and Y chromosome markers and performed high-resolution human leukocyte antigen (HLA) genotyping of DNA harvested from previously collected sera of 48 reputedly nonadmixed native Easter Islanders. All individuals carried mtDNA types and HLA alleles previously found in Polynesia, and most men carried Y chromosome markers of Polynesian origin, providing further evidence of a Polynesian origin of the population of Easter Island. A few individuals carried HLA alleles and/or Y chromosome markers of European origin. More interestingly, some individuals carried the HLA alleles A*0212 and B*3905, which are of typical Amerindian origin. The genealogy of some of the individuals carrying these non-Polynesian HLA alleles and their haplotypic backgrounds suggest an introduction into Easter Island in the early 1800s, or earlier. Thus, there may have been an early European and Amerindian contribution to the Polynesian gene pool of Easter Island.

  6. The association of interacting neighborhood gene-environment risk with cortisol and blood pressure in African-American adults

    PubMed Central

    Coulon, Sandra M.; Wilson, Dawn K.; Van Horn, M. L.; Hand, Gregory A.; Kresovich, Stephen

    2016-01-01

    Background African-American adults are disproportionately affected by stress-related chronic conditions like high blood pressure (BP), and both environmental stress and genetic risk may play a role in its development. Purpose This study tested whether the dual risk of low neighborhood socioeconomic status (SES) and glucocorticoid genetic sensitivity interacted to predict waking cortisol and BP. Methods Cross-sectional waking cortisol and BP were collected from 208 African-American adults who were participating in a follow-up visit as part of the Positive Action for Today’s Health trial. Three single nucleotide polymorphisms were genotyped, salivary cortisol samples were collected, and neighborhood SES was calculated using 2010 Census data. Results The sample was mostly female (65%), with weight classified as overweight or obese (MBMI=32.74, SD=8.88), and a mean age of 55.64 (SD=15.21). The gene-by-neighborhood SES interaction predicted cortisol (B=0.235, p=.001, r2=.036), but not BP. For adults with high genetic risk, waking cortisol was lower with lower SES but higher with higher SES (B=0.87). Lower neighborhood SES was also related to higher systolic BP (B=−0.794, p=.028). Conclusions Findings demonstrated an interaction whereby African-American adults with high genetic sensitivity had high levels of waking cortisol with higher neighborhood SES, and low levels with lower neighborhood SES. This moderation effect is consistent with a differential susceptibility gene-environment pattern, rather than a dual-risk pattern. These findings contribute to a growing body of evidence that demonstrates the importance of investigating complex gene-environment relations in order to better understand stress-related health disparities. PMID:26685668

  7. Mutation analysis of the phospholamban gene in 315 South Africans with dilated, hypertrophic, peripartum and arrhythmogenic right ventricular cardiomyopathies

    PubMed Central

    Fish, Maryam; Shaboodien, Gasnat; Kraus, Sarah; Sliwa, Karen; Seidman, Christine E.; Burke, Michael A.; Crotti, Lia; Schwartz, Peter J.; Mayosi, Bongani M.

    2016-01-01

    Cardiomyopathy is an important cause of heart failure in Sub-Saharan Africa, accounting for up to 30% of adult heart failure hospitalisations. This high prevalence poses a challenge in societies without access to resources and interventions essential for disease management. Over 80 genes have been implicated as a cause of cardiomyopathy. Mutations in the phospholamban (PLN) gene are associated with dilated cardiomyopathy (DCM) and severe heart failure. In Africa, the prevalence of PLN mutations in cardiomyopathy patients is unknown. Our aim was to screen 315 patients with arrhythmogenic right ventricular cardiomyopathy (n = 111), DCM (n = 95), hypertrophic cardiomyopathy (n = 40) and peripartum cardiomyopathy (n = 69) for disease-causing PLN mutations by high resolution melt analysis and DNA sequencing. We detected the previously reported PLN c.25C > T (p.R9C) mutation in a South African family with severe autosomal dominant DCM. Haplotype analysis revealed that this mutation occurred against a different haplotype background to that of the original North American family and was therefore unlikely to have been inherited from a common ancestor. No other mutations in PLN were detected (mutation prevalence = 0.2%). We conclude that PLN is a rare cause of cardiomyopathy in African patients. The PLN p.R9C mutation is not well-tolerated, emphasising the importance of this gene in cardiac function. PMID:26917049

  8. Mutation analysis of the phospholamban gene in 315 South Africans with dilated, hypertrophic, peripartum and arrhythmogenic right ventricular cardiomyopathies.

    PubMed

    Fish, Maryam; Shaboodien, Gasnat; Kraus, Sarah; Sliwa, Karen; Seidman, Christine E; Burke, Michael A; Crotti, Lia; Schwartz, Peter J; Mayosi, Bongani M

    2016-02-26

    Cardiomyopathy is an important cause of heart failure in Sub-Saharan Africa, accounting for up to 30% of adult heart failure hospitalisations. This high prevalence poses a challenge in societies without access to resources and interventions essential for disease management. Over 80 genes have been implicated as a cause of cardiomyopathy. Mutations in the phospholamban (PLN) gene are associated with dilated cardiomyopathy (DCM) and severe heart failure. In Africa, the prevalence of PLN mutations in cardiomyopathy patients is unknown. Our aim was to screen 315 patients with arrhythmogenic right ventricular cardiomyopathy (n = 111), DCM (n = 95), hypertrophic cardiomyopathy (n = 40) and peripartum cardiomyopathy (n = 69) for disease-causing PLN mutations by high resolution melt analysis and DNA sequencing. We detected the previously reported PLN c.25C > T (p.R9C) mutation in a South African family with severe autosomal dominant DCM. Haplotype analysis revealed that this mutation occurred against a different haplotype background to that of the original North American family and was therefore unlikely to have been inherited from a common ancestor. No other mutations in PLN were detected (mutation prevalence = 0.2%). We conclude that PLN is a rare cause of cardiomyopathy in African patients. The PLN p.R9C mutation is not well-tolerated, emphasising the importance of this gene in cardiac function.

  9. Genetic variants in one-carbon metabolism genes and breast cancer risk in European American and African American women.

    PubMed

    Gong, Zhihong; Yao, Song; Zirpoli, Gary; David Cheng, Ting-Yuan; Roberts, Michelle; Khoury, Thaer; Ciupak, Gregory; Davis, Warren; Pawlish, Karen; Jandorf, Lina; Bovbjerg, Dana H; Bandera, Elisa V; Ambrosone, Christine B

    2015-08-01

    Folate-mediated one-carbon metabolism plays critical roles in DNA synthesis, repair and DNA methylation. The impact of single nucleotide polymorphisms (SNPs) in folate-metabolizing enzymes has been investigated in risk of breast cancer among European or Asian populations, but not among women of African ancestry. We conducted a comprehensive analysis of SNPs in eleven genes involved in one-carbon metabolism and risk of breast cancer in 1,275 European-American (EA) and 1,299 African-American (AA) women who participated in the Women's Circle of Health Study. Allele frequencies varied significantly between EA and AA populations. A number of these SNPs, specifically in genes including MTR, MTRR, SHMT1, TYMS and SLC19A1, were associated with overall breast cancer risk, as well as risk by estrogen receptor (ER) status, in either EA or AA women. Associations appeared to be modified by dietary folate intake. Although single-SNP associations were not statistically significant after correcting for multiple comparisons, polygenetic score analyses revealed significant associations with breast cancer risk. Per unit increase of the risk score was associated with a modest 19 to 50% increase in risk of breast cancer overall, ER positive or ER negative cancer (all p < 0.0005) in EAs or AAs. In summary, our data suggest that one-carbon metabolizing gene polymorphisms could play a role in breast cancer and that may differ between EA and AA women.

  10. Transcriptional profiling of inflammatory cytokine genes in African buffaloes (Syncerus caffer) infected with Theileria parva.

    PubMed

    Okagawa, Tomohiro; Konnai, Satoru; Mekata, Hirohisa; Githaka, Naftaly; Suzuki, Saori; Kariuki, Edward; Gakuya, Francis; Kanduma, Esther; Shirai, Tatsuya; Ikebuchi, Ryoyo; Ikenaka, Yoshinori; Ishizuka, Mayumi; Murata, Shiro; Ohashi, Kazuhiko

    2012-08-15

    Theileria parva (T. parva) causes East Coast fever (ECF), which is of huge economic importance to Eastern and Southern African countries. In a previous bovine model, inflammatory cytokines were closely associated with disease progression in animals experimentally infected with T. parva. The African Cape buffalo (Syncerus caffer), the natural reservoir for T. parva, is completely resistant to ECF despite a persistently high parasitaemia following infection with T. parva. Characterizing basic immunological interactions in the host is critical to understanding the mechanism underlying disease resistance in the African Cape buffalo. In this study, the expression level of several cytokines was analyzed in T. parva-infected buffaloes. There were no significant differences in the expression profiles of inflammatory cytokines between the infected and uninfected animals despite a remarkably high parasitaemia in the former. However, the expression level of IL-10 was significantly upregulated in the infected animals. These results indicate a correlation between diminished inflammatory cytokines response and disease resistance in the buffalo.

  11. Sequencing of GJB2 in Cameroonians and Black South Africans and comparison to 1000 Genomes Project Data Support Need to Revise Strategy for Discovery of Nonsyndromic Deafness Genes in Africans.

    PubMed

    Bosch, Jason; Noubiap, Jean Jacques N; Dandara, Collet; Makubalo, Nomlindo; Wright, Galen; Entfellner, Jean-Baka Domelevo; Tiffin, Nicki; Wonkam, Ambroise

    2014-11-01

    Mutations in the GJB2 gene, encoding connexin 26, could account for 50% of congenital, nonsyndromic, recessive deafness cases in some Caucasian/Asian populations. There is a scarcity of published data in sub-Saharan Africans. We Sanger sequenced the coding region of the GJB2 gene in 205 Cameroonian and Xhosa South Africans with congenital, nonsyndromic deafness; and performed bioinformatic analysis of variations in the GJB2 gene, incorporating data from the 1000 Genomes Project. Amongst Cameroonian patients, 26.1% were familial. The majority of patients (70%) suffered from sensorineural hearing loss. Ten GJB2 genetic variants were detected by sequencing. A previously reported pathogenic mutation, g.3741_3743delTTC (p.F142del), and a putative pathogenic mutation, g.3816G>A (p.V167M), were identified in single heterozygous samples. Amongst eight the remaining variants, two novel variants, g.3318-41G>A and g.3332G>A, were reported. There were no statistically significant differences in allele frequencies between cases and controls. Principal Components Analyses differentiated between Africans, Asians, and Europeans, but only explained 40% of the variation. The present study is the first to compare African GJB2 sequences with the data from the 1000 Genomes Project and have revealed the low variation between population groups. This finding has emphasized the hypothesis that the prevalence of mutations in GJB2 in nonsyndromic deafness amongst European and Asian populations is due to founder effects arising after these individuals migrated out of Africa, and not to a putative "protective" variant in the genomic structure of GJB2 in Africans. Our results confirm that mutations in GJB2 are not associated with nonsyndromic deafness in Africans.

  12. Phylogeny and biogeography of African Murinae based on mitochondrial and nuclear gene sequences, with a new tribal classification of the subfamily

    PubMed Central

    2008-01-01

    Background Within the subfamily Murinae, African murines represent 25% of species biodiversity, making this group ideal for detailed studies of the patterns and timing of diversification of the African endemic fauna and its relationships with Asia. Here we report the results of phylogenetic analyses of the endemic African murines through a broad sampling of murine diversity from all their distribution area, based on the mitochondrial cytochrome b gene and the two nuclear gene fragments (IRBP exon 1 and GHR). Results A combined analysis of one mitochondrial and two nuclear gene sequences consistently identified and robustly supported ten primary lineages within Murinae. We propose to formalize a new tribal arrangement within the Murinae that reflects this phylogeny. The diverse African murine assemblage includes members of five of the ten tribes and clearly derives from multiple faunal exchanges between Africa and Eurasia. Molecular dating analyses using a relaxed Bayesian molecular clock put the first colonization of Africa around 11 Mya, which is consistent with the fossil record. The main period of African murine diversification occurred later following disruption of the migration route between Africa and Asia about 7–9 Mya. A second period of interchange, dating to around 5–6.5 Mya, saw the arrival in Africa of Mus (leading to the speciose endemic Nannomys), and explains the appearance of several distinctive African lineages in the late Miocene and Pliocene fossil record of Eurasia. Conclusion Our molecular survey of Murinae, which includes the most complete sampling so far of African taxa, indicates that there were at least four separate radiations within the African region, as well as several phases of dispersal between Asia and Africa during the last 12 My. We also reconstruct the phylogenetic structure of the Murinae, and propose a new classification at tribal level for this traditionally problematic group. PMID:18616808

  13. Ancestral and derived attributes of the dlx gene repertoire, cluster structure and expression patterns in an African cichlid fish

    PubMed Central

    2011-01-01

    Background Cichlid fishes have undergone rapid, expansive evolutionary radiations that are manifested in the diversification of their trophic morphologies, tooth patterning and coloration. Understanding the molecular mechanisms that underlie the cichlids' unique patterns of evolution requires a thorough examination of genes that pattern the neural crest, from which these diverse phenotypes are derived. Among those genes, the homeobox-containing Dlx gene family is of particular interest since it is involved in the patterning of the brain, jaws and teeth. Results In this study, we characterized the dlx genes of an African cichlid fish, Astatotilapia burtoni, to provide a baseline to later allow cross-species comparison within Cichlidae. We identified seven dlx paralogs (dlx1a, -2a, -4a, -3b, -4b, -5a and -6a), whose orthologies were validated with molecular phylogenetic trees. The intergenic regions of three dlx gene clusters (dlx1a-2a, dlx3b-4b, and dlx5a-6a) were amplified with long PCR. Intensive cross-species comparison revealed a number of conserved non-coding elements (CNEs) that are shared with other percomorph fishes. This analysis highlighted additional lineage-specific gains/losses of CNEs in different teleost fish lineages and a novel CNE that had previously not been identified. Our gene expression analyses revealed overlapping but distinct expression of dlx orthologs in the developing brain and pharyngeal arches. Notably, four of the seven A. burtoni dlx genes, dlx2a, dlx3b, dlx4a and dlx5a, were expressed in the developing pharyngeal teeth. Conclusion This comparative study of the dlx genes of A. burtoni has deepened our knowledge of the diversity of the Dlx gene family, in terms of gene repertoire, expression patterns and non-coding elements. We have identified possible cichlid lineage-specific changes, including losses of a subset of dlx expression domains in the pharyngeal teeth, which will be the targets of future functional studies. PMID:21205289

  14. Prevalence of common vitamin D receptor gene polymorphisms in HIV-infected and uninfected South Africans

    PubMed Central

    McNamara, Lynne; Takuva, Simbarashe; Chirwa, Tobias; MacPhail, Patrick

    2016-01-01

    Background: Host genetic factors may a play role in susceptibility to infection. Vitamin-D is an immunomodulator that may play a role in HIV infection. Vitamin-D action is mediated by the vitamin-D receptor. We establish prevalence of ApaI, BsmI, FokI and TaqI polymorphisms (VDRPs) amongst a black southern African HIV+ve population and investigate polymorphic differences between HIV+ve and -ve people. Methods: Seventy-nine sex and age-group matched HIV+ve patients of African origin initiating antiretroviral therapy (ART) and 79 HIV-ve participants, also of African origin, were recruited from a public sector HIV testing and treatment clinic and investigated for the 4 polymorphisms. The genotype frequencies were compared, odds ratios and 95% confidence intervals of the association of HIV status and each genotype were calculated. Both dominant, co-dominant, recessive and allele models were tested. Results: We found no evidence of difference in distribution and association between HIV infection and the genotypes of the BsmI, FokI and TaqI VDR polymorphisms. The genotype distributions were consistent with Hardy-Weinberg equilibrium for these genotypes. The ApaI genotype showed differences in distribution by HIV status in the dominant and co-dominant models. However this finding is cautiously stated as the ApaI genotype violated the Hardy-Weinberg equilibrium and frequency of the minor variant was unexpectedly low in this population. Conclusion: We do not show convincing differences in distribution of the VDR genotypes among HIV+ve and HIV-ve black southern African persons. Future studies need to be replicated in larger study populations as understanding polymorphic differences and similarities may offer insights into the different susceptibility and progression of HIV in southern African populations. PMID:27186331

  15. Association of genetic variation with systolic and diastolic blood pressure among African Americans: the Candidate Gene Association Resource study.

    PubMed

    Fox, Ervin R; Young, J Hunter; Li, Yali; Dreisbach, Albert W; Keating, Brendan J; Musani, Solomon K; Liu, Kiang; Morrison, Alanna C; Ganesh, Santhi; Kutlar, Abdullah; Ramachandran, Vasan S; Polak, Josef F; Fabsitz, Richard R; Dries, Daniel L; Farlow, Deborah N; Redline, Susan; Adeyemo, Adebowale; Hirschorn, Joel N; Sun, Yan V; Wyatt, Sharon B; Penman, Alan D; Palmas, Walter; Rotter, Jerome I; Townsend, Raymond R; Doumatey, Ayo P; Tayo, Bamidele O; Mosley, Thomas H; Lyon, Helen N; Kang, Sun J; Rotimi, Charles N; Cooper, Richard S; Franceschini, Nora; Curb, J David; Martin, Lisa W; Eaton, Charles B; Kardia, Sharon L R; Taylor, Herman A; Caulfield, Mark J; Ehret, Georg B; Johnson, Toby; Chakravarti, Aravinda; Zhu, Xiaofeng; Levy, Daniel

    2011-06-01

    The prevalence of hypertension in African Americans (AAs) is higher than in other US groups; yet, few have performed genome-wide association studies (GWASs) in AA. Among people of European descent, GWASs have identified genetic variants at 13 loci that are associated with blood pressure. It is unknown if these variants confer susceptibility in people of African ancestry. Here, we examined genome-wide and candidate gene associations with systolic blood pressure (SBP) and diastolic blood pressure (DBP) using the Candidate Gene Association Resource (CARe) consortium consisting of 8591 AAs. Genotypes included genome-wide single-nucleotide polymorphism (SNP) data utilizing the Affymetrix 6.0 array with imputation to 2.5 million HapMap SNPs and candidate gene SNP data utilizing a 50K cardiovascular gene-centric array (ITMAT-Broad-CARe [IBC] array). For Affymetrix data, the strongest signal for DBP was rs10474346 (P= 3.6 × 10(-8)) located near GPR98 and ARRDC3. For SBP, the strongest signal was rs2258119 in C21orf91 (P= 4.7 × 10(-8)). The top IBC association for SBP was rs2012318 (P= 6.4 × 10(-6)) near SLC25A42 and for DBP was rs2523586 (P= 1.3 × 10(-6)) near HLA-B. None of the top variants replicated in additional AA (n = 11 882) or European-American (n = 69 899) cohorts. We replicated previously reported European-American blood pressure SNPs in our AA samples (SH2B3, P= 0.009; TBX3-TBX5, P= 0.03; and CSK-ULK3, P= 0.0004). These genetic loci represent the best evidence of genetic influences on SBP and DBP in AAs to date. More broadly, this work supports that notion that blood pressure among AAs is a trait with genetic underpinnings but also with significant complexity.

  16. Association of genetic variation with systolic and diastolic blood pressure among African Americans: the Candidate Gene Association Resource study

    PubMed Central

    Fox, Ervin R.; Young, J. Hunter; Li, Yali; Dreisbach, Albert W.; Keating, Brendan J.; Musani, Solomon K.; Liu, Kiang; Morrison, Alanna C.; Ganesh, Santhi; Kutlar, Abdullah; Ramachandran, Vasan S.; Polak, Josef F.; Fabsitz, Richard R.; Dries, Daniel L.; Farlow, Deborah N.; Redline, Susan; Adeyemo, Adebowale; Hirschorn, Joel N.; Sun, Yan V.; Wyatt, Sharon B.; Penman, Alan D.; Palmas, Walter; Rotter, Jerome I.; Townsend, Raymond R.; Doumatey, Ayo P.; Tayo, Bamidele O.; Mosley, Thomas H.; Lyon, Helen N.; Kang, Sun J.; Rotimi, Charles N.; Cooper, Richard S.; Franceschini, Nora; Curb, J. David; Martin, Lisa W.; Eaton, Charles B.; Kardia, Sharon L.R.; Taylor, Herman A.; Caulfield, Mark J.; Ehret, Georg B.; Johnson, Toby; Chakravarti, Aravinda; Zhu, Xiaofeng; Levy, Daniel; Munroe, Patricia B.; Rice, Kenneth M.; Bochud, Murielle; Johnson, Andrew D.; Chasman, Daniel I.; Smith, Albert V.; Tobin, Martin D.; Verwoert, Germaine C.; Hwang, Shih-Jen; Pihur, Vasyl; Vollenweider, Peter; O'Reilly, Paul F.; Amin, Najaf; Bragg-Gresham, Jennifer L.; Teumer, Alexander; Glazer, Nicole L.; Launer, Lenore; Zhao, Jing Hua; Aulchenko, Yurii; Heath, Simon; Sõber, Siim; Parsa, Afshin; Luan, Jian'an; Arora, Pankaj; Dehghan, Abbas; Zhang, Feng; Lucas, Gavin; Hicks, Andrew A.; Jackson, Anne U.; Peden, John F.; Tanaka, Toshiko; Wild, Sarah H.; Rudan, Igor; Igl, Wilmar; Milaneschi, Yuri; Parker, Alex N.; Fava, Cristiano; Chambers, John C.; Kumari, Meena; JinGo, Min; van der Harst, Pim; Kao, Wen Hong Linda; Sjögren, Marketa; Vinay, D.G.; Alexander, Myriam; Tabara, Yasuharu; Shaw-Hawkins, Sue; Whincup, Peter H.; Liu, Yongmei; Shi, Gang; Kuusisto, Johanna; Seielstad, Mark; Sim, Xueling; Nguyen, Khanh-Dung Hoang; Lehtimäki, Terho; Matullo, Giuseppe; Wu, Ying; Gaunt, Tom R.; Charlotte Onland-Moret, N.; Cooper, Matthew N.; Platou, Carl G.P.; Org, Elin; Hardy, Rebecca; Dahgam, Santosh; Palmen, Jutta; Vitart, Veronique; Braund, Peter S.; Kuznetsova, Tatiana; Uiterwaal, Cuno S.P.M.; Campbell, Harry; Ludwig, Barbara; Tomaszewski, Maciej; Tzoulaki, Ioanna; Palmer, Nicholette D.; Aspelund, Thor; Garcia, Melissa; Chang, Yen-Pei C.; O'Connell, Jeffrey R.; Steinle, Nanette I.; Grobbee, Diederick E.; Arking, Dan E.; Hernandez, Dena; Najjar, Samer; McArdle, Wendy L.; Hadley, David; Brown, Morris J.; Connell, John M.; Hingorani, Aroon D.; Day, Ian N.M.; Lawlor, Debbie A.; Beilby, John P.; Lawrence, Robert W.; Clarke, Robert; Collins, Rory; Hopewell, Jemma C.; Ongen, Halit; Bis, Joshua C.; Kähönen, Mika; Viikari, Jorma; Adair, Linda S.; Lee, Nanette R.; Chen, Ming-Huei; Olden, Matthias; Pattaro, Cristian; Hoffman Bolton, Judith A.; Köttgen, Anna; Bergmann, Sven; Mooser, Vincent; Chaturvedi, Nish; Frayling, Timothy M.; Islam, Muhammad; Jafar, Tazeen H.; Erdmann, Jeanette; Kulkarni, Smita R.; Bornstein, Stefan R.; Grässler, Jürgen; Groop, Leif; Voight, Benjamin F.; Kettunen, Johannes; Howard, Philip; Taylor, Andrew; Guarrera, Simonetta; Ricceri, Fulvio; Emilsson, Valur; Plump, Andrew; Barroso, Inês; Khaw, Kay-Tee; Weder, Alan B.; Hunt, Steven C.; Bergman, Richard N.; Collins, Francis S.; Bonnycastle, Lori L.; Scott, Laura J.; Stringham, Heather M.; Peltonen, Leena; Perola, Markus; Vartiainen, Erkki; Brand, Stefan-Martin; Staessen, Jan A.; Wang, Thomas J.; Burton, Paul R.; SolerArtigas, Maria; Dong, Yanbin; Snieder, Harold; Wang, Xiaoling; Zhu, Haidong; Lohman, Kurt K.; Rudock, Megan E.; Heckbert, Susan R.; Smith, Nicholas L.; Wiggins, Kerri L.; Shriner, Daniel; Veldre, Gudrun; Viigimaa, Margus; Kinra, Sanjay; Prabhakaran, Dorairajan; Tripathy, Vikal; Langefeld, Carl D.; Rosengren, Annika; Thelle, Dag S.; MariaCorsi, Anna; Singleton, Andrew; Forrester, Terrence; Hilton, Gina; McKenzie, Colin A.; Salako, Tunde; Iwai, Naoharu; Kita, Yoshikuni; Ogihara, Toshio; Ohkubo, Takayoshi; Okamura, Tomonori; Ueshima, Hirotsugu; Umemura, Satoshi; Eyheramendy, Susana; Meitinger, Thomas; Wichmann, H.-Erich; Cho, Yoon Shin; Kim, Hyung-Lae; Lee, Jong-Young; Scott, James; Sehmi, Joban S.; Zhang, Weihua; Hedblad, Bo; Nilsson, Peter; Smith, George Davey; Wong, Andrew; Narisu, Narisu; Stančáková, Alena; Raffel, Leslie J.; Yao, Jie; Kathiresan, Sekar; O'Donnell, Chris; Schwartz, Steven M.; Arfan Ikram, M.; Longstreth, Will T.; Seshadri, Sudha; Shrine, Nick R.G.; Wain, Louise V.; Morken, Mario A.; Swift, Amy J.; Laitinen, Jaana; Prokopenko, Inga; Zitting, Paavo; Cooper, Jackie A.; Humphries, Steve E.; Danesh, John; Rasheed, Asif; Goel, Anuj; Hamsten, Anders; Watkins, Hugh; Bakker, Stephan J.L.; van Gilst, Wiek H.; Janipalli, Charles S.; Radha Mani, K.; Yajnik, Chittaranjan S.; Hofman, Albert; Mattace-Raso, Francesco U.S.; Oostra, Ben A.; Demirkan, Ayse; Isaacs, Aaron; Rivadeneira, Fernando; Lakatta, Edward G.; Orru, Marco; Scuteri, Angelo; Ala-Korpela, Mika; Kangas, Antti J.; Lyytikäinen, Leo-Pekka; Soininen, Pasi; Tukiainen, Taru; Würz, Peter; Twee-Hee Ong, Rick; Dörr, Marcus; Kroemer, Heyo K.; Völker, Uwe; Völzke, Henry; Galan, Pilar; Hercberg, Serge; Lathrop, Mark; Zelenika, Diana; Deloukas, Panos; Mangino, Massimo; Spector, Tim D.; Zhai, Guangju; Meschia, James F.; Nalls, Michael A.; Sharma, Pankaj; Terzic, Janos; Kranthi Kumar, M.J.; Denniff, Matthew; Zukowska-Szczechowska, Ewa; Wagenknecht, Lynne E.; Fowkes, Gerald R.; Charchar, Fadi J.; Schwarz, Peter E.H.; Hayward, Caroline; Guo, Xiuqing; Bots, Michiel L.; Brand, Eva; Samani, Nilesh J.; Polasek, Ozren; Talmud, Philippa J.; Nyberg, Fredrik; Kuh, Diana; Laan, Maris; Hveem, Kristian; Palmer, Lyle J.; van der Schouw, Yvonne T.; Casas, Juan P.; Mohlke, Karen L.; Vineis, Paolo; Raitakari, Olli; Wong, Tien Y.; Shyong Tai, E.; Laakso, Markku; Rao, Dabeeru C.; Harris, Tamara B.; Morris, Richard W.; Dominiczak, Anna F.; Kivimaki, Mika; Marmot, Michael G.; Miki, Tetsuro; Saleheen, Danish; Chandak, Giriraj R.; Coresh, Josef; Navis, Gerjan; Salomaa, Veikko; Han, Bok-Ghee; Kooner, Jaspal S.; Melander, Olle; Ridker, Paul M.; Bandinelli, Stefania; Gyllensten, Ulf B.; Wright, Alan F.; Wilson, James F.; Ferrucci, Luigi; Farrall, Martin; Tuomilehto, Jaakko; Pramstaller, Peter P.; Elosua, Roberto; Soranzo, Nicole; Sijbrands, Eric J.G.; Altshuler, David; Loos, Ruth J.F.; Shuldiner, Alan R.; Gieger, Christian; Meneton, Pierre; Uitterlinden, Andre G.; Wareham, Nicholas J.; Gudnason, Vilmundur; Rettig, Rainer; Uda, Manuela; Strachan, David P.; Witteman, Jacqueline C.M.; Hartikainen, Anna-Liisa; Beckmann, Jacques S.; Boerwinkle, Eric; Boehnke, Michael; Larson, Martin G.; Järvelin, Marjo-Riitta; Psaty, Bruce M.; Abecasis, Gonçalo R.; Elliott, Paul; van Duijn , Cornelia M.; Newton-Cheh, Christopher

    2011-01-01

    The prevalence of hypertension in African Americans (AAs) is higher than in other US groups; yet, few have performed genome-wide association studies (GWASs) in AA. Among people of European descent, GWASs have identified genetic variants at 13 loci that are associated with blood pressure. It is unknown if these variants confer susceptibility in people of African ancestry. Here, we examined genome-wide and candidate gene associations with systolic blood pressure (SBP) and diastolic blood pressure (DBP) using the Candidate Gene Association Resource (CARe) consortium consisting of 8591 AAs. Genotypes included genome-wide single-nucleotide polymorphism (SNP) data utilizing the Affymetrix 6.0 array with imputation to 2.5 million HapMap SNPs and candidate gene SNP data utilizing a 50K cardiovascular gene-centric array (ITMAT-Broad-CARe [IBC] array). For Affymetrix data, the strongest signal for DBP was rs10474346 (P= 3.6 × 10−8) located near GPR98 and ARRDC3. For SBP, the strongest signal was rs2258119 in C21orf91 (P= 4.7 × 10−8). The top IBC association for SBP was rs2012318 (P= 6.4 × 10−6) near SLC25A42 and for DBP was rs2523586 (P= 1.3 × 10−6) near HLA-B. None of the top variants replicated in additional AA (n = 11 882) or European-American (n = 69 899) cohorts. We replicated previously reported European-American blood pressure SNPs in our AA samples (SH2B3, P= 0.009; TBX3-TBX5, P= 0.03; and CSK-ULK3, P= 0.0004). These genetic loci represent the best evidence of genetic influences on SBP and DBP in AAs to date. More broadly, this work supports that notion that blood pressure among AAs is a trait with genetic underpinnings but also with significant complexity. PMID:21378095

  17. Molecular anthropology meets genetic medicine to treat blindness in the North African Jewish population: human gene therapy initiated in Israel.

    PubMed

    Banin, Eyal; Bandah-Rozenfeld, Dikla; Obolensky, Alexey; Cideciyan, Artur V; Aleman, Tomas S; Marks-Ohana, Devora; Sela, Malka; Boye, Sanford; Sumaroka, Alexander; Roman, Alejandro J; Schwartz, Sharon B; Hauswirth, William W; Jacobson, Samuel G; Hemo, Itzhak; Sharon, Dror

    2010-12-01

    The history of the North African Jewish community is ancient and complicated with a number of immigration waves and persecutions dramatically affecting its population size. A decade-long process in Israel of clinical-molecular screening of North African Jews with incurable autosomal recessive blindness led to the identification of a homozygous splicing mutation (c.95-2A > T; IVS2-2A > T) in RPE65, the gene encoding the isomerase that catalyzes a key step in the retinoid-visual cycle, in patients from 10 unrelated families. A total of 33 patients (four now deceased) had the severe childhood blindness known as Leber congenital amaurosis (LCA), making it the most common cause of retinal degeneration in this population. Haplotype analysis in seven of the patients revealed a shared homozygous region, indicating a population-specific founder mutation. The age of the RPE65 founder mutation was estimated to have emerged 100-230 (mean, 153) generations ago, suggesting it originated before the establishment of the Jewish community in North Africa. Individuals with this RPE65 mutation were characterized with retinal studies to determine if they were candidates for gene replacement, the recent and only therapy to date for this otherwise incurable blindness. The step from molecular anthropological studies to application of genetic medicine was then taken, and a representative of this patient subgroup was treated with subretinal rAAV2-RPE65 gene therapy. An increase in vision was present in the treated area as early as 15 days after the intervention. This process of genetically analyzing affected isolated populations as a screen for gene-based therapy suggests a new paradigm for disease diagnosis and treatment.

  18. Gene polymorphisms and gene scores linked to low serum carotenoid status and their associations with metabolic disturbance and depressive symptoms in African-American adults

    PubMed Central

    Beydoun, May A.; Nalls, Michael A.; Canas, J. Atilio; Evans, Michele K.; Zonderman, Alan B.

    2016-01-01

    Gene polymorphisms provide means to obtain unconfounded associations between carotenoids and various health outcomes. We tested whether gene polymophorisms and gene scores linked to serum carotenoid status are related to metabolic disturbance and depressive symptoms in African-American adults residing in Baltimore city, MD, using cross-sectional data from the Healthy Aging in Neighborhood of Diversity Across the Lifespan (HANDLS) study (Age range:30–64y, N=873–994). We examined 24 single nucleotide polymorphisms of various gene loci that were previously shown to be associated with low serum carotenoid status (SNPlcar). Genetic risk scores (5 low specific-carotenoid risk scores (LSCRS: α-carotene, β-carotene, lutein+zeaxanthin, β-cryptoxanthin, lycopene) and 1 low total-carotenoid risk score (LTCRS: total carotenoids)) were created. SNPlcar, LSCRS and LTCRS were entered as predictors for a number of health outcomes. Those included obesity, National Cholesterol Education Program (NCEP) Adult Treatment Panel (ATP) III metabolic syndrome (MetS) and its components, elevated homeostatic model assessment, Insulin Resistance (HOMA-IR), C-reactive protein (CRP), hyperuricemia and elevated depressive symptoms (EDS, Center for Epidemiologic Studies-Depression (CES-D) score≥16). Among key findings, SNPlcar were not associated with the main outcomes after correction for multiple testing. However, an inverse association was found between LTCRS and HDL-C dyslipidemia. Specifically, the α-carotene and β-cryptoxanthin LSCRS were associated with lower odds of HDL-C dyslipidemia. However, the β-cryptoxanthin LSCRS was linked to a higher odds of EDS, with a linear dose-response relationship. In sum, gene risk scores linked to low serum carotenoids had mixed effects on HDL-C dyslipidemia and EDS. Further studies using larger African-American samples are needed. PMID:25201307

  19. Androgen receptor and prostate-specific antigen gene polymorphisms and breast cancer in African-American women.

    PubMed

    Wang, Wei; John, Esther M; Ingles, Sue Ann

    2005-12-01

    Several previous studies have found the CAG repeat polymorphism in exon 1 of the androgen receptor (AR) gene to be associated with breast cancer risk among some groups of Caucasian and Asian women. In a population-based case-control study of 488 African-American women (239 cases and 249 controls), we examined this polymorphism along with a polymorphism (-158 G/A) in an androgen-regulated gene (PSA) whose expression has been correlated with breast cancer prognosis. Overall, we did not observe any significant association between the CAG repeat polymorphism and breast cancer risk. However, among women with a first-degree family history of breast cancer, longer CAG repeats were associated with a significantly increased risk. Women carrying at least one longer allele [(CAG)n > or = 22] had a 3-fold increased risk compared to those with two shorter alleles (odds ratio, 3.18; 95% confidence interval, 1.08-9.36). There was no significant association between the PSA gene polymorphism and breast cancer risk, nor was there significant gene-gene interaction. In summary, our results further support that shorter CAG repeats (stronger AR transactivation activity) may reduce the risk of breast cancer, at least among some groups of women. Our data, however, are unable to provide evidence that PSA is the pathway through which the protective effect of androgens operates.

  20. Genetic screening of Alzheimer's disease genes in Iberian and African samples yields novel mutations in presenilins and APP.

    PubMed

    Guerreiro, Rita Joao; Baquero, Miquel; Blesa, Rafael; Boada, Mercè; Brás, Jose Miguel; Bullido, Maria J; Calado, Ana; Crook, Richard; Ferreira, Carla; Frank, Ana; Gómez-Isla, Teresa; Hernández, Isabel; Lleó, Alberto; Machado, Alvaro; Martínez-Lage, Pablo; Masdeu, José; Molina-Porcel, Laura; Molinuevo, José L; Pastor, Pau; Pérez-Tur, Jordi; Relvas, Rute; Oliveira, Catarina Resende; Ribeiro, Maria Helena; Rogaeva, Ekaterina; Sa, Alfredo; Samaranch, Lluís; Sánchez-Valle, Raquel; Santana, Isabel; Tàrraga, Lluís; Valdivieso, Fernando; Singleton, Andrew; Hardy, John; Clarimón, Jordi

    2010-05-01

    Mutations in three genes (PSEN1, PSEN2, and APP) have been identified in patients with early-onset (<65 years) Alzheimer's disease (AD). We performed a screening for mutations in the coding regions of presenilins, as well as exons 16 and 17 of the APP gene in a total of 231 patients from the Iberian peninsular with a clinical diagnosis of early-onset AD (mean age at onset of 52.9 years; range 31-64). We found three novel mutations in PSEN1, one novel mutation in PSEN2, and a novel mutation in the APP gene. Four previously described mutations in PSEN1 were also found. The same analysis was carried in 121 elderly healthy controls from the Iberian peninsular, and a set of 130 individuals from seven African populations belonging to the Centre d'Etude du Polymorphisme Humain-Human Genome Diversity Panel (CEPH-HGDP), in order to determine the extent of normal variability in these genes. Interestingly, in the latter series, we found five new non-synonymous changes in all three genes and a presenilin 2 variant (R62H) that has been previously related to AD. In some of these mutations, the pathologic consequence is uncertain and needs further investigation. To address this question we propose and use a systematic algorithm to classify the putative pathology of AD mutations.

  1. Genetic diversity of the black gram [Vigna mungo (L.) Hepper] gene pool as revealed by SSR markers

    PubMed Central

    Kaewwongwal, Anochar; Kongjaimun, Alisa; Somta, Prakit; Chankaew, Sompong; Yimram, Tarikar; Srinives, Peerasak

    2015-01-01

    In this study, 520 cultivated and 14 wild accessions of black gram (Vigna mungo (L.) Hepper) were assessed for diversity using 22 SSR markers. Totally, 199 alleles were detected with a mean of 9.05 alleles per locus. Wild black gram showed higher gene diversity than cultivated black gram. Gene diversity of cultivated accessions among regions was comparable, while allelic richness of South Asia was higher than that of other regions. 78.67% of the wild gene diversity presented in cultivated accessions, indicating that the domestication bottleneck effect in black gram is relatively low. Genetic distance analysis revealed that cultivated black gram was more closely related to wild black gram from South Asia than that from Southeast Asia. STRUCTURE, principal coordinate and neighbor-joining analyses consistently revealed that 534 black gram accessions were grouped into three major subpopulations. The analyses also revealed that cultivated black gram from South Asia was genetically distinct from that from West Asia. Comparison by SSR analysis with other closely related Vigna species, including mungbean, azuki bean, and rice bean, revealed that level of gene diversity of black gram is comparable to that of mungbean and rice bean but lower than that of azuki bean. PMID:26069442

  2. Neotropical Africanized honey bees have African mitochondrial DNA.

    PubMed

    Smith, D R; Taylor, O R; Brown, W M

    1989-05-18

    Non-indigenous African honey bees have invaded most of South and Central America in just over 30 years. The genetic composition of this population and the means by which it rapidly colonizes new territory remain controversial. In particular, it has been unclear whether this 'Africanized' population has resulted from interbreeding between African and domestic European bees, or is an essentially pure African population. Also, it has not been known whether this population expanded primarily by female or by male migration. Restriction site mapping of 62 mitochondrial DNAs of African bees from Brazil, Venezuela and Mexico reveals that 97% were of African (Apis mellifera scutellata) type. Although neotropical European apiary populations are rapidly Africanized by mating with neotropical African males, there is little reciprocal gene flow to the neotropical African population through European females. These are the first genetic data to indicate that the neotropical African population could be expanding its range by female migration.

  3. Sex-biased gene flow in African Americans but not in American Caucasians.

    PubMed

    Gonçalves, V F; Prosdocimi, F; Santos, L S; Ortega, J M; Pena, S D J

    2007-05-09

    We have previously shown evidence of strong sex-biased genetic blending in the founding and ongoing history of the Brazilian population, with the African and Amerindian contribution being highest from maternal lineages (as measured by mitochondrial DNA) and the European contribution foremost from paternal lineages (estimated from Y-chromosome haplogroups). The same phenomenon has been observed in several other Latin American countries, suggesting that it might constitute a universal characteristic of the Iberian colonization of the Americas. However, it has also recently been detected in the Black population of the United States. We thus wondered if the same could be observed in American Caucasians. To answer that question, we retrieved 1387 hypervariable I Caucasian mitochondrial DNA sequences from the FBI population database and established their haplogroups and continental geographical sources. In sharp contrast with the situation of the Caucasian population of Latin American countries, only 3.1% of the American Caucasian sequences had African and/or Amerindian origin. To explain this discrepancy we propose that the finding of elevated genomic contributions from European males and Amerindian or African females depends not only on the occurrence of directional mating, but also on the "racial" categorization of the children born from these relations. In this respect, social practices in Latin America and in the United States diverge considerably; in the former socially significant "races" are normally designated according to physical appearance, while in the latter descent appears to be the most important factor.

  4. Effect of N-fertilization, plant genotype and environmental conditions on nifH gene pools in roots of rice.

    PubMed

    Tan, Zhiyuan; Hurek, Thomas; Reinhold-Hurek, Barbara

    2003-10-01

    Terminal restriction fragment length polymorphism (T-RFLP) analysis of PCR-amplified nitrogenase gene (nifH) fragments is a rapid technique for profiling of diazotrophic microbial communities without the necessity of cultures for study. Here, we examined the impact of N-fertilization, plant genotype and environmental conditions on diazotrophic microbial populations in association with roots of rice (Oryza species) by T-RFLP community profiling and found marked effects on the composition of the microbial community. We found a rapid change of the diazotrophic population structure within 15 days after application of nitrogen fertilizer and a strong effect of environmental conditions and plant genotype. Control experiments revealed that phylogenetically distantly related nifH genes were proportionately amplified, and that signal strength reflected the relative abundance of nifH genes in the sample within a 10-fold range of template concentrations. These results clearly demonstrated that our T-RFLP method was suitable to reflect compositional differences in the diazotrophic community in a semiquantitative manner and that the diazotrophic rhizosphere communities of rice are not static but presumably rather highly dynamic.

  5. Novel 180- and 480-base-pair insertions in African and African-American strains of Helicobacter pylori.

    PubMed

    McNulty, Shannon L; Mole, Beth M; Dailidiene, Daiva; Segal, Issy; Ally, Reid; Mistry, Rajesh; Secka, Ousman; Adegbola, Richard A; Thomas, Julian E; Lenarcic, Erik M; Peek, Richard M; Berg, Douglas E; Forsyth, Mark H

    2004-12-01

    Helicobacter pylori is a genetically diverse bacterial species that chronically infects human stomachs and sometimes causes severe gastroduodenal disease. Studies of polymorphic DNA sequences can suggest geographic origins of individual strains. Here, we describe a 180-bp insertion (ins180), which is just after the translation stop of a gene of unknown function, near the promoter of jhp0152-jhp0151 two-component signal transduction genes in strain J99, and absent from this site in strain 26695. This ins180 insertion was found in 9 of 9 Gambian (West African), 9 of 20 (45%) South African, and 9 of 40 (23%) Spanish strains but in only 2 of 20 (10%) North American strains and none of 20 Lithuanian, 20 Indian, and 20 Japanese strains. Four South African isolates that lacked ins180 and that belonged to an unusual outlier group contained a 480-bp insertion at this site (ins480), whereas none of 181 other strains screened contained ins480. In further tests 56% (10 of 18) of strains from African Americans but only 17% (3 of 18) of strains from Caucasian Americans carried ins180 (P < 0.05). Thus, the H. pylori strains of modern African Americans seem to retain traces of African roots, despite the multiple generations since their ancestors were taken from West Africa. Fragmentary ins180-like sequences were found at numerous sites in H. pylori genomes, always between genes. Such sequences might affect regulation of transcription and could facilitate genome rearrangement by homologous recombination. Apparent differences between African-American and Caucasian-American H. pylori gene pools may bear on our understanding of H. pylori transmission and disease outcome.

  6. Five novel missense mutations of the Lewis gene (FUT3) in African (Xhosa) and Caucasian populations in South Africa.

    PubMed

    Pang, H; Liu, Y; Koda, Y; Soejima, M; Jia, J; Schlaphoff, T; Du Toit, E D; Kimura, H

    1998-06-01

    Five novel missense mutations, viz., C304 A, T370 G, G484 A, G667 A, and G808 A, in the Lewis gene (FUT3) were detected in African (Xhosa) and Caucasian individuals in South Africa. These single base substitutions may result in changes in amino acid residues from Gln102 to Lys in the 304 mutation, Ser124 to Ala in the 370 mutation, Asp162 to Asn in the 484 mutation, Gly223 to Arg in the 667 mutation, and Val270 to Met in the 808 mutation. Out of the five novel mutations identified in this investigation, four new alleles (le484,667, le484,667,808, Le304, and Le370) were determined in the Xhosa population and two new alleles (le202,314,484 and Le304) in the Caucasian population. The determination of alpha(1,3/1,4)fucosyltransferase activity, after transfection of plasmids containing the new alleles into COS7 cells, suggested that alleles le484,667 and le484,667,808 encoded an inactive enzyme, and that alleles Le304 and Le370 encoded a functional enzyme. In addition, we also examined the incidence of five common alleles, Le59, le59,508 le59,1067, le202,314, and le1067 in two populations by the polymerase chain reaction/restriction fragment length polymorphism method and compared differences in the allele frequencies of FUT3 among three ethnic groups (Orientals, Africans, and Caucasians).

  7. An African-specific polymorphism in the TP53 gene impairs p53 tumor suppressor function in a mouse model.

    PubMed

    Jennis, Matthew; Kung, Che-Pei; Basu, Subhasree; Budina-Kolomets, Anna; Leu, Julia I-Ju; Khaku, Sakina; Scott, Jeremy P; Cai, Kathy Q; Campbell, Michelle R; Porter, Devin K; Wang, Xuting; Bell, Douglas A; Li, Xiaoxian; Garlick, David S; Liu, Qin; Hollstein, Monica; George, Donna L; Murphy, Maureen E

    2016-04-15

    A nonsynonymous single-nucleotide polymorphism at codon 47 in TP53 exists in African-descent populations (P47S, rs1800371; referred to here as S47). Here we report that, in human cell lines and a mouse model, the S47 variant exhibits a modest decrease in apoptosis in response to most genotoxic stresses compared with wild-type p53 but exhibits a significant defect in cell death induced by cisplatin. We show that, compared with wild-type p53, S47 has nearly indistinguishable transcriptional function but shows impaired ability to transactivate a subset of p53 target genes, including two involved in metabolism:Gls2(glutaminase 2) and Sco2 We also show that human and mouse cells expressing the S47 variant are markedly resistant to cell death by agents that induce ferroptosis (iron-mediated nonapoptotic cell death). We show that mice expressing S47 in homozygous or heterozygous form are susceptible to spontaneous cancers of diverse histological types. Our data suggest that the S47 variant may contribute to increased cancer risk in individuals of African descent, and our findings highlight the need to assess the contribution of this variant to cancer risk in these populations. These data also confirm the potential relevance of metabolism and ferroptosis to tumor suppression by p53.

  8. Harnessing microbial gene pools to remediate persistent organic pollutants using genetically modified plants--a viable technology?

    PubMed

    Rylott, Elizabeth L; Johnston, Emily J; Bruce, Neil C

    2015-11-01

    It has been 14 years since the international community came together to legislate the Stockholm Convention on Persistent Organic Pollutants (POPs), restricting the production and use of specific chemicals that were found to be environmentally stable, often bioaccumulating, with long-term toxic effects. Efforts are continuing to remove these pollutants from the environment. While incineration and chemical treatment can be successful, these methods require the removal of tonnes of soil, at high cost, and are damaging to soil structure and microbial communities. The engineering of plants for in situ POP remediation has had highly promising results, and could be a more environmentally-friendly alternative. This review discusses the characterization of POP-degrading bacterial pathways, and how the genes responsible have been harnessed using genetic modification (GM) to introduce these same abilities into plants. Recent advances in multi-gene cloning, genome editing technologies and expression in monocot species are accelerating progress with remediation-applicable species. Examples include plants developed to degrade 2,4,6-trinitrotoluene (TNT), hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX), trichloroethylene (TCE), and polychlorinated biphenyls (PCBs). However, the costs and timescales needed to gain regulatory approval, along with continued public opposition, are considerable. The benefits and challenges in this rapidly developing and promising field are discussed.

  9. MC1R gene variants and non-melanoma skin cancer: a pooled-analysis from the M-SKIP project

    PubMed Central

    Tagliabue, E; Fargnoli, M C; Gandini, S; Maisonneuve, P; Liu, F; Kayser, M; Nijsten, T; Han, J; Kumar, R; Gruis, N A; Ferrucci, L; Branicki, W; Dwyer, T; Blizzard, L; Helsing, P; Autier, P; García-Borrón, J C; Kanetsky, P A; Landi, M T; Little, J; Newton-Bishop, J; Sera, F; Raimondi, S

    2015-01-01

    Background: The melanocortin-1-receptor (MC1R) gene regulates human pigmentation and is highly polymorphic in populations of European origins. The aims of this study were to evaluate the association between MC1R variants and the risk of non-melanoma skin cancer (NMSC), and to investigate whether risk estimates differed by phenotypic characteristics. Methods: Data on 3527 NMSC cases and 9391 controls were gathered through the M-SKIP Project, an international pooled-analysis on MC1R, skin cancer and phenotypic characteristics. We calculated summary odds ratios (SOR) with random-effect models, and performed stratified analyses. Results: Subjects carrying at least one MC1R variant had an increased risk of NMSC overall, basal cell carcinoma (BCC) and squamous cell carcinoma (SCC): SOR (95%CI) were 1.48 (1.24–1.76), 1.39 (1.15–1.69) and 1.61 (1.35–1.91), respectively. All of the investigated variants showed positive associations with NMSC, with consistent significant results obtained for V60L, D84E, V92M, R151C, R160W, R163Q and D294H: SOR (95%CI) ranged from 1.42 (1.19–1.70) for V60L to 2.66 (1.06–6.65) for D84E variant. In stratified analysis, there was no consistent pattern of association between MC1R and NMSC by skin type, but we consistently observed higher SORs for subjects without red hair. Conclusions: Our pooled-analysis highlighted a role of MC1R variants in NMSC development and suggested an effect modification by red hair colour phenotype. PMID:26103569

  10. The Ep152R ORF of African Swine Fever Virus strain Georgia encodes for an essential gene that interacts with host protein BAG6

    Technology Transfer Automated Retrieval System (TEKTRAN)

    African swine fever virus (ASFV) is the etiological agent of a contagious and often lethal disease of domestic pigs that has significant economic consequences for the swine industry. The viral genome encodes for more than 150 genes, and only a select few have been studied in some detail. Here we rep...

  11. Linkage disequilibrium analysis reveals an albuminuria risk haplotype containing three missense mutations in the cubilin gene with striking differences among European and African ancestry populations

    PubMed Central

    2012-01-01

    Background A recent meta-analysis described a variant (p.Ile2984Val) in the cubilin gene (CUBN) that is associated with levels of albuminuria in the general population and in diabetics. Methods We implemented a Linkage Disequilibrium (LD) search with data from the 1000 Genomes Project, on African and European population genomic sequences. Results We found that the p.Ile2984Val variation is part of a larger haplotype in European populations and it is almost absent in west Africans. This haplotype contains 19 single nucleotide polymorphisms (SNPs) in very high LD, three of which are missense mutations (p.Leu2153Phe, p.Ile2984Val, p.Glu3002Gly), and two have not been previously reported. Notably, this European haplotype is absent in west African populations, and the frequency of each individual polymorphism differs significantly in Africans. Conclusions Genotyping of these variants in existing African origin sample sets coupled to measurements of urine albumin excretion levels should reveal which is the most likely functional candidate for albuminuria risk. The unique haplotypic structure of CUBN in different populations may leverage the effort to identify the functional variant and to shed light on evolution of the CUBN gene locus. PMID:23114252

  12. Shallow gene pools in the high intertidal: extreme loss of genetic diversity in viviparous sea stars (Parvulastra)

    PubMed Central

    Keever, Carson C.; Puritz, Jonathan B.; Addison, Jason A.; Byrne, Maria; Grosberg, Richard K.; Toonen, Robert J.; Hart, Michael W.

    2013-01-01

    We document an extreme example of reproductive trait evolution that affects population genetic structure in sister species of Parvulastra cushion stars from Australia. Self-fertilization by hermaphroditic adults and brood protection of benthic larvae causes strong inbreeding and range-wide genetic poverty. Most samples were fixed for a single allele at nearly all nuclear loci; heterozygotes were extremely rare (0.18%); mitochondrial DNA sequences were more variable, but few populations shared haplotypes in common. Isolation-with-migration models suggest that these patterns are caused by population bottlenecks (relative to ancestral population size) and low gene flow. Loss of genetic diversity and low potential for dispersal between high-intertidal habitats may have dire consequences for extinction risk and potential for future adaptive evolution in response to climate and other selective agents. PMID:23925835

  13. Shallow gene pools in the high intertidal: extreme loss of genetic diversity in viviparous sea stars (Parvulastra).

    PubMed

    Keever, Carson C; Puritz, Jonathan B; Addison, Jason A; Byrne, Maria; Grosberg, Richard K; Toonen, Robert J; Hart, Michael W

    2013-10-23

    We document an extreme example of reproductive trait evolution that affects population genetic structure in sister species of Parvulastra cushion stars from Australia. Self-fertilization by hermaphroditic adults and brood protection of benthic larvae causes strong inbreeding and range-wide genetic poverty. Most samples were fixed for a single allele at nearly all nuclear loci; heterozygotes were extremely rare (0.18%); mitochondrial DNA sequences were more variable, but few populations shared haplotypes in common. Isolation-with-migration models suggest that these patterns are caused by population bottlenecks (relative to ancestral population size) and low gene flow. Loss of genetic diversity and low potential for dispersal between high-intertidal habitats may have dire consequences for extinction risk and potential for future adaptive evolution in response to climate and other selective agents.

  14. Evaluation of Candidate Nephropathy Susceptibility Genes in a Genome-Wide Association Study of African American Diabetic Kidney Disease

    PubMed Central

    Palmer, Nicholette D.; Ng, Maggie C. Y.; Hicks, Pamela J.; Mudgal, Poorva; Langefeld, Carl D.; Freedman, Barry I.; Bowden, Donald W.

    2014-01-01

    Type 2 diabetes (T2D)-associated end-stage kidney disease (ESKD) is a complex disorder resulting from the combined influence of genetic and environmental factors. This study contains a comprehensive genetic analysis of putative nephropathy loci in 965 African American (AA) cases with T2D-ESKD and 1029 AA population-based controls extending prior findings. Analysis was based on 4,341 directly genotyped and imputed single nucleotide polymorphisms (SNPs) in 22 nephropathy candidate genes. After admixture adjustment and correction for multiple comparisons, 37 SNPs across eight loci were significantly associated (1.6E-05genes is shared across populations of African and European ancestry. PMID:24551085

  15. Regulatory variant in FZD6 gene contributes to nonsyndromic cleft lip and palate in an African-American family

    PubMed Central

    Cvjetkovic, Nevena; Maili, Lorena; Weymouth, Katelyn S; Hashmi, S Shahrukh; Mulliken, John B; Topczewski, Jacek; Letra, Ariadne; Yuan, Qiuping; Blanton, Susan H; Swindell, Eric C; Hecht, Jacqueline T

    2015-01-01

    Nonsyndromic cleft lip with or without cleft palate (NSCLP) is a common birth defect affecting 135,000 newborns worldwide each year. While a multifactorial etiology has been suggested as the cause, despite decades of research, the genetic underpinnings of NSCLP remain largely unexplained. In our previous genome-wide linkage study of a large NSCLP African-American family, we identified a candidate locus at 8q21.3-24.12 (LOD = 2.98). This region contained four genes, Frizzled-6 (FZD6), Matrilin-2 (MATN2), Odd-skipped related 2 (OSR2) and Solute Carrier Family 25, Member 32 (SLC25A32). FZD6 was located under the maximum linkage peak. In this study, we sequenced the coding and noncoding regions of these genes in two affected family members, and identified a rare variant in intron 1 of FZD6 (rs138557689; c.-153 + 432A>C). The variant C allele segregated with NSCLP in this family, through affected and unaffected individuals, and was found in one other NSCLP African-American family. Functional assays showed that this allele creates an allele-specific protein-binding site and decreases promoter activity. We also observed that loss and gain of fzd6 in zebrafish contributes to craniofacial anomalies. FZD6 regulates the WNT signaling pathway, which is involved in craniofacial development, including midfacial formation and upper labial fusion. We hypothesize, therefore, that alteration in FZD6 expression contributes to NSCLP in this family by perturbing the WNT signaling pathway. PMID:26436110

  16. Deletion of the thymidine kinase gene induces complete attenuation of the Georgia isolate of African swine fever virus.

    PubMed

    Sanford, B; Holinka, L G; O'Donnell, V; Krug, P W; Carlson, J; Alfano, M; Carrillo, C; Wu, Ping; Lowe, Andre; Risatti, G R; Gladue, D P; Borca, M V

    2016-02-02

    African swine fever virus (ASFV) is the etiological agent of a contagious and often lethal viral disease of domestic pigs. There are no vaccines to control Africa swine fever (ASF). Experimental vaccines have been developed using genetically modified live attenuated ASFVs obtained by specifically deleting virus genes involved in virulence, including the thymidine kinase (TK) gene. TK has been shown to be involved in the virulence of several viruses, including ASFV. Here we report the construction of a recombinant virus (ASFV-G/V-ΔTK) obtained by deleting the TK gene in a virulent strain of ASFV Georgia adapted to replicate in Vero cells (ASFV-G/VP30). ASFV-G/P-ΔTK demonstrated decreased replication both in primary swine macrophage cell cultures and in Vero cells compared with ASFV-G/VP30. In vivo, intramuscular administration of up to 10(6) TCID50 of ASFV-G/V-ΔTK does not result in ASF disease. However, these animals are not protected when challenged with the virulent parental Georgia strain.

  17. Analysis of a donor gene region for a variant surface glycoprotein and its expression site in African trypanosomes.

    PubMed

    LaCount, D J; El-Sayed, N M; Kaul, S; Wanless, D; Turner, C M; Donelson, J E

    2001-05-15

    African trypanosomes evade the immune response of their mammalian hosts by sequentially expressing genes for different variant surface glycoproteins (VSGs) from telomere-linked VSG expression sites. In the Trypanosoma brucei clone whose genome is being sequenced (GUTat 10.1), we show that the expressed VSG (VSG 10.1) is duplicated from a silent donor VSG located at another telomere-linked site. We have determined two 130 kb sequences representing the VSG 10.1 donor and expression sites. The telomere-linked donor VSG 10.1 resembles metacyclic VSG expression sites, and is preceded by a cluster of 35 or more tandem housekeeping genes, all of which are transcribed away from the telomere. The 45 kb telomere-linked VSG 10.1 expression site contains a promoter followed by seven expression site-associated genes (ESAGs), three pseudo ESAGs, two pseudo VSGs and VSG 10.1. The 80 kb preceding the expression site has few, if any, functional ORFs, but contains 50 bp repeats, INGI retrotransposon-like elements, and novel 4-12 kb repeats found near other telomeres. This analysis provides the first look over a 130 kb range of a telomere-linked donor VSG and its corresponding telomere-linked VSG expression site and forms the basis for studies on antigenic variation in the context of a completely sequenced genome.

  18. Genetic structure and diversity among sheep breeds in the United States: identification of the major gene pools.

    PubMed

    Blackburn, H D; Paiva, S R; Wildeus, S; Getz, W; Waldron, D; Stobart, R; Bixby, D; Purdy, P H; Welsh, C; Spiller, S; Brown, M

    2011-08-01

    Understanding existing levels of genetic diversity of sheep breeds facilitates in situ and ex situ conservation activities. A comprehensive evaluation of US sheep breeds has not been previously performed; therefore, we evaluated the genetic diversity among and within 28 US sheep breeds. Both major and minor breeds were included in the analysis and consisted of 666 animals from 222 producers located in 38 states. The level of within-breed genetic diversity was variable and not dependent upon status of a breed as a major or minor breed. Bayesian cluster analysis indicated the breeds were grouped more by physiological differences (meat vs. wool production) rather than geographic origin. Results suggest several actionable items to improve in situ and ex situ conservation. The results clearly identify breeds in need of increased in situ and ex situ management (e.g., Hog Island and Karakul) and allow several suggestions for in situ management of flocks. Conversely, several of the breeds appear genetically similar and therefore require less emphasis on collecting germplasm samples for the gene bank. Commercially important breeds (e.g., Rambouillet and Suffolk) were found to have substantial variation, which should enable breeders to proceed, unencumbered by genetic diversity concerns, with selection strategies that maximize profit.

  19. Expression and Sequence Evolution of Aromatase cyp19a1 and Other Sexual Development Genes in East African Cichlid Fishes

    PubMed Central

    Böhne, Astrid; Heule, Corina; Boileau, Nicolas; Salzburger, Walter

    2013-01-01

    Sex determination mechanisms are highly variable across teleost fishes and sexual development is often plastic. Nevertheless, downstream factors establishing the two sexes are presumably conserved. Here, we study sequence evolution and gene expression of core genes of sexual development in a prime model system in evolutionary biology, the East African cichlid fishes. Using the available five cichlid genomes, we test for signs of positive selection in 28 genes including duplicates from the teleost whole-genome duplication, and examine the expression of these candidate genes in three cichlid species. We then focus on a particularly striking case, the A- and B-copies of the aromatase cyp19a1, and detect different evolutionary trajectories: cyp19a1A evolved under strong positive selection, whereas cyp19a1B remained conserved at the protein level, yet is subject to regulatory changes at its transcription start sites. Importantly, we find shifts in gene expression in both copies. Cyp19a1 is considered the most conserved ovary-factor in vertebrates, and in all teleosts investigated so far, cyp19a1A and cyp19a1B are expressed in ovaries and the brain, respectively. This is not the case in cichlids, where we find new expression patterns in two derived lineages: the A-copy gained a novel testis-function in the Ectodine lineage, whereas the B-copy is overexpressed in the testis of the speciest-richest cichlid group, the Haplochromini. This suggests that even key factors of sexual development, including the sex steroid pathway, are not conserved in fish, supporting the idea that flexibility in sexual determination and differentiation may be a driving force of speciation. PMID:23883521

  20. Genetic evidence for larger African population size during recent human evolution.

    PubMed

    Relethford, J H; Jorde, L B

    1999-03-01

    Genetic evidence suggests that the long-term average effective size of sub-Saharan Africa is larger than other geographic regions. A method is described that allows estimation of relative long-term regional population sizes. This method is applied to 60 microsatellite DNA loci from a sample of 72 sub-Saharan Africans, 63 East Asians, and 120 Europeans. Average heterozygosity is significantly higher in the sub-Saharan African sample. Expected heterozygosity was computed for each region and locus using a population genetic model based on the null hypothesis of equal long-term population sizes. Average residual heterozygosity is significantly higher in the sub-Saharan African sample, indicating that African population size was larger than other regions during recent human evolution. The best fit of the model is with relative population weights of 0.73 for sub-Saharan Africa, 0.09 for East Asia, and 0.18 for Europe. These results are similar to those obtained using craniometric variation for these three geographic regions. These results, combined with inferences from other genetic studies, support a major role of Africa in the origin of modern humans. It is less clear, however, whether complete African replacement is the most appropriate model. An alternative is an African origin with non-African gene flow. While Africa is an important region in recent human evolution, it is not clear whether the gene pool of our species is completely out of Africa or predominately out of Africa.

  1. Tyrosinase-positive oculocutaneous albinism in Southern African blacks: P gene-associated haplotypes suggest a major mutation in the 5{prime} region of the gene

    SciTech Connect

    Ramsay, M.; Stevens, G.; Beukering, J. van

    1994-09-01

    Tyrosinase-positive oculocutaneous albinism (ty-pos OCA) occurs with a prevalence of 1 in 3900 among Southern African (SA) blacks. The major contributors to morbidity and mortality are skin cancer and decreased visual acuity. Two distinct phenotypes occur, namely individuals with ephelides (darkly pigmented patches) and those without. There is complete concordance with regard to ephelus status among siblings. The disorder is linked to markers on chromosome 15q11.2-q12, and no obligatory cross-overs were observed with polymophic markers at the human homolog, P, of the mouse pink eyed dilute gene, p. Contrary to what has been shown for Caucasoid ty-pos OCA, this condition shows locus homogeneity among SA blacks. The P gene is an excellent candidate for ty-pos OCA and mutations in this gene will confirm its role in causing the common form of albinism in SA. Numerous P gene mutations have been described in other populations. In an attempt to detect mutations, the P gene cDNA was used to search for structural rearrangements or polymorphisms. Six polymorphisms (plR10/Scal, 912/Xbal, 912/HincII, 912/TaqI, 1412/TaqI [two systems] and 1412/HindIII) were detected with subclones of the P cDNA and haplotypes were determined in each family. None were clearly associated with an albinism-related rearrangement. However, strong linkage disequilibrium was observed with alleles at loci toward the 5{prime} region of the gene ({triangle}=0.65, 0.57 and 0.80 for the three polymorphisms detected with the 912 subclone), suggesting a major ty-pos OCA mutation in this region. Haplotype analysis provides evidence for a major mutation associated with the same haplotype in individuals with ephelides (8/12 OCA chromosomes) and those without ephelides (24:30). The presence of other ty-pos OCA associated haplotypes indicates several other less common mutations.

  2. Gene-based analysis of the fibroblast growth factor receptor signaling pathway in relation to breast cancer in African American women: the AMBER consortium.

    PubMed

    Ruiz-Narváez, Edward A; Haddad, Stephen A; Lunetta, Kathryn L; Yao, Song; Bensen, Jeannette T; Sucheston-Campbell, Lara E; Hong, Chi-Chen; Haiman, Christopher A; Olshan, Andrew F; Ambrosone, Christine B; Palmer, Julie R

    2016-01-01

    We conducted gene-based analysis in 26 genes in the FGFR signaling pathway to identify genes carrying genetic variation affecting risk of breast cancer and the specific estrogen receptor (ER) subtypes. Tagging single-nucleotide polymorphisms (SNPs) for each gene were selected and genotyped on a customized Illumina Exome Array. Imputation was carried out using 1000 Genomes haplotypes. The analysis included 3237 SNPs in 3663 breast cancer cases (including 1983 ER-positive, and 1098 ER-negative) and 4687 controls from the African American Breast Cancer Epidemiology and Risk consortium, a collaborative project of four large studies of breast cancer in African American women (Carolina Breast Cancer Study, Black Women's Health Study, Women's Circle of Health Study, and Multiethnic Cohort). We used a multi-locus adaptive joint (AdaJoint) test to determine the association of each gene in the FGFR signaling pathway with overall breast cancer and ER subtypes. The FGF1 gene was significantly associated with risk of ER-negative breast cancer (P = 0.001). The FGFR2 gene was associated with risk of overall breast cancer (P = 0.002) and ER-positive breast cancer (P = 0.002). The FGF1 gene affects risk of ER-negative breast cancer in African American women. We confirmed the association of the FGFR2 gene with risk of overall and ER-positive breast cancer. These results highlight the importance of the FGFR signaling pathway in the pathogenesis of breast cancer, and suggest that different genes in the same pathway may be associated with different ER breast cancer subtypes.

  3. Gene-based analysis of the fibroblast growth factor receptor signaling pathway in relation to breast cancer in African American women: the AMBER consortium

    PubMed Central

    Ruiz-Narváez, Edward A.; Haddad, Stephen A.; Lunetta, Kathryn L.; Yao, Song; Bensen, Jeannette T.; Sucheston-Campbell, Lara E.; Hong, Chi-Chen; Haiman, Christopher A.; Olshan, Andrew F.; Ambrosone, Christine B.; Palmer, Julie R.

    2016-01-01

    Purpose We conducted gene-based analysis in 26 genes in the FGFR signaling pathway to identify genes carrying genetic variation affecting risk of breast cancer and the specific estrogen receptor (ER) subtypes. Methods Tagging single nucleotide polymorphisms (SNPs) for each gene were selected and genotyped on a customized Illumina Exome Array. Imputation was carried out using 1000 Genomes haplotypes. The analysis included 3,237 SNPs in 3,663 breast cancer cases (including 1,983 ER positive, and 1,098 ER-negative and 4,687 controls from the African American Breast Cancer Epidemiology and Risk consortium, a collaborative project of four large studies of breast cancer in African American women (Carolina Breast Cancer Study, Black Women's Health Study, Women's Circle of Health Study, and Multiethnic Cohort). We used a multi-locus adaptive joint (AdaJoint) test to determine the association of each gene in the FGFR signaling pathway with overall breast cancer and ER subtypes. Results The FGF1 gene was significantly associated with risk of ER negative breast cancer (P = 0.001). The FGFR2 gene was associated with risk of overall breast cancer (P = 0.002) and ER positive breast cancer (P = 0.002). Conclusions The FGF1 gene affects risk of ER negative breast cancer in African American women. We confirmed the association of the FGFR2 gene with risk of overall and ER positive breast cancer. These results highlight the importance of the FGFR signaling pathway in the pathogenesis of breast cancer, and suggest that different genes in the same pathway may be associated with different ER breast cancer subtypes. PMID:26743380

  4. Geographic population structure of the African malaria vector Anopheles gambiae suggests a role for the forest-savannah biome transition as a barrier to gene flow.

    PubMed

    Pinto, J; Egyir-Yawson, A; Vicente, Jl; Gomes, B; Santolamazza, F; Moreno, M; Charlwood, Jd; Simard, F; Elissa, N; Weetman, D; Donnelly, Mj; Caccone, A; Della Torre, A

    2013-09-01

    The primary Afrotropical malaria mosquito vector Anopheles gambiae sensu stricto has a complex population structure. In west Africa, this species is split into two molecular forms and displays local and regional variation in chromosomal arrangements and behaviors. To investigate patterns of macrogeographic population substructure, 25 An. gambiae samples from 12 African countries were genotyped at 13 microsatellite loci. This analysis detected the presence of additional population structuring, with the M-form being subdivided into distinct west, central, and southern African genetic clusters. These clusters are coincident with the central African rainforest belt and northern and southern savannah biomes, which suggests restrictions to gene flow associated with the transition between these biomes. By contrast, geographically patterned population substructure appears much weaker within the S-form.

  5. Geographic population structure of the African malaria vector Anopheles gambiae suggests a role for the forest-savannah biome transition as a barrier to gene flow

    PubMed Central

    Pinto, J; Egyir-Yawson, A; Vicente, JL; Gomes, B; Santolamazza, F; Moreno, M; Charlwood, JD; Simard, F; Elissa, N; Weetman, D; Donnelly, MJ; Caccone, A; della Torre, A

    2013-01-01

    The primary Afrotropical malaria mosquito vector Anopheles gambiae sensu stricto has a complex population structure. In west Africa, this species is split into two molecular forms and displays local and regional variation in chromosomal arrangements and behaviors. To investigate patterns of macrogeographic population substructure, 25 An. gambiae samples from 12 African countries were genotyped at 13 microsatellite loci. This analysis detected the presence of additional population structuring, with the M-form being subdivided into distinct west, central, and southern African genetic clusters. These clusters are coincident with the central African rainforest belt and northern and southern savannah biomes, which suggests restrictions to gene flow associated with the transition between these biomes. By contrast, geographically patterned population substructure appears much weaker within the S-form. PMID:24062800

  6. Absence of Factor V Leiden, thrombomodulin and prothrombin gene variants in Black South African women with pre-eclampsia and eclampsia.

    PubMed

    Hira, B; Pegoraro, R J; Rom, L; Moodley, J

    2003-03-01

    It has been suggested that gene aberrations may contribute to vascular endothelial dysfunction of pre-eclampsia in Caucasian and Japanese women. This study was undertaken to examine the association between pre-eclampsia in Black Zulu speaking South African women and the Factor 5 Leiden mutation. 100 patients with pre-eclampsia comprised the study group. The control group comprised 110 normotensive pregnant women of the same population group. Genotyping was performed to detect the G or A allele at residue 506 of the Factor V gene, and the C or T allele at residue 455 of the thrombomodulin gene. Our findings demonstrate that these particularly genetic loci are of little use in disease association studies for pre-eclampsia in homogenous Zulu speaking Africans.

  7. Ethnic group-related differences in CpG hypermethylation of the GSTP1 gene promoter among African-American, Caucasian and Asian patients with prostate cancer.

    PubMed

    Enokida, Hideki; Shiina, Hiroaki; Urakami, Shinji; Igawa, Mikio; Ogishima, Tatsuya; Pookot, Deepa; Li, Long-Cheng; Tabatabai, Z Laura; Kawahara, Motoshi; Nakagawa, Masayuki; Kane, Christopher J; Carroll, Peter R; Dahiya, Rajvir

    2005-08-20

    The incidence and mortality of prostate cancer (PC) is approximately 2-fold higher among African-Americans as compared to Caucasians and very low in Asian. We hypothesize that inactivation of GSTP1 genes through CpG methylation plays a role in the pathogenesis of PC, and its ability to serve as a diagnostic marker that differs among ethnic groups. GSTP1 promoter hypermethylation and its correlation with clinico-pathological findings were evaluated in 291 PC (Asian = 170; African-American = 44; Caucasian = 77) and 172 benign prostate hypertrophy samples (BPH) (Asian = 96; African-American = 38; Caucasian = 38) using methylation-specific PCR. In PC cells, 5-aza-dC treatment increased expression of GSTP1 mRNA transcripts. The methylation of all CpG sites was found in 191 of 291 PC (65.6%), but only in 34 of 139 BPH (24.5%). The GSTP1 hypermethylation was significantly higher in PC as compared to BPH in each ethnic group (p < 0.0001). Logistic regression analysis (PC vs. BPH) showed that African-Americans had a higher hazard ratio (HR) (13.361) compared to Caucasians (3.829) and Asian (8.603). Chi-square analysis showed correlation of GSTP1 hypermethylation with pathological findings (pT categories and higher Gleason sum) in Asian PC (p < 0.0001) but not in African-Americans and Caucasian PC. Our results suggest that GSTP1 hypermethylation is a sensitive biomarker in African-Americans as compared to that in Caucasians or Asian, and that it strongly influences tumor progression in Asian PC. Ours is the first study investigating GSTP1 methylation differences in PC among African-American, Caucasian and Asian.

  8. Epidemiology, ecology and gene pool of influenza A virus in Egypt: Will Egypt be the epicentre of the next influenza pandemic?

    PubMed Central

    Abdelwhab, EM; Abdel-Moneim, Ahmed S

    2015-01-01

    Outside Asia, Egypt is considered to be an influenza H5N1 epicentre and presents a far greater pandemic risk than other countries. The long-term endemicity of H5N1 and the recent emergence of H9N2 in poultry call attention to the need for unravelling the epidemiology, ecology and highly diverse gene pool of influenza A virus (IAV) in Egypt which is the aim of this review. Isolation of a considerable number of IAV subtypes from several avian and mammalian hosts was described. Co-infections of poultry with H5N1 and H9N2 and subclinical infections of pigs and humans with H1N1 and H5N1 may raise the potential for the reassortment of these viruses. Moreover, the adjustment of IAV genomes, particularly H5N1, to optimize their evolution toward efficient transmission in human is progressing in Egypt. Understanding the present situation of influenza viruses in Egypt will help in the control of the disease and can potentially prevent a possible pandemic. PMID:25635701

  9. Epidemiology, ecology and gene pool of influenza A virus in Egypt: will Egypt be the epicentre of the next influenza pandemic?

    PubMed

    Abdelwhab, E M; Abdel-Moneim, Ahmed S

    2015-01-01

    Outside Asia, Egypt is considered to be an influenza H5N1 epicentre and presents a far greater pandemic risk than other countries. The long-term endemicity of H5N1 and the recent emergence of H9N2 in poultry call attention to the need for unravelling the epidemiology, ecology and highly diverse gene pool of influenza A virus (IAV) in Egypt which is the aim of this review. Isolation of a considerable number of IAV subtypes from several avian and mammalian hosts was described. Co-infections of poultry with H5N1 and H9N2 and subclinical infections of pigs and humans with H1N1 and H5N1 may raise the potential for the reassortment of these viruses. Moreover, the adjustment of IAV genomes, particularly H5N1, to optimize their evolution toward efficient transmission in human is progressing in Egypt. Understanding the present situation of influenza viruses in Egypt will help in the control of the disease and can potentially prevent a possible pandemic.

  10. Validation and Interrogation of Differentially Expressed and Alternatively Spliced Genes in African-American Prostate Cancer

    DTIC Science & Technology

    2015-10-01

    RNA and annotated. In addition, we have developed SSOs to manipulate PIK3CD alternative splicing, to correct aberrant splicing leading to production...molecular mechanisms, differential gene expression, alternative RNA splicing, epigenetic alterations, clinical tumor aggressiveness 16. SECURITY...words): Prostate cancer, health disparities among racial groups, molecular mechanisms, differential gene expression, alternative RNA splicing

  11. Denitrification gene pools, transcription and kinetics of NO, N2O and N2 production as affected by soil pH.

    PubMed

    Liu, Binbin; Mørkved, Pål Tore; Frostegård, Asa; Bakken, Lars Reier

    2010-06-01

    The N(2)O : N(2) product ratio of denitrification is negatively correlated with soil pH, but the mechanisms involved are not clear. We compared soils from field experiments where the pH had been maintained at different levels (pH 4.0-8.0) by liming (> or = 20 years), and quantified functional gene pools (nirS, nirK and nosZ), their transcription and gas kinetics (NO, N(2)O and N(2)) of denitrification as induced by anoxic incubation with and without a carbon substrate (glutamate). Denitrification in unamended soil appeared to be based largely on the activation of a pre-existing denitrification proteome, because constant rates of N(2) and N(2)O production were observed, and the transcription of functional genes was below the detection level. In contrast, glutamate-amended soils showed sharp peaks in the transcripts of nirS and nosZ, increasing the rates of denitrification and pH-dependent transient accumulation of N(2)O. The results indicate that the high N(2)O : N(2) product ratio at low pH is a post-transcriptional phenomenon, because the transcription rate of nosZ relative to that of nirS was higher at pH 6.1 than at pH 8.0. The most plausible explanation is that the translation/assembly of N(2)O reductase is more sensitive to low pH than that of the other reductases involved in denitrification.

  12. In search of genetic markers for nonsyndromic deafness in Africa: a study in Cameroonians and Black South Africans with the GJB6 and GJA1 candidate genes.

    PubMed

    Bosch, Jason; Lebeko, Kamogelo; Nziale, Jean Jacques Noubiap; Dandara, Collet; Makubalo, Nomlindo; Wonkam, Ambroise

    2014-07-01

    Deafness is the most common sensory disability in the world and has a variety of causes. Globally, mutations in GJB2 have been shown to play a major role in nonsyndromic deafness, but this has not been seen in Africans. Two other connexin genes, GJB6 and GJA1, have been implicated in hearing loss but have seldom been investigated in African populations. We set out to investigate the role of genetic variation in GJB6 and GJA1 in a group of Cameroonian and South African Blacks with nonsyndromic recessive hearing loss. A subset of 100 patients, affected with nonsyndromic hearing loss, from a cohort that was previously shown not to have GJB2 mutation, was analyzed by Sanger sequencing of the entire coding regions of GJB6 and GJA1. In addition, the large-scale GJB6-D3S1830 deletion was also investigated. No pathogenic mutation was detected in either GJB6 or GJA1, nor was the GJB6-D3S1830 deletion detected. There were no statistically significant differences in sequence variants between patients and controls. Mutations in GJB6 and GJA1 are not a major cause of nonsyndromic deafness in this group of Africans from Cameroon and South Africa. Currently, there is no sufficient evidence to support their testing in a clinical setting for individuals of African ancestry.

  13. Gene-specific DNA methylation association with serum levels of C-reactive protein in African Americans.

    PubMed

    Sun, Yan V; Lazarus, Alicia; Smith, Jennifer A; Chuang, Yu-Hsuan; Zhao, Wei; Turner, Stephen T; Kardia, Sharon L R

    2013-01-01

    A more thorough understanding of the differences in DNA methylation (DNAm) profiles in populations may hold promise for identifying molecular mechanisms through which genetic and environmental factors jointly contribute to human diseases. Inflammation is a key molecular mechanism underlying several chronic diseases including cardiovascular disease, and it affects DNAm profile on both global and locus-specific levels. To understand the impact of inflammation on the DNAm of the human genome, we investigated DNAm profiles of peripheral blood leukocytes from 966 African American participants in the Genetic Epidemiology Network of Arteriopathy (GENOA) study. By testing the association of DNAm sites on CpG islands of over 14,000 genes with C-reactive protein (CRP), an inflammatory biomarker of cardiovascular disease, we identified 257 DNAm sites in 240 genes significantly associated with serum levels of CRP adjusted for age, sex, body mass index and smoking status, and corrected for multiple testing. Of the significantly associated DNAm sites, 80.5% were hypomethylated with higher CRP levels. The most significant Gene Ontology terms enriched in the genes associated with the CRP levels were immune system process, immune response, defense response, response to stimulus, and response to stress, which are all linked to the functions of leukocytes. While the CRP-associated DNAm may be cell-type specific, understanding the DNAm association with CRP in peripheral blood leukocytes of multi-ethnic populations can assist in unveiling the molecular mechanism of how the process of inflammation affects the risks of developing common disease through epigenetic modifications.

  14. Allele mining in the gene pool of wild Solanum species for homologues of late blight resistance gene RB/Rpi-blb1

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Solanum bulbocastanum comprising a CC-NBS-LRR gene RB/Rpi-blb1 confers broad-spectrum resistance to Phytophthora infestans and is currently employed in potato breeding for durable late blight (LB) resistance. Genomes of several Solanum species were reported to contain RB homologues with confirmed b...

  15. Urotensin II upregulates migration and cytokine gene expression in leukocytes of the African clawed frog, Xenopus laevis.

    PubMed

    Tomiyama, Shiori; Nakamachi, Tomoya; Uchiyama, Minoru; Matsuda, Kouhei; Konno, Norifumi

    2015-05-15

    Urotensin II (UII) exhibits diverse physiological actions including vasoconstriction, locomotor activity, osmoregulation, and immune response via the UII receptor (UTR) in mammals. However, in amphibians the function of the UII-UTR system remains unknown. In the present study, we investigated the potential immune function of UII using leukocytes isolated from the African clawed frog, Xenopus laevis. Stimulation of male frogs with lipopolysaccharide increased mRNA expression of UII and UTR in leukocytes, suggesting that inflammatory stimuli induce activation of the UII-UTR system. Migration assays showed that both UII and UII-related peptide enhanced migration of leukocytes in a dose-dependent manner, and that UII effect was inhibited by the UTR antagonist urantide. Inhibition of Rho kinase with Y-27632 abolished UII-induced migration, suggesting that it depends on the activation of RhoA/Rho kinase. Treatment of isolated leukocytes with UII increased the expression of several cytokine genes including tumor necrosis factor-α, interleukin-1β, and macrophage migration inhibitory factor, and the effects were abolished by urantide. These results suggest that in amphibian leukocytes the UII-UTR system is involved in the activation of leukocyte migration and cytokine gene expression in response to inflammatory stimuli.

  16. Whole-genome sequence analyses of Western Central African Pygmy hunter-gatherers reveal a complex demographic history and identify candidate genes under positive natural selection

    PubMed Central

    Hsieh, PingHsun; Veeramah, Krishna R.; Lachance, Joseph; Tishkoff, Sarah A.; Wall, Jeffrey D.; Hammer, Michael F.; Gutenkunst, Ryan N.

    2016-01-01

    African Pygmies practicing a mobile hunter-gatherer lifestyle are phenotypically and genetically diverged from other anatomically modern humans, and they likely experienced strong selective pressures due to their unique lifestyle in the Central African rainforest. To identify genomic targets of adaptation, we sequenced the genomes of four Biaka Pygmies from the Central African Republic and jointly analyzed these data with the genome sequences of three Baka Pygmies from Cameroon and nine Yoruba famers. To account for the complex demographic history of these populations that includes both isolation and gene flow, we fit models using the joint allele frequency spectrum and validated them using independent approaches. Our two best-fit models both suggest ancient divergence between the ancestors of the farmers and Pygmies, 90,000 or 150,000 yr ago. We also find that bidirectional asymmetric gene flow is statistically better supported than a single pulse of unidirectional gene flow from farmers to Pygmies, as previously suggested. We then applied complementary statistics to scan the genome for evidence of selective sweeps and polygenic selection. We found that conventional statistical outlier approaches were biased toward identifying candidates in regions of high mutation or low recombination rate. To avoid this bias, we assigned P-values for candidates using whole-genome simulations incorporating demography and variation in both recombination and mutation rates. We found that genes and gene sets involved in muscle development, bone synthesis, immunity, reproduction, cell signaling and development, and energy metabolism are likely to be targets of positive natural selection in Western African Pygmies or their recent ancestors. PMID:26888263

  17. Reconciling Differences in Pool-GWAS Between Populations: A Case Study of Female Abdominal Pigmentation in Drosophila melanogaster

    PubMed Central

    Endler, Lukas; Betancourt, Andrea J.; Nolte, Viola; Schlötterer, Christian

    2016-01-01

    The degree of concordance between populations in the genetic architecture of a given trait is an important issue in medical and evolutionary genetics. Here, we address this problem, using a replicated pooled genome-wide association study approach (Pool-GWAS) to compare the genetic basis of variation in abdominal pigmentation in female European and South African Drosophila melanogaster. We find that, in both the European and the South African flies, variants near the tan and bric-à-brac 1 (bab1) genes are most strongly associated with pigmentation. However, the relative contribution of these loci differs: in the European populations, tan outranks bab1, while the converse is true for the South African flies. Using simulations, we show that this result can be explained parsimoniously, without invoking different causal variants between the populations, by a combination of frequency differences between the two populations and dominance for the causal alleles at the bab1 locus. Our results demonstrate the power of cost-effective, replicated Pool-GWAS to shed light on differences in the genetic architecture of a given trait between populations. PMID:26715669

  18. Reconciling Differences in Pool-GWAS Between Populations: A Case Study of Female Abdominal Pigmentation in Drosophila melanogaster.

    PubMed

    Endler, Lukas; Betancourt, Andrea J; Nolte, Viola; Schlötterer, Christian

    2016-02-01

    The degree of concordance between populations in the genetic architecture of a given trait is an important issue in medical and evolutionary genetics. Here, we address this problem, using a replicated pooled genome-wide association study approach (Pool-GWAS) to compare the genetic basis of variation in abdominal pigmentation in female European and South African Drosophila melanogaster. We find that, in both the European and the South African flies, variants near the tan and bric-à-brac 1 (bab1) genes are most strongly associated with pigmentation. However, the relative contribution of these loci differs: in the European populations, tan outranks bab1, while the converse is true for the South African flies. Using simulations, we show that this result can be explained parsimoniously, without invoking different causal variants between the populations, by a combination of frequency differences between the two populations and dominance for the causal alleles at the bab1 locus. Our results demonstrate the power of cost-effective, replicated Pool-GWAS to shed light on differences in the genetic architecture of a given trait between populations.

  19. Child maltreatment, impulsivity, and antisocial behavior in African American children: Moderation effects from a cumulative dopaminergic gene index.

    PubMed

    Thibodeau, Eric L; Cicchetti, Dante; Rogosch, Fred A

    2015-11-01

    A model examining the effects of an increasing number of maltreatment subtypes experienced on antisocial behavior, as mediated by impulsivity and moderated by a polygenic index of dopaminergic genotypes, was investigated. An African American sample of children (N = 1,012, M age = 10.07) with and without maltreatment histories participated. Indicators of aggression, delinquency, and disruptive peer behavior were obtained from peer- and counselor-rated measures to form a latent variable of antisocial behavior; impulsivity was assessed by counselor report. Five genotypes in four dopaminergic genes (dopamine receptors D4, D2, known as DRD4, DRD2; dopamine active transporter 1, known as DAT1; and catechol-O-methyltransferase, known as COMT) conferring heightened environmental sensitivity were combined into one polygenic index. Using structural equation modeling, a first-stage, moderated-mediation model was evaluated. Age and sex were entered as covariates, both as main effects and in interaction with maltreatment and the gene index. The model had excellent fit: χ2 (32, N = 1,012) = 86.51, p < .001; comparative fit index = 0.982, Tucker-Lewis index = 0.977, root mean square error of approximation = 0.041, and standardized root mean square residual = 0.022. The effect of maltreatment subtypes on antisocial behavior was partially mediated by impulsivity (β = 0.173, p < .001), and these relations were moderated by the number of differentiating dopaminergic genotypes. Specifically, a significant Gene × Environment interaction (β = 0.016, p = .013) indicated that the relation between maltreatment and impulsivity was stronger as children evinced more differentiating genotypes, thereby strengthening the mediational effect of impulsivity on antisocial behavior. These findings elucidate the manner by which maltreated children develop early signs of antisocial behavior, and the genetic mechanisms involved in greater vulnerability for maladaptation in impulse control within the

  20. Swimming pool granuloma

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/001357.htm Swimming pool granuloma To use the sharing features on this page, please enable JavaScript. A swimming pool granuloma is a long-term (chronic) skin ...

  1. Swimming Pool Safety

    MedlinePlus

    ... Prevention Listen Español Text Size Email Print Share Swimming Pool Safety Page Content ​What is the best way to keep my child safe around swimming pools? An adult should actively watch children at ...

  2. Association analysis of photoperiodic flowering genes in West and Central African sorghum [Sorghum bicolor (L.) Moench

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Photoperiod-sensitive flowering is a key adaptive trait for sorghum (Sorghum bicolor) in West and Central Africa. In this study we performed an association analysis to investigate the effect of polymorphisms within the genes putatively related to variation in flowering time on photoperiod sensitive ...

  3. Differential Splicing of Oncogenes and Tumor Suppressor Genes in African- and Caucasian-American Populations: Contributing Factor in Prostate Cancer Disparities?

    DTIC Science & Technology

    2014-10-01

    award is to characterize differential splicing of oncongenes and tumor suppressor genes in prostate cancer disparities between African American ( AA ...splicing where the AA -specific variants are engendered with a more aggressive oncogenic phenotype in vitro and in vivo. Full-length cloning of the AA ...and CA variants of both PIK3CD and FGFR3 have been accomplished. PCa cell lines genetically manipulated to predominantly express the AA -variant of

  4. Localization of the gene causing keratolytic winter erythema to chromosome 8p22-p23, and evidence for a founder effect in South African Afrikaans-speakers.

    PubMed Central

    Starfield, M; Hennies, H C; Jung, M; Jenkins, T; Wienker, T; Hull, P; Spurdle, A; Küster, W; Ramsay, M; Reis, A

    1997-01-01

    Keratolytic winter erythema (KWE), also known as "Oudtshoorn skin disease," or "erythrokeratolysis hiemalis," is an autosomal dominant skin disorder of unknown etiology characterized by a cyclical erythema, hyperkeratosis, and recurrent and intermittent peeling of the palms and soles, particularly during winter. Initially KWE was believed to be unique to South Africa, but recently a large pedigree of German origin has been identified. The disorder occurs with a prevalence of 1/7,000 in the South African Afrikaans-speaking Caucasoid population, and this high frequency has been attributed to founder effect. After a number of candidate regions were excluded from linkage to KWE in both the German family and several South African families, a genomewide analysis was embarked on. Linkage to the microsatellite marker D8S550 on chromosome 8p22-p23 was initially observed, with a maximum LOD score (Z(max)) of 9.2 at a maximum recombination fraction (theta(max)) of .0 in the German family. Linkage was also demonstrated in five of the larger South African families, with Z(max) = 7.4 at theta(max) = .02. When haplotypes were constructed, 11 of 14 South African KWE families had the complete "ancestral" haplotype, and 3 demonstrated conservation of parts of this haplotype, supporting the hypothesis of founder effect. The chromosome segregating with the disease in the German family demonstrated a different haplotype, suggesting that these chromosomes do not have a common origin. Recombination events place the KWE gene in a 6-cM interval between D8S550 and D8S552. If it is assumed that there was a single South African founder, a proposed ancestral recombinant suggests that the gene is most likely in a 1-cM interval between D8S550 and D8S265. PMID:9311742

  5. Common genetic variation near the connexin-43 gene is associated with resting heart rate in African Americans: A genome-wide association study of 13,372 participants

    PubMed Central

    Deo, R.; Nalls, M.A.; Avery, C.L.; Smith, J.G.; Evans, D.S.; Keller, M.F.; Butler, A.M.; Buxbaum, S.G.; Li, G.; Quibrera, P. Miguel; Smith, E.N.; Tanaka, T.; Akylbekova, E.L.; Alonso, A.; Arking, D.E.; Benjamin, E.J.; Berenson, G.S.; Bis, J.C.; Chen, L.Y.; Chen, W.; Cummings, S.R.; Ellinor, P.T.; Evans, M.K.; Ferrucci, L.; Fox, E.R.; Heckbert, S.R.; Heiss, G.; Hsueh, W.C.; Kerr, K.F.; Limacher, M.C.; Liu, Y.; Lubitz, S.A.; Magnani, J.W.; Mehra, R.; Marcus, G.M.; Murray, S.S.; Newman, A.B.; Njajou, O.; North, K.E.; Paltoo, D.N.; Psaty, B.M.; Redline, S.S.; Reiner, A.P.; Robinson, J.G.; Rotter, J.I.; Samdarshi, T.E.; Schnabel, R.B.; Schork, N.J.; Singleton, A.B.; Siscovick, D.; Soliman, E.Z.; Sotoodehnia, N.; Srinivasan, S.R.; Taylor, H.A.; Trevisan, M.; Zhang, Z.; Zonderman, A.B.; Newton-Cheh, C.; Whitsel, E.A.

    2013-01-01

    BACKGROUND Genome-wide association studies have identified several genetic loci associated with variation in resting heart rate in European and Asian populations. No study has evaluated genetic variants associated with heart rate in African Americans. OBJECTIVE To identify novel genetic variants associated with resting heart rate in African Americans. METHODS Ten cohort studies participating in the Candidate-gene Association Resource and Continental Origins and Genetic Epidemiology Network consortia performed genome-wide genotyping of single nucleotide polymorphisms (SNPs) and imputed 2,954,965 SNPs using HapMap YRI and CEU panels in 13,372 participants of African ancestry. Each study measured the RR interval (ms) from 10-second resting 12-lead electrocardiograms and estimated RR-SNP associations using covariate-adjusted linear regression. Random-effects meta-analysis was used to combine cohort-specific measures of association and identify genome-wide significant loci (P ≤ 2.5 × 10−8). RESULTS Fourteen SNPs on chromosome 6q22 exceeded the genome-wide significance threshold. The most significant association was for rs9320841 (+13 ms per minor allele; P = 4.98 × 10−15). This SNP was approximately 350 kb downstream of GJA1, a locus previously identified as harboring SNPs associated with heart rate in Europeans. Adjustment for rs9320841 also attenuated the association between the remaining 13 SNPs in this region and heart rate. In addition, SNPs in MYH6, which have been identified in European genome-wide association study, were associated with similar changes in the resting heart rate as this population of African Americans. CONCLUSIONS An intergenic region downstream of GJA1 (the gene encoding connexin 43, the major protein of the human myocardial gap junction) and an intragenic region within MYH6 are associated with variation in resting heart rate in African Americans as well as in populations of European and Asian origin. PMID:23183192

  6. African ancestry allelic variation at the MYH9 gene contributes to increased susceptibility to non-diabetic end-stage kidney disease in Hispanic Americans.

    PubMed

    Behar, Doron M; Rosset, Saharon; Tzur, Shay; Selig, Sara; Yudkovsky, Guennady; Bercovici, Sivan; Kopp, Jeffrey B; Winkler, Cheryl A; Nelson, George W; Wasser, Walter G; Skorecki, Karl

    2010-05-01

    Recent studies identified MYH9 as a major susceptibility gene for common forms of non-diabetic end-stage kidney disease (ESKD). A set of African ancestry DNA sequence variants comprising the E-1 haplotype, was significantly associated with ESKD. In order to determine whether African ancestry variants are also associated with disease susceptibility in admixed populations with differing genomic backgrounds, we genotyped a total of 1425 African and Hispanic American subjects comprising dialysis patients with diabetic and non-diabetic ESKD and controls, using 42 single nucleotide polymorphisms (SNPs) within the MYH9 gene and 40 genome-wide and 38 chromosome 22 ancestry informative markers. Following ancestry correction, logistic regression demonstrated that three of the E-1 SNPs are also associated with non-diabetic ESKD in the new sample sets of both African and Hispanic Americans, with a stronger association in Hispanic Americans. We also identified MYH9 SNPs that are even more powerfully associated with the disease phenotype than the E-1 SNPs. These newly associated SNPs, could be divided into those comprising a haplotype termed S-1 whose association was significant under a recessive or additive inheritance mode (rs5750248, OR 4.21, P < 0.01, Hispanic Americans, recessive), and those comprising a haplotype termed F-1 whose association was significant under a dominant or additive inheritance mode (rs11912763, OR 4.59, P < 0.01, Hispanic Americans, dominant). These findings strengthen the contention that a sequence variant of MYH9, common in populations with varying degrees of African ancestry admixture, and in strong linkage disequilibrium with the associated SNPs and haplotypes reported herein, strongly predisposes to non-diabetic ESKD.

  7. The science of pooling

    SciTech Connect

    Gilbert, E.

    1995-10-01

    The pooling of data from radon studies is described. Pooling refers to the analysis of original data from several studies, not meta-analysis in which summary measures from published data are analyzed. A main objective for pooling is to reduce uncertainty and to obtain more precise estimates of risk than would be available from any single study.

  8. Development of a diagnostic gene expression assay for tuberculosis and its use under field conditions in African buffaloes (Syncerus caffer).

    PubMed

    Parsons, Sven D C; Menezes, Angela M; Cooper, David; Walzl, Gerhard; Warren, Robin M; van Helden, Paul D

    2012-08-15

    The development of diagnostic tests for tuberculosis (TB) in exotic species is constrained by host biology and the limited availability of suitable assay reagents. As such, we evaluated a gene expression assay (GEA) which is easily modified for novel species and allows for initial sample processing under field conditions. African buffaloes (Syncerus caffer) were categorized using the single comparative intradermal tuberculin test, and blood from test-positive and test-negative animals was incubated for 20 h in "Nil" tubes (containing saline) and "TB Antigen" tubes (containing Mycobacterium tuberculosis complex (MTC)-specific antigens) of a commercial human TB test, the QuantiFERON(®)-TB Gold (In-Tube) (QFT) assay. Blood samples were then stabilized in RNAlater(®) and transported to the laboratory for RNA extraction. A Custom TaqMan GEA was used to calculate the relative abundance of interferon-gamma (IFN-γ) mRNA in the TB Antigen tube compared to that in the Nil tube as a marker of immune activation in response to MTC antigen recognition. The GEA results from the two buffalo groups were compared and a cutoff value of 2.85 was calculated to differentiate between animals from these groups with a sensitivity of 80% (95% C.I.: 56-94%) and a specificity of 95% (95% C.I.: 75-100%). Further optimization of this assay could provide a highly useful tool for the diagnosis of MTC infection in exotic species.

  9. Toll-like receptor 3 gene polymorphisms in South African Blacks with type 1 diabetes.

    PubMed

    Pirie, F J; Pegoraro, R; Motala, A A; Rauff, S; Rom, L; Govender, T; Esterhuizen, T M

    2005-08-01

    Type 1 diabetes is the consequence of exposure of genetically susceptible individuals to specific environmental precipitants. The innate immune system provides the initial response to exogenous antigen and links with the adaptive immune system. The aim of this study was to assess the role of polymorphisms occurring in the cytoplasmic region of toll-like receptor (TLR) 3 gene and immediate 5' sequence, in subjects of Zulu descent with type 1 diabetes in KwaZulu-Natal, South Africa. Seventy-nine subjects with type 1 diabetes and 74 healthy normal glucose tolerant gender-matched control subjects were studied. Parts of exon 4 and exon 3/intron 3 of the TLR3 gene were studied by polymerase chain reaction, direct sequencing and restriction enzyme digestion with Bts 1. Of the nine polymorphisms studied, a significant association with type 1 diabetes was found for the major allele in the 2593 C/T polymorphism and for the minor alleles in the 2642 C/A and 2690 A/G polymorphisms, which were found to be in complete linkage disequilibrium. Correction of the P-values for the number of alleles studied, however, rendered the results no longer significant. These results suggest that polymorphisms in the TLR3 gene, which is part of the innate immune system, may be associated with type 1 diabetes in this population.

  10. Child Maltreatment, Impulsivity, and Antisocial Behavior in African-American Children: Moderation Effects from a Cumulative Dopaminergic Gene Index

    PubMed Central

    Thibodeau, Eric L.; Cicchetti, Dante; Rogosch, Fred A.

    2015-01-01

    A model examining the effects of an increasing number of maltreatment subtypes experienced on antisocial behavior, as mediated by impulsivity and moderated by a polygenic index of dopaminergic genotypes, was investigated. An African American sample of children (N = 1012, M age = 10.07) with and without maltreatment histories participated. Indicators of aggression, delinquency, and disruptive peer behavior were obtained from peer and counselor rated measures to form a latent variable of antisocial behavior; impulsivity was assessed by counselor report. Five genotypes in four dopaminergic genes (DRD4, DRD2, DAT1, and COMT) conferring heightened environmental sensitivity were combined into one polygenic index. Using SEM, a first-stage, moderated-mediation model was evaluated. Age and sex were entered as covariates, both as main effects and in interaction with maltreatment and the gene index. The model had excellent fit: χ2(32, N =1012) = 86..51, p<0.001; CFI = 0.982; TLI = 0.977; RMSEA = 0.041; SRMR = 0.022. The effect of maltreatment subtypes on antisocial behavior was partially mediated by impulsivity (β= 0.173, p<0.001), and these relations were moderated by the number of differentiating dopaminergic genotypes. Specifically, a significant GxE interaction (b = 0.016, p = 0.013) indicated that the relation between maltreatment and impulsivity was stronger as children evinced more differentiating genotypes, thereby strengthening the mediational effect of impulsivity on antisocial behavior. These findings elucidate the manner by which maltreated children develop early signs of antisocial behavior, and the genetic mechanisms involved in greater vulnerability for maladaptation in impulse-control within context of child maltreatment. PMID:26535948

  11. Polymorphisms in nucleotide excision repair genes, smoking and breast cancer in African Americans and whites: a population-based case-control study.

    PubMed

    Mechanic, Leah E; Millikan, Robert C; Player, Jon; de Cotret, Allan René; Winkel, Scott; Worley, Kendra; Heard, Kristin; Heard, Kimberley; Tse, Chiu-Kit; Keku, Temitope

    2006-07-01

    Polymorphisms exist in several genes involved in nucleotide excision repair (NER), the principal pathway for removal of smoking-induced DNA damage. An epidemiologic study was conducted to determine whether these polymorphisms modify the association between smoking and breast cancer. DNA samples and exposure histories were analyzed as part of a large population-based case-control study of breast cancer in North Carolina. The study population included 2311 cases (894 African Americans, 1417 whites) and 2022 controls (788 African Americans, 1234 whites). Odds ratios (ORs) were calculated for breast cancer and smoking, and for breast cancer and nine non-synonymous coding polymorphisms in six NER genes (XPD codons 312 and 751, RAD23B codon 249, XPG codon 1104, XPC codon 939, XPF codons 415 and 662, and ERCC6 codons 1213 and 1230). Modification of ORs for smoking by single and combined NER genotypes was investigated. In this study population, smoking was more strongly associated with breast cancer in African American women compared with white women. Among African American women, the association of breast cancer and smoking was strongest among women with specific combinations of NER genotypes. Evidence for multiplicative interaction was found between combined NER genotypes and smoking dose (likelihood ratio test P = 0.06), duration (P = 0.09), time since cessation (P = 0.02), age at initiation (P = 0.04) and former smoking (P = 0.03). No interactions were observed in white women. Therefore, polymorphisms in NER genes may modify the relationship between breast cancer and smoking. These results are consistent with previous evidence of exposure-specific p53 mutations in breast tumors from current and former smokers, suggesting that smoking may play a role in breast cancer etiology.

  12. CD1A, D and E gene polymorphisms in a North African population from Morocco.

    PubMed

    Aureli, Anna; Oumhani, Khadija; Del Beato, Tiziana; El Aouad, Rajae; Piancatelli, Daniela

    2016-07-01

    CD1 molecules are specialized in capturing and presenting lipids and glycolipids to distinct subsets of T and NKT cells. Glycolipid presentation could play a significant role in the immune response against microbial infections. There are five closely linked CD1 genes in humans, named CD1A, B, C, D, and E, which all show a limited polymorphism. In this study, exon 2 polymorphisms of CD1A, CD1D and CD1E were investigated and allele, genotype and haplotype frequencies of these loci were reported in a Moroccan population. A comparison with allele, genotype and haplotype frequencies observed in other geographic areas was also performed. Results confirmed the presence of ethnic differences in CD1 polymorphism, mainly in CD1D (in this population two additional CD1D variant alleles, CD1D(∗)03 and CD1D(∗)04, were described) and E genes. These data could be useful to evaluate a possible pathogenetic role of CD1 in diseases. Increasing the knowledge in this field may offer possibilities for the development of new immunotherapeutic approaches.

  13. Leaky transcription of variant surface glycoprotein gene expression sites in bloodstream african trypanosomes.

    PubMed

    Alarcon, C M; Pedram, M; Donelson, J E

    1999-06-11

    Trypanosoma brucei undergoes antigenic variation by periodically switching the expression of its variant surface glycoprotein (VSG) genes (vsg) among an estimated 20-40 telomere-linked expression sites (ES), only one of which is fully active at a given time. We found that in bloodstream trypanosomes one ES is transcribed at a high level and other ESs are expressed at low levels, resulting in organisms containing one abundant VSG mRNA and several rare VSG RNAs. Some of the rare VSG mRNAs come from monocistronic ESs in which the promoters are situated about 2 kilobases upstream of the vsg, in contrast to the polycistronic ESs in which the promoters are located 45-60 kilobases upstream of the vsg. The monocistronic ES containing the MVAT4 vsg does not include the ES-associated genes (esag) that occur between the promoter and the vsg in polycistronic ESs. However, bloodstream MVAT4 trypanosomes contain the mRNAs for many different ESAGs 6 and 7 (transferrin receptors), suggesting that polycistronic ESs are partially active in this clone. To explain these findings, we propose a model in which both mono- and polycistronic ESs are controlled by a similar mechanism throughout the parasite's life cycle. Certain VSGs are preferentially expressed in metacyclic versus bloodstream stages as a result of differences in ESAG expression and the proximity of the promoters to the vsg and telomere.

  14. Oxygen control of nif gene expression in Klebsiella pneumoniae depends on NifL reduction at the cytoplasmic membrane by electrons derived from the reduced quinone pool.

    PubMed

    Grabbe, Roman; Schmitz, Ruth A

    2003-04-01

    In Klebsiella pneumoniae, the flavoprotein, NifL regulates NifA mediated transcriptional activation of the N2-fixation (nif) genes in response to molecular O2 and ammonium. We investigated the influence of membrane-bound oxidoreductases on nif-regulation by biochemical analysis of purified NifL and by monitoring NifA-mediated expression of nifH'-'lacZ reporter fusions in different mutant backgrounds. NifL-bound FAD-cofactor was reduced by NADH only in the presence of a redox-mediator or inside-out vesicles derived from anaerobically grown K. pneumoniae cells, indicating that in vivo NifL is reduced by electrons derived from membrane-bound oxidoreductases of the anaerobic respiratory chain. This mechanism is further supported by three lines of evidence: First, K. pneumoniae strains carrying null mutations of fdnG or nuoCD showed significantly reduced nif-induction under derepressing conditions, indicating that NifL inhibition of NifA was not relieved in the absence of formate dehydrogenase-N or NADH:ubiquinone oxidoreductase. The same effect was observed in a heterologous Escherichia coli system carrying a ndh null allele (coding for NADH dehydrogenaseII). Second, studying nif-induction in K. pneumoniae revealed that during anaerobic growth in glycerol, under nitrogen-limitation, the presence of the terminal electron acceptor nitrate resulted in a significant decrease of nif-induction. The final line of evidence is that reduced quinone derivatives, dimethylnaphthoquinol and menadiol, are able to transfer electrons to the FAD-moiety of purified NifL. On the basis of these data, we postulate that under anaerobic and nitrogen-limited conditions, NifL inhibition of NifA activity is relieved by reduction of the FAD-cofactor by electrons derived from the reduced quinone pool, generated by anaerobic respiration, that favours membrane association of NifL. We further hypothesize that the quinol/quinone ratio is important for providing the signal to NifL.

  15. Associations between Common Variants in Iron-Related Genes with Haematological Traits in Populations of African Ancestry

    PubMed Central

    Tanaka, Toshiko; Towers, G. Wayne; Verhoef, Hans; Veenemans, Jacobien; Talsma, Elise F.; Harryvan, Jan; Boekschoten, Mark V.; Feskens, Edith J.; Melse-Boonstra, Alida

    2016-01-01

    Background Large genome-wide association (GWA) studies of European ancestry individuals have identified multiple genetic variants influencing iron status. Studies on the generalizability of these associations to African ancestry populations have been limited. These studies are important given interethnic differences in iron status and the disproportionate burden of iron deficiency among African ancestry populations. Methods We tested the associations of 20 previously identified iron status-associated single nucleotide polymorphisms (SNPs) in 628 Kenyans, 609 Tanzanians, 608 South Africans and 228 African Americans. In each study, we examined the associations present between 20 SNPs with ferritin and haemoglobin, adjusting for age, sex and CRP levels. Results In the meta analysis including all 4 African ancestry cohorts, we replicated previously reported associations with lowered haemoglobin concentrations for rs2413450 (β = -0.19, P = 0.02) and rs4820268 (β = -0.16, P = 0.04) in TMPRSS6. An association with increased ferritin concentrations was also confirmed for rs1867504 in TF (β = 1.04, P = <0.0001) in the meta analysis including the African cohorts only. Conclusions In all meta analyses, we only replicated 4 of the 20 single nucleotide polymorphisms reported to be associated with iron status in large GWA studies of European ancestry individuals. While there is now evidence for the associations of a number of genetic variants with iron status in both European and African ancestry populations, the considerable lack of concordance highlights the importance of continued ancestry-specific studies to elucidate the genetic underpinnings of iron status in ethnically diverse populations. PMID:27332551

  16. A genome-wide search for type 2 diabetes susceptibility genes in West Africans: the Africa America Diabetes Mellitus (AADM) Study.

    PubMed

    Rotimi, Charles N; Chen, Guanjie; Adeyemo, Adebowale A; Furbert-Harris, Paulette; Parish-Gause, Debra; Zhou, Jie; Berg, Kate; Adegoke, Olufemi; Amoah, Albert; Owusu, Samuel; Acheampong, Joseph; Agyenim-Boateng, Kofi; Eghan, Benjamin A; Oli, Johnnie; Okafor, Godfrey; Ofoegbu, Ester; Osotimehin, Babatunde; Abbiyesuku, Fayeofori; Johnson, Thomas; Rufus, Theresa; Fasanmade, Olufemi; Kittles, Rick; Daniel, Harold; Chen, Yuanxiu; Dunston, Georgia; Collins, Francis S; Guass, Debra

    2004-03-01

    The incidence of type 2 diabetes is growing rapidly, not only in developed countries but also worldwide. We chose to study type 2 diabetes in West Africa, where diabetes is less common than in the U.S., reasoning that in an environment where calories are less abundant, incident cases of type 2 diabetes might carry a proportionately greater genetic component. Through the Africa America Diabetes Mellitus (AADM) study, we carried out a genome-wide linkage analysis of type 2 diabetes in a cohort of 343 affected sibling pairs (691 individuals) enrolled from five West African centers in two countries (Ghana: Accra and Kumasi; Nigeria: Enugu, Ibadan, and Lagos). A total of 390 polymorphic markers were genotyped, and multipoint linkage analysis was conducted using the GENEHUNTER-PLUS and ASM programs. Suggestive evidence of linkage was observed in four regions on three chromosomes (12, 19, and 20). The two largest logarithm of odds scores of 2.63 and 1.92 for chromosomes 20q13.3 and 12q24, respectively, are particularly interesting because these regions have been reported to harbor diabetes susceptibility genes in several other populations and ethnic groups. Given the history of forced migration of West African populations during the slave trade, these results should have considerable relevance to the study of type 2 diabetes in African Americans.

  17. Variants in interleukin family of cytokines genes influence clearance of high risk HPV in HIV-1 coinfected African-American adolescents.

    PubMed

    Sudenga, Staci L; Wiener, Howard W; Shendre, Aditi; Wilson, Craig M; Tang, Jianming; Shrestha, Sadeep

    2013-12-01

    Our work aimed to examine the potential influence of variants in interleukin/interleukin receptors genes on high-risk (HR-HPV) HPV clearance. Clearance of genital HR-HPV infection was evaluated for 134 HIV-1 seropositive African-American female adolescents from the Reaching for Excellence in Adolescent Care and Health (REACH) cohort. Genotyping targeted 225 single nucleotide polymorphisms (SNPs) within the exons, 5' untranslated region (UTR) and 3' UTR sequences of 27 immune-related candidate genes encoding interleukin family of cytokines. Cox proportional hazard models were used to determine the association of type-specific HPV clearance adjusting for time-varying CD4+ T-cell count and low-risk (LR-HPV) HPV co-infections. HR-HPV clearance rates were significantly (p < 0.001) associated with five SNPs (rs228942, rs419598, rs315950, rs7737000, and rs9292618) mapped to coding and regulatory regions in three genes (IL2RB, IL1RN, and IL7R). These data suggest that the analyzed genetic variants in interleukin family of cytokines modulate HR-HPV clearance in HIV-1 seropositive African-Americans that warrants replication.

  18. Genetic variants in one-carbon metabolism genes and breast cancer risk in European American (EA) and African American (AA) women

    PubMed Central

    Gong, Zhihong; Yao, Song; Zirpoli, Gary; Cheng, Ting-Yuan David; Roberts, Michelle; Khoury, Thaer; Ciupak, Gregory; Davis, Warren; Pawlish, Karen; Jandorf, Lina; Bovbjerg, Dana H.; Bandera, Elisa V.; Ambrosone, Christine B.

    2015-01-01

    Folate-mediated one-carbon metabolism plays critical roles in DNA synthesis, repair, and DNA methylation. The impact of single nucleotide polymorphisms (SNPs) in folate-metabolizing enzymes has been investigated in risk of breast cancer among European or Asian populations, but not among women of African ancestry. We conducted a comprehensive analysis of SNPs in eleven genes involved in one-carbon metabolism and risk of breast cancer in 1,275 European-American (EA) and 1,299 African-American (AA) women who participated in the Women’s Circle of Health Study. Allele frequencies varied significantly between EA and AA populations. A number of these SNPs, specifically in genes including MTR, MTRR, SHMT1, TYMS, and SLC19A1, were associated with overall breast cancer risk, as well as risk by estrogen receptor (ER) status, in either EA or AA women. Associations appeared to be modified by dietary folate intake. Although single-SNP associations were not statistically significant after correcting for multiple comparisons, polygenetic score analyses revealed significant associations with breast cancer risk. Per unit increase of the risk score was associated with a modest 19% to 50% increase in risk of breast cancer overall, ER positive or ER negative cancer (all P<0.0005) in EAs or AAs. In summary, our data suggest that one-carbon metabolizing gene polymorphisms could play a role in breast cancer and that may differ between EA and AA women. PMID:25598430

  19. 13 CFR 120.611 - Pools backing Pool Certificates.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Pools backing Pool Certificates. 120.611 Section 120.611 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION BUSINESS LOANS Secondary Market Certificates § 120.611 Pools backing Pool Certificates. (a) Pool characteristics. As...

  20. Transcriptome sequencing reveals population differentiation in gene expression linked to functional traits and environmental gradients in the South African shrub Protea repens.

    PubMed

    Akman, Melis; Carlson, Jane E; Holsinger, Kent E; Latimer, Andrew M

    2016-04-01

    Understanding the environmental and genetic mechanisms underlying locally adaptive trait variation across the ranges of species is a major focus of evolutionary biology. Combining transcriptome sequencing with common garden experiments on populations spanning geographical and environmental gradients holds promise for identifying such mechanisms. The South African shrub Protea repens displays diverse phenotypes in the wild along drought and temperature gradients. We grew plants from seeds collected at 19 populations spanning this species' range, and sequenced the transcriptomes of these plants to reveal gene pathways associated with adaptive trait variation. We related expression in co-expressed gene networks to trait phenotypes measured in the common garden and to source population climate. We found that expression in gene networks correlated with source-population environment and with plant traits. In particular, the activity of gene networks enriched for growth related pathways correlated strongly with source site minimum winter temperature and with leaf size, stem diameter and height in the garden. Other gene networks with enrichments for photosynthesis related genes showed associations with precipitation. Our results strongly suggest that this species displays population-level differences in gene expression that have been shaped by source population site climate, and that are reflected in trait variation along environmental gradients.

  1. T cell receptor repertoire differences between African Americans and Caucasians associated with polymorphism of the TCRBV3S1 (V{beta}3.1) gene

    SciTech Connect

    De Inocencio, J.; Glass, D.N.; Hirsch, R.

    1995-05-01

    The generation of TCR diversity occurs primarily through rearrangement of germline DNA. Genetic polymorphism of the TCR chains appears to be a rarer mechanism for generating repertoire differences between races. Flow cytometric analysis of the TCR V{beta} repertoire in a population of healthy African Americans (n = 30) and Caucasians (n = 30) revealed a significant difference in the frequency of cells bearing V{beta}3.1, but not V{beta}2, V{beta}5.1, V{beta}5.2-5.3, V{beta}6.7, V{beta}8.1-8.2, V{beta}12.1, V{beta}13.3, or V{beta}19. African Americans had a significantly lower frequency of V{beta}3.1{sup +} cells, in both the CD4{sup +} (2.55 {+-} 0.36% vs 4.85 {+-} 0.43%, p = 0.0001) and the CD8{sup +} (3.03 {+-} 0.54% vs 5.32 {+-} 0.57%, p = 0.004) population than did Caucasians, and this difference was independent of the age of the individuals. Analysis of genomic DNA revealed that the observed differences in frequency of V{beta}3.1{sup +} cells correlated with a recently described polymorphism of the recombination signal sequence of the TCRBV3S1 gene. Allele 1, associated with a lower frequency of V{beta}3.1{sup +} cells, was more commonly present in African Americans (0.68 vs 0.43), whereas allele 2, associated with a higher frequency of V{beta}3.1{sup +} cells, was more commonly present in Caucasians (0.31 vs 0.56). This study demonstrates the potential for TCR repertoire differences, based on genetic polymorphism, between African Americans and Caucasians. 31 refs., 2 figs., 5 tabs.

  2. Biological variation among african trypanosomes: I. Clonal expression of virulence is not linked to the variant surface glycoprotein or the variant surface glycoprotein gene telomeric expression site.

    PubMed

    Inverso, Jill A; Uphoff, Timothy S; Johnson, Scott C; Paulnock, Donna M; Mansfield, John M

    2010-05-01

    The potential association of variant surface glycoprotein (VSG) gene expression with clonal expression of virulence in African trypanosomes was addressed. Two populations of clonally related trypanosomes, which differ dramatically in virulence for the infected host, but display the same apparent VSG surface coat phenotype, were characterized with respect to the VSG genes expressed as well as the chromosome telomeric expression sites (ES) utilized for VSG gene transcription. The VSG gene sequences expressed by clones LouTat 1 and LouTat 1A of Trypanosoma brucei rhodesiense were identical, and gene expression in both clones occurred precisely by the same gene conversion events (duplication and transposition), which generated an expression-linked copy (ELC) of the VSG gene. The ELC was present on the same genomic restriction fragments in both populations and resided in the telomere of a 330-kb chromosome; a single basic copy of the LouTat 1/1A VSG gene, present in all variants of the LouTat 1 serodeme, was located at an internal site of a 1.5-Mb chromosome. Restriction endonuclease mapping of the ES telomere revealed that the VSG ELC of clones LouTat 1 and 1A resides in the same site. Therefore, these findings provide evidence that the VSG gene ES and, potentially, any cotranscribed ES-associated genes do not play a role in the clonal regulation of virulence because trypanosome clones LouTat 1 and 1A, which differ markedly in their virulence properties, both express identical VSG genes from the same chromosome telomeric ES.

  3. Large-scale pattern of genetic differentiation within African rainforest trees: insights on the roles of ecological gradients and past climate changes on the evolution of Erythrophleum spp (Fabaceae)

    PubMed Central

    2013-01-01

    Background The evolutionary events that have shaped biodiversity patterns in the African rainforests are still poorly documented. Past forest fragmentation and ecological gradients have been advocated as important drivers of genetic differentiation but their respective roles remain unclear. Using nuclear microsatellites (nSSRs) and chloroplast non-coding sequences (pDNA), we characterised the spatial genetic structure of Erythrophleum (Fabaceae) forest trees in West and Central Africa (Guinea Region, GR). This widespread genus displays a wide ecological amplitude and taxonomists recognize two forest tree species, E. ivorense and E. suaveolens, which are difficult to distinguish in the field and often confused. Results Bayesian-clustering applied on nSSRs of a blind sample of 648 specimens identified three major gene pools showing no or very limited introgression. They present parapatric distributions correlated to rainfall gradients and forest types. One gene pool is restricted to coastal evergreen forests and corresponds to E. ivorense; a second one is found in gallery forests from the dry forest zone of West Africa and North-West Cameroon and corresponds to West-African E. suaveolens; the third gene pool occurs in semi-evergreen forests and corresponds to Central African E. suaveolens. These gene pools have mostly unique pDNA haplotypes but they do not form reciprocally monophyletic clades. Nevertheless, pDNA molecular dating indicates that the divergence between E. ivorense and Central African E. suaveolens predates the Pleistocene. Further Bayesian-clustering applied within each major gene pool identified diffuse genetic discontinuities (minor gene pools displaying substantial introgression) at a latitude between 0 and 2°N in Central Africa for both species, and at a longitude between 5° and 8°E for E. ivorense. Moreover, we detected evidence of past population declines which are consistent with historical habitat fragmentation induced by Pleistocene climate

  4. Effects of Lifestyle Modification on Telomerase Gene Expression in Hypertensive Patients: A Pilot Trial of Stress Reduction and Health Education Programs in African Americans

    PubMed Central

    Duraimani, Shanthi; Schneider, Robert H.; Randall, Otelio S.; Nidich, Sanford I.; Xu, Shichen; Ketete, Muluemebet; Rainforth, Maxwell A.; Gaylord-King, Carolyn; Salerno, John W.; Fagan, John

    2015-01-01

    Background African Americans suffer from disproportionately high rates of hypertension and cardiovascular disease. Psychosocial stress, lifestyle and telomere dysfunction contribute to the pathogenesis of hypertension and cardiovascular disease. This study evaluated effects of stress reduction and lifestyle modification on blood pressure, telomerase gene expression and lifestyle factors in African Americans. Methods Forty-eight African American men and women with stage I hypertension who participated in a larger randomized controlled trial volunteered for this substudy. These subjects participated in either stress reduction with the Transcendental Meditation technique and a basic health education course (SR) or an extensive health education program (EHE) for 16 weeks. Primary outcomes were telomerase gene expression (hTERT and hTR) and clinic blood pressure. Secondary outcomes included lifestyle-related factors. Data were analyzed for within-group and between-group changes. Results Both groups showed increases in the two measures of telomerase gene expression, hTR mRNA levels (SR: p< 0.001; EHE: p< 0.001) and hTERT mRNA levels (SR: p = 0.055; EHE: p< 0.002). However, no statistically significant between-group changes were observed. Both groups showed reductions in systolic BP. Adjusted changes were SR = -5.7 mm Hg, p< 0.01; EHE = -9.0 mm Hg, p < 0.001 with no statistically significant difference between group difference. There was a significant reduction in diastolic BP in the EHE group (-5.3 mm Hg, p< 0.001) but not in SR (-1.2 mm Hg, p = 0.42); the between-group difference was significant (p = 0.04). The EHE group showed a greater number of changes in lifestyle behaviors. Conclusion In this pilot trial, both stress reduction (Transcendental Meditation technique plus health education) and extensive health education groups demonstrated increased telomerase gene expression and reduced BP. The association between increased telomerase gene expression and reduced BP

  5. Single-nucleotide polymorphisms in DNA bypass polymerase genes and association with breast cancer and breast cancer subtypes among African Americans and Whites

    PubMed Central

    Family, Leila; Bensen, Jeannette T.; Troester, Melissa A.; Wu, Michael C.; Anders, Carey K.; Olshan, Andrew F.

    2015-01-01

    DNA damage recognition and repair is a complex system of genes focused on maintaining genomic stability. Recently, there has been a focus on how breast cancer susceptibility relates to genetic variation in the DNA bypass polymerases pathway. Race-stratified and subtype-specific logistic regression models were used to estimate odds ratios (ORs) and 95 % confidence intervals (CIs) for the association between 22 single-nucleotide polymorphisms (SNPs) in seven bypass polymerase genes and breast cancer risk in the Carolina Breast Cancer Study, a population-based, case–control study (1,972 cases and 1,776 controls). We used SNP-set kernel association test (SKAT) to evaluate the multi-gene, multi-locus (combined) SNP effects within bypass polymerase genes. We found similar ORs for breast cancer with three POLQ SNPs (rs487848 AG/AA vs. GG; OR = 1.31, 95 % CI 1.03–1.68 for Whites and OR = 1.22, 95 % CI 1.00–1.49 for African Americans), (rs532411 CT/TT vs. CC; OR = 1.31, 95 % CI 1.02–1.66 for Whites and OR = 1.22, 95 % CI 1.00–1.48 for African Americans), and (rs3218634 CG/CC vs. GG; OR = 1.29, 95 % CI 1.02–1.65 for Whites). These three SNPs are in high linkage disequilibrium in both races. Tumor subtype analysis showed the same SNPs to be associated with increased risk of Luminal breast cancer. SKAT analysis showed no significant combined SNP effects. These results suggest that variants in the POLQ gene may be associated with the risk of Luminal breast cancer. PMID:25417172

  6. Genetics Home Reference: African iron overload

    MedlinePlus

    ... of a genetic condition? Genetic and Rare Diseases Information Center Frequency African iron overload is common in rural areas of central and ... more about the gene associated with African iron overload SLC40A1 Related Information What is a gene? What is a gene ...

  7. Phylogenomic analysis of 11 complete African swine fever virus genome sequences

    SciTech Connect

    Villiers, Etienne P. de; Gallardo, Carmina; Arias, Marisa; Martin, Raquel

    2010-04-25

    Viral molecular epidemiology has traditionally analyzed variation in single genes. Whole genome phylogenetic analysis of 123 concatenated genes from 11 ASFV genomes, including E75, a newly sequenced virulent isolate from Spain, identified two clusters. One contained South African isolates from ticks and warthog, suggesting derivation from a sylvatic transmission cycle. The second contained isolates from West Africa and the Iberian Peninsula. Two isolates, from Kenya and Malawi, were outliers. Of the nine genomes within the clusters, seven were within p72 genotype 1. The 11 genomes sequenced comprised only 5 of the 22 p72 genotypes. Comparison of synonymous and non-synonymous mutations at the genome level identified 20 genes subject to selection pressure for diversification. A novel gene of the E75 virus evolved by the fusion of two genes within the 360 multicopy family. Comparative genomics reveals high diversity within a limited sample of the ASFV viral gene pool.

  8. African human mtDNA phylogeography at-a-glance.

    PubMed

    Rosa, Alexandra; Brehem, António

    2011-01-01

    The mitochondrial DNA (mtDNA) genetic system has long proven to be useful for studying the demographic history of our species, since their proposed Southeast/East African origin 200 kya. Despite the weak archaeological and anthropologic records, which render a difficult understanding of early intra- continental migrations, the phylogenetic L0-L1'6 split at about 140-160 kya is thought to represent also an early sub-structuring of small and isolated communities in South and East Africa. Regional variation accumulated over the following millennia, with L2 and L3 lineages arising in Central and East Africa 100-75 kya. Their sub-Saharan dispersal not later than 60 kya, largely overwhelmed the L0'1 distribution, nowadays limited to South African Khoisan and Central African Pygmies. Cyclic expansions and retractions of the equatorial forest between 40 kya and the "Last Glacial Aridity Maximum" were able to reduce the genetic diversity of modern humans. Surviving regional-specific lineages have emerged from the Sahelian refuge areas, repopulating the region and contributing to the overall West African genetic similarity. Particular L1- L3 lineages mirror the substantial population growth made possible by moister and warmer conditions of the Sahara's Wet Phase and the adoption of agriculture and iron smelting techniques. The diffusion of the farming expertise from a Central African source towards South Africa was mediated by the Bantu people 3 kya. The strong impact of their gene flow almost erased the pre-existent maternal pool. Non-L mtDNAs testify for Eurasian lineages that have enriched the African maternal pool at different timeframes: i) Near and Middle Eastern influences in Upper Palaeolithic, probably link to the spread of Afro-Asiatic languages; ii) particular lineages from West Eurasia around or after the glacial period; iii) post-glacial mtDNA signatures from the Franco-Cantabrian refugia, that have crossed the Strait of Gibraltar and iv) Eurasian lineages

  9. Swimming pool. View of aisle between swimming pool and seating ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Swimming pool. View of aisle between swimming pool and seating area. Non-original spa pool is partially visible on right. - Jewish Community Center of San Francisco, 3200 California Street, San Francisco, San Francisco County, CA

  10. Genetic variants in IGF-I, IGF-II, IGFBP-3, and adiponectin genes and colon cancer risk in African Americans and Whites

    PubMed Central

    Keku, Temitope O.; Vidal, Adriana; Oliver, Shannon; Hoyo, Catherine; Hall, Ingrid J.; Omofoye, Seun; McDoom, Maya; Worley, Kendra; Galanko, Joseph; Sandler, Robert S.; Millikan, Robert

    2014-01-01

    Purpose Evaluating genetic susceptibility may clarify effects of known environmental factors and also identify individuals at high risk. We evaluated the association of four insulin-related pathway gene polymorphisms in insulin-like growth factor-1 (IGF-I) (CA)n repeat, insulin-like growth factor-2 (IGF-II) (rs680), insulin-like growth factor binding protein-3 (IGFBP-3) (rs2854744), and adiponectin (APM1 rs1501299) with colon cancer risk, as well as relationships with circulating IGF-I, IGF-II, IGFBP-3, and C-peptide in a population-based study. Methods Participants were African Americans (231cases, 306 controls) and Whites (297 cases, 530 controls). Consenting subjects provided blood specimens, and lifestyle/diet information. Genotyping for all genes except IGF-I was performed by the 5′-exonuclease (Taqman) assay. The IGF-I (CA)n repeat was assayed by PCR, and fragment analysis. Circulating proteins were measured by enzyme immunoassays. Odds ratios (ORs) and 95% confidence intervals (CIs) were calculated by logistic regression. Results The IGF-I (CA)19 repeat was higher in White controls (50%) than African American controls (31%). Whites homozygous for the IGF-I (CA)19 repeat had a nearly two fold increase in risk of colon cancer (OR=1.77; 95%CI=1.15–2.73), but not African Americans (OR= 0.73, 95%CI 0.50–1.51). We observed an inverse association between the IGF-II Apa1 A-variant and colon cancer risk (OR= 0.49, 95%CI 0.28–0.88) in Whites only. Carrying the IGFBP-3 variant alleles was associated with lower IGFBP-3 protein levels, a difference most pronounced in Whites (p- trend < 0.05). Conclusions These results support an association between insulin pathway-related genes and elevated colon cancer risk in Whites but not in African Americans. PMID:22565227

  11. Protective immunization of horses with a recombinant canarypox virus vectored vaccine co-expressing genes encoding the outer capsid proteins of African horse sickness virus.

    PubMed

    Guthrie, Alan J; Quan, Melvyn; Lourens, Carina W; Audonnet, Jean-Christophe; Minke, Jules M; Yao, Jiansheng; He, Ling; Nordgren, Robert; Gardner, Ian A; Maclachlan, N James

    2009-07-16

    We describe the development and preliminary characterization of a recombinant canarypox virus vectored (ALVAC) vaccine for protective immunization of equids against African horse sickness virus (AHSV) infection. Horses (n=8) immunized with either of two concentrations of recombinant canarypox virus vector (ALVAC-AHSV) co-expressing synthetic genes encoding the outer capsid proteins (VP2 and VP5) of AHSV serotype 4 (AHSV-4) developed variable titres (<10-80) of virus-specific neutralizing antibodies and were completely resistant to challenge infection with a virulent strain of AHSV-4. In contrast, a horse immunized with a commercial recombinant canarypox virus vectored vaccine expressing the haemagglutinin genes of two equine influenza H3N8 viruses was seronegative to AHSV and following infection with virulent AHSV-4 developed pyrexia, thrombocytopenia and marked oedema of the supraorbital fossae typical of the "dikkop" or cardiac form of African horse sickness. AHSV was detected by virus isolation and quantitative reverse transcriptase polymerase chain reaction in the blood of the control horse from 8 days onwards after challenge infection whereas AHSV was not detected at any time in the blood of the ALVAC-AHSV vaccinated horses. The control horse seroconverted to AHSV by 2 weeks after challenge infection as determined by both virus neutralization and ELISA assays, whereas six of eight of the ALVAC-AHSV vaccinated horses did not seroconvert by either assay following challenge infection with virulent AHSV-4. These data confirm that the ALVAC-AHSV vaccine will be useful for the protective immunization of equids against African horse sickness, and avoids many of the problems inherent to live-attenuated AHSV vaccines.

  12. Deletion of the thymidine kinase gene induces complete attenuation of the Georgia isolate of African swine fever virus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    African swine fever virus (ASFV) is the etiological agent of a contagious and often lethal viral disease of domestic pigs. There are no vaccines to control Africa swine fever (ASF). Experimental vaccines have been developed using genetically modified live attenuated ASFVs obtained by specifically de...

  13. A study of Gm allotypes and immunoglobulin heavy gamma IGHG genes in Berbers, Arabs and sub-Saharan Africans from Jerba Island, Tunisia.

    PubMed

    Loveslati, B Y; Sanchez-Mazas, A; Ennafaa, H; Marrakchi, R; Dugoujon, J M; Lefranc, J M; Elgaaied, A B

    2001-10-01

    The Gm polymorphism of human IgG immunoglobulins was investigated in three different ethnic groups--Arabs, Berbers and 'dark-skinned people'--on Jerba Island, Tunisia. The genetic relationships among these groups and several populations from North Africa, sub-Saharan Africa, west Asia and Europe were analysed by principal coordinate analysis, Fst significance testing, and analysis of molecular variance based on haplotype frequencies. The results revealed a non-significant genetic differentiation between Arabs and Berbers from Jerba. However, the Jerbian population of sub-Saharan African origin was close to Ethiopians. Gene flow among the three Jerbian populations, as well as an East African origin of the dark-skinned individuals, is proposed to account for the observed genetic pattern. However, the genetic diversity observed among the different Tunisian populations did not show any significant correlation with either geographic or linguistic differentiation. A preliminary analysis of the restriction fragment length polymorphism of the IGHG genes in Arabs and Berbers from Jerba confirmed the close genetic relationship between the two populations. However, it also indicated a lower level of genetic diversity in the Berbers, which may be explained by more rapid genetic drift due to longer isolation on the island.

  14. Molecular Variation of Adh and P6 Genes in an African Population of Drosophila Melanogaster and Its Relation to Chromosomal Inversions

    PubMed Central

    Benassi, V.; Aulard, S.; Mazeau, S.; Veuille, M.

    1993-01-01

    Four-cutter molecular polymorphism of Adh and P6, and chromosome inversion polymorphism of chromosome II were investigated in 95 isogenic lines of an Ivory Coast population of Drosophila melanogaster, a species assumed to have recently spread throughout the world from a West African origin. The P6 gene showed little linkage disequilibrium with the In(2L)t inversion, although it is located within this inversion. This suggests that the inversion and the P6 locus have extensively exchanged genetic information through either double crossover or gene conversion. Allozymic variation in ADH was in linkage disequilibrium with In(2L)t and In(2R)NS inversions. Evidence suggests either that inversion linkage with the Fast allele is selectively maintained, or that this allele only recently appeared. Molecular polymorphism at the Adh locus in the Ivory Coast is not higher than in North American populations. New haplotypes specific to the African population were found, some of them connect the ``Wa(s)-like'' haplotypes found at high frequencies in the United States to the other slow haplotypes. Their relation with In(2L)t supports the hypothesis that Wa(s) recently recombined away from an In(2L)t chromosome which may be the cause of its divergence from the other haplotypes. PMID:8349110

  15. Polymorphisms within the neuronal cadherin (CDH2) gene are associated with obsessive-compulsive disorder (OCD) in a South African cohort.

    PubMed

    McGregor, N W; Lochner, C; Stein, D J; Hemmings, S M J

    2016-02-01

    OCD is characterised by recurrent obsessions and compulsions that result in severe distress and increased risk for comorbidity. Recently published findings have indicated that the neuronal cadherin gene (CDH2) plays a role in the development of canine OCD, and led us to investigate the human ortholog, CDH2, in a human OCD cohort. Seven CDH2 polymorphisms were selected and genotyped in a South African Caucasian cohort of 234 OCD patients and 180 healthy controls using TaqMan assays. Polymorphisms were analysed in a single-locus and haplotypic context. Of the seven polymorphisms, two reached statistical significance for OCD under additive and codominant models of inheritance (rs1120154 and rs12605662). CDH2 SNP, rs1120154, C-allele carriers were found to be significantly associated with lower risk to develop OCD compared to TT-homozygotes (OR = 0.49; 95% CI: 0.32-0.75; p < 0.001), and rs12605662 G-allele carriers were significantly associated with reduced risk OCD compared to TT-homozygotes (OR = 0.46; 95% CI: 0.30-0.71; p < 0.001), Furthermore, a single haplotype was found to infer an increased risk for OCD diagnosis (*rs8087457-rs1148374: A-T). Polymorphisms within the CDH2 gene are associated with susceptibility to OCD in a South African cohort.

  16. Pools for the Handicapped.

    ERIC Educational Resources Information Center

    American School and University, 1979

    1979-01-01

    Three institutions in Ohio now stress hydrotherapy and water recreation as important parts of individual educational programs for the handicapped. Specially designed and adapted pools provide freedom of movement and ego building as well as physical education and recreation. (Author)

  17. Vitamin D Pooling Project

    Cancer.gov

    The Vitamin D Pooling Project of Rarer Cancers brought together investigators from 10 cohorts to conduct a large prospective epidemiologic study of the association between vitamin D status and seven rarer cancers.

  18. Swimming Pool Chemistry Teaching.

    ERIC Educational Resources Information Center

    Harding, Jennifer

    1994-01-01

    Outlines a strategy for the teaching of equilibrium in a poolside atmosphere. Illustrates the practical application of knowledge about equilibrium as demonstrated by pool staff as they satisfy the needs of both the swimmers and local health inspectors. (DDR)

  19. Weld pool phenomena

    SciTech Connect

    David, S.A.; Vitek, J.M.; Zacharia, T.; DebRoy, T.

    1994-09-01

    During welding, the composition, structure and properties of the welded structure are affected by the interaction of the heat source with the metal. The interaction affects the fluid flow, heat transfer and mass transfer in the weld pool, and the solidification behavior of the weld metal. In recent years, there has been a growing recognition of the importance of the weld pool transport processes and the solid state transformation reactions in determining the composition, structure and properties of the welded structure. The relation between the weld pool transport processes and the composition and structure is reviewed. Recent applications of various solidification theories to welding are examined to understand the special problems of weld metal solidification. The discussion is focussed on the important problems and issues related to weld pool transport phenomena and solidification. Resolution of these problems would be an important step towards a science based control of composition, structure and properties of the weld metal.

  20. Phytase-producing capacity of yeasts isolated from traditional African fermented food products and PHYPk gene expression of Pichia kudriavzevii strains.

    PubMed

    Greppi, Anna; Krych, Łukasz; Costantini, Antonella; Rantsiou, Kalliopi; Hounhouigan, D Joseph; Arneborg, Nils; Cocolin, Luca; Jespersen, Lene

    2015-07-16

    Phytate is known as a strong chelate of minerals causing their reduced uptake by the human intestine. Ninety-three yeast isolates from traditional African fermented food products, belonging to nine species (Pichia kudriavzevii, Saccharomyces cerevisiae, Clavispora lusitaniae, Kluyveromyces marxianus, Millerozyma farinosa, Candida glabrata, Wickerhamomyces anomalus, Hanseniaspora guilliermondii and Debaryomyces nepalensis) were screened for phytase production on solid and liquid media. 95% were able to grow in the presence of phytate as sole phosphate source, P. kudriavzevii being the best growing species. A phytase coding gene of P. kudriavzevii (PHYPk) was identified and its expression was studied during growth by RT-qPCR. The expression level of PHYPk was significantly higher in phytate-medium, compared to phosphate-medium. In phytate-medium expression was seen in the lag phase. Significant differences in gene expression were detected among the strains as well as between the media. A correlation was found between the PHYPk expression and phytase extracellular activity.

  1. Comparison of the sequence of the gene encoding African swine fever virus attachment protein p12 from field virus isolates and viruses passaged in tissue culture.

    PubMed Central

    Angulo, A; Viñuela, E; Alcamí, A

    1992-01-01

    Comparison of the amino acid sequence of the African swine fever virus attachment protein p12 from different field virus isolates, deduced from the nucleotide sequence of the gene, revealed a high degree of conservation. No mutations were found after adaptation to Vero cells, and a polypeptide with similar characteristics was present in an IBRS2-adapted virus. The sequence of the 5' flanking region was conserved among the isolates, whereas sequences downstream of the gene were highly variable in length and contained direct repeats in tandem that may account for the deletions found in different isolates. Protein p12 was synthesized in swine macrophages infected with all of the viruses tested. PMID:1583733

  2. Simultaneous Deletion of the 9GL and UK Genes from the African Swine Fever Virus Georgia 2007 Isolate Offers Increased Safety and Protection against Homologous Challenge.

    PubMed

    O'Donnell, Vivian; Risatti, Guillermo R; Holinka, Lauren G; Krug, Peter W; Carlson, Jolene; Velazquez-Salinas, Lauro; Azzinaro, Paul A; Gladue, Douglas P; Borca, Manuel V

    2017-01-01

    African swine fever virus (ASFV) is the etiological agent of a contagious and often lethal viral disease of domestic pigs that has significant economic consequences for the swine industry. The control of African swine fever (ASF) has been hampered by the unavailability of vaccines. Successful experimental vaccines have been derived from naturally occurring, cell culture-adapted, or genetically modified live attenuated ASFV. Recombinant viruses harboring engineered deletions of specific virulence-associated genes induce solid protection against challenge with parental viruses. Deletion of the 9GL (B119L) gene in the highly virulent ASFV isolates Malawi Lil-20/1 (Mal) and Pretoriuskop/96/4 (Δ9GL viruses) resulted in complete protection when challenged with parental isolates. When similar deletions were created within the ASFV Georgia 2007 (ASFV-G) genome, attenuation was achieved but the protective and lethal doses were too similar. To enhance attenuation of ASFV-G, we deleted another gene, UK (DP96R), which was previously shown to be involved in attenuation of the ASFV E70 isolate. Here, we report the construction of a double-gene-deletion recombinant virus, ASFV-G-Δ9GL/ΔUK. When administered intramuscularly (i.m.) to swine, there was no induction of disease, even at high doses (10(6) HAD50). Importantly, animals infected with 10(4) 50% hemadsorbing doses (HAD50) of ASFV-G-Δ9GL/ΔUK were protected as early as 14 days postinoculation when challenged with ASFV-G. The presence of protection correlates with the appearance of serum anti-ASFV antibodies, but not with virus-specific circulating ASFV-specific gamma interferon (IFN-γ)-producing cells. ASFV-G-Δ9GL/ΔUK is the first rationally designed experimental ASFV vaccine that protects against the highly virulent ASFV Georgia 2007 isolate as early as 2 weeks postvaccination.

  3. Rainfall-driven sex-ratio genes in African buffalo suggested by correlations between Y-chromosomal haplotype frequencies and foetal sex ratio

    PubMed Central

    2010-01-01

    Background The Y-chromosomal diversity in the African buffalo (Syncerus caffer) population of Kruger National Park (KNP) is characterized by rainfall-driven haplotype frequency shifts between year cohorts. Stable Y-chromosomal polymorphism is difficult to reconcile with haplotype frequency variations without assuming frequency-dependent selection or specific interactions in the population dynamics of X- and Y-chromosomal genes, since otherwise the fittest haplotype would inevitably sweep to fixation. Stable Y-chromosomal polymorphism due one of these factors only seems possible when there are Y-chromosomal distorters of an equal sex ratio, which act by negatively affecting X-gametes, or Y-chromosomal suppressors of a female-biased sex ratio. These sex-ratio (SR) genes modify (suppress) gamete transmission in their own favour at a fitness cost, allowing for stable polymorphism. Results Here we show temporal correlations between Y-chromosomal haplotype frequencies and foetal sex ratios in the KNP buffalo population, suggesting SR genes. Frequencies varied by a factor of five; too high to be alternatively explained by Y-chromosomal effects on pregnancy loss. Sex ratios were male-biased during wet and female-biased during dry periods (male proportion: 0.47-0.53), seasonally and annually. Both wet and dry periods were associated with a specific haplotype indicating a SR distorter and SR suppressor, respectively. Conclusions The distinctive properties suggested for explaining Y-chromosomal polymorphism in African buffalo may not be restricted to this species alone. SR genes may play a broader and largely overlooked role in mammalian sex-ratio variation. PMID:20416038

  4. Reverse genetics in the tide pool: knock-down of target gene expression via RNA interference in the copepod Tigriopus californicus.

    PubMed

    Barreto, Felipe S; Schoville, Sean D; Burton, Ronald S

    2015-07-01

    Reverse genetic tools are essential for characterizing phenotypes of novel genes and testing functional hypotheses generated from next-generation sequencing studies. RNA interference (RNAi) has been a widely used technique for describing or quantifying physiological, developmental or behavioural roles of target genes by suppressing their expression. The marine intertidal copepod Tigriopus californicus has become an emerging model for evolutionary and physiological studies, but this species is not amenable to most genetic manipulation approaches. As crustaceans are susceptible to RNAi-mediated gene knock-down, we developed a simple method for delivery of gene-specific double-stranded RNA that results in significant suppression of target gene transcription levels. The protocol was examined on five genes of interest, and for each, at least 50% knock-down in expression was achieved. While knock-down levels did not reach 100% in any trial, a well-controlled experiment with one heat-shock gene showed unambiguously that such partial gene suppression may cause dramatic changes in phenotype. Copepods with suppressed expression of heat-shock protein beta 1 (hspb1) exhibited dramatically decreased tolerance to high temperatures, validating the importance of this gene during thermal stress, as proposed by a previous study. The application of this RNAi protocol in T. californicus will be invaluable for examining the role of genes putatively involved in reproductive isolation, mitochondrial function and local adaptation.

  5. Microsatellites in the estrogen receptor (ESR1, ESR2) and androgen receptor (AR) genes and breast cancer risk in African American and Nigerian women.

    PubMed

    Zheng, Yonglan; Huo, Dezheng; Zhang, Jing; Yoshimatsu, Toshio F; Niu, Qun; Olopade, Olufunmilayo I

    2012-01-01

    Genetic variants in hormone receptor genes may be crucial predisposing factors for breast cancer, and microsatellites in the estrogen receptor (ESR1, ESR2) and androgen receptor (AR) genes have been suggested to play a role. We studied 258 African-American (AA) women with breast cancer and 259 hospital-based controls, as well as 349 Nigerian (NG) female breast cancer patients and 296 community controls. Three microsatellites, ESR1_TA, ESR2_CA and AR_CAG, in the ESR1, ESR2 and AR genes, respectively, were genotyped. Their repeat lengths were then analyzed as continuous and dichotomous variables. Analyses of continuous variables showed no association with breast cancer risk in either AA or NG at ESR1_TA; AA cases had shorter repeats in the long allele of ESR2_CA than AA controls (Mann-Whitney P= 0.036; logistic regression P = 0.04, OR= 0.91, 95% CI 0.83-1.00), whereas NG patients had longer repeats in the short allele than NG controls (Mann-Whitney P= 0.0018; logistic regression P= 0.04, OR= 1.06, 95% CI 1.00-1.11); and AA cases carried longer repeats in the short allele of AR_CAG than AA controls (Mann-Whitney P= 0.038; logistic regression P = 0.03, OR= 1.08, 95% CI 1.01-1.15). When allele sizes were categorized as dichotomous variables, we discovered that women with two long alleles of ESR2_CA had increased risk of breast cancer (OR = 1.38, 95% CI 1.10-1.74; P = 0.006). This is the first study to investigate these three microsatellites in hormonal receptor genes in relation to breast cancer risk in an indigenous African population. After adjusting for multiple-testing, our findings suggest that ESR2_CA is associated with breast cancer risk in Nigerian women, whereas ESR1_TA and AR_CAG seem to have no association with the disease among African American or Nigerian women.

  6. Hepatic Gene Expression in Protoporphyic Fech Mice Is Associated with Cholestatic Injury but Not a Marked Depletion of the Heme Regulatory Pool

    PubMed Central

    Davies, Reginald; Schuurman, Arenda; Barker, Colin R.; Clothier, Bruce; Chernova, Tatyana; Higginson, Fiona M.; Judah, David J.; Dinsdale, David; Edwards, Richard E.; Greaves, Peter; Gant, Timothy W.; Smith, Andrew G.

    2005-01-01

    BALB/c Fechm1Pas mice have a mutated ferrochelatase gene resulting in protoporphyria that models the hepatic injury occurring sporadically in human erythropoietic protoporphyria. We used this mouse model to study the development of the injury and to compare the dysfunction of heme synthesis with hepatic gene expression of liver metabolism, oxidative stress, and cellular injury/inflammation. From an early age expression of total cytochrome P450 and many of its isoforms was significantly lower than in wild-type mice. However, despite massive accumulation of protoporphyrin in the liver, expression of the main genes controlling heme synthesis and catabolism (Alas1 and Hmox1, respectively) were only modestly affected even in the presence of the cytochrome P450-inducing CAR agonist 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene. In contrast, in BALB/c mice exhibiting griseofulvin-induced hepatic protoporphyria with induction and destruction of cytochrome P450, both Alas1 and Hmox1 genes were markedly up-regulated. Other expression profiles in BALB/c Fechm1Pas mice identified roles for oxidative mechanisms in liver injury while modulated gene expression of hepatocyte transport proteins and cholesterol and bile acid synthesis illustrated the development of cholestasis. Subsequent inflammation and cirrhosis were also shown by the up-regulation of cytokine, cell cycling, and procollagen genes. Thus, gene expression profiles studied in Fechm1Pas mice may provide candidates for human polymorphisms that explain the sporadic hepatic consequences of erythropoietic protoporphyria. PMID:15793285

  7. The Ep152R ORF of African swine fever virus strain Georgia encodes for an essential gene that interacts with host protein BAG6.

    PubMed

    Borca, Manuel V; O'Donnell, Vivian; Holinka, Lauren G; Rai, Devendra K; Sanford, Brenton; Alfano, Marialexia; Carlson, Jolene; Azzinaro, Paul A; Alonso, Covadonga; Gladue, Douglas P

    2016-09-02

    African swine fever virus (ASFV) is the etiological agent of a contagious and often lethal disease of domestic pigs that has significant economic consequences for the swine industry. The viral genome encodes for more than 150 genes, and only a select few of these genes have been studied in some detail. Here we report the characterization of open reading frame Ep152R that has a predicted complement control module/SCR domain. This domain is found in Vaccinia virus proteins that are involved in blocking the immune response during viral infection. A recombinant ASFV harboring a HA tagged version of the Ep152R protein was developed (ASFV-G-Ep152R-HA) and used to demonstrate that Ep152R is an early virus protein. Attempts to construct recombinant viruses having a deleted Ep152R gene were consistently unsuccessful indicating that Ep152R is an essential gene. Interestingly, analysis of host-protein interactions for Ep152R using a yeast two-hybrid screen, identified BAG6, a protein previously identified as being required for ASFV replication. Furthermore, fluorescent microscopy analysis confirms that Ep152R-BAG6 interaction actually occurs in cells infected with ASFV.

  8. Immune responses to recombinants of the South African vaccine strain of lumpy skin disease virus generated by using thymidine kinase gene insertion.

    PubMed

    Wallace, David B; Viljoen, Gerrit J

    2005-04-27

    The South African vaccine strain of lumpy skin disease virus (type SA-Neethling) is currently being developed as a vector for recombinant vaccines of economically important livestock diseases throughout Africa. In this study, the feasibility of using the viral thymidine kinase gene as the site of insertion was investigated and recombinant viruses were evaluated in animal trials. Two separate recombinants were generated and selected for homogeneity expressing either the structural glycoprotein gene of bovine ephemeral fever virus (BEFV) or the two structural glycoprotein genes of Rift Valley fever virus (RVFV). Both recombinants incorporate the enhanced green fluorescent protein (EGFP) as a visual marker and the Escherichia coli guanine phosphoribosyl transferase (gpt) gene for dominant positive selection. The LSDV-RVFV recombinant construct (rLSDV-RVFV) protected mice against virulent RVFV challenge. In a small-scale BEFV-challenge cattle trial the rLSDV-BEFV construct failed to fully protect the cattle against virulent challenge, although both a humoral and cellular BEFV-specific immune response was elicited.

  9. Contrasting patterns of gene flow between sister plant species in the understorey of African moist forests - the case of sympatric and parapatric Marantaceae species.

    PubMed

    Ley, A C; Hardy, O J

    2014-08-01

    Gene flow within and between species is a fundamental process shaping the evolutionary history of taxa. However, the extent of hybridization and reinforcement is little documented in the tropics. Here we explore the pattern of gene flow between three sister species from the herbaceous genus Marantochloa (Marantaceae), sympatrically distributed in the understorey of the African rainforest, using data from the chloroplast and nuclear genomes (DNA sequences and AFLP). We found highly contrasting patterns: while there was no evidence of gene flow between M. congensis and M. monophylla, species identity between M. monophylla and M. incertifolia was maintained despite considerable gene flow. We hypothesize that M. incertifolia originated from an ancient hybridization event between M. congensis and M. monophylla, considering the current absence of hybridization between the two assumed parent species, the rare presence of shared haplotypes between all three species and the high percentage of haplotypes shared by M. incertifolia with each of the two parent species. This example is contrasted with two parapatrically distributed species from the same family in the genus Haumania forming a hybrid zone restricted to the area of overlap. This work illustrates the diversity of speciation/introgression patterns that can potentially occur in the flora of tropical Africa.

  10. Vernal Pool Lessons and Activities.

    ERIC Educational Resources Information Center

    Childs, Nancy; Colburn, Betsy

    This curriculum guide accompanies Certified: A Citizen's Step-by-Step Guide to Protecting Vernal Pools which is designed to train volunteers in the process of identifying vernal pool habitat so that as many of these pools as possible can be certified by the Massachusetts Natural Heritage and Endangered Species Program. Vernal pools are a kind of…

  11. Nevoid basal cell carcinoma syndrome with medulloblastoma in an African-American boy: A rare case illustrating gene-environment interaction

    SciTech Connect

    Korczak, J.F.; Goldstein, A.M.; Kase, R.G.

    1997-03-31

    We present an 8-year-old African-American boy with medulloblastoma and nevoid basal cell carcinoma syndrome (NBCCS) who exhibited the radiosensitive response of basal cell carcinoma (BCC) formation in the area irradiated for medulloblastoma. Such a response is well-documented in Caucasian NBCCS patients with medulloblastoma. The propositus was diagnosed with medulloblastoma at the age of 2 years and underwent surgery, chemotherapy, and craniospinal irradiation. At the age of 6 years, he was diagnosed with NBCCS following his presentation with a large odontogenic keratocyst of the mandible, pits of the palms and soles and numerous BCCs in the area of the back and neck that had been irradiated previously for medulloblastoma. Examination of other relatives showed that the propositus mother also had NBCCS but was more mildly affected; in particular, she had no BCCs. This case illustrates complex gene-environment interaction, in that increased skin pigmentation in African-Americans is presumably protective against ultraviolet, but not ionizing, radiation. This case and other similar cases in the literature show the importance of considering NBCCS in the differential diagnosis of any patient who presents with a medulloblastoma, especially before the age of 5 years, and of examining other close relatives for signs of NBCCS to determine the patient`s at-risk status. Finally, for individuals who are radiosensitive, protocols that utilize chemotherapy in lieu of radiotherapy should be considered. 27 refs., 4 figs.

  12. [Blood proteins in African trypanosomiasis: variations and statistical interpretations].

    PubMed

    Cailliez, M; Poupin, F; Pages, J P; Savel, J

    1982-01-01

    The estimation of blood orosomucoid, haptoglobin, C-reactive protein and immunoglobulins levels, has enable us to prove a specific proteic profile in the human african trypanosomiasis, as compared with other that of parasitic diseases, and with an healthy african reference group. Data processing informatique by principal components analysis, provide a valuable pool for epidemiological surveys.

  13. Lack of specific alleles for the bovine chemokine (C-X-C) receptor type 4 (CXCR4) gene in West African cattle questions its role as a candidate for trypanotolerance.

    PubMed

    Álvarez, Isabel; Pérez-Pardal, Lucía; Traoré, Amadou; Fernández, Iván; Goyache, Félix

    2016-08-01

    A panel of 81 Asian, African and European cattle (Bos taurus and B. indicus) was analysed for the whole sequence of the CXCR4 gene (3844bp), a strong candidate for cattle trypanotolerance. Thirty-one polymorphic sites identified gave 31 different haplotypes. Neutrality tests rejected the hypothesis of either positive or purifying selection. Bayesian phylogenetic tree showed differentiation of haplotypes into two clades gathering genetic variability predating domestication. Related with clades definition, linkage disequilibrium analyses suggested the existence of one only linkage block on the CXCR4 gene. Two tag SNPs identified on exon 2 captured 50% of variability. Whatever the analysis carried out, no clear separation between cattle groups was identified. Most haplotypes identified in West African taurine cattle were also found in European cattle and in Asian and West African zebu. West African taurine samples did not carry unique variants on the CXCR4 gene sequence. The current analysis failed in identifying a causal mutation on the CXCR4 gene underlying a previously reported QTL for cattle trypanotolerance on BTA2.

  14. A gene expression study of dorso-ventrally restricted pigment pattern in adult fins of Neolamprologus meeli, an African cichlid species

    PubMed Central

    Sefc, Kristina M.

    2017-01-01

    Fish color patterns are among the most diverse phenotypic traits found in the animal kingdom. Understanding the molecular and cellular mechanisms that control in chromatophore distribution and pigmentation underlying this diversity is a major goal in developmental and evolutionary biology, which has predominantly been pursued in the zebrafish model system. Here, we apply results from zebrafish work to study a naturally occurring color pattern phenotype in the fins of an African cichlid species from Lake Tanganyika. The cichlid fish Neolamprologus meeli displays a distinct dorsal color pattern, with black and white stripes along the edges of the dorsal fin and of the dorsal half of the caudal fin, corresponding with differences in melanophore density. To elucidate the molecular mechanisms controlling the differences in dorsal and ventral color patterning in the fins, we quantitatively assessed the expression of 15 candidate target genes involved in adult zebrafish pigmentation and stripe formation. For reference gene validation, we screened the expression stability of seven widely expressed genes across the investigated tissue samples and identified tbp as appropriate reference. Relative expression levels of the candidate target genes were compared between the dorsal, striped fin regions and the corresponding uniform, grey-colored regions in the anal and ventral caudal fin. Dorso-ventral expression differences, with elevated levels in both white and black stripes, were observed in two genes, the melanosome protein coding gene pmel and in igsf11, which affects melanophore adhesion, migration and survival. Next, we predicted potential shared upstream regulators of pmel and igsf11. Testing the expression patterns of six predicted transcriptions factors revealed dorso-ventral expression difference of irf1 and significant, negative expression correlation of irf1 with both pmel and igsf11. Based on these results, we propose pmel, igsf11 and irf1 as likely components of

  15. Metschnikowia Species Share a Pool of Diverse rRNA Genes Differing in Regions That Determine Hairpin-Loop Structures and Evolve by Reticulation

    PubMed Central

    Sipiczki, Matthias; Pfliegler, Walter P.; Holb, Imre J.

    2013-01-01

    Modern taxonomy of yeasts is mainly based on phylogenetic analysis of conserved DNA and protein sequences. By far the most frequently used sequences are those of the repeats of the chromosomal rDNA array. It is generally accepted that the rDNA repeats of a genome have identical sequences due to the phenomenon of sequence homogenisation and can thus be used for identification and barcoding of species. Here we show that the rDNA arrays of the type strains of Metschnikowia andauensis and M. fructicola are not homogenised. Both have arrays consisting of diverse repeats that differ from each other in the D1/D2 domains by up to 18 and 25 substitutions. The variable sites are concentrated in two regions that correspond to back-folding stretches of hairpin loops in the predicted secondary structure of the RNA molecules. The substitutions do not alter significantly the overall hairpin-loop structure due to wobble base pairing at sites of C-T transitions and compensatory mutations in the complementary strand of the hairpin stem. The phylogenetic and network analyses of the cloned sequences revealed that the repeats had not evolved in a vertical tree-like way but reticulation might have shaped the rDNA arrays of both strains. The neighbour-net analysis of all cloned sequences of the type strains and the database sequences of different strains further showed that these species share a continuous pool of diverse repeats that appear to evolve by reticulate evolution. PMID:23805311

  16. Swimming Pools for Schools.

    ERIC Educational Resources Information Center

    Neilson, Donald W.; Nixon, John E.

    The increasing interest in swimming instruction and recreation for elementary and secondary school children has resulted in the development of this guide for swimming pool use, design, and construction. Introductory material discussed the need for swimming in the educational program and the organization of swimming programs in the school. Design…

  17. The Future of Pooling.

    ERIC Educational Resources Information Center

    Young, Peter C.; Fone, Martin

    1997-01-01

    Discusses seven propositions underlying the strategies that insurance pools can, will, and must pursue: (1) risk management versus risk financing; (2) elimination of windfall advantages; (3) the maintenance of market-dominant status; (4) cost leadership; (5) client focus; (6) innovation and diversification; and (7) leadership challenges. A sidebar…

  18. NEW APPROACHES: Pool table

    NASA Astrophysics Data System (ADS)

    Parry, Malcolm

    1998-05-01

    This article explains a novel way of demonstrating the principle of conservation of energy. This can be difficult to demonstrate in the laboratory, but if students have been convinced of the conservation of momentum, two-dimensional collisions on a pool table may be used.

  19. Thread Pool Interface (TPI)

    SciTech Connect

    Edwards, H. Carter

    2008-04-01

    Thread Pool Interface (TpI) provides a simple interface for running functions written in C or C++ in a thread-parallel mode. Application or library codes may need to perform operations thread-parallel on machines with multicore processors. the TPI library provides a simple mechanism for managing thread activation, deactivation, and thread-parallel execution of application-provided subprograms.

  20. Associations between HDL-cholesterol and polymorphisms in hepatic lipase and lipoprotein lipase genes are modified by dietary fat intake in African American and White adults.

    PubMed

    Nettleton, Jennifer A; Steffen, Lyn M; Ballantyne, Christie M; Boerwinkle, Eric; Folsom, Aaron R

    2007-10-01

    Polymorphisms in genes involved in HDL-cholesterol (HDL-C) metabolism influence plasma HDL-C concentrations. We examined whether dietary fat intake modified relations between HDL-C and polymorphisms in hepatic lipase (LIPC-514C-->T), cholesteryl ester transfer protein (CETP TaqIB), and lipoprotein lipase (LPL S447X) genes. Diet (food frequency questionnaire), plasma lipids, and LIPC, CETP, and LPL genotypes were assessed in approximately 12,000 White and African American adults. In both races and all genotypes studied, minor allele homozygotes had highest HDL-C concentrations compared to the other genotypes (P<0.001). However, main effects were modified by usual dietary fat intake. In African Americans - women somewhat more strongly than men -LIPC TT homozygotes with fat intake >or=33.2% of energy had approximately 3-4 mg/dL higher HDL-C concentrations than CC and CT genotypes. In contrast, when fat intake was <33.2% of energy, TT homozygotes had HDL-C concentrations approximately 3.5mg/dL greater than those with the CC genotype but not different from those with the CT genotype (P(interaction)=0.013). In Whites, LPLGG homozygotes had greatest HDL-C at lower total, saturated, and monounsaturated fat intakes but lowest HDL-C at higher intakes of these fats (P(interaction)

  1. Genetic variants determining survival and fertility in an adverse African environment: a population-based large-scale candidate gene association study

    PubMed Central

    Koopman, Jacob J.E.; Pijpe, Jeroen; Böhringer, Stefan; van Bodegom, David; Eriksson, Ulrika K.; Sanchez-Faddeev, Hernando; Ziem, Juventus B.; Zwaan, Bas; Slagboom, P. Eline; de Knijff, Peter; Westendorp, Rudi G.J.

    2016-01-01

    Human survival probability and fertility decline strongly with age. These life history traits have been shaped by evolution. However, research has failed to uncover a consistent genetic determination of variation in survival and fertility. As an explanation, such genetic determinants have been selected in adverse environments, in which humans have lived during most of their history, but are almost exclusively studied in populations in modern affluent environments. Here, we present a large-scale candidate gene association study in a rural African population living in an adverse environment. In 4387 individuals, we studied 4052 SNPs in 148 genes that have previously been identified as possible determinants of survival or fertility in animals or humans. We studied their associations with survival comparing newborns, middle-age adults, and old individuals. In women, we assessed their associations with reported and observed numbers of children. We found no statistically significant associations of these SNPs with survival between the three age groups nor with women's reported and observed fertility. Population stratification was unlikely to explain these results. Apart from a lack of power, we hypothesise that genetic heterogeneity of complex phenotypes and gene-environment interactions prevent the identification of genetic variants explaining variation in survival and fertility in humans. PMID:27356285

  2. Protective potency of clove oil and its transcriptional down-regulation of Aeromonas sobria virulence genes in African catfish (Clarias gariepinus L.).

    PubMed

    Abd El-Hamid, M I; Abd El-Aziz, N K; Ali, H A

    2016-08-31

    Disease episodes of fish caused by Aeromonas species are moved to the top list of limiting problems worldwide. The present study was planned to verify the in vitro antibacterial activities as well as the in vivo potential values of clove oil and ciprofloxacin against Aeromonas sobria in African catfish (Clarias gariepinus). The in vitro phenotypic virulence activities and the successful amplification of aerolysin and hemolysin genes in the precisely identified A. sobria strain were predictive for its virulence. In the in vivo assay, virulence of A. sobria strain was fully demonstrated based on constituent mRNA expression profile of tested virulence genes and typical septicemia associated with high mortalities of infected fish. Apparent lower mortality rates were correlated well with both decrescent bacterial burden and significant down-regulated transcripts of representative genes in the treated groups with clove oil, followed by ciprofloxacin as a prophylactic use for 15 days (P < 0.0001); however, the essential oil apart from ciprofloxacin significantly enhanced different hematological parameters (P < 0.05). In addition, administration of antibiotic may be considered as a pronounced stress factor in the fish even when it used in the prophylactic dose. In conclusion, medicinal plants-derived essential oils provide a virtually safer alternative to chemotherapeutics on fish, consumers and ecosystems.

  3. Deletion of virulence associated genes from attenuated African swine fever virus isolate OUR T88/3 decreases its ability to protect against challenge with virulent virus.

    PubMed

    Abrams, Charles C; Goatley, Lynnette; Fishbourne, Emma; Chapman, David; Cooke, Lyndsay; Oura, Christopher A; Netherton, Christopher L; Takamatsu, Haru-Hisa; Dixon, Linda K

    2013-08-15

    African swine fever virus (ASFV) causes an acute haemorrhagic disease of domestic pigs against which there is no effective vaccine. The attenuated ASFV strain OUR T88/3 has been shown previously to protect vaccinated pigs against challenge with some virulent strains including OUR T88/1. Two genes, DP71L and DP96R were deleted from the OUR T88/3 genome to create recombinant virus OUR T88/3ΔDP2. Deletion of these genes from virulent viruses has previously been shown to reduce ASFV virulence in domestic pigs. Groups of 6 pigs were immunised with deletion virus OUR T88/3ΔDP2 or parental virus OUR T88/3 and challenged with virulent OUR T88/1 virus. Four pigs (66%) were protected by inoculation with the deletion virus OUR T88/3ΔDP2 compared to 100% protection with the parental virus OUR T88/3. Thus the deletion of the two genes DP71L and DP96R from OUR T88/3 strain reduced its ability to protect pigs against challenge with virulent virus.

  4. Improving AFLP analysis of large-scale patterns of genetic variation--a case study with the Central African lianas Haumania spp (Marantaceae) showing interspecific gene flow.

    PubMed

    Ley, A C; Hardy, O J

    2013-04-01

    AFLP markers are often used to study patterns of population genetic variation and gene flow because they offer a good coverage of the nuclear genome, but the reliability of AFLP scoring is critical. To assess interspecific gene flow in two African rainforest liana species (Haumania danckelmaniana, H. liebrechtsiana) where previous evidence of chloroplast captures questioned the importance of hybridization and species boundaries, we developed new AFLP markers and a novel approach to select reliable bands from their degree of reproducibility. The latter is based on the estimation of the broad-sense heritability of AFLP phenotypes, an improvement over classical scoring error rates, which showed that the polymorphism of most AFLP bands was affected by a substantial nongenetic component. Therefore, using a quantitative genetics framework, we also modified an existing estimator of pairwise kinship coefficient between individuals correcting for the limited heritability of markers. Bayesian clustering confirms the recognition of the two Haumania species. Nevertheless, the decay of the relatedness between individuals of distinct species with geographic distance demonstrates that hybridization affects the nuclear genome. In conclusion, although we showed that AFLP markers might be substantially affected by nongenetic factors, their analysis using the new methods developed considerably advanced our understanding of the pattern of gene flow in our model species.

  5. The Lysobacter capsici AZ78 Genome Has a Gene Pool Enabling it to Interact Successfully with Phytopathogenic Microorganisms and Environmental Factors

    PubMed Central

    Puopolo, Gerardo; Tomada, Selena; Sonego, Paolo; Moretto, Marco; Engelen, Kristof; Perazzolli, Michele; Pertot, Ilaria

    2016-01-01

    Lysobacter capsici AZ78 has considerable potential for biocontrol of phytopathogenic microorganisms. However, lack of information about genetic cues regarding its biological characteristics may slow down its exploitation as a biofungicide. In order to obtain a comprehensive overview of genetic features, the L. capsici AZ78 genome was sequenced, annotated and compared with the phylogenetically related pathogens Stenotrophomonas malthophilia K729a and Xanthomonas campestris pv. campestris ATCC 33913. Whole genome comparison, supported by functional analysis, indicated that L. capsici AZ78 has a larger number of genes responsible for interaction with phytopathogens and environmental stress than S. malthophilia K729a and X. c. pv. campestris ATCC 33913. Genes involved in the production of antibiotics, lytic enzymes and siderophores were specific for L. capsici AZ78, as well as genes involved in resistance to antibiotics, environmental stressors, fungicides and heavy metals. The L. capsici AZ78 genome did not encompass genes involved in infection of humans and plants included in the S. malthophilia K729a and X. c. pv. campestris ATCC 33913 genomes, respectively. The L. capsici AZ78 genome provides a genetic framework for detailed analysis of other L. capsici members and the development of novel biofungicides based on this bacterial strain. PMID:26903975

  6. [Dose-Response Dependences for Frequency of RET/PTC Gene Rearrangements in Papillary Thyroid Carcinoma after Irradiation. Simple Pooling Analysis of Molecular Epidemiological Data].

    PubMed

    Koterov, A N; Ushenkova, L N; Biryukov, A P

    2016-01-01

    On the basis of all possible publications on the theme included in the previously formed base of sources on molecular epidemiology of RET/PTC rearrangements in thyroid papillary carcinoma a pooled analysis ("simple pooling data") on determination of the dose-effect dependences for RET/PTC frequency in radiogenic carcinomas of various irradiated groups was performed. (They are groups subjected to radiotherapeutic exposure, residents near the Chernobyl nuclear power plant (CNPP) and victims of nuclear bombing). The tendency to Pearson linear correlation (r = 0.746; p = 0.148) between the frequency of RET/PTC and the estimated dose on thyroid in the regions affected by the CNPP accident was revealed. But this tendency was recognized to be random owing to abnormally low values of the indicator for the most contaminated Gomel region. The method tentatively called "case-control" showed reliable differences in thyroid dose values for carcinomas with RET/PTC and without those. The versatility of changes was found: the lack of RET/PTC for radiotherapeutic impacts was associated with higher doses, whereas in case of the CNPP accident and for nuclear bombing victims it was the opposite. Probably, in the first case the "cellular cleaning" phenomenon after exposure to very high doses took place. Search of direct Pearson correlations between average/median thyroid doses on groups and RET/PTC frequency in carcinomas of these groups showed a high reliability for the dose-effect dependences- at the continuous dose scale (for RET/PTC in total and RET/PTC1 respectively: r = 0.830; p = 0.002 and r = 0.906; p = 0.0003); while there was no significant correlation received for RET/PTC3. When using the weighting least square regression analysis (proceeding from the number of carcinomas in samples), the specified regularities remained. Attempts to influence the strength of correlation by exception ofthe data of all the samples connected with the accident on the CNPP did not significantly

  7. Sequence variation identified in the 18S rRNA gene of Theileria mutans and Theileria velifera from the African buffalo (Syncerus caffer).

    PubMed

    Chaisi, Mamohale E; Collins, Nicola E; Potgieter, Fred T; Oosthuizen, Marinda C

    2013-01-16

    The African buffalo (Syncerus caffer) is a natural reservoir host for both pathogenic and non-pathogenic Theileria species. These often occur naturally as mixed infections in buffalo. Although the benign and mildly pathogenic forms do not have any significant economic importance, their presence could complicate the interpretation of diagnostic test results aimed at the specific diagnosis of the pathogenic Theileria parva in cattle and buffalo in South Africa. The 18S rRNA gene has been used as the target in a quantitative real-time PCR (qPCR) assay for the detection of T. parva infections. However, the extent of sequence variation within this gene in the non-pathogenic Theileria spp. of the Africa buffalo is not well known. The aim of this study was, therefore, to characterise the full-length 18S rRNA genes of Theileria mutans, Theileria sp. (strain MSD) and T. velifera and to determine the possible influence of any sequence variation on the specific detection of T. parva using the 18S rRNA qPCR. The reverse line blot (RLB) hybridization assay was used to select samples which either tested positive for several different Theileria spp., or which hybridised only with the Babesia/Theileria genus-specific probe and not with any of the Babesia or Theileria species-specific probes. The full-length 18S rRNA genes from 14 samples, originating from 13 buffalo and one bovine from different localities in South Africa, were amplified, cloned and the resulting recombinants sequenced. Variations in the 18S rRNA gene sequences were identified in T. mutans, Theileria sp. (strain MSD) and T. velifera, with the greatest diversity observed amongst the T. mutans variants. This variation possibly explained why the RLB hybridization assay failed to detect T. mutans and T. velifera in some of the analysed samples.

  8. Genetic variants in microRNA and microRNA biogenesis pathway genes and breast cancer risk among women of African ancestry.

    PubMed

    Qian, Frank; Feng, Ye; Zheng, Yonglan; Ogundiran, Temidayo O; Ojengbede, Oladosu; Zheng, Wei; Blot, William; Ambrosone, Christine B; John, Esther M; Bernstein, Leslie; Hu, Jennifer J; Ziegler, Regina G; Nyante, Sarah; Bandera, Elisa V; Ingles, Sue A; Press, Michael F; Nathanson, Katherine L; Hennis, Anselm; Nemesure, Barbara; Ambs, Stefan; Kolonel, Laurence N; Olopade, Olufunmilayo I; Haiman, Christopher A; Huo, Dezheng

    2016-10-01

    MicroRNAs (miRNA) regulate breast biology by binding to specific RNA sequences, leading to RNA degradation and inhibition of translation of their target genes. While germline genetic variations may disrupt some of these interactions between miRNAs and their targets, studies assessing the relationship between genetic variations in the miRNA network and breast cancer risk are still limited, particularly among women of African ancestry. We systematically put together a list of 822 and 10,468 genetic variants among primary miRNA sequences and 38 genes in the miRNA biogenesis pathway, respectively; and examined their association with breast cancer risk in the ROOT consortium which includes women of African ancestry. Findings were replicated in an independent consortium. Logistic regression was used to estimate the odds ratio (OR) and 95 % confidence intervals (CI). For overall breast cancer risk, three single-nucleotide polymorphisms (SNPs) in miRNA biogenesis genes DROSHA rs78393591 (OR = 0.69, 95 % CI: 0.55-0.88, P = 0.003), ESR1 rs523736 (OR = 0.88, 95 % CI: 0.82-0.95, P = 3.99 × 10(-4)), and ZCCHC11 rs114101502 (OR = 1.33, 95 % CI: 1.11-1.59, P = 0.002), and one SNP in primary miRNA sequence (rs116159732 in miR-6826, OR = 0.74, 95 % CI: 0.63-0.89, P = 0.001) were found to have significant associations in both discovery and validation phases. In a subgroup analysis, two SNPs were associated with risk of estrogen receptor (ER)-negative breast cancer, and three SNPs were associated with risk of ER-positive breast cancer. Several variants in miRNA and miRNA biogenesis pathway genes were associated with breast cancer risk. Risk associations varied by ER status, suggesting potential new mechanisms in etiology.

  9. African Universities Tackle the Continent's Agricultural Crisis

    ERIC Educational Resources Information Center

    Lindow, Megan

    2009-01-01

    Pests, population growth, and depleted soil have wreaked havoc on agriculture in Africa, so universities across the continent are rethinking how they teach the topic. Some African universities have been building their own networks and pooling their limited resources to train more agricultural scientists and improve their responsiveness to the…

  10. Salinity-related variation in gene expression in wild populations of the black-chinned tilapia from various West African coastal marine, estuarine and freshwater habitats

    NASA Astrophysics Data System (ADS)

    Tine, Mbaye; McKenzie, David J.; Bonhomme, François; Durand, Jean-Dominique

    2011-01-01

    This study measured the relative expression of the genes coding for Na +, K +-ATPase 1α(NAKA), voltage-dependent anion channel (VDAC), cytochrome c oxidase-1 (COX), and NADH dehydrogenase (NDH), in gills of six wild populations of a West African tilapia species, acclimatised to a range of seasonal (rainy or dry) salinities in coastal, estuarine and freshwater sites. Previous laboratory experiments have demonstrated that these genes, involved in active ion transport, oxidative phosphorylation, and intra-cellular ATP transport, are relatively over-expressed in gill tissues of this species acclimated to high salinity. Positive correlations between relative expression and ambient salinity were found for all genes in the wild populations (Spearman rank correlation, p < 0.05), although for some genes these were only significant in either the rainy season or dry season. Most significantly, however, relative expression was positively correlated amongst the four genes, indicating that they are functionally interrelated in adaptation of Sarotherodon melanotheron to salinity variations in its natural environment. In the rainy season, when salinity was unstable and ranged between zero and 37 psu across the sites, overall mean expression of the genes was higher than in the dry season, which may have reflected more variable particularly sudden fluctuations in salinity and poorer overall water quality. In the dry season, when the salinity is more stable but ranged between zero and 100 psu across the sites, NAKA, NDH and VDAC expression revealed U-shaped relationships with lowest relative expression at salinities approaching seawater, between 25 and 45 psu. Although it is not simple to establish direct relationship between gene expression levels and energy requirement for osmoregulation, these results may indicate that costs of adaptation to salinity are lowest in seawater, the natural environment of this species. While S. melanotheron can colonise environments with extremely

  11. Allergic to Pool Water

    PubMed Central

    2012-01-01

    To identify the allergy problem of a 36-year old swimming instructor, who experiences heavy itching and rashes whenever she comes in contact with pool water. Patch tests were performed with European standard series and materials from the work floor. A positive patch test to aluminum chloride and flocculant was observed. Occupational dermatitis is, based on a contact allergy to aluminum chloride in the flocculant. PMID:22993713

  12. The African Pediatric Fellowship Program: Training in Africa for Africans.

    PubMed

    Wilmshurst, Jo M; Morrow, Brenda; du Preez, Avril; Githanga, David; Kennedy, Neil; Zar, Heather J

    2016-01-01

    Africa has a significant burden of childhood disease, with relatively few skilled health care professionals. The African Paediatric Fellowship Programme was developed by the Department of Pediatrics and Child Health at the University of Cape Town to provide relevant training for African child health professionals, by Africans, within Africa. Trainees identified by partner academic institutions spend 6 months to 2 years training in the Department of Pediatrics and allied disciplines. They then return to their home institution to build practice, training, research, and advocacy. From 2008 to 2015, 73 physicians have completed or are completing training in general pediatrics or a pediatric subspecialty. At 1 year posttraining, 98% to 100% are practicing back in their home institution. The impact of the returning fellows is evident from their practice interventions, research collaborations, and positions as stakeholders who can change health care policies. Thirty-three centers in 13 African countries are partners with the program, and the program template is now followed by other partner sites in Africa. Increasing and retaining the skills pool of African child health specialists is building a network of motivated, highly skilled clinicians who are equipped to advance child health in Africa.

  13. Swimming Pools and Molluscum Contagiosum

    MedlinePlus

    ... Travelers’ Health: Smallpox & Other Orthopoxvirus-Associated Infections Poxvirus Swimming Pools Recommend on Facebook Tweet Share Compartir The ... often ask if molluscum virus can spread in swimming pools. There is also concern that it can ...

  14. ADRB2 gene variants, dual-energy x-ray absorptiometry body composition, and hypertension in Tobago men of African descent.

    PubMed

    Beason, Tracey Samantha; Bunker, Clareann H; Zmuda, Joseph M; Wilson, John W; Patrick, Alan L; Wheeler, Victor W; Weissfeld, Joel L

    2011-05-01

    Classic tissue effects of β(2)-adrenergic receptor activation include skeletal muscle glycogenolysis and vascular smooth muscle relaxation, factors relevant to obesity and hypertension, respectively. In a population-based study, we examined 2 common amino acid substitutions in the β(2)-adrenergic receptor gene (ADRB2) in relation to body composition and blood pressure. A cross-sectional analysis of 1893 African-descent men living in Tobago and participating in a prostate cancer screening study was performed. Body mass index, waist circumference, blood pressure, dual-energy x-ray absorptiometry body composition, and ADRB2 (Arg16Gly; Gln27Glu) genotype were determined. Twenty-six percent were obese (body mass index ≥30 kg/m(2)), and 50% were hypertensive. ADRB2 Arg16Gly and Gln27Glu alleles were in linkage disequilibrium (D' = 0.96, r(2) = 0.15). ADRB2 16Gly-containing and 27Glu-containing genotypes were equally frequent in low, medium, and high tertiles of percentage of body fat mass (16Gly-containing genotypes: 73.4%, 74.4%, and 74.5%, P(trend) = .66; 27Glu-containing genotypes: 27.6%, 23.8%, and 25.4%, P(trend) = .39) and in normal blood pressure, prehypertensive, and hypertensive men (16Gly-containing genotypes: 73.4%, 72.8%, and 74.4%, P(trend) = .61; 27Glu-containing genotypes: 25.6%, 24.1%, and 26.7%, P(trend) = .50). In a high-obesity and high-hypertension risk population with ancestry in common with African Americans, genetic variation defined by 2 common ADRB2 amino acid substitutions was not associated with body composition or hypertension.

  15. Single Nucleotide Polymorphisms in JAZF1 and BCL11A gene are nominally associated with Type 2 Diabetes in African American Families from the GENNID Study

    PubMed Central

    Langberg, Kurt A.; Ma, Lijun; Sharma, Neeraj K; Hanis, Craig L.; Elbein, Steven C.; Hasstedt, Sandra J.; Das, Swapan K.

    2011-01-01

    Prior type 2 diabetes (T2D) genome-wide association studies (GWASs) have generated a list of well-replicated susceptibility loci in populations of European and Asian ancestry. In order to validate the trans-ethnic contribution of these GWAS SNPs, we performed a family-based association analysis of 32 selected GWAS SNPs in a cohort of 1496 African American (AA) subjects from the GENNID study. Functional roles of these SNPs were evaluated by screening cis-eQTLs in transformed lymphoblast cell lines available for a sub-group of GENNID families from Arkansas. Only three of the 32 GWAS-derived SNPs showed nominally significant association with T2D in our AA cohort. Among the replicated SNPs rs864745 in JAZF1 and rs10490072 in BCL11A gene (p= 0.006 and 0.03, respectively, after adjustment for BMI) were within the 1-lod drop support interval of T2D linkage peaks reported in these families. Genotyping of 19 Tag-SNPs in these two loci revealed no further common SNPs or haplotypes that may be a stronger predictor of T2D susceptibility than the index SNPs. Six T2D GWAS SNPs (rs6698181, rs9472138, rs730497, rs10811661, rs11037909, and rs1153188) were associated with nearby transcript expression in transformed lymphoblast cell lines of GENNID AA subjects. Thus, our study indicates a nominal role for JAZF1 and BCL11A variants in T2D susceptibility in AAs and suggested little overlap in known susceptibility to T2D between European and African derived populations when considering GWAS SNPs alone. PMID:22113416

  16. ECS DAAC Data Pools

    NASA Astrophysics Data System (ADS)

    Kiebuzinski, A. B.; Bories, C. M.; Kalluri, S.

    2002-12-01

    As part of its Earth Observing System (EOS), NASA supports operations for several satellites including Landsat 7, Terra, and Aqua. ECS (EOSDIS Core System) is a vast archival and distribution system and includes several Distributed Active Archive Centers (DAACs) located around the United States. EOSDIS reached a milestone in February when its data holdings exceeded one petabyte (1,000 terabytes) in size. It has been operational since 1999 and originally was intended to serve a large community of Earth Science researchers studying global climate change. The Synergy Program was initiated in 2000 with the purpose of exploring and expanding the use of remote sensing data beyond the traditional research community to the applications community including natural resource managers, disaster/emergency managers, urban planners and others. This included facilitating data access at the DAACs to enable non-researchers to exploit the data for their specific applications. The combined volume of data archived daily across the DAACs is of the order of three terabytes. These archived data are made available to the research community and to general users of ECS data. Currently, the average data volume distributed daily is two terabytes, which combined with an ever-increasing need for timely access to these data, taxes the ECS processing and archival resources for more real-time use than was previously intended for research purposes. As a result, the delivery of data sets to users was being delayed in many cases, to unacceptable limits. Raytheon, under the auspices of the Synergy Program, investigated methods at making data more accessible at a lower cost of resources (processing and archival) at the DAACs. Large on-line caches (as big as 70 Terabytes) of data were determined to be a solution that would allow users who require contemporary data to access them without having to pull it from the archive. These on-line caches are referred to as "Data Pools." In the Data Pool concept

  17. Dynamics of the Linuron Hydrolase libA Gene Pool Size in Response to Linuron Application and Environmental Perturbations in Agricultural Soil and On-Farm Biopurification Systems

    PubMed Central

    Bers, Karolien; Sniegowski, Kristel; De Mot, René

    2012-01-01

    libA, a gene encoding a novel type of linuron hydrolase, was recently identified in the linuron-mineralizing Variovorax sp. strain SRS16. In order to assess the contribution of libA to linuron degradation in environmental settings, libA abundance was monitored in response to the application of linuron and to environmental perturbations in agricultural soil microcosms and microcosms simulating the matrix of on-farm biopurification systems. libA numbers were measured by real-time PCR and linked to reported data of Variovorax community composition and linuron mineralization capacity. In the soil microcosms and one biopurification system setup, libA numbers responded to the application of linuron and environmental changes in congruency with the modulation of linuron mineralization capacity and the occurrence of a particular Variovorax phylotype (phylotype A). However, in another biopurification system setup, no such correlations were found. Our data suggest that in the simulated environmental settings, the occurrence of libA can be linked to the linuron mineralization capacity and that libA is primarily hosted by Variovorax phylotype A strains. However, the results also suggest that, apart from libA, other, as-yet-unknown isofunctional genes play an important role in linuron mineralization in the environment. PMID:22307296

  18. Identification of Theileria parva and Theileria sp. (buffalo) 18S rRNA gene sequence variants in the African Buffalo (Syncerus caffer) in southern Africa.

    PubMed

    Chaisi, Mamohale E; Sibeko, Kgomotso P; Collins, Nicola E; Potgieter, Fred T; Oosthuizen, Marinda C

    2011-12-15

    Theileria parva is the causative agent of Corridor disease in cattle in South Africa. The African buffalo (Syncerus caffer) is the reservoir host, and, as these animals are important for eco-tourism in South Africa, it is compulsory to test and certify them disease free prior to translocation. A T. parva-specific real-time polymerase chain reaction (PCR) test based on the small subunit ribosomal RNA (18S rRNA) gene is one of the tests used for the diagnosis of the parasite in buffalo and cattle in South Africa. However, because of the high similarity between the 18S rRNA gene sequences of T. parva and Theileria sp. (buffalo), the latter is also amplified by the real-time PCR primers, although it is not detected by the T. parva-specific hybridization probes. Preliminary sequencing studies have revealed a small number of sequence differences within the 18S rRNA gene in both species but the extent of this sequence variation is unknown. The aim of the current study was to sequence the 18S rRNA genes of T. parva and Theileria sp. (buffalo), and to determine whether all identified genotypes can be correctly detected by the real-time PCR assay. The reverse line blot (RLB) hybridization assay was used to identify T. parva and Theileria sp. (buffalo) positive samples from buffalo blood samples originating from the Kruger National Park, Hluhluwe-iMfolozi Park, the Greater Limpopo Transfrontier Park, and a private game ranch in the Hoedspruit area. T. parva and Theileria sp. (buffalo) were identified in 42% and 28%, respectively, of 252 samples, mainly as mixed infections. The full-length 18S rRNA gene of selected samples was amplified, cloned and sequenced. From a total of 20 sequences obtained, 10 grouped with previously published T. parva sequences from GenBank while 10 sequences grouped with a previously published Theileria sp. (buffalo) sequence. All these formed a monophyletic group with known pathogenic Theileria species. Our phylogenetic analyses confirm the

  19. Genome-wide patterns of population structure and admixture in West Africans and African Americans.

    PubMed

    Bryc, Katarzyna; Auton, Adam; Nelson, Matthew R; Oksenberg, Jorge R; Hauser, Stephen L; Williams, Scott; Froment, Alain; Bodo, Jean-Marie; Wambebe, Charles; Tishkoff, Sarah A; Bustamante, Carlos D

    2010-01-12

    Quantifying patterns of population structure in Africans and African Americans illuminates the history of human populations and is critical for undertaking medical genomic studies on a global scale. To obtain a fine-scale genome-wide perspective of ancestry, we analyze Affymetrix GeneChip 500K genotype data from African Americans (n = 365) and individuals with ancestry from West Africa (n = 203 from 12 populations) and Europe (n = 400 from 42 countries). We find that population structure within the West African sample reflects primarily language and secondarily geographical distance, echoing the Bantu expansion. Among African Americans, analysis of genomic admixture by a principal component-based approach indicates that the median proportion of European ancestry is 18.5% (25th-75th percentiles: 11.6-27.7%), with very large variation among individuals. In the African-American sample as a whole, few autosomal regions showed exceptionally high or low mean African ancestry, but the X chromosome showed elevated levels of African ancestry, consistent with a sex-biased pattern of gene flow with an excess of European male and African female ancestry. We also find that genomic profiles of individual African Americans afford personalized ancestry reconstructions differentiating ancient vs. recent European and African ancestry. Finally, patterns of genetic similarity among inferred African segments of African-American genomes and genomes of contemporary African populations included in this study suggest African ancestry is most similar to non-Bantu Niger-Kordofanian-speaking populations, consistent with historical documents of the African Diaspora and trans-Atlantic slave trade.

  20. Association analysis of photoperiodic flowering time genes in west and central African sorghum [Sorghum bicolor (L.) Moench

    PubMed Central

    2012-01-01

    Background Photoperiod-sensitive flowering is a key adaptive trait for sorghum (Sorghum bicolor) in West and Central Africa. In this study we performed an association analysis to investigate the effect of polymorphisms within the genes putatively related to variation in flowering time on photoperiod-sensitive flowering in sorghum. For this purpose a genetically characterized panel of 219 sorghum accessions from West and Central Africa was evaluated for their photoperiod response index (PRI) based on two sowing dates under field conditions. Results Sorghum accessions used in our study were genotyped for single nucleotide polymorphisms (SNPs) in six genes putatively involved in the photoperiodic control of flowering time. Applying a mixed model approach and previously-determined population structure parameters to these candidate genes, we found significant associations between several SNPs with PRI for the genes CRYPTOCHROME 1 (CRY1-b1) and GIGANTEA (GI). Conclusions The negative values of Tajima's D, found for the genes of our study, suggested that purifying selection has acted on genes involved in photoperiodic control of flowering time in sorghum. The SNP markers of our study that showed significant associations with PRI can be used to create functional markers to serve as important tools for marker-assisted selection of photoperiod-sensitive cultivars in sorghum. PMID:22394582

  1. Differential gene expression in the liver of the African lungfish, Protopterus annectens, after 6 days of estivation in air.

    PubMed

    Loong, A M; Hiong, K C; Wong, W P; Chew, S F; Ip, Y K

    2012-02-01

    This study aimed to identify estivation-specific gene clusters through the determination of differential gene expressions in the liver of Protopterus annectens after 6 days of estivation in a mucus cocoon in air (normoxia) using suppression subtractive hybridization polymerase chain reaction. Our results demonstrated that 6 days of estivation in normoxia led to up-regulation of mRNA expressions of several genes related to urea synthesis, including carbamoyl phosphate synthetase (Cps), argininosuccinate synthetase and glutamine synthetase. They indicate that increased urea synthesis, despite being energy-intensive, is an important adaptive response of estivation. They also offer indirect support to the proposition that urea synthesis in this lungfish involved a Cps that uses glutamine as a substrate. In addition, up- or down-regulation of several gene clusters occurred in the liver of P. annectens after 6 days of estivation in normoxia. These estivation-specific genes were involved in the prevention of clot formation, activation of the lectin pathway for complement activation, conservation of minerals (e.g. iron and copper) and increased production of hemoglobin beta. Since there were up- and down-regulation of mRNA expressions of genes related to ribosomal proteins and translational elongation factors, there could be simultaneous increases in protein degradation and protein synthesis during the first 6 days (the induction phase) of estivation, confirming the importance of reconstruction of protein structures in preparation for the maintenance phase of estivation.

  2. Pooling analysis of genetic data: the association of leptin receptor (LEPR) polymorphisms with variables related to human adiposity.

    PubMed Central

    Heo, M; Leibel, R L; Boyer, B B; Chung, W K; Koulu, M; Karvonen, M K; Pesonen, U; Rissanen, A; Laakso, M; Uusitupa, M I; Chagnon, Y; Bouchard, C; Donohoue, P A; Burns, T L; Shuldiner, A R; Silver, K; Andersen, R E; Pedersen, O; Echwald, S; Sørensen, T I; Behn, P; Permutt, M A; Jacobs, K B; Elston, R C; Hoffman, D J; Allison, D B

    2001-01-01

    Analysis of raw pooled data from distinct studies of a single question generates a single statistical conclusion with greater power and precision than conventional metaanalysis based on within-study estimates. However, conducting analyses with pooled genetic data, in particular, is a daunting task that raises important statistical issues. In the process of analyzing data pooled from nine studies on the human leptin receptor (LEPR) gene for the association of three alleles (K109R, Q223R, and K656N) of LEPR with body mass index (BMI; kilograms divided by the square of the height in meters) and waist circumference (WC), we encountered the following methodological challenges: data on relatives, missing data, multivariate analysis, multiallele analysis at multiple loci, heterogeneity, and epistasis. We propose herein statistical methods and procedures to deal with such issues. With a total of 3263 related and unrelated subjects from diverse ethnic backgrounds such as African-American, Caucasian, Danish, Finnish, French-Canadian, and Nigerian, we tested effects of individual alleles; joint effects of alleles at multiple loci; epistatic effects among alleles at different loci; effect modification by age, sex, diabetes, and ethnicity; and pleiotropic genotype effects on BMI and WC. The statistical methodologies were applied, before and after multiple imputation of missing observations, to pooled data as well as to individual data sets for estimates from each study, the latter leading to a metaanalysis. The results from the metaanalysis and the pooling analysis showed that none of the effects were significant at the 0.05 level of significance. Heterogeneity tests showed that the variations of the nonsignificant effects are within the range of sampling variation. Although certain genotypic effects could be population specific, there was no statistically compelling evidence that any of the three LEPR alleles is associated with BMI or waist circumference in the general

  3. The SPANX gene family of cancer/testis-specific antigens: rapid evolution and amplification in African great apes and hominids.

    PubMed

    Kouprina, Natalay; Mullokandov, Michael; Rogozin, Igor B; Collins, N Keith; Solomon, Greg; Otstot, John; Risinger, John I; Koonin, Eugene V; Barrett, J Carl; Larionov, Vladimir

    2004-03-02

    Human sperm protein associated with the nucleus on the X chromosome (SPANX) genes comprise a gene family with five known members (SPANX-A1, -A2, -B, -C, and -D), encoding cancer/testis-specific antigens that are potential targets for cancer immunotherapy. These highly similar paralogous genes cluster on the X chromosome at Xq27. We isolated and sequenced primate genomic clones homologous to human SPANX. Analysis of these clones and search of the human genome sequence revealed an uncharacterized group of genes, SPANX-N, which are present in all primates as well as in mouse and rat. In humans, four SPANX-N genes comprise a series of tandem duplicates at Xq27; a fifth member of this subfamily is located at Xp11. Similarly to SPANX-A/D, human SPANX-N genes are expressed in normal testis and some melanoma cell lines; testis-specific expression of SPANX is also conserved in mouse. Analysis of the taxonomic distribution of the long and short forms of the intron indicates that SPANX-N is the ancestral form, from which the SPANX-A/D subfamily evolved in the common ancestor of the hominoid lineage. Strikingly, the coding sequences of the SPANX genes evolved much faster than the intron and the 5' untranslated region. There is a strong correlation between the rates of evolution of synonymous and nonsynonymous codon positions, both of which are accelerated 2-fold or more compared to the noncoding sequences. Thus, evolution of the SPANX family appears to have involved positive selection that affected not only the protein sequence but also the synonymous sites in the coding sequence.

  4. Cloning and expression analysis of interferon-γ-inducible-lysosomal thiol reductase gene in South African clawed frog (Xenopus laevis).

    PubMed

    Cui, Xian-wei; Xiao, Wen; Ke, Zhen; Liu, Xia; Xu, Xing-zhou; Zhang, Shuang-quan

    2011-12-01

    In this study, an interferon-γ-inducible-lysosomal thiol reductase (GILT) homologue has been cloned and identified from South African clawed frog Xenopus laevis (designated XlGILT). The open reading frame (ORF) of XlGILT consists of 771 bases encoding a protein of 256 amino acids with an estimated molecular mass of 28.76kDa and a theoretical isoelectric point of 5.12. The N-terminus of the XlGILT was found to have a putative signal peptide with a cleavage site amino acid position at 15-16. SMART analysis showed that the XlGILT contained a GILT active-site C(69)GGC(72) motif and a GILT signature motif C(114)QHGKEECIGNLIETC(129). The expression levels of XlGILT mRNA were higher in spleen and peripheral blood mononuclear cells (PBMCs), moderate in liver, intestine, heart and kidney, and lower in lung. The XlGILT mRNA expression was significantly up-regulated in spleen in vivo and PBMCs in vitro after LPS stimulation. The soluble X. laevis GILT (XlsGILT) was inserted into a pET28a vector and expressed in BL21 (DE3) cells as a His-tag fusion enzyme. After purification, further study revealed that XlsGILT was capable of catalyzing the reduction of the interchain disulfide bonds intact IgG. These results will allow for further investigation to unravel the role of this key enzyme in class II MHC-restricted antigen processing and to use X. laevis as an in vivo model for related studies.

  5. The susceptibility of five African Anopheles species to Anabaena PCC 7120 expressing Bacillus thuringiensis subsp. israelensis mosquitocidal cry genes

    PubMed Central

    2012-01-01

    Background Malaria, one of the leading causes of death in Africa, is transmitted by the bite of an infected female Anopheles mosquito. Problems associated with the development of resistance to chemical insecticides and concerns about the non-target effects and persistence of chemical insecticides have prompted the development of environmentally friendly mosquito control agents. The aim of this study was to evaluate the larvicidal activity of a genetically engineered cyanobacterium, Anabaena PCC 7120#11, against five African Anopheles species in laboratory bioassays. Findings There were significant differences in the susceptibility of the anopheline species to PCC 7120#11. The ranking of the larvicidal activity of PCC 7120#11 against species in the An. gambiae complex was: An. merus

  6. Common variants in the CD36 gene are associated with oral fat perception, fat preferences, and obesity in African Americans.

    PubMed

    Keller, Kathleen L; Liang, Lisa C H; Sakimura, Johannah; May, Daniel; van Belle, Christopher; Breen, Cameron; Driggin, Elissa; Tepper, Beverly J; Lanzano, Patricia C; Deng, Liyong; Chung, Wendy K

    2012-05-01

    Animal studies show that CD36, a fatty acid translocase, is involved in fat detection and preference, but these findings have not been reported in humans. The objective of this study was to determine whether human genetic variation in 5 common CD36 polymorphisms is associated with oral fat perception of Italian salad dressings, self-reported acceptance of high-fat foods and obesity in African-American adults (n = 317). Ratings of perceived oiliness, fat content, and creaminess were assessed on a 170-mm visual analogue scale (VAS) in response to salad dressings that were 5%, 35%, and 55% fat-by-weight content. Acceptance of added fats and oils and high-fat foods was self-reported and anthropometric measures were taken in the laboratory. DNA was isolated from saliva and genotyped at 5 CD36 polymorphisms. Three polymorphisms, rs1761667, rs3840546, and rs1527483 were associated with the outcomes. Participants with the A/A genotype at rs1761667 reported greater perceived creaminess, regardless of the fat concentration of the salad dressings (P < 0.01) and higher mean acceptance of added fats and oils (P = 0.02) compared to those with other genotypes at this site. Individuals who had C/T or T/T genotypes at rs1527483 also perceived greater fat content in the salad dressings, independent of fat concentration (P = 0.03). BMI and waist circumference were higher in participants who were homozygous for a deletion (D/D) at rs3840546, compared to I/D or D/D individuals (P < 0.001), but only 2 D/D individuals were tested, so this finding needs replication. This is the first study to demonstrate an association between common variants in CD36 and fat ingestive behaviors in humans.

  7. Common Variants in the CD36 Gene Are Associated With Oral Fat Perception, Fat Preferences, and Obesity in African Americans

    PubMed Central

    Keller, Kathleen L.; Liang, Lisa C.H.; Sakimura, Johannah; May, Daniel; van Belle, Christopher; Breen, Cameron; Driggin, Elissa; Tepper, Beverly J.; Lanzano, Patricia C.; Deng, Liyong; Chung, Wendy K.

    2013-01-01

    Animal studies show that CD36, a fatty acid translocase, is involved in fat detection and preference, but these findings have not been reported in humans. The objective of this study was to determine whether human genetic variation in 5 common CD36 polymorphisms is associated with oral fat perception of Italian salad dressings, self-reported acceptance of high-fat foods and obesity in African-American adults (n = 317). Ratings of perceived oiliness, fat content, and creaminess were assessed on a 170-mm visual analogue scale (VAS) in response to salad dressings that were 5%, 35%, and 55% fat-by-weight content. Acceptance of added fats and oils and high-fat foods was self-reported and anthropometric measures were taken in the laboratory. DNA was isolated from saliva and genotyped at 5 CD36 polymorphisms. Three polymorphisms, rs1761667, rs3840546, and rs1527483 were associated with the outcomes. Participants with the A/A genotype at rs1761667 reported greater perceived creaminess, regardless of the fat concentration of the salad dressings (P < 0.01) and higher mean acceptance of added fats and oils (P = 0.02) compared to those with other genotypes at this site. Individuals who had C/T or T/T genotypes at rs1527483 also perceived greater fat content in the salad dressings, independent of fat concentration (P = 0.03). BMI and waist circumference were higher in participants who were homozygous for a deletion (D/D) at rs3840546, compared to I/D or D/D individuals (P < 0.001), but only 2 D/D individuals were tested, so this finding needs replication. This is the first study to demonstrate an association between common variants in CD36 and fat ingestive behaviors in humans. PMID:22240721

  8. Ku is important for telomere maintenance, but not for differential expression of telomeric VSG genes, in African trypanosomes.

    PubMed

    Conway, Colin; McCulloch, Richard; Ginger, Michael L; Robinson, Nicholas P; Browitt, Alison; Barry, J David

    2002-06-14

    Trypanosome antigenic variation, involving differential expression of variant surface glycoprotein (VSG) genes, has a strong association with telomeres and with DNA recombination. All expressed VSGs are telomeric, and differential activation involves recombination into the telomeric environment or silencing/activation of subtelomeric promoters. A number of pathogen contingency gene systems associated with immune evasion involve telomeric loci, which has prompted speculation that chromosome ends provide conditions conducive for the operation of rapid gene switching mechanisms. Ku is a protein associated with eukaryotic telomeres that is directly involved in DNA recombination and in gene silencing. We have tested the hypothesis that Ku in trypanosomes is centrally involved in differential VSG expression. We show, via the generation of null mutants, that trypanosome Ku is closely involved in telomere length maintenance, more so for a transcriptionally active than an inactive telomere, but exhibits no detectable influence on DNA double strand break repair. The absence of Ku and the consequent great shortening of telomeres had no detectable influence either on the rate of VSG switching or on the silencing of the telomeric promoters of the VSG subset that is expressed in the tsetse fly.

  9. Evolutionary history of trypanosomes from South American caiman (Caiman yacare) and African crocodiles inferred by phylogenetic analyses using SSU rDNA and gGAPDH genes.

    PubMed

    Viola, L B; Almeida, R S; Ferreira, R C; Campaner, M; Takata, C S A; Rodrigues, A C; Paiva, F; Camargo, E P; Teixeira, M M G

    2009-01-01

    In this study, using a combined data set of SSU rDNA and gGAPDH gene sequences, we provide phylogenetic evidence that supports clustering of crocodilian trypanosomes from the Brazilian Caiman yacare (Alligatoridae) and Trypanosoma grayi, a species that circulates between African crocodiles (Crocodilydae) and tsetse flies. In a survey of trypanosomes in Caiman yacare from the Brazilian Pantanal, the prevalence of trypanosome infection was 35% as determined by microhaematocrit and haemoculture, and 9 cultures were obtained. The morphology of trypomastigotes from caiman blood and tissue imprints was compared with those described for other crocodilian trypanosomes. Differences in morphology and growth behaviour of caiman trypanosomes were corroborated by molecular polymorphism that revealed 2 genotypes. Eight isolates were ascribed to genotype Cay01 and 1 to genotype Cay02. Phylogenetic inferences based on concatenated SSU rDNA and gGAPDH sequences showed that caiman isolates are closely related to T. grayi, constituting a well-supported monophyletic assemblage (clade T. grayi). Divergence time estimates based on clade composition, and biogeographical and geological events were used to discuss the relationships between the evolutionary histories of crocodilian trypanosomes and their hosts.

  10. A second gene for the African green monkey poliovirus receptor that has no putative N-glycosylation site in the functional N-terminal immunoglobulin-like domain.

    PubMed Central

    Koike, S; Ise, I; Sato, Y; Yonekawa, H; Gotoh, O; Nomoto, A

    1992-01-01

    Using cDNA of the human poliovirus receptor (PVR) as a probe, two types of cDNA clones of the monkey homologs were isolated from a cDNA library prepared from an African green monkey kidney cell line. Either type of cDNA clone rendered mouse L cells permissive for poliovirus infection. Homologies of the amino acid sequences deduced from these cDNA sequences with that of human PVR were 90.2 and 86.4%, respectively. These two monkey PVRs were found to be encoded in two different loci of the genome. Evolutionary analysis suggested that duplication of the PVR gene in the monkey genome had occurred after the species differentiation between humans and monkeys. The NH2-terminal immunoglobulin-like domain, domain 1, of the second monkey PVR, which lacks a putative N-glycosylation site, mediated poliovirus infection. In addition, a human PVR mutant without N-glycosylation sites in domain 1 also promoted viral infection. These results suggest that domain 1 of the monkey receptor also harbors the binding site for poliovirus and that sugar moieties possibly attached to this domain of human PVR are dispensable for the virus-receptor interaction. Images PMID:1331508

  11. Four plant defensins from an indigenous South African Brassicaceae species display divergent activities against two test pathogens despite high sequence similarity in the encoding genes

    PubMed Central

    2011-01-01

    Background Plant defensins are an important component of the innate defence system of plants where they form protective antimicrobial barriers between tissue types of plant organs as well as around seeds. These peptides also have other activities that are important for agricultural applications as well as the medical sector. Amongst the numerous plant peptides isolated from a variety of plant species, a significant number of promising defensins have been isolated from Brassicaceae species. Here we report on the isolation and characterization of four defensins from Heliophila coronopifolia, a native South African Brassicaceae species. Results Four defensin genes (Hc-AFP1-4) were isolated with a homology based PCR strategy. Analysis of the deduced amino acid sequences showed that the peptides were 72% similar and grouped closest to defensins isolated from other Brassicaceae species. The Hc-AFP1 and 3 peptides shared high homology (94%) and formed a unique grouping in the Brassicaceae defensins, whereas Hc-AFP2 and 4 formed a second homology grouping with defensins from Arabidopsis and Raphanus. Homology modelling showed that the few amino acids that differed between the four peptides had an effect on the surface properties of the defensins, specifically in the alpha-helix and the loop connecting the second and third beta-strands. These areas are implicated in determining differential activities of defensins. Comparing the activities after recombinant production of the peptides, Hc-AFP2 and 4 had IC50 values of 5-20 μg ml-1 against two test pathogens, whereas Hc-AFP1 and 3 were less active. The activity against Botrytis cinerea was associated with membrane permeabilization, hyper-branching, biomass reduction and even lytic activity. In contrast, only Hc-AFP2 and 4 caused membrane permeabilization and severe hyper-branching against the wilting pathogen Fusarium solani, while Hc-AFP1 and 3 had a mild morphogenetic effect on the fungus, without any indication of

  12. Allele mining in the pepper gene pool provided new complementation effects between pvr2-eIF4E and pvr6-eIF(iso)4E alleles for resistance to pepper veinal mottle virus.

    PubMed

    Rubio, Manuel; Nicolaï, Maryse; Caranta, Carole; Palloix, Alain

    2009-11-01

    Molecular cloning of recessive resistance genes to potyviruses in a large range of host species identified the eukaryotic translation initiation factor 4E (eIF4E) as an essential determinant in the outcome of potyvirus infection. Resistance results from a few amino acid changes in the eIF4E protein encoded by the recessive resistance allele that disrupt the direct interaction with the potyviral protein VPg. In plants, several loci encode two protein subfamilies, eIF4E and eIF(iso)4E. While most eIF4E-mediated resistance to potyviruses depends on mutations in a single eIF4E protein, simultaneous mutations in eIF4E (corresponding to the pvr2 locus) and eIF(iso)4E (corresponding to the pvr6 locus) are required to prevent pepper veinal mottle virus (PVMV) infection in pepper. We used this model to look for additional alleles at the pvr2-eIF4E locus that result in resistance when combined with the pvr6-eIF(iso)4E resistant allele. Among the 12 pvr2-eIF4E resistance alleles sequenced in the pepper gene pool, three were shown to have a complementary effect with pvr6-eIF(iso)4E for resistance. Two amino acid changes were exclusively shared by these three alleles and were systematically associated with a second amino acid change, suggesting that these substitutions are associated with resistance expression. The availability of new resistant allele combinations increases the possibility for the durable deployment of resistance against this pepper virus which is prevalent in Africa.

  13. African Aesthetics

    ERIC Educational Resources Information Center

    Abiodun, Rowland

    2001-01-01

    No single traditional discipline can adequately supply answers to the many unresolved questions in African art history. Because of the aesthetic, cultural, historical, and, not infrequently, political biases, already built into the conception and development of Western art history, the discipline of art history as defined and practiced in the West…

  14. African Pentecostalism

    ERIC Educational Resources Information Center

    Garrard, David J.

    2009-01-01

    The diversity of African Pentecostalism, its early colonial and missionary history and its current characteristics are described and analysed. Reference is made to methods of training and forms of leadership, and suggestions are made about the reasons for its growth and persistence. (Contains 19 notes.)

  15. Origin, evolution, and population genetics of the selfish Segregation Distorter gene duplication in European and African populations of Drosophila melanogaster.

    PubMed

    Brand, Cara L; Larracuente, Amanda M; Presgraves, Daven C

    2015-05-01

    Meiotic drive elements are a special class of evolutionarily "selfish genes" that subvert Mendelian segregation to gain preferential transmission at the expense of homologous loci. Many drive elements appear to be maintained in populations as stable polymorphisms, their equilibrium frequencies determined by the balance between drive (increasing frequency) and selection (decreasing frequency). Here we show that a classic, seemingly balanced, drive system is instead characterized by frequent evolutionary turnover giving rise to dynamic, rather than stable, equilibrium frequencies. The autosomal Segregation Distorter (SD) system of the fruit fly Drosophila melanogaster is a selfish coadapted meiotic drive gene complex in which the major driver corresponds to a partial duplication of the gene Ran-GTPase activating protein (RanGAP). SD chromosomes segregate at similar, low frequencies of 1-5% in natural populations worldwide, consistent with a balanced polymorphism. Surprisingly, our population genetic analyses reveal evidence for parallel, independent selective sweeps of different SD chromosomes in populations on different continents. These findings suggest that, rather than persisting at a single stable equilibrium, SD chromosomes turn over frequently within populations.

  16. Re-sequencing of the APOL1-APOL4 and MYH9 gene regions in African Americans does not identify additional risks for CKD progression

    PubMed Central

    Hawkins, Gregory A.; Friedman, David J.; Lu, Lingyi; McWilliams, David R.; Chou, Jeff W.; Sajuthi, Satria; Divers, Jasmin; Parekh, Rulan; Li, Man; Genovese, Giulio; Pollak, Martin R.; Hicks, Pamela J.; Bowden, Donald W.; Ma, Lijun; Freedman, Barry I.; Langefeld, Carl D.

    2015-01-01

    Background APOL1 G1 and G2 nephropathy risk variants are associated with non-diabetic end-stage kidney disease (ESKD) in African Americans (AAs) in an autosomal recessive pattern. Additional risk and protective genetic variants may be present near the APOL1 loci since earlier age ESKD is observed in some AAs with one APOL1 renal-risk variant and because the adjacent gene MYH9 is associated with nephropathy in populations lacking G1 and G2 variants. Methods Re-sequencing was performed across a ~275 kb region encompassing the APOL1-APOL4 and MYH9 genes in 154 AA cases with non-diabetic ESKD and 38 controls without nephropathy who were heterozygous for a single APOL1 G1 or G2 risk variant. Results Sequencing identified 3246 non-coding single nucleotide polymorphisms (SNPs), 55 coding SNPs, and 246 insertion/deletions (InDels). No new coding variations were identified. Eleven variants, including a rare APOL3 Gln58Ter null variant (rs11089781), were genotyped in a replication panel of 1571 AA ESKD cases and 1334 controls. After adjusting for APOL1 G1 and G2 risk effects, these variations were not significantly associated with ESKD. In subjects with <2 APOL1 G1 and/or G2 alleles (849 cases; 1139 controls), the APOL3 null variant was nominally associated with ESKD (recessive model, OR 1.81; p=0.026); however, analysis in 807 AA cases and 634 controls from the Family Investigation of Nephropathy and Diabetes (FIND) did not replicate this association. Conclusion Additional common variants in the APOL1-APOL4-MYH9 region do not contribute significantly to ESKD risk beyond the APOL1 G1 and G2 alleles. PMID:26343748

  17. Positive Selection of Deleterious Alleles through Interaction with a Sex-Ratio Suppressor Gene in African Buffalo: A Plausible New Mechanism for a High Frequency Anomaly

    PubMed Central

    van Hooft, Pim; Greyling, Ben J.; Getz, Wayne M.; van Helden, Paul D.; Zwaan, Bas J.; Bastos, Armanda D. S.

    2014-01-01

    Although generally rare, deleterious alleles can become common through genetic drift, hitchhiking or reductions in selective constraints. Here we present a possible new mechanism that explains the attainment of high frequencies of deleterious alleles in the African buffalo (Syncerus caffer) population of Kruger National Park, through positive selection of these alleles that is ultimately driven by a sex-ratio suppressor. We have previously shown that one in four Kruger buffalo has a Y-chromosome profile that, despite being associated with low body condition, appears to impart a relative reproductive advantage, and which is stably maintained through a sex-ratio suppressor. Apparently, this sex-ratio suppressor prevents fertility reduction that generally accompanies sex-ratio distortion. We hypothesize that this body-condition-associated reproductive advantage increases the fitness of alleles that negatively affect male body condition, causing genome-wide positive selection of these alleles. To investigate this we genotyped 459 buffalo using 17 autosomal microsatellites. By correlating heterozygosity with body condition (heterozygosity-fitness correlations), we found that most microsatellites were associated with one of two gene types: one with elevated frequencies of deleterious alleles that have a negative effect on body condition, irrespective of sex; the other with elevated frequencies of sexually antagonistic alleles that are negative for male body condition but positive for female body condition. Positive selection and a direct association with a Y-chromosomal sex-ratio suppressor are indicated, respectively, by allele clines and by relatively high numbers of homozygous deleterious alleles among sex-ratio suppressor carriers. This study, which employs novel statistical techniques to analyse heterozygosity-fitness correlations, is the first to demonstrate the abundance of sexually-antagonistic genes in a natural mammal population. It also has important

  18. Triosephosphate isomerase gene promoter variation: -5G/A and -8G/A polymorphisms in clinical malaria groups in two African populations.

    PubMed

    Guerra, Mónica; Machado, Patrícia; Manco, Licínio; Fernandes, Natércia; Miranda, Juliana; Arez, Ana Paula

    2015-06-01

    TPI1 promoter polymorphisms occur in high prevalence in individuals from African origin. Malaria-patients from Angola and Mozambique were screened for the TPI1 gene promoter variants rs1800200A>G, (-5G>A), rs1800201G>A, (-8G>A), rs1800202T>G, (-24T>G), and for the intron 5 polymorphism rs2071069G>A, (2262G>A). -5G>A and -8G>A variants occur in 47% and 53% in Angola and Mozambique, respectively while -24T>G was monomorphic for the wild-type T allele. Six haplotypes were identified and -8A occurred in 45% of the individuals, especially associated with the GAG haplotype and more frequent in non-severe malaria groups, although not significantly. The arising and dispersion of -5G>A and -8G>A polymorphisms is controversial. Their age was estimated by analyses of two microsatellite loci, CD4 and ATN1, adjacent to TPI1 gene. The -5G>A is older than -8G>A, with an average estimate of approximately 35,000 years. The -8A variant arose in two different backgrounds, suggesting independent mutational events. The first, on the -5G background, may have occurred in East Africa around 20,800 years ago; the second, on the -5A background, may have occurred in West Africa some 7500 years ago. These estimates are within the period of spread of agriculture and the malaria mosquito vector in Africa, which could has been a possible reason for the selection of -8A polymorphism in malaria endemic countries.

  19. The African buffalo parasite Theileria. sp. (buffalo) can infect and immortalize cattle leukocytes and encodes divergent orthologues of Theileria parva antigen genes

    PubMed Central

    Bishop, R.P.; Hemmink, J.D.; Morrison, W.I.; Weir, W.; Toye, P.G.; Sitt, T.; Spooner, P.R.; Musoke, A.J.; Skilton, R.A.; Odongo, D.O.

    2015-01-01

    African Cape buffalo (Syncerus caffer) is the wildlife reservoir of multiple species within the apicomplexan protozoan genus Theileria, including Theileria parva which causes East coast fever in cattle. A parasite, which has not yet been formally named, known as Theileria sp. (buffalo) has been recognized as a potentially distinct species based on rDNA sequence, since 1993. We demonstrate using reverse line blot (RLB) and sequencing of 18S rDNA genes, that in an area where buffalo and cattle co-graze and there is a heavy tick challenge, T. sp. (buffalo) can frequently be isolated in culture from cattle leukocytes. We also show that T. sp. (buffalo), which is genetically very closely related to T. parva, according to 18s rDNA sequence, has a conserved orthologue of the polymorphic immunodominant molecule (PIM) that forms the basis of the diagnostic ELISA used for T. parva serological detection. Closely related orthologues of several CD8 T cell target antigen genes are also shared with T. parva. By contrast, orthologues of the T. parva p104 and the p67 sporozoite surface antigens could not be amplified by PCR from T. sp. (buffalo), using conserved primers designed from the corresponding T. parva sequences. Collectively the data re-emphasise doubts regarding the value of rDNA sequence data alone for defining apicomplexan species in the absence of additional data. ‘Deep 454 pyrosequencing’ of DNA from two Theileria sporozoite stabilates prepared from Rhipicephalus appendiculatus ticks fed on buffalo failed to detect T. sp. (buffalo). This strongly suggests that R. appendiculatus may not be a vector for T. sp. (buffalo). Collectively, the data provides further evidence that T. sp. (buffalo). is a distinct species from T. parva. PMID:26543804

  20. Positive selection of deleterious alleles through interaction with a sex-ratio suppressor gene in African Buffalo: a plausible new mechanism for a high frequency anomaly.

    PubMed

    van Hooft, Pim; Greyling, Ben J; Getz, Wayne M; van Helden, Paul D; Zwaan, Bas J; Bastos, Armanda D S

    2014-01-01

    Although generally rare, deleterious alleles can become common through genetic drift, hitchhiking or reductions in selective constraints. Here we present a possible new mechanism that explains the attainment of high frequencies of deleterious alleles in the African buffalo (Syncerus caffer) population of Kruger National Park, through positive selection of these alleles that is ultimately driven by a sex-ratio suppressor. We have previously shown that one in four Kruger buffalo has a Y-chromosome profile that, despite being associated with low body condition, appears to impart a relative reproductive advantage, and which is stably maintained through a sex-ratio suppressor. Apparently, this sex-ratio suppressor prevents fertility reduction that generally accompanies sex-ratio distortion. We hypothesize that this body-condition-associated reproductive advantage increases the fitness of alleles that negatively affect male body condition, causing genome-wide positive selection of these alleles. To investigate this we genotyped 459 buffalo using 17 autosomal microsatellites. By correlating heterozygosity with body condition (heterozygosity-fitness correlations), we found that most microsatellites were associated with one of two gene types: one with elevated frequencies of deleterious alleles that have a negative effect on body condition, irrespective of sex; the other with elevated frequencies of sexually antagonistic alleles that are negative for male body condition but positive for female body condition. Positive selection and a direct association with a Y-chromosomal sex-ratio suppressor are indicated, respectively, by allele clines and by relatively high numbers of homozygous deleterious alleles among sex-ratio suppressor carriers. This study, which employs novel statistical techniques to analyse heterozygosity-fitness correlations, is the first to demonstrate the abundance of sexually-antagonistic genes in a natural mammal population. It also has important

  1. Cytokine and cytokine receptor genes of the adaptive immune response are differentially associated with breast cancer risk in American women of African and European ancestry.

    PubMed

    Quan, Lei; Gong, Zhihong; Yao, Song; Bandera, Elisa V; Zirpoli, Gary; Hwang, Helena; Roberts, Michelle; Ciupak, Gregory; Davis, Warren; Sucheston, Lara; Pawlish, Karen; Bovbjerg, Dana H; Jandorf, Lina; Cabasag, Citadel; Coignet, Jean-Gabriel; Ambrosone, Christine B; Hong, Chi-Chen

    2014-03-15

    Disparities in breast cancer biology are evident between American women of African ancestry (AA) and European ancestry (EA) and may be due, in part, to differences in immune function. To assess the potential role of constitutional host immunity on breast carcinogenesis, we tested associations between breast cancer risk and 47 single nucleotide polymorphisms (SNPs) in 26 cytokine-related genes of the adaptive immune system using 650 EA (n = 335 cases) and 864 AA (n = 458 cases) women from the Women's Circle of Health Study (WCHS). With additional participant accrual to the WCHS, promising SNPs from the initial analysis were evaluated in a larger sample size (1,307 EAs and 1,365 AAs). Multivariate logistic regression found SNPs in genes important for T helper type 1 (Th1) immunity (IFNGR2 rs1059293, IL15RA rs2296135, LTA rs1041981), Th2 immunity (IL4R rs1801275), and T regulatory cell-mediated immunosuppression (TGFB1 rs1800469) associated with breast cancer risk, mainly among AAs. The combined effect of these five SNPs was highly significant among AAs (P-trend = 0.0005). When stratified by estrogen receptor (ER) status, LTA rs1041981 was associated with ER-positive breast cancers among EAs and marginally among AAs. Only among AA women, IL15 rs10833 and IL15RA rs2296135 were associated with ER-positive tumors, and IL12RB1 rs375947, IL15 rs10833 and TGFB1 rs1800469 were associated with ER-negative tumors. Our study systematically identified genetic variants in the adaptive immune response pathway associated with breast cancer risk, which appears to differ by ancestry groups, menopausal status and ER status.

  2. GWAS study using DNA pooling strategy identifies association of variant rs4910623 in OR52B4 gene with anti-VEGF treatment response in age-related macular degeneration

    PubMed Central

    Riaz, Moeen; Lorés-Motta, Laura; Richardson, Andrea J.; Lu, Yi; Montgomery, Grant; Omar, Amer; Koenekoop, Robert K.; Chen, John; Muether, Philipp; Altay, Lebriz; Schick, Tina; Fauser, Sascha; Smailhodzic, Dzenita; van Asten, Freekje; de Jong, Eiko K.; Hoyng, Carel B.; Burdon, Kathryn P.; MacGregor, Stuart; Guymer, Robyn H.; den Hollander, Anneke I.; Baird, Paul N.

    2016-01-01

    Pooled DNA based GWAS to determine genetic association of SNPs with visual acuity (VA) outcome in anti-vascular endothelial growth factor (anti-VEGF) treated neovascular age-related macular degeneration (nAMD) patients. We performed pooled DNA based GWAS on 285 anti-VEGF treated nAMD patients using high density Illumina 4.3 M array. Primary outcome was change in VA in Early Treatment Diabetic Retinopathy Study (ETDRS) letters after 6 months of anti-VEGF treatment (patients who lost ≥5 ETDRS letters classified as non-responders and all remaining classified as responders). GWAS analysis identified 44 SNPs of interest: 37 with strong evidence of association (p < 9 × 10−8), 2 in drug resistance genes (p < 5 × 10−6) and 5 nonsynonymous changes (p < 1 × 10−4). In the validation phase, individual genotyping of 44 variants showed three SNPs (rs4910623 p = 5.6 × 10−5, rs323085 p = 6.5 × 10−4 and rs10198937 p = 1.30 × 10−3) remained associated with VA response at 6 months. SNP rs4910623 also associated with treatment response at 3 months (p = 1.5 × 10−3). Replication of these three SNPs in 376 patients revealed association of rs4910623 with poor VA response after 3 and 6 months of treatment (p = 2.4 × 10−3 and p = 3.5 × 10−2, respectively). Meta-analysis of both cohorts (673 samples) confirmed association of rs4910623 with poor VA response after 3 months (p = 1.2 × 10−5) and 6 months (p = 9.3 × 10−6) of treatment in nAMD patients. PMID:27892514

  3. The tyrosinase-positive oculocutaneous albinism gene shows locus homogeneity on chromosome 15q11-q13 and evidence of multiple mutations in southern African negroids

    SciTech Connect

    Kedda, M.A.; Stevens, G.; Manga, P.; Viljoen, C.; Jenkins, T.; Ramsay, M. Univ. of Witwatersrand, Johannesburg )

    1994-06-01

    Tyrosinase-positive oculocutaneous albinism (ty-pos OCA) is an autosomal recessive disorder of the melanin pigmentary system. South African ty-pos OCA individuals occur with two distinct phenotypes, with or without darkly pigmented patches (ephelides, or dendritic freckles) on exposed areas of the skin. These phenotypes are concordant within families, suggesting that there may be more than one mutation at the ty-pos OCA locus. Linkage studies carried out in 41 families have shown linkage between markers in the Prader-Willi/Angelman syndrome (PWS/AS) region on chromosome 15q11-q13 and ty-pos OCA. Analysis showed no obligatory crossovers between the alleles at the D15S12 locus and ty-pos OCA, suggesting that the D15S12 locus is very close to or part of the disease locus, which is postulated to be the human homologue, P, of the mouse pink-eyed dilution gene, p. Unlike caucasoid [open quotes]ty-pos OCA[close quotes] individuals, negroid ty-pos OCA individuals do not show any evidence of locus heterogeneity. Studies of allelic association between the polymorphic alleles detected at the D15S12 locus and ephelus status suggest that there was a single major mutation giving rise to ty-pos OCA without ephelides. There may, however, be two major mutations causing ty-pos OCA with ephelides, one associated with D15S12 allele 1 and the other associated with D15S12 allele 2. The two loci, GABRA5 and D15S24, flanking D15S12, are both hypervariable, and many different haplotypes were observed with the alleles at the three loci on both ty-pos OCA-associated chromosomes and [open quotes]normal[close quotes] chromosomes. No haplotype showed statistically significant association with ty-pos OCA, and thus none could be used to predict the origins of the ty-pos OCA mutations. On the basis of the D15S12 results, there is evidence for multiple ty-pos OCA mutations in southern African negroids. 31 refs., 1 fig., 3 tabs.

  4. Morphology of drying blood pools

    NASA Astrophysics Data System (ADS)

    Laan, Nick; Smith, Fiona; Nicloux, Celine; Brutin, David; D-Blood project Collaboration

    2016-11-01

    Often blood pools are found on crime scenes providing information concerning the events and sequence of events that took place on the scene. However, there is a lack of knowledge concerning the drying dynamics of blood pools. This study focuses on the drying process of blood pools to determine what relevant information can be obtained for the forensic application. We recorded the drying process of blood pools with a camera and measured the weight. We found that the drying process can be separated into five different: coagulation, gelation, rim desiccation, centre desiccation, and final desiccation. Moreover, we found that the weight of the blood pool diminishes similarly and in a reproducible way for blood pools created in various conditions. In addition, we verify that the size of the blood pools is directly related to its volume and the wettability of the surface. Our study clearly shows that blood pools dry in a reproducible fashion. This preliminary work highlights the difficult task that represents blood pool analysis in forensic investigations, and how internal and external parameters influence its dynamics. We conclude that understanding the drying process dynamics would be advancement in timeline reconstitution of events. ANR funded project: D-Blood Project.

  5. Polymorphism of the human factor H-related gene (FHR-1) and of factor H in a West African individual

    SciTech Connect

    Meyer, C.G.; Skerka, C.; Zipfel, P.F.

    1995-03-01

    The human factor H-related 1 (FHR-1) protein is structurally and immunogenically related to the regulatory complement protein factor H (FH). Polymorphism of the FHR-1 gene is indicated by the nucleotide differences as described by the five cDNA clones isolated so far. In order to further analyze this polymorphism we identified PCR-primers which allow the simultaneous amplification of FHR-1 and FH alleles in a single polymerase chain reaction (PCR). By DNA sequence analysis, two novel FHR-1 variants and one as yet unrecognized FH allele could be characterized in an individual from Benin, West Africa. 2 refs., 1 fig.

  6. 1. OVERVIEW OF POOLE POWERHOUSE COMPLEX SETTING. POOLE POWERHOUSE AND ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. OVERVIEW OF POOLE POWERHOUSE COMPLEX SETTING. POOLE POWERHOUSE AND TRIPLEX COTTAGE ARE VISIBLE AT PHOTO CENTER IN SMALL CLEARING AMONG TREES IN LEE VINING CREEK VALLEY. VIEW TO SOUTH EAST. - Lee Vining Creek Hydroelectric System, Triplex Cottage, Lee Vining Creek, Lee Vining, Mono County, CA

  7. The period Gene Thr-Gly Polymorphism in Australian and African Drosophila melanogaster Populations: Implications for Selection

    PubMed Central

    Sawyer, Lesley A.; Sandrelli, Federica; Pasetto, Carlo; Peixoto, Alexandre A.; Rosato, Ezio; Costa, Rodolfo; Kyriacou, Charalambos P.

    2006-01-01

    The period gene is a key regulator of biological rhythmicity in Drosophila melanogaster. The central part of the gene encodes a dipeptide Thr-Gly repeat that has been implicated in the evolution of both circadian and ultradian rhythms. We have previously observed that length variation in the repeat follows a latitudinal cline in Europe and North Africa, so we have sought to extend this observation to the southern hemisphere. We observe a parallel cline in Australia for one of the two major length variants and find higher levels of some Thr-Gly length variants, particularly at the tropical latitudes, that are extremely rare in Europe. In addition we examined >40 haplotypes from sub-Saharan Africa and find a very different and far more variable profile of Thr-Gly sequences. Statistical analysis of the periodicity and codon content of the repeat from all three continents reveals a possible mechanism that may explain how the repeat initially arose in the ancestors of the D. melanogaster subgroup of species. Our results further reinforce the view that thermal selection may have contributed to shaping the continental patterns of Thr-Gly variability. PMID:16849607

  8. Gene Variant from Africa Linked to Black Obesity

    MedlinePlus

    ... Health News on: African American Health Genes and Gene Therapy Obesity Recent Health News Related MedlinePlus Health Topics African American Health Genes and Gene Therapy Obesity About MedlinePlus Site Map FAQs Customer Support ...

  9. African-American Biography.

    ERIC Educational Resources Information Center

    Martin, Ron

    1995-01-01

    Suggests sources of information for African American History Month for library media specialists who work with students in grades four through eight. Gale Research's "African-American Reference Library," which includes "African-America Biography,""African-American Chronology," and "African-American Almanac,"…

  10. Diagnostic disparity and identification of two TNNI3 gene mutations, one novel and one arising de novo, in South African patients with restrictive cardiomyopathy and focal ventricular hypertrophy

    PubMed Central

    Mouton, Jomien M; Kinnear, Craig J; Moolman-Smook, Johanna C; Herbst, Philip G; Pellizzon, Adriano S; Goosen, Althea; Brink, Paul A

    2015-01-01

    Summary Introduction The minimum criterion for the diagnosis of hypertrophic cardiomyopathy (HCM) is thickening of the left ventricular wall, typically in an asymmetrical or focal fashion, and it requires no functional deficit. Using this criterion, we identified a family with four affected individuals and a single unrelated individual essentially with restrictive cardiomyopathy (RCM). Mutations in genes coding for the thin filaments of cardiac muscle have been described in RCM and HCM with ‘restrictive features’. One such gene encodes for cardiac troponin I (TNNI3), a sub-unit of the troponin complex involved in the regulation of striated muscle contraction. We hypothesised that mutations in TNNI3 could underlie this particular phenotype, and we therefore screened TNNI3 for mutations in 115 HCM probands. Methods Clinical investigation involved examination, echocardiography, chest X-ray and an electrocardiogram of both the index cases and close relatives. The study cohort consisted of 113 South African HCM probands, with and without known founder HCM mutations, and 100 ethnically matched control individuals. Mutation screening of TNNI3 for disease-causing mutations were performed using high-resolution melt (HRM) analysis. Results HRM analyses identified three previously described HCM-causing mutations (p.Pro82Ser, p.Arg162Gln, p.Arg170Gln) and a novel exonic variant (p.Leu144His). A previous study involving the same amino acid identified a p.Leu144Gln mutation in a patient presenting with RCM, with clinical features of HCM. We observed the novel p.Leu144His mutation in three siblings with clinical RCM and varying degrees of ventricular hypertrophy. The isolated index case with the de novo p.Arg170Gln mutation presented with a similar phenotype. Both mutations were absent in a healthy control group. Conclusion We have identified a novel disease-causing p.Leu144His mutation and a de novo p.Arg170Gln mutation associated with RCM and focal ventricular hypertrophy

  11. Chromonoodles: Jump into the Gene Pool

    ERIC Educational Resources Information Center

    Farrar, Jennifer; Barnhart, Kelsi

    2011-01-01

    Chromosomes, alleles, chromatids, genotype, phenotype, mitosis, meiosis, fertilization--this vocabulary can be overwhelming, confusing, and difficult for students to tie together. However, since these terms are commonplace in the high school biology classroom, and are the basis for understanding both DNA and heredity, students must understand…

  12. Examining the African American K-12 Public Superintendency from a Critical Race Theory Perspective: Counter-Stories about Hiring and Retention Practices

    ERIC Educational Resources Information Center

    Chalmers, Anthony Gene

    2012-01-01

    For the last decade, research has shown concern about the pool of African American candidates for the superintendency. Nationally, African American candidates make up two percent of superintendents and fourteen percent of the teaching force, the pool from which superintendents are traditionally chosen. Increasing demands to meet the needs of…

  13. Tidal Pools--Miniature Oceans

    ERIC Educational Resources Information Center

    Plake, Linda Perry

    1977-01-01

    A comprehensive discussion of the biological activity in tidal pools is provided. The importance of environmental factors such as oxygen supply, temperature, salinity, and light is detailed. Plants and animals that might be found in a tidal pool are identified and described. (BT)

  14. African Trypanosomiasis

    DTIC Science & Technology

    2011-06-01

    infection by protozoan hemo- flagellates of the Trypanosoma brucei complex, 2 subspe- cies of which cause disease in humans: Trypanosoma bru- cei gambiense...public release; distribution unlimited 13. SUPPLEMENTARY NOTES See also ADA545141. Chapter 3 from e-book, Topics on the Pathology of Protozoan and...the brief ferry crossing. 2 3 • Topics on The paThology of proTozoan and invasive arThropod diseases Three severe epidemics of African trypanosomiasis

  15. Staphylococci in swimming pool water

    PubMed Central

    Crone, P. B.; Tee, G. H.

    1974-01-01

    During a period of five years 1192 water samples from swimming pools were examined for staphylococci and 338 for coliform organisms only. Eighty-nine different pools were sampled. Numbers of staphylococci, estimated by the membrane filtration technique did not bear any significant relation to either bathing load or concentration of free chlorine. Wide variation in the staphylococcal count was observed when different parts of a pool were sampled on the same occasion. The only practicable standard for pool samples in relation to staphylococci would appear to be that these organisms should be absent from 100 ml. water when the pool has been out of use during at least ten hours before sampling if filtration and chlorination are adequate. PMID:4608265

  16. Differential gene expression in the brain of the African lungfish, Protopterus annectens, after six days or six months of aestivation in air.

    PubMed

    Hiong, Kum C; Ip, Yuen K; Wong, Wai P; Chew, Shit F

    2013-01-01

    The African lungfish, Protopterus annectens, can undergo aestivation during drought. Aestivation has three phases: induction, maintenance and arousal. The objective of this study was to examine the differential gene expression in the brain of P. annectens during the induction (6 days) and maintenance (6 months) phases of aestivation as compared with the freshwater control using suppression subtractive hybridization. During the induction phase of aestivation, the mRNA expression of prolactin (prl) and growth hormone were up-regulated in the brain of P. annectens, which indicate for the first time the possible induction role of these two hormones in aestivation. Also, the up-regulation of mRNA expression of tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein γ polypeptide and the down-regulation of phosphatidylethanolamine binding protein, suggest that there could be a reduction in biological and neuronal activities in the brain. The mRNA expression of cold inducible RNA-binding protein and glucose regulated protein 58 were also up-regulated in the brain, probably to enhance their cytoprotective effects. Furthermore, the down-regulation of prothymosin α expression suggests that there could be a suppression of transcription and cell proliferation in preparation for the maintenance phase. In general, the induction phase appeared to be characterized by reduction in glycolytic capacity and metabolic activity, suppression of protein synthesis and degradation, and an increase in defense against ammonia toxicity. In contrast, there was a down-regulation in the mRNA expression of prl in the brain of P. annectens during the maintenance phase of aestivation. In addition, there could be an increase in oxidative defense capacity, and up-regulation of transcription, translation, and glycolytic capacities in preparation for arousal. Overall, our results signify the importance of reconstruction of protein structures and regulation of energy expenditure during

  17. Discovery of Point Mutations in the Voltage-Gated Sodium Channel from African Aedes aegypti Populations: Potential Phylogenetic Reasons for Gene Introgression

    PubMed Central

    Muranami, Yuto; Kawashima, Emiko; Osei, Joseph H. N.; Sakyi, Kojo Yirenkyi; Dadzie, Samuel; de Souza, Dziedzom K.; Appawu, Maxwell; Ohta, Nobuo; Minakawa, Noboru

    2016-01-01

    Background Yellow fever is endemic in some countries in Africa, and Aedes aegpyti is one of the most important vectors implicated in the outbreak. The mapping of the nation-wide distribution and the detection of insecticide resistance of vector mosquitoes will provide the beneficial information for forecasting of dengue and yellow fever outbreaks and effective control measures. Methodology/Principal Findings High resistance to DDT was observed in all mosquito colonies collected in Ghana. The resistance and the possible existence of resistance or tolerance to permethrin were suspected in some colonies. High frequencies of point mutations at the voltage-gated sodium channel (F1534C) and one heterozygote of the other mutation (V1016I) were detected, and this is the first detection on the African continent. The frequency of F1534C allele and the ratio of F1534C homozygotes in Ae. aegypti aegypti (Aaa) were significantly higher than those in Ae. aegypti formosus (Aaf). We could detect the two types of introns between exon 20 and 21, and the F1534C mutations were strongly linked with one type of intron, which was commonly found in South East Asian and South and Central American countries, suggesting the possibility that this mutation was introduced from other continents or convergently selected after the introgression of Aaa genes from the above area. Conclusions/Significance The worldwide eradication programs in 1940s and 1950s might have caused high selection pressure on the mosquito populations and expanded the distribution of insecticide-resistant Ae. aegypti populations. Selection of the F1534C point mutation could be hypothesized to have taken place during this period. The selection of the resistant population of Ae. aegypti with the point mutation of F1534C, and the worldwide transportation of vector mosquitoes in accordance with human activity such as trading of used tires, might result in the widespread distribution of F1534C point mutation in tropical countries

  18. Differential Gene Expression in the Brain of the African Lungfish, Protopterus annectens, after Six Days or Six Months of Aestivation in Air

    PubMed Central

    Hiong, Kum C.; Ip, Yuen K.; Wong, Wai P.; Chew, Shit F.

    2013-01-01

    The African lungfish, Protopterus annectens, can undergo aestivation during drought. Aestivation has three phases: induction, maintenance and arousal. The objective of this study was to examine the differential gene expression in the brain of P. annectens during the induction (6 days) and maintenance (6 months) phases of aestivation as compared with the freshwater control using suppression subtractive hybridization. During the induction phase of aestivation, the mRNA expression of prolactin (prl) and growth hormone were up-regulated in the brain of P. annectens, which indicate for the first time the possible induction role of these two hormones in aestivation. Also, the up-regulation of mRNA expression of tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein γ polypeptide and the down-regulation of phosphatidylethanolamine binding protein, suggest that there could be a reduction in biological and neuronal activities in the brain. The mRNA expression of cold inducible RNA-binding protein and glucose regulated protein 58 were also up-regulated in the brain, probably to enhance their cytoprotective effects. Furthermore, the down-regulation of prothymosin α expression suggests that there could be a suppression of transcription and cell proliferation in preparation for the maintenance phase. In general, the induction phase appeared to be characterized by reduction in glycolytic capacity and metabolic activity, suppression of protein synthesis and degradation, and an increase in defense against ammonia toxicity. In contrast, there was a down-regulation in the mRNA expression of prl in the brain of P. annectens during the maintenance phase of aestivation. In addition, there could be an increase in oxidative defense capacity, and up-regulation of transcription, translation, and glycolytic capacities in preparation for arousal. Overall, our results signify the importance of reconstruction of protein structures and regulation of energy expenditure during

  19. Reduced neutrophil count in people of African descent is due to a regulatory variant in the Duffy antigen receptor for chemokines gene.

    PubMed

    Reich, David; Nalls, Michael A; Kao, W H Linda; Akylbekova, Ermeg L; Tandon, Arti; Patterson, Nick; Mullikin, James; Hsueh, Wen-Chi; Cheng, Ching-Yu; Coresh, Josef; Boerwinkle, Eric; Li, Man; Waliszewska, Alicja; Neubauer, Julie; Li, Rongling; Leak, Tennille S; Ekunwe, Lynette; Files, Joe C; Hardy, Cheryl L; Zmuda, Joseph M; Taylor, Herman A; Ziv, Elad; Harris, Tamara B; Wilson, James G

    2009-01-01

    Persistently low white blood cell count (WBC) and neutrophil count is a well-described phenomenon in persons of African ancestry, whose etiology remains unknown. We recently used admixture mapping to identify an approximately 1-megabase region on chromosome 1, where ancestry status (African or European) almost entirely accounted for the difference in WBC between African Americans and European Americans. To identify the specific genetic change responsible for this association, we analyzed genotype and phenotype data from 6,005 African Americans from the Jackson Heart Study (JHS), the Health, Aging and Body Composition (Health ABC) Study, and the Atherosclerosis Risk in Communities (ARIC) Study. We demonstrate that the causal variant must be at least 91% different in frequency between West Africans and European Americans. An excellent candidate is the Duffy Null polymorphism (SNP rs2814778 at chromosome 1q23.2), which is the only polymorphism in the region known to be so differentiated in frequency and is already known to protect against Plasmodium vivax malaria. We confirm that rs2814778 is predictive of WBC and neutrophil count in African Americans above beyond the previously described admixture association (P = 3.8 x 10(-5)), establishing a novel phenotype for this genetic variant.

  20. Indentured migration and differential gender gene flow: the origin and evolution of the East-Indian community of Limón, Costa Rica.

    PubMed

    Castrì, Loredana; Otárola, Flory; Blell, Mwenza; Ruiz, Ernesto; Barrantes, Ramiro; Luiselli, Donata; Pettener, Davide; Madrigal, Lorena

    2007-10-01

    After the emancipation of African slaves in the Caribbean, the labor void left by out-migrating former slaves was filled by in-migrating indentured servants from prepartition India and China. In some areas of the Caribbean such as Trinidad, Suriname, and Guyana, the East-Indian migrants formed large communities. In this article, we report a study based on mtDNA and Y-chromosomal markers of a small East-Indian community from Limón, Costa Rica. The purpose of the project is to determine the place of origin in the Indian subcontinent of the ancestors of our group and the contributions to its gene pool through gene flow by members of other ethnic groups. Both Y-chromosome and mtDNA suggest that the Indo-Costa Ricans descend from migrants primarily from Central India. While both paternal and maternal markers indicate that this group is overwhelmingly of Indian origin, they also indicate that males and females of African, European, and Amerindian origin contributed to it differently. We discuss our results in the historical context of the virtual extinction of Amerindian Caribbean groups, the forced migration of African slaves to the Caribbean, and the gene flow between Amerindians, Europeans, East-Indians, and Africans that eventually produced the Caribbean's currently diverse gene pool.

  1. Rank Pooling for Action Recognition.

    PubMed

    Fernando, Basura; Gavves, Efstratios; Oramas M, Jose Oramas; Ghodrati, Amir; Tuytelaars, Tinne

    2017-04-01

    We propose a function-based temporal pooling method that captures the latent structure of the video sequence data - e.g., how frame-level features evolve over time in a video. We show how the parameters of a function that has been fit to the video data can serve as a robust new video representation. As a specific example, we learn a pooling function via ranking machines. By learning to rank the frame-level features of a video in chronological order, we obtain a new representation that captures the video-wide temporal dynamics of a video, suitable for action recognition. Other than ranking functions, we explore different parametric models that could also explain the temporal changes in videos. The proposed functional pooling methods, and rank pooling in particular, is easy to interpret and implement, fast to compute and effective in recognizing a wide variety of actions. We evaluate our method on various benchmarks for generic action, fine-grained action and gesture recognition. Results show that rank pooling brings an absolute improvement of 7-10 average pooling baseline. At the same time, rank pooling is compatible with and complementary to several appearance and local motion based methods and features, such as improved trajectories and deep learning features.

  2. Pooling techniques for bioassay screening

    SciTech Connect

    Sun, L.C.; Baum, J.W.; Kaplan, E; Moorthy, A.R.

    1996-03-01

    Pooling techniques commonly are used to increase the throughput of samples used for screening purposes. While the advantages of such techniques are increased analytical efficiency and cost savings, the sensitivity of measurements decreases because it is inversely proportional to the number of samples in the pools. Consequently, uncertainties in estimates of dose and risk which are based on the results of pooled samples increase as the number of samples in the pools increases in all applications. However, sensitivities may not be seriously degraded, for example, in urinalysis, if the samples in the pools are of known time duration, or if the fraction of some attribute of the grab urine samples to that in a 24-hour composite is known (e.g., mass, specific gravity, creatinine, or volume, per 24-h interval). This paper presents square and cube pooling schemes that greatly increase throughput and can considerably reduce analytical costs (on a sample basis). The benefit-cost ratios for 5{times}5 square and 5{times}5{times}5 cube pooling schemes are 2.5 and 8.3, respectively. Three-dimensional and higher arrayed pooling schemes would result in even greater economies; however, significant improvements in analytical sensitivity are required to achieve these advantages. These are various other considerations for designing a pooling scheme, where the number of dimensions and of samples in the optimum array are influenced by: (1) the minimal detectable amount (MDA) of the analytical processes, (2) the screening dose-rate requirements, (3) the maximum masses or volumes of the composite samples that can be analyzed, (4) the information already available from results of composite analysis, and (5) the ability of an analytical system to guard against both false negative and false positive results. Many of these are beyond the scope of this paper but are being evaluated.

  3. Structural analysis of the 5 prime flanking region of the. beta. -globin gene in African sickle cell anemia patients: Further evidence for three origins of the sickle cell mutation in Africa

    SciTech Connect

    Chebloune, Y.; Pagnier, J.; Trabuchet, G.; Faure, C.; Verdier, G.; Labie, D.; Nigon, V. )

    1988-06-01

    Haplotype analysis of the {beta}-globin gene cluster shows two regions of DNA characterized by nonrandom association of restriction site polymorphisms. These regions are separated by a variable segment containing the repeated sequences (ATTTT){sub n} and (AT){sub x}T{sub y}, which might be involved in recombinational events. Studies of haplotypes linked to the sickle cell gene in Africa provide strong argument for three origins of the mutation: Benin, Senegal, and the Central African Republic. The structure of the variable segment in the three African populations was studied by S1 nuclease mapping of genomic DNA, which allows a comparison of several samples. A 1080-base-pair DNA segment was sequenced for one sample from each population. S1 nuclease mapping confirmed the homogeneity of each population with regard to both (ATTTT){sub n} and (AT){sub x}T{sub y} repeats. The authors found three additional structures for (AT){sub x}T{sub y} correlating with the geographic origin of the patients. Ten other nucleotide positions, 5{prime} and 3{prime} to the (AT){sub x}T{sub y} copies, were found to be variable when compared to homologous sequences from human and monkey DNAs. These results allow us to propose an evolutionary scheme for the polymorphisms in the 5{prime} flanking region of the {beta}-globin gene. The results strongly support the hypothesis of three origins for the sickle mutation in Africa.

  4. Pool impacts of Leidenfrost drop

    NASA Astrophysics Data System (ADS)

    Darbois Texier, Baptiste; Maquet, Laurent; Dorbolo, Stephane; Dehandschoewercker, Eline; Pan, Zhao; Truscott, Tadd

    2015-11-01

    This work concerns the impact of a droplet made of a volatile liquid (typically HFE) on a pool of an other liquid (typically silicone oil) which temperature is above the boiling point of the drop. Depending on the properties of the two liquids and the impacting conditions, four different regimes are observed. For low impacting speeds, the droplet bounces on the surface of the bath and finally levitates above it in a Leidenfrost state. Such a regime occurs as soon as the pool temperature exceeds the boiling point of the drop. This observation means that there is no threshold in temperature for a Leidenfrost effect on a liquid surface contrary to the case of a solid substrate. For intermediate impacting velocities, the pinch-off of the surface of the pool entraps the drop in the liquid bulk. The entrapped drop is separated from the pool by a layer of its own vapour in a similar way of antibulles. For increasing impacting speeds, the vapour layer between the drop and the pool does not hold during the pinch-off event. The contact of the drop with the hot liquid provokes a sudden and intense evaporation. At very large impacting speeds, the drop rapidely contacts the pool, spreads and finally induces a hemi-spherical cavity. In the end, these four different regimes are summarized in a Froud-Weber diagram which boundaries are discussed.

  5. A variant reference data set for the Africanized honeybee, Apis mellifera

    PubMed Central

    Kadri, Samir M.; Harpur, Brock A.; Orsi, Ricardo O.; Zayed, Amro

    2016-01-01

    The Africanized honeybee (AHB) is a population of Apis mellifera found in the Americas. AHBs originated in 1956 in Rio Clara, Brazil where imported African A. m. scutellata escaped and hybridized with local populations of European A. mellifera. Africanized populations can now be found from Northern Argentina to the Southern United States. AHBs—often referred to as ‘Killer Bees’— are a major concern to the beekeeping industry as well as a model for the evolutionary genetics of colony defence. We performed high coverage pooled-resequencing of 360 diploid workers from 30 Brazilian AHB colonies using Illumina Hi-Seq (150 bp PE). This yielded a high density SNP data set with an average read depth at each site of 20.25 reads. With 3,606,720 SNPs and 155,336 SNPs within 11,365 genes, this data set is the largest genomic resource available for AHBs and will enable high-resolution studies of the population dynamics, evolution, and genetics of this successful biological invader, in addition to facilitating the development of SNP-based tools for identifying AHBs. PMID:27824336

  6. A variant reference data set for the Africanized honeybee, Apis mellifera.

    PubMed

    Kadri, Samir M; Harpur, Brock A; Orsi, Ricardo O; Zayed, Amro

    2016-11-08

    The Africanized honeybee (AHB) is a population of Apis mellifera found in the Americas. AHBs originated in 1956 in Rio Clara, Brazil where imported African A. m. scutellata escaped and hybridized with local populations of European A. mellifera. Africanized populations can now be found from Northern Argentina to the Southern United States. AHBs-often referred to as 'Killer Bees'- are a major concern to the beekeeping industry as well as a model for the evolutionary genetics of colony defence. We performed high coverage pooled-resequencing of 360 diploid workers from 30 Brazilian AHB colonies using Illumina Hi-Seq (150 bp PE). This yielded a high density SNP data set with an average read depth at each site of 20.25 reads. With 3,606,720 SNPs and 155,336 SNPs within 11,365 genes, this data set is the largest genomic resource available for AHBs and will enable high-resolution studies of the population dynamics, evolution, and genetics of this successful biological invader, in addition to facilitating the development of SNP-based tools for identifying AHBs.

  7. African Outreach Workshop 1974.

    ERIC Educational Resources Information Center

    Schmidt, Nancy J.

    This report discusses the 1974 African Outreach Workshop planned and coordinated by the African Studies Program at the University of Illinois at Urbana-Champaign. Its major aim was to assist teachers in developing curriculum units on African using materials available in their local community. A second aim was for the African Studies Program to…

  8. Africans in America.

    ERIC Educational Resources Information Center

    Hart, Ayanna; Spangler, Earl

    This book introduces African-American history and culture to children. The first Africans in America came from many different regions and cultures, but became united in this country by being black, African, and slaves. Once in America, Africans began a long struggle for freedom which still continues. Slavery, the Civil War, emancipation, and the…

  9. The imprint of the Slave Trade in an African American population: mitochondrial DNA, Y chromosome and HTLV-1 analysis in the Noir Marron of French Guiana

    PubMed Central

    2010-01-01

    Background Retracing the genetic histories of the descendant populations of the Slave Trade (16th-19th centuries) is particularly challenging due to the diversity of African ethnic groups involved and the different hybridisation processes with Europeans and Amerindians, which have blurred their original genetic inheritances. The Noir Marron in French Guiana are the direct descendants of maroons who escaped from Dutch plantations in the current day Surinam. They represent an original ethnic group with a highly blended culture. Uniparental markers (mtDNA and NRY) coupled with HTLV-1 sequences (env and LTR) were studied to establish the genetic relationships linking them to African American and African populations. Results All genetic systems presented a high conservation of the African gene pool (African ancestry: mtDNA = 99.3%; NRY = 97.6%; HTLV-1 env = 20/23; HTLV-1 LTR = 6/8). Neither founder effect nor genetic drift was detected and the genetic diversity is within a range commonly observed in Africa. Higher genetic similarities were observed with the populations inhabiting the Bight of Benin (from Ivory Coast to Benin). Other ancestries were identified but they presented an interesting sex-bias. Whilst male origins spread throughout the north of the bight (from Benin to Senegal), female origins were spread throughout the south (from the Ivory Coast to Angola). Conclusions The Noir Marron are unique in having conserved their African genetic ancestry, despite major cultural exchanges with Amerindians and Europeans through inhabiting the same region for four centuries. Their maroon identity and the important number of slaves deported in this region have maintained the original African diversity. All these characteristics permit to identify a major origin located in the former region of the Gold Coast and the Bight of Benin; regions highly impacted by slavery, from which goes a sex-biased longitudinal gradient of ancestry. PMID:20958967

  10. The Genetic Diversity of the Nguni Breed of African Cattle (Bos spp.): Complete Mitochondrial Genomes of Haplogroup T1

    PubMed Central

    Horsburgh, K. Ann; Prost, Stefan; Gosling, Anna; Stanton, Jo-Ann; Rand, Christy; Matisoo-Smith, Elizabeth A.

    2013-01-01

    Domesticated cattle were commonplace in northern Africa by about 7,000 years ago. Archaeological evidence, however, suggests they were not established in southern Africa until much later, no earlier than 2,000 years ago. Genetic reconstructions have started to shed light on the movement of African cattle, but efforts have been frustrated by a lack of data south of Ethiopia and the nature of the mitochondrial haplogroup T1 which is almost fixed across the continent. We sequenced 35 complete mitochondrial genomes from a South African herd of Nguni cattle, a breed historically associated with Bantu speaking farmers who were among the first to bring cattle to southern Africa. As expected, all individuals in the study were found to be members of haplogroup T1. Only half of the sub-haplogroups of T1 (T1a-T1f) are represented in our sample and the overwhelming majority (94%) in this study belong to subhaplogroup T1b. A previous study of African cattle found frequencies of T1b of 27% in Egypt and 69% in Ethiopia. These results are consistent with serial multiple founder effects significantly shaping the gene pool as cattle were moved from north to south across the continent. Interestingly, these mitochondrial data give no indication that the impacts of the founder effects were ameliorated by gene flow from recently introduced Indian cattle breeds. PMID:23977187

  11. Bight of Benin: a Maternal Perspective of Four Beninese Populations and their Genetic Implications on the American Populations of African Ancestry.

    PubMed

    Primativo, Giuseppina; Ottoni, Claudio; Biondi, Gianfranco; Serafino, Sara; Martínez-Labarga, Cristina; Larmuseau, Maarten H D; Scardi, Michele; Decorte, Ronny; Rickards, Olga

    2017-03-01

    The understanding of the first movements of the ancestral populations within the African continent is still unclear, particularly in West Africa, due to several factors that have shaped the African genetic pool across time. To improve the genetic representativeness of the Beninese population and to better understand the patterns of human settlement inside West Africa and the dynamics of peopling of the Democratic Republic of Benin, we analyzed the maternal genetic variation of 193 Beninese individuals belonging to Bariba, Berba, Dendi, and Fon populations. Results support the oral traditions indicating that the western neighbouring populations have been the ancestors of the first Beninese populations, and the extant genetic structure of the Beninese populations is most likely the result of admixture between populations from neighbouring countries and native people. The present findings highlight how the Beninese populations contributed to the gene pool of the extant populations of some American populations of African ancestry. This strengthens the hypothesis that the Bight of Benin was not only an assembly point for the slave trade during the Trans-Atlantic Slave Trade but also an important slave trapping area.

  12. Prostate cancer in men of African origin.

    PubMed

    McGinley, Kathleen F; Tay, Kae Jack; Moul, Judd W

    2016-02-01

    Men of African origin are disproportionately affected by prostate cancer: prostate cancer incidence is highest among men of African origin in the USA, prostate cancer mortality is highest among men of African origin in the Caribbean, and tumour stage and grade at diagnosis are highest among men in sub-Saharan Africa. Socioeconomic, educational, cultural, and genetic factors, as well as variations in care delivery and treatment selection, contribute to this cancer disparity. Emerging data on single-nucleotide-polymorphism patterns, epigenetic changes, and variations in fusion-gene products among men of African origin add to the understanding of genetic differences underlying this disease. On the diagnosis of prostate cancer, when all treatment options are available, men of African origin are more likely to choose radiation therapy or to receive no definitive treatment than white men. Among men of African origin undergoing surgery, increased rates of biochemical recurrence have been identified. Understanding differences in the cancer-survivorship experience and quality-of-life outcomes among men of African origin are critical to appropriately counsel patients and improve cultural sensitivity. Efforts to curtail prostate cancer screening will likely affect men of African origin disproportionately and widen the racial disparity of disease.

  13. Association of primary open-angle glaucoma with mitochondrial variants and haplogroups common in African Americans

    PubMed Central

    Gudiseva, Harini V.; Trachtman, Benjamin; Bowman, Anita S.; Sagaser, Anna; Sankar, Prithvi; Miller-Ellis, Eydie; Lehman, Amanda; Addis, Victoria; O'Brien, Joan M.

    2016-01-01

    Purpose To estimate the population frequencies of all common mitochondrial variants and ancestral haplogroups among 1,999 subjects recruited for the Primary Open-Angle African American Glaucoma Genetics (POAAGG) Study, including 1,217 primary open-angle glaucoma (POAG) cases and 782 controls, and to identify ancestral subpopulations and mitochondrial mutations as potential risk factors for POAG susceptibility. Methods Subject classification by characteristic glaucomatous optic nerve findings and corresponding visual field defects, as defined by enrolling glaucoma specialists, stereo disc photography, phlebotomy, extraction of total DNA from peripheral blood or saliva, DNA quantification and normalization, PCR amplification of whole mitochondrial genomes, Ion Torrent deep semiconductor DNA sequencing on DNA pools (“Pool-seq”), Sanger sequencing of 3,479 individual mitochondrial DNAs, and bioinformatic analysis. Results The distribution of common African haplogroups within the POAAGG study population was broadly similar to prior surveys of African Americans. However, the POAG case population was found to be enriched in L1c2 haplogroups, which are defined in part by missense mutations m.6150G>A (Val83Ile, odds ratio [OR] 1.8, p=0.01), m.6253C>T (Met117Thr, rs200165736, OR 1.6, p=0.04), and m.6480G>A (Val193Ile, rs199476128, OR 4.6, p=0.04) in the cytochrome c oxidase subunit 1 (MT-CO1) gene and by a variant, m.2220A>G (OR 2.0, p=0.01), in MT-RNR2, which encodes the mitochondrial ribosomal 16s RNA gene. L2 haplogroups were predicted to be overrepresented in the POAG case population by Pool-seq, and the difference was confirmed to be significant with Sanger sequencing, that targeted the L2-associated variants m.2416T>C (rs28358580, OR 1.2, p=0.02) and m.2332C>T (OR 1.2, p=.02) in MT-RNR2. Another variant within MT-RNR2, m.3010G>A (rs3928306), previously implicated in sensitivity to the optic neuropathy-associated antibiotic linezolid, and arising on D4 and J1

  14. Carbon concentrations and transformations in peatland pools

    NASA Astrophysics Data System (ADS)

    Chapman, Pippa; Holden, Joseph; Baird, Andrew; Turner, Edward; Dooling, Gemma; Billett, Mike; McKenzie, Rebecca; Leith, Fraser; Dinsmore, Kerry

    2016-04-01

    Peatland pools may act as important features for aquatic and gaseous carbon production, transformation and release. Peatland restoration often results in new pools being created. Here we compare aquatic carbon concentrations in nearby natural and artificial pool systems monitored at three sites in northern Scotland over a three-year period. We found significant differences in pool water carbon concentrations between pool types with larger dissolved organic carbon (DOC) and dissolved carbon dioxide (CO2) in artificial pools. The differences were strong for all sites and occurred in all seasons. Importantly, the DOC outflows from natural pools were markedly lower than the DOC flowing into natural pools showing that processes in these pools were transforming and removing the DOC. These effects were not found in the artificial pools. Data on the composition of the DOC (absorbance ratios, specific ultraviolet absorbance) suggested that natural pools tended to have DOC that had been processed, and was older (radiocarbon dating) while the DOC in artificial pools was young and had not undergone much biochemical processing. Slope position was an important factor influencing pool DOC with those pools with a longer upslope contributing area and collecting water with a longer hillslope residence time having larger DOC concentrations. Dissolved methane (CH4) concentrations were not significantly different between pool types but the concentrations were always above atmospheric levels with values ˜ 200 times atmospheric concentrations not uncommon. Dissolved CO2 concentrations in the artificial pools were extremely large; typically ˜20 times atmospheric levels while those in natural pools were typically only just above atmospheric levels. The pools were strong sources of CH4 and CO2 evasion from the peat system. The smaller size of the artificial pools means that more of their CO2 is stored in the water until it reaches the stream system, while the larger natural pools have

  15. 13 CFR 120.1708 - Pool Certificates.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... Certificates. (a) SBA Guarantee of Pool Certificates. SBA guarantees to a Pool Investor the timely payment of... Investor is entitled. If an Obligor misses a scheduled payment pursuant to the terms of the Pool Note... the schedule of interest and principal payments to the Pool Investor. If SBA makes such payments,...

  16. 13 CFR 120.1708 - Pool Certificates.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... Certificates. (a) SBA Guarantee of Pool Certificates. SBA guarantees to a Pool Investor the timely payment of... Investor is entitled. If an Obligor misses a scheduled payment pursuant to the terms of the Pool Note... the schedule of interest and principal payments to the Pool Investor. If SBA makes such payments,...

  17. European Swimming Pool Designs Cross the Atlantic.

    ERIC Educational Resources Information Center

    Jaskulak, Neil

    1983-01-01

    Conventional swimming pools have been built with the needs of competitive swimmers in mind. Planners in several European countries have greatly increased swimming pool attendance by designing "leisure pools," based primarily on the needs and behavior of recreationists. Design of these pools and their equipment requirements are discussed.…

  18. HYDROLOGY AND LANDSCAPE CONNECTIVITY OF VERNAL POOLS

    EPA Science Inventory

    Vernal pools are shaped by hydrologic processes which influence many aspects of pool function. The hydrologic budget of a pool can be summarized by a water balance equation that relates changes in the amount of water in the pool to precipitation, ground- and surface-water flows, ...

  19. 21 CFR 1250.89 - Swimming pools.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Swimming pools. 1250.89 Section 1250.89 Food and... SANITATION Sanitation Facilities and Conditions on Vessels § 1250.89 Swimming pools. (a) Fill and draw swimming pools shall not be installed or used. (b) Swimming pools of the recirculation type shall...

  20. 21 CFR 1250.89 - Swimming pools.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Swimming pools. 1250.89 Section 1250.89 Food and... SANITATION Sanitation Facilities and Conditions on Vessels § 1250.89 Swimming pools. (a) Fill and draw swimming pools shall not be installed or used. (b) Swimming pools of the recirculation type shall...

  1. 21 CFR 1250.89 - Swimming pools.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Swimming pools. 1250.89 Section 1250.89 Food and... SANITATION Sanitation Facilities and Conditions on Vessels § 1250.89 Swimming pools. (a) Fill and draw swimming pools shall not be installed or used. (b) Swimming pools of the recirculation type shall...

  2. 21 CFR 1250.89 - Swimming pools.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Swimming pools. 1250.89 Section 1250.89 Food and... SANITATION Sanitation Facilities and Conditions on Vessels § 1250.89 Swimming pools. (a) Fill and draw swimming pools shall not be installed or used. (b) Swimming pools of the recirculation type shall...

  3. 21 CFR 1250.89 - Swimming pools.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Swimming pools. 1250.89 Section 1250.89 Food and... SANITATION Sanitation Facilities and Conditions on Vessels § 1250.89 Swimming pools. (a) Fill and draw swimming pools shall not be installed or used. (b) Swimming pools of the recirculation type shall...

  4. Swimming Pools. Managing School Facilities, Guide 2.

    ERIC Educational Resources Information Center

    Department for Education and Employment, London (England). Architects and Building Branch.

    This guide for schools with swimming pools offers advice concerning appropriate training for pool managers, the importance of water quality and testing, safety in the handling of chemicals, maintenance and cleaning requirements, pool security, and health concerns. The guide covers both indoor and outdoor pools, explains some technical terms,…

  5. Significant interactions between maternal PAH exposure and haplotypes in candidate genes on B[a]P-DNA adducts in a NYC cohort of non-smoking African-American and Dominican mothers and newborns.

    PubMed

    Iyer, Shoba; Perera, Frederica; Zhang, Bingzhi; Chanock, Stephen; Wang, Shuang; Tang, Deliang

    2014-01-01

    Polycyclic aromatic hydrocarbons (PAH) are a class of chemicals common in the environment. Certain PAH are carcinogenic, although the degree to which genetic variation influences susceptibility to carcinogenic PAH remains unclear. Also unknown is the influence of genetic variation on the procarcinogenic effect of in utero exposures to PAH. Benzo[a]pyrene (B[a]P) is a well-studied PAH that is classified as a probable human carcinogen. Within our New York City-based cohort, we explored interactions between maternal exposure to airborne PAH during pregnancy and maternal and newborn haplotypes (and in one case, a single-nucleotide polymorphism) in key B[a]P metabolism genes on B[a]P-DNA adducts in paired cord blood samples. The study subjects included non-smoking African-American (n = 132) and Dominican (n = 235) women with available data on maternal PAH exposure, paired cord adducts and genetic data who resided in the Washington Heights, Central Harlem and South Bronx neighborhoods of New York City. We selected seven maternal and newborn genes related to B[a]P metabolism, detoxification and repair for our analyses: CYP1A1, CYP1A2, CYP1B1, GSTM3, GSTT2, NQO1 and XRCC1. We found significant interactions between maternal PAH exposure and haplotype on cord B[a]P-DNA adducts in the following genes: maternal CYP1B1, XRCC1 and GSTM3, and newborn CYP1A2 and XRCC1 in African-Americans; and maternal XRCC1 and newborn NQO1 in Dominicans. These novel findings highlight differences in maternal and newborn genetic contributions to B[a]P-DNA adduct formation, as well as ethnic differences in gene-environment interactions, and have the potential to identify at-risk subpopulations who are susceptible to the carcinogenic potential of B[a]P.

  6. Method of measuring a liquid pool volume

    DOEpatents

    Garcia, Gabe V.; Carlson, Nancy M.; Donaldson, Alan D.

    1991-01-01

    A method of measuring a molten metal liquid pool volume and in particular molten titanium liquid pools, including the steps of (a) generating an ultrasonic wave at the surface of the molten metal liquid pool, (b) shining a light on the surface of a molten metal liquid pool, (c) detecting a change in the frequency of light, (d) detecting an ultrasonic wave echo at the surface of the molten metal liquid pool, and (e) computing the volume of the molten metal liquid.

  7. Regional structuring of genetic variation in short-lived rock pool populations of Branchipodopsis wolfi (Crustacea: Anostraca).

    PubMed

    Brendonck, L; De Meester, L; Riddoch, B J

    2000-06-01

    The genetic structure of three metapopulations of the southern African anostracan Branchipodopsis wolfi was compared by analysing allozyme variation at four loci (PGM, GPI, APK, AAT). In total, 17 local populations from three sites (metapopulations) were analysed from rock pools in south-eastern Botswana ranging from 0.2 to 21 m(2) in surface area. In three populations we found significant deviations from Hardy-Weinberg (H-W) equilibrium at one or more loci due to heterozygote deficiencies. Genetic variability at one site was significantly lower than at the other sites, which may be linked to a greater incidence of extinction and recolonisation, as the basins at this site are shallower and have shorter hydrocycles. Across all local populations, a significant level of population differentiation was revealed. More than 90% of this variation was explained by differentiation among sites (metapopulations), although this differentiation did not correlate with geographic distance, or with environmental variables. Genetic differentiation among populations within metapopulations was low, but significant at all sites. At only one of the sites was a significantly positive association measured between genetic and geographic distance among local populations. Our data suggest that persistent stochastic events and limited effective long-range dispersal appear to dominate genetic differentiation among populations of B. wolfi inhabiting desert rock pools. The lack of association between geographic distance and genetic or ecological differences between rock pool sites is indicative of historical stochastic events. Low heterozygosity, the significant deviations from H-W equilibrium, and the large inter- but low intra-site differentiation are suggestive of the importance of short-range dispersal. Gene flow between metapopulations of B. wolfi appears to be seriously constrained by distances of 2 km or even less.

  8. Flame spread across liquid pools

    NASA Technical Reports Server (NTRS)

    Ross, Howard; Miller, Fletcher; Schiller, David; Sirignano, William A.

    1993-01-01

    For flame spread over liquid fuel pools, the existing literature suggests three gravitational influences: (1) liquid phase buoyant convection, delaying ignition and assisting flame spread; (2) hydrostatic pressure variation, due to variation in the liquid pool height caused by thermocapillary-induced convection; and (3) gas-phase buoyant convection in the opposite direction to the liquid phase motion. No current model accounts for all three influences. In fact, prior to this work, there was no ability to determine whether ignition delay times and flame spread rates would be greater or lesser in low gravity. Flame spread over liquid fuel pools is most commonly characterized by the relationship of the initial pool temperature to the fuel's idealized flash point temperature, with four or five separate characteristic regimes having been identified. In the uniform spread regime, control has been attributed to: (1) gas-phase conduction and radiation; (2) gas-phase conduction only; (3) gas-phase convection and liquid conduction, and most recently (4) liquid convection ahead of the flame. Suggestions were made that the liquid convection was owed to both vuoyancy and thermocapillarity. Of special interest to this work is the determination of whether, and under what conditions, pulsating spread can and will occur in microgravity in the absence of buoyant flows in both phases. The approach we have taken to resolving the importance of buoyancy for these flames is: (1) normal gravity experiments and advanced diagnostics; (2) microgravity experiments; and (3) numerical modelling at arbitrary gravitational level.

  9. ENERGY STAR Certified Pool Pumps

    EPA Pesticide Factsheets

    Certified models meet all ENERGY STAR requirements as listed in the Version 1.0 ENERGY STAR Program Requirements for Pool Pumps that are effective as of February 15, 2013. A detailed listing of key efficiency criteria are available at http://www.energystar.gov/index.cfm?c=poolpumps.pr_crit_poolpumps

  10. BRCA1 and BRCA2 Mutations in African Americans

    DTIC Science & Technology

    2002-04-01

    genetic testing in African Americans must include the entire coding and flanking non-coding regions of the BRCA2 gene . "* It is noteworthy that BRCA ...Over 80% of inherited breast cancer is due to mutations in the breast cancer predisposing genes BRCA ] and BRCA2. In one of the largest studies of high...population 25-27,32. Therefore, genetic testing in African Americans must include complete sequencing of both BRCA 1 and BRCA2 genes . Familial cancer

  11. Introducing the Algerian Mitochondrial DNA and Y-Chromosome Profiles into the North African Landscape

    PubMed Central

    Bekada, Asmahan; Fregel, Rosa; Cabrera, Vicente M.; Larruga, José M.; Pestano, José; Benhamamouch, Soraya; González, Ana M.

    2013-01-01

    North Africa is considered a distinct geographic and ethnic entity within Africa. Although modern humans originated in this Continent, studies of mitochondrial DNA (mtDNA) and Y-chromosome genealogical markers provide evidence that the North African gene pool has been shaped by the back-migration of several Eurasian lineages in Paleolithic and Neolithic times. More recent influences from sub-Saharan Africa and Mediterranean Europe are also evident. The presence of East-West and North-South haplogroup frequency gradients strongly reinforces the genetic complexity of this region. However, this genetic scenario is beset with a notable gap, which is the lack of consistent information for Algeria, the largest country in the Maghreb. To fill this gap, we analyzed a sample of 240 unrelated subjects from a northwest Algeria cosmopolitan population using mtDNA sequences and Y-chromosome biallelic polymorphisms, focusing on the fine dissection of haplogroups E and R, which are the most prevalent in North Africa and Europe respectively. The Eurasian component in Algeria reached 80% for mtDNA and 90% for Y-chromosome. However, within them, the North African genetic component for mtDNA (U6 and M1; 20%) is significantly smaller than the paternal (E-M81 and E-V65; 70%). The unexpected presence of the European-derived Y-chromosome lineages R-M412, R-S116, R-U152 and R-M529 in Algeria and the rest of the Maghreb could be the counterparts of the mtDNA H1, H3 and V subgroups, pointing to direct maritime contacts between the European and North African sides of the western Mediterranean. Female influx of sub-Saharan Africans into Algeria (20%) is also significantly greater than the male (10%). In spite of these sexual asymmetries, the Algerian uniparental profiles faithfully correlate between each other and with the geography. PMID:23431392

  12. The T Allele of a Single-Nucleotide Polymorphism 13.9 kb Upstream of the Lactase Gene (LCT) (C−13.9kbT) Does Not Predict or Cause the Lactase-Persistence Phenotype in Africans

    PubMed Central

    Mulcare, Charlotte A.; Weale, Michael E.; Jones, Abigail L.; Connell, Bruce; Zeitlyn, David; Tarekegn, Ayele; Swallow, Dallas M.; Bradman, Neil; Thomas, Mark G.

    2004-01-01

    The ability to digest the milk sugar lactose as an adult (lactase persistence) is a variable genetic trait in human populations. The lactase-persistence phenotype is found at low frequencies in the majority of populations in sub-Saharan Africa that have been tested, but, in some populations, particularly pastoral groups, it is significantly more frequent. Recently, a CT polymorphism located 13.9 kb upstream of exon 1 of the lactase gene (LCT) was shown in a Finnish population to be closely associated with the lactase-persistence phenotype (Enattah et al. 2002). We typed this polymorphism in 1,671 individuals from 20 distinct cultural groups in seven African countries. It was possible to match seven of the groups tested with groups from the literature for whom phenotypic information is available. In five of these groups, the published frequencies of lactase persistence are ⩾25%. We found the T allele to be so rare that it cannot explain the frequency of the lactase-persistence phenotype throughout Africa. By use of a statistical procedure to take phenotyping and sampling errors into account, the T-allele frequency was shown to be significantly different from that predicted in five of the African groups. Only the Fulbe and Hausa from Cameroon possessed the T allele at a level consistent with phenotypic observations (as well as an Irish sample used for comparison). We conclude that the C−13.9kbT polymorphism is not a predictor of lactase persistence in sub-Saharan Africans. We also present Y-chromosome data that are consistent with previously reported evidence for a back-migration event into Cameroon, and we comment on the implications for the introgression of the −13.9kb*T allele. PMID:15106124

  13. Analyses of genes encoding Theileria parva p104 and polymorphic immunodominant molecule (PIM) reveal evidence of the presence of cattle-type alleles in the South African T. parva population.

    PubMed

    Sibeko, Kgomotso P; Collins, Nicola E; Oosthuizen, Marinda C; Troskie, Milana; Potgieter, Frederick T; Coetzer, Jacobus A W; Geysen, Dirk

    2011-09-27

    Restriction fragment length polymorphism analysis of PCR products (PCR-RFLP) and sequencing of the variable region of the p104 and PIM genes was performed on samples obtained from South African T. parva parasites originating from cattle on farms with suspected theileriosis and from buffalo. p104 and PIM PCR-RFLP profiles similar to those of the T. parva Muguga stock, an isolate that causes ECF in Kenya, were obtained from three of seven cattle samples collected on a farm near Ladysmith in KwaZulu-Natal Province. Amino acid sequences of the p104 and PIM genes from two of these samples were almost identical to the T. parva Muguga p104 and PIM sequences. This result supports findings from a recent p67 study in which p67 alleles similar to those of the T. parva Muguga stock were identified from the same samples. While these results suggest the presence of a cattle-derived T. parva parasite, reports of cattle-to-cattle transmission could not be substantiated and ECF was not diagnosed on this farm. Although extensive diversity of p104 and PIM gene sequences from South African T. parva isolates was demonstrated, no sequences identical to known cattle-type p104 and PIM alleles were identified from any of the buffalo T. parva samples analyzed. 'Mixed' PIM alleles containing both cattle- and buffalo-type amino acid motifs were identified for the first time, and there appeared to be selection of cattle-type and 'mixed'-type PIM sequences in the cattle samples examined.

  14. Significant interactions between maternal PAH exposure and haplotypes in candidate genes on B[a]P-DNA adducts in a NYC cohort of non-smoking African-American and Dominican mothers and newborns

    PubMed Central

    Tang, Deliang

    2014-01-01

    Polycyclic aromatic hydrocarbons (PAH) are a class of chemicals common in the environment. Certain PAH are carcinogenic, although the degree to which genetic variation influences susceptibility to carcinogenic PAH remains unclear. Also unknown is the influence of genetic variation on the procarcinogenic effect of in utero exposures to PAH. Benzo[a]pyrene (B[a]P) is a well-studied PAH that is classified as a probable human carcinogen. Within our New York City-based cohort, we explored interactions between maternal exposure to airborne PAH during pregnancy and maternal and newborn haplotypes (and in one case, a single-nucleotide polymorphism) in key B[a]P metabolism genes on B[a]P-DNA adducts in paired cord blood samples. The study subjects included non-smoking African-American (n = 132) and Dominican (n = 235) women with available data on maternal PAH exposure, paired cord adducts and genetic data who resided in the Washington Heights, Central Harlem and South Bronx neighborhoods of New York City. We selected seven maternal and newborn genes related to B[a]P metabolism, detoxification and repair for our analyses: CYP1A1, CYP1A2, CYP1B1, GSTM3, GSTT2, NQO1 and XRCC1. We found significant interactions between maternal PAH exposure and haplotype on cord B[a]P-DNA adducts in the following genes: maternal CYP1B1, XRCC1 and GSTM3, and newborn CYP1A2 and XRCC1 in African-Americans; and maternal XRCC1 and newborn NQO1 in Dominicans. These novel findings highlight differences in maternal and newborn genetic contributions to B[a]P-DNA adduct formation, as well as ethnic differences in gene–environment interactions, and have the potential to identify at-risk subpopulations who are susceptible to the carcinogenic potential of B[a]P. PMID:24177223

  15. African Americans and Glaucoma

    MedlinePlus

    ... Involved News About Us Donate In This Section African Americans and Glaucoma email Send this article to a ... glaucoma is the leading cause of blindness in African Americans. Half of those with glaucoma don't know ...

  16. Black African Traditional Mathematics

    ERIC Educational Resources Information Center

    Zaslavsky, Claudia

    1970-01-01

    Discusses the traditional number systems and the origin of the number names used by several African peoples living south of the Sahara. Also included are limitations in African mathematical development, and possible topics for research. (RP)

  17. The African Connection

    ERIC Educational Resources Information Center

    Oguntoyinbo, Lekan

    2012-01-01

    From student and faculty exchanges to joint research projects, U.S. universities maintain a broad spectrum of collaborative relationships with African universities. It's unclear how many U.S. colleges and universities have partnerships with African universities. The African Studies Association, an organization of scholars, doesn't keep that kind…

  18. Meta- and pooled analyses of the cytochrome P-450 1B1 Val432Leu polymorphism and breast cancer: a HuGE-GSEC review.

    PubMed

    Paracchini, Valentina; Raimondi, Sara; Gram, Inger T; Kang, Daehee; Kocabas, Neslihan A; Kristensen, Vessela N; Li, Donghui; Parl, Fritz F; Rylander-Rudqvist, Tove; Soucek, Pavel; Zheng, Wei; Wedren, Sara; Taioli, Emanuela

    2007-01-15

    The association between the cytochrome P-450 1B1 (CYP1B1) Val432Leu polymorphism and breast cancer was assessed through a meta-analysis of all published case-control studies and a pooled analysis of both published and unpublished case-control studies from the Genetic Susceptibility to Environmental Carcinogens (GSEC) database ( www.upci.upmc.edu/research/ccps/ccontrol/g_intro.html ). GSEC is a collaborative project that gathers information on studies of metabolic gene polymorphisms and cancer. Thirteen articles were included in the meta-analysis (14,331 subjects; 7,514 cases, 6,817 controls); nine data sets were included in the pooled analysis (6,842 subjects; 3,391 cases, 3,451 controls). A summary meta- or pooled estimate of the association between the CYP1B1 Val432Leu polymorphism and breast cancer could not be calculated because of statistically significant heterogeneity in the point estimates among studies. No association between the CYP1B1 Val432Leu polymorphism and breast cancer was observed in Asians (for Val/Val and Val/Leu combined, odds ratio (OR) = 1.0, 95% confidence interval (CI): 0.8, 1.2). An inverse association was observed in populations of mixed/African origin (OR = 0.8, 95% CI: 0.7, 0.9). The pooled analysis suggested a possible association in Caucasians (for Val/Val and Val/Leu combined, OR = 1.5, 95% CI: 1.1, 2.1), with effect modification across age categories. The observed effect of age on the association in Caucasians indicates that further studies are needed on the role of CYP1B1 Val432Leu in estrogen metabolism according to age, ethnicity, and menopausal status.

  19. Sustainability of common pool resources

    PubMed Central

    Timilsina, Raja Rajendra; Kamijo, Yoshio

    2017-01-01

    Sustainability has become a key issue in managing natural resources together with growing concerns for capitalism, environmental and resource problems. We hypothesize that the ongoing modernization of competitive societies, which we refer to as “capitalism,” affects human nature for utilizing common pool resources, thus compromising sustainability. To test this hypothesis, we design and implement a set of dynamic common pool resource games and experiments in the following two types of Nepalese areas: (i) rural (non-capitalistic) and (ii) urban (capitalistic) areas. We find that a proportion of prosocial individuals in urban areas is lower than that in rural areas, and urban residents deplete resources more quickly than rural residents. The composition of proself and prosocial individuals in a group and the degree of capitalism are crucial in that an increase in prosocial members in a group and the rural dummy positively affect resource sustainability by 65% and 63%, respectively. Overall, this paper shows that when societies move toward more capitalistic environments, the sustainability of common pool resources tends to decrease with the changes in individual preferences, social norms, customs and views to others through human interactions. This result implies that individuals may be losing their coordination abilities for social dilemmas of resource sustainability in capitalistic societies. PMID:28212426

  20. Pool power control in remelting systems

    DOEpatents

    Williamson, Rodney L [Albuquerque, NM; Melgaard, David K [Albuquerque, NM; Beaman, Joseph J [Austin, TX

    2011-12-13

    An apparatus for and method of controlling a remelting furnace comprising adjusting current supplied to an electrode based upon a predetermined pool power reference value and adjusting the electrode drive speed based upon the predetermined pool power reference value.

  1. Cold Pools in the Columbia Basin

    SciTech Connect

    Whiteman, Charles D.; Zhong, Shiyuan; Shaw, William J.; Hubbe, John M.; Bian, Xindi; Mittelstadt, J.

    2001-01-01

    Persistent midwinter cold air pools produce multi-day periods of cold, dreary weather in valleys and basins. Persistent stable stratification leads to the buildup of pollutants and moisture in the pool. Because the pool sometimes has temperatures below freezing while the air above is warmer, freezing precipitation often occurs with consequent effects on transportation and safety. Forecasting the buildup and breakdown of these cold pools is difficult because the physical mechanisms leading to their formation, maintenance, and destruction have received little study. This paper provides a succinct meteorological definition of a cold pool, develops a climatology of Columbia Basin cold pools, and analyzes remote and in situ temperature and wind sounding data for two winter cold pool episodes that were accompanied by fog and stratus, illustrating many of the physical mechanisms affecting cold pool evolution.

  2. Pool Safety: A Few Simple Rules.

    ERIC Educational Resources Information Center

    PTA Today, 1993

    1993-01-01

    Presents suggestions by the National Swimming Pool Safety Committee on how to keep children safe while swimming. Ideas include maintaining strict adult supervision, pool and spa barriers, and knowledge of cardiopulmonary resuscitation. (SM)

  3. Methyl-Deficient Diets and Risks of Breast Cancer Among African-American Women: A Case-Control Study by Methylation Status of the ER Gene

    DTIC Science & Technology

    1999-10-01

    Fort Detrick, MD 21702-5012. AUTHORITY USAMRMC, 5 Mar 2002 THIS PAGE IS UNCLASSIFIED AD Award Number: DAMD17-97- 1 -7287 TITLE: Methyl-Deficient Diets and...RELATE TO THEM. LIMITED RIGHTS LEGEND 7 / Award Number: DAMD17-97- 1 -7287 Organization: Meharry Medical College Location of Limited Rights Data (Pages...Risks of Breast CanCer Among~ rAMD17-97- 1 -7287 African-American Women: A Case-Control Study by Methylation Status of thet ER Gone 6. AUTHOR(S) i

  4. Identification of Homogeneous and Heterogeneous Variables in Pooled Cohort Studies

    PubMed Central

    Cheng, Xin; Lu, Wenbin; Liu, Mengling

    2016-01-01

    Summary Pooled analyses integrate data from multiple studies and achieve a larger sample size for enhanced statistical power. When heterogeneity exists in variables’ effects on the outcome across studies, the simple pooling strategy fails to present a fair and complete picture of the effects of heterogeneous variables. Thus, it is important to investigate the homogeneous and heterogeneous structure of variables in pooled studies. In this paper, we consider the pooled cohort studies with time-to-event outcomes and propose a penalized Cox partial likelihood approach with adaptively weighted composite penalties on variables’ homogeneous and heterogeneous effects. We show that our method can characterize the variables as having heterogeneous, homogeneous, or null effects, and estimate non-zero effects. The results are readily extended to high-dimensional applications where the number of parameters is larger than the sample size. The proposed selection and estimation procedure can be implemented using the iterative shooting algorithm. We conduct extensive numerical studies to evaluate the performance of our proposed method and demonstrate it using a pooled analysis of gene expression in patients with ovarian cancer. PMID:25732747

  5. Oligonucleotide Based Magnetic Bead Capture of Onchocerca volvulus DNA for PCR Pool Screening of Vector Black Flies

    PubMed Central

    Gopal, Hemavathi; Hassan, Hassan K.; Rodríguez-Pérez, Mario A.; Toé, Laurent D.; Lustigman, Sara; Unnasch, Thomas R.

    2012-01-01

    Background Entomological surveys of Simulium vectors are an important component in the criteria used to determine if Onchocerca volvulus transmission has been interrupted and if focal elimination of the parasite has been achieved. However, because infection in the vector population is quite rare in areas where control has succeeded, large numbers of flies need to be examined to certify transmission interruption. Currently, this is accomplished through PCR pool screening of large numbers of flies. The efficiency of this process is limited by the size of the pools that may be screened, which is in turn determined by the constraints imposed by the biochemistry of the assay. The current method of DNA purification from pools of vector black flies relies upon silica adsorption. This method can be applied to screen pools containing a maximum of 50 individuals (from the Latin American vectors) or 100 individuals (from the African vectors). Methodology/Principal Findings We have evaluated an alternative method of DNA purification for pool screening of black flies which relies upon oligonucleotide capture of Onchocerca volvulus genomic DNA from homogenates prepared from pools of Latin American and African vectors. The oligonucleotide capture assay was shown to reliably detect one O. volvulus infective larva in pools containing 200 African or Latin American flies, representing a two-four fold improvement over the conventional assay. The capture assay requires an equivalent amount of technical time to conduct as the conventional assay, resulting in a two-four fold reduction in labor costs per insect assayed and reduces reagent costs to $3.81 per pool of 200 flies, or less than $0.02 per insect assayed. Conclusions/Significance The oligonucleotide capture assay represents a substantial improvement in the procedure used to detect parasite prevalence in the vector population, a major metric employed in the process of certifying the elimination of onchocerciasis. PMID:22724041

  6. Development of a suspension microarray for the genotyping of African swine fever virus targeting the SNPs in the C-terminal end of the p72 gene region of the genome.

    PubMed

    Leblanc, N; Cortey, M; Fernandez Pinero, J; Gallardo, C; Masembe, C; Okurut, A R; Heath, L; van Heerden, J; Sánchez-Vizcaino, J M; Ståhl, K; Belák, S

    2013-08-01

    African swine fever virus (ASFV) causes one of the most dreaded transboundary animal diseases (TADs) in Suidae. African swine fever (ASF) often causes high rates of morbidity and mortality, which can reach 100% in domestic swine. To date, serological diagnosis has the drawback of not being able to differentiate variants of this virus. Previous studies have identified the 22 genotypes based on sequence variation in the C-terminal region of the p72 gene, which has become the standard for categorizing ASFVs. This article describes a genotyping assay developed using a segment of PCR-amplified genomic DNA of approximately 450 bp, which encompasses the C-terminal end of the p72 gene. Complementary paired DNA probes of 15 or 17 bp in length, which are identical except for a single nucleotide polymorphism (SNP) in the central position, were designed to either individually or in combination differentiate between the 22 genotypes. The assay was developed using xMAP technology; probes were covalently linked to microspheres, hybridized to PCR product, labelled with a reporter and read in the Luminex 200 analyzer. Characterization of the sample was performed by comparing fluorescence of the paired SNP probes, that is, the probe with higher fluorescence in a complementary pair identified the SNP that a particular sample possessed. In the final assay, a total of 52 probes were employed, 24 SNP pairs and 4 for general detection. One or more samples from each of the 22 genotypes were tested. The assay was able to detect and distinguish all 22 genotypes. This novel assay provides a powerful novel tool for the simultaneous rapid diagnosis and genotypic differentiation of ASF.

  7. Swimming Pool Survey, Offutt AFB, Nebraska.

    DTIC Science & Technology

    1987-12-01

    70-RIl9 236 SWIMMING POOL SIEVEY OFFUTT NWD NEURASIR(U) AIR FORCE 1/1 OCCUIPATIONAL AND EIWIRONHENTAL HEALTH LAIDBOOKS NFl TX ft 0 INGY! DEC 87... test in swimming pool evaluations to determine the severity of’ future contamination problems. C. In order to maintain pool water stability...154EQ0146MSB I4 Swimming Pool Survey, Offutt AFB NE ROBERT D. BINOVI, Lt Col, USAF, BSC vTO ELECTEOEC 3 1197 ,: i December 1987 Final Report Distribution

  8. Swimming pools soak up the sun

    SciTech Connect

    Cuoghi, D.; Hesse, P.; Schiller, T.

    1996-05-01

    Solar pool heaters survived the boom and bust solar years of the 1970s and 1980s. Today they are even popular and cost-effective in parts of the country where many people think solar is impractical. This article discusses the following topics: how solar pool heaters work; types of solar pool heater collectors; collector and pump sizing; collector siting and mounting; systems costs and economics; pool covers. 3 figs.

  9. Effects of pool-fencing ordinances and other factors on childhood drowning in Los Angeles County, 1990-1995.

    PubMed Central

    Morgenstern, H; Bingham, T; Reza, A

    2000-01-01

    OBJECTIVES: This study estimated the effects of local pool-fencing ordinances and other factors on the rate of childhood drowning in Los Angeles County, California. METHODS: Stage 1 was a retrospective dynamic cohort study of all drownings among children younger than 10 years that occurred in residential swimming pools in Los Angeles County between 1990 and 1995. Stage 2 was a matched case-control study that compared pools in which childhood drownings occurred (cases) with randomly selected pools in which drownings did not occur (controls). RESULTS: The drowning rate was relatively high among toddlers (aged 1-4 years), boys, and African Americans and in areas with a high density of residential swimming pools. Pool-fencing ordinances were not associated with a reduced overall rate of childhood drowning. CONCLUSIONS: Local ordinances enacted in Los Angeles County before 1996 do not appear to have been effective in reducing the rate of childhood drowning in residential pools. Possible reasons for this ineffectiveness are insufficient building codes for isolating pools from homes, inadequate enforcement of the ordinances, and inadequate operation or maintenance of fencing equipment by pool owners. PMID:10754975

  10. 7 CFR 1001.7 - Pool plant.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Pool plant. 1001.7 Section 1001.7 Agriculture... Handling Definitions § 1001.7 Pool plant. Pool plant means a plant, unit of plants, or system of plants as specified in paragraphs (a) through (f) of this section, but excluding a plant described in paragraph (h)...

  11. 7 CFR 1005.7 - Pool plant.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Pool plant. 1005.7 Section 1005.7 Agriculture... Handling Definitions § 1005.7 Pool plant. Pool plant means a plant specified in paragraphs (a) through (d) of this section, a unit of plants as specified in paragraph (e) of this section, or a plant...

  12. 7 CFR 1001.7 - Pool plant.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 9 2011-01-01 2011-01-01 false Pool plant. 1001.7 Section 1001.7 Agriculture... Handling Definitions § 1001.7 Pool plant. Pool plant means a plant, unit of plants, or system of plants as specified in paragraphs (a) through (f) of this section, but excluding a plant described in paragraph (h)...

  13. 7 CFR 1124.7 - Pool plant.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Pool plant. 1124.7 Section 1124.7 Agriculture... Regulating Handling Definitions § 1124.7 Pool plant. Pool plant means a plant, unit of plants, or a system of plants as specified in paragraphs (a) through (f) of this section, but excluding a plant specified...

  14. 7 CFR 1033.7 - Pool plant.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 9 2011-01-01 2011-01-01 false Pool plant. 1033.7 Section 1033.7 Agriculture... Handling Definitions § 1033.7 Pool plant. Pool plant means a plant, unit of plants, or system of plants as specified in paragraphs (a) through (f) of this section, or a plant specified in paragraph (j) of...

  15. 7 CFR 1131.7 - Pool plant.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 9 2011-01-01 2011-01-01 false Pool plant. 1131.7 Section 1131.7 Agriculture... Handling Definitions § 1131.7 Pool plant. Pool Plant means a plant or unit of plants specified in paragraphs (a) through (e) of this section, but excluding a plant specified in paragraph (g) of this...

  16. 7 CFR 1131.7 - Pool plant.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Pool plant. 1131.7 Section 1131.7 Agriculture... Handling Definitions § 1131.7 Pool plant. Pool Plant means a plant or unit of plants specified in paragraphs (a) through (e) of this section, but excluding a plant specified in paragraph (g) of this...

  17. 7 CFR 1032.7 - Pool plant.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 9 2011-01-01 2011-01-01 false Pool plant. 1032.7 Section 1032.7 Agriculture... Handling Definitions § 1032.7 Pool plant. Pool plant means a plant, unit of plants, or system of plants as specified in paragraphs (a) through (f) of this section, or a plant specified in paragraph (i) of...

  18. 7 CFR 1006.7 - Pool plant.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Pool plant. 1006.7 Section 1006.7 Agriculture... Handling Definitions § 1006.7 Pool plant. Pool plant means a plant specified in paragraphs (a) through (d) of this section, a unit of plants as specified in paragraph (e) of this section, or a plant...

  19. 7 CFR 1007.7 - Pool plant.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Pool plant. 1007.7 Section 1007.7 Agriculture... Handling Definitions § 1007.7 Pool plant. Pool plant means a plant specified in paragraphs (a) through (d) of this section, a unit of plants as specified in paragraph (e) of this section, or a plant...

  20. 7 CFR 1006.7 - Pool plant.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 9 2011-01-01 2011-01-01 false Pool plant. 1006.7 Section 1006.7 Agriculture... Handling Definitions § 1006.7 Pool plant. Pool plant means a plant specified in paragraphs (a) through (d) of this section, a unit of plants as specified in paragraph (e) of this section, or a plant...

  1. 7 CFR 1126.7 - Pool plant.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 9 2011-01-01 2011-01-01 false Pool plant. 1126.7 Section 1126.7 Agriculture... Handling Definitions § 1126.7 Pool plant. Pool plant means a plant specified in paragraphs (a) through (d) of this section, a unit of plants as specified in paragraph (e) of this section, or a plant...

  2. 7 CFR 1032.7 - Pool plant.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Pool plant. 1032.7 Section 1032.7 Agriculture... Handling Definitions § 1032.7 Pool plant. Pool plant means a plant, unit of plants, or system of plants as specified in paragraphs (a) through (f) of this section, or a plant specified in paragraph (i) of...

  3. 7 CFR 1124.7 - Pool plant.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 9 2011-01-01 2011-01-01 false Pool plant. 1124.7 Section 1124.7 Agriculture... Regulating Handling Definitions § 1124.7 Pool plant. Pool plant means a plant, unit of plants, or a system of plants as specified in paragraphs (a) through (f) of this section, but excluding a plant specified...

  4. 7 CFR 1007.7 - Pool plant.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 9 2011-01-01 2011-01-01 false Pool plant. 1007.7 Section 1007.7 Agriculture... Handling Definitions § 1007.7 Pool plant. Pool plant means a plant specified in paragraphs (a) through (d) of this section, a unit of plants as specified in paragraph (e) of this section, or a plant...

  5. 7 CFR 1030.7 - Pool plant.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Pool plant. 1030.7 Section 1030.7 Agriculture... Handling Definitions § 1030.7 Pool plant. Pool plant means a plant, unit of plants, or system of plants as specified in paragraphs (a) through (f) of this section, but excluding a plant specified in paragraph (h)...

  6. 7 CFR 1005.7 - Pool plant.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 9 2011-01-01 2011-01-01 false Pool plant. 1005.7 Section 1005.7 Agriculture... Handling Definitions § 1005.7 Pool plant. Pool plant means a plant specified in paragraphs (a) through (d) of this section, a unit of plants as specified in paragraph (e) of this section, or a plant...

  7. 7 CFR 1033.7 - Pool plant.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Pool plant. 1033.7 Section 1033.7 Agriculture... Handling Definitions § 1033.7 Pool plant. Pool plant means a plant, unit of plants, or system of plants as specified in paragraphs (a) through (f) of this section, or a plant specified in paragraph (j) of...

  8. 7 CFR 1126.7 - Pool plant.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Pool plant. 1126.7 Section 1126.7 Agriculture... Handling Definitions § 1126.7 Pool plant. Pool plant means a plant specified in paragraphs (a) through (d) of this section, a unit of plants as specified in paragraph (e) of this section, or a plant...

  9. 7 CFR 1030.7 - Pool plant.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 9 2011-01-01 2011-01-01 false Pool plant. 1030.7 Section 1030.7 Agriculture... Handling Definitions § 1030.7 Pool plant. Pool plant means a plant, unit of plants, or system of plants as specified in paragraphs (a) through (f) of this section, but excluding a plant specified in paragraph (h)...

  10. 28 CFR 540.64 - Press pools.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Press pools. 540.64 Section 540.64... PERSONS IN THE COMMUNITY Contact With News Media § 540.64 Press pools. (a) The Warden may establish a press pool whenever he or she determines that the frequency of requests for interviews and...

  11. 1968 Listing of Swimming Pool Equipment.

    ERIC Educational Resources Information Center

    National Sanitation Foundation, Ann Arbor, MI. Testing Lab.

    An up-to-date listing of swimming pool equipment including--(1) companies authorized to display the National Sanitation Foundation seal of approval, (2) equipment listed as meeting NSF swimming pool equipment standards relating to diatomite type filters, (3) equipment listed as meeting NSF swimming pool equipment standard relating to sand type…

  12. 47 CFR 13.215 - Question pools.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false Question pools. 13.215 Section 13.215 Telecommunication FEDERAL COMMUNICATIONS COMMISSION GENERAL COMMERCIAL RADIO OPERATORS Examination System § 13.215 Question pools. The question pool for each written examination element will be composed of...

  13. Apparatus for heating a swimming pool

    SciTech Connect

    Kremen, R.D.

    1983-09-06

    This disclosure relates to a solar heater apparatus for a swimming pool which incorporates a submersible suspendible black body sheet to serve as a device to absorb solar radiation and transfer the collected energy to the pool water so that the pool water can be efficiently heated.

  14. 7 CFR 1033.7 - Pool plant.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 9 2014-01-01 2013-01-01 true Pool plant. 1033.7 Section 1033.7 Agriculture... Handling Definitions § 1033.7 Pool plant. Pool plant means a plant, unit of plants, or system of plants as specified in paragraphs (a) through (f) of this section, or a plant specified in paragraph (j) of...

  15. 7 CFR 1006.7 - Pool plant.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 9 2013-01-01 2013-01-01 false Pool plant. 1006.7 Section 1006.7 Agriculture... Handling Definitions § 1006.7 Pool plant. Pool plant means a plant specified in paragraphs (a) through (d) of this section, a unit of plants as specified in paragraph (e) of this section, or a plant...

  16. 7 CFR 1126.7 - Pool plant.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 9 2013-01-01 2013-01-01 false Pool plant. 1126.7 Section 1126.7 Agriculture... Handling Definitions § 1126.7 Pool plant. Pool plant means a plant specified in paragraphs (a) through (d) of this section, a unit of plants as specified in paragraph (e) of this section, or a plant...

  17. 7 CFR 1005.7 - Pool plant.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 9 2012-01-01 2012-01-01 false Pool plant. 1005.7 Section 1005.7 Agriculture... Handling Definitions § 1005.7 Pool plant. Pool plant means a plant specified in paragraphs (a) through (d) of this section, a unit of plants as specified in paragraph (e) of this section, or a plant...

  18. 7 CFR 1007.7 - Pool plant.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 9 2013-01-01 2013-01-01 false Pool plant. 1007.7 Section 1007.7 Agriculture... Handling Definitions § 1007.7 Pool plant. Pool plant means a plant specified in paragraphs (a) through (d) of this section, a unit of plants as specified in paragraph (e) of this section, or a plant...

  19. 7 CFR 1030.7 - Pool plant.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 9 2014-01-01 2013-01-01 true Pool plant. 1030.7 Section 1030.7 Agriculture... Handling Definitions § 1030.7 Pool plant. Pool plant means a plant, unit of plants, or system of plants as specified in paragraphs (a) through (f) of this section, but excluding a plant specified in paragraph (h)...

  20. 7 CFR 1005.7 - Pool plant.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 9 2013-01-01 2013-01-01 false Pool plant. 1005.7 Section 1005.7 Agriculture... Handling Definitions § 1005.7 Pool plant. Pool plant means a plant specified in paragraphs (a) through (d) of this section, a unit of plants as specified in paragraph (e) of this section, or a plant...

  1. 7 CFR 1032.7 - Pool plant.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 9 2012-01-01 2012-01-01 false Pool plant. 1032.7 Section 1032.7 Agriculture... Handling Definitions § 1032.7 Pool plant. Pool plant means a plant, unit of plants, or system of plants as specified in paragraphs (a) through (f) of this section, or a plant specified in paragraph (i) of...

  2. 7 CFR 1005.7 - Pool plant.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 9 2014-01-01 2013-01-01 true Pool plant. 1005.7 Section 1005.7 Agriculture... Handling Definitions § 1005.7 Pool plant. Pool plant means a plant specified in paragraphs (a) through (d) of this section, a unit of plants as specified in paragraph (e) of this section, or a plant...

  3. 7 CFR 1007.7 - Pool plant.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 9 2012-01-01 2012-01-01 false Pool plant. 1007.7 Section 1007.7 Agriculture... Handling Definitions § 1007.7 Pool plant. Pool plant means a plant specified in paragraphs (a) through (d) of this section, a unit of plants as specified in paragraph (e) of this section, or a plant...

  4. 7 CFR 1032.7 - Pool plant.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 9 2013-01-01 2013-01-01 false Pool plant. 1032.7 Section 1032.7 Agriculture... Handling Definitions § 1032.7 Pool plant. Pool plant means a plant, unit of plants, or system of plants as specified in paragraphs (a) through (f) of this section, or a plant specified in paragraph (i) of...

  5. 7 CFR 1124.7 - Pool plant.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 9 2013-01-01 2013-01-01 false Pool plant. 1124.7 Section 1124.7 Agriculture... Regulating Handling Definitions § 1124.7 Pool plant. Pool plant means a plant, unit of plants, or a system of plants as specified in paragraphs (a) through (f) of this section, but excluding a plant specified...

  6. 7 CFR 1001.7 - Pool plant.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 9 2014-01-01 2013-01-01 true Pool plant. 1001.7 Section 1001.7 Agriculture... Handling Definitions § 1001.7 Pool plant. Pool plant means a plant, unit of plants, or system of plants as specified in paragraphs (a) through (f) of this section, but excluding a plant described in paragraph (h)...

  7. 7 CFR 1001.7 - Pool plant.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 9 2013-01-01 2013-01-01 false Pool plant. 1001.7 Section 1001.7 Agriculture... Handling Definitions § 1001.7 Pool plant. Pool plant means a plant, unit of plants, or system of plants as specified in paragraphs (a) through (f) of this section, but excluding a plant described in paragraph (h)...

  8. 7 CFR 1033.7 - Pool plant.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 9 2012-01-01 2012-01-01 false Pool plant. 1033.7 Section 1033.7 Agriculture... Handling Definitions § 1033.7 Pool plant. Pool plant means a plant, unit of plants, or system of plants as specified in paragraphs (a) through (f) of this section, or a plant specified in paragraph (j) of...

  9. 7 CFR 1030.7 - Pool plant.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 9 2012-01-01 2012-01-01 false Pool plant. 1030.7 Section 1030.7 Agriculture... Handling Definitions § 1030.7 Pool plant. Pool plant means a plant, unit of plants, or system of plants as specified in paragraphs (a) through (f) of this section, but excluding a plant specified in paragraph (h)...

  10. 7 CFR 1131.7 - Pool plant.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 9 2012-01-01 2012-01-01 false Pool plant. 1131.7 Section 1131.7 Agriculture... Handling Definitions § 1131.7 Pool plant. Pool Plant means a plant or unit of plants specified in paragraphs (a) through (e) of this section, but excluding a plant specified in paragraph (g) of this...

  11. 7 CFR 1033.7 - Pool plant.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 9 2013-01-01 2013-01-01 false Pool plant. 1033.7 Section 1033.7 Agriculture... Handling Definitions § 1033.7 Pool plant. Pool plant means a plant, unit of plants, or system of plants as specified in paragraphs (a) through (f) of this section, or a plant specified in paragraph (j) of...

  12. 7 CFR 1006.7 - Pool plant.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 9 2012-01-01 2012-01-01 false Pool plant. 1006.7 Section 1006.7 Agriculture... Handling Definitions § 1006.7 Pool plant. Pool plant means a plant specified in paragraphs (a) through (d) of this section, a unit of plants as specified in paragraph (e) of this section, or a plant...

  13. 7 CFR 1126.7 - Pool plant.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 9 2012-01-01 2012-01-01 false Pool plant. 1126.7 Section 1126.7 Agriculture... Handling Definitions § 1126.7 Pool plant. Pool plant means a plant specified in paragraphs (a) through (d) of this section, a unit of plants as specified in paragraph (e) of this section, or a plant...

  14. 7 CFR 1126.7 - Pool plant.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 9 2014-01-01 2013-01-01 true Pool plant. 1126.7 Section 1126.7 Agriculture... Handling Definitions § 1126.7 Pool plant. Pool plant means a plant specified in paragraphs (a) through (d) of this section, a unit of plants as specified in paragraph (e) of this section, or a plant...

  15. 7 CFR 1006.7 - Pool plant.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 9 2014-01-01 2013-01-01 true Pool plant. 1006.7 Section 1006.7 Agriculture... Handling Definitions § 1006.7 Pool plant. Pool plant means a plant specified in paragraphs (a) through (d) of this section, a unit of plants as specified in paragraph (e) of this section, or a plant...

  16. 7 CFR 1030.7 - Pool plant.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 9 2013-01-01 2013-01-01 false Pool plant. 1030.7 Section 1030.7 Agriculture... Handling Definitions § 1030.7 Pool plant. Pool plant means a plant, unit of plants, or system of plants as specified in paragraphs (a) through (f) of this section, but excluding a plant specified in paragraph (h)...

  17. 7 CFR 1124.7 - Pool plant.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 9 2014-01-01 2013-01-01 true Pool plant. 1124.7 Section 1124.7 Agriculture... Regulating Handling Definitions § 1124.7 Pool plant. Pool plant means a plant, unit of plants, or a system of plants as specified in paragraphs (a) through (f) of this section, but excluding a plant specified...

  18. 7 CFR 1001.7 - Pool plant.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 9 2012-01-01 2012-01-01 false Pool plant. 1001.7 Section 1001.7 Agriculture... Handling Definitions § 1001.7 Pool plant. Pool plant means a plant, unit of plants, or system of plants as specified in paragraphs (a) through (f) of this section, but excluding a plant described in paragraph (h)...

  19. 7 CFR 1131.7 - Pool plant.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 9 2014-01-01 2013-01-01 true Pool plant. 1131.7 Section 1131.7 Agriculture... Handling Definitions § 1131.7 Pool plant. Pool Plant means a plant or unit of plants specified in paragraphs (a) through (e) of this section, but excluding a plant specified in paragraph (g) of this...

  20. 7 CFR 1124.7 - Pool plant.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 9 2012-01-01 2012-01-01 false Pool plant. 1124.7 Section 1124.7 Agriculture... Regulating Handling Definitions § 1124.7 Pool plant. Pool plant means a plant, unit of plants, or a system of plants as specified in paragraphs (a) through (f) of this section, but excluding a plant specified...

  1. 7 CFR 1007.7 - Pool plant.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 9 2014-01-01 2013-01-01 true Pool plant. 1007.7 Section 1007.7 Agriculture... Handling Definitions § 1007.7 Pool plant. Pool plant means a plant specified in paragraphs (a) through (d) of this section, a unit of plants as specified in paragraph (e) of this section, or a plant...

  2. 7 CFR 1131.7 - Pool plant.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 9 2013-01-01 2013-01-01 false Pool plant. 1131.7 Section 1131.7 Agriculture... Handling Definitions § 1131.7 Pool plant. Pool Plant means a plant or unit of plants specified in paragraphs (a) through (e) of this section, but excluding a plant specified in paragraph (g) of this...

  3. 7 CFR 1032.7 - Pool plant.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 9 2014-01-01 2013-01-01 true Pool plant. 1032.7 Section 1032.7 Agriculture... Handling Definitions § 1032.7 Pool plant. Pool plant means a plant, unit of plants, or system of plants as specified in paragraphs (a) through (f) of this section, or a plant specified in paragraph (i) of...

  4. 13 CFR 120.1709 - Transfers of Pool Certificates.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... of transmittal must accompany each Pool Certificate which a Pool Investor submits to the CSA for transfer. The Pool Investor must supply the following information in the letter: (1) Pool number; (2) Pool... recovery. At the same time a Pool Investor submits a letter of transmittal for a Pool Certificate...

  5. 13 CFR 120.1709 - Transfers of Pool Certificates.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... of transmittal must accompany each Pool Certificate which a Pool Investor submits to the CSA for transfer. The Pool Investor must supply the following information in the letter: (1) Pool number; (2) Pool... recovery. At the same time a Pool Investor submits a letter of transmittal for a Pool Certificate...

  6. Population Genomics of sub-saharan Drosophila melanogaster: African diversity and non-African admixture.

    PubMed

    Pool, John E; Corbett-Detig, Russell B; Sugino, Ryuichi P; Stevens, Kristian A; Cardeno, Charis M; Crepeau, Marc W; Duchen, Pablo; Emerson, J J; Saelao, Perot; Begun, David J; Langley, Charles H

    2012-01-01

    Drosophila melanogaster has played a pivotal role in the development of modern population genetics. However, many basic questions regarding the demographic and adaptive history of this species remain unresolved. We report the genome sequencing of 139 wild-derived strains of D. melanogaster, representing 22 population samples from the sub-Saharan ancestral range of this species, along with one European population. Most genomes were sequenced above 25X depth from haploid embryos. Results indicated a pervasive influence of non-African admixture in many African populations, motivating the development and application of a novel admixture detection method. Admixture proportions varied among populations, with greater admixture in urban locations. Admixture levels also varied across the genome, with localized peaks and valleys suggestive of a non-neutral introgression process. Genomes from the same location differed starkly in ancestry, suggesting that isolation mechanisms may exist within African populations. After removing putatively admixed genomic segments, the greatest genetic diversity was observed in southern Africa (e.g. Zambia), while diversity in other populations was largely consistent with a geographic expansion from this potentially ancestral region. The European population showed different levels of diversity reduction on each chromosome arm, and some African populations displayed chromosome arm-specific diversity reductions. Inversions in the European sample were associated with strong elevations in diversity across chromosome arms. Genomic scans were conducted to identify loci that may represent targets of positive selection within an African population, between African populations, and between European and African populations. A disproportionate number of candidate selective sweep regions were located near genes with varied roles in gene regulation. Outliers for Europe-Africa F(ST) were found to be enriched in genomic regions of locally elevated

  7. Why African American women leave the academy: barriers to and opportunities for retention.

    PubMed

    Gregory, S T

    1994-01-01

    African American women have participated in higher education for well over a century. Although the journey has been difficult, significant achievements have been made. Today, fewer African American women doctoral recipients are choosing academic employment, and many of those who enter the academy later leave for employment in business, industry and the professions where salaries are often more attractive. Furthermore, the present decline of African American faculty women is expected to become more severe as the growth of the academic labor market levels off. If we are to successfully retain the pool of African American faculty women it is important to discover the reasons why an increasing number are voluntarily leaving the academy. This article is based on a cross-sectional study of 384 African American academic women which examines the primary barriers to faculty retention and offer suggestions to help prevent the further loss of African American women scholars.

  8. Method of measuring a liquid pool volume

    DOEpatents

    Garcia, G.V.; Carlson, N.M.; Donaldson, A.D.

    1991-03-19

    A method of measuring a molten metal liquid pool volume and in particular molten titanium liquid pools is disclosed, including the steps of (a) generating an ultrasonic wave at the surface of the molten metal liquid pool, (b) shining a light on the surface of a molten metal liquid pool, (c) detecting a change in the frequency of light, (d) detecting an ultrasonic wave echo at the surface of the molten metal liquid pool, and (e) computing the volume of the molten metal liquid. 3 figures.

  9. Patent Pools: Intellectual Property Rights and Competition

    PubMed Central

    Rodriguez, Victor

    2010-01-01

    Patent pools do not correct all problems associated with patent thickets. In this respect, patent pools might not stop the outsider problem from striking pools. Moreover, patent pools can be expensive to negotiate, can exclude patent holders with smaller numbers of patents or enable a group of major players to form a cartel that excludes new competitors. For all the above reasons, patent pools are subject to regulatory clearance because they could result in a monopoly. The aim of this article is to present the relationship between patents and competition in a broad context. PMID:20200607

  10. Y Chromosome Lineages in Men of West African Descent

    PubMed Central

    Keita, Shomarka O. Y.; Kittles, Rick A.

    2012-01-01

    The early African experience in the Americas is marked by the transatlantic slave trade from ∼1619 to 1850 and the rise of the plantation system. The origins of enslaved Africans were largely dependent on European preferences as well as the availability of potential laborers within Africa. Rice production was a key industry of many colonial South Carolina low country plantations. Accordingly, rice plantations owners within South Carolina often requested enslaved Africans from the so-called “Grain Coast” of western Africa (Senegal to Sierra Leone). Studies on the African origins of the enslaved within other regions of the Americas have been limited. To address the issue of origins of people of African descent within the Americas and understand more about the genetic heterogeneity present within Africa and the African Diaspora, we typed Y chromosome specific markers in 1,319 men consisting of 508 west and central Africans (from 12 populations), 188 Caribbeans (from 2 islands), 532 African Americans (AAs from Washington, DC and Columbia, SC), and 91 European Americans. Principal component and admixture analyses provide support for significant Grain Coast ancestry among African American men in South Carolina. AA men from DC and the Caribbean showed a closer affinity to populations from the Bight of Biafra. Furthermore, 30–40% of the paternal lineages in African descent populations in the Americas are of European ancestry. Diverse west African ancestries and sex-biased gene flow from EAs has contributed greatly to the genetic heterogeneity of African populations throughout the Americas and has significant implications for gene mapping efforts in these populations. PMID:22295064

  11. Genome-Wide Analysis Identifies IL-18 and FUCA2 as Novel Genes Associated with Diastolic Function in African Americans with Sickle Cell Disease

    PubMed Central

    Sysol, Justin R.; Abbasi, Taimur; Patel, Amit R.; Lang, Roberto M.; Gupta, Akash; Garcia, Joe G. N.; Gordeuk, Victor R.; Machado, Roberto F.

    2016-01-01

    Background Diastolic dysfunction is common in sickle cell disease (SCD), and is associated with an increased risk of mortality. However, the molecular pathogenesis underlying this development is poorly understood. The aim of this study was to identify a gene expression profile that is associated with diastolic function in SCD, potentially elucidating molecular mechanisms behind diastolic dysfunction development. Methods Diastolic function was measured via echocardiography in 65 patients with SCD from two independent study populations. Gene expression microarray data was compared with diastolic function in both study cohorts. Candidate genes that associated in both analyses were tested for validation in a murine SCD model. Lastly, genotyping array data from the replication cohort was used to derive cis-expression quantitative trait loci (cis-eQTLs) and genetic associations within the candidate gene regions. Results Transcriptome data from both patient cohorts implicated 7 genes associated with diastolic function, and mouse SCD myocardial expression validated 3 of these genes. Genetic associations and eQTLs were detected in 2 of the 3 genes, FUCA2 and IL18. Conclusions FUCA2 and IL18 are associated with diastolic function in SCD patients, and may be involved in the pathogenesis of the disease. Genetic polymorphisms within the FUCA2 and IL18 gene regions are also associated with diastolic function in SCD, likely by affecting expression levels of the genes. PMID:27636371

  12. Dissecting the genetic diversity in African rice

    Technology Transfer Automated Retrieval System (TEKTRAN)

    African cultivated rice, Oryza glaberrima, and its progenitor, O. barthii are excellent sources of important genes for rice improvement because they exhibit tolerance to several abiotic and biotic stresses. Development of advance backcross (ABC) populations between an unadapted donor parent and ada...

  13. Bioreactor scale up and protein product quality characterization of piggyBac transposon derived CHO pools.

    PubMed

    Rajendra, Yashas; Balasubramanian, Sowmya; Peery, Robert B; Swartling, James R; McCracken, Neil A; Norris, Dawn L; Frye, Christopher C; Barnard, Gavin C

    2017-02-11

    Chinese hamster ovary (CHO) cells remain the most popular host for the production of biopharmaceutical drugs, particularly monoclonal antibodies (mAbs), bispecific antibodies, and Fc-fusion proteins. Creating and characterizing the stable CHO clonally-derived cell lines (CDCLs) needed to manufacture these therapeutic proteins is a lengthy and laborious process. Therefore, CHO pools have increasingly been used to rapidly produce protein to support and enable preclinical drug development. We recently described the generation of CHO pools yielding mAb titers as high as 7.6 g/L in a 16 day bioprocess using piggyBac transposon-mediated gene integration. In this study, we wanted to understand why the piggyBac pool titers were significantly higher (2-10 fold) than the control CHO pools. Higher titers were the result of a combination of increased average gene copy number, significantly higher messenger RNA levels and the homogeneity (i.e. less diverse population distribution) of the piggyBac pools, relative to the control pools. In order to validate the use of piggyBac pools to support preclinical drug development, we then performed an in-depth product quality analysis of purified protein. The product quality of protein obtained from the piggyBac pools was very similar to the product quality profile of protein obtained from the control pools. Finally, we demonstrated the scalability of these pools from shake flasks to 36L bioreactors. Overall, these results suggest that gram quantities of therapeutic protein can be rapidly obtained from piggyBac CHO pools without significantly changing product quality attributes. © 2017 American Institute of Chemical Engineers Biotechnol. Prog., 2017.

  14. Differential gene expression in the liver of the African lungfish, Protopterus annectens, after 6 months of aestivation in air or 1 day of arousal from 6 months of aestivation.

    PubMed

    Hiong, Kum C; Ip, Yuen K; Wong, Wai P; Chew, Shit F

    2015-01-01

    The African lungfish, Protopterus annectens, can undergo aestivation during drought. Aestivation has three phases: induction, maintenance and arousal. The objective of this study was to examine the differential gene expression in the liver of P. annectens after 6 months (the maintenance phase) of aestivation as compared with the freshwater control, or after 1 day of arousal from 6 months aestivation as compared with 6 months of aestivation using suppression subtractive hybridization. During the maintenance phase of aestivation, the mRNA expression of argininosuccinate synthetase 1 and carbamoyl phosphate synthetase III were up-regulated, indicating an increase in the ornithine-urea cycle capacity to detoxify ammonia to urea. There was also an increase in the expression of betaine homocysteine-S-transferase 1 which could reduce and prevent the accumulation of hepatic homocysteine. On the other hand, the down-regulation of superoxide dismutase 1 expression could signify a decrease in ROS production during the maintenance phase of aestivation. In addition, the maintenance phase was marked by decreases in expressions of genes related to blood coagulation, complement fixation and iron and copper metabolism, which could be strategies used to prevent thrombosis and to conserve energy. Unlike the maintenance phase of aestivation, there were increases in expressions of genes related to nitrogen, carbohydrate and lipid metabolism and fatty acid transport after 1 day of arousal from 6 months aestivation. There were also up-regulation in expressions of genes that were involved in the electron transport system and ATP synthesis, indicating a greater demand for metabolic energy during arousal. Overall, our results signify the importance of sustaining a low rate of waste production and conservation of energy store during the maintenance phase, and the dependence on internal energy store for repair and structural modification during the arousal phase, of aestivation in the liver

  15. Differential Gene Expression in the Liver of the African Lungfish, Protopterus annectens, after 6 Months of Aestivation in Air or 1 Day of Arousal from 6 Months of Aestivation

    PubMed Central

    Hiong, Kum C.; Ip, Yuen K.; Wong, Wai P.; Chew, Shit F.

    2015-01-01

    The African lungfish, Protopterus annectens, can undergo aestivation during drought. Aestivation has three phases: induction, maintenance and arousal. The objective of this study was to examine the differential gene expression in the liver of P. annectens after 6 months (the maintenance phase) of aestivation as compared with the freshwater control, or after 1 day of arousal from 6 months aestivation as compared with 6 months of aestivation using suppression subtractive hybridization. During the maintenance phase of aestivation, the mRNA expression of argininosuccinate synthetase 1 and carbamoyl phosphate synthetase III were up-regulated, indicating an increase in the ornithine-urea cycle capacity to detoxify ammonia to urea. There was also an increase in the expression of betaine homocysteine-S-transferase 1 which could reduce and prevent the accumulation of hepatic homocysteine. On the other hand, the down-regulation of superoxide dismutase 1 expression could signify a decrease in ROS production during the maintenance phase of aestivation. In addition, the maintenance phase was marked by decreases in expressions of genes related to blood coagulation, complement fixation and iron and copper metabolism, which could be strategies used to prevent thrombosis and to conserve energy. Unlike the maintenance phase of aestivation, there were increases in expressions of genes related to nitrogen, carbohydrate and lipid metabolism and fatty acid transport after 1 day of arousal from 6 months aestivation. There were also up-regulation in expressions of genes that were involved in the electron transport system and ATP synthesis, indicating a greater demand for metabolic energy during arousal. Overall, our results signify the importance of sustaining a low rate of waste production and conservation of energy store during the maintenance phase, and the dependence on internal energy store for repair and structural modification during the arousal phase, of aestivation in the liver

  16. The African superswell

    NASA Technical Reports Server (NTRS)

    Nyblade, Andrew A.; Robinson, Scott W.

    1994-01-01

    Maps of residual bathymetry in the ocean basins around the African continent reveal a broad bathymetric swell in the southeastern Atlantic Ocean with an amplitude of about 500 m. We propose that this region of anomalously shallow bathymetry, together with the contiguous eastern and southern African plateaus, form a superswell which we refer to as the African superswell. The origin of the African superswell is uncertain. However, rifting and volcanism in eastern Africa, as well as heat flow measurements in southern Africa and the southeastern Atlantic Ocean, suggest that the superswell may be attributed, at least in part, to heating of the lithosphere.

  17. Serum Total Bilirubin, not Cholelithiasis, is Influenced by UGT1A1 Polymorphism, Alpha Thalassemia and βs Haplotype: First Report on Comparison between Arab-Indian and African βs Genes

    PubMed Central

    Alkindi, Said Y.; Pathare, Anil; Al Zadjali, Shoaib; Panjwani, Vinodhkumar; Wasim, Fauzia; Khan, Hammad; Chopra, Pradeep; Krishnamoorthy, Rajagopal; Alkindi, Salam

    2015-01-01

    Background We explored the potential relationship between steady state serum bilirubin levels and the incidence of cholelithiasis in the context of UGT1A1 gene A(TA)nTAA promoter polymorphism in Omani sickle cell anemia (SCA) patients, homozygotes for African (Benin and Bantu) and Arab-Indian βS haplotypes, but sharing the same microgeographical environment and comparable life style factors. Methods 136 SCA patients were retrospectively studied in whom imaging data including abdominal CT scan, MRI or Ultrasonography were routinely available. Available data on the mean steady state hematological/biochemical parameters (n=136), βs haplotypes(n=136), α globin gene status (n=105) and UGT1A1 genotypes (n=133) were reviewed from the respective medical records. Results The mean serum total bilirubin level was significantly higher in the homozygous UGT1A1(AT)7 group as compared to UGT1A1(AT)6 group. Thus, not cholelithiasis but total serum bilirubin was influenced by UGT1A1 polymorphism in this SCA cohort. Conclusion As observed in other population groups, the UGT1A1 (AT)7 homozygosity was significantly associated with raised serum total bilirubin level, but the prevalence of gallstones in the Omani SCA patients was not associated with α thalassaemia, UGT1A1 polymorphism, or βs haplotypes. PMID:26543529

  18. 1. OBLIQUE VIEW OF THE POOL BUILDING 307 AND THE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. OBLIQUE VIEW OF THE POOL BUILDING 307 AND THE POOL 308, LOOKING WEST. - Mill Valley Air Force Station, Pool Building & Swimming Pool, East Ridgecrest Boulevard, Mount Tamalpais, Mill Valley, Marin County, CA

  19. Family Economic Hardship, Corticotropin-Releasing Hormone Receptor Polymorphisms, and Depressive Symptoms in Rural African American Youths

    PubMed Central

    Chen, Yi-fu; Brody, Gene H.

    2015-01-01

    Purpose To use pooled data from 2 independent studies of rural African American youths to test the moderation effect of the corticotropin-releasing hormone receptor 1 gene (CRHR1) on the link between family economic hardship and trajectories of depressive symptoms. Methods Two longitudinal studies were conducted involving African Americans, 16 (N = 474) and 18 (N = 419) years of age, who were randomly recruited in rural Georgia. Family economic hardship and youths’ depressive symptoms were assessed 4 times across 2 1/2 years. Genetic data also were collected. Haplotype analysis was performed on single nucleotide polymorphisms of CRHR1; 2 haplotypes were aggregated to form a CRHR1 index. Growth curve models were executed to determine whether CRHR1 moderated the link between Wave 1 family economic hardship and youths’ development of depression. Results CRHR1 × family economic hardship interactions significantly predicted youths’ depressive symptoms. When exposed to family economic hardship 1 standard deviation above the mean at Wave 1, youths who scored 0 on the CRHR1 index showed high and increasing depressive symptoms across time, whereas those who scored 2 on the index showed a decrease in depressive symptoms. Conclusions The CRHR1 gene reduces the risk for depressive symptoms among youths living in families undergoing high levels of economic hardship. PMID:26206446

  20. Solar powered swimming pool skimmer

    SciTech Connect

    Distinti, J.A.; Fonti, R.G.

    1992-04-21

    This patent describes a swimming pool skimmer assembly. It comprises: a U-shaped housing which includes two spaced-apart pontoons and a leg connecting the pontoons together, a paddle wheel assembly mounted on the housing and including, a motor having an output shaft, a gear reduction assembly connected to the motor output shaft and a paddle wheel means connected to the gear reduction assembly; a debris catcher mounted on the housing adjacent to the paddle wheel; power means on the housing and connected to the motor, including a solar cell array mounted on the housing connecting leg, and electrically connected to the motor, and a solar concentrator mounted on the housing adjacent to the solar cell; and an alarm circuit means connected to the debris catcher.

  1. Radioisotope Power System Pool Concept

    NASA Technical Reports Server (NTRS)

    Rusick, Jeffrey J.; Bolotin, Gary S.

    2015-01-01

    Advanced Radioisotope Power Systems (RPS) for NASA deep space science missions have historically used static thermoelectric-based designs because they are highly reliable, and their radioisotope heat sources can be passively cooled throughout the mission life cycle. Recently, a significant effort to develop a dynamic RPS, the Advanced Stirling Radioisotope Generator (ASRG), was conducted by NASA and the Department of Energy, because Stirling based designs offer energy conversion efficiencies four times higher than heritage thermoelectric designs; and the efficiency would proportionately reduce the amount of radioisotope fuel needed for the same power output. However, the long term reliability of a Stirling based design is a concern compared to thermoelectric designs, because for certain Stirling system architectures the radioisotope heat sources must be actively cooled via the dynamic operation of Stirling converters throughout the mission life cycle. To address this reliability concern, a new dynamic Stirling cycle RPS architecture is proposed called the RPS Pool Concept.

  2. Variants within the COMP and THBS2 genes are not associated with Achilles tendinopathy in a case-control study of South African and Australian populations.

    PubMed

    Saunders, Colleen J; Van Der Merwe, Lize; Cook, Jill; Handley, Christopher J; Collins, Malcolm; September, Alison V

    2014-01-01

    Cartilage oligomeric matrix protein is a structural protein of the extracellular matrix, while thrombospondin-2 is a matricellular protein involved in cell-matrix interactions. Recent studies have shown that genetic variation is a significant risk factor for Achilles tendinopathy, and the genes encoding cartilage oligomeric matrix protein (COMP) and thrombospondin-2 (THBS2) were identified as good candidate genes for association with Achilles tendinopathy. This study aimed to test the association of sequence variants within these candidate genes with the risk of Achilles tendinopathy in participants from South Africa (SA) and Australia (AUS). Three-hundred and forty (133 SA; 207 AUS) control participants with no history of Achilles tendinopathy and 178 (94 SA; 84 AUS) participants clinically diagnosed with Achilles tendinopathy were genotyped for five single nucleotide polymorphisms within the COMP and THBS2 genes in this case-control study. There was no difference in genotype distributions between control and tendinopathy groups for either the THBS2 variants rs9505888, rs6422747 and rs9283850, or the COMP variants rs730079 and rs28494505 in the SA and AUS populations. As the selection of COMP and THBS2 as candidate genes was hypothesis driven, based on biological function, the possibility that other variants within these genes are associated with Achilles tendinopathy cannot be excluded.

  3. Genetic variation in the immunosuppression pathway genes and breast cancer susceptibility: a pooled analysis of 42,510 cases and 40,577 controls from the Breast Cancer Association Consortium.

    PubMed

    Lei, Jieping; Rudolph, Anja; Moysich, Kirsten B; Behrens, Sabine; Goode, Ellen L; Bolla, Manjeet K; Dennis, Joe; Dunning, Alison M; Easton, Douglas F; Wang, Qin; Benitez, Javier; Hopper, John L; Southey, Melissa C; Schmidt, Marjanka K; Broeks, Annegien; Fasching, Peter A; Haeberle, Lothar; Peto, Julian; Dos-Santos-Silva, Isabel; Sawyer, Elinor J; Tomlinson, Ian; Burwinkel, Barbara; Marmé, Frederik; Guénel, Pascal; Truong, Thérèse; Bojesen, Stig E; Flyger, Henrik; Nielsen, Sune F; Nordestgaard, Børge G; González-Neira, Anna; Menéndez, Primitiva; Anton-Culver, Hoda; Neuhausen, Susan L; Brenner, Hermann; Arndt, Volker; Meindl, Alfons; Schmutzler, Rita K; Brauch, Hiltrud; Hamann, Ute; Nevanlinna, Heli; Fagerholm, Rainer; Dörk, Thilo; Bogdanova, Natalia V; Mannermaa, Arto; Hartikainen, Jaana M; Van Dijck, Laurien; Smeets, Ann; Flesch-Janys, Dieter; Eilber, Ursula; Radice, Paolo; Peterlongo, Paolo; Couch, Fergus J; Hallberg, Emily; Giles, Graham G; Milne, Roger L; Haiman, Christopher A; Schumacher, Fredrick; Simard, Jacques; Goldberg, Mark S; Kristensen, Vessela; Borresen-Dale, Anne-Lise; Zheng, Wei; Beeghly-Fadiel, Alicia; Winqvist, Robert; Grip, Mervi; Andrulis, Irene L; Glendon, Gord; García-Closas, Montserrat; Figueroa, Jonine; Czene, Kamila; Brand, Judith S; Darabi, Hatef; Eriksson, Mikael; Hall, Per; Li, Jingmei; Cox, Angela; Cross, Simon S; Pharoah, Paul D P; Shah, Mitul; Kabisch, Maria; Torres, Diana; Jakubowska, Anna; Lubinski, Jan; Ademuyiwa, Foluso; Ambrosone, Christine B; Swerdlow, Anthony; Jones, Michael; Chang-Claude, Jenny

    2016-01-01

    Immunosuppression plays a pivotal role in assisting tumors to evade immune destruction and promoting tumor development. We hypothesized that genetic variation in the immunosuppression pathway genes may be implicated in breast cancer tumorigenesis. We included 42,510 female breast cancer cases and 40,577 controls of European ancestry from 37 studies in the Breast Cancer Association Consortium (2015) with available genotype data for 3595 single nucleotide polymorphisms (SNPs) in 133 candidate genes. Associations between genotyped SNPs and overall breast cancer risk, and secondarily according to estrogen receptor (ER) status, were assessed using multiple logistic regression models. Gene-level associations were assessed based on principal component analysis. Gene expression analyses were conducted using RNA sequencing level 3 data from The Cancer Genome Atlas for 989 breast tumor samples and 113 matched normal tissue samples. SNP rs1905339 (A>G) in the STAT3 region was associated with an increased breast cancer risk (per allele odds ratio 1.05, 95 % confidence interval 1.03-1.08; p value = 1.4 × 10(-6)). The association did not differ significantly by ER status. On the gene level, in addition to TGFBR2 and CCND1, IL5 and GM-CSF showed the strongest associations with overall breast cancer risk (p value = 1.0 × 10(-3) and 7.0 × 10(-3), respectively). Furthermore, STAT3 and IL5 but not GM-CSF were differentially expressed between breast tumor tissue and normal tissue (p value = 2.5 × 10(-3), 4.5 × 10(-4) and 0.63, respectively). Our data provide evidence that the immunosuppression pathway genes STAT3, IL5, and GM-CSF may be novel susceptibility loci for breast cancer in women of European ancestry.

  4. OBS FOMAR POOL: Gibraltar and ALERTES-RIM experiments.

    NASA Astrophysics Data System (ADS)

    Pazos, Antonio; Martín Davila, Jose; Buforn, Elisa; Cabieces, Roberto; Santos, Jose; Sandoval, Nicolas; Roca, Antoni; Dahm, Torsten

    2016-04-01

    The Eurasian-African plate boundary crosses the called "Ibero-Maghrebian" region from the San Vicente Cape (SW Portugal) to Tunisia including the south Iberia, Alboran Sea, and northern of Morocco and Algeria. The low convergence rate at this plate boundary produces a continuous moderate seismic activity of low magnitude and shallow depth, where the occurrence of large earthquakes is separated by long time intervals, even with associated tsunamis, like the 1755 Lisbon earthquake. In this region, there are also intermediate and very deep earthquakes. Due to the fact that part of the seismic activity is located at marine areas, and also because of the poor geographic azimuthal coverage at some zones provided by the land stations (specially in the SW of the San Vicente Cape area), Royal Spanish Navy Observatory (ROA) acquired three "LOSTERN" broad band (CMG-40T sensors) OBS, manufactured by KUM (Kiel, Germany), and, more recently (2014), the Complutense University of Madrid (UCM) acquired another three with Trillium 120 sensors. All of them conform the OBS FOMAR pool. Since January to November 2014, the FOMAR pool has been deployed along the Gibraltar strait (Gibraltar experiment), in collaboration with SECEGSA (Spanish society to study the fix communication through the Gibraltar Strait), to study the local microseismicity in the Gibraltar strait area. Also, since September 2015, the FOMAR pool has been deployed for 8 months in SW of the San Vicente Cape with an hexagonal array configuration as a part of ALERTES-RIM project. In this work the some preliminary results of the Gibraltar strait and ALERTES-RIM OBS experiment are shown.

  5. A continuum of admixture in the Western Hemisphere revealed by the African Diaspora genome.

    PubMed

    Mathias, Rasika Ann; Taub, Margaret A; Gignoux, Christopher R; Fu, Wenqing; Musharoff, Shaila; O'Connor, Timothy D; Vergara, Candelaria; Torgerson, Dara G; Pino-Yanes, Maria; Shringarpure, Suyash S; Huang, Lili; Rafaels, Nicholas; Boorgula, Meher Preethi; Johnston, Henry Richard; Ortega, Victor E; Levin, Albert M; Song, Wei; Torres, Raul; Padhukasahasram, Badri; Eng, Celeste; Mejia-Mejia, Delmy-Aracely; Ferguson, Trevor; Qin, Zhaohui S; Scott, Alan F; Yazdanbakhsh, Maria; Wilson, James G; Marrugo, Javier; Lange, Leslie A; Kumar, Rajesh; Avila, Pedro C; Williams, L Keoki; Watson, Harold; Ware, Lorraine B; Olopade, Christopher; Olopade, Olufunmilayo; Oliveira, Ricardo; Ober, Carole; Nicolae, Dan L; Meyers, Deborah; Mayorga, Alvaro; Knight-Madden, Jennifer; Hartert, Tina; Hansel, Nadia N; Foreman, Marilyn G; Ford, Jean G; Faruque, Mezbah U; Dunston, Georgia M; Caraballo, Luis; Burchard, Esteban G; Bleecker, Eugene; Araujo, Maria Ilma; Herrera-Paz, Edwin Francisco; Gietzen, Kimberly; Grus, Wendy E; Bamshad, Michael; Bustamante, Carlos D; Kenny, Eimear E; Hernandez, Ryan D; Beaty, Terri H; Ruczinski, Ingo; Akey, Joshua; Barnes, Kathleen C

    2016-10-11

    The African Diaspora in the Western Hemisphere represents one of the largest forced migrations in history and had a profound impact on genetic diversity in modern populations. To date, the fine-scale population structure of descendants of the African Diaspora remains largely uncharacterized. Here we present genetic variation from deeply sequenced genomes of 642 individuals from North and South American, Caribbean and West African populations, substantially increasing the lexicon of human genomic variation and suggesting much variation remains to be discovered in African-admixed populations in the Americas. We summarize genetic variation in these populations, quantifying the postcolonial sex-biased European gene flow across multiple regions. Moreover, we refine estimates on the burden of deleterious variants carried across populations and how this varies with African ancestry. Our data are an important resource for empowering disease mapping studies in African-admixed individuals and will facilitate gene discovery for diseases disproportionately affecting individuals of African ancestry.

  6. A continuum of admixture in the Western Hemisphere revealed by the African Diaspora genome

    PubMed Central

    Mathias, Rasika Ann; Taub, Margaret A.; Gignoux, Christopher R.; Fu, Wenqing; Musharoff, Shaila; O'Connor, Timothy D.; Vergara, Candelaria; Torgerson, Dara G.; Pino-Yanes, Maria; Shringarpure, Suyash S.; Huang, Lili; Rafaels, Nicholas; Boorgula, Meher Preethi; Johnston, Henry Richard; Ortega, Victor E.; Levin, Albert M.; Song, Wei; Torres, Raul; Padhukasahasram, Badri; Eng, Celeste; Mejia-Mejia, Delmy-Aracely; Ferguson, Trevor; Qin, Zhaohui S.; Scott, Alan F.; Yazdanbakhsh, Maria; Wilson, James G.; Marrugo, Javier; Lange, Leslie A.; Kumar, Rajesh; Avila, Pedro C.; Williams, L. Keoki; Watson, Harold; Ware, Lorraine B.; Olopade, Christopher; Olopade, Olufunmilayo; Oliveira, Ricardo; Ober, Carole; Nicolae, Dan L.; Meyers, Deborah; Mayorga, Alvaro; Knight-Madden, Jennifer; Hartert, Tina; Hansel, Nadia N.; Foreman, Marilyn G.; Ford, Jean G.; Faruque, Mezbah U.; Dunston, Georgia M.; Caraballo, Luis; Burchard, Esteban G.; Bleecker, Eugene; Araujo, Maria Ilma; Herrera-Paz, Edwin Francisco; Gietzen, Kimberly; Grus, Wendy E.; Bamshad, Michael; Bustamante, Carlos D.; Kenny, Eimear E.; Hernandez, Ryan D.; Beaty, Terri H.; Ruczinski, Ingo; Akey, Joshua; Campbell, Monica; Chavan, Sameer; Foster, Cassandra; Gao, Li; Horowitz, Edward; Ortiz, Romina; Potee, Joseph; Gao, Jingjing; Hu, Yijuan; Hansen, Mark; Deshpande, Aniket; Locke, Devin P.; Grammer, Leslie; Kim, Kwang-YounA; Schleimer, Robert; De La Vega, Francisco M.; Szpiech, Zachary A.; Oluwole, Oluwafemi; Arinola, Ganiyu; Correa, Adolfo; Musani, Solomon; Chong, Jessica; Nickerson, Deborah; Reiner, Alexander; Maul, Pissamai; Maul, Trevor; Martinez, Beatriz; Meza, Catherine; Ayestas, Gerardo; Landaverde-Torres, Pamela; Erazo, Said Omar Leiva; Martinez, Rosella; Mayorga, Luis F.; Ramos, Hector; Saenz, Allan; Varela, Gloria; Vasquez, Olga Marina; Samms-Vaughan, Maureen; Wilks, Rainford J.; Adegnika, Akim; Ateba-Ngoa, Ulysse; Barnes, Kathleen C.

    2016-01-01

    The African Diaspora in the Western Hemisphere represents one of the largest forced migrations in history and had a profound impact on genetic diversity in modern populations. To date, the fine-scale population structure of descendants of the African Diaspora remains largely uncharacterized. Here we present genetic variation from deeply sequenced genomes of 642 individuals from North and South American, Caribbean and West African populations, substantially increasing the lexicon of human genomic variation and suggesting much variation remains to be discovered in African-admixed populations in the Americas. We summarize genetic variation in these populations, quantifying the postcolonial sex-biased European gene flow across multiple regions. Moreover, we refine estimates on the burden of deleterious variants carried across populations and how this varies with African ancestry. Our data are an important resource for empowering disease mapping studies in African-admixed individuals and will facilitate gene discovery for diseases disproportionately affecting individuals of African ancestry. PMID:27725671

  7. Understanding African American Males

    ERIC Educational Resources Information Center

    Bell, Edward Earl

    2010-01-01

    The purpose of this study was to assess the socialization skills, self-esteem, and academic readiness of African American males in a school environment. Discussions with students and the School Perceptions Questionnaire provided data for this investigation. The intended targets for this investigation were African American students; however, there…

  8. Africans Away from Home.

    ERIC Educational Resources Information Center

    Clarke, John Henrik

    Africans who were brought across the Atlantic as slaves never fully adjusted to slavery or accepted its inevitability. Resistance began on board the slave ships, where many jumped overboard or committed suicide. African slaves in South America led the first revolts against tyranny in the New World. The first slave revolt in the Caribbean occurred…

  9. Educating African American Males

    ERIC Educational Resources Information Center

    Bell, Edward E.

    2010-01-01

    Background: Schools across America spend money, invest in programs, and sponsor workshops, offer teacher incentives, raise accountability standards, and even evoke the name of Obama in efforts to raise the academic achievement of African American males. Incarceration and college retention rates point to a dismal plight for many African American…

  10. 16 Extraordinary African Americans.

    ERIC Educational Resources Information Center

    Lobb, Nancy

    This collection for children tells the stories of 16 African Americans who helped make America what it is today. African Americans can take pride in the heritage of these contributors to society. Biographies are given for the following: (1) Sojourner Truth, preacher and abolitionist; (2) Frederick Douglass, abolitionist; (3) Harriet Tubman, leader…

  11. Keeping African Masks Real

    ERIC Educational Resources Information Center

    Waddington, Susan

    2012-01-01

    Art is a good place to learn about our multicultural planet, and African masks are prized throughout the world as powerfully expressive artistic images. Unfortunately, multicultural education, especially for young children, can perpetuate stereotypes. Masks taken out of context lose their meaning and the term "African masks" suggests that there is…

  12. Hydrogenotrophic microbiota distinguish native Africans from African and European Americans.

    PubMed

    Nava, Gerardo M; Carbonero, Franck; Ou, Junhai; Benefiel, Ann C; O'Keefe, Stephen J; Gaskins, H Rex

    2012-06-01

    Reduced susceptibility to sporadic colorectal cancer in native Africans (NA) is correlated with low consumption of animal products and greater microbial production of colonic methane. In this context, two hydrogenotrophic microbial groups are of interest, methanogenic Archaea (MA) utilizing H2 to produce methane and sulfate-reducing bacteria (SRB) generating hydrogen sulfide, which has been linked with chronic inflammatory disorders of the colon. In the present study, stool samples from NA, consuming a diet high in resistant starch and low in animal products, and from African Americans (AA) and European Americans (EA), both consuming a typical Western diet, were examined for genetic diversity and structure of Archaea, MA and SRB communities. In general, a greater proportion of NA than AA and EA harboured the full range of targeted hydrogenotrophic groups. Terminal restriction fragment length polymorphism analysis of 16S rRNA genes and specific functional genes, combined with multivariate statistical analyses, revealed that NA harboured more diverse and different Archaea and MA populations than AA and EA. Also, NA harboured significantly distinct SRB populations compared with AA and EA. Taken together, these data are consistent with diet selecting for distinct hydrogenotrophic microbiota.

  13. A sulphur deficiency-induced gene, sdi1, involved in the utilization of stored sulphate pools under sulphur-limiting conditions has potential as a diagnostic indicator of sulphur nutritional status.

    PubMed

    Howarth, Jonathan R; Parmar, Saroj; Barraclough, Peter B; Hawkesford, Malcolm J

    2009-02-01

    A sulphate deficiency-induced gene, sdi1, has been identified by cDNA-amplified fragment length polymorphism (AFLP) analysis utilizing field-grown, nutrient-deficient wheat (Triticum aestivum var. Hereward). The expression of sdi1 was specifically induced in leaf and root tissues in response to sulphate deficiency, but was not induced by nitrogen, phosphorus, potassium or magnesium deficiency. Expression was also shown to increase in plant tissues as the external sulphate concentration in hydroponically grown plants was reduced from 1.0 to 0.0 mm. On this basis, sdi1 gene expression has potential as a sensitive indicator of sulphur nutritional status in wheat. Genome-walking techniques were used to clone the 2.7-kb region upstream of sdi1 from genomic DNA, revealing several cis-element motifs previously identified as being associated with sulphur responses in plants. The Arabidopsis thaliana gene most highly homologous to sdi1 is At5g48850, which was also demonstrated to be induced by sulphur deficiency, an observation confirmed by the analysis of microarray data available in the public domain. The expression of Atsdi1 was induced more rapidly than previously characterized sulphur-responsive genes in the period immediately following the transfer of plants to sulphur-deficient medium. Atsdi1 T-DNA 'knockout' mutants were shown to maintain higher tissue sulphate concentrations than wild-type plants under sulphur-limiting conditions, indicating a role in the utilization of stored sulphate under sulphur-deficient conditions. The structural features of the sdi1 gene and its application in the genetic determination of the sulphur nutritional status of wheat crops are discussed.

  14. Microbiological analysis in three diverse natural geothermal bathing pools in Iceland.

    PubMed

    Thorolfsdottir, Berglind Osk Th; Marteinsson, Viggo Thor

    2013-03-14

    Natural thermal bathing pools contain geothermal water that is very popular to bathe in but the water is not sterilized, irradiated or treated in any way. Increasing tourism in Iceland will lead to increasing numbers of bath guests, which can in turn affect the microbial flora in the pools and therefore user safety. Today, there is no legislation that applies to natural geothermal pools in Iceland, as the water is not used for consumption and the pools are not defined as public swimming pools. In this study, we conducted a microbiological analysis on three popular but different natural pools in Iceland, located at Lýsuhóll, Hveravellir and Landmannalaugar. Total bacterial counts were performed by flow cytometry, and with plate count at 22 °C, 37 °C and 50 °C. The presence of viable coliforms, Enterococcus spp. and pseudomonads were investigated by growth experiments on selective media. All samples were screened for noroviruses by real time PCR. The results indicate higher fecal contamination in the geothermal pools where the geothermal water flow was low and bathing guest count was high during the day. The number of cultivated Pseudomonas spp. was high (13,000-40,000 cfu/100 mL) in the natural pools, and several strains were isolated and classified as opportunistic pathogens. Norovirus was not detected in the three pools. DNA was extracted from one-liter samples in each pool and analyzed by partial 16S rRNA gene sequencing. Microbial diversity analysis revealed different microbial communities between the pools and they were primarily composed of alpha-, beta- and gammaproteobacteria.

  15. Microbiological Analysis in Three Diverse Natural Geothermal Bathing Pools in Iceland

    PubMed Central

    Thorolfsdottir, Berglind Osk Th.; Marteinsson, Viggo Thor

    2013-01-01

    Natural thermal bathing pools contain geothermal water that is very popular to bathe in but the water is not sterilized, irradiated or treated in any way. Increasing tourism in Iceland will lead to increasing numbers of bath guests, which can in turn affect the microbial flora in the pools and therefore user safety. Today, there is no legislation that applies to natural geothermal pools in Iceland, as the water is not used for consumption and the pools are not defined as public swimming pools. In this study, we conducted a microbiological analysis on three popular but different natural pools in Iceland, located at Lýsuhóll, Hveravellir and Landmannalaugar. Total bacterial counts were performed by flow cytometry, and with plate count at 22 °C, 37 °C and 50 °C. The presence of viable coliforms, Enterococcus spp. and pseudomonads were investigated by growth experiments on selective media. All samples were screened for noroviruses by real time PCR. The results indicate higher fecal contamination in the geothermal pools where the geothermal water flow was low and bathing guest count was high during the day. The number of cultivated Pseudomonas spp. was high (13,000–40,000 cfu/100 mL) in the natural pools, and several strains were isolated and classified as opportunistic pathogens. Norovirus was not detected in the three pools. DNA was extracted from one-liter samples in each pool and analyzed by partial 16S rRNA gene sequencing. Microbial diversity analysis revealed different microbial communities between the pools and they were primarily composed of alpha-, beta- and gammaproteobacteria. PMID:23493033

  16. Association between childhood maltreatment and adult emotional dysregulation in a low-income, urban, African American sample: moderation by oxytocin receptor gene.

    PubMed

    Bradley, Bekh; Westen, Drew; Mercer, Kristina B; Binder, Elisabeth B; Jovanovic, Tanja; Crain, Daniel; Wingo, Aliza; Heim, Christine

    2011-05-01

    The ability to effectively regulate emotions and a secure attachment style are critical for maintaining mental health across the life span. The experience of childhood maltreatment interferes with normal development of emotional regulation and dramatically increases risk for a wide range of psychiatric disorders in adulthood. The central nervous system oxytocin systems are critically involved in mediating social attachment and buffering psychophysiological responses to stress. We therefore investigated the impact of childhood maltreatment and an oxytocin receptor (OXTR) single nucleotide polymorphism (rs53576) and their interaction on emotional dysregulation and attachment style in adulthood in a sample of low-income, African American men and women recruited from primary care clinics of an urban, public hospital. Consistent with prior research, we found that the severity of childhood maltreatment was associated with increased levels of emotional dysregulation in adulthood. Childhood maltreatment was also positively associated with ratings of disorganized/unresolved adult attachment style and negatively associated with ratings of secure adult attachment style. There was no direct association between rs53576 and emotional dysregulation or ratings of adult attachment style. However, there were significant interactions between rs53576 and childhood maltreatment in predicting level of adult emotional dysregulation and attachment style. Specifically, G/G genotype carriers were at risk for increased emotional dysregulation when exposed to three or more categories of childhood abuse. In addition, G/G genotype carriers exhibited enhanced disorganized adult attachment style when exposed to severe childhood abuse compared to A/A and A/G carriers. Our findings suggest that A allele carriers of OXTR rs53576 are resilient against the effects of severe childhood adversity, by protection against emotional dysregulation and disorganized attachment.

  17. Multigene expression in stable CHO cell pools generated with the piggyBac transposon system.

    PubMed

    Balasubramanian, Sowmya; Wurm, Florian M; Hacker, David L

    2016-09-01

    Heterogenous populations of recombinant cells (cell pools) stably expressing 1-4 transgenes were generated from Chinese hamster overy (CHO) cells with the piggyBac (PB) transposon system. The cell pools produced different combinations of three model proteins-enhanced green fluorescent protein (EGFP), secreted alkaline phosphatase (SEAP), and a monoclonal IgG1 antibody. Each transgene was present on a separate PB donor plasmid with either the same or a different selection gene. In both cases, we obtained PB-derived cell pools with higher recombinant protein yields than from cell pools generated by conventional gene delivery. In PB-derived cell pools generated using a single selection agent, both protein production and the number of integrated copies of each transgene declined as the number of transfected transgenes increased. However, the total number of integrated transgenes was similar regardless of the number of different transgenes transfected. For PB-derived cell pools generated by selection of each transgene with a different selection agent, the total number of integrated transgenes increased with the number of transfected transgenes. The results suggest that the generation of cell pools producing multiple recombinant proteins is feasible and that the method is more efficient when each individual transgene is selected with a different marker. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:1308-1317, 2016.

  18. LinguisticBelief and PoolEvidence

    SciTech Connect

    DARBY, JOHN

    2008-03-11

    LinguisticBelief allows the creation and analysis of combinations of linguistic variables with epistemic uncertainty for decision making. The model is solved using approximate reasoning to implement the belief/plausibility measure of uncertainty for combinations of variables expressed as purely linguistic fuzzy sets. PoolEvidence pools evidence for linguistic variables from many experts for input into LinguisticBelief.

  19. 47 CFR 97.523 - Question pools.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 47 Telecommunication 5 2012-10-01 2012-10-01 false Question pools. 97.523 Section 97.523 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES AMATEUR RADIO SERVICE Qualifying Examination Systems § 97.523 Question pools. All VECs must cooperate in maintaining...

  20. 47 CFR 97.523 - Question pools.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 47 Telecommunication 5 2014-10-01 2014-10-01 false Question pools. 97.523 Section 97.523 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES AMATEUR RADIO SERVICE Qualifying Examination Systems § 97.523 Question pools. All VECs must cooperate in maintaining...

  1. 47 CFR 97.523 - Question pools.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Question pools. 97.523 Section 97.523 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES AMATEUR RADIO SERVICE Qualifying Examination Systems § 97.523 Question pools. All VECs must cooperate in maintaining...

  2. 47 CFR 97.523 - Question pools.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 47 Telecommunication 5 2011-10-01 2011-10-01 false Question pools. 97.523 Section 97.523 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES AMATEUR RADIO SERVICE Qualifying Examination Systems § 97.523 Question pools. All VECs must cooperate in maintaining...

  3. 47 CFR 97.523 - Question pools.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 47 Telecommunication 5 2013-10-01 2013-10-01 false Question pools. 97.523 Section 97.523 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES AMATEUR RADIO SERVICE Qualifying Examination Systems § 97.523 Question pools. All VECs must cooperate in maintaining...

  4. 10 CFR 36.33 - Irradiator pools.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... purification system designed to be capable of maintaining the water during normal operation at a conductivity..., irradiator pools must either: (1) Have a water-tight stainless steel liner or a liner metallurgically... water level that could allow water to drain out of the pool. Pipes that have intakes more than 0.5...

  5. 10 CFR 36.33 - Irradiator pools.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... purification system designed to be capable of maintaining the water during normal operation at a conductivity..., irradiator pools must either: (1) Have a water-tight stainless steel liner or a liner metallurgically... water level that could allow water to drain out of the pool. Pipes that have intakes more than 0.5...

  6. 10 CFR 36.33 - Irradiator pools.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... purification system designed to be capable of maintaining the water during normal operation at a conductivity..., irradiator pools must either: (1) Have a water-tight stainless steel liner or a liner metallurgically... water level that could allow water to drain out of the pool. Pipes that have intakes more than 0.5...

  7. 10 CFR 36.33 - Irradiator pools.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... purification system designed to be capable of maintaining the water during normal operation at a conductivity..., irradiator pools must either: (1) Have a water-tight stainless steel liner or a liner metallurgically... water level that could allow water to drain out of the pool. Pipes that have intakes more than 0.5...

  8. 10 CFR 36.33 - Irradiator pools.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... purification system designed to be capable of maintaining the water during normal operation at a conductivity..., irradiator pools must either: (1) Have a water-tight stainless steel liner or a liner metallurgically... water level that could allow water to drain out of the pool. Pipes that have intakes more than 0.5...

  9. Camera Would Monitor Weld-Pool Contours

    NASA Technical Reports Server (NTRS)

    Gordon, Stephen S.; Gutow, David A.

    1990-01-01

    Weld pool illuminated and viewed coaxially along welding torch. Proposed monitoring subsystem for arc welder provides image in which horizontal portions of surface of weld pool highlighted. Monitoring and analyzing subsystems integrated into overall control system of robotic welder. Control system sets welding parameters to adapt to changing conditions, maintaining surface contour giving desired pattern of reflections.

  10. The Chemistry of Swimming Pool Maintenance

    ERIC Educational Resources Information Center

    Salter, Carl; Langhus, David L.

    2007-01-01

    The study of chemistry involved in the maintenance of a swimming pool provides a lot of chemical education to the students, including the demonstration of the importance of pH in water chemistry. The various chemical aspects hidden in the maintenance of the pool are being described.

  11. A Training Program for Swimming Pool Operators.

    ERIC Educational Resources Information Center

    Pope, James R., Jr.; Mihalik, Brian J.

    1985-01-01

    In the United States today, there is a dramatic shortage of qualified public swimming pool operators. This article describes a training program initiated in South Carolina to serve the needs of everyone responsible for and involved in the safe operation and management of a public swimming pool. (MT)

  12. Comparative Genomics of Four Isosphaeraceae Planctomycetes: A Common Pool of Plasmids and Glycoside Hydrolase Genes Shared by Paludisphaera borealis PX4T, Isosphaera pallida IS1BT, Singulisphaera acidiphila DSM 18658T, and Strain SH-PL62

    PubMed Central

    Ivanova, Anastasia A.; Naumoff, Daniil G.; Miroshnikov, Kirill K.; Liesack, Werner; Dedysh, Svetlana N.

    2017-01-01

    The family Isosphaeraceae accommodates stalk-free planctomycetes with spherical cells, which can be assembled in short chains, long filaments, or aggregates. These bacteria inhabit a wide variety of terrestrial environments, among those the recently described Paludisphaera borealis PX4T that was isolated from acidic boreal wetlands. Here, we analyzed its finished genome in comparison to those of three other members of the Isosphaeraceae: Isosphaera pallida IS1BT, Singulisphaera acidiphila DSM 18658T, and the uncharacterized planctomycete strain SH-PL62. The complete genome of P. borealis PX4T consists of a 7.5 Mb chromosome and two plasmids, 112 and 43 kb in size. Annotation of the genome sequence revealed 5802 potential protein-coding genes of which 2775 could be functionally assigned. The genes encoding metabolic pathways common for chemo-organotrophic bacteria, such as glycolysis, citrate cycle, pentose-phosphate pathway, and oxidative phosphorylation were identified. Several genes involved in the synthesis of peptidoglycan as well as N-methylated ornithine lipids were present in the genome of P. borealis PX4T. A total of 26 giant genes with a size >5 kb were detected. The genome encodes a wide repertoire of carbohydrate-active enzymes (CAZymes) including 44 glycoside hydrolases (GH) and 83 glycosyltransferases (GT) affiliated with 21 and 13 CAZy families, respectively. The most-represented families are GH5, GH13, GH57, GT2, GT4, and GT83. The experimentally determined carbohydrate utilization pattern agrees well with the genome-predicted capabilities. The CAZyme repertoire in P. borealis PX4T is highly similar to that in the uncharacterized planctomycete SH-PL62 and S. acidiphila DSM 18658T, but different to that in the thermophile I. pallida IS1BT. The latter strain has a strongly reduced CAZyme content. In P. borealis PX4T, many of its CAZyme genes are organized in clusters. Contrary to most other members of the order Planctomycetales, all four analyzed

  13. Greenhouse Gas Fluxes from Peatland Pools

    NASA Astrophysics Data System (ADS)

    Turner, E.; Baird, A. J.; Billett, M. F.; Chapman, P. J.; Dinsmore, K. J.; Holden, J.

    2015-12-01

    Peatlands contain around one third of the global soil carbon (C) stock. Understanding the processes in peatland C cycling, and in particular those involved in the release of the greenhouse gases (GHGs) CO2 and CH4 to the atmosphere, is a current research priority. Natural open-water pools are a common feature of many peatlands, and previous research suggests pools can be strong sources of atmospheric GHGs, particularly CH4, and thus have the potential to play an important role in global radiative forcing. The area of open-water in peatlands is rapidly expanding in a warming Arctic (e.g. Walter et al., 2007) while artificially created pools are becoming more commonplace in the recent drive to restore the hydrological functioning of drained peatlands by blocking ditches. We present the results of >2 years of comprehensive field monitoring from pool complexes in the Flow Country of northern Scotland, the largest expanse (c.4000 km2) of blanket bog in Europe. Concentrations and fluxes of CO2 and CH4 are presented from 12 intensively monitored pools and the adjacent terrestrial surface. We examined both natural (n = 6) and artificial (n = 6) pools, which allowed us to quantify how pools created during restoration compare to undisturbed sites. C and hydrology budgets were determined for the study pools and the adjacent terrestrial surface. Dissolved concentrations of GHGs ranged from 0.08-4.68 mg CO2-C L-1 and 0.01-731 µg CH4-C L-1 in natural pools, and 0.29-10.38 mg CO2-C L-1 and 0.04-239 µg CH4-C L-1 in artificial pools. GHG fluxes from natural pool surfaces ranged between -2.47-653 mg CH4 m-2 d-1 and -31.7-14.8 g CO2 m-2 d-1. Artificial pool GHG fluxes were -8.19-581 mg CH4 m-2 d-1 and -7.66-34.9 g CO2 m-2 d-1. We provide more accurate GHG budgets for peatlands with natural pool complexes by considering their relative importance at the landscape-scale, and outline the potential effect on GHG fluxes when creating artificial pools during peatland restoration

  14. Comprehensive analysis of correlation coefficients estimated from pooling heterogeneous microarray data

    PubMed Central

    2013-01-01

    Background The synthesis of information across microarray studies has been performed by combining statistical results of individual studies (as in a mosaic), or by combining data from multiple studies into a large pool to be analyzed as a single data set (as in a melting pot of data). Specific issues relating to data heterogeneity across microarray studies, such as differences within and between labs or differences among experimental conditions, could lead to equivocal results in a melting pot approach. Results We applied statistical theory to determine the specific effect of different means and heteroskedasticity across 19 groups of microarray data on the sign and magnitude of gene-to-gene Pearson correlation coefficients obtained from the pool of 19 groups. We quantified the biases of the pooled coefficients and compared them to the biases of correlations estimated by an effect-size model. Mean differences across the 19 groups were the main factor determining the magnitude and sign of the pooled coefficients, which showed largest values of bias as they approached ±1. Only heteroskedasticity across the pool of 19 groups resulted in less efficient estimations of correlations than did a classical meta-analysis approach of combining correlation coefficients. These results were corroborated by simulation studies involving either mean differences or heteroskedasticity across a pool of N > 2 groups. Conclusions The combination of statistical results is best suited for synthesizing the correlation between expression profiles of a gene pair across several microarray studies. PMID:23822712

  15. (AAT)n repeat in the cannabinoid receptor gene (CNR1): association with cocaine addiction in an African-Caribbean population.

    PubMed

    Ballon, N; Leroy, S; Roy, C; Bourdel, M C; Charles-Nicolas, A; Krebs, M O; Poirier, M F

    2006-01-01

    Owing to their agonist action on dopaminergic systems, cannabinoids may play a major role in substance dependency and schizophrenia. We examined the (AAT)n triplet repeat polymorphism nearby the CNR1 gene, which encodes human cannabinoid (CB1) receptor, in a male Afro-Caribbean population. The allelic and genotypic distributions were significantly different in non-schizophrenic cocaine dependents (n = 97), schizophrenic cocaine dependents (n = 45) and matched controls (n = 88) (P < 10(-4)). The frequency of the (AAT)12 repeat allele was increased in non-schizophrenic cocaine dependents and schizophrenic cocaine dependents vs controls (25.3 and 26.7 vs 5.7%) (P < 10(-4)). Our results support that the (AAT)n polymorphism nearby the CNR1 gene could be associated with predisposition to cocaine dependency.

  16. African swine fever virus Georgia isolate harboring deletions of MGF360 and MGF505 genes is attenuated in swine and confers protection against challenge with the virulent parental virus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    African swine fever virus (ASFV) is the etiological agent of a contagious and often lethal disease of domestic pigs that has significant economic consequences for the swine industry. The control of African Swine Fever (ASF) has been hampered by the unavailability of vaccines. Experimental vaccines h...

  17. Deletion of African swine fever virus Georgia 2007 virulence-associated gene 9GL (B119L) leads to virus attenuation in swine at low doses while inducing an effective protection against homologous challenge

    Technology Transfer Automated Retrieval System (TEKTRAN)

    African swine fever virus (ASFV) is the etiological agent of a contagious and often lethal viral disease of domestic pigs that has significant economic consequences for swine breeding. The control of African Swine Fever (ASF) has been hampered by the unavailability of vaccines. Experimental vaccines...

  18. Increased gene expression of a facilitated diffusion urea transporter in the skin of the African lungfish (Protopterus annectens) during massively elevated post-terrestrialization urea excretion.

    PubMed

    Hung, Carrie Y C; Galvez, Fernando; Ip, Yuen K; Wood, Chris M

    2009-04-01

    The full-length cDNA sequence of a putative urea transporter (lfUT) of the facilitated diffusion UT-A type has been cloned from the African lungfish Protopterus annectens. The lfUT cDNA is 1990 bp in length and its open reading frame encodes a 409 amino acid long protein, with a calculated molecular mass of 44,723 Da. The sequence is closest to those of amphibians ( approximately 65% amino acid homology), followed by mammals and elasmobranchs ( approximately 60%), and then teleosts ( approximately 50%). lfUT was clearly expressed in gill, kidney, liver, skeletal muscle and skin. Upon re-immersion in water after 33 days of air exposure ('terrestrialization'), lungfish exhibited a massive rise in urea-N excretion which peaked at 12-30 h with rates of 2000-5000 micromol-N kg(-1) h(-1) (versus normal aquatic rates of <130 micromol-N kg(-1) h(-1)) and persisted until 70 h. This appears to occur mainly through the skin. Total 'excess' urea-N excretion amounted to approximately 81,000-91,000 micromol-N kg(-1) over 3 days. By real-time PCR, there was no difference in lfUT expression in the ventral abdominal skin between aquatic ammoniotelic controls and terrestrialized lungfish immediately after return to water (0 h), and no elevation of urea-N excretion at this time. However, skin biopsies revealed a significant 2.55-fold elevation of lfUT expression at 14 h, coincident with peak urea-N excretion. At 48 h, there was no longer any significant difference in lfUT mRNA levels from those at 0 and 14 h, or from aquatic fed controls. In accordance with earlier studies, which identified elevated urea-N excretion via the skin of P. dolloi with pharmacology typical of UT-A carriers, these results argue that transcriptional activation of a facilitated diffusion type urea transporter (lfUT) occurs in the skin during re-immersion. This serves to clear the body burden of urea-N accumulated during terrestrialization.

  19. Polymorphisms in the carcinogen detoxification genes CYB5A and CYB5R3 and breast cancer risk in African American women

    PubMed Central

    Blanke, Kristina L.; Sacco, James C.; Millikan, Robert C.; Olshan, Andrew F.; Luo, Jingchun; Trepanier, Lauren A.

    2014-01-01

    Purpose Cytochrome b5 (encoded by CYB5A) and NADH cytochrome b5 reductase (encoded by CYB5R3) detoxify aromatic and heterocyclic amine mammary carcinogens found in cigarette smoke. We hypothesized that CYB5A and CYB5R3 polymorphisms would be associated with breast cancer risk in women. Methods We characterized the prevalence of 18 CYB5A and CYB5R3 variants in genomic DNA from African American (AfrAm) and Caucasian (Cauc) women from the Carolina Breast Cancer Study population (1946 cases and 1747 controls), and determined their associations with breast cancer risk, with effect modification by smoking. Results A CYB5R3 variant, I1M+6T (rs8190370) was significantly more common in breast cancer cases (MAF 0.0238) compared to controls (0.0169, P =0.039); this was attributable to a higher MAF in AfrAm cases (0.0611) compared to AfrAm controls (0.0441, P=0.046; adjusted OR 1.41, CI 0.98-2.04; P=0.062). When smoking was considered, I1M+6T was more strongly associated with breast cancer risk in AfrAm smokers (adjusted OR 2.10, 1.08-4.07; P=0.028) compared to never-smokers (OR=1.21; 0.77-1.88; P for interaction=0.176). I1M+6T and three additional CYB5R3 variants, -251T, I8-1676C, and *392C, as well as two CYB5A variants, 13G and I2-992T, were significantly more common in AfrAms compared to Caucs. Conclusions CYB5R3 I1M+6 C>T should be considered in future molecular epidemiologic studies of breast cancer risk in AfrAms. Further, variants in CYB5A and CYB5R3 should be considered in the evaluation of other tumors in AfrAms that are associated with aromatic and heterocyclic amine exposures, to include prostate, bladder, and colon cancers. PMID:25225034

  20. African swine fever virus Georgia isolate harboring deletions of 9GL and MGF360/505 genes is highly attenuated in swine but does not confer protection against parental virus challenge.

    PubMed

    O'Donnell, Vivian; Holinka, Lauren G; Sanford, Brenton; Krug, Peter W; Carlson, Jolene; Pacheco, Juan M; Reese, Bo; Risatti, Guillermo R; Gladue, Douglas P; Borca, Manuel V

    2016-08-02

    African swine fever virus (ASFV) produces a contagious disease of domestic pigs that results in severe economic consequences to the swine industry. Control of the disease has been hampered by the unavailability of vaccines. We recently reported the development of two experimental vaccine strains (ASFV-G-Δ9GL and ASFV-G-ΔMGF) based on the attenuation of the highly virulent and epidemiologically relevant Georgia2007 isolate. Deletion of the 9GL gene or six genes of the MGF360/505 group produced two attenuated ASFV strains which were able to confer protection to animals when challenged with the virulent parental virus. Both viruses, although efficient in inducing protection, present concerns regarding their safety. In an attempt to solve this problem we developed a novel virus strain, ASFV-G-Δ9GL/ΔMGF, based on the deletion of all genes deleted in ASFV-G-Δ9GL and ASFV-G-ΔMGF. ASFV-G-Δ9GL/ΔMGF is the first derivative of a highly virulent ASFV field strain subjected to a double round of recombination events seeking to sequentially delete specific genes. ASFV-G-Δ9GL/ΔMGF showed a decreased ability to replicate in primary swine macrophage cultures relative to that of ASFV-G and ASFV-G-ΔMGF but similar to that of ASFV-G-Δ9GL. ASFV-G-Δ9GL/ΔMGF was attenuated when intramuscularly inoculated into swine, even at doses as high as 10(6) HAD50. Animals infected with doses ranging from 10(2) to 10(6) HAD50 did not present detectable levels of virus in blood at any time post-infection and they did not develop detectable levels of anti-ASFV antibodies. Importantly, ASFV-G-Δ9GL/ΔMGF does not induce protection against challenge with the virulent parental ASFV-G isolate. Results presented here suggest caution towards approaches involving genomic manipulations when developing rationally designed ASFV vaccine strains.

  1. Apparatus for draining lower drywell pool water into suppresion pool in boiling water reactor

    DOEpatents

    Gluntz, Douglas M.

    1996-01-01

    An apparatus which mitigates temperature stratification in the suppression pool water caused by hot water drained into the suppression pool from the lower drywell pool. The outlet of a spillover hole formed in the inner bounding wall of the suppression pool is connected to and in flow communication with one end of piping. The inlet end of the piping is above the water level in the suppression pool. The piping is routed down the vertical downcomer duct and through a hole formed in the thin wall separating the downcomer duct from the suppression pool water. The piping discharge end preferably has an elevation at or near the bottom of the suppression pool and has a location in the horizontal plane which is removed from the point where the piping first emerges on the suppression pool side of the inner bounding wall of the suppression pool. This enables water at the surface of the lower drywell pool to flow into and be discharged at the bottom of the suppression pool.

  2. African American Suicide

    MedlinePlus

    ... accounted for 83.8% of Caucasian elderly suicides. • Firearms were the predominant method of suicide among African ... per 100,000 annually. Source: Centers for Disease Control and Prevention. National Vital Statistics System. Mortality Data. ...

  3. Obesity and African Americans

    MedlinePlus

    ... and Management System Report to Congress Knowledge Center Capacity Building Information Services Events Calendar Resource Guide Justice ... Workforce Diversity Grants Youth Program Grants Other Grants Planning and Evaluation Grantee Best Practices Black/African American ...

  4. Evidence from mitochondrial DNA that African honey bees spread as continuous maternal lineages.

    PubMed

    Hall, H G; Muralidharan, K

    1989-05-18

    African honey bees have populated much of South and Central America and will soon enter the United States. The mechanism by which they have spread is controversial. Africanization may be largely the result of paternal gene flow into extant European populations or, alternatively, of maternal migration of feral swarms that have maintained an African genetic integrity. We have been using both mitochondrial and nuclear DNA restriction fragment length polymorphisms to follow the population dynamics between European and African bees. In earlier reports, we suggested that if African honey bees had distinctive mitochondrial (mt) DNA, then it could potentially distinguish the relative contributions of swarming and mating to the Africanization process. Because mtDNA is maternally inherited, it would not be transmitted by mating drones and only transported by queens accompanying swarms. Furthermore, the presence of African mtDNA would reflect unbroken maternal lineages from the original bees introduced from Africa. The value of mtDNA for population studies in general has been reviewed recently. Here we report that 19 feral swarms, randomly caught in Mexico, all carried African mtDNA. Thus, the migrating force of the African honey bee in the American tropics consists of continuous African maternal lineages spreading as swarms. The mating of African drones to European queens seems to contribute little to African bee migration.

  5. Pool-riffle Maintenance in Mountain Streams

    NASA Astrophysics Data System (ADS)

    Chartrand, S. M.

    2015-12-01

    Pool-riffles are maintained through a combination of at least several mechanisms that operate and interact over a range of temporal and spatial scales. Velocity or shear reversal is subsumed within several of these mechanisms, however a growing body of work suggests that (1) flow convergence into pools, (2) structuring of riffle crest sediments, and (3) local feedbacks between flood stage bedform evolution and hydrodynamics may be disproportionately important. We additionally propose that temporal and spatial patterns of sediment sorting across pool-riffles may also provide some level of bedform maintenance. A comprehensive understanding of these maintenance mechanisms is needed. We will report results of several flume experiments for autogenic pool-riffles. The experiments examined pool-riffle maintenance processes under variable flood and sediment supply conditions. A focus of our work is to characterize spatial and temporal patterns of pool-riffle sediment sorting, and to examine this in relation to temporal patterns of bedform evolution. The experiments represent a 5:1 scale-model of a prototype reach of a pool-riffle stream located within the University of British Columbia Malcolm Knapp Research Forest, Maple Ridge, BC.

  6. An improved test for Africanized honeybee mitochondrial DNA.

    PubMed

    Crozier, Y C; Koulianos, S; Crozier, R H

    1991-09-15

    Mitochondrial DNA derived from Apis mellifera scutellata, the ancestor of the Africanized bees of the New World, lacks a BglII restriction site found in other types of honeybee. We present primers allowing amplification of a 485-bp section of the cytochrome b gene containing this site, using the polymerase chain reaction. Digestion of the amplified product with BglII yields contrasting patterns between Africanized and other honeybees.

  7. Molecular identification of potential pathogens in water and air of a hospital therapy pool

    PubMed Central

    Angenent, Largus T.; Kelley, Scott T.; Amand, Allison St.; Pace, Norman R.; Hernandez, Mark T.

    2005-01-01

    Indoor warm-water therapy pool workers in a Midwestern regional hospital were diagnosed with non-tuberculosis pulmonary hypersensitive pneumonitis and Mycobacterium avium infections. In response, we conducted a multiseason survey of microorganisms present in this therapy pool water, in biofilms associated with the pool containment walls, and in air immediately above the pool. The survey used culture, microscopy, and culture-independent molecular phylogenetic analyses. Although outfitted with a state-of-the-art UV-peroxide disinfection system, the numbers of bacteria in the therapy pool water were relatively high compared with the potable water used to fill the pool. Regardless of the source, direct microscopic counts of microbes were routinely ≈1,000 times greater than conventional plate counts. Analysis of clone libraries of small subunit rRNA genes from environmental DNA provided phylogenetic diversity estimates of the microorganisms collected in and above the pool. A survey of >1,300 rRNA genes yielded a total of 628 unique sequences, the most common of which was nearly identical to that of M. avium strains. The high proportion of clones with different Mycobacterium spp. rRNA genes suggested that such organisms comprised a significant fraction of microbes in the pool water (to >30%) and preferentially partition into aerosols (to >80%) relative to other waterborne bacteria present. The results of the study strongly validate aerosol partitioning as a mechanism for disease transfer in these environments. The results also show that culture protocols currently used by public health facilities and agencies are seriously inadequate for the detection and enumeration of potential pathogens. PMID:15769858

  8. 10 CFR 36.63 - Pool water purity.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... § 36.63 Pool water purity. (a) Pool water purification system must be run sufficiently to maintain the conductivity of the pool water below 20 microsiemens per centimeter under normal circumstances. If pool water... 10 Energy 1 2010-01-01 2010-01-01 false Pool water purity. 36.63 Section 36.63 Energy...

  9. 10 CFR 36.63 - Pool water purity.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... § 36.63 Pool water purity. (a) Pool water purification system must be run sufficiently to maintain the conductivity of the pool water below 20 microsiemens per centimeter under normal circumstances. If pool water... 10 Energy 1 2014-01-01 2014-01-01 false Pool water purity. 36.63 Section 36.63 Energy...

  10. 10 CFR 36.63 - Pool water purity.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... § 36.63 Pool water purity. (a) Pool water purification system must be run sufficiently to maintain the conductivity of the pool water below 20 microsiemens per centimeter under normal circumstances. If pool water... 10 Energy 1 2012-01-01 2012-01-01 false Pool water purity. 36.63 Section 36.63 Energy...

  11. Swimming Pools. A Guide to Their Planning, Design and Operation.

    ERIC Educational Resources Information Center

    Gabrielsen, M. Alexander, Ed.

    Information is presented regarding all phases of swimming pool development and operation from earliest planning considerations to final programing. This comprehensive book covers--(1) the steps involved in planning a pool, (2) designing the pool, (3) water circulation, filtration, and treatment, (4) community pools, school and agency pools, and…

  12. 10 CFR 36.63 - Pool water purity.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 1 2011-01-01 2011-01-01 false Pool water purity. 36.63 Section 36.63 Energy NUCLEAR... § 36.63 Pool water purity. (a) Pool water purification system must be run sufficiently to maintain the conductivity of the pool water below 20 microsiemens per centimeter under normal circumstances. If pool...

  13. 10 CFR 36.63 - Pool water purity.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 1 2013-01-01 2013-01-01 false Pool water purity. 36.63 Section 36.63 Energy NUCLEAR... § 36.63 Pool water purity. (a) Pool water purification system must be run sufficiently to maintain the conductivity of the pool water below 20 microsiemens per centimeter under normal circumstances. If pool...

  14. MMAPPR: Mutation Mapping Analysis Pipeline for Pooled RNA-seq

    PubMed Central

    Hill, Jonathon T.; Demarest, Bradley L.; Bisgrove, Brent W.; Gorsi, Bushra; Su, Yi-Chu; Yost, H. Joseph

    2013-01-01

    Forward genetic screens in model organisms are vital for identifying novel genes essential for developmental or disease processes. One drawback of these screens is the labor-intensive and sometimes inconclusive process of mapping the causative mutation. To leverage high-throughput techniques to improve this mapping process, we have developed a Mutation Mapping Analysis Pipeline for Pooled RNA-seq (MMAPPR) that works without parental strain information or requiring a preexisting SNP map of the organism, and adapts to differential recombination frequencies across the genome. MMAPPR accommodates the considerable amount of noise in RNA-seq data sets, calculates allelic frequency by Euclidean distance followed by Loess regression analysis, identifies the region where the mutation lies, and generates a list of putative coding region mutations in the linked genomic segment. MMAPPR can exploit RNA-seq data sets from isolated tissues or whole organisms that are used for gene expression and transcriptome analysis in novel mutants. We tested MMAPPR on two known mutant lines in zebrafish, nkx2.5 and tbx1, and used it to map two novel ENU-induced cardiovascular mutants, with mutations found in the ctr9 and cds2 genes. MMAPPR can be directly applied to other model organisms, such as Drosophila and Caenorhabditis elegans, that are amenable to both forward genetic screens and pooled RNA-seq experiments. Thus, MMAPPR is a rapid, cost-efficient, and highly automated pipeline, available to perform mutant mapping in any organism with a well-assembled genome. PMID:23299975

  15. Investigations in Marine Chemistry: Tide Pool Ecology.

    ERIC Educational Resources Information Center

    Schlenker, Richard M.

    Students investigated the salinity of tide pools at different levels in the intertidal zone. Data are analyzed collectively. Students graphed and discussed data. Included are suggestions for evaluation and further study. (Author)

  16. CDC Study Finds Fecal Contamination in Pools

    MedlinePlus

    ... Electronic Media , Office of Communication (404) 639-3286 CDC study finds fecal contamination in pools A study ... Calendar Resources Resources Contact Us Frequently Asked Questions CDC Quick Links Data & Statistics Freedom of Information Act ...

  17. Registry in a tube: multiplexed pools of retrievable parts for genetic design space exploration.

    PubMed

    Woodruff, Lauren B A; Gorochowski, Thomas E; Roehner, Nicholas; Mikkelsen, Tarjei S; Densmore, Douglas; Gordon, D Benjamin; Nicol, Robert; Voigt, Christopher A

    2016-12-21

    Genetic designs can consist of dozens of genes and hundreds of genetic parts. After evaluating a design, it is desirable to implement changes without the cost and burden of starting the construction process from scratch. Here, we report a two-step process where a large design space is divided into deep pools of composite parts, from which individuals are retrieved and assembled to build a final construct. The