Science.gov

Sample records for african trypanosome trypanosoma

  1. Two new Trypanosoma species from African birds, with notes on the taxonomy of avian trypanosomes.

    PubMed

    Valkiūnas, Gediminas; Iezhova, Tatjana A; Carlson, Jenny S; Sehgal, Ravinder N M

    2011-10-01

    Trypanosoma anguiformis n. sp. and Trypanosoma polygranularis n. sp. are described from the African olive sunbird, Cyanomitra olivacea, and Latham's forest francolin, Francolinus lathami, respectively, based on the morphology of their hematozoic trypomastigotes and partial sequences of the small subunit ribosomal RNA gene. Both new species belong to the group of small non-striated avian trypanosomes (<30 µm in length on average) with the kinetoplast situated close to the posterior end of the body. Trypanosoma anguiformis can be readily distinguished from other small avian trypanosomes due to its markedly attenuated (snake-shaped) form of the hematozoic trypomastigotes and the dumbbell-shaped nucleus of the parasite. Trypanosoma polygranularis is readily distinguishable due to the markedly off-center (anteriorly) located nucleus, numerous azurophilic granules that are arranged in a line following the undulating membrane, and the large kinetoplast (with an area up to 1.7 µm(2) [1.1 µm(2) on average]). Illustrations of hematozoic trypomastigotes of the new species are given, and DNA lineages associated with these parasites are reported. The current situation in species taxonomy of avian trypanosomes is discussed. We call for the redescription of valid species of avian trypanosomes from their type vertebrate hosts and type localities by using morphological and polymerase chain reaction-based techniques as an initial essential step towards revising the species composition of avian trypanosomes and reconstructing the taxonomy of these organisms.

  2. Phylogeny and Morphological Variability of Trypanosomes from African Pelomedusid Turtles with Redescription of Trypanosoma mocambicum Pienaar, 1962.

    PubMed

    Dvořáková, Nela; Čepička, Ivan; Qablan, Moneeb A; Gibson, Wendy; Blažek, Radim; Široký, Pavel

    2015-12-01

    Little is known about host specificity, genetic diversity and phylogenetic relationships of African turtle trypanosomes. Using PCR targeting the SSU rRNA gene, we detected trypanosomes in 24 of 134 (17.9%) wild caught African pelomedusid turtles: Pelusios upembae (n=14), P. bechuanicus (n=1), P. rhodesianus (n=3) and P. subniger (n=6). Mixed infection of Trypanosoma species was confirmed by PCR in three specimens of P. upembae, and in one specimen each of P. bechuanicus, P. rhodesianus, and P. subniger. Microscopic examination of stained blood smears revealed two distinct forms (broad and slender) of trypomastigotes. The broad form coincided in morphology with T. mocambicumPienaar, 1962. Accordingly, we have designated this form as the neotype of T. mocambicum. In phylogenetic analysis of the SSU rRNA gene, all the new turtle trypanosome sequences grouped in a single clade within the strongly supported "aquatic" clade of Trypanosoma species. The turtle trypanosome clade was further subdivided into two subclades, which did not correlate with host turtle species or trypanosome morphology. This study provides the first sequence data of Trypanosoma species isolated from freshwater turtles from tropical Africa and extends knowledge on diversity of trypanosomes in the Afrotropical zoogeographical realm.

  3. Genetics of resistance to the African trypanosomes. IV. Resistance of radiation chimeras to Trypanosoma rhodesiense infection

    SciTech Connect

    DeGee, A.L.; Mansfield, J.M.

    1984-08-01

    The cellular bases of resistance to the African trypanosomes were examined in inbred mice. As part of these studies, reciprocal bone marrow cell transplants were performed between H-2 compatible mice which differ in relative resistance to Trypanosoma brucei rhodesiense infection. Relatively resistant C57BL/10 mice, intermediate A.By mice, and least resistant C3H.SW mice that were reconstituted after lethal irradiation with syngeneic bone marrow cells displayed resistance and immunity characteristic of the homologous donor strain. When C57BL/10 mice were reconstituted with C3H.SW mouse bone marrow cells they retained the ability to produce antibodies to trypanosome surface antigen but the antibody titers were significantly reduced. Control of parasitemia and mean survival time were reduced in these chimeras, but differed significantly from C3H.SW mice. A. By mice that received cells from C57BL/10 donors exhibited antibody responses and survival times similar to the C57BL/10 mice. Survival times of A.By mice given syngeneic cells or C3H.SW cells were the same, but the antibody responses of A.By mice given C3H.SW cells were lower than those of A.By mice given syngeneic cells. C3H.SW mice reconstituted with C57BL/10 bone marrow cells were capable of making antibodies and controlling parasitemia, in marked contrast to the absence of such responses in C3H.SW mice reconstituted with syngeneic cells. Survival times, however, were indistinguishable from those of C3H.SW mice given syngeneic cells. Thus, resistance to T.B. rhodesiense was shown for the first time to depend on donor bone marrow derived cells as well as upon radiation-resistant cells/factors associated with host genetic background. Also, parasite-specific IgM antibody responses seem to be regulated by a mechanism which does not depend on bone marrow derived cells alone, and the presence of such immune responses is not linked to survival time.

  4. A tsetse and tabanid fly survey of African great apes habitats reveals the presence of a novel trypanosome lineage but the absence of Trypanosoma brucei.

    PubMed

    Votýpka, Jan; Rádrová, Jana; Skalický, Tomáš; Jirků, Milan; Jirsová, Dagmar; Mihalca, Andrei D; D'Amico, Gianluca; Petrželková, Klára J; Modrý, David; Lukeš, Julius

    2015-10-01

    Tsetse and tabanid flies transmit several Trypanosoma species, some of which are human and livestock pathogens of major medical and socioeconomic impact in Africa. Recent advances in molecular techniques and phylogenetic analyses have revealed a growing diversity of previously unidentified tsetse-transmitted trypanosomes potentially pathogenic to livestock and/or other domestic animals as well as wildlife, including African great apes. To map the distribution, prevalence and co-occurrence of known and novel trypanosome species, we analyzed tsetse and tabanid flies collected in the primary forested part of the Dzanga-Sangha Protected Areas, Central African Republic, which hosts a broad spectrum of wildlife including primates and is virtually devoid of domestic animals. Altogether, 564 tsetse flies and 81 tabanid flies were individually screened for the presence of trypanosomes using 18S rRNA-specific nested PCR. Herein, we demonstrate that wildlife animals are parasitized by a surprisingly wide range of trypanosome species that in some cases may circulate via these insect vectors. While one-third of the examined tsetse flies harbored trypanosomes either from the Trypanosoma theileri, Trypanosoma congolense or Trypanosoma simiae complex, or one of the three new members of the genus Trypanosoma (strains 'Bai', 'Ngbanda' and 'Didon'), more than half of the tabanid flies exclusively carried T. theileri. To establish the putative vertebrate hosts of the novel trypanosome species, we further analyzed the provenance of blood meals of tsetse flies. DNA individually isolated from 1033 specimens of Glossina spp. and subjected to high-throughput library-based screening proved that most of the examined tsetse flies engorged on wild ruminants (buffalo, sitatunga, bongo), humans and suids. Moreover, they also fed (albeit more rarely) on other vertebrates, thus providing indirect but convincing evidence that trypanosomes can be transmitted via these vectors among a wide range of

  5. Antigenic variation in African trypanosomes

    PubMed Central

    Horn, David

    2014-01-01

    Studies on Variant Surface Glycoproteins (VSGs) and antigenic variation in the African trypanosome, Trypanosoma brucei, have yielded a remarkable range of novel and important insights. The features first identified in T. brucei extend from unique to conserved-among-trypanosomatids to conserved-among-eukaryotes. Consequently, much of what we now know about trypanosomatid biology and much of the technology available has its origin in studies related to VSGs. T. brucei is now probably the most advanced early branched eukaryote in terms of experimental tractability and can be approached as a pathogen, as a model for studies on fundamental processes, as a model for studies on eukaryotic evolution or often all of the above. In terms of antigenic variation itself, substantial progress has been made in understanding the expression and switching of the VSG coat, while outstanding questions continue to stimulate innovative new approaches. There are large numbers of VSG genes in the genome but only one is expressed at a time, always immediately adjacent to a telomere. DNA repair processes allow a new VSG to be copied into the single transcribed locus. A coordinated transcriptional switch can also allow a new VSG gene to be activated without any detectable change in the DNA sequence, thereby maintaining singular expression, also known as allelic exclusion. I review the story behind VSGs; the genes, their expression and switching, their central role in T. brucei virulence, the discoveries that emerged along the way and the persistent questions relating to allelic exclusion in particular. PMID:24859277

  6. Drug cytotoxicity assay for African trypanosomes and Leishmania species.

    PubMed

    Bodley, A L; McGarry, M W; Shapiro, T A

    1995-10-01

    The trypanosomes and Leishmania species are parasitic protozoa that afflict millions of people throughout the world. If not treated, African trypanosomiasis and visceral leishmaniasis are fatal. The available drugs are severely limited by toxicity, marginal efficacy, the requirement for parenteral administration, and spreading drug resistance. In this study, a spectrophotometric assay was developed and validated for measuring the cytotoxicity of test compounds against axenically cultured bloodstream-form Trypanosoma brucei (African trypanosomes) and promastigotes of Leishmania donovani. Enzymatic hydrolysis of p-nitrophenyl phosphate, monitored by a microtiter plate reader, is a reliable surrogate for parasite cell counts. The assay is simple, inexpensive, and highly reproducible. The coefficient of variation for EC50 values is < 10% for determinations obtained over several months. This method permits the rapid screening of candidates for much-needed new drugs against these parasites.

  7. Dihydroxyacetone induced autophagy in African trypanosomes.

    PubMed

    Uzcátegui, Néstor L; Denninger, Viola; Merkel, Patrick; Schoenfeld, Caroline; Figarella, Katherine; Duszenko, Michael

    2007-01-01

    Dihydroxyacetone (DHA) was examined to explore its trypanocidal activity. The compound is easily taken up by trypanosomes via its aquaglyceroporins but is not converted to a glycolytic intermediate due to the lack of a respective kinase. Investigating the DHA-induced cell death it became evident that parasites die by autophagy rather than by necrosis or apoptosis. Since autophagy is not well studied in African trypanosomes our work offers a way to investigate the importance of autophagy for trypanosomes not only for stress coping but also for organelle reconstruction during differentiation.

  8. Trypanosome alternative oxidase, a potential therapeutic target for sleeping sickness, is conserved among Trypanosoma brucei subspecies.

    PubMed

    Nakamura, Kosuke; Fujioka, Sunao; Fukumoto, Shinya; Inoue, Noboru; Sakamoto, Kimitoshi; Hirata, Haruyuki; Kido, Yasutoshi; Yabu, Yoshisada; Suzuki, Takashi; Watanabe, Yoh-ichi; Saimoto, Hiroyuki; Akiyama, Hiroshi; Kita, Kiyoshi

    2010-12-01

    Trypanosoma brucei rhodesiense and T. b. gambiense are known causes of human African trypanosomiasis (HAT), or "sleeping sickness," which is deadly if untreated. We previously reported that a specific inhibitor of trypanosome alternative oxidase (TAO), ascofuranone, quickly kills African trypanosomes in vitro and cures mice infected with another subspecies, non-human infective T. b. brucei, in in vivo trials. As an essential factor for trypanosome survival, TAO is a promising drug target due to the absence of alternative oxidases in the mammalian host. This study found TAO expression in HAT-causing trypanosomes; its amino acid sequence was identical to that in non-human infective T. b. brucei. The biochemical understanding of the TAO including its 3 dimensional structure and inhibitory compounds against TAO could therefore be applied to all three T. brucei subspecies in search of a cure for HAT. Our in vitro study using T. b. rhodesiense confirmed the effectiveness of ascofuranone (IC(50) value: 1 nM) to eliminate trypanosomes in human infective strain cultures.

  9. African Trypanosomes Find a Fat Haven

    PubMed Central

    Beverley, Stephen M.

    2016-01-01

    The African trypanosome was thought to primarily develop in the bloodstream and interstitial spaces of its mammalian host. In this issue of Cell Host & Microbe, Trindade et al. (2016) report the surprising finding that during ongoing persistent infections in mice, a major fraction of the parasites reside within fatty tissues. PMID:27281564

  10. Developmentally Regulated Sphingolipid Synthesis in African Trypanosomes

    PubMed Central

    Sutterwala, Shaheen S.; Hsu, Fong Fu; Sevova, Elitza S.; Schwartz, Kevin J.; Zhang, Kai; Key, Phillip; Turk, John; Beverley, Stephen M.; Bangs, James D.

    2008-01-01

    Sphingolipids are essential components of eukaryotic membranes, and many unicellular eukaryotes, including kinetoplastid protozoa, are thought to synthesize exclusively inositol phosphorylceramide (IPC). Here we characterize sphingolipids from Trypanosoma brucei, and a trypanosome sphingolipid synthase gene family (TbSLS1-4) that is orthologous to Leishmania IPC synthase. Procyclic trypanosomes contain IPC, but also sphingomyelin, while surprisingly bloodstream stage parasites contain sphingomyelin and ethanolamine phosphorylceramide (EPC), but no detectable IPC. In vivo fluorescent ceramide labeling confirmed stage specific biosynthesis of both sphingomyelin and IPC. Expression of TbSLS4 in Leishmania resulted in production of sphingomyelin and EPC suggesting that the TbSLS gene family has bi-functional synthase activity. RNAi silencing of TbSLS1-4 in bloodstream trypanosomes led to rapid growth arrest and eventual cell death. Ceramide levels were increased >3-fold by silencing suggesting a toxic downstream effect mediated by this potent intracellular messenger. Topology predictions support a revised six transmembrane domain model for the kinetoplastid sphingolipid synthases consistent with the proposed mammalian SM synthase structure. This work reveals novel diversity and regulation in sphingolipid metabolism in this important group of human parasites. PMID:18699867

  11. Identification of Trypanosome proteins in plasma from African sleeping sickness patients infected with T. b. rhodesiense.

    PubMed

    Eyford, Brett A; Ahmad, Rushdy; Enyaru, John C; Carr, Steven A; Pearson, Terry W

    2013-01-01

    Control of human African sleeping sickness, caused by subspecies of the protozoan parasite Trypanosoma brucei, is based on preventing transmission by elimination of the tsetse vector and by active diagnostic screening and treatment of infected patients. To identify trypanosome proteins that have potential as biomarkers for detection and monitoring of African sleeping sickness, we have used a 'deep-mining" proteomics approach to identify trypanosome proteins in human plasma. Abundant human plasma proteins were removed by immunodepletion. Depleted plasma samples were then digested to peptides with trypsin, fractionated by basic reversed phase and each fraction analyzed by liquid chromatography-tandem mass spectrometry (LC-MS/MS). This sample processing and analysis method enabled identification of low levels of trypanosome proteins in pooled plasma from late stage sleeping sickness patients infected with Trypanosoma brucei rhodesiense. A total of 254 trypanosome proteins were confidently identified. Many of the parasite proteins identified were of unknown function, although metabolic enzymes, chaperones, proteases and ubiquitin-related/acting proteins were found. This approach to the identification of conserved, soluble trypanosome proteins in human plasma offers a possible route to improved disease diagnosis and monitoring, since these molecules are potential biomarkers for the development of a new generation of antigen-detection assays. The combined immuno-depletion/mass spectrometric approach can be applied to a variety of infectious diseases for unbiased biomarker identification.

  12. Tropolysin, a new oligopeptidase from African trypanosomes.

    PubMed

    Morty, Rory E; Vadász, István; Bulau, Patrick; Dive, Vincent; Oliveira, Vitor; Seeger, Werner; Juliano, Luiz

    2005-11-08

    Oligopeptidases are emerging as important pathogenic factors and therapeutic targets in trypanosome infections. We describe here the purification, cloning, and biochemical analysis of a new oligopeptidase from two pathogenic African trypanosomes. This oligopeptidase, which we have called tropolysin (encoded by the trn gene), represents an evolutionarily distant member of the M3A subfamily of metallopeptidases, ancestral to thimet oligopeptidase, neurolysin, and saccharolysin. The trn gene was present as a single copy per haploid genome, was expressed in both the mammalian and insect stages of the parasite life cycle, and encoded an 84 kDa protein. Both purified and hyperexpressed tropolysin hydrolyzed bradykinin-derived fluorogenic peptide substrates at restricted sites, with an alkaline pH optimum, and were activated by dithiothreitol and reduced glutathione and by divalent metal cations, in the order Zn(2+) > Co(2+) > Mn(2+). Under oxidizing conditions, tropolysin reversibly formed inactive multimers. Tropolysin exhibited a preference for acidic amino acid side chains in P(4), hydrophobic side chains in P(3), and hydrophobic or large uncharged side chains in P(1), P(1)', and P(3)', while the S(2)' site was unselective. Highly charged residues were not tolerated in P(1)'. Tropolysin was responsible for the bulk of the kinin-degrading activity in trypanosome lysates, potently (k(cat) approximately 119 s(-)(1)) inactivated the vasoactive kinins bradykinin and kallidin, and generated angiotensin(1-7) from angiotensin I. This hydrolysis both abolished the capacity of bradykinin to stimulate the bradykinin B(2) receptor and abrogated bradykinin prohypotensive properties in vivo, raising the possibility that tropolysin may play a role in the dysregulated kinin metabolism observed in the plasma of trypanosome-infected hosts.

  13. 25 years of African trypanosome research: From description to molecular dissection and new drug discovery.

    PubMed

    Matthews, Keith R

    2015-01-01

    The Molecular Parasitology conference was first held at the Marine Biological laboratory, Woods Hole, USA 25 years ago. Since that first meeting, the conference has evolved and expanded but has remained the showcase for the latest research developments in molecular parasitology. In this perspective, I reflect on the scientific discoveries focussed on African trypanosomes (Trypanosoma brucei spp.) that have occurred since the inaugural MPM meeting and discuss the current and future status of research on these parasites.

  14. Social motility in African trypanosomes: fact or model?

    PubMed

    Bastin, Philippe; Rotureau, Brice

    2015-02-01

    African trypanosomes grown on agarose plates exhibit behaviours akin to social motility. This phenomenon has not been observed in vivo so far but recently turned out to be instrumental in the definition of two specific stages of the parasite cycle and as a tool to probe for trypanosome sensing functions.

  15. Identification of a tryptophan-like epitope borne by the variable surface glycoprotein (VSG) of African trypanosomes.

    PubMed

    Semballa, S; Okomo-Assoumou, M C; Holzmuller, P; Büscher, P; Magez, S; Lemesre, J L; Daulouede, S; Courtois, P; Geffard, M; Vincendeau, P

    2007-02-01

    Antibodies (Ab) directed against a tryptophan-like epitope (WE) were previously detected in patients with human African trypanosomiasis (HAT). We investigated whether or not these Ab resulted from immunization against trypanosome antigen(s) expressing a WE. By Western blotting, we identified an antigen having an apparent molecular weight ranging from 60 to 65 kDa, recognized by purified rabbit anti-WE Ab. This antigen, present in trypomastigote forms, was absent in procyclic forms and Trypanosoma cruzi trypomastigotes. Using purified variable surface glycoproteins (VSG) from various trypanosomes, we showed that VSG was the parasite antigen recognized by these rabbit Ab. Anti-WE and anti-VSG Ab were purified from HAT sera by affinity chromatography. Immunoreactivity of purified antibodies eluted from affinity columns and of depleted fractions showed that WE was one of the epitopes borne by VSG. These data underline the existence of an invariant WE in the structure of VSG from several species of African trypanosomes.

  16. What has DNA sequencing revealed about the VSG expression sites of African trypanosomes?

    PubMed

    McCulloch, Richard; Horn, David

    2009-08-01

    Antigenic variation is crucial for the survival of African trypanosomes in mammals and involves switches in expression of variant surface glycoprotein genes, which are co-transcribed with a number of expression-site-associated genes (ESAGs) from loci termed 'bloodstream expression sites' (BESs). Trypanosomes possess multiple BESs, although the reason for this (and why ESAGs are resident in these loci) has remained a subject of debate. The genome sequence of Trypanosoma brucei, released in 2005, did not include the BESs because of their telomeric disposition. This gap in our knowledge has now been bridged by two new studies, which we discuss here, asking what has been revealed about the biological significance of BES multiplicity and ESAG function and evolution.

  17. Deforestation does not affect the prevalence of a common trypanosome in African birds.

    PubMed

    Valkiūnas, Gediminas; Iezhova, Tatjana A; Sehgal, Ravinder N M

    2016-10-01

    In spite of numerous reports of avian Trypanosoma spp. in birds throughout the world, patterns of the distribution and prevalence of these blood parasites remains insufficiently understood. It is clear that spatial heterogeneity influences parameters of parasite distributions in natural populations, but data regarding avian trypanosomes are scarce. Using microscopy and molecular diagnostic methods, we analysed the variation of prevalence of avian Trypanosoma parasites in two widespread African bird species, the yellow-whiskered greenbul Andropadus latirostris and the olive sunbird Cyanomitra olivacea. In all, 353 birds were captured in pristine forests and agroforest sites in Cameroon and Ghana. Overall, the prevalence of avian trypanosomes was 51.3%. Five morphospecies were reported (Trypanosoma everetti, T. anguiformis, T. avium, T. naviformis, T. ontarioensis). Trypanosoma everetti predominated, representing 98% of all Trypanosoma spp. reports, and it was present in both avian hosts. The prevalence of T. everetti was significantly less in the yellow-whiskered greenbul (19%) than olive sunbird (83%), and the same pattern of prevalence was reported in these avian hosts at different study sites. We found no interaction between sites and the prevalence of T. everetti. For both avian hosts, the prevalence did not differ significantly between pristine forests and agroforests. This indicates the same pattern of transmission at sites with different levels of deforestation and suggests that spatial heterogeneity related to deforestation does not affect the prevalence of avian Trypanosoma infections. It is likely that host-related factors, but not environmental conditions favour or reduce these parasite infections in forests of sub-Saharan Africa. Microscopic and PCR-based diagnostics showed the same sensitivity in diagnostics of T. everetti. We discuss the implications of these findings for the epidemiology of avian trypanosomiasis in natural populations.

  18. 25 years of African trypanosome research: From description to molecular dissection and new drug discovery☆☆☆

    PubMed Central

    Matthews, Keith R.

    2015-01-01

    The Molecular Parasitology conference was first held at the Marine Biological laboratory, Woods Hole, USA 25 years ago. Since that first meeting, the conference has evolved and expanded but has remained the showcase for the latest research developments in molecular parasitology. In this perspective, I reflect on the scientific discoveries focussed on African trypanosomes (Trypanosoma brucei spp.) that have occurred since the inaugural MPM meeting and discuss the current and future status of research on these parasites. PMID:25736427

  19. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.

    2008-01-01

    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  20. African trypanosome infections of the nervous system: parasite entry and effects on sleep and synaptic functions.

    PubMed

    Kristensson, Krister; Nygård, Mikael; Bertini, Giuseppe; Bentivoglio, Marina

    2010-06-01

    The extracellular parasite Trypanosoma brucei causes human African trypanosomiasis (HAT), also known as sleeping sickness. Trypanosomes are transmitted by tsetse flies and HAT occurs in foci in sub-Saharan Africa. The disease, which is invariably lethal if untreated, evolves in a first hemo-lymphatic stage, progressing to a second meningo-encephalitic stage when the parasites cross the blood-brain barrier. At first, trypanosomes are restricted to circumventricular organs and choroid plexus in the brain outside the blood-brain barrier, and to dorsal root ganglia. Later, parasites cross the blood-brain barrier at post-capillary venules, through a multi-step process similar to that of lymphocytes. Accumulation of parasites in the brain is regulated by cytokines and chemokines. Trypanosomes can alter neuronal function and the most prominent manifestation is represented by sleep alterations. These are characterized, in HAT and experimental rodent infections, by disruption of the sleep-wake 24h cycle and internal sleep structure. Trypanosome infections alter also some, but not all, other endogenous biological rhythms. A number of neural pathways and molecules may be involved in such effects. Trypanosomes secrete prostaglandins including the somnogenic PGD2, and they interact with the host's immune system to cause release of pro-inflammatory cytokines. From the sites of early localization of parasites in the brain and meninges, such molecules could affect adjacent brain areas implicated in sleep-wakefulness regulation, including the suprachiasmatic nucleus and its downstream targets, to cause the changes characteristic of the disease. This raises challenging issues on the effects of cytokines on synaptic functions potentially involved in sleep-wakefulness alterations.

  1. Bromodomain Proteins Contribute to Maintenance of Bloodstream Form Stage Identity in the African Trypanosome

    PubMed Central

    Schulz, Danae; Mugnier, Monica R.; Paulsen, Eda-Margaret; Kim, Hee-Sook; Chung, Chun-wa W.; Tough, David F.; Rioja, Inmaculada; Prinjha, Rab K.; Papavasiliou, F. Nina; Debler, Erik W.

    2015-01-01

    Trypanosoma brucei, the causative agent of African sleeping sickness, is transmitted to its mammalian host by the tsetse. In the fly, the parasite’s surface is covered with invariant procyclin, while in the mammal it resides extracellularly in its bloodstream form (BF) and is densely covered with highly immunogenic Variant Surface Glycoprotein (VSG). In the BF, the parasite varies this highly immunogenic surface VSG using a repertoire of ~2500 distinct VSG genes. Recent reports in mammalian systems point to a role for histone acetyl-lysine recognizing bromodomain proteins in the maintenance of stem cell fate, leading us to hypothesize that bromodomain proteins may maintain the BF cell fate in trypanosomes. Using small-molecule inhibitors and genetic mutants for individual bromodomain proteins, we performed RNA-seq experiments that revealed changes in the transcriptome similar to those seen in cells differentiating from the BF to the insect stage. This was recapitulated at the protein level by the appearance of insect-stage proteins on the cell surface. Furthermore, bromodomain inhibition disrupts two major BF-specific immune evasion mechanisms that trypanosomes harness to evade mammalian host antibody responses. First, monoallelic expression of the antigenically varied VSG is disrupted. Second, rapid internalization of antibodies bound to VSG on the surface of the trypanosome is blocked. Thus, our studies reveal a role for trypanosome bromodomain proteins in maintaining bloodstream stage identity and immune evasion. Importantly, bromodomain inhibition leads to a decrease in virulence in a mouse model of infection, establishing these proteins as potential therapeutic drug targets for trypanosomiasis. Our 1.25Å resolution crystal structure of a trypanosome bromodomain in complex with I-BET151 reveals a novel binding mode of the inhibitor, which serves as a promising starting point for rational drug design. PMID:26646171

  2. Trypanosome species, including Trypanosoma cruzi, in sylvatic and peridomestic bats of Texas, USA.

    PubMed

    Hodo, Carolyn L; Goodwin, Chloe C; Mayes, Bonny C; Mariscal, Jacqueline A; Waldrup, Kenneth A; Hamer, Sarah A

    2016-12-01

    In contrast to other mammalian reservoirs, many bat species migrate long-distances and have the potential to introduce exotic pathogens to new areas. Bats have long been associated with blood-borne protozoal trypanosomes of the Schizotrypanum subgenus, which includes the zoonotic parasite Trypanosoma cruzi, agent of Chagas disease. Another member of the subgenus, Trypanosoma dionisii, infects bats of Europe and South America, and genetic similarities between strains from the two continents suggest transcontinental movement of this parasite via bats. Despite the known presence of diverse trypanosomes in bats of Central and South America, and the presence of T. cruzi-infected vectors and wildlife in the US, the role of bats in maintaining and dispersing trypanosomes in the US has not yet been reported. We collected hearts and blood from 8 species of insectivorous bats from 30 counties across Texas. Using PCR and DNA sequencing, we tested 593 bats for trypanosomes and found 1 bat positive for T. cruzi (0.17%), 9 for T. dionisii (1.5%), and 5 for Blastocrithidia spp. (0.8%), a group of insect trypanosomes. The T. cruzi-infected bat was carrying TcI, the strain type associated with human disease in the US. In the T. dionisii-infected bats, we detected three unique variants associated with the three infected bat species. These findings represent the first report of T. cruzi in a bat in the US, of T. dionisii in North America, and of Blastocrithidia spp. in mammals, and underscore the importance of bats in the maintenance of trypanosomes, including agents of human and animal disease, across broad geographic locales.

  3. The phylogeography of trypanosomes from South American alligatorids and African crocodilids is consistent with the geological history of South American river basins and the transoceanic dispersal of Crocodylus at the Miocene

    PubMed Central

    2013-01-01

    Background Little is known about the diversity, phylogenetic relationships, and biogeography of trypanosomes infecting non-mammalian hosts. In this study, we investigated the influence of host species and biogeography on shaping the genetic diversity, phylogenetic relationship, and distribution of trypanosomes from South American alligatorids and African crocodilids. Methods Small Subunit rRNA (SSU rRNA) and glycosomal Glyceraldehyde Phosphate Dehydrogenase (gGAPDH) genes were employed for phylogenetic inferences. Trypanosomes from crocodilians were obtained by haemoculturing. Growth behaviour, morphology, and ultrastructural features complement the molecular description of two new species strongly supported by phylogenetic analyses. Results The inferred phylogenies disclosed a strongly supported crocodilian-restricted clade comprising three subclades. The subclade T. grayi comprised the African Trypanosoma grayi from Crocodylus niloticus and tsetse flies. The subclade T. ralphi comprised alligatorid trypanosomes represented by Trypanosoma ralphi n. sp. from Melanosuchus niger, Caiman crocodilus and Caiman yacare from Brazilian river basins. T. grayi and T. ralphi were sister subclades. The basal subclade T. terena comprised alligatorid trypanosomes represented by Trypanosoma terena n. sp. from Ca. yacare sharing hosts and basins with the distantly genetic related T. ralphi. This subclade also included the trypanosome from Ca. crocodilus from the Orinoco basin in Venezuela and, unexpectedly, a trypanosome from the African crocodilian Osteolaemus tetraspis. Conclusion The close relationship between South American and African trypanosomes is consistent with paleontological evidence of recent transoceanic dispersal of Crocodylus at the Miocene/Pliocene boundaries (4–5 mya), and host-switching of trypanosomes throughout the geological configuration of South American hydrographical basins shaping the evolutionary histories of the crocodilians and their trypanosomes

  4. Anti-trypanosomal effect of Peristrophe bicalyculata extract on Trypanosoma brucei brucei-infected rats

    PubMed Central

    Abimbola, Abdulazeez Mansurah; Baba, Ibrahim Abdulrazak; Yenusa, Edibo Zakari; Omanibe, Sidali Joseph; Oladimeji, Idris Habeeb

    2013-01-01

    Objective To investigate the in vitro and in vivo effect of whole plant extracts of Peristrophe bicalyculata on Trypanosoma brucei brucei-infected rats. Methods The experiment was divided into two phases: In the first phase, the anti-trypanosomal activity of the hot water, cold water, methanol and butanol extracts of the whole plant were determined by incubating with Trypanosoma brucei brucei. The cold water extract was partially-purified and the anti-trypanosomal activity of the fractions determined. In the second phase, Trypanosoma brucei brucei-infected rats were treated with fraction 2c for nine days. Packed cell volume (PCV), high density lipoprotein (HDL), low density lipoprotein (LDL), total cholesterol (TC), triacylglycerol (TAG), aspartate aminotransferase, alanine aminotransferases (ALT), alkaline phosphatase (ALP), total and direct bilirubin levels were determined at the end of the experiment. Results Cold water extract immobilized 90% of the parasites after 60 min of incubation, and fraction 2c completely immobilized the parasites after 35 min. It significantly increased PCV in Trypanosoma brucei brucei-infected rats. Decreased TC, TAG, HDL and LDL levels of infected rats increased significantly when rats were treated with the fraction, while elevated levels of total bilirubin and ALT also decreased. The difference in urea, direct bilirubin and ALP was not significant when infected rats were compared to rats in other groups. Conclusions The ability of the plant to ameliorate the infection-induced biochemical changes calls for detailed investigation of the potentials of the plant for antitrypanosomiasis drug delivery. PMID:23835905

  5. Mammalian African trypanosome VSG coat enhances tsetse's vector competence.

    PubMed

    Aksoy, Emre; Vigneron, Aurélien; Bing, XiaoLi; Zhao, Xin; O'Neill, Michelle; Wu, Yi-Neng; Bangs, James D; Weiss, Brian L; Aksoy, Serap

    2016-06-21

    Tsetse flies are biological vectors of African trypanosomes, the protozoan parasites responsible for causing human and animal trypanosomiases across sub-Saharan Africa. Currently, no vaccines are available for disease prevention due to antigenic variation of the Variant Surface Glycoproteins (VSG) that coat parasites while they reside within mammalian hosts. As a result, interference with parasite development in the tsetse vector is being explored to reduce disease transmission. A major bottleneck to infection occurs as parasites attempt to colonize tsetse's midgut. One critical factor influencing this bottleneck is the fly's peritrophic matrix (PM), a semipermeable, chitinous barrier that lines the midgut. The mechanisms that enable trypanosomes to cross this barrier are currently unknown. Here, we determined that as parasites enter the tsetse's gut, VSG molecules released from trypanosomes are internalized by cells of the cardia-the tissue responsible for producing the PM. VSG internalization results in decreased expression of a tsetse microRNA (mir-275) and interferes with the Wnt-signaling pathway and the Iroquois/IRX transcription factor family. This interference reduces the function of the PM barrier and promotes parasite colonization of the gut early in the infection process. Manipulation of the insect midgut homeostasis by the mammalian parasite coat proteins is a novel function and indicates that VSG serves a dual role in trypanosome biology-that of facilitating transmission through its mammalian host and insect vector. We detail critical steps in the course of trypanosome infection establishment that can serve as novel targets to reduce the tsetse's vector competence and disease transmission.

  6. A novel ISWI is involved in VSG expression site downregulation in African trypanosomes.

    PubMed

    Hughes, Katie; Wand, Matthew; Foulston, Lucy; Young, Rosanna; Harley, Kate; Terry, Stephen; Ersfeld, Klaus; Rudenko, Gloria

    2007-05-02

    African trypanosomes show monoallelic expression of one of about 20 telomeric variant surface glycoprotein (VSG) gene-expression sites (ESs) while multiplying in the mammalian bloodstream. We screened for genes involved in ES silencing using flow cytometry and RNA interference (RNAi). We show that a novel member of the ISWI family of SWI2/SNF2-related chromatin-remodelling proteins (TbISWI) is involved in ES downregulation in Trypanosoma brucei. TbISWI has an atypical protein architecture for an ISWI, as it lacks characteristic SANT domains. Depletion of TbISWI by RNAi leads to 30-60-fold derepression of ESs in bloodstream-form T. brucei, and 10-17-fold derepression in insect form T. brucei. We show that although blocking synthesis of TbISWI leads to derepression of silent VSG ES promoters, this does not lead to fully processive transcription of silent ESs, or an increase in ES-activation rates. VSG ES activation in African trypanosomes therefore appears to be a multistep process, whereby an increase in transcription from a silent ES promoter is necessary but not sufficient for full ES activation.

  7. Histone deacetylases play distinct roles in telomeric VSG expression site silencing in African trypanosomes.

    PubMed

    Wang, Qiao-Ping; Kawahara, Taemi; Horn, David

    2010-09-01

    African trypanosomes evade the host immune response through antigenic variation, which is achieved by periodically expressing different variant surface glycoproteins (VSGs). VSG expression is monoallelic such that only one of approximately 15 telomeric VSG expression sites (ESs) is transcribed at a time. Epigenetic regulation is involved in VSG control but our understanding of the mechanisms involved remains incomplete. Histone deacetylases are potential drug targets for diseases caused by protozoan parasites. Here, using recombinant expression we show that the essential Trypanosoma brucei deacetylases, DAC1 (class I) and DAC3 (class II) display histone deacetylase activity. Both DAC1 and DAC3 are nuclear proteins in the bloodstream stage parasite, while only DAC3 remains concentrated in the nucleus in insect-stage cells. Consistent with developmentally regulated localization, DAC1 antagonizes SIR2rp1-dependent telomeric silencing only in the bloodstream form, indicating a conserved role in the control of silent chromatin domains. In contrast, DAC3 is specifically required for silencing at VSG ES promoters in both bloodstream and insect-stage cells. We conclude that DAC1 and DAC3 play distinct roles in subtelomeric gene silencing and that DAC3 represents the first readily druggable target linked to VSG ES control in the African trypanosome.

  8. The Social Life of African Trypanosomes.

    PubMed

    Imhof, Simon; Roditi, Isabel

    2015-10-01

    The unicellular parasite Trypanosoma brucei shuttles between its definitive host, the tsetse fly, and various mammals including humans. In the fly digestive tract, T. brucei must first migrate to the ectoperitrophic space, establish a persistent infection of the midgut and then migrate to the salivary glands before being transmitted to a new mammalian host. In 2010, it was shown that insect stages of the parasite (procyclic forms) exhibit social motility (SoMo) when cultured on a semi-solid surface, and it was postulated that this behaviour might reflect a migration step in the tsetse fly. Now, almost 5 years after the initial report, several new publications shed some light on the biological function of SoMo and provide insights into the underlying signalling pathways.

  9. In vitro drug susceptibility of two strains of the wildlife trypanosome, Trypanosoma copemani: A comparison with Trypanosoma cruzi.

    PubMed

    Botero, Adriana; Keatley, Sarah; Peacock, Christopher; Thompson, R C Andrew

    2017-04-01

    Trypanosomes are blood protozoan parasites that are capable of producing illness in the vertebrate host. Within Australia, several native Trypanosoma species have been described infecting wildlife. However, only Trypanosoma copemani has been associated with pathological lesions in wildlife hosts and more recently has been associated with the drastic decline of the critically endangered woylie (Bettongia penicillata). The impact that some trypanosomes have on the health of the vertebrate host has led to the development of numerous drug compounds that could inhibit the growth or kill the parasite. This study investigated and compared the in vitro susceptibility of two strains of T. copemani (G1 and G2) and one strain of Trypanosoma cruzi (10R26) against drugs that are known to show trypanocidal activity (benznidazole, posaconazole, miltefosine and melarsoprol) and against four lead compounds, two fenarimols and two pyridine derivatives (EPL-BS1937, EPL-BS2391, EPL-BS0967, and EPL-BS1246), that have been developed primarily against T.cruzi. The in vitro cytotoxicity of all drugs against L6 rat myoblast cells was also assessed. Results showed that both strains of T. copemani were more susceptible to all drugs and lead compounds than T. cruzi, with all IC50 values in the low and sub-μM range for both species. Melarsoprol and miltefosine exhibited the highest drug activity against both T. copemani and T. cruzi, but they also showed the highest toxicity in L6 cells. Interestingly, both fenarimol and pyridine derivative compounds were more active against T. copemani and T. cruzi than the reference drugs benznidazole and posaconazole. T. copemani strains exhibited differences in susceptibility to all drugs demonstrating once again considerable differences in their biological behaviour.

  10. Morphological and Phylogenetic Description of Trypanosoma noyesi sp. nov.: An Australian Wildlife Trypanosome within the T. cruzi Clade.

    PubMed

    Botero, Adriana; Cooper, Crystal; Thompson, Craig K; Clode, Peta L; Rose, Karrie; Thompson, R C Andrew

    2016-11-01

    A number of trypanosome isolates from Australian marsupials are within the clade containing the human pathogen Trypanosoma cruzi. Trypanosomes within this clade are thought to have diverged from a common ancestral bat trypanosome. Here, we characterise Trypanosoma noyesi sp. nov. isolated from the critically endangered woylie (Bettongia pencillata) using phylogenetic inferences from three gene regions (18S rDNA, gGAPDH, and CytB) coupled with morphological and behavioural observations in vitro. We also investigated potential vectors and the presence of T. noyesi in the grey-headed flying fox (Pteropus poliocephalus). Phylogenetic analysis revealed T. noyesi and similar genotypes grouped at the periphery of the T. cruzi clade. T. noyesi is morphologically distinct both from other species of Australian trypanosomes and those within the T. cruzi clade. Although trypanosomes were not observed in the digestive tract of ectoparasites and biting flies collected from T. noyesi infected marsupials, tabanid and biting midges tested positive for T. noyesi DNA, indicating they are vector candidates. Tissues from flying foxes were negative for T. noyesi. This study provides novel information on the morphology and genetic variability of an Australian trypanosome within the T. cruzi clade.

  11. Evolutionary history of trypanosomes from South American caiman (Caiman yacare) and African crocodiles inferred by phylogenetic analyses using SSU rDNA and gGAPDH genes.

    PubMed

    Viola, L B; Almeida, R S; Ferreira, R C; Campaner, M; Takata, C S A; Rodrigues, A C; Paiva, F; Camargo, E P; Teixeira, M M G

    2009-01-01

    In this study, using a combined data set of SSU rDNA and gGAPDH gene sequences, we provide phylogenetic evidence that supports clustering of crocodilian trypanosomes from the Brazilian Caiman yacare (Alligatoridae) and Trypanosoma grayi, a species that circulates between African crocodiles (Crocodilydae) and tsetse flies. In a survey of trypanosomes in Caiman yacare from the Brazilian Pantanal, the prevalence of trypanosome infection was 35% as determined by microhaematocrit and haemoculture, and 9 cultures were obtained. The morphology of trypomastigotes from caiman blood and tissue imprints was compared with those described for other crocodilian trypanosomes. Differences in morphology and growth behaviour of caiman trypanosomes were corroborated by molecular polymorphism that revealed 2 genotypes. Eight isolates were ascribed to genotype Cay01 and 1 to genotype Cay02. Phylogenetic inferences based on concatenated SSU rDNA and gGAPDH sequences showed that caiman isolates are closely related to T. grayi, constituting a well-supported monophyletic assemblage (clade T. grayi). Divergence time estimates based on clade composition, and biogeographical and geological events were used to discuss the relationships between the evolutionary histories of crocodilian trypanosomes and their hosts.

  12. Locus-specific control of DNA resection and suppression of subtelomeric VSG recombination by HAT3 in the African trypanosome.

    PubMed

    Glover, Lucy; Horn, David

    2014-11-10

    The African trypanosome, Trypanosoma brucei, is a parasitic protozoan that achieves antigenic variation through DNA-repair processes involving Variant Surface Glycoprotein (VSG) gene rearrangements at subtelomeres. Subtelomeric suppression of DNA repair operates in eukaryotes but little is known about these controls in trypanosomes. Here, we identify a trypanosome histone acetyltransferase (HAT3) and a deacetylase (SIR2rp1) required for efficient RAD51-dependent homologous recombination. HAT3 and SIR2rp1 were required for RAD51-focus assembly and disassembly, respectively, at a chromosome-internal locus and a synthetic defect indicated distinct contributions to DNA repair. Although HAT3 promoted chromosome-internal recombination, it suppressed subtelomeric VSG recombination, and these locus-specific effects were mediated through differential production of ssDNA by DNA resection; HAT3 promoted chromosome-internal resection but suppressed subtelomeric resection. Consistent with the resection defect, HAT3 was specifically required for the G2-checkpoint response at a chromosome-internal locus. HAT3 also promoted resection at a second chromosome-internal locus comprising tandem-duplicated genes. We conclude that HAT3 and SIR2rp1 can facilitate temporally distinct steps in DNA repair. HAT3 promotes ssDNA formation and recombination at chromosome-internal sites but has the opposite effect at a subtelomeric VSG. These locus-specific controls reveal compartmentalization of the T. brucei genome in terms of the DNA-damage response and suppression of antigenic variation by HAT3.

  13. High Throughput Screening against the Peroxidase Cascade of African Trypanosomes Identifies Antiparasitic Compounds That Inactivate Tryparedoxin*

    PubMed Central

    Fueller, Florian; Jehle, Britta; Putzker, Kerstin; Lewis, Joe D.; Krauth-Siegel, R. Luise

    2012-01-01

    In African trypanosomes, the detoxification of broad spectrum hydroperoxides relies on a unique cascade composed of trypanothione (T(SH)2), trypanothione reductase, tryparedoxin (Tpx), and nonselenium glutathione peroxidase-type enzymes. All three proteins are essential for Trypanosoma brucei. Here, we subjected the complete system to a high throughput screening approach with nearly 80,000 chemicals. Twelve compounds inhibited the peroxidase system. All but one carried chloroalkyl substituents. The detailed kinetic analysis showed that two compounds weakly inhibited trypanothione reductase, but none of them specifically interacted with the peroxidase. They proved to be time-dependent inhibitors of Tpx-modifying Cys-40, the first cysteine of its active site WCPPC motif. Importantly, gel shift assays verified Tpx as a target in the intact parasites. T(SH)2, present in the in vitro assays and in the cells in high molar excess, did not interfere with Tpx inactivation. The compounds inhibited the proliferation of bloodstream T. brucei with EC50 values down to <1 μm and exerted up to 83-fold lower toxicity toward HeLa cells. Irreversible inhibitors are traditionally regarded as unfavorable. However, a large number of antimicrobials and anticancer therapeutics acts covalently with their target protein. The compounds identified here also interacted with recombinant human thioredoxin, a distant relative of Tpx. This finding might even be exploited for thioredoxin-based anticancer drug development approaches reported recently. The fact that the T(SH)2/Tpx couple occupies a central position within the trypanosomal thiol metabolism and delivers electrons also for the synthesis of DNA precursors renders the parasite-specific oxidoreductase an attractive drug target molecule. PMID:22275351

  14. State of the Art in African Trypanosome Drug Discovery

    PubMed Central

    Jacobs, Robert T.; Nare, Bakela; Phillips, Margaret A.

    2011-01-01

    African sleeping sickness is endemic in sub-Saharan Africa where the WHO estimates that 60 million people are at risk for the disease. Human African trypanosomiasis (HAT) is 100% fatal if untreated and the current drug therapies have significant limitations due to toxicity and difficult treatment regimes. No new chemical agents have been approved since eflornithine in 1990. The pentamidine analog DB289, which was in late stage clinical trials for the treatment of early stage HAT recently failed due to toxicity issues. A new protocol for the treatment of late-stage T. brucei gambiense that uses combination nifurtomox/eflornithine (NECT) was recently shown to have better safety and efficacy than eflornithine alone, while being easier to administer. This breakthrough represents the only new therapy for HAT since the approval of eflornithine. A number of research programs are on going to exploit the unusual biochemical pathways in the parasite to identify new targets for target based drug discovery programs. HTS efforts are also underway to discover new chemical entities through whole organism screening approaches. A number of inhibitors with anti-trypanosomal activity have been identified by both approaches, but none of the programs are yet at the stage of identifying a preclinical candidate. This dire situation underscores the need for continued effort to identify new chemical agents for the treatment of HAT. PMID:21401507

  15. Receptor-mediated endocytosis for drug delivery in African trypanosomes: fulfilling Paul Ehrlich's vision of chemotherapy.

    PubMed

    Alsford, Sam; Field, Mark C; Horn, David

    2013-05-01

    Bloodstream-form cells of Trypanosoma brucei exhibit massively increased endocytic activity relative to the insect midgut stage, enabling rapid recycling of variant surface glycoprotein and antibody clearance from the surface. In addition, recent advances have identified a role for receptor-mediated endocytosis in the uptake of the antitrypanosomal drug, suramin, via invariant surface glycoprotein 75, and in the uptake of trypanosome lytic factor 1 via haptoglobin-haemoglobin receptor. Here, we argue that receptor-mediated endocytosis represents both a validated drug target and a promising route for the delivery of novel therapeutics into trypanosomes.

  16. The skin is a significant but overlooked anatomical reservoir for vector-borne African trypanosomes

    PubMed Central

    Capewell, Paul; Cren-Travaillé, Christelle; Marchesi, Francesco; Johnston, Pamela; Clucas, Caroline; Benson, Robert A; Gorman, Taylor-Anne; Calvo-Alvarez, Estefania; Crouzols, Aline; Jouvion, Grégory; Jamonneau, Vincent; Weir, William; Stevenson, M Lynn; O'Neill, Kerry; Cooper, Anneli; Swar, Nono-raymond Kuispond; Bucheton, Bruno; Ngoyi, Dieudonné Mumba; Garside, Paul

    2016-01-01

    The role of mammalian skin in harbouring and transmitting arthropod-borne protozoan parasites has been overlooked for decades as these pathogens have been regarded primarily as blood-dwelling organisms. Intriguingly, infections with low or undetected blood parasites are common, particularly in the case of Human African Trypanosomiasis caused by Trypanosoma brucei gambiense. We hypothesise, therefore, the skin represents an anatomic reservoir of infection. Here we definitively show that substantial quantities of trypanosomes exist within the skin following experimental infection, which can be transmitted to the tsetse vector, even in the absence of detectable parasitaemia. Importantly, we demonstrate the presence of extravascular parasites in human skin biopsies from undiagnosed individuals. The identification of this novel reservoir requires a re-evaluation of current diagnostic methods and control policies. More broadly, our results indicate that transmission is a key evolutionary force driving parasite extravasation that could further result in tissue invasion-dependent pathology. DOI: http://dx.doi.org/10.7554/eLife.17716.001 PMID:27653219

  17. Nicotinamide Inhibits the Lysosomal Cathepsin b-like Protease and Kills African Trypanosomes*

    PubMed Central

    Unciti-Broceta, Juan D.; Maceira, José; Morales, Sonia; García-Pérez, Angélica; Muñóz-Torres, Manuel E.; Garcia-Salcedo, Jose A.

    2013-01-01

    Nicotinamide, a soluble compound of the vitamin B3 group, has antimicrobial activity against several microorganisms ranging from viruses to parasite protozoans. However, the mode of action of this antimicrobial activity is unknown. Here, we investigate the trypanocidal activity of nicotinamide on Trypanosoma brucei, the causative agent of African trypanosomiasis. Incubation of trypanosomes with nicotinamide causes deleterious defects in endocytic traffic, disruption of the lysosome, failure of cytokinesis, and, ultimately, cell death. At the same concentrations there was no effect on a cultured mammalian cell line. The effects on endocytosis and vesicle traffic were visible within 3 h and can be attributed to inhibition of lysosomal cathepsin b-like protease activity. The inhibitory effect of nicotinamide was confirmed by a direct activity assay of recombinant cathepsin b-like protein. Taken together, these data demonstrate that inhibition of the lysosomal protease cathepsin b-like blocks endocytosis, causing cell death. In addition, these results demonstrate for the first time the inhibitory effect of nicotinamide on a protease. PMID:23443665

  18. Variant surface glycoprotein RNA interference triggers a precytokinesis cell cycle arrest in African trypanosomes.

    PubMed

    Sheader, Karen; Vaughan, Sue; Minchin, James; Hughes, Katie; Gull, Keith; Rudenko, Gloria

    2005-06-14

    Trypanosoma brucei is a protozoan parasite that causes African sleeping sickness. T. brucei multiplies extracellularly in the bloodstream, relying on antigenic variation of a dense variant surface glycoprotein (VSG) coat to escape antibody-mediated lysis. We investigated the role of VSG in proliferation and pathogenicity by using inducible RNA interference to ablate VSG transcript down to 1-2% normal levels. Inhibiting VSG synthesis in vitro triggers a rapid and specific cell cycle checkpoint blocking cell division. Parasites arrest at a discrete precytokinesis stage with two full-length flagella and opposing flagellar pockets, without undergoing additional rounds of S phase and mitosis. A subset (<10%) of the stalled cells have internal flagella, indicating that the progenitors of these cells were already committed to cytokinesis when VSG restriction was sensed. Although there was no obvious VSG depletion in vitro after 24-h induction of VSG RNA interference, there was rapid clearance of these cells in vivo. We propose that a stringent block in VSG synthesis produces stalled trypanosomes with a minimally compromised VSG coat, which can be targeted by the immune system. Our data indicate that VSG protein or transcript is monitored during cell cycle progression in bloodstream-form T. brucei and describes precise precytokinesis cell cycle arrest. This checkpoint before cell division provides a link between the protective VSG coat and cell cycle progression and could function as a novel parasite safety mechanism, preventing extensive dilution of the protective VSG coat in the absence of VSG synthesis.

  19. African trypanosomiasis with special reference to Egyptian Trypanosoma evansi: is it a neglected zoonosis?

    PubMed

    El-Bahnasawy, Mamdouh M M; Khater, Mai Kh A; Morsy, Tosson A

    2014-12-01

    Trypanosomes (including humans) are blood and sometimes tissue parasites of the order Kinetoplastida, family Trypanosomatidae, genus Trypanosoma, principally transmitted by biting insects where most of them undergo a biological cycle. They are divided into Stercoraria with the posterior station inoculation, including T. cruzi, both an extra- and intracellular parasite that causes Chagas disease, a major human disease affecting 15 million people and threatening 100 million people in Latin America, and the Salivaria with the anterior station inoculation, mainly African livestock pathogenic trypanosomes, including the agents of sleeping sickness, a major human disease affecting around half a million people and threatening 60 million people in Africa. Now, T. evansi was reported in man is it required to investigate its zoonotic potential?

  20. Lapatinib-Binding Protein Kinases in the African Trypanosome: Identification of Cellular Targets for Kinase-Directed Chemical Scaffolds

    PubMed Central

    Katiyar, Samiksha; Kufareva, Irina; Behera, Ranjan; Thomas, Sarah M.; Ogata, Yuko; Pollastri, Michael; Abagyan, Ruben; Mensa-Wilmot, Kojo

    2013-01-01

    Human African trypanosomiasis is caused by the eukaryotic microbe Trypanosoma brucei. To discover new drugs against the disease, one may use drugs in the clinic for other indications whose chemical scaffolds can be optimized via a medicinal chemistry campaign to achieve greater potency against the trypanosome. Towards this goal, we tested inhibitors of human EGFR and/or VEGFR as possible anti-trypanosome compounds. The 4-anilinoquinazolines canertinib and lapatinib, and the pyrrolopyrimidine AEE788 killed bloodstream T. brucei in vitro with GI50 in the low micromolar range. Curiously, the genome of T. brucei does not encode EGFR or VEGFR, indicating that the drugs recognize alternate proteins. To discover these novel targets, a trypanosome lysate was adsorbed to an ATP-sepharose matrix and washed with a high salt solution followed by nicotinamide adenine dinucleotide (NAD+). Proteins that remained bound to the column were eluted with drugs, and identified by mass spectrometry/bioinformatics. Lapatinib bound to Tb927.4.5180 (termed T. brucei lapatinib-binding protein kinase-1 (TbLBPK1)) while AEE788 bound Tb927.5.800 (TbLBPK2). When the NAD+ wash was omitted from the protocol, AEE788, canertinib and lapatinib eluted TbLBPK1, TbLBPK2, and Tb927.3.1570 (TbLBPK3). In addition, both canertinib and lapatinib eluted Tb10.60.3140 (TbLBPK4), whereas only canertinib desorbed Tb10.61.1880 (TbCBPK1). Lapatinib binds to a unique conformation of protein kinases. To gain insight into the structural basis for lapatinib interaction with TbLBPKs, we constructed three-dimensional models of lapatinib•TbLBPK complexes, which confirmed that TbLBPKs can adopt lapatinib-compatible conformations. Further, lapatinib, AEE788, and canertinib were docked to TbLBPKs with favorable scores. Our studies (a) present novel targets of kinase-directed drugs in the trypanosome, and (b) offer the 4-anilinoquinazoline and pyrrolopyrimidines as scaffolds worthy of medicinal chemistry and structural

  1. Antigenic diversity is generated by distinct evolutionary mechanisms in African trypanosome species.

    PubMed

    Jackson, Andrew P; Berry, Andrew; Aslett, Martin; Allison, Harriet C; Burton, Peter; Vavrova-Anderson, Jana; Brown, Robert; Browne, Hilary; Corton, Nicola; Hauser, Heidi; Gamble, John; Gilderthorp, Ruth; Marcello, Lucio; McQuillan, Jacqueline; Otto, Thomas D; Quail, Michael A; Sanders, Mandy J; van Tonder, Andries; Ginger, Michael L; Field, Mark C; Barry, J David; Hertz-Fowler, Christiane; Berriman, Matthew

    2012-02-28

    Antigenic variation enables pathogens to avoid the host immune response by continual switching of surface proteins. The protozoan blood parasite Trypanosoma brucei causes human African trypanosomiasis ("sleeping sickness") across sub-Saharan Africa and is a model system for antigenic variation, surviving by periodically replacing a monolayer of variant surface glycoproteins (VSG) that covers its cell surface. We compared the genome of Trypanosoma brucei with two closely related parasites Trypanosoma congolense and Trypanosoma vivax, to reveal how the variant antigen repertoire has evolved and how it might affect contemporary antigenic diversity. We reconstruct VSG diversification showing that Trypanosoma congolense uses variant antigens derived from multiple ancestral VSG lineages, whereas in Trypanosoma brucei VSG have recent origins, and ancestral gene lineages have been repeatedly co-opted to novel functions. These historical differences are reflected in fundamental differences between species in the scale and mechanism of recombination. Using phylogenetic incompatibility as a metric for genetic exchange, we show that the frequency of recombination is comparable between Trypanosoma congolense and Trypanosoma brucei but is much lower in Trypanosoma vivax. Furthermore, in showing that the C-terminal domain of Trypanosoma brucei VSG plays a crucial role in facilitating exchange, we reveal substantial species differences in the mechanism of VSG diversification. Our results demonstrate how past VSG evolution indirectly determines the ability of contemporary parasites to generate novel variant antigens through recombination and suggest that the current model for antigenic variation in Trypanosoma brucei is only one means by which these parasites maintain chronic infections.

  2. Drug resistance in trypanosomes; effects of metabolic inhibitors, ph and oxidation-reduction potential on normal and resistant trypanosoma rhodesiense

    PubMed Central

    Williamson, J.

    1959-01-01

    A wide variety of metabolic inhibitors tested in vitro for trypanocidal activity on normal and drug-resistant strains of Trypanosoma rhodesiense showed no relation between acquired drug resistance and changes in specific enzymatic function. Oxidation-reduction potential is an important factor in trypanocidal action but is not obviously related to the development of resistance. The dependence on pH of the trypanocidal action of ionizing drugs against both normal and resistant trypanosomes supports the postulate that the development of resistance involves physical changes in cell structures associated with the uptake of drug. PMID:13844959

  3. Cationic antimicrobial peptide killing of African trypanosomes and Sodalis glossinidius, a bacterial symbiont of the insect vector of sleeping sickness.

    PubMed

    Haines, Lee R; Hancock, Robert E W; Pearson, Terry W

    2003-01-01

    Nine biochemically distinct cationic antimicrobial peptides were tested in vitro for their effects on bloodstream forms and procyclic (insect) forms of African trypanosomes, the protozoan parasites that cause African sleeping sickness in humans and trypanosomiasis in domestic animals. At low concentrations, one peptide completely inhibited growth of bloodstream forms, one inhibited procyclic forms, and five inhibited both trypanosome life cycle stages. The peptides were also tested on Sodalis glossinidius, a bacterial symbiont of tsetse flies. S. glossinidius was highly resistant to seven of the nine peptides, including both that specifically inhibited either bloodstream or procyclic forms and three of the five that inhibited both trypanosome life cycle stages. The results indicate that several of these peptides may be ideal candidates for therapy of trypanosome infected mammals or for transgenic expression in S. glossinidius as a strategy for inhibiting trypanosome survival, development, and maturation in tsetse and interference with transmission of African sleeping sickness.

  4. Trypanosome Lytic Factor-1 Initiates Oxidation-stimulated Osmotic Lysis of Trypanosoma brucei brucei*

    PubMed Central

    Greene, Amy Styer; Hajduk, Stephen L.

    2016-01-01

    Human innate immunity against the veterinary pathogen Trypanosoma brucei brucei is conferred by trypanosome lytic factors (TLFs), against which human-infective T. brucei gambiense and T. brucei rhodesiense have evolved resistance. TLF-1 is a subclass of high density lipoprotein particles defined by two primate-specific apolipoproteins: the ion channel-forming toxin ApoL1 (apolipoprotein L1) and the hemoglobin (Hb) scavenger Hpr (haptoglobin-related protein). The role of oxidative stress in the TLF-1 lytic mechanism has been controversial. Here we show that oxidative processes are involved in TLF-1 killing of T. brucei brucei. The lipophilic antioxidant N,N′-diphenyl-p-phenylenediamine protected TLF-1-treated T. brucei brucei from lysis. Conversely, lysis of TLF-1-treated T. brucei brucei was increased by the addition of peroxides or thiol-conjugating agents. Previously, the Hpr-Hb complex was postulated to be a source of free radicals during TLF-1 lysis. However, we found that the iron-containing heme of the Hpr-Hb complex was not involved in TLF-1 lysis. Furthermore, neither high concentrations of transferrin nor knock-out of cytosolic lipid peroxidases prevented TLF-1 lysis. Instead, purified ApoL1 was sufficient to induce lysis, and ApoL1 lysis was inhibited by the antioxidant DPPD. Swelling of TLF-1-treated T. brucei brucei was reminiscent of swelling under hypotonic stress. Moreover, TLF-1-treated T. brucei brucei became rapidly susceptible to hypotonic lysis. T. brucei brucei cells exposed to peroxides or thiol-binding agents were also sensitized to hypotonic lysis in the absence of TLF-1. We postulate that ApoL1 initiates osmotic stress at the plasma membrane, which sensitizes T. brucei brucei to oxidation-stimulated osmotic lysis. PMID:26645690

  5. Mechanical transmission of Trypanosoma congolense in cattle by the African tabanid Atylotus agrestis.

    PubMed

    Desquesnes, Marc; Dia, Mamadou Lamine

    2003-01-01

    The trypanosomes pathogenic to livestock in Africa (Trypanosoma congolense, Trypanosoma vivax, and Trypanosoma brucei) are mainly cyclically transmitted by tsetse (Glossina). However, T. vivax, can also be mechanically transmitted by haematophagous insects. Laboratory studies have demonstrated the mechanical transmission of T. congolense, but confirmation of this under natural conditions was necessary. An experiment was therefore carried out in Lahirasso, Burkina Faso, in a corral completely covered by mosquito net, to avoid exposure to tsetse. Eight receiver heifers, free of trypanosome infection, were kept together with two donor heifers, experimentally infected with local stocks of T. congolense. On average, 291 Atylotus agrestis, freshly captured in Nzi traps, were introduced into the mosquito net daily for a period of 20 days to initiate mechanical transmission among cattle. Daily microscopical observation of their blood indicated that two of the eight receiver heifers became infected with T. congolense from days 42 and 53. Mechanical transmission of T. congolense by A. agrestis was demonstrated unequivocally with a 25% incidence over a 20-day period of exposure under a mean challenge of 29 insects/animal/day. These results, in addition to previous reports, demonstrate the ability of A. agrestis to transmit T. vivax and T. congolense to cattle in Africa by mechanical means. Efforts to eliminate cattle trypanosomosis should therefore consider the eventual persistence of disease as a result of mechanical transmission of trypanosomes by tabanids. Index descriptor and abbreviations: Trypanosoma congolense (Trypanosomatidae) is a pathogenic trypanosome found in wild and domestic herbivores, principally in cattle (Bos taurus, Bos indicus, and cross-breds), in Africa. It is cyclically transmitted by tsetse (Glossina, Diptera); however, mechanical transmission by biting insects may also occur. The present study demonstrates unequivocally the mechanical transmission of

  6. Morphological and molecular characterization and phylogenetic relationships of a new species of trypanosome in Tapirus terrestris (lowland tapir), Trypanosoma terrestris sp. nov., from Atlantic Rainforest of southeastern Brazi

    PubMed Central

    2013-01-01

    Background The Lowland tapir (Tapirus terrestris) is the largest Brazilian mammal and despite being distributed in various Brazilian biomes, it is seriously endangered in the Atlantic Rainforest. These hosts were never evaluated for the presence of Trypanosoma parasites. Methods The Lowland tapirs were captured in the Brazilian southeastern Atlantic Rainforest, Espírito Santo state. Trypanosomes were isolated by hemoculture, and the molecular phylogeny based on small subunit rDNA (SSU rDNA) and glycosomal-3-phosphate dehydrogenase (gGAPDH) gene sequences and the ultrastructural features seen via light microscopy and scanning and transmission electron microscopy are described. Results Phylogenetic trees using combined SSU rDNA and gGAPDH data sets clustered the trypanosomes of Lowland tapirs, which were highly divergent from other trypanosome species. The phylogenetic position and morphological discontinuities, mainly in epimastigote culture forms, made it possible to classify the trypanosomes from Lowland tapirs as a separate species. Conclusions The isolated trypanosomes from Tapirus terrestris are a new species, Trypanosoma terrestris sp. n., and were positioned in a new Trypanosoma clade, named T. terrestris clade. PMID:24330660

  7. Variant surface glycoproteins from Venezuelan trypanosome isolates are recognized by sera from animals infected with either Trypanosoma evansi or Trypanosoma vivax.

    PubMed

    Camargo, Rocío; Izquier, Adriana; Uzcanga, Graciela L; Perrone, Trina; Acosta-Serrano, Alvaro; Carrasquel, Liomary; Arias, Laura P; Escalona, José L; Cardozo, Vanessa; Bubis, José

    2015-01-15

    Salivarian trypanosomes sequentially express only one variant surface glycoprotein (VSG) on their cell surface from a large repertoire of VSG genes. Seven cryopreserved animal trypanosome isolates known as TeAp-ElFrio01, TEVA1 (or TeAp-N/D1), TeGu-N/D1, TeAp-Mantecal01, TeGu-TerecayTrino, TeGu-Terecay03 and TeGu-Terecay323, which had been isolated from different hosts identified in several geographical areas of Venezuela were expanded using adult albino rats. Soluble forms of predominant VSGs expressed during the early infection stages were purified and corresponded to concanavalin A-binding proteins with molecular masses of 48-67 kDa by sodium dodecyl sulfate-polyacrylamide gel electropohoresis, and pI values between 6.1 and 7.5. The biochemical characterization of all purified soluble VSGs revealed that they were dimers in their native form and represented different gene products. Sequencing of some of these proteins yielded peptides homologous to VSGs from Trypanosoma (Trypanozoon) brucei and Trypanosoma (Trypanozoon) evansi and established that they most likely are mosaics generated by homologous recombination. Western blot analysis showed that all purified VSGs were cross-reacting antigens that were recognized by sera from animals infected with either T. evansi or Trypanosoma (Dutonella) vivax. The VSG glycosyl-phosphatidylinositol cross-reacting determinant epitope was only partially responsible for the cross-reactivity of the purified proteins, and antibodies appeared to recognize cross-reacting conformational epitopes from the various soluble VSGs. ELISA experiments were performed using infected bovine sera collected from cattle in a Venezuelan trypanosome-endemic area. In particular, soluble VSGs from two trypanosome isolates, TeGu-N/D1 and TeGu-TeracayTrino, were recognized by 93.38% and 73.55% of naturally T. vivax-infected bovine sera, respectively. However, approximately 70% of the sera samples did not recognize all seven purified proteins. Hence, the

  8. Variant surface glycoproteins from Venezuelan trypanosome isolates are recognized by sera from animals infected with either Trypanosoma evansi or Trypanosoma vivax

    PubMed Central

    Camargo, Rocío; Izquier, Adriana; Uzcanga, Graciela L.; Perrone, Trina; Acosta-Serrano, Alvaro; Carrasquel, Liomary; Arias, Laura P.; Escalona, José L.; Cardozo, Vanessa; Bubis, José

    2015-01-01

    Salivarian trypanosomes sequentially express only one variant surface glycoprotein (VSG) on their cell surface from a large repertoire of VSG genes. Seven cryopreserved animal trypanosome isolates known as TeAp-ElFrio01, TEVA1 (or TeAp-N/D1), TeGu-N/D1, TeAp-Mantecal01, TeGu-TerecayTrino, TeGu-Terecay03 and TeGu-Terecay323, which had been isolated from different hosts identified in several geographical areas of Venezuela were expanded using adult albino rats. Soluble forms of predominant VSGs expressed during the early infection stages were purified and corresponded to concanavalin A-binding proteins with molecular masses of 48–67 kDa by sodium dodecyl sulfate-polyacrylamide gel electropohoresis, and pI values between 6.1 and 7.5. The biochemical characterization of all purified soluble VSGs revealed that they were dimers in their native form and represented different gene products. Sequencing of some of these proteins yielded peptides homologous to VSGs from Trypanosoma (Trypanozoon) brucei and Trypanosoma (Trypanozoon) evansi and established that they most likely are mosaics generated by homologous recombination. Western blot analysis showed that all purified VSGs were cross-reacting antigens that were recognized by sera from animals infected with either T. evansi or Trypanosoma (Dutonella) vivax. The VSG glycosyl-phosphatidylinositol cross-reacting determinant epitope was only partially responsible for the cross-reactivity of the purified proteins, and antibodies appeared to recognize cross-reacting conformational epitopes from the various soluble VSGs. ELISA experiments were performed using infected bovine sera collected from cattle in a Venezuelan trypanosome-endemic area. In particular, soluble VSGs from two trypanosome isolates, TeGu-N/D1 and TeGu-TeracayTrino, were recognized by 93.38% and 73.55% of naturally T. vivax-infected bovine sera, respectively. However, approximately 70% of the sera samples did not recognize all seven purified proteins. Hence

  9. Bats, Trypanosomes, and Triatomines in Ecuador: New Insights into the Diversity, Transmission, and Origins of Trypanosoma cruzi and Chagas Disease

    PubMed Central

    Pinto, C. Miguel; Ocaña-Mayorga, Sofía; Tapia, Elicio E.; Lobos, Simón E.; Zurita, Alejandra P.; Aguirre-Villacís, Fernanda; MacDonald, Amber; Villacís, Anita G.; Lima, Luciana; Teixeira, Marta M. G.; Grijalva, Mario J.; Perkins, Susan L.

    2015-01-01

    The generalist parasite Trypanosoma cruzi has two phylogenetic lineages associated almost exclusively with bats—Trypanosoma cruzi Tcbat and the subspecies T. c. marinkellei. We present new information on the genetic variation, geographic distribution, host associations, and potential vectors of these lineages. We conducted field surveys of bats and triatomines in southern Ecuador, a country endemic for Chagas disease, and screened for trypanosomes by microscopy and PCR. We identified parasites at species and genotype levels through phylogenetic approaches based on 18S ribosomal RNA (18S rRNA) and cytochrome b (cytb) genes and conducted a comparison of nucleotide diversity of the cytb gene. We document for the first time T. cruzi Tcbat and T. c. marinkellei in Ecuador, expanding their distribution in South America to the western side of the Andes. In addition, we found the triatomines Cavernicola pilosa and Triatoma dispar sharing shelters with bats. The comparisons of nucleotide diversity revealed a higher diversity for T. c. marinkellei than any of the T. c. cruzi genotypes associated with Chagas disease. Findings from this study increased both the number of host species and known geographical ranges of both parasites and suggest potential vectors for these two trypanosomes associated with bats in rural areas of southern Ecuador. The higher nucleotide diversity of T. c. marinkellei supports a long evolutionary relationship between T. cruzi and bats, implying that bats are the original hosts of this important parasite. PMID:26465748

  10. Bats, Trypanosomes, and Triatomines in Ecuador: New Insights into the Diversity, Transmission, and Origins of Trypanosoma cruzi and Chagas Disease.

    PubMed

    Pinto, C Miguel; Ocaña-Mayorga, Sofía; Tapia, Elicio E; Lobos, Simón E; Zurita, Alejandra P; Aguirre-Villacís, Fernanda; MacDonald, Amber; Villacís, Anita G; Lima, Luciana; Teixeira, Marta M G; Grijalva, Mario J; Perkins, Susan L

    2015-01-01

    The generalist parasite Trypanosoma cruzi has two phylogenetic lineages associated almost exclusively with bats-Trypanosoma cruzi Tcbat and the subspecies T. c. marinkellei. We present new information on the genetic variation, geographic distribution, host associations, and potential vectors of these lineages. We conducted field surveys of bats and triatomines in southern Ecuador, a country endemic for Chagas disease, and screened for trypanosomes by microscopy and PCR. We identified parasites at species and genotype levels through phylogenetic approaches based on 18S ribosomal RNA (18S rRNA) and cytochrome b (cytb) genes and conducted a comparison of nucleotide diversity of the cytb gene. We document for the first time T. cruzi Tcbat and T. c. marinkellei in Ecuador, expanding their distribution in South America to the western side of the Andes. In addition, we found the triatomines Cavernicola pilosa and Triatoma dispar sharing shelters with bats. The comparisons of nucleotide diversity revealed a higher diversity for T. c. marinkellei than any of the T. c. cruzi genotypes associated with Chagas disease. Findings from this study increased both the number of host species and known geographical ranges of both parasites and suggest potential vectors for these two trypanosomes associated with bats in rural areas of southern Ecuador. The higher nucleotide diversity of T. c. marinkellei supports a long evolutionary relationship between T. cruzi and bats, implying that bats are the original hosts of this important parasite.

  11. Field and experimental evidence of a new caiman trypanosome species closely phylogenetically related to fish trypanosomes and transmitted by leeches.

    PubMed

    Fermino, Bruno R; Paiva, Fernando; Soares, Priscilla; Tavares, Luiz Eduardo R; Viola, Laerte B; Ferreira, Robson C; Botero-Arias, Robinson; de-Paula, Cátia D; Campaner, Marta; Takata, Carmen S A; Teixeira, Marta M G; Camargo, Erney P

    2015-12-01

    Trypanosoma terena and Trypanosoma ralphi are known species of the South American crocodilians Caiman crocodilus, Caiman yacare and Melanosuchus niger and are phylogenetically related to the tsetse-transmitted Trypanosoma grayi of the African Crocodylus niloticus. These trypanosomes form the Crocodilian clade of the terrestrial clade of the genus Trypanosoma. A PCR-survey for trypanosomes in caiman blood samples and in leeches taken from caimans revealed unknown trypanosome diversity and frequent mixed infections. Phylogenies based on SSU (small subunit) of rRNA and gGAPDH (glycosomal Glyceraldehyde Phosphate Dehydrogenase) gene sequences revealed a new trypanosome species clustering with T. terena and T. ralphi in the crocodilian clade and an additional new species nesting in the distant Aquatic clade of trypanosomes, which is herein named Trypanosoma clandestinus n. sp. This new species was found in Caiman yacare, Caiman crocodilus and M. niger from the Pantanal and Amazonian biomes in Brazil. Large numbers of dividing epimastigotes and unique thin and long trypomastigotes were found in the guts of leeches (Haementeria sp.) removed from the mouths of caimans. The trypanosomes recovered from the leeches had sequences identical to those of T. clandestinus of caiman blood samples. Experimental infestation of young caimans (Caiman yacare) with infected leeches resulted in long-lasting T. clandestinus infections that permitted us to delineate its life cycle. In contrast to T. terena, T. ralphi and T. grayi, which are detectable by hemoculturing, microscopy and standard PCR of caiman blood, T. clandestinus passes undetected by these methods due to very low parasitemia and could be detected solely by the more sensitive nested PCR method. T. clandestinus n. sp. is the first crocodilian trypanosome known to be transmitted by leeches and positioned in the aquatic clade closest to fish trypanosomes. Our data show that caimans can host trypanosomes of the aquatic or

  12. Field and experimental evidence of a new caiman trypanosome species closely phylogenetically related to fish trypanosomes and transmitted by leeches

    PubMed Central

    Fermino, Bruno R.; Paiva, Fernando; Soares, Priscilla; Tavares, Luiz Eduardo R.; Viola, Laerte B.; Ferreira, Robson C.; Botero-Arias, Robinson; de-Paula, Cátia D.; Campaner, Marta; Takata, Carmen S.A.; Teixeira, Marta M.G.; Camargo, Erney P.

    2015-01-01

    Trypanosoma terena and Trypanosoma ralphi are known species of the South American crocodilians Caiman crocodilus, Caiman yacare and Melanosuchus niger and are phylogenetically related to the tsetse-transmitted Trypanosoma grayi of the African Crocodylus niloticus. These trypanosomes form the Crocodilian clade of the terrestrial clade of the genus Trypanosoma. A PCR-survey for trypanosomes in caiman blood samples and in leeches taken from caimans revealed unknown trypanosome diversity and frequent mixed infections. Phylogenies based on SSU (small subunit) of rRNA and gGAPDH (glycosomal Glyceraldehyde Phosphate Dehydrogenase) gene sequences revealed a new trypanosome species clustering with T. terena and T. ralphi in the crocodilian clade and an additional new species nesting in the distant Aquatic clade of trypanosomes, which is herein named Trypanosoma clandestinus n. sp. This new species was found in Caiman yacare, Caiman crocodilus and M. niger from the Pantanal and Amazonian biomes in Brazil. Large numbers of dividing epimastigotes and unique thin and long trypomastigotes were found in the guts of leeches (Haementeria sp.) removed from the mouths of caimans. The trypanosomes recovered from the leeches had sequences identical to those of T. clandestinus of caiman blood samples. Experimental infestation of young caimans (Caiman yacare) with infected leeches resulted in long-lasting T. clandestinus infections that permitted us to delineate its life cycle. In contrast to T. terena, T. ralphi and T. grayi, which are detectable by hemoculturing, microscopy and standard PCR of caiman blood, T. clandestinus passes undetected by these methods due to very low parasitemia and could be detected solely by the more sensitive nested PCR method. T. clandestinus n. sp. is the first crocodilian trypanosome known to be transmitted by leeches and positioned in the aquatic clade closest to fish trypanosomes. Our data show that caimans can host trypanosomes of the aquatic or

  13. Novel trypanosome Trypanosoma gilletti sp. (Euglenozoa: Trypanosomatidae) and the extension of the host range of Trypanosoma copemani to include the koala ( Phascolarctos cinereus).

    PubMed

    McInnes, L M; Hanger, J; Simmons, G; Reid, S A; Ryan, U M

    2011-01-01

    Trypanosoma irwini was previously described from koalas and we now report the finding of a second novel species, T. gilletti, as well as the extension of the host range of Trypanosoma copemani to include koalas. Phylogenetic analysis at the 18S rDNA and gGAPDH loci demonstrated that T. gilletti was genetically distinct with a genetic distance (± s.e.) at the 18S rDNA locus of 2.7 ± 0.5% from T. copemani (wombat). At the gGAPDH locus, the genetic distance (± s.e.) of T. gilletti was 8.7 ± 1.1% from T. copemani (wombat). Trypanosoma gilletti was detected using a nested trypanosome 18S rDNA PCR in 3/139 (∼2%) blood samples and in 2/29 (∼7%) spleen tissue samples from koalas whilst T. irwini was detected in 72/139 (∼52%) blood samples and T. copemani in 4/139 (∼3%) blood samples from koalas. In addition, naturally occurring mixed infections were noted in 2/139 (∼1.5%) of the koalas tested.

  14. Effect of dibutyltin(IV) on the ultrastructure of African Trypanosoma spp.

    PubMed

    Shuaibu, M N; Kanbara, H; Yanagi, T; Ichinose, A; Ameh, D A; Bonire, J J; Nok, A J

    2004-01-01

    Diorganotins (R2SnX2) are compounds with a wide variety of biological properties. In an attempt to follow the morphological events and to characterize the toxic effects of diorganotins on in vitro cultured African Trypanosoma spp., the ultrastructural alterations induced on the parasites by dibutyltins (Bu2SnX2) were followed. The data obtained indicate that these compounds induced irreparable damage to the in vitro cultured bloodstream forms of the parasites. Transmission and scanning electron microscopy allowed observations on the perturbation of the kinetoplast, extensive cytoplasmic swellings, disconfiguration around the flagellar pocket and membrane disintegration. Fluorescence microscopy with 4,6-diamidine-2-phenylindole stain was also used to visualize the survival or degeneration of kDNA. Understanding the collateral cellular toxic effect of these compounds on the parasites may shed light on the possible mechanism by which they kill trypanosomes. Agarose gel electrophoresis resolution of isolated kDNAs revealed no fragmentation by these compounds following in vitro incubation at 37 degrees C. However, fragmentation was observed from the gel electrophoresis of kDNA isolated from in vitro cultured Bu2SnX2-exposed parasites. Transmission electron microscopy of the kDNAs revealed the same pattern as observed with gel electrophoresis. These results provide evidence for the possible involvement of the Bu2Sn moiety in the in vivo-induced fragmentation of trypanosomal kDNA and consequent trypanolysis. This observation also underlies the relevance of organometallics in the therapy of African trypanosomiasis.

  15. Modeling the locomotion of the African trypanosome using multi-particle collision dynamics

    NASA Astrophysics Data System (ADS)

    Babu, Sujin B.; Stark, Holger

    2012-08-01

    The African trypanosome is a single flagellated micro-organism that causes the deadly sleeping sickness in humans and animals. We study the locomotion of a model trypanosome by modeling the spindle-shaped cell body using an elastic network of vertices with additional bending rigidity. The flagellum firmly attached to the model cell body is either straight or helical. A bending wave propagates along the flagellum and pushes the trypanosome forward in its viscous environment, which we simulate with the method of multi-particle collision dynamics. The relaxation dynamics of the model cell body due to a static bending wave reveals the sperm number from elastohydrodynamics as the relevant parameter. Characteristic cell body conformations for the helically attached flagellum resemble experimental observations. We show that the swimming velocity scales as the root of the angular frequency of the bending wave reminiscent of predictions for an actuated slender rod attached to a large viscous load. The swimming velocity for one geometry collapses on a single master curve when plotted versus the sperm number. The helically attached flagellum leads to a helical swimming path and a rotation of the model trypanosome about its long axis as observed in experiments. The simulated swimming velocity agrees with the experimental value.

  16. Analysis of a donor gene region for a variant surface glycoprotein and its expression site in African trypanosomes.

    PubMed

    LaCount, D J; El-Sayed, N M; Kaul, S; Wanless, D; Turner, C M; Donelson, J E

    2001-05-15

    African trypanosomes evade the immune response of their mammalian hosts by sequentially expressing genes for different variant surface glycoproteins (VSGs) from telomere-linked VSG expression sites. In the Trypanosoma brucei clone whose genome is being sequenced (GUTat 10.1), we show that the expressed VSG (VSG 10.1) is duplicated from a silent donor VSG located at another telomere-linked site. We have determined two 130 kb sequences representing the VSG 10.1 donor and expression sites. The telomere-linked donor VSG 10.1 resembles metacyclic VSG expression sites, and is preceded by a cluster of 35 or more tandem housekeeping genes, all of which are transcribed away from the telomere. The 45 kb telomere-linked VSG 10.1 expression site contains a promoter followed by seven expression site-associated genes (ESAGs), three pseudo ESAGs, two pseudo VSGs and VSG 10.1. The 80 kb preceding the expression site has few, if any, functional ORFs, but contains 50 bp repeats, INGI retrotransposon-like elements, and novel 4-12 kb repeats found near other telomeres. This analysis provides the first look over a 130 kb range of a telomere-linked donor VSG and its corresponding telomere-linked VSG expression site and forms the basis for studies on antigenic variation in the context of a completely sequenced genome.

  17. Mammalian African trypanosome VSG coat enhances tsetse’s vector competence

    PubMed Central

    Aksoy, Emre; Vigneron, Aurélien; Bing, XiaoLi; Zhao, Xin; O’Neill, Michelle; Wu, Yi-neng; Bangs, James D.; Weiss, Brian L.; Aksoy, Serap

    2016-01-01

    Tsetse flies are biological vectors of African trypanosomes, the protozoan parasites responsible for causing human and animal trypanosomiases across sub-Saharan Africa. Currently, no vaccines are available for disease prevention due to antigenic variation of the Variant Surface Glycoproteins (VSG) that coat parasites while they reside within mammalian hosts. As a result, interference with parasite development in the tsetse vector is being explored to reduce disease transmission. A major bottleneck to infection occurs as parasites attempt to colonize tsetse’s midgut. One critical factor influencing this bottleneck is the fly’s peritrophic matrix (PM), a semipermeable, chitinous barrier that lines the midgut. The mechanisms that enable trypanosomes to cross this barrier are currently unknown. Here, we determined that as parasites enter the tsetse’s gut, VSG molecules released from trypanosomes are internalized by cells of the cardia—the tissue responsible for producing the PM. VSG internalization results in decreased expression of a tsetse microRNA (mir-275) and interferes with the Wnt-signaling pathway and the Iroquois/IRX transcription factor family. This interference reduces the function of the PM barrier and promotes parasite colonization of the gut early in the infection process. Manipulation of the insect midgut homeostasis by the mammalian parasite coat proteins is a novel function and indicates that VSG serves a dual role in trypanosome biology—that of facilitating transmission through its mammalian host and insect vector. We detail critical steps in the course of trypanosome infection establishment that can serve as novel targets to reduce the tsetse’s vector competence and disease transmission. PMID:27185908

  18. A conserved flagellar pocket exposed high mannose moiety is used by African trypanosomes as a host cytokine binding molecule.

    PubMed

    Magez, S; Radwanska, M; Stijlemans, B; Xong, H V; Pays, E; De Baetselier, P

    2001-09-07

    Trypanosomes use antigenic variation of their variant-specific surface glycoprotein (VSG) coat as defense against the host immune system. However, in order to sustain their growth, they need to expose conserved epitopes, allowing host macromolecule binding and receptor-mediated endocytosis. Here we show that Trypanosoma brucei uses the conserved chitobiose-oligomannose (GlcNAc(2)-Man(5-9)) moieties of its VSG as a binding ligand for tumor necrosis factor (TNF), a host cytokine with lectin-like properties. As endocytosis in trypanosomes is restricted to the flagellar pocket, we show that soluble flagellar pocket extracts, and in particular soluble VSG, inhibit the binding of (125)I-TNF to trypanosomes. The interaction between TNF and VSG is confirmed by affinity chromatography, biosensor, and dot-blot affinity measurements, and soluble VSG inhibition of TNF-mediated trypanolysis. In all approaches, removal of N-linked carbohydrates abrogates the TNF-VSG interaction. In addition, synthetic high mannose oligosaccharides can block TNF-VSG interactions, and a VSG glycopeptide carrying the GlcNAc(2)-Man(5-9) moiety is shown to inhibit TNF-mediated trypanosome killing in mixed parasite/macrophage cell cultures. Together, these results support the observation that TNF plays a role in growth control of trypanosomes and, moreover, suggest that, by the use of conserved VSG carbohydrates as lectin-binding epitopes, trypanosomes can limit the necessity to express large numbers of invariant surface exposed receptors.

  19. Myristate exchange in glycolipid A and VSG of African trypanosomes.

    PubMed

    Buxbaum, L U

    1994-02-01

    The variant surface glycoprotein (VSG) of T. brucei is anchored to the plasma membrane via a glycosylphosphatidylinositol (GPI) anchor which is unique in that its fatty acids are exclusively myristate (a fourteen carbon saturated fatty acid). We showed that the myristate is added to the GPI precursor in a remodeling reaction involving deacylation and reacylation. We now demonstrate that trypanosomes have a second pathway of myristoylation for GPI anchors that we call "myristate exchange" which is distinct from the fatty acid remodeling pathway. We propose that this is an exchange of [3H]myristate into both sn-1 and sn-2 positions of glycolipid A, which already contains myristate, and have demonstrated this using inhibitors and a variety of other methods. We have partially characterized myristate exchange with respect to specificity and susceptibility to some inhibitors. The apparent Km for myristoyl CoA is 7 nM. This myristate-specific process may represent a proof-reading system to ensure that the fatty acids on VSG are exclusively myristate. Although myristate exchange was first discovered for glycolipid A, we now believe that VSG is the true substrate of this reaction. VSG is efficiently labeled by exchange in the presence of cycloheximide, which prevents anchoring of newly synthesized protein. Although its location is not yet known, we have evidence that exchange does not localize to either the endoplasmic reticulum or the plasma membrane. We will present data indicating that surface VSG may be internalized and undergo myristate exchange.

  20. Purification of the Alpha Glycerophosphate Oxidase from African Trypanosomes

    DTIC Science & Technology

    1989-10-28

    development of several African and South American countries. African trypanosomiasis is ranked among the top six tropical diseases selected for scientific...This enzyme is therefore of interest as a possible target for drug chemotherapy . At present only suramin and organic arsenicals remain as the mainstay...of chemotherapy , despite their many dangerous disadvantages. With the use of a fast protein liquid chromatography (FPLC) system and a Mono Q anion

  1. Antigenic variation in African trypanosomes: the importance of chromosomal and nuclear context in VSG expression control.

    PubMed

    Glover, Lucy; Hutchinson, Sebastian; Alsford, Sam; McCulloch, Richard; Field, Mark C; Horn, David

    2013-12-01

    African trypanosomes are lethal human and animal parasites that use antigenic variation for evasion of host adaptive immunity. To facilitate antigenic variation, trypanosomes dedicate approximately one third of their nuclear genome, including many minichromosomes, and possibly all sub-telomeres, to variant surface glycoprotein (VSG) genes and associated sequences. Antigenic variation requires transcription of a single VSG by RNA polymerase I (Pol-I), with silencing of other VSGs, and periodic switching of the expressed gene, typically via DNA recombination with duplicative translocation of a new VSG to the active site. Thus, telomeric location, epigenetic controls and monoallelic transcription by Pol-I at an extranucleolar site are prominent features of VSGs and their expression, with telomeres, chromatin structure and nuclear organization all making vitally important contributions to monoallelic VSG expression control and switching. We discuss VSG transcription, recombination and replication control within this chromosomal and sub-nuclear context.

  2. Trypanosoma vivax: mechanical transmission in cattle by one of the most common African tabanids, Atylotus agrestis.

    PubMed

    Desquesnes, Marc; Dia, Mamadou Lamine

    2003-01-01

    The role of mechanical vectors in the transmission of African livestock trypanosomes has always been controversial relative to tsetse flies, their cyclical vectors. An experiment was carried out in Burkina Faso to demonstrate mechanical transmission of Trypanosoma vivax by one of the most common tabanids in Africa: Atylotus agrestis. Eight heifers (crossbred zebuxBaoulé), free of trypanosome infection, were kept in a corral covered by a mosquito net, together with two heifers infected experimentally with a local stock of T. vivax. On average, 324 A. agrestis, freshly captured with Nzi traps, were introduced daily over 20 days. Parasitological, PCR and serological examinations were carried out regularly to assess infections and levels of parasitaemia. Microscopic examination of buffy-coats indicated that five of the eight receiver-heifers were infected on days 8, 13, 32, 41, and 48. PCR results indicated that these five heifers were already infected by day 13. Mechanical transmission of T. vivax by A. agrestis was demonstrated unequivocally, at a high rate (63% in 13-20 days). Conditions of transmission in this experiment are discussed in terms of natural rates of challenge. The importance of tabanids as mechanical vectors of T. vivax should be re-considered, in light of these results. Creation of tsetse free zones in Africa will generally lead to the disappearance of T. congolense, T. brucei, and most often T. vivax as well; however, in areas where T. vivax can be mechanically transmitted, clearance of tsetse may not be sufficient to eradicate livestock trypanosomosis.

  3. How Does the VSG Coat of Bloodstream Form African Trypanosomes Interact with External Proteins?

    PubMed

    Schwede, Angela; Macleod, Olivia J S; MacGregor, Paula; Carrington, Mark

    2015-12-01

    Variations on the statement "the variant surface glycoprotein (VSG) coat that covers the external face of the mammalian bloodstream form of Trypanosoma brucei acts a physical barrier" appear regularly in research articles and reviews. The concept of the impenetrable VSG coat is an attractive one, as it provides a clear model for understanding how a trypanosome population persists; each successive VSG protects the plasma membrane and is immunologically distinct from previous VSGs. What is the evidence that the VSG coat is an impenetrable barrier, and how do antibodies and other extracellular proteins interact with it? In this review, the nature of the extracellular surface of the bloodstream form trypanosome is described, and past experiments that investigated binding of antibodies and lectins to trypanosomes are analysed using knowledge of VSG sequence and structure that was unavailable when the experiments were performed. Epitopes for some VSG monoclonal antibodies are mapped as far as possible from previous experimental data, onto models of VSG structures. The binding of lectins to some, but not to other, VSGs is revisited with more recent knowledge of the location and nature of N-linked oligosaccharides. The conclusions are: (i) Much of the variation observed in earlier experiments can be explained by the identity of the individual VSGs. (ii) Much of an individual VSG is accessible to antibodies, and the barrier that prevents access to the cell surface is probably at the base of the VSG N-terminal domain, approximately 5 nm from the plasma membrane. This second conclusion highlights a gap in our understanding of how the VSG coat works, as several plasma membrane proteins with large extracellular domains are very unlikely to be hidden from host antibodies by VSG.

  4. Leaky transcription of variant surface glycoprotein gene expression sites in bloodstream african trypanosomes.

    PubMed

    Alarcon, C M; Pedram, M; Donelson, J E

    1999-06-11

    Trypanosoma brucei undergoes antigenic variation by periodically switching the expression of its variant surface glycoprotein (VSG) genes (vsg) among an estimated 20-40 telomere-linked expression sites (ES), only one of which is fully active at a given time. We found that in bloodstream trypanosomes one ES is transcribed at a high level and other ESs are expressed at low levels, resulting in organisms containing one abundant VSG mRNA and several rare VSG RNAs. Some of the rare VSG mRNAs come from monocistronic ESs in which the promoters are situated about 2 kilobases upstream of the vsg, in contrast to the polycistronic ESs in which the promoters are located 45-60 kilobases upstream of the vsg. The monocistronic ES containing the MVAT4 vsg does not include the ES-associated genes (esag) that occur between the promoter and the vsg in polycistronic ESs. However, bloodstream MVAT4 trypanosomes contain the mRNAs for many different ESAGs 6 and 7 (transferrin receptors), suggesting that polycistronic ESs are partially active in this clone. To explain these findings, we propose a model in which both mono- and polycistronic ESs are controlled by a similar mechanism throughout the parasite's life cycle. Certain VSGs are preferentially expressed in metacyclic versus bloodstream stages as a result of differences in ESAG expression and the proximity of the promoters to the vsg and telomere.

  5. The Dithiol Glutaredoxins of African Trypanosomes Have Distinct Roles and Are Closely Linked to the Unique Trypanothione Metabolism*

    PubMed Central

    Ceylan, Sevgi; Seidel, Vera; Ziebart, Nicole; Berndt, Carsten; Dirdjaja, Natalie; Krauth-Siegel, R. Luise

    2010-01-01

    Trypanosoma brucei, the causative agent of African sleeping sickness, possesses two dithiol glutaredoxins (Grx1 and Grx2). Grx1 occurs in the cytosol and catalyzes protein deglutathionylations with kcat/Km-values of up to 2 × 105 m−1 s−1. It accelerates the reduction of ribonucleotide reductase by trypanothione although less efficiently than the parasite tryparedoxin and has low insulin disulfide reductase activity. Despite its classical CPYC active site, Grx1 forms dimeric iron-sulfur complexes with GSH, glutathionylspermidine, or trypanothione as non-protein ligands. Thus, contrary to the generally accepted assumption, replacement of the Pro is not a prerequisite for cluster formation. T. brucei Grx2 shows an unusual CQFC active site, and orthologues occur exclusively in trypanosomatids. Grx2 is enriched in mitoplasts, and fractionated digitonin lysis resulted in a co-elution with cytochrome c, suggesting localization in the mitochondrial intermembrane space. Grx2 catalyzes the reduction of insulin disulfide but not of ribonucleotide reductase and exerts deglutathionylation activity 10-fold lower than that of Grx1. RNA interference against Grx2 caused a growth retardation of procyclic cells consistent with an essential role. Grx1 and Grx2 are constitutively expressed with cellular concentrations of about 2 μm and 200 nm, respectively, in both the mammalian bloodstream and insect procyclic forms. Trypanothione reduces the disulfide form of both proteins with apparent rate constants that are 3 orders of magnitude higher than those with glutathione. Grx1 and, less efficiently, also Grx2 catalyze the reduction of GSSG by trypanothione. Thus, the Grxs play exclusive roles in the trypanothione-based thiol redox metabolism of African trypanosomes. PMID:20826822

  6. The putative promoter for a metacyclic VSG gene in African trypanosomes.

    PubMed

    Nagoshi, Y L; Alarcon, C M; Donelson, J E

    1995-06-01

    During their metacyclic developmental stage, African trypanosomes are coated with one of 12-15 variant surface glycoproteins (VSGs) that define different metacyclic variant antigen types (MVATs). The MVAT VSG genes are located near telomeres of large chromosomes and are expressed without rearrangement in the metacyclic stage. We have cloned and examined the telomere-linked MVAT5 VSG gene and its upstream expression site associated gene (ESAG I) which are separated by 4.5 kb. Within this 4.5-kb intergenic region is an 87-bp sequence that serves as a strong promoter for a luciferase reporter gene in transient transfection assays. This 87-bp sequence is similar, but not identical, to the promoter for another MVAT VSG gene. UV irradiation experiments were used to detect RNA synthesis from this MVAT5 promoter in bloodstream trypanosomes expressing an unrelated VSG. We propose that this sequence is a specific promoter for the MVAT5 VSG mRNA that occurs in about 10% of the trypanosome population during the metacyclic stage of the parasites' life cycle.

  7. Biological variation among african trypanosomes: I. Clonal expression of virulence is not linked to the variant surface glycoprotein or the variant surface glycoprotein gene telomeric expression site.

    PubMed

    Inverso, Jill A; Uphoff, Timothy S; Johnson, Scott C; Paulnock, Donna M; Mansfield, John M

    2010-05-01

    The potential association of variant surface glycoprotein (VSG) gene expression with clonal expression of virulence in African trypanosomes was addressed. Two populations of clonally related trypanosomes, which differ dramatically in virulence for the infected host, but display the same apparent VSG surface coat phenotype, were characterized with respect to the VSG genes expressed as well as the chromosome telomeric expression sites (ES) utilized for VSG gene transcription. The VSG gene sequences expressed by clones LouTat 1 and LouTat 1A of Trypanosoma brucei rhodesiense were identical, and gene expression in both clones occurred precisely by the same gene conversion events (duplication and transposition), which generated an expression-linked copy (ELC) of the VSG gene. The ELC was present on the same genomic restriction fragments in both populations and resided in the telomere of a 330-kb chromosome; a single basic copy of the LouTat 1/1A VSG gene, present in all variants of the LouTat 1 serodeme, was located at an internal site of a 1.5-Mb chromosome. Restriction endonuclease mapping of the ES telomere revealed that the VSG ELC of clones LouTat 1 and 1A resides in the same site. Therefore, these findings provide evidence that the VSG gene ES and, potentially, any cotranscribed ES-associated genes do not play a role in the clonal regulation of virulence because trypanosome clones LouTat 1 and 1A, which differ markedly in their virulence properties, both express identical VSG genes from the same chromosome telomeric ES.

  8. An Alternative Model for the Role of RP2 Protein in Flagellum Assembly in the African Trypanosome*

    PubMed Central

    Andre, Jane; Kerry, Louise; Qi, Xin; Hawkins, Erica; Drižytė, Kristina; Ginger, Michael L.; McKean, Paul G.

    2014-01-01

    The tubulin cofactor C domain-containing protein TbRP2 is a basal body (centriolar) protein essential for axoneme formation in the flagellate protist Trypanosoma brucei, the causal agent of African sleeping sickness. Here, we show how TbRP2 is targeted and tethered at mature basal bodies and provide novel insight into TbRP2 function. Regarding targeting, understanding how several hundred proteins combine to build a microtubule axoneme is a fundamental challenge in eukaryotic cell biology. We show that basal body localization of TbRP2 is mediated by twinned, N-terminal TOF (TON1, OFD1, and FOP) and LisH motifs, motifs that otherwise facilitate localization of only a few conserved proteins at microtubule-organizing centers in animals, plants, and flagellate protists. Regarding TbRP2 function, there is a debate as to whether the flagellar assembly function of specialized, centriolar tubulin cofactor C domain-containing proteins is processing tubulin, the major component of axonemes, or general vesicular trafficking in a flagellum assembly context. Here we report that TbRP2 is required for the recruitment of T. brucei orthologs of MKS1 and MKS6, proteins that, in animal cells, are part of a complex that assembles at the base of the flagellum to regulate protein composition and cilium function. We also identify that TbRP2 is detected by YL1/2, an antibody classically used to detect α-tubulin. Together, these data suggest a general processing role for TbRP2 in trypanosome flagellum assembly and challenge the notion that TbRP2 functions solely in assessing tubulin “quality” prior to tubulin incorporation into the elongating axoneme. PMID:24257747

  9. Nucleosomes are depleted at the VSG expression site transcribed by RNA polymerase I in African trypanosomes.

    PubMed

    Figueiredo, Luisa M; Cross, George A M

    2010-01-01

    In most eukaryotes, RNA polymerase I (Pol I) exclusively transcribes long arrays of identical rRNA genes (ribosomal DNA [rDNA]). African trypanosomes have the unique property of using Pol I to also transcribe the variant surface glycoprotein VSG genes. VSGs are important virulence factors because their switching allows trypanosomes to escape the host immune system, a mechanism known as antigenic variation. Only one VSG is transcribed at a time from one of 15 bloodstream-form expression sites (BESs). Although it is clear that switching among BESs does not involve DNA rearrangements and that regulation is probably epigenetic, it remains unknown why BESs are transcribed by Pol I and what roles are played by chromatin structure and histone modifications. Using chromatin immunoprecipitation, micrococcal nuclease digestion, and chromatin fractionation, we observed that there are fewer nucleosomes at the active BES and that these are irregularly spaced compared to silent BESs. rDNA coding regions are also depleted of nucleosomes, relative to the rDNA spacer. In contrast, genes transcribed by Pol II are organized in a more compact, regularly spaced, nucleosomal structure. These observations provide new insight on antigenic variation by showing that chromatin remodeling is an intrinsic feature of BES regulation.

  10. Trypanosoma livingstonei: a new species from African bats supports the bat seeding hypothesis for the Trypanosoma cruzi clade

    PubMed Central

    2013-01-01

    Background Bat trypanosomes have been implicated in the evolutionary history of the T. cruzi clade, which comprises species from a wide geographic and host range in South America, Africa and Europe, including bat-restricted species and the generalist agents of human American trypanosomosis T. cruzi and T. rangeli. Methods Trypanosomes from bats (Rhinolophus landeri and Hipposideros caffer) captured in Mozambique, southeast Africa, were isolated by hemoculture. Barcoding was carried out through the V7V8 region of Small Subunit (SSU) rRNA and Fluorescent Fragment Length barcoding (FFLB). Phylogenetic inferences were based on SSU rRNA, glyceraldehyde phosphate dehydrogenase (gGAPDH) and Spliced Leader (SL) genes. Morphological characterization included light, scanning and transmission electron microscopy. Results New trypanosomes from bats clustered together forming a clade basal to a larger assemblage called the T. cruzi clade. Barcoding, phylogenetic analyses and genetic distances based on SSU rRNA and gGAPDH supported these trypanosomes as a new species, which we named Trypanosoma livingstonei n. sp. The large and highly polymorphic SL gene repeats of this species showed a copy of the 5S ribosomal RNA into the intergenic region. Unique morphological (large and broad blood trypomastigotes compatible to species of the subgenus Megatrypanum and cultures showing highly pleomorphic epimastigotes and long and slender trypomastigotes) and ultrastructural (cytostome and reservosomes) features and growth behaviour (when co-cultivated with HeLa cells at 37°C differentiated into trypomastigotes resembling the blood forms and do not invaded the cells) complemented the description of this species. Conclusion Phylogenetic inferences supported the hypothesis that Trypanosoma livingstonei n. sp. diverged from a common ancestral bat trypanosome that evolved exclusively in Chiroptera or switched at independent opportunities to mammals of several orders forming the clade T. cruzi

  11. Zoonotic trypanosomes in South East Asia: Attempts to control Trypanosoma lewisi using veterinary drugs.

    PubMed

    Desquesnes, Marc; Yangtara, Sarawut; Kunphukhieo, Pawinee; Chalermwong, Piangjai; Jittapalapong, Sathaporn; Herder, Stéphane

    2016-06-01

    A growing number of atypical human infections due to the livestock parasite Trypanosoma evansi, or to the rat parasite Trypanosoma lewisi, are reported in humans in Asia. In some cases, clinical evolutions request treatments, however, so far, there were very few attempts to control T. lewisi using trypanocidal drugs. In a study published elsewhere, the efficacy of human trypanocides is evaluated in laboratory rats, and it concludes that none of them is able to cure rats experimentally infected with T. lewisi. Control of T. lewisi in rat would be a step for identification of drugs against this parasite. In the present study, 4 veterinary drugs: diminazene aceturate, isometamidium chloride, melarsomine hydrochloride and quinapyramine sulfate and chloride, were evaluated at low and high doses, in intra-muscular injections to normal rats experimentally infected with a stock of T. lewisi from Thailand. None of these treatments being efficient, a trial was also made using melarsomine hydrochloride in T. evansi infected rats and in mixed T. lewisi and T. evansi infected rats, in order to demonstrate the efficacy of the drugs under the present protocol. T. evansi was cleared from the rat's blood the day after the treatment, while, T. lewisi remained unaffected until the end of the experiment. These observations clearly demonstrated the efficacy of melarsomine hydrochloride against T. evansi and its inefficacy against T. lewisi. In conclusion none of the veterinary drugs was efficient against this stock of T. lewisi. Other protocols using higher doses or other drugs and T. lewisi stocks should be investigated in further studies. The control of T. lewisi infection in Wistar rats, using veterinary trypanocidal drugs, remains so far unsuccessful.

  12. Mechanical transmission of Trypanosoma vivax in cattle by the African tabanid Atylotus fuscipes.

    PubMed

    Desquesnes, Marc; Dia, Mamadou Lamine

    2004-01-05

    An experiment was carried out in Burkina Faso to evaluate the potential for mechanical transmission of Trypanosoma vivax by the African tabanid Atylotus fuscipes. The experiment was carried out in a corral (10 m x 10 m) completely covered by a mosquito net (12 m x 12 m and 2.5m high). Eight heifers (cross-bred Zebu X Baoulé), free of trypanosome infection, were kept together with two heifers experimentally infected with a local stock of T. vivax. An average of 539 A. fuscipes per day, freshly captured with two Nzi traps, were introduced into the mosquito net from Day 1 to 20, to allow mechanical transmission of the parasites among cattle. Daily parasitological examinations (BCM) of cattle blood samples indicated that six of the eight receiver heifers were positive from days 9, 10, 15, 16, 19 and 29. Mechanical transmission of T. vivax by A. fuscipes was demonstrated unequivocally in close to natural conditions, at a high rate (75% incidence over a 20-day period) under a mean challenge of 54 insects per heifer per day. These results, in addition to previous demonstration of mechanical transmission of T. vivax by Atylotus agrestis, confirm that mechanical transmission can be a significant route of infection.

  13. Modulation of the Surface Proteome through Multiple Ubiquitylation Pathways in African Trypanosomes

    PubMed Central

    Alsford, Sam; Horn, David; Field, Mark C.

    2015-01-01

    Recently we identified multiple suramin-sensitivity genes with a genome wide screen in Trypanosoma brucei that includes the invariant surface glycoprotein ISG75, the adaptin-1 (AP-1) complex and two deubiquitylating enzymes (DUBs) orthologous to ScUbp15/HsHAUSP1 and pVHL-interacting DUB1 (type I), designated TbUsp7 and TbVdu1, respectively. Here we have examined the roles of these genes in trafficking of ISG75, which appears key to suramin uptake. We found that, while AP-1 does not influence ISG75 abundance, knockdown of TbUsp7 or TbVdu1 leads to reduced ISG75 abundance. Silencing TbVdu1 also reduced ISG65 abundance. TbVdu1 is a component of an evolutionarily conserved ubiquitylation switch and responsible for rapid receptor modulation, suggesting similar regulation of ISGs in T. brucei. Unexpectedly, TbUsp7 knockdown also blocked endocytosis. To integrate these observations we analysed the impact of TbUsp7 and TbVdu1 knockdown on the global proteome using SILAC. For TbVdu1, ISG65 and ISG75 are the only significantly modulated proteins, but for TbUsp7 a cohort of integral membrane proteins, including the acid phosphatase MBAP1, that is required for endocytosis, and additional ISG-related proteins are down-regulated. Furthermore, we find increased expression of the ESAG6/7 transferrin receptor and ESAG5, likely resulting from decreased endocytic activity. Therefore, multiple ubiquitylation pathways, with a complex interplay with trafficking pathways, control surface proteome expression in trypanosomes. PMID:26492041

  14. Repertoire, Genealogy and Genomic Organization of Cruzipain and Homologous Genes in Trypanosoma cruzi, T. cruzi-Like and Other Trypanosome Species

    PubMed Central

    Lima, Luciana; Ortiz, Paola A.; da Silva, Flávia Maia; Alves, João Marcelo P.; Serrano, Myrna G.; Cortez, Alane P.; Alfieri, Silvia C.; Buck, Gregory A.; Teixeira, Marta M. G.

    2012-01-01

    Trypanosoma cruzi, the agent of Chagas disease, is a complex of genetically diverse isolates highly phylogenetically related to T. cruzi-like species, Trypanosoma cruzi marinkellei and Trypanosoma dionisii, all sharing morphology of blood and culture forms and development within cells. However, they differ in hosts, vectors and pathogenicity: T. cruzi is a human pathogen infective to virtually all mammals whilst the other two species are non-pathogenic and bat restricted. Previous studies suggest that variations in expression levels and genetic diversity of cruzipain, the major isoform of cathepsin L-like (CATL) enzymes of T. cruzi, correlate with levels of cellular invasion, differentiation, virulence and pathogenicity of distinct strains. In this study, we compared 80 sequences of genes encoding cruzipain from 25 T. cruzi isolates representative of all discrete typing units (DTUs TcI-TcVI) and the new genotype Tcbat and 10 sequences of homologous genes from other species. The catalytic domain repertoires diverged according to DTUs and trypanosome species. Relatively homogeneous sequences are found within and among isolates of the same DTU except TcV and TcVI, which displayed sequences unique or identical to those of TcII and TcIII, supporting their origin from the hybridization between these two DTUs. In network genealogies, sequences from T. cruzi clustered tightly together and closer to T. c. marinkellei than to T. dionisii and largely differed from homologues of T. rangeli and T. b. brucei. Here, analysis of isolates representative of the overall biological and genetic diversity of T. cruzi and closest T. cruzi-like species evidenced DTU- and species-specific polymorphisms corroborating phylogenetic relationships inferred with other genes. Comparison of both phylogenetically close and distant trypanosomes is valuable to understand host-parasite interactions, virulence and pathogenicity. Our findings corroborate cruzipain as valuable target for drugs, vaccine

  15. Repertoire, genealogy and genomic organization of cruzipain and homologous genes in Trypanosoma cruzi, T. cruzi-like and other trypanosome species.

    PubMed

    Lima, Luciana; Ortiz, Paola A; da Silva, Flávia Maia; Alves, João Marcelo P; Serrano, Myrna G; Cortez, Alane P; Alfieri, Silvia C; Buck, Gregory A; Teixeira, Marta M G

    2012-01-01

    Trypanosoma cruzi, the agent of Chagas disease, is a complex of genetically diverse isolates highly phylogenetically related to T. cruzi-like species, Trypanosoma cruzi marinkellei and Trypanosoma dionisii, all sharing morphology of blood and culture forms and development within cells. However, they differ in hosts, vectors and pathogenicity: T. cruzi is a human pathogen infective to virtually all mammals whilst the other two species are non-pathogenic and bat restricted. Previous studies suggest that variations in expression levels and genetic diversity of cruzipain, the major isoform of cathepsin L-like (CATL) enzymes of T. cruzi, correlate with levels of cellular invasion, differentiation, virulence and pathogenicity of distinct strains. In this study, we compared 80 sequences of genes encoding cruzipain from 25 T. cruzi isolates representative of all discrete typing units (DTUs TcI-TcVI) and the new genotype Tcbat and 10 sequences of homologous genes from other species. The catalytic domain repertoires diverged according to DTUs and trypanosome species. Relatively homogeneous sequences are found within and among isolates of the same DTU except TcV and TcVI, which displayed sequences unique or identical to those of TcII and TcIII, supporting their origin from the hybridization between these two DTUs. In network genealogies, sequences from T. cruzi clustered tightly together and closer to T. c. marinkellei than to T. dionisii and largely differed from homologues of T. rangeli and T. b. brucei. Here, analysis of isolates representative of the overall biological and genetic diversity of T. cruzi and closest T. cruzi-like species evidenced DTU- and species-specific polymorphisms corroborating phylogenetic relationships inferred with other genes. Comparison of both phylogenetically close and distant trypanosomes is valuable to understand host-parasite interactions, virulence and pathogenicity. Our findings corroborate cruzipain as valuable target for drugs, vaccine

  16. Trypanosomes of Australian mammals: A review.

    PubMed

    Thompson, Craig K; Godfrey, Stephanie S; Thompson, R C Andrew

    2014-08-01

    Approximately 306 species of terrestrial and arboreal mammals are known to have inhabited the mainland and coastal islands of Australia at the time of European settlement in 1788. The exotic Trypanosoma lewisi was the first mammalian trypanosome identified in Australia in 1888, while the first native species, Trypanosoma pteropi, was taxonomically described in 1913. Since these discoveries, about 22% of the indigenous mammalian fauna have been examined during the surveillance of trypanosome biodiversity in Australia, including 46 species of marsupials, 9 rodents, 9 bats and both monotremes. Of those mammals examined, trypanosomes have been identified from 28 host species, with eight native species of Trypanosoma taxonomically described. These native trypanosomes include T. pteropi, Trypanosoma thylacis, Trypanosoma hipposideri, Trypanosoma binneyi, Trypanosoma irwini, Trypanosoma copemani, Trypanosoma gilletti and Trypanosoma vegrandis. Exotic trypanosomes have also been identified from the introduced mammalian fauna of Australia, and include T. lewisi, Trypanosoma melophagium, Trypanosoma theileri, Trypanosoma nabiasi and Trypanosoma evansi. Fortunately, T. evansi was eradicated soon after its introduction and did not establish in Australia. Of these exotic trypanosomes, T. lewisi is the sole representative that has been reported from indigenous Australian mammals; morphological forms were recorded from two indigenous species of rodents (Hydromys chrysogaster and Rattus fuscipes). Numerous Australian marsupial species are potentially at risk from the native T. copemani, which may be chronically pathogenic, while marsupials, rodents and monotremes appear at risk from exotic species, including T. lewisi, Trypanosoma cruzi and T. evansi. This comprehensive review of trypanosome biodiversity in Australia highlights the negative impact of these parasites upon their mammalian hosts, as well as the threatening biosecurity concerns.

  17. Trypanosomes of Australian mammals: A review

    PubMed Central

    Thompson, Craig K.; Godfrey, Stephanie S.; Thompson, R.C. Andrew

    2014-01-01

    Approximately 306 species of terrestrial and arboreal mammals are known to have inhabited the mainland and coastal islands of Australia at the time of European settlement in 1788. The exotic Trypanosoma lewisi was the first mammalian trypanosome identified in Australia in 1888, while the first native species, Trypanosoma pteropi, was taxonomically described in 1913. Since these discoveries, about 22% of the indigenous mammalian fauna have been examined during the surveillance of trypanosome biodiversity in Australia, including 46 species of marsupials, 9 rodents, 9 bats and both monotremes. Of those mammals examined, trypanosomes have been identified from 28 host species, with eight native species of Trypanosoma taxonomically described. These native trypanosomes include T. pteropi, Trypanosoma thylacis, Trypanosoma hipposideri, Trypanosoma binneyi, Trypanosoma irwini, Trypanosoma copemani, Trypanosoma gilletti and Trypanosoma vegrandis. Exotic trypanosomes have also been identified from the introduced mammalian fauna of Australia, and include T. lewisi, Trypanosoma melophagium, Trypanosoma theileri, Trypanosoma nabiasi and Trypanosoma evansi. Fortunately, T. evansi was eradicated soon after its introduction and did not establish in Australia. Of these exotic trypanosomes, T. lewisi is the sole representative that has been reported from indigenous Australian mammals; morphological forms were recorded from two indigenous species of rodents (Hydromys chrysogaster and Rattus fuscipes). Numerous Australian marsupial species are potentially at risk from the native T. copemani, which may be chronically pathogenic, while marsupials, rodents and monotremes appear at risk from exotic species, including T. lewisi, Trypanosoma cruzi and T. evansi. This comprehensive review of trypanosome biodiversity in Australia highlights the negative impact of these parasites upon their mammalian hosts, as well as the threatening biosecurity concerns. PMID:25161902

  18. Evidence for an interplay between cell cycle progression and the initiation of differentiation between life cycle forms of African trypanosomes

    PubMed Central

    1994-01-01

    Successful transmission of the African trypanosome between the mammalian host blood-stream and the tsetse fly vector involves dramatic alterations in the parasite's morphology and biochemistry. This differentiation through to the tsetse midgut procyclic form is accompanied by re-entry into a proliferative cell cycle. Using a synchronous differentiation model and a variety of markers diagnostic for progress through both differentiation and the cell cycle, we have investigated the interplay between these two processes. Our results implicate a relationship between the trypanosome cell cycle position and the perception of the differentiation signal and demonstrate that irreversible commitment to the differentiation occurs rapidly after induction. Furthermore, we show that re-entry into the cell cycle in the differentiating population is synchronous, and that once initiated, progress through the differentiation pathway can be uncoupled from progress through the cell cycle. PMID:8195296

  19. Trypanosoma naviformis sp. nov. (Kinetoplastidae: Trypanosomatidae) from widespread African songbirds, the Olive sunbird (Cyanomitra olivacea) and Yellow-whiskered greenbul (Andropadus latirostris).

    PubMed

    Sehgal, Ravinder N M; Iezhova, Tatjana A; Marzec, Timothy; Valkiūnas, Gediminas

    2015-10-29

    Trypanosoma naviformis n. sp. is described from the African olive sunbird Cyanomitra olivacea in Ghana based on the morphology of its hematozoic trypomastigotes and partial sequences of the small subunit ribosomal RNA gene. This parasite belongs to the group of small non-striated avian trypanosomes (< 30 µm in length in average) with the kinetoplast situated close to the posterior end of the body. Trypanosoma naviformis can be distinguished from other small avian trypanosomes due to its poorly visible flagellum, central position of its nucleus, and the symmetrically (in relation to the nucleus) narrowing of both ends of the hematozoic trypomastigotes, which are boat-like in shape. Illustrations of trypomastigotes of the new species are given, and SSU rDNA lineages associated with this parasite are documented. This parasite has been reported in Ghana and Cameroon and was also found in the yellow-whiskered greenbul, Andropadus latirostris in these countries. It appears to be widespread in its range given the distribution of these bird species in Africa.

  20. The response of trypanosomes and other eukaryotes to ER stress and the spliced leader RNA silencing (SLS) pathway in Trypanosoma brucei.

    PubMed

    Michaeli, Shulamit

    2015-01-01

    The unfolded protein response (UPR) is induced when the quality control machinery of the cell is overloaded with unfolded proteins or when one of the functions of the endoplasmic reticulum (ER) is perturbed. Here, I describe UPR in yeast and mammals, and compare it to what we know about pathogenic fungi and the parasitic protozoans from the order kinetoplastida, focusing on the novel pathway the spliced leader silencing (SLS) in Trypanosoma brucei. Trypanosomes lack conventional transcription regulation, and thus, lack most of the UPR machinery present in other eukaryotes. Trypanosome genes are transcribed in polycistronic units that are processed by trans-splicing and polyadenylation. In trans-splicing, which is essential for processing of each mRNA, an exon known as the spliced leader (SL) is added to all mRNAs from a small RNA, the SL RNA. Under severe ER stress, T. brucei elicits the SLS pathway. In SLS, the transcription of the SL RNA gene is extinguished, and the entire transcription complex dissociates from the SL RNA promoter. Induction of SLS is mediated by an ER-associated kinase (PK3) that migrates to the nucleus, where it phosphorylates the TATA-binding protein (TRF4), leading shut-off of SL RNA transcription. As a result, trans-splicing is inhibited and the parasites activate a programmed cell death (PCD) pathway. Despite the ability to sense the ER stress, the different eukaryotes, especially unicellular parasites and pathogenic fungi, developed a variety of unique and different ways to sense and adjust to this stress in a manner different from their host.

  1. A Receptor’s Tale: An Eon in the Life of a Trypanosome Receptor

    PubMed Central

    Lane-Serff, Harriet; MacGregor, Paula; Carrington, Mark

    2017-01-01

    African trypanosomes have complex life cycles comprising at least ten developmental forms, variously adapted to different niches in their tsetse fly vector and their mammalian hosts. Unlike many other protozoan pathogens, they are always extracellular and have evolved intricate surface coats that allow them to obtain nutrients while also protecting them from the immune defenses of either insects or mammals. The acquisition of macromolecular nutrients requires receptors that function within the context of these surface coats. The best understood of these is the haptoglobin–hemoglobin receptor (HpHbR) of Trypanosoma brucei, which is used by the mammalian bloodstream form of the parasite, allowing heme acquisition. However, in some primates it also provides an uptake route for trypanolytic factor-1, a mediator of innate immunity against trypanosome infection. Recent studies have shown that during the evolution of African trypanosome species the receptor has diversified in function from a hemoglobin receptor predominantly expressed in the tsetse fly to a haptoglobin–hemoglobin receptor predominantly expressed in the mammalian bloodstream. Structural and functional studies of homologous receptors from different trypanosome species have allowed us to propose an evolutionary history for how one receptor has adapted to different roles in different trypanosome species. They also highlight the challenges that a receptor faces in operating on the complex trypanosome surface and show how these challenges can be met. PMID:28125726

  2. Tsetse-trypanosome interactions: rites of passage.

    PubMed

    Welburn, S C; Maudlin, I

    1999-10-01

    Trypanosomes that cause sleeping sickness (Trypanosoma brucei rhodesiense and T. b. gambiense) are entirely dependent on tsetse for their transmission between hosts, but the flies are not easily infected. This situation has not arisen by chance - the tsetse has evolved an efficient defence system against trypanosome invasion. In this review, Susan Welburn and Ian Maudlin chart the progress of trypanosomes through the fly and identify some of the hazards faced by both parasite and fly that affect vector competence of tsetse.

  3. Extracellular vesicles from Trypanosoma brucei mediate virulence factor transfer and cause host anemia

    PubMed Central

    Szempruch, Anthony J.; Sykes, Steven E.; Kieft, Rudo; Denison, Lauren; Becker, Allison C.; Gartrell, Anzio; Martin, William J.; Nakayasu, Ernesto S.; Almeida, Igor C.; Hajduk, Stephen L.; Harrington, John M.

    2015-01-01

    Intercellular communication between parasites and with host cells provides mechanisms for parasite development, immune evasion and disease pathology. Bloodstream African trypanosomes produce membranous nanotubes that originate from the flagellar membrane and disassociate into free extracellular vesicles (EVs). Trypanosome EVs contain several flagellar proteins that contribute to virulence and Trypanosoma brucei rhodesiense EVs contain the serum resistance-associated protein (SRA) necessary for human infectivity. T. b. rhodesiense EVs transfer SRA to non-human infectious trypanosomes allowing evasion of human innate immunity. Trypanosome EVs can also fuse with mammalian erythrocytes resulting in rapid erythrocyte clearance and anemia. These data indicate that trypanosome EVs are organelles mediating non-hereditary virulence factor transfer and causing host erythrocyte remodeling inducing anemia. PMID:26771494

  4. Distribution and Characterization of Antigens Found in Subcellular Fractions of African Trypanosomes

    DTIC Science & Technology

    1983-08-01

    label- led as described previously (15). In some instances trypanosomes were surface labelled using the fluorescamine-g cyclodextrin complex (12) as...interest for further investiga- tion for either vaccine use or for developing antibodies for use in targetting liposome encapsulated drugs. The flagella...product formed per minute, with standard deviations based on five determinations. Relative fluorescence for (a) free and (b) ß- cyclodextrin complexed

  5. Apolipoprotein L1 Variant Associated with Increased Susceptibility to Trypanosome Infection

    PubMed Central

    Cuypers, Bart; Lecordier, Laurence; Meehan, Conor J.; Van den Broeck, Frederik; Imamura, Hideo; Büscher, Philippe; Dujardin, Jean-Claude; Laukens, Kris; Schnaufer, Achim; Dewar, Caroline; Lewis, Michael; Balmer, Oliver; Azurago, Thomas; Kyei-Faried, Sardick; Ohene, Sally-Ann; Duah, Boateng; Homiah, Prince; Mensah, Ebenezer Kofi; Anleah, Francis; Franco, Jose Ramon; Pays, Etienne

    2016-01-01

    ABSTRACT African trypanosomes, except Trypanosoma brucei gambiense and Trypanosoma brucei rhodesiense, which cause human African trypanosomiasis, are lysed by the human serum protein apolipoprotein L1 (ApoL1). These two subspecies can resist human ApoL1 because they express the serum resistance proteins T. b. gambiense glycoprotein (TgsGP) and serum resistance-associated protein (SRA), respectively. Whereas in T. b. rhodesiense, SRA is necessary and sufficient to inhibit ApoL1, in T. b. gambiense, TgsGP cannot protect against high ApoL1 uptake, so different additional mechanisms contribute to limit this uptake. Here we report a complex interplay between trypanosomes and an ApoL1 variant, revealing important insights into innate human immunity against these parasites. Using whole-genome sequencing, we characterized an atypical T. b. gambiense infection in a patient in Ghana. We show that the infecting trypanosome has diverged from the classical T. b. gambiense strains and lacks the TgsGP defense mechanism against human serum. By sequencing the ApoL1 gene of the patient and subsequent in vitro mutagenesis experiments, we demonstrate that a homozygous missense substitution (N264K) in the membrane-addressing domain of this ApoL1 variant knocks down the trypanolytic activity, allowing the trypanosome to avoid ApoL1-mediated immunity. PMID:27073096

  6. Vitamin C biosynthesis in trypanosomes: A role for the glycosome

    PubMed Central

    Wilkinson, Shane R.; Prathalingam, S. Radhika; Taylor, Martin C.; Horn, David; Kelly, John M.

    2005-01-01

    The capacity to synthesize vitamin C (ascorbate) is widespread in eukaryotes but is absent from humans. The last step in the biosynthetic pathway involves the conversion of an aldonolactone substrate to ascorbate, a reaction catalyzed by members of an FAD-dependent family of oxidoreductases. Here we demonstrate that both the African trypanosome, Trypanosoma brucei, and the American trypanosome, Trypanosoma cruzi, have the capacity to synthesize vitamin C and show that this reaction occurs in a unique single-membrane organelle, the glycosome. The corresponding T. brucei flavoprotein (TbALO) obeys Michaelis–Menten kinetics and can utilize both l-galactono-γ-lactone and d-arabinono-γ-lactone as substrate, properties characteristic of plant and fungal enzymes. We could detect no activity toward the mammalian enzyme substrate l-gulono-γ-lactone. TbALO null mutants (bloodstream form) were found to display a transient growth defect, a trait that was enhanced when they were cultured in medium in which the essential serum component had been pretreated with ascorbate oxidase to deplete vitamin C. It is implicit, therefore, that bloodstream-form trypanosomes also possess a capacity for ascorbate transport. PMID:16087875

  7. The use of ITS1 rDNA PCR in detecting pathogenic African trypanosomes.

    PubMed

    Njiru, Z K; Constantine, C C; Guya, S; Crowther, J; Kiragu, J M; Thompson, R C A; Dávila, A M R

    2005-02-01

    There are 11 different pathogenic trypanosomes in trypanosomiasis endemic regions of Africa. Their detection and characterisation by molecular methods relies on species-specific primers; consequently several PCR tests have to be made on each sample. Primers ITS1 CF and ITS1 BR, previously designed to amplify the internal transcribed spacer (ITS1) of rDNA, have been evaluated for use in a universal diagnostic test for all pathogenic trypanosomes. Blood was collected from 373 cattle and 185 camels. The primers gave constant PCR products with the stocks of each taxon tested. Members of subgenus Trypanozoon (T. brucei brucei, T. evansi, T. b. rhodesiense and T. b. gambiense) gave a constant product of approximately 480 bp; T. congolense, savannah 700 bp, T. congolense kilifi 620 bp and T. congolense forest 710 bp: T. simiae 400 bp, T. simiae tsavo 370 bp, T. godfreyi 300 bp and T. vivax 250 bp. The sensitivity of the test ranged from 10 pg for Trypanozoon, T. congolense clade and T. vivax to 100 pg for T. simiae and T. godfreyi. The primers detected cases of multi-taxa samples, although the sensitivity was reduced with an increase in the combinations. A better detection rate of trypanosome DNA was recorded with buffy coats than from direct blood. With the field samples, the diagnostic sensitivity was close to the sensitivity obtained using single reactions with species-specific primers for Trypanozoon 38/40 (95%) and T. congolense savannah 30/33 (90.9%) but was lower with T. vivax 25/31 (77.4%). The primers offer promise as a routine diagnostic tool through the use of a single PCR; however, further evaluation is recommended.

  8. Massive screening yields novel and selective Trypanosoma cruzi triosephosphate isomerase dimer-interface-irreversible inhibitors with anti-trypanosomal activity.

    PubMed

    Alvarez, Guzmán; Aguirre-López, Beatriz; Varela, Javier; Cabrera, Mauricio; Merlino, Alicia; López, Gloria V; Lavaggi, María Laura; Porcal, Williams; Di Maio, Rossanna; González, Mercedes; Cerecetto, Hugo; Cabrera, Nallely; Pérez-Montfort, Ruy; de Gómez-Puyou, Marieta Tuena; Gómez-Puyou, Armando

    2010-12-01

    Triosephosphate isomerase from Trypanosoma cruzi (TcTIM), an enzyme in the glycolytic pathway that exhibits high catalytic rates of glyceraldehyde-3-phosphate- and dihydroxyacetone-phosphate-isomerization only in its dimeric form, was screened against an in-house chemical library containing nearly 230 compounds belonging to different chemotypes. After secondary screening, twenty-six compounds from eight different chemotypes were identified as screening positives. Four compounds displayed selectivity for TcTIM over TIM from Homo sapiens and, concomitantly, in vitro activity against T. cruzi.

  9. Trypanosomes - versatile microswimmers

    NASA Astrophysics Data System (ADS)

    Krüger, Timothy; Engstler, Markus

    2016-11-01

    Evolution has generated a plethora of flagellate microswimmers. They populate all natural waters, from the deep sea to the ponds in our neighbourhood. But flagellates also thrive in the bodies of higher organisms, where they mostly remain undetected, but can also become pathogenic. Trypanosomes comprise a large group of mostly parasitic flagellates that cause many diseases, such as human sleeping sickness or the cattle plague nagana. We consider African trypanosomes as extremely versatile microswimmers, as they have to adapt to very diverse microenvironments. They swim efficiently in the blood of their mammalian hosts, but also in various tissue spaces and even in the human brain. Furthermore, in the transmitting tsetse fly, trypanosomes undergo characteristic morphological changes that are accompanied by amazing transitions between solitary and collective types of motion. In this review, we provide a basic introduction to trypanosome biology and then focus on the complex type of rotational movement that trypanosomes display. We relate their swimming performance to morphological parameters and the respective microenvironment, developing a contemporary view on the physics of trypanosome motility. The genetically programmed successions of life style-dependent motion patterns provide challenges and opportunities for interdisciplinary studies of microswimmers.

  10. Silencing cytokeratin 18 gene inhibits intracellular replication of Trypanosoma cruzi in HeLa cells but not binding and invasion of trypanosomes

    PubMed Central

    Claser, Carla; Curcio, Marli; de Mello, Samanta M; Silveira, Eduardo V; Monteiro, Hugo P; Rodrigues, Mauricio M

    2008-01-01

    Background As an obligatory intracellular parasite, Trypanosoma cruzi, the etiological agent of Chagas' disease, must invade and multiply within mammalian cells. Cytokeratin 18 (CK18) is among the host molecules that have been suggested as a mediator of important events during T. cruzi-host cell interaction. Based on that possibility, we addressed whether RNA interference (RNAi)-mediated down regulation of the CK18 gene could interfere with the parasite life cycle in vitro. HeLa cells transiently transfected with CK18-RNAi had negligible levels of CK18 transcripts, and significantly reduced levels of CK18 protein expression as determined by immunoblotting or immunofluorescence. Results CK18 negative or positive HeLa cells were invaded equally as well by trypomastigotes of different T. cruzi strains. Also, in CK18 negative or positive cells, parasites recruited host cells lysosomes and escaped from the parasitophorous vacuole equally as well. After that, the growth of amastigotes of the Y or CL-Brener strains, was drastically arrested in CK18 RNAi-treated cells. After 48 hours, the number of amastigotes was several times lower in CK18 RNAi-treated cells when compared to control cells. Simultaneous staining of parasites and CK18 showed that in HeLa cells infected with the Y strain both co-localize. Although the amastigote surface protein-2 contains the domain VTVXNVFLYNR previously described to bind to CK18, in several attempts, we failed to detect binding of a recombinant protein to CK-18. Conclusion The study demonstrates that silencing CK18 by transient RNAi, inhibits intracellular multiplication of the Y and CL strain of T. cruzi in HeLa cells, but not trypanosome binding and invasion. PMID:19087356

  11. Conservation and divergence within the clathrin interactome of Trypanosoma cruzi

    PubMed Central

    Kalb, Ligia Cristina; Frederico, Yohana Camila A.; Boehm, Cordula; Moreira, Claudia Maria do Nascimento; Soares, Maurilio José; Field, Mark C.

    2016-01-01

    Trypanosomatids are parasitic protozoa with a significant burden on human health. African and American trypanosomes are causative agents of Nagana and Chagas disease respectively, and speciated about 300 million years ago. These parasites have highly distinct life cycles, pathologies, transmission strategies and surface proteomes, being dominated by the variant surface glycoprotein (African) or mucins (American) respectively. In African trypanosomes clathrin-mediated trafficking is responsible for endocytosis and post-Golgi transport, with several mechanistic aspects distinct from higher organisms. Using clathrin light chain (TcCLC) and EpsinR (TcEpsinR) as affinity handles, we identified candidate clathrin-associated proteins (CAPs) in Trypanosoma cruzi; the cohort includes orthologs of many proteins known to mediate vesicle trafficking, but significantly not the AP-2 adaptor complex. Several trypanosome-specific proteins common with African trypanosomes, were also identified. Fluorescence microscopy revealed localisations for TcEpsinR, TcCLC and TcCHC at the posterior region of trypomastigote cells, coincident with the flagellar pocket and Golgi apparatus. These data provide the first systematic analysis of clathrin-mediated trafficking in T. cruzi, allowing comparison between protein cohorts and other trypanosomes and also suggest that clathrin trafficking in at least some life stages of T. cruzi may be AP-2-independent. PMID:27502971

  12. Social motility of African trypanosomes is a property of a distinct life-cycle stage that occurs early in tsetse fly transmission.

    PubMed

    Imhof, Simon; Knüsel, Sebastian; Gunasekera, Kapila; Vu, Xuan Lan; Roditi, Isabel

    2014-10-01

    The protozoan pathogen Trypanosoma brucei is transmitted between mammals by tsetse flies. The first compartment colonised by trypanosomes after a blood meal is the fly midgut lumen. Trypanosomes present in the lumen-designated as early procyclic forms-express the stage-specific surface glycoproteins EP and GPEET procyclin. When the trypanosomes establish a mature infection and colonise the ectoperitrophic space, GPEET is down-regulated, and EP becomes the major surface protein of late procyclic forms. A few years ago, it was discovered that procyclic form trypanosomes exhibit social motility (SoMo) when inoculated on a semi-solid surface. We demonstrate that SoMo is a feature of early procyclic forms, and that late procyclic forms are invariably SoMo-negative. In addition, we show that, apart from GPEET, other markers are differentially expressed in these two life-cycle stages, both in culture and in tsetse flies, indicating that they have different biological properties and should be considered distinct stages of the life cycle. Differentially expressed genes include two closely related adenylate cyclases, both hexokinases and calflagins. These findings link the phenomenon of SoMo in vitro to the parasite forms found during the first 4-7 days of a midgut infection. We postulate that ordered group movement on plates reflects the migration of parasites from the midgut lumen into the ectoperitrophic space within the tsetse fly. Moreover, the process can be uncoupled from colonisation of the salivary glands. Although they are the major surface proteins of procyclic forms, EP and GPEET are not essential for SoMo, nor, as shown previously, are they required for near normal colonisation of the fly midgut.

  13. Autoimmunity in trypanosome infections

    PubMed Central

    MacKenzie, A. R.; Boreham, P. F. L.

    1974-01-01

    Ten rabbits infected with Trypanosoma (Trypanozoon) brucei showed a substantial increase in a natural anti-tissue autoantibody and Wassermann antibody. Absorptions suggest that the liver and Wassermann antibodies are distinct. The liver antibody reacts equally well with homologous and autologous liver. Absorption with trypanosomes and liver show that cross-reacting trypanosomal antibodies are not responsible for the liver activity. These antibodies will contribute to the raised IgM levels of rabbit trypanosomiasis and may be important in this respect but the precise extent of the contribution is not known. It is suggested that a depression of certain T-cell functions may release antibody secreting B-cell descendants from T-cell control resulting in elevated IgM. PMID:4211823

  14. Mechanisms of natural resistance to trypanosomal infection. Role of complement in avian resistance to Trypanosoma cruzi infection.

    PubMed Central

    Kierszenbaum, F; Ivanyi, J; Budzko, D B

    1976-01-01

    The natural resistance of chickens to Trypanosoma curzi infection and the capacity of their sera to lyse blood (trypomastigote) forms of the parasite in vitro were found to be complement-dependent phenomena. Parasites given intravenously to decomplemented chickens were detectable in their bloodstream for at least 24 h post-infection, whereas in untreated animals they became undetectable after 1 min (and destroyed flagellates were observed). One millilitre of serum had the capacity to lyse as many as 10-30 X 10(6) organisms. The lytic activity of serum in vitro was not impaired in chickens that had been immunosuppressed by four different procedures and was present in the absence of antibodies. In vitro lysis of T. cruzi by either normal or antibody-free chicken sera occurred in the absence of calcium ions but required magnesium ions, indicating that complement was activated via the alternative pathway. Administration of normal chicken serum to mice infected with T. cruzi provoked a marked decrease in their parasitaemias. PMID:765264

  15. A Primate APOL1 Variant That Kills Trypanosoma brucei gambiense

    PubMed Central

    Cooper, Anneli; Capewell, Paul; Clucas, Caroline; Veitch, Nicola; Weir, William; Thomson, Russell; Raper, Jayne; MacLeod, Annette

    2016-01-01

    Humans are protected against infection from most African trypanosomes by lipoprotein complexes present in serum that contain the trypanolytic pore-forming protein, Apolipoprotein L1 (APOL1). The human-infective trypanosomes, Trypanosoma brucei rhodesiense in East Africa and T. b. gambiense in West Africa have separately evolved mechanisms that allow them to resist APOL1-mediated lysis and cause human African trypanosomiasis, or sleeping sickness, in man. Recently, APOL1 variants were identified from a subset of Old World monkeys, that are able to lyse East African T. b. rhodesiense, by virtue of C-terminal polymorphisms in the APOL1 protein that hinder that parasite’s resistance mechanism. Such variants have been proposed as candidates for developing therapeutic alternatives to the unsatisfactory anti-trypanosomal drugs currently in use. Here we demonstrate the in vitro lytic ability of serum and purified recombinant protein of an APOL1 ortholog from the West African Guinea baboon (Papio papio), which is able to lyse examples of all sub-species of T. brucei including T. b. gambiense group 1 parasites, the most common agent of human African trypanosomiasis. The identification of a variant of APOL1 with trypanolytic ability for both human-infective T. brucei sub-species could be a candidate for universal APOL1-based therapeutic strategies, targeted against all pathogenic African trypanosomes. PMID:27494254

  16. PPL2 Translesion Polymerase Is Essential for the Completion of Chromosomal DNA Replication in the African Trypanosome

    PubMed Central

    Rudd, Sean G.; Glover, Lucy; Jozwiakowski, Stanislaw K.; Horn, David; Doherty, Aidan J.

    2013-01-01

    Summary Faithful copying of the genome is essential for life. In eukaryotes, a single archaeo-eukaryotic primase (AEP), DNA primase, is required for the initiation and progression of DNA replication. Here we have identified additional eukaryotic AEP-like proteins with DNA-dependent primase and/or polymerase activity. Uniquely, the genomes of trypanosomatids, a group of kinetoplastid protozoa of significant medical importance, encode two PrimPol-like (PPL) proteins. In the African trypanosome, PPL2 is a nuclear enzyme present in G2 phase cells. Following PPL2 knockdown, a cell-cycle arrest occurs after the bulk of DNA synthesis, the DNA damage response is activated, and cells fail to recover. Consistent with this phenotype, PPL2 replicates damaged DNA templates in vitro, including templates containing the UV-induced pyrimidine-pyrimidone (6-4) photoproduct. Furthermore, PPL2 accumulates at sites of nuclear DNA damage. Taken together, our results indicate an essential role for PPL2 in postreplication tolerance of endogenous DNA damage, thus allowing completion of genome duplication. PMID:24267450

  17. Tripartite interactions between tsetse flies, Sodalis glossinidius and trypanosomes--an epidemiological approach in two historical human African trypanosomiasis foci in Cameroon.

    PubMed

    Farikou, Oumarou; Njiokou, Flobert; Mbida Mbida, Jean A; Njitchouang, Guy R; Djeunga, Hugues Nana; Asonganyi, Tazoacha; Simarro, Pere P; Cuny, Gérard; Geiger, Anne

    2010-01-01

    Epidemiological surveys were conducted in two historical human African trypanosomiasis foci in South Cameroon, Bipindi and Campo. In each focus, three sampling areas were defined. In Bipindi, only Glossina palpalis was identified, whereas four species were identified in Campo, G. palpalis being highly predominant (93%). For further analyses, 75 flies were randomly chosen among the flies trapped in each of the six villages. Large and statistically significant differences were recorded between both (1) the prevalence of Sodalis glossinidius (tsetse symbiont) and the prevalence of trypanosome infection of the major fly species G. p. palpalis and (2) the respective prevalence of symbiont and infection between the two foci. Despite these differences, the rate of infected flies harbouring the symbiont was very similar (75%) in both foci, suggesting that symbionts favour fly infection by trypanosomes. This hypothesis was statistically tested and assessed, showing that S. glossinidius is potentially an efficient target for controlling tsetse fly vectorial competence and consequently sleeping sickness.

  18. The silicon trypanosome: a test case of iterative model extension in systems biology.

    PubMed

    Achcar, Fiona; Fadda, Abeer; Haanstra, Jurgen R; Kerkhoven, Eduard J; Kim, Dong-Hyun; Leroux, Alejandro E; Papamarkou, Theodore; Rojas, Federico; Bakker, Barbara M; Barrett, Michael P; Clayton, Christine; Girolami, Mark; Krauth-Siegel, R Luise; Matthews, Keith R; Breitling, Rainer

    2014-01-01

    The African trypanosome, Trypanosoma brucei, is a unicellular parasite causing African Trypanosomiasis (sleeping sickness in humans and nagana in animals). Due to some of its unique properties, it has emerged as a popular model organism in systems biology. A predictive quantitative model of glycolysis in the bloodstream form of the parasite has been constructed and updated several times. The Silicon Trypanosome is a project that brings together modellers and experimentalists to improve and extend this core model with new pathways and additional levels of regulation. These new extensions and analyses use computational methods that explicitly take different levels of uncertainty into account. During this project, numerous tools and techniques have been developed for this purpose, which can now be used for a wide range of different studies in systems biology.

  19. The Silicon Trypanosome: a test case of iterative model extension in systems biology

    PubMed Central

    Achcar, Fiona; Fadda, Abeer; Haanstra, Jurgen R.; Kerkhoven, Eduard J.; Kim, Dong-Hyun; Leroux, Alejandro E.; Papamarkou, Theodore; Rojas, Federico; Bakker, Barbara M.; Barrett, Michael P.; Clayton, Christine; Girolami, Mark; Luise Krauth-Siegel, R.; Matthews, Keith R.; Breitling, Rainer

    2016-01-01

    The African trypanosome, Trypanosoma brucei, is a unicellular parasite causing African Trypanosomiasis (sleeping sickness in humans and nagana in animals). Due to some of its unique properties, it has emerged as a popular model organism in systems biology. A predictive quantitative model of glycolysis in the bloodstream form of the parasite has been constructed and updated several times. The Silicon Trypanosome (SilicoTryp) is a project that brings together modellers and experimentalists to improve and extend this core model with new pathways and additional levels of regulation. These new extensions and analyses use computational methods that explicitly take different levels of uncertainty into account. During this project, numerous tools and techniques have been developed for this purpose, which can now be used for a wide range of different studies in systems biology. PMID:24797926

  20. Structural basis for ligand and innate immunity factor uptake by the trypanosome haptoglobin-haemoglobin receptor

    PubMed Central

    Lane-Serff, Harriet; MacGregor, Paula; Lowe, Edward D; Carrington, Mark; Higgins, Matthew K

    2014-01-01

    The haptoglobin-haemoglobin receptor (HpHbR) of African trypanosomes allows acquisition of haem and provides an uptake route for trypanolytic factor-1, a mediator of innate immunity against trypanosome infection. In this study, we report the structure of Trypanosoma brucei HpHbR in complex with human haptoglobin-haemoglobin (HpHb), revealing an elongated ligand-binding site that extends along its membrane distal half. This contacts haptoglobin and the β-subunit of haemoglobin, showing how the receptor selectively binds HpHb over individual components. Lateral mobility of the glycosylphosphatidylinositol-anchored HpHbR, and a ∼50o kink in the receptor, allows two receptors to simultaneously bind one HpHb dimer. Indeed, trypanosomes take up dimeric HpHb at significantly lower concentrations than monomeric HpHb, due to increased ligand avidity that comes from bivalent binding. The structure therefore reveals the molecular basis for ligand and innate immunity factor uptake by trypanosomes and identifies adaptations that allow efficient ligand uptake in the context of the complex trypanosome cell surface. DOI: http://dx.doi.org/10.7554/eLife.05553.001 PMID:25497229

  1. Structural basis for ligand and innate immunity factor uptake by the trypanosome haptoglobin-haemoglobin receptor.

    PubMed

    Lane-Serff, Harriet; MacGregor, Paula; Lowe, Edward D; Carrington, Mark; Higgins, Matthew K

    2014-12-12

    The haptoglobin-haemoglobin receptor (HpHbR) of African trypanosomes allows acquisition of haem and provides an uptake route for trypanolytic factor-1, a mediator of innate immunity against trypanosome infection. In this study, we report the structure of Trypanosoma brucei HpHbR in complex with human haptoglobin-haemoglobin (HpHb), revealing an elongated ligand-binding site that extends along its membrane distal half. This contacts haptoglobin and the β-subunit of haemoglobin, showing how the receptor selectively binds HpHb over individual components. Lateral mobility of the glycosylphosphatidylinositol-anchored HpHbR, and a ∼50° kink in the receptor, allows two receptors to simultaneously bind one HpHb dimer. Indeed, trypanosomes take up dimeric HpHb at significantly lower concentrations than monomeric HpHb, due to increased ligand avidity that comes from bivalent binding. The structure therefore reveals the molecular basis for ligand and innate immunity factor uptake by trypanosomes and identifies adaptations that allow efficient ligand uptake in the context of the complex trypanosome cell surface.

  2. Population Genetics and Reproductive Strategies of African Trypanosomes: Revisiting Available Published Data.

    PubMed

    Koffi, Mathurin; De Meeûs, Thierry; Séré, Modou; Bucheton, Bruno; Simo, Gustave; Njiokou, Flobert; Salim, Bashir; Kaboré, Jacques; MacLeod, Annette; Camara, Mamadou; Solano, Philippe; Belem, Adrien Marie Gaston; Jamonneau, Vincent

    2015-01-01

    Trypanosomatidae are a dangerous family of Euglenobionta parasites that threaten the health and economy of millions of people around the world. More precisely describing the population biology and reproductive mode of such pests is not only a matter of pure science, but can also be useful for understanding parasite adaptation, as well as how parasitism, specialization (parasite specificity), and complex life cycles evolve over time. Studying this parasite's reproductive strategies and population structure can also contribute key information to the understanding of the epidemiology of associated diseases; it can also provide clues for elaborating control programs and predicting the probability of success for control campaigns (such as vaccines and drug therapies), along with emergence or re-emergence risks. Population genetics tools, if appropriately used, can provide precise and useful information in these investigations. In this paper, we revisit recent data collected during population genetics surveys of different Trypanosoma species in sub-Saharan Africa. Reproductive modes and population structure depend not only on the taxon but also on the geographical location and data quality (absence or presence of DNA amplification failures). We conclude on issues regarding future directions of research, in particular vis-à-vis genotyping and sampling strategies, which are still relevant yet, too often, neglected issues.

  3. Species-Specific Adaptations of Trypanosome Morphology and Motility to the Mammalian Host

    PubMed Central

    McOdimba, Francis A.; Omogo, Collins O.; Adung’a, Vincent O.; Krüger, Timothy; Masiga, Daniel K.; Engstler, Markus

    2016-01-01

    African trypanosomes thrive in the bloodstream and tissue spaces of a wide range of mammalian hosts. Infections of cattle cause an enormous socio-economic burden in sub-Saharan Africa. A hallmark of the trypanosome lifestyle is the flagellate’s incessant motion. This work details the cell motility behavior of the four livestock-parasites Trypanosoma vivax, T. brucei, T. evansi and T. congolense. The trypanosomes feature distinct swimming patterns, speeds and flagellar wave frequencies, although the basic mechanism of flagellar propulsion is conserved, as is shown by extended single flagellar beat analyses. Three-dimensional analyses of the trypanosomes expose a high degree of dynamic pleomorphism, typified by the ‘cellular waveform’. This is a product of the flagellar oscillation, the chirality of the flagellum attachment and the stiffness of the trypanosome cell body. The waveforms are characteristic for each trypanosome species and are influenced by changes of the microenvironment, such as differences in viscosity and the presence of confining obstacles. The distinct cellular waveforms may be reflective of the actual anatomical niches the parasites populate within their mammalian host. T. vivax displays waveforms optimally aligned to the topology of the bloodstream, while the two subspecies T. brucei and T. evansi feature distinct cellular waveforms, both additionally adapted to motion in more confined environments such as tissue spaces. T. congolense reveals a small and stiff waveform, which makes these parasites weak swimmers and destined for cell adherence in low flow areas of the circulation. Thus, our experiments show that the differential dissemination and annidation of trypanosomes in their mammalian hosts may depend on the distinct swimming capabilities of the parasites. PMID:26871910

  4. Adaptations of Trypanosoma brucei to gradual loss of kinetoplast DNA: Trypanosoma equiperdum and Trypanosoma evansi are petite mutants of T. brucei

    PubMed Central

    Lai, De-Hua; Hashimi, Hassan; Lun, Zhao-Rong; Ayala, Francisco J.; Lukeš, Julius

    2008-01-01

    Trypanosoma brucei is a kinetoplastid flagellate, the agent of human sleeping sickness and ruminant nagana in Africa. Kinetoplastid flagellates contain their eponym kinetoplast DNA (kDNA), consisting of two types of interlocked circular DNA molecules: scores of maxicircles and thousands of minicircles. Maxicircles have typical mitochondrial genes, most of which are translatable only after RNA editing. Minicircles encode guide RNAs, required for decrypting the maxicircle transcripts. The life cycle of T. brucei involves a bloodstream stage (BS) in vertebrates and a procyclic stage (PS) in the tsetse fly vector. Partial [dyskinetoplastidy (Dk)] or total [akinetoplastidy (Ak)] loss of kDNA locks the trypanosome in the BS form. Transmission between vertebrates becomes mechanical without PS and tsetse mediation, allowing the parasite to spread outside the African tsetse belt. Trypanosoma equiperdum and Trypanosoma evansi are agents of dourine and surra, diseases of horses, camels, and water buffaloes. We have characterized representative strains of T. equiperdum and T. evansi by numerous molecular and classical parasitological approaches. We show that both species are actually strains of T. brucei, which lost part (Dk) or all (Ak) of their kDNA. These trypanosomes are not monophyletic clades and do not qualify for species status. They should be considered two subspecies, respectively T. brucei equiperdum and T. brucei evansi, which spontaneously arose recently. Dk/Ak trypanosomes may potentially emerge repeatedly from T. brucei. PMID:18245376

  5. Sexual differences in prevalence of a new species of trypanosome infecting túngara frogs

    PubMed Central

    Bernal, Ximena E.; Pinto, C. Miguel

    2016-01-01

    Trypanosomes are a diverse group of protozoan parasites of vertebrates transmitted by a variety of hematophagous invertebrate vectors. Anuran trypanosomes and their vectors have received relatively little attention even though these parasites have been reported from frog and toad species worldwide. Blood samples collected from túngara frogs (Engystomops pustulosus), a Neotropical anuran species heavily preyed upon by eavesdropping frog-biting midges (Corethrella spp.), were examined for trypanosomes. Our results revealed sexual differences in trypanosome prevalence with female frogs being rarely infected (<1%). This finding suggests this protozoan parasite may be transmitted by frog-biting midges that find their host using the mating calls produced by male frogs. Following previous anuran trypanosome studies, we examined 18S ribosomal RNA gene to characterize and establish the phylogenetic relationship of the trypanosome species found in túngara frogs. A new species of giant trypanosome, Trypanosoma tungarae n. sp., is described in this study. Overall the morphometric data revealed that the trypomastigotes of T. tungarae n. sp. are similar to other giant trypanosomes such as Trypanosoma rotatorium and Trypanosoma ranarum. Despite its slender and long cell shape, however, 18S rRNA gene sequences revealed that T. tungarae n. sp. is sister to the rounded-bodied giant trypanosome, Trypanosoma chattoni. Therefore, morphological convergence explains similar morphology among members of two non-closely related groups of trypanosomes infecting frogs. The results from this study underscore the value of coupling morphological identification with molecular characterization of anuran trypanosomes. PMID:26977404

  6. Sexual differences in prevalence of a new species of trypanosome infecting túngara frogs.

    PubMed

    Bernal, Ximena E; Pinto, C Miguel

    2016-04-01

    Trypanosomes are a diverse group of protozoan parasites of vertebrates transmitted by a variety of hematophagous invertebrate vectors. Anuran trypanosomes and their vectors have received relatively little attention even though these parasites have been reported from frog and toad species worldwide. Blood samples collected from túngara frogs (Engystomops pustulosus), a Neotropical anuran species heavily preyed upon by eavesdropping frog-biting midges (Corethrella spp.), were examined for trypanosomes. Our results revealed sexual differences in trypanosome prevalence with female frogs being rarely infected (<1%). This finding suggests this protozoan parasite may be transmitted by frog-biting midges that find their host using the mating calls produced by male frogs. Following previous anuran trypanosome studies, we examined 18S ribosomal RNA gene to characterize and establish the phylogenetic relationship of the trypanosome species found in túngara frogs. A new species of giant trypanosome, Trypanosoma tungarae n. sp., is described in this study. Overall the morphometric data revealed that the trypomastigotes of T. tungarae n. sp. are similar to other giant trypanosomes such as Trypanosoma rotatorium and Trypanosoma ranarum. Despite its slender and long cell shape, however, 18S rRNA gene sequences revealed that T. tungarae n. sp. is sister to the rounded-bodied giant trypanosome, Trypanosoma chattoni. Therefore, morphological convergence explains similar morphology among members of two non-closely related groups of trypanosomes infecting frogs. The results from this study underscore the value of coupling morphological identification with molecular characterization of anuran trypanosomes.

  7. Bovine trypanosome species prevalence and farmers' trypanosomiasis control methods in south-western Uganda.

    PubMed

    Alingu, Richard A; Muhanguzi, Dennis; MacLeod, Ewan; Waiswa, Charles; Fyfe, Jenna

    2014-10-28

    A cross-sectional study was conducted in Mbarara district, south-western Uganda in May 2012 to determine the burden of African animal trypanosomosis (AAT) in the semi-intensive dairy production systems where pyrethroid acaricides are frequently used in the control of tick-borne diseases (TBDs). A total of 295 cattle blood samples were taken and analysed using a single pair of primers previously designed to amplify internal transcribed spacer (ITS1) of trypanosome ribosomal deoxyribonucleic acid (rDNA). A structured questionnaire was administered to 55 participating livestock farmers to generate data on acaricide and trypanocidal drug usage. The overall prevalence of trypanosome species was 2.4% (95% CI; 1.0% - 4.8%); Trypanosoma vivax was the most predominant species (2.0%; 95% CI; 0.7% - 4.4%). A single mixed infection of T. vivax and Trypanosoma brucei s.l. was detected. All the participating farmers used acaricides for tsetse and TBD control; 89.1% of the acaricides used were pyrethroids. About half of the farmers used trypanocidal drugs, mainly diminazene formulations (Berenil®). Low prevalence of trypanosomes in examined samples is most likely related to the frequent use of pyrethroid insecticides, trypanocides and restricted grazing (paddocking and tethering). These rigorous management practices are geared towards optimising production of exotic dairy breeds kept in this region that are highly susceptible to TBDs and AAT.

  8. Neglected disease - african sleeping sickness: recent synthetic and modeling advances.

    PubMed

    Paliwal, Sarvesh K; Verma, Ankita Narayan; Paliwal, Shailendra

    2011-01-01

    Human African Trypanosomiasis (HAT) also called sleeping sickness is caused by subspecies of the parasitic hemoflagellate Trypanosoma brucei that mostly occurs in sub-Saharan Africa. The current chemotherapy of the human trypanosomiases relies on only six drugs, five of which have been developed more than 30 years ago, have undesirable toxic side effects and most of them show drug-resistance. Though development of new anti-trypanosomal drugs seems to be a priority area research in this area has lagged far behind. The given review mainly focus upon the recent synthetic and computer based approaches made by various research groups for the development of newer anti-trypanosomal analogues which may have improved efficacy and oral bioavailability than the present ones. The given paper also attempts to investigate the relationship between the various physiochemical parameters and anti-trypanosomal activity that may be helpful in development of potent anti-trypanosomal agents against sleeping sickness.

  9. The Trypanosome Exocyst: A Conserved Structure Revealing a New Role in Endocytosis

    PubMed Central

    Boehm, Cordula M.; Obado, Samson; Gadelha, Catarina; Kaupisch, Alexandra; Manna, Paul T.; Gould, Gwyn W.; Rout, Michael P.; Field, Mark C.

    2017-01-01

    Membrane transport is an essential component of pathogenesis for most infectious organisms. In African trypanosomes, transport to and from the plasma membrane is closely coupled to immune evasion and antigenic variation. In mammals and fungi an octameric exocyst complex mediates late steps in exocytosis, but comparative genomics suggested that trypanosomes retain only six canonical subunits, implying mechanistic divergence. We directly determined the composition of the Trypanosoma brucei exocyst by affinity isolation and demonstrate that the parasite complex is nonameric, retaining all eight canonical subunits (albeit highly divergent at the sequence level) plus a novel essential subunit, Exo99. Exo99 and Sec15 knockdowns have remarkably similar phenotypes in terms of viability and impact on morphology and trafficking pathways. Significantly, both Sec15 and Exo99 have a clear function in endocytosis, and global proteomic analysis indicates an important role in maintaining the surface proteome. Taken together these data indicate additional exocyst functions in trypanosomes, which likely include endocytosis, recycling and control of surface composition. Knockdowns in HeLa cells suggest that the role in endocytosis is shared with metazoan cells. We conclude that, whilst the trypanosome exocyst has novel components, overall functionality appears conserved, and suggest that the unique subunit may provide therapeutic opportunities. PMID:28114397

  10. Cyclic AMP effectors in African trypanosomes revealed by genome-scale RNA interference library screening for resistance to the phosphodiesterase inhibitor CpdA.

    PubMed

    Gould, Matthew K; Bachmaier, Sabine; Ali, Juma A M; Alsford, Sam; Tagoe, Daniel N A; Munday, Jane C; Schnaufer, Achim C; Horn, David; Boshart, Michael; de Koning, Harry P

    2013-10-01

    One of the most promising new targets for trypanocidal drugs to emerge in recent years is the cyclic AMP (cAMP) phosphodiesterase (PDE) activity encoded by TbrPDEB1 and TbrPDEB2. These genes were genetically confirmed as essential, and a high-affinity inhibitor, CpdA, displays potent antitrypanosomal activity. To identify effectors of the elevated cAMP levels resulting from CpdA action and, consequently, potential sites for adaptations giving resistance to PDE inhibitors, resistance to the drug was induced. Selection of mutagenized trypanosomes resulted in resistance to CpdA as well as cross-resistance to membrane-permeable cAMP analogues but not to currently used trypanocidal drugs. Resistance was not due to changes in cAMP levels or in PDEB genes. A second approach, a genome-wide RNA interference (RNAi) library screen, returned four genes giving resistance to CpdA upon knockdown. Validation by independent RNAi strategies confirmed resistance to CpdA and suggested a role for the identified cAMP Response Proteins (CARPs) in cAMP action. CARP1 is unique to kinetoplastid parasites and has predicted cyclic nucleotide binding-like domains, and RNAi repression resulted in >100-fold resistance. CARP2 and CARP4 are hypothetical conserved proteins associated with the eukaryotic flagellar proteome or with flagellar function, with an orthologue of CARP4 implicated in human disease. CARP3 is a hypothetical protein, unique to Trypanosoma. CARP1 to CARP4 likely represent components of a novel cAMP signaling pathway in the parasite. As cAMP metabolism is validated as a drug target in Trypanosoma brucei, cAMP effectors highly divergent from the mammalian host, such as CARP1, lend themselves to further pharmacological development.

  11. Ku is important for telomere maintenance, but not for differential expression of telomeric VSG genes, in African trypanosomes.

    PubMed

    Conway, Colin; McCulloch, Richard; Ginger, Michael L; Robinson, Nicholas P; Browitt, Alison; Barry, J David

    2002-06-14

    Trypanosome antigenic variation, involving differential expression of variant surface glycoprotein (VSG) genes, has a strong association with telomeres and with DNA recombination. All expressed VSGs are telomeric, and differential activation involves recombination into the telomeric environment or silencing/activation of subtelomeric promoters. A number of pathogen contingency gene systems associated with immune evasion involve telomeric loci, which has prompted speculation that chromosome ends provide conditions conducive for the operation of rapid gene switching mechanisms. Ku is a protein associated with eukaryotic telomeres that is directly involved in DNA recombination and in gene silencing. We have tested the hypothesis that Ku in trypanosomes is centrally involved in differential VSG expression. We show, via the generation of null mutants, that trypanosome Ku is closely involved in telomere length maintenance, more so for a transcriptionally active than an inactive telomere, but exhibits no detectable influence on DNA double strand break repair. The absence of Ku and the consequent great shortening of telomeres had no detectable influence either on the rate of VSG switching or on the silencing of the telomeric promoters of the VSG subset that is expressed in the tsetse fly.

  12. New organoruthenium complexes with bioactive thiosemicarbazones as co-ligands: potential anti-trypanosomal agents†

    PubMed Central

    Demoro, Bruno; Sarniguet, Cynthia; Sánchez-Delgado, Roberto; Rossi, Miriam; Liebowitz, Daniel; Caruso, Francesco; Olea-Azar, Claudio; Moreno, Virtudes; Medeiros, Andrea; Comini, Marcelo A.; Otero, Lucía; Gambino, Dinorah

    2012-01-01

    In the search for new therapeutic tools against neglected diseases produced by trypanosomatid parasites, and particularly against African Trypanosomiasis, whose etiological agent is Trypanosoma brucei, organoruthenium compounds with bioactive nitrofuran containing thiosemicarbazones (L) as co-ligands were obtained. Four ruthenium(ii) complexes with the formula [Ru2(p-cymene)2(L)2]X2, where X = Cl or PF6, were synthesized and the crystal structures of two of them were solved by X-ray diffraction methods. Two of the complexes show significant in vitro growth inhibition activity against Trypanosoma brucei brucei and are highly selective towards trypanosomal cells with respect to mammalian cells (J774 murine macrophages). These promising results make the title organoruthenium compounds good lead candidates for further developments towards potential antitrypanosomal organometallic drugs. PMID:22138896

  13. Antibodies to calmodulin during experimental Trypanosoma brucei rhodesiense infections in rabbits.

    PubMed Central

    Ruben, L; Patton, C L

    1985-01-01

    Calmodulin is an intracellular Ca2+ receptor protein which regulates a wide variety of enzymatic processes in eukaryotic cells examined in detail. Native calmodulin is not antigenic in rabbits because of its small size, high degree of amino acid sequence conservation and hydrophobicity. African trypanosomes contain a novel calmodulin which is structurally distinct from bovine brain and Tetrahymena calmodulins. In the present study, we examine the antibody response towards these calmodulins during chronic Trypanosoma brucei rhodesiense infections. Injection of purified trypanosome calmodulin into rabbits stimulates the production of specific IgG antibodies which recognize trypanosome, but not bovine brain or Tetrahymena calmodulins. By contrast, during chronic T. brucei infections in rabbits, antibodies (IgG + IgM + IgA) that recognize trypanosome, Tetrahymena and mammalian calmodulins arise. When only IgG antibodies are evaluated from infection sera, the major response is against mammalian and Tetrahymena calmodulins. Significantly fewer IgG antibodies are measured in the infection sera which recognize trypanosome calmodulin, while the non-specific control protein, chicken ovalbumin, is not recognized. Peak IgG antibody responses against calmodulin occur between Days 30-34 post-infection. Competition assays indicate that Tetrahymena and mammalian calmodulins are recognized at identical epitopes which are distinct from epitopes on trypanosome calmodulin. We conclude that, in the context of chronic T. brucei infections in rabbits, antibodies arise which are able to recognize mammalian host calmodulin. Images Figure 1 PMID:2414212

  14. Trypanosome Transmission Dynamics in Tsetse

    PubMed Central

    Aksoy, Serap; Weiss, Brian L.; Attardo, Geoff M.

    2014-01-01

    Tsetse flies (Diptera:Glossinidae) are vectors of African trypanosomes. Tsetse undergo viviparous reproductive biology, and depend on their obligate endosymbiont (genus Wigglesworthia) for the maintenance of fecundity and immune system development. Trypanosomes establish infections in the midgut and salivary glands of the fly. Tsetse’s resistance to trypanosome infection increases as a function of age. Among the factors that mediate resistance to parasites are antimicrobial peptides (AMPs) produced by the Immune deficiency (Imd) signaling pathway, peptidoglycan recognition protein (PGRP) LB, tsetse-EP protein and the integrity of the midgut peritrophic matrix (PM) barrier. The presence of obligate Wigglesworthia during larval development is essential for adult immune system maturation and PM development. Thus, Wigglesworthia prominently influences the vector competency of it’s tsetse host. PMID:25580379

  15. A new lineage of trypanosomes from Australian vertebrates and terrestrial bloodsucking leeches (Haemadipsidae).

    PubMed

    Hamilton, P B; Stevens, J R; Gidley, J; Holz, P; Gibson, W C

    2005-04-01

    Little is known about the trypanosomes of indigenous Australian vertebrates and their vectors. We surveyed a range of vertebrates and blood-feeding invertebrates for trypanosomes by parasitological and PCR-based methods using primers specific to the small subunit ribosomal RNA (SSU rRNA) gene of genus Trypanosoma. Trypanosome isolates were obtained in culture from two common wombats, one swamp wallaby and an Australian bird (Strepera sp.). By PCR, blood samples from three wombats, one brush-tailed wallaby, three platypuses and a frog were positive for trypanosome DNA. All the blood-sucking invertebrates screened were negative for trypanosomes both by microscopy and PCR, except for specimens of terrestrial leeches (Haemadipsidae). Of the latter, two Micobdella sp. specimens from Victoria and 18 Philaemon sp. specimens from Queensland were positive by PCR. Four Haemadipsa zeylanica specimens from Sri Lanka and three Leiobdella jawarerensis specimens from Papua New Guinea were also PCR positive for trypanosome DNA. We sequenced the SSU rRNA and glycosomal glyceraldehyde phosphate dehydrogenase (gGAPDH) genes in order to determine the phylogenetic positions of the new vertebrate and terrestrial leech trypanosomes. In trees based on these genes, Australian vertebrate trypanosomes fell in several distinct clades, for the most part being more closely related to trypanosomes outside Australia than to each other. Two previously undescribed wallaby trypanosomes fell in a clade with Trypanosoma theileri, the cosmopolitan bovid trypanosome, and Trypanosoma cyclops from a Malaysian primate. The terrestrial leech trypanosomes were closely related to the wallaby trypanosomes, T. cyclops and a trypanosome from an Australian frog. We suggest that haemadipsid leeches may be significant and widespread vectors of trypanosomes in Australia and Asia.

  16. Neglected Disease – African Sleeping Sickness: Recent Synthetic and Modeling Advances

    PubMed Central

    Paliwal, Sarvesh K.; Verma, Ankita Narayan; Paliwal, Shailendra

    2011-01-01

    Human African Trypanosomiasis (HAT) also called sleeping sickness is caused by subspecies of the parasitic hemoflagellate Trypanosoma brucei that mostly occurs in sub-Saharan Africa. The current chemotherapy of the human trypanosomiases relies on only six drugs, five of which have been developed more than 30 years ago, have undesirable toxic side effects and most of them show drug-resistance. Though development of new anti-trypanosomal drugs seems to be a priority area research in this area has lagged far behind. The given review mainly focus upon the recent synthetic and computer based approaches made by various research groups for the development of newer anti-trypanosomal analogues which may have improved efficacy and oral bioavailability than the present ones. The given paper also attempts to investigate the relationship between the various physiochemical parameters and anti-trypanosomal activity that may be helpful in development of potent anti-trypanosomal agents against sleeping sickness. PMID:21886894

  17. Surface proteins, ERAD and antigenic variation in Trypanosoma brucei.

    PubMed

    Tiengwe, Calvin; Muratore, Katherine A; Bangs, James D

    2016-11-01

    Variant surface glycoprotein (VSG) is central to antigenic variation in African trypanosomes. Although much prior work documents that VSG is efficiently synthesized and exported to the cell surface, it was recently claimed that 2-3 fold more is synthesized than required, the excess being eliminated by ER-Associated Degradation (ERAD) (Field et al., ). We now reinvestigate VSG turnover and find no evidence for rapid degradation, consistent with a model whereby VSG synthesis is precisely regulated to match requirements for a functional surface coat on each daughter cell. However, using a mutated version of the ESAG7 subunit of the transferrin receptor (E7:Ty) we confirm functional ERAD in trypanosomes. E7:Ty fails to assemble into transferrin receptors and accumulates in the ER, consistent with retention of misfolded protein, and its turnover is selectively rescued by the proteasomal inhibitor MG132. We also show that ER accumulation of E7:Ty does not induce an unfolded protein response. These data, along with the presence of ERAD orthologues in the Trypanosoma brucei genome, confirm ERAD in trypanosomes. We discuss scenarios in which ERAD could be critical to bloodstream parasites, and how these may have contributed to the evolution of antigenic variation in trypanosomes.

  18. A cell-free assay for glycosylphosphatidylinositol anchoring in African trypanosomes. Demonstration of a transamidation reaction mechanism.

    PubMed

    Sharma, D K; Vidugiriene, J; Bangs, J D; Menon, A K

    1999-06-04

    We established an in vitro assay for the addition of glycosyl-phosphatidylinositol (GPI) anchors to proteins using procyclic trypanosomes engineered to express GPI-anchored variant surface glycoprotein (VSG). The assay is based on the premise that small nucleophiles, such as hydrazine, can substitute for the GPI moiety and effect displacement of the membrane anchor of a GPI-anchored protein or pro-protein causing release of the protein into the aqueous medium. Cell membranes containing pulse-radiolabeled VSG were incubated with hydrazine, and the VSG released from the membranes was measured by carbonate extraction, immunoprecipitation, and SDS-polyacrylamide gel electrophoresis/fluorography. Release of VSG was time- and temperature-dependent, was stimulated by hydrazine, and occurred only for VSG molecules situated in early compartments of the secretory pathway. No nucleophile-induced VSG release was seen in membranes prepared from cells expressing a VSG variant with a conventional transmembrane anchor (i.e. a nonfunctional GPI signal sequence). Pro-VSG was shown to be a substrate in the reaction by assaying membranes prepared from cells treated with mannosamine, a GPI biosynthesis inhibitor. When a biotinylated derivative of hydrazine was used instead of hydrazine, the released VSG could be precipitated with streptavidin-agarose, indicating that the biotin moiety was covalently incorporated into the protein. Hydrazine was shown to block the C terminus of the released VSG hydrazide because the released material, unlike a truncated form of VSG lacking a GPI signal sequence, was not susceptible to proteolysis by carboxypeptidases. These results firmly establish that the released material in our assay is VSG hydrazide and strengthen the proof that GPI anchoring proceeds via a transamidation reaction mechanism. The reaction could be inhibited with sulfhydryl alkylating reagents, suggesting that the transamidase enzyme contains a functionally important sulfhydryl

  19. Central Nervous System Parasitosis and Neuroinflammation Ameliorated by Systemic IL-10 Administration in Trypanosoma brucei-Infected Mice.

    PubMed

    Rodgers, Jean; Bradley, Barbara; Kennedy, Peter G E; Sternberg, Jeremy M

    2015-01-01

    Invasion of the central nervous system (CNS) by African trypanosomes represents a critical step in the development of human African trypanosomiasis. In both clinical cases and experimental mouse infections it has been demonstrated that predisposition to CNS invasion is associated with a type 1 systemic inflammatory response. Using the Trypanosoma brucei brucei GVR35 experimental infection model, we demonstrate that systemic delivery of the counter-inflammatory cytokine IL-10 lowers plasma IFN-γ and TNF-α concentrations, CNS parasitosis and ameliorates neuro-inflammatory pathology and clinical symptoms of disease. The results provide evidence that CNS invasion may be susceptible to immunological attenuation.

  20. Development of resazurin-based assay in 384-well format for high throughput whole cell screening of Trypanosoma brucei rhodesiense strain STIB 900 for the identification of potential anti-trypanosomal agents.

    PubMed

    Lim, Kah Tee; Zahari, Zuriati; Amanah, Azimah; Zainuddin, Zafarina; Adenan, Mohd Ilham

    2016-03-01

    To accelerate the discovery of novel leads for the treatment of Human African Trypanosomiasis (HAT), it is necessary to have a simple, robust and cost-effective assay to identify positive hits by high throughput whole cell screening. Most of the fluorescence assay was made in black plate however in this study the HTS assay developed in 384-well format using clear plate and black plate, for comparison. The HTS assay developed is simple, sensitive, reliable and reproducible in both types of plates. Assay robustness and reproducibility were determined under the optimized conditions in 384-well plate was well tolerated in the HTS assay, including percentage of coefficient of variation (% CV) of 4.68% and 4.74% in clear and black 384-well plate, signal-to-background ratio (S/B) of 12.75 in clear 384-well plate and 12.07 in black 384-well plate, Z' factor of 0.79 and 0.82 in clear 384-well plate and black 384-well plate, respectively and final concentration of 0.30% dimethylsulfoxide (DMSO) in both types of plate. Drug sensitivity was found to be comparable to the reported anti-trypanosomal assay in 96-well format. The reproducibility and sensitivity of this assay make it compliant to automated liquid handler use in HTS applications.

  1. The krebs cycle enzyme α-ketoglutarate decarboxylase is an essential glycosomal protein in bloodstream African trypanosomes.

    PubMed

    Sykes, Steven; Szempruch, Anthony; Hajduk, Stephen

    2015-03-01

    α-Ketoglutarate decarboxylase (α-KDE1) is a Krebs cycle enzyme found in the mitochondrion of the procyclic form (PF) of Trypanosoma brucei. The bloodstream form (BF) of T. brucei lacks a functional Krebs cycle and relies exclusively on glycolysis for ATP production. Despite the lack of a functional Krebs cycle, α-KDE1 was expressed in BF T. brucei and RNA interference knockdown of α-KDE1 mRNA resulted in rapid growth arrest and killing. Cell death was preceded by progressive swelling of the flagellar pocket as a consequence of recruitment of both flagellar and plasma membranes into the pocket. BF T. brucei expressing an epitope-tagged copy of α-KDE1 showed localization to glycosomes and not the mitochondrion. We used a cell line transfected with a reporter construct containing the N-terminal sequence of α-KDE1 fused to green fluorescent protein to examine the requirements for glycosome targeting. We found that the N-terminal 18 amino acids of α-KDE1 contain overlapping mitochondrion- and peroxisome-targeting sequences and are sufficient to direct localization to the glycosome in BF T. brucei. These results suggest that α-KDE1 has a novel moonlighting function outside the mitochondrion in BF T. brucei.

  2. The Krebs Cycle Enzyme α-Ketoglutarate Decarboxylase Is an Essential Glycosomal Protein in Bloodstream African Trypanosomes

    PubMed Central

    Sykes, Steven; Szempruch, Anthony

    2014-01-01

    α-Ketoglutarate decarboxylase (α-KDE1) is a Krebs cycle enzyme found in the mitochondrion of the procyclic form (PF) of Trypanosoma brucei. The bloodstream form (BF) of T. brucei lacks a functional Krebs cycle and relies exclusively on glycolysis for ATP production. Despite the lack of a functional Krebs cycle, α-KDE1 was expressed in BF T. brucei and RNA interference knockdown of α-KDE1 mRNA resulted in rapid growth arrest and killing. Cell death was preceded by progressive swelling of the flagellar pocket as a consequence of recruitment of both flagellar and plasma membranes into the pocket. BF T. brucei expressing an epitope-tagged copy of α-KDE1 showed localization to glycosomes and not the mitochondrion. We used a cell line transfected with a reporter construct containing the N-terminal sequence of α-KDE1 fused to green fluorescent protein to examine the requirements for glycosome targeting. We found that the N-terminal 18 amino acids of α-KDE1 contain overlapping mitochondrion- and peroxisome-targeting sequences and are sufficient to direct localization to the glycosome in BF T. brucei. These results suggest that α-KDE1 has a novel moonlighting function outside the mitochondrion in BF T. brucei. PMID:25416237

  3. Purification of the Alpha Glycerophosphate Oxidase From Trypanosomes.

    DTIC Science & Technology

    1992-08-01

    is the purifica- tion of the glycerphosphate oxidase from the terminal oxidase in bloodstream trypanosomes. African trypanosomiasis remains one of the...oxidase from the terminal oxidase in bloodstream trypanosomes. African trypanosomiasis remains one of the major diseases in the world today, affecting...interest as a possible target for drug chemotherapy . At present only suramin and organic arsenicals remain as the mainstay of chemotherapy , despite their

  4. The Design and Synthesis of Potent and Selective Inhibitors of Trypanosoma brucei Glycogen Synthase Kinase 3 for the Treatment of Human African Trypanosomiasis

    PubMed Central

    2014-01-01

    Glycogen synthase kinase 3 (GSK3) is a genetically validated drug target for human African trypanosomiasis (HAT), also called African sleeping sickness. We report the synthesis and biological evaluation of aminopyrazole derivatives as Trypanosoma brucei GSK3 short inhibitors. Low nanomolar inhibitors, which had high selectivity over the off-target human CDK2 and good selectivity over human GSK3β enzyme, have been prepared. These potent kinase inhibitors demonstrated low micromolar levels of inhibition of the Trypanosoma brucei brucei parasite grown in culture. PMID:25198388

  5. CD5+ B lymphocytes are the main source of antibodies reactive with non-parasite antigens in Trypanosoma congolense-infected cattle.

    PubMed Central

    Buza, J; Sileghem, M; Gwakisa, P; Naessens, J

    1997-01-01

    Mice infected with African trypanosomes produce exceptionally large amounts of serum IgM, a major part of which binds to non-trypanosome antigens such as trinitrophenol and single-strand DNA. In this paper, we describe that in cattle infected with Trypanosoma congolense and T. vivax, similar antibodies are found, although they bind mainly to protein antigens, such as beta-galactosidase, ovalbumin and ferritin. The parasite non-specific IgM antibodies appear around the same time as the parasite-specific antibodies, but their origin and function are not clear. We tested the hypothesis that CD5+ B cells (or B-1 cells), which increase during trypanosome infections in cattle, are responsible for production of antibodies to non-trypanosome antigens. Splenic CD5+ and CD5- B cells from infected cattle were sorted and tested in a single cell blot assay. The numbers of immunoglobulin-secreting cells were similar in both B-cell populations. However, antibodies with reactivity for non-trypanosome antigens were significantly more prevalent in the CD5+ B-cell fraction and were exclusively IgM. The preference for production of these antibodies by CD5+ B cells and the expansion of this subpopulation during infections in cattle, strongly suggest that CD5+ B cells are the main source of trypanosome non-specific antibodies. We propose that these antibodies are natural, polyreactive antibodies that are predominantly secreted by CD5+ B cells. Since B-1 cells are up-regulated in many states of immune insufficiency, the immunosuppression associated with trypanosome infections may be responsible for the increase of this subset and the concomitant increase in trypanosome non-specific antibodies. PMID:9415031

  6. Immunization of mice with Trypanosoma rhodesiense exposed to ultraviolet irradiation

    SciTech Connect

    Charoenvit, Y.; Campbell, G.H.

    1981-11-01

    Exposure time of Trypanosoma rhodesiense as short as 1 minute to ultraviolet (uv) light prevents the organisms from causing infection. Live trypanosome challenge of mice immunized with uv-irradiated trypanosomes results in sterile immunity. This allows a method for the induction of protective immunity to experimental trypanosomiasis which can be performed in most laboratories using uv germicidal lamps found in sterile hoods.

  7. Characterization of the late endosomal ESCRT machinery in Trypanosoma brucei.

    PubMed

    Silverman, Jason S; Muratore, Katherine A; Bangs, James D

    2013-10-01

    The multivesicular body (MVB) is a specialized Rab7+ late endosome (LE) containing multiple intralumenal vesicles that function in targeting ubiquitinylated cell surface proteins to the lysosome for degradation. African trypanosomes lack a morphologically well-defined MVB, but contain orthologs of the ESCRT (Endosomal Sorting Complex Required for Transport) machinery that mediates MVB formation. We investigate the role of TbVps23, an early ESCRT component, and TbVps4, the terminal ESCRT ATPase, in lysosomal trafficking in bloodstream form trypanosomes. Both localize to the TbRab7+ LE and RNAi silencing of each rapidly blocks growth. TbVps4 silencing results in approximately threefold accumulation of TbVps23 at the LE, consistent with blocking terminal ESCRT disassembly. Trafficking of endocytic and biosynthetic cargo, but not default lysosomal reporters, is also negatively affected. Others reported that TbVps23 mediates ubiquitin-dependent lysosomal degradation of invariant surface glycoproteins (ISG65) (Leung et al., Traffic 2008;9:1698-1716). In contrast, we find that TbVps23 ablation does not affect ISG65 turnover, while TbVps4 silencing markedly enhances lysosomal degradation. We propose several models to accommodate these results, including that the ESCRT machinery actually retrieves ISG65 from the LE to earlier endocytic compartments, and in its absence ISG65 traffics more efficiently to the lysosome. Overall, these results confirm that the ESCRT machinery is essential in Trypanosoma brucei and plays important and novel role(s) in LE function in trypanosomes.

  8. VSG gene expression site control in insect form Trypanosoma brucei.

    PubMed

    Rudenko, G; Blundell, P A; Taylor, M C; Kieft, R; Borst, P

    1994-11-15

    When the African trypanosome Trypanosoma brucei is taken up from mammals by a tse-tse fly, it replaces its variant surface glycoprotein (VSG) coat by a procyclin coat. Transcription of VSG genes stops in the fly, but transcription of sequences derived from the promoter area of the VSG expression site(s) remains high. Whether this is due to continuing high activity of one promoter or to low activity of many promoters was unclear. We have used the small differences between the sequences of different expression sites to show that multiple expression site promoters are active in insect form trypanosomes. This is confirmed by the low expression of single copy marker genes introduced into the transcribed area. However, if the expression site promoter is removed from the genomic location of the expression site and inserted in the non-transcribed spacer of the ribosomal DNA (rDNA), it is derepressed. Derepression of transcription can also be accomplished by replacing the promoter of an expression site by an rDNA promoter. We conclude that the down-regulation of VSG gene expression site promoters in insect form trypanosomes is affected by both the DNA sequence of the promoter and the genomic context in which it resides.

  9. Quercetin, a fluorescent bioflavanoid, inhibits Trypanosoma brucei hexokinase 1

    PubMed Central

    Dodson, Heidi C.; Lyda, Todd L.; Chambers, Jeremy W.; Morris, Meredith T.; Christensen, Kenneth A.; Morris, James C.

    2010-01-01

    Hexokinases from the African trypanosome, Trypanosoma brucei, are attractive targets for the development of anti-parasitic drugs, in part because the parasite utilizes glycolysis exclusively for ATP production during the mammalian infection. Here, we have demonstrated that the bioflavanoid quercetin (QCN), a known trypanocide, is a mixed inhibitor of Trypanosoma brucei hexokinase 1 (TbHK1) (IC50 = 4.1 ± 0.8 μM). Spectroscopic analysis of QCN binding to TbHK1, taking advantage of the intrinsically fluorescent single tryptophan (Trp177) in TbHK1, revealed that QCN quenches emission of Trp177, which is located near the hinge region of the enzyme. ATP similarly quenched Trp177 emission, while glucose had no impact on fluorescence. Supporting the possibility that QCN toxicity is a consequence of inhibition of the essential hexokinase, in live parasites QCN fluorescence localizes to glycosomes, the subcellular home of TbHK1. Additionally, RNAi-mediated silencing of TbHK1 expression expedited QCN induced death, while over-expressing TbHK1 protected trypanosomes from the compound. In summary, these observations support the suggestion that QCN toxicity is in part attributable to inhibition of the essential TbHK1. PMID:20971104

  10. Human African trypanosomiasis.

    PubMed

    Lejon, Veerle; Bentivoglio, Marina; Franco, José Ramon

    2013-01-01

    Human African trypanosomiasis or sleeping sickness is a neglected tropical disease that affects populations in sub-Saharan Africa. The disease is caused by infection with the gambiense and rhodesiense subspecies of the extracellular parasite Trypanosoma brucei, and is transmitted to humans by bites of infected tsetse flies. The disease evolves in two stages, the hemolymphatic and meningoencephalitic stages, the latter being defined by central nervous system infection after trypanosomal traversal of the blood-brain barrier. African trypanosomiasis, which leads to severe neuroinflammation, is fatal without treatment, but the available drugs are toxic and complicated to administer. The choice of medication is determined by the infecting parasite subspecies and disease stage. Clinical features include a constellation of nonspecific symptoms and signs with evolving neurological and psychiatric alterations and characteristic sleep-wake disturbances. Because of the clinical profile variability and insidiously progressive central nervous system involvement, disease staging is currently based on cerebrospinal fluid examination, which is usually performed after the finding of trypanosomes in blood or other body fluids. No vaccine being available, control of human African trypanosomiasis relies on diagnosis and treatment of infected patients, assisted by vector control. Better diagnostic tools and safer, easy to use drugs are needed to facilitate elimination of the disease.

  11. Characterization of Calflagin, a Flagellar Calcium-Binding Protein from Trypanosoma congolense

    PubMed Central

    Eyford, Brett A.; Kaufman, Laura; Salama-Alber, Orly; Loveless, Bianca; Pope, Matthew E.; Burke, Robert D.; Matovu, Enock; Boulanger, Martin J.; Pearson, Terry W.

    2016-01-01

    Background Identification of species-specific trypanosome molecules is important for laboratory- and field-based research into epidemiology and disease diagnosis. Although Trypanosoma congolense is the most important trypanosome pathogen of cattle in Africa, no species-specific molecules found in infective bloodstream forms (BSF) of the parasites have been identified, thus limiting development of diagnostic tests. Methods Immuno-mass spectrometric methods were used to identify a protein that is recognized by a T. congolense-specific monoclonal antibody (mAb) Tc6/42.6.4. The identified molecule was expressed as a recombinant protein in E. coli and was tested in several immunoassays for its ability to interact with the mAb. The three dimensional structure of the protein was modeled and compared to crystal- and NMR-structures of the homologous proteins from T. cruzi and T. brucei respectively, in order to examine structural differences leading to the different immunoreactivity of the T. congolense molecule. Enzyme-linked immunosorbent assays (ELISA) were used to measure antibodies produced by trypanosome-infected African cattle in order to assess the potential for use of T. congolense calflagin in a serodiagnostic assay. Results The antigen recognized by the T. congolense-specific mAb Tc6/42.6.4 was identified as a flagellar calcium-binding protein, calflagin. The recombinant molecule showed immunoreactivity with the T. congolense-specific mAb confirming that it is the cognate antigen. Immunofluorescence experiments revealed that Ca2+ modulated the localization of the calflagin molecule in trypanosomes. Structural modelling and comparison with calflagin homologues from other trypanosomatids revealed four non-conserved regions on the surface of the T. congolense molecule that due to differences in surface chemistry and structural topography may form species-specific epitopes. ELISAs using the recombinant calflagin as antigen to detect antibodies in trypanosome

  12. Detection and identification of pathogenic trypanosome species in tsetse flies along the Comoé River in Côte d’Ivoire

    PubMed Central

    Djohan, Vincent; Kaba, Dramane; Rayaissé, Jean-Baptiste; Dayo, Guiguigbaza-Kossigan; Coulibaly, Bamoro; Salou, Ernest; Dofini, Fabien; Kouadio, Alain De Marie Koffi; Menan, Hervé; Solano, Philippe

    2015-01-01

    In order to identify pathogenic trypanosomes responsible for African trypanosomiasis, and to better understand tsetse-trypanosome relationships, surveys were undertaken in three sites located in different eco-climatic areas in Côte d’Ivoire during the dry and rainy seasons. Tsetse flies were caught during five consecutive days using biconical traps, dissected and microscopically examined looking for trypanosome infection. Samples from infected flies were tested by PCR using specific primers for Trypanosoma brucei s.l., T. congolense savannah type, T. congolense forest type and T. vivax. Of 1941 tsetse flies caught including four species, i.e. Glossina palpalis palpalis, G. p. gambiensis, G. tachinoides and G. medicorum, 513 (26%) were dissected and 60 (12%) were found positive by microscopy. Up to 41% of the infections were due to T. congolense savannah type, 30% to T. vivax, 20% to T. congolense forest type and 9% due to T. brucei s.l. All four trypanosome species and subgroups were identified from G. tachinoides and G. p. palpalis, while only two were isolated from G. p. gambiensis (T. brucei s.l., T. congolense savannah type) and G. medicorum (T. congolense forest, savannah types). Mixed infections were found in 25% of cases and all involved T. congolense savannah type with another trypanosome species. The simultaneous occurrence of T. brucei s.l., and tsetse from the palpalis group may suggest that human trypanosomiasis can still be a constraint in these localities, while high rates of T. congolense and T. vivax in the area suggest a potential risk of animal trypanosomiasis in livestock along the Comoé River. PMID:26035296

  13. Development of drug resistance in Trypanosoma brucei rhodesiense and Trypanosoma brucei gambiense. Treatment of human African trypanosomiasis with natural products (Review).

    PubMed

    Gehrig, Stefanie; Efferth, Thomas

    2008-10-01

    Human African trypanosomiasis is an infectious disease which has resulted in the deaths of thousands of people in Sub-Saharan Africa. Two subspecies of the protozoan parasite Trypanosoma brucei are the causative agents of the infection, whereby T. b. gambiense leads to chronic development of the disease and T. b. rhodesiense establishes an acute form, which is fatal within months or even weeks. Current chemotherapy treatment is complex, since special drugs have to be used for the different development stages of the disease, as well as for the parasite concerned. Melarsoprol is the only approved drug for effectively treating both subspecies of human African trypanosomiasis in its advanced stage, however, the drug's potency is constrained due to an unacceptable side effect: encephalopathy, which develops in one out of every 20 patients who are treated with the drug. In addition to the deleterious treatment with melarsoprol, the number of drug-resistant strains of T. brucei supp. increases. Mechanisms of drug resistance have been elucidated and involve decreased drug import through the loss of the purine transporter P2 as well as enhanced drug export, mediated by a multidrug resistance-associated protein called TbMRPA. Thereby, the medical treatment with the available chemotherapeutics becomes exceedingly difficult. A promising strategy for research into new drugs and moreover, to overcome drug resistance, are compounds derived from natural sources. This study provides an overview of the recently discovered small molecules with trypanocidal activity against T. b. gambiense and T. b. rhodesiense. In addition, former promising compounds are touched upon.

  14. The ethanolamine branch of the Kennedy pathway is essential in the bloodstream form of Trypanosoma brucei

    PubMed Central

    Gibellini, Federica; Hunter, William N; Smith, Terry K

    2009-01-01

    Phosphatidylethanolamine (GPEtn), a major phospholipid component of trypanosome membranes, is synthesized de novo from ethanolamine through the Kennedy pathway. Here the composition of the GPEtn molecular species in the bloodstream form of Trypanosoma brucei is determined, along with new insights into phospholipid metabolism, by in vitro and in vivo characterization of a key enzyme of the Kennedy pathway, the cytosolic ethanolamine-phosphate cytidylyltransferase (TbECT). Gene knockout indicates that TbECT is essential for growth and survival, thus highlighting the importance of the Kennedy pathway for the pathogenic stage of the African trypanosome. Phosphatiylserine decarboxylation, a potential salvage pathway, does not appear to be active in cultured bloodstream form T. brucei, and it is not upregulated even when the Kennedy pathway is disrupted. In vivo metabolic labelling and phospholipid composition analysis by ESI-MS/MS of the knockout cells confirmed a significant decrease in GPEtn species, as well as changes in the relative abundance of other phospholipid species. Reduction in GPEtn levels had a profound influence on the morphology of the mutants and it compromised mitochondrial structure and function, as well as glycosylphosphatidylinositol anchor biosynthesis. TbECT is therefore genetically validated as a potential drug target against the African trypanosome. PMID:19555461

  15. Adult blood-feeding tsetse flies, trypanosomes, microbiota and the fluctuating environment in sub-Saharan Africa.

    PubMed

    Geiger, Anne; Ponton, Fleur; Simo, Gustave

    2015-07-01

    The tsetse fly vector transmits the protozoan Trypanosoma brucei, responsible for Human African Trypanosomiasis, one of the most neglected tropical diseases. Despite a recent decline in new cases, it is still crucial to develop alternative strategies to combat this disease. Here, we review the literature on the factors that influence trypanosome transmission from the fly vector to its vertebrate host (particularly humans). These factors include climate change effects to pathogen and vector development (in particular climate warming), as well as the distribution of host reservoirs. Finally, we present reports on the relationships between insect vector nutrition, immune function, microbiota and infection, to demonstrate how continuing research on the evolving ecology of these complex systems will help improve control strategies. In the future, such studies will be of increasing importance to understand how vector-borne diseases are spread in a changing world.

  16. Adult blood-feeding tsetse flies, trypanosomes, microbiota and the fluctuating environment in sub-Saharan Africa

    PubMed Central

    Geiger, Anne; Ponton, Fleur; Simo, Gustave

    2015-01-01

    The tsetse fly vector transmits the protozoan Trypanosoma brucei, responsible for Human African Trypanosomiasis, one of the most neglected tropical diseases. Despite a recent decline in new cases, it is still crucial to develop alternative strategies to combat this disease. Here, we review the literature on the factors that influence trypanosome transmission from the fly vector to its vertebrate host (particularly humans). These factors include climate change effects to pathogen and vector development (in particular climate warming), as well as the distribution of host reservoirs. Finally, we present reports on the relationships between insect vector nutrition, immune function, microbiota and infection, to demonstrate how continuing research on the evolving ecology of these complex systems will help improve control strategies. In the future, such studies will be of increasing importance to understand how vector-borne diseases are spread in a changing world. PMID:25500509

  17. Structure of the trypanosome haptoglobin–hemoglobin receptor and implications for nutrient uptake and innate immunity

    PubMed Central

    Higgins, Matthew K.; Tkachenko, Olga; Brown, Alan; Reed, Jenny; Raper, Jayne; Carrington, Mark

    2013-01-01

    African trypanosomes are protected by a densely packed surface monolayer of variant surface glycoprotein (VSG). A haptoglobin–hemoglobin receptor (HpHbR) within this VSG coat mediates heme acquisition. HpHbR is also exploited by the human host to mediate endocytosis of trypanolytic factor (TLF)1 from serum, contributing to innate immunity. Here, the crystal structure of HpHbR from Trypanosoma congolense has been solved, revealing an elongated three α-helical bundle with a small membrane distal head. To understand the receptor in the context of the VSG layer, the dimensions of Trypanosoma brucei HpHbR and VSG have been determined by small-angle X-ray scattering, revealing the receptor to be more elongated than VSG. It is, therefore, likely that the receptor protrudes above the VSG layer and unlikely that the VSG coat can prevent immunoglobulin binding to the receptor. The HpHb-binding site has been mapped by single-residue mutagenesis and surface plasmon resonance. This site is located where it is readily accessible above the VSG layer. A single HbHpR polymorphism unique to human infective T. brucei gambiense has been shown to be sufficient to reduce binding of both HpHb and TLF1, modulating ligand affinity in a delicate balancing act that allows nutrient acquisition but avoids TLF1 uptake. PMID:23319650

  18. Structure of the trypanosome haptoglobin-hemoglobin receptor and implications for nutrient uptake and innate immunity.

    PubMed

    Higgins, Matthew K; Tkachenko, Olga; Brown, Alan; Reed, Jenny; Raper, Jayne; Carrington, Mark

    2013-01-29

    African trypanosomes are protected by a densely packed surface monolayer of variant surface glycoprotein (VSG). A haptoglobin-hemoglobin receptor (HpHbR) within this VSG coat mediates heme acquisition. HpHbR is also exploited by the human host to mediate endocytosis of trypanolytic factor (TLF)1 from serum, contributing to innate immunity. Here, the crystal structure of HpHbR from Trypanosoma congolense has been solved, revealing an elongated three α-helical bundle with a small membrane distal head. To understand the receptor in the context of the VSG layer, the dimensions of Trypanosoma brucei HpHbR and VSG have been determined by small-angle X-ray scattering, revealing the receptor to be more elongated than VSG. It is, therefore, likely that the receptor protrudes above the VSG layer and unlikely that the VSG coat can prevent immunoglobulin binding to the receptor. The HpHb-binding site has been mapped by single-residue mutagenesis and surface plasmon resonance. This site is located where it is readily accessible above the VSG layer. A single HbHpR polymorphism unique to human infective T. brucei gambiense has been shown to be sufficient to reduce binding of both HpHb and TLF1, modulating ligand affinity in a delicate balancing act that allows nutrient acquisition but avoids TLF1 uptake.

  19. Trypanosoma brucei adenine-phosphoribosyltransferases mediate adenine salvage and aminopurinol susceptibility but not adenine toxicity.

    PubMed

    Lüscher, Alexandra; Lamprea-Burgunder, Estelle; Graf, Fabrice E; de Koning, Harry P; Mäser, Pascal

    2014-04-01

    African trypanosomes, like all obligate parasitic protozoa, cannot synthesize purines de novo and import purines from their hosts to build nucleic acids. The purine salvage pathways of Trypanosoma brucei being redundant, none of the involved enzymes is likely to be essential. Nevertheless they can be of pharmacological interest due to their role in activation of purine nucleobase or nucleoside analogues, which only become toxic when converted to nucleotides. Aminopurine antimetabolites, in particular, are potent trypanocides and even adenine itself is toxic to trypanosomes at elevated concentrations. Here we report on the T. brucei adenine phosphoribosyltransferases TbAPRT1 and TbAPRT2, encoded by the two genes Tb927.7.1780 and Tb927.7.1790, located in tandem on chromosome seven. The duplication is syntenic in all available Trypanosoma genomes but not in Leishmania. While TbAPRT1 is cytosolic, TbAPRT2 possesses a glycosomal targeting signal and co-localizes with the glycosomal marker aldolase. Interestingly, the distribution of glycosomal targeting signals among trypanosomatid adenine phosphoribosyltransferases is not consistent with their phylogeny, indicating that the acquisition of adenine salvage to the glycosome happened after the radiation of Trypanosoma. Double null mutant T. brucei Δtbaprt1,2 exhibited no growth phenotype but no longer incorporated exogenous adenine into the nucleotide pool. This, however, did not reduce their sensitivity to adenine. The Δtbaprt1,2 trypanosomes were resistant to the adenine isomer aminopurinol, indicating that it is activated by phosphoribosyl transfer. Aminopurinol was about 1000-fold more toxic to bloodstream-form T. brucei than the corresponding hypoxanthine isomer allopurinol. Aminopurinol uptake was not dependent on the aminopurine permease P2 that has been implicated in drug resistance.

  20. The susceptibility of Trypanosoma congolense and Trypanosoma brucei to isometamidium chloride and its synthetic impurities.

    PubMed

    Sahin, Annelise; Asencio, Corinne; Izotte, Julien; Pillay, Davita; Coustou, Virginie; Karembe, Hamadi; Baltz, Théo

    2014-07-14

    Since the 1950s, the chemotherapy of animal African trypanosomosis in cattle has essentially relied on only two compounds: isometamidium chloride (ISM), a phenanthridine, and diminazene aceturate, an aromatic diamidine. The commercial formulations of ISM, including Veridium(®) and Samorin(®), are a mixture of different compounds: ISM is the major component, mixed with the red isomer, blue isomer and disubstituted compound. To investigate the pharmacological effects of these individual compounds ISM, the blue and red isomers and the disubstituted compound were synthesised and purified by HPLC. The activity of each compound was analysed both in vitro, and in mice in vivo. For the in vitro analysis, a drug sensitivity assay was developed in 96-well tissue culture plates to determine the effective concentration which killed 50% of trypanosome population within 48 h of drug exposure (IC50). All compounds tested in vitro possessed trypanocidal activity, and purified ISM was the most active. Veridium(®) and Samorin(®) had similar IC50 values to purified ISM for both Trypanosoma congolense and Trypanosoma brucei brucei. The disubstituted compound had the highest IC50 values whereas intermediate IC50 values were obtained for the blue and red isomers. In vivo, single-dose tests were used to evaluate the trypanocidal and prophylactic activity against T. congolense. Interestingly, the prophylactic effect two months post treatment was as efficient with ISM, Veridium(®), Samorin(®) and the disubstituted compound at the highest dose of 1mg/kg whereas the red and blue isomers both showed much lower prophylactic activity. This study on T. congolense implies that it is necessary to limit the quantity of the blue and red isomers in the commercial mixture. Finally, the in vitro sensitivity assay may be useful for screening new trypanocides but also for the testing and detection of resistant trypanosome isolates.

  1. Trypanosoma evansi: identification and characterization of a variant surface glycoprotein lacking cysteine residues in its C-terminal domain.

    PubMed

    Jia, Yonggen; Zhao, Xinxin; Zou, Jingru; Suo, Xun

    2011-01-01

    African trypanosomes are flagellated unicellular parasites which proliferate extracellularly in the mammalian host blood-stream and tissue spaces. They evade the hosts' antibody-mediated lyses by sequentially changing their variant surface glycoprotein (VSG). VSG tightly coats the entire parasite body, serving as a physical barrier. In Trypanosoma brucei and the closely related species Trypanosoma evansi, Trypanosoma equiperdum, each VSG polypeptide can be divided into N- and C-terminal domains, based on cysteine distribution and sequence homology. N-terminal domain, the basis of antigenic variation, is hypervariable and contains all the exposed epitopes; C-terminal domain is relatively conserved and a full set of four or eight cysteines were generally observed. We cloned two genes from two distinct variants of T. evansi, utilizing RT-PCR with VSG-specific primers. One contained a VSG type A N-terminal domain followed a C-terminal domain lacking cysteine residues. To confirm that this gene is expressed as a functional VSG, the expression and localization of the corresponding gene product were characterized using Western blotting and immunofluorescent staining of living trypanosomes. Expression analysis showed that this protein was highly expressed, variant-specific, and had a ubiquitous cellular surface localization. All these results indicated that it was expressed as a functional VSG. Our finding showed that cysteine residues in VSG C-terminal domain were not essential; the conserved C-terminal domain generally in T. brucei like VSGs would possibly evolve for regulating the VSG expression.

  2. Structure of Trypanosoma brucei flagellum accounts for its bihelical motion

    PubMed Central

    Koyfman, Alexey Y.; Schmid, Michael F.; Gheiratmand, Ladan; Fu, Caroline J.; Khant, Htet A.; Huang, Dandan; He, Cynthia Y.; Chiu, Wah

    2011-01-01

    Trypanosoma brucei is a parasitic protozoan that causes African sleeping sickness. It contains a flagellum required for locomotion and viability. In addition to a microtubular axoneme, the flagellum contains a crystalline paraflagellar rod (PFR) and connecting proteins. We show here, by cryoelectron tomography, the structure of the flagellum in three bending states. The PFR lattice in straight flagella repeats every 56 nm along the length of the axoneme, matching the spacing of the connecting proteins. During flagellar bending, the PFR crystallographic unit cell lengths remain constant while the interaxial angles vary, similar to a jackscrew. The axoneme drives the expansion and compression of the PFR lattice. We propose that the PFR modifies the in-plane axoneme motion to produce the characteristic trypanosome bihelical motility as captured by high-speed light microscope videography. PMID:21690369

  3. The anatomy and transcription of a monocistronic expression site for a metacyclic variant surface glycoprotein gene in Trypanosoma brucei.

    PubMed

    Pedram, M; Donelson, J E

    1999-06-11

    African trypanosomes evade the immune response of their mammalian hosts by switching the expression of their variant surface glycoprotein genes (vsg). The bloodstream trypanosome clone MVAT4 of Trypanosoma brucei rhodesiense expresses a metacyclic vsg as a monocistronic RNA from a promoter located 2 kilobases (kb) upstream of its start codon. Determination of 23 kb of sequence at the metacyclic variant antigen type 4 (MVAT) vsg expression site (ES) revealed an ES-associated gene (esag) 1 preceded by an ingi retroposon and an inverted region containing an unrelated vsg, short stretches of 70-bp repeats and a pseudo esag 3. Nuclear run-on experiments indicate that the 18-kb region upstream of the MVAT4 vsg promoter is transcriptionally silent. However, multiple members of different esag families are expressed from elsewhere in the genome. The MVAT4 vsg promoter is highly repressed in the procyclic stage, in contrast to the known polycistronic vsg ESs which undergo abortive transcription. Activation of the MVAT4 vsg ES occurs in situ without nucleotide sequence changes, although this monocistronic ES undergoes a pattern of base J modifications similar to that reported for the polycistronic ESs. The relative simplicity of the MVAT4 vsg ES and the uncoupled expression of the vsg and esags provide a unique opportunity for investigating the molecular mechanisms responsible for antigenic variation in African trypanosomes.

  4. Virulence of Trypanosoma congolense strains isolated from cattle and African buffaloes (Syncerus caffer) in KwaZulu-Natal, South Africa.

    PubMed

    Motloang, Makhosazana Y; Masumu, Justin; Mans, Ben J; Latif, Abdalla A

    2014-12-01

    Trypanosoma congolense and Trypanosoma vivax are major species that infect cattle in north-eastern KwaZulu-Natal (KZN), South Africa. Of the two genetically distinct types of T. congolense, Savannah and Kilifi sub-groups, isolated from cattle and tsetse flies in KZN, the former is more prevalent and thought to be responsible for African animal trypanosomosis outbreaks in cattle. Furthermore, variation in pathogenicity within the Savannah sub-group is ascribed to strain differences and seems to be related to geographical locations. The objective of the present study was to compare the virulence of T. congolense strains isolated from African buffaloes (Syncerus caffer) inside Hluhluwe-iMfolozi Park, and from cattle on farms near wildlife parks (< 5 km), to isolates from cattle kept away (> 10 km) from parks. To obtain T. congolense isolates, blood of known parasitologically positive cattle or cattle symptomatically suspect with trypanosomosis, as well as isolates from buffaloes kept inside Hluhluwe-iMfolozi Park were passaged in inbred BALB/c mice. A total of 26 T. congolense isolates were obtained: 5 from buffaloes, 13 from cattle kept near parks and 8 from cattle distant from parks. Molecular characterisation revealed 80% and 20% of isolates to belong to T. congolense Savannah and Kilifi, respectively. To compare virulence, each isolate was inoculated into a group of six mice. No statistical differences were observed in the mean pre-patent period, maximum parasitaemia or drop in packed cell volume (PCV). Significant differences were found in days after infection for the drop in PCV, the patent period and the survival time. These differences were used to categorise the isolates as being of high, moderate or low virulence. Based on the virulence, 12 of 26 (46%) isolates were classified as highly virulent and 27% each as either of moderate or of low virulence. Whilst 11 of 12 high virulent strains were from buffaloes or cattle near the park, only 1 of 7 low virulent

  5. Identification of paralogous life-cycle stage specific cytoskeletal proteins in the parasite Trypanosoma brucei.

    PubMed

    Portman, Neil; Gull, Keith

    2014-01-01

    The life cycle of the African trypanosome Trypanosoma brucei, is characterised by a transition between insect and mammalian hosts representing very different environments that present the parasite with very different challenges. These challenges are met by the expression of life-cycle stage-specific cohorts of proteins, which function in systems such as metabolism and immune evasion. These life-cycle transitions are also accompanied by morphological rearrangements orchestrated by microtubule dynamics and associated proteins of the subpellicular microtubule array. Here we employed a gel-based comparative proteomic technique, Difference Gel Electrophoresis, to identify cytoskeletal proteins that are expressed differentially in mammalian infective and insect form trypanosomes. From this analysis we identified a pair of novel, paralogous proteins, one of which is expressed in the procyclic form and the other in the bloodstream form. We show that these proteins, CAP51 and CAP51V, localise to the subpellicular corset of microtubules and are essential for correct organisation of the cytoskeleton and successful cytokinesis in their respective life cycle stages. We demonstrate for the first time redundancy of function between life-cycle stage specific paralogous sets in the cytoskeleton and reveal modification of cytoskeletal components in situ prior to their removal during differentiation from the bloodstream form to the insect form. These specific results emphasise a more generic concept that the trypanosome genome encodes a cohort of cytoskeletal components that are present in at least two forms with life-cycle stage-specific expression.

  6. The extraordinary mitochondrion and unusual citric acid cycle in Trypanosoma brucei.

    PubMed

    van Hellemond, J J; Opperdoes, F R; Tielens, A G M

    2005-11-01

    African trypanosomes are parasitic protozoa that cause sleeping sickness and nagana. Trypanosomes are not only of scientific interest because of their clinical importance, but also because these protozoa contain several very unusual biological features, such as their specially adapted mitochondrion and the compartmentalization of glycolytic enzymes in glycosomes. The energy metabolism of Trypanosoma brucei differs significantly from that of their hosts and changes drastically during the life cycle. Despite the presence of all citric acid cycle enzymes in procyclic insect-stage T. brucei, citric acid cycle activity is not used for energy generation. Recent investigations on the influence of substrate availability on the type of energy metabolism showed that absence of glycolytic substrates did not induce a shift from a fermentative metabolism to complete oxidation of substrates. Apparently, insect-stage T. brucei use parts of the citric acid cycle for other purposes than for complete degradation of mitochondrial substrates. Parts of the cycle are suggested to be used for (i) transport of acetyl-CoA units from the mitochondrion to the cytosol for the biosynthesis of fatty acids, (ii) degradation of proline and glutamate to succinate, (iii) generation of malate, which can then be used for gluconeogenesis. Therefore the citric acid cycle in trypanosomes does not function as a cycle.

  7. The Role of Folate Transport in Antifolate Drug Action in Trypanosoma brucei*

    PubMed Central

    Dewar, Simon; Sienkiewicz, Natasha; Ong, Han B.; Wall, Richard J.; Horn, David

    2016-01-01

    The aim of this study was to identify and characterize mechanisms of resistance to antifolate drugs in African trypanosomes. Genome-wide RNAi library screens were undertaken in bloodstream form Trypanosoma brucei exposed to the antifolates methotrexate and raltitrexed. In conjunction with drug susceptibility and folate transport studies, RNAi knockdown was used to validate the functions of the putative folate transporters. The transport kinetics of folate and methotrexate were further characterized in whole cells. RNA interference target sequencing experiments identified a tandem array of genes encoding a folate transporter family, TbFT1–3, as major contributors to antifolate drug uptake. RNAi knockdown of TbFT1–3 substantially reduced folate transport into trypanosomes and reduced the parasite's susceptibly to the classical antifolates methotrexate and raltitrexed. In contrast, knockdown of TbFT1–3 increased susceptibly to the non-classical antifolates pyrimethamine and nolatrexed. Both folate and methotrexate transport were inhibited by classical antifolates but not by non-classical antifolates or biopterin. Thus, TbFT1–3 mediates the uptake of folate and classical antifolates in trypanosomes, and TbFT1–3 loss-of-function is a mechanism of antifolate drug resistance. PMID:27703008

  8. The challenge of Trypanosoma brucei gambiense sleeping sickness diagnosis outside Africa.

    PubMed

    Lejon, V; Boelaert, M; Jannin, J; Moore, A; Büscher, P

    2003-12-01

    Sleeping sickness is a lethal African disease caused by parasites of the Trypanosoma brucei subspecies, which is transmitted by tsetse flies. Occasionally, patients are reported outside Africa. Diagnosis of such imported cases can be problematic when the infection is due to Trypanosoma brucei gambiense, the chronic form of sleeping sickness found in west and central Africa. The low number of trypanosomes in the blood and the non-specific, variable symptoms make the diagnosis difficult, particularly when the index of suspicion is low. When the trypanosomes have penetrated into the central nervous system, neuropathological signs become apparent but even at this stage, misdiagnosis is frequent. Rapid and correct diagnosis of sleeping sickness can avoid inappropriate or delayed treatment and even death of the patient. In this article, an overview on diagnosis of imported cases of T b gambiense sleeping sickness is given, and possible pitfalls in the diagnostic process are highlighted. Bioclinical parameters that should raise the suspicion of sleeping sickness in a patient who has been in west or central Africa are discussed. Techniques for diagnosis are reviewed. A clinician suspecting sleeping sickness should contact a national reference centre for tropical medicine in his or her country, or the WHO, Geneva, Switzerland, or the Centers for Disease Control and Prevention (CDC), Atlanta, GA, USA, for clinical consultation and provision of specific diagnostic tests. Appropriate drugs for sleeping sickness treatment are also provided by WHO and the CDC.

  9. Disulfide bond involvement in the maintenance of the cryptic nature of the cross-reacting determinant of metacyclic forms of Trypanosoma congolense

    SciTech Connect

    Fish, W.R.; Muriuki, C.W.; Muthiani, A.M.; Grab, D.J.; Lonsdale-Eccles, J.D. )

    1989-06-27

    The variable surface glycoprotein (VSG) of African trypanosomes possesses a 1,2-dimyristoylglycosylphosphatidylinositol at the carboxy terminus. Cleavage of the 1,2-dimyristoylglycerol (1,2-DMG) moiety from the VSG reportedly results in a higher apparent molecular mass and an increased binding of antibodies against the cross-reacting determinant (CRD), a cryptic epitope present on most VSGs. Using metacyclic forms of Trypanosoma congolense, the authors show that the process involved are more complex than heretofore presumed and that the removal of the 1,2-DMG moiety may not be necessary for binding of anti-CRD antibodies (RxCRD). Among other findings, they observe the following: (1) in sonicated samples of trypanosomes metabolically labeled with ({sup 3}H)myristate, the binding of RxCRD on Western blots is coincident with bands containing labeled (membrane form) VSGs; (2) disulfide reduction of trypanosome sonicates suffices to promote RxCRD binding in the presence or absence of inhibitors of a glycosylphosphatidylinositol-specific phospholipase C; (3) trypanosomes directly solubilized in detergents show quantitative and qualitative differences in RxCRD binding which depend upon the detergent used and the order of addition of disulfide reducing agents. The authors conclude that the binding of RxCRD to T. congolense metacyclic VSGs depends upon the degree of unfolding of the molecule and is clearly a complex, multistep process in which structural changes and disulfide reduction play pivotal roles.

  10. MIF contributes to Trypanosoma brucei associated immunopathogenicity development.

    PubMed

    Stijlemans, Benoît; Leng, Lin; Brys, Lea; Sparkes, Amanda; Vansintjan, Liese; Caljon, Guy; Raes, Geert; Van Den Abbeele, Jan; Van Ginderachter, Jo A; Beschin, Alain; Bucala, Richard; De Baetselier, Patrick

    2014-09-01

    African trypanosomiasis is a chronic debilitating disease affecting the health and economic well-being of many people in developing countries. The pathogenicity associated with this disease involves a persistent inflammatory response, whereby M1-type myeloid cells, including Ly6C(high) inflammatory monocytes, are centrally implicated. A comparative gene analysis between trypanosusceptible and trypanotolerant animals identified MIF (macrophage migrating inhibitory factor) as an important pathogenic candidate molecule. Using MIF-deficient mice and anti-MIF antibody treated mice, we show that MIF mediates the pathogenic inflammatory immune response and increases the recruitment of inflammatory monocytes and neutrophils to contribute to liver injury in Trypanosoma brucei infected mice. Moreover, neutrophil-derived MIF contributed more significantly than monocyte-derived MIF to increased pathogenic liver TNF production and liver injury during trypanosome infection. MIF deficient animals also featured limited anemia, coinciding with increased iron bio-availability, improved erythropoiesis and reduced RBC clearance during the chronic phase of infection. Our data suggest that MIF promotes the most prominent pathological features of experimental trypanosome infections (i.e. anemia and liver injury), and prompt considering MIF as a novel target for treatment of trypanosomiasis-associated immunopathogenicity.

  11. Structure of the trypanosome cyanide-insensitive alternative oxidase

    PubMed Central

    Shiba, Tomoo; Kido, Yasutoshi; Sakamoto, Kimitoshi; Inaoka, Daniel Ken; Tsuge, Chiaki; Tatsumi, Ryoko; Takahashi, Gen; Balogun, Emmanuel Oluwadare; Nara, Takeshi; Aoki, Takashi; Honma, Teruki; Tanaka, Akiko; Inoue, Masayuki; Matsuoka, Shigeru; Saimoto, Hiroyuki; Moore, Anthony L.; Harada, Shigeharu; Kita, Kiyoshi

    2013-01-01

    In addition to haem copper oxidases, all higher plants, some algae, yeasts, molds, metazoans, and pathogenic microorganisms such as Trypanosoma brucei contain an additional terminal oxidase, the cyanide-insensitive alternative oxidase (AOX). AOX is a diiron carboxylate protein that catalyzes the four-electron reduction of dioxygen to water by ubiquinol. In T. brucei, a parasite that causes human African sleeping sickness, AOX plays a critical role in the survival of the parasite in its bloodstream form. Because AOX is absent from mammals, this protein represents a unique and promising therapeutic target. Despite its bioenergetic and medical importance, however, structural features of any AOX are yet to be elucidated. Here we report crystal structures of the trypanosomal alternative oxidase in the absence and presence of ascofuranone derivatives. All structures reveal that the oxidase is a homodimer with the nonhaem diiron carboxylate active site buried within a four-helix bundle. Unusually, the active site is ligated solely by four glutamate residues in its oxidized inhibitor-free state; however, inhibitor binding induces the ligation of a histidine residue. A highly conserved Tyr220 is within 4 Å of the active site and is critical for catalytic activity. All structures also reveal that there are two hydrophobic cavities per monomer. Both inhibitors bind to one cavity within 4 Å and 5 Å of the active site and Tyr220, respectively. A second cavity interacts with the inhibitor-binding cavity at the diiron center. We suggest that both cavities bind ubiquinol and along with Tyr220 are required for the catalytic cycle for O2 reduction. PMID:23487766

  12. Trypanosoma irwini n. sp (Sarcomastigophora: Trypanosomatidae) from the koala ( Phascolarctos cinereus).

    PubMed

    McInnes, L M; Gillett, A; Ryan, U M; Austen, J; Campbell, R S F; Hanger, J; Reid, S A

    2009-07-01

    The morphology and genetic characterization of a new species of trypanosome infecting koalas (Phascolarctos cinereus) are described. Morphological analysis of bloodstream forms and phylogenetic analysis at the 18S rDNA and gGAPDH loci demonstrated this trypanosome species to be genetically distinct and most similar to Trypanosoma bennetti, an avian trypanosome with a genetic distance of 0.9% at the 18S rDNA and 10.7% at the gGAPDH locus. The trypanosome was detected by 18S rDNA PCR in the blood samples of 26 out of 68 (38.2%) koalas studied. The aetiological role of trypanosomes in koala disease is currently poorly defined, although infection with these parasites has been associated with severe clinical signs in a number of koalas. Based on biological and genetic characterization data, this trypanosome species infecting koalas is proposed to be a new species Trypanosome irwini n. sp.

  13. Clinical presentation of human African trypanosomiasis in Zambia is linked to the existence of strains of Trypanosoma brucei rhodesiense with varied virulence: two case reports

    PubMed Central

    2014-01-01

    Introduction Trypanosoma brucei rhodesiense typically causes acute and severe human African trypanosomiasis in Zambia and other countries in Eastern and Southern Africa. Although a few atypical cases of chronic and mild forms of this disease were reported in Zambia more than 40 years ago, no such cases have been diagnosed over the last four decades. Case presentations For the first case, a 19-year-old Black African woman from the Eastern Province of Zambia presented with symptoms and signs of an atypical chronic and mild form of the disease for a period of 2 years. For the second case, a 16-year-old Black African boy from the Northern Province presented with symptoms and signs of a typical acute and severe form of the disease for 3 weeks. Conclusion Two strains of T. b. rhodesiense with varying degrees of virulence still do exist in Zambia. This has implications for control strategies at the national level. PMID:24529084

  14. Effects of Trypanocidal Drugs on the Function of Trypanosomes

    DTIC Science & Technology

    1983-06-30

    heart disease." The need for new trypanocides cannot be overemphasized. At present, chemotherapy of African trypanosomiasis is dependent on a...pathways in trypanosomes. BACKGROUND African trypanosomiasis is confined to Africa by the distribution of its vectors. T. gambiense infection occurs over a... trypanosomiasis of man and animals in Africa has been summarized recently by Kershaw (1) in the statement: " The World Health Organization in determining

  15. Effects of Trypanocidal Drugs on the Function of Trypanosomes.

    DTIC Science & Technology

    1980-09-01

    The need for new trypanocides cannor be overemphasized. At present, chemotherapy of African trypanosomiasis is dependent on a relatively small number...1976. Trypanosomiasis : an approach to chemotherapy by the inhibition of carbohydrate catabolism. Science 194: 204-206. 15. Bienen, E. J., Hammadi, E...components or metabolic pathways in trypanosomes; 4. The basis of the selective toxicity of known drugs. AM " , 5 BACKGROUND African trypanosomiasis is

  16. High affinity nanobodies against the Trypanosome brucei VSG are potent trypanolytic agents that block endocytosis.

    PubMed

    Stijlemans, Benoît; Caljon, Guy; Natesan, Senthil Kumar A; Saerens, Dirk; Conrath, Katja; Pérez-Morga, David; Skepper, Jeremy N; Nikolaou, Alexandros; Brys, Lea; Pays, Etienne; Magez, Stefan; Field, Mark C; De Baetselier, Patrick; Muyldermans, Serge

    2011-06-01

    The African trypanosome Trypanosoma brucei, which persists within the bloodstream of the mammalian host, has evolved potent mechanisms for immune evasion. Specifically, antigenic variation of the variant-specific surface glycoprotein (VSG) and a highly active endocytosis and recycling of the surface coat efficiently delay killing mediated by anti-VSG antibodies. Consequently, conventional VSG-specific intact immunoglobulins are non-trypanocidal in the absence of complement. In sharp contrast, monovalent antigen-binding fragments, including 15 kDa nanobodies (Nb) derived from camelid heavy-chain antibodies (HCAbs) recognizing variant-specific VSG epitopes, efficiently lyse trypanosomes both in vitro and in vivo. This Nb-mediated lysis is preceded by very rapid immobilisation of the parasites, massive enlargement of the flagellar pocket and major blockade of endocytosis. This is accompanied by severe metabolic perturbations reflected by reduced intracellular ATP-levels and loss of mitochondrial membrane potential, culminating in cell death. Modification of anti-VSG Nbs through site-directed mutagenesis and by reconstitution into HCAbs, combined with unveiling of trypanolytic activity from intact immunoglobulins by papain proteolysis, demonstrates that the trypanolytic activity of Nbs and Fabs requires low molecular weight, monovalency and high affinity. We propose that the generation of low molecular weight VSG-specific trypanolytic nanobodies that impede endocytosis offers a new opportunity for developing novel trypanosomiasis therapeutics. In addition, these data suggest that the antigen-binding domain of an anti-microbial antibody harbours biological functionality that is latent in the intact immunoglobulin and is revealed only upon release of the antigen-binding fragment.

  17. Lectins discriminate between pathogenic and nonpathogenic South American trypanosomes

    SciTech Connect

    de Miranda Santos, I.K.; Pereira, M.E.

    1984-09-01

    Cell surface carbohydrates of Trypanosoma cruzi, Trypanosoma rangeli, and Trypanosoma conorhini were analyzed by a micro-agglutination assay employing 27 highly purified lectins and by binding assays using various /sup 125/I-labeled lectins. The following seven lectins discriminated between the trypanosomes: 1) tomato lectin (an N-acetyl-D-glucosamine-binding protein), both in purified form and as crude tomato juice; 2) Bauhinea purpurea and Sophora japonica lectins (both N-acetyl-D-galactosamine-binding proteins), which selectively agglutinated T. cruzi; 3) Vicia villosa (an N-acetyl-D-galactosamine-binding protein) which was specific for T. rangeli; 4) peanut lectin (a D-galactose-binding protein) both in purified form and as crude saline extract; and 5) Ulex europaeus and Lotus tetragonolobus (both L-fucose-binding proteins) lectins which reacted only with T. conorhini. Binding studies with 125I-labeled lectins were performed to find whether unagglutinated cells of the three different species of trypanosomes might have receptors for these lectins, in which case absence of agglutination could be due to a peculiar arrangement of the receptors. These assays essentially confirmed the agglutination experiments.

  18. Lectins discriminate between pathogenic and nonpathogenic South American trypanosomes.

    PubMed

    de Miranda Santos, I K; Pereira, M E

    1984-09-01

    Cell surface carbohydrates of Trypanosoma cruzi, Trypanosoma rangeli, and Trypanosoma conorhini were analyzed by a micro-agglutination assay employing 27 highly purified lectins and by binding assays using various 125I-labeled lectins. The following seven lectins discriminated between the trypanosomes: 1) tomato lectin (an N-acetyl-D-glucosamine-binding protein), both in purified form and as crude tomato juice; 2) Bauhinea purpurea and Sophora japonica lectins (both N-acetyl-D-galactosamine-binding proteins), which selectively agglutinated T. cruzi; 3) Vicia villosa (an N-acetyl-D-galactosamine-binding protein) which was specific for T. rangeli; 4) peanut lectin (a D-galactose-binding protein) both in purified form and as crude saline extract; and 5) Ulex europaeus and Lotus tetragonolobus (both L-fucose-binding proteins) lectins which reacted only with T. conorhini. Binding studies with 125I-labeled lectins were performed to find whether unagglutinated cells of the three different species of trypanosomes might have receptors for these lectins, in which case absence of agglutination could be due to a peculiar arrangement of the receptors. These assays essentially confirmed the agglutination experiments.

  19. Specific Cell Targeting Therapy Bypasses Drug Resistance Mechanisms in African Trypanosomiasis

    PubMed Central

    Unciti-Broceta, Juan D.; Arias, José L.; Maceira, José; Soriano, Miguel; Ortiz-González, Matilde; Hernández-Quero, José; Muñóz-Torres, Manuel; de Koning, Harry P.; Magez, Stefan; Garcia-Salcedo, José A.

    2015-01-01

    African trypanosomiasis is a deadly neglected disease caused by the extracellular parasite Trypanosoma brucei. Current therapies are characterized by high drug toxicity and increasing drug resistance mainly associated with loss-of-function mutations in the transporters involved in drug import. The introduction of new antiparasitic drugs into therapeutic use is a slow and expensive process. In contrast, specific targeting of existing drugs could represent a more rapid and cost-effective approach for neglected disease treatment, impacting through reduced systemic toxicity and circumventing resistance acquired through impaired compound uptake. We have generated nanoparticles of chitosan loaded with the trypanocidal drug pentamidine and coated by a single domain nanobody that specifically targets the surface of African trypanosomes. Once loaded into this nanocarrier, pentamidine enters trypanosomes through endocytosis instead of via classical cell surface transporters. The curative dose of pentamidine-loaded nanobody-chitosan nanoparticles was 100-fold lower than pentamidine alone in a murine model of acute African trypanosomiasis. Crucially, this new formulation displayed undiminished in vitro and in vivo activity against a trypanosome cell line resistant to pentamidine as a result of mutations in the surface transporter aquaglyceroporin 2. We conclude that this new drug delivery system increases drug efficacy and has the ability to overcome resistance to some anti-protozoal drugs. PMID:26110623

  20. Specific Cell Targeting Therapy Bypasses Drug Resistance Mechanisms in African Trypanosomiasis.

    PubMed

    Unciti-Broceta, Juan D; Arias, José L; Maceira, José; Soriano, Miguel; Ortiz-González, Matilde; Hernández-Quero, José; Muñóz-Torres, Manuel; de Koning, Harry P; Magez, Stefan; Garcia-Salcedo, José A

    2015-06-01

    African trypanosomiasis is a deadly neglected disease caused by the extracellular parasite Trypanosoma brucei. Current therapies are characterized by high drug toxicity and increasing drug resistance mainly associated with loss-of-function mutations in the transporters involved in drug import. The introduction of new antiparasitic drugs into therapeutic use is a slow and expensive process. In contrast, specific targeting of existing drugs could represent a more rapid and cost-effective approach for neglected disease treatment, impacting through reduced systemic toxicity and circumventing resistance acquired through impaired compound uptake. We have generated nanoparticles of chitosan loaded with the trypanocidal drug pentamidine and coated by a single domain nanobody that specifically targets the surface of African trypanosomes. Once loaded into this nanocarrier, pentamidine enters trypanosomes through endocytosis instead of via classical cell surface transporters. The curative dose of pentamidine-loaded nanobody-chitosan nanoparticles was 100-fold lower than pentamidine alone in a murine model of acute African trypanosomiasis. Crucially, this new formulation displayed undiminished in vitro and in vivo activity against a trypanosome cell line resistant to pentamidine as a result of mutations in the surface transporter aquaglyceroporin 2. We conclude that this new drug delivery system increases drug efficacy and has the ability to overcome resistance to some anti-protozoal drugs.

  1. Active VSG expression sites in Trypanosoma brucei are depleted of nucleosomes.

    PubMed

    Stanne, Tara M; Rudenko, Gloria

    2010-01-01

    African trypanosomes regulate transcription differently from other eukaryotes. Most of the trypanosome genome is constitutively transcribed by RNA polymerase II (Pol II) as large polycistronic transcription units while the genes encoding the major surface proteins are transcribed by RNA polymerase I (Pol I). In bloodstream form Trypanosoma brucei, the gene encoding the variant surface glycoprotein (VSG) coat is expressed in a monoallelic fashion from one of about 15 VSG bloodstream form expression sites (BESs). Little is known about the chromatin structure of the trypanosome genome, and the chromatin state of active versus silent VSG BESs remains controversial. Here, we determined histone H3 occupancy within the genome of T. brucei, focusing on active versus silent VSG BESs in the bloodstream form. We found that histone H3 was most enriched in the nontranscribed 50-bp and 177-bp repeats and relatively depleted in Pol I, II, and III transcription units, with particular depletion over promoter regions. Using two isogenic T. brucei lines containing marker genes in different VSG BESs, we determined that histone H3 is 11- to 40-fold depleted from active VSG BESs compared with silent VSG BESs. Quantitative PCR analysis of fractionated micrococcal nuclease-digested chromatin revealed that the active VSG BES is depleted of nucleosomes. Therefore, in contrast to earlier views, nucleosome positioning appears to be involved in the monoalleleic control of VSG BESs in T. brucei. This may provide a level of epigenetic regulation enabling bloodstream form trypanosomes to efficiently pass on the transcriptional state of active and silent BESs to daughter cells.

  2. Molecular survey of rodent-borne Trypanosoma in Niger with special emphasis on T. lewisi imported by invasive black rats.

    PubMed

    Dobigny, Gauthier; Poirier, Philippe; Hima, Karmadine; Cabaret, Odile; Gauthier, Philippe; Tatard, Caroline; Costa, Jean-Marc; Bretagne, Stéphane

    2011-03-01

    Invading rodent species can harbor parasites with potential transmission to native rodents and/or humans. To investigate trypanosomes prevalence in rodents, the spleen of 76 rodents from Niger identified by their karyotype was used as a DNA source for Trypanosoma detection using a newly developed qPCR assay. Of the invasive black rat, Rattus rattus, 71% (10/14) were PCR positive as well as 6% (4/62) of native African rodents. Sequences of ~400bp of the SSU rDNA gene identified phylogenetically close Trypanosoma lineages. Trypanosoma lewisi was present in all positive black rats and the sequences displayed 100% similarity with T. lewisi-infected humans in Senegal. T. lewisi was also detected in one Acomys johannis, suggesting a possible transmission to native species. In addition to improved knowledge of Trypanosoma diversity in rodents, our data underscore the introduction of the potentially pathogenic T. lewisi kinetoplastid through the human-mediated invasion of black rats all over West Africa.

  3. Cell Surface Proteomics Provides Insight into Stage-Specific Remodeling of the Host-Parasite Interface in Trypanosoma brucei*

    PubMed Central

    Shimogawa, Michelle M.; Saada, Edwin A.; Vashisht, Ajay A.; Barshop, William D.; Wohlschlegel, James A.; Hill, Kent L.

    2015-01-01

    African trypanosomes are devastating human and animal pathogens transmitted by tsetse flies between mammalian hosts. The trypanosome surface forms a critical host interface that is essential for sensing and adapting to diverse host environments. However, trypanosome surface protein composition and diversity remain largely unknown. Here, we use surface labeling, affinity purification, and proteomic analyses to describe cell surface proteomes from insect-stage and mammalian bloodstream-stage Trypanosoma brucei. The cell surface proteomes contain most previously characterized surface proteins. We additionally identify a substantial number of novel proteins, whose functions are unknown, indicating the parasite surface proteome is larger and more diverse than generally appreciated. We also show stage-specific expression for individual paralogs within several protein families, suggesting that fine-tuned remodeling of the parasite surface allows adaptation to diverse host environments, while still fulfilling universally essential cellular needs. Our surface proteome analyses complement existing transcriptomic, proteomic, and in silico analyses by highlighting proteins that are surface-exposed and thereby provide a major step forward in defining the host-parasite interface. PMID:25963835

  4. Isolation and phylogenetic relationships of bat trypanosomes from different biomes in Mato Grosso, Brazil.

    PubMed

    Marcili, Arlei; da Costa, Andrea P; Soares, Herbert S; Acosta, Igor da C L; de Lima, Julia T R; Minervino, Antonio H H; Melo, Andréia T L; Aguiar, Daniel M; Pacheco, Richard C; Gennari, Solange M

    2013-12-01

    In the order Chiroptera, more than 30 trypanosome species belonging to the subgenera Herpetosoma, Schizotrypanum, Megatrypanum, and Trypanozoon have been described. The species Trypanosoma cruzi , Trypanosoma cruzi marinkellei, and Trypanosoma dionisii are the most common in bats and belong to the Schizotrypanum subgenus. Bats from 2 different biomes, Pantanal and Amazonia/Cerrado in the state of Mato Grosso, Brazil, were evaluated according to the presence of trypanosome parasites by means of hemoculture and PCR in primary samples (blood samples). A total of 211 bats from 20 different species were caught and the trypanosome prevalence, evaluated through hemoculture, was 9.0% (19), 15.5% (13), and 4.8% (6) in the municipalities of Confresa (Amazonia/Cerrado biome) and Poconé (Pantanal biome). Among the 123 primary samples obtained from the bats, only 3 (2.4%) were positive. Phylogenetic analysis using trypanosomatid barcoding (V7V8 region of SSU rDNA) identified all the isolates and primary samples as T. c. marinkellei. The sequences of the isolates were segregated according to the bat host genus or species and suggest that co-evolutionary patterns exist between hosts and parasites. Further studies in different Brazilian regions and biomes need to be conducted in order to gain real understanding of the diversity of trypanosomes in bats.

  5. Diversity of bats trypanosomes in hydroeletric area of Belo Monte in Brazilian Amazonia.

    PubMed

    da Costa, Andréa P; Nunes, Pablo Henrique; Leite, Beatriz Helena Santos; Ferreira, Juliana Isabel G da S; Tonhosolo, Renata; da Rosa, Adriana Ruckert; da Rocha, Patricio Adriano; Aires, Caroline Cotrim; Gennari, Solange Maria; Marcili, Arlei

    2016-12-01

    The Trypanosoma comprises flagellates able to infect many mammalian species and is transmitted by several groups of invertebrates. The order Chiroptera can be infected by the subgenera Herpetosoma, Schizotrypanum, Megatrypanum and Trypanozoon. In this study, we described the diversity of bats trypanosomes, inferring the phylogenetic relationships among the trypanosomes from bats caught Belo Monte Hydroeletric area (Brazilian Amazonia). Trypanosomes from bats were isolated by haemoculture, and the molecular phylogeny based on small subunit rDNA (SSU rDNA) and glycosomal-3-phosphate dehydrogenase (gGAPDH) gene sequences. Morphological characterization included light and scanning electron microscopy. A total of 157 bats were caught in the area belonging 6 Families (Emballonuridae, Furipteridae, Mormoopidae, Natalidae, Phyllostomidae and Vespertilionidae) and 34 species. The bat trypanosome prevalence, as evaluated through haemoculture, was 5,7%. Phylogenetic trees grouped the isolates in T. cruzi branch (TCI and TCbat lineage), T. cruzi marinkellei and Trypanosoma wauwau from Pteronotus parnellii. This is the first isolate from T. wauwau in Para state. The occurrence of T. cruzi in the ​​ Belo Monte Hydroeletric area (UHE Belo Monte) in Amazon/Brazil attentive to the risk of migration human population required for the works of the dam and new cities that grow in the vicinity of these businesses, but it is a zoonosis already known to the Amazon region, and the presence of unclassified Trypanosoma species, attend to the large parasitic biodiversity still unknown.

  6. Molecular detection of equine trypanosomes in the Sudan.

    PubMed

    Salim, Bashir; Bakheit, Mohammed Ahmed; Sugimoto, Chihiro

    2014-03-01

    Equine trypanosomosis (ET) is a protozoan disease affecting equines in many parts of the world. We examined 509 samples collected from geographically distinct regions in eastern, central and western Sudan to estimate the endemicity of ET using the generic ITS1-PCR diagnostic methods. Results revealed that horses and donkeys were infected by Trypanosoma brucei subgroup, Trypanosoma vivax, Trypanosoma simiae and Trypanosoma congolense. The prevalence of Trypanosoma spp. was higher in horses (12.7%, n=393) than in donkeys (3.4%, n=116). The highest prevalence was observed in South Darfur State (19.3%, n=202), followed by Kassala State (15.1%, n=86), Gadaref State (3.7%, n=82), and Khartoum State (2.6%, n=76). No trypanosomes were detected in the 63 samples collected from North Kurdofan State. We report for the first time the presence of T. simiae and T. congolense in horses in the Sudan. This study should alert veterinary services, authorized bodies to take action toward ET by undertaking countrywide epidemiological studies of the disease and adopting control strategies.

  7. Discovery of a Carbazole-Derived Lead Drug for Human African Trypanosomiasis

    PubMed Central

    Thomas, Sarah M.; Purmal, Andrei; Pollastri, Michael; Mensa-Wilmot, Kojo

    2016-01-01

    The protozoan parasite Trypanosoma brucei causes the fatal illness human African trypanosomiasis (HAT). Standard of care medications currently used to treat HAT have severe limitations, and there is a need to find new chemical entities that are active against infections of T. brucei. Following a “drug repurposing” approach, we tested anti-trypanosomal effects of carbazole-derived compounds called “Curaxins”. In vitro screening of 26 compounds revealed 22 with nanomolar potency against axenically cultured bloodstream trypanosomes. In a murine model of HAT, oral administration of compound 1 cured the disease. These studies established 1 as a lead for development of drugs against HAT. Pharmacological time-course studies revealed the primary effect of 1 to be concurrent inhibition of mitosis coupled with aberrant licensing of S-phase entry. Consequently, polyploid trypanosomes containing 8C equivalent of DNA per nucleus and three or four kinetoplasts were produced. These effects of 1 on the trypanosome are reminiscent of “mitotic slippage” or endoreplication observed in some other eukaryotes. PMID:27561392

  8. Statistical analysis of trypanosomes' motility

    NASA Astrophysics Data System (ADS)

    Zaburdaev, Vasily; Uppaluri, Sravanti; Pfohl, Thomas; Engstler, Markus; Stark, Holger; Friedrich, Rudolf

    2010-03-01

    Trypanosome is a parasite causing the sleeping sickness. The way it moves in the blood stream and penetrates various obstacles is the area of active research. Our goal was to investigate a free trypanosomes' motion in the planar geometry. Our analysis of trypanosomes' trajectories reveals that there are two correlation times - one is associated with a fast motion of its body and the second one with a slower rotational diffusion of the trypanosome as a point object. We propose a system of Langevin equations to model such motion. One of its peculiarities is the presence of multiplicative noise predicting higher level of noise for higher velocity of the trypanosome. Theoretical and numerical results give a comprehensive description of the experimental data such as the mean squared displacement, velocity distribution and auto-correlation function.

  9. Activities of Psilostachyin A and Cynaropicrin against Trypanosoma cruzi In Vitro and In Vivo

    PubMed Central

    da Silva, Cristiane França; Batista, Denise da Gama Jaen; De Araújo, Julianna Siciliano; Batista, Marcos Meuser; Lionel, Jessica; de Souza, Elen Mello; Hammer, Erica Ripoll; da Silva, Patricia Bernardino; De Mieri, Maria; Adams, Michael; Zimmermann, Stefanie; Hamburger, Matthias; Brun, Reto; Schühly, Wolfgang

    2013-01-01

    In vitro and in vivo activities against Trypanosoma cruzi were evaluated for two sesquiterpene lactones: psilostachyin A and cynaropicrin. Cynaropicrin had previously been shown to potently inhibit African trypanosomes in vivo, and psilostachyin A had been reported to show in vivo effects against T. cruzi, albeit in another test design. In vitro data showed that cynaropicrin was more effective than psilostachyin A. Ultrastructural alterations induced by cynaropicrin included shedding events, detachment of large portions of the plasma membrane, and vesicular bodies and large vacuoles containing membranous structures, suggestive of parasite autophagy. Acute toxicity studies showed that one of two mice died at a cynaropicrin dose of 400 mg/kg of body weight given intraperitoneally (i.p.). Although no major plasma biochemical alterations could be detected, histopathology demonstrated that the liver was the most affected organ in cynaropicrin-treated animals. Although cynaropicrin was as effective as benznidazole against trypomastigotes in vitro, the treatment (once or twice a day) of T. cruzi-infected mice (up to 50 mg/kg/day cynaropicrin) did not suppress parasitemia or protect against mortality induced by the Y and Colombiana strains. Psilostachyin A (0.5 to 50 mg/kg/day given once a day) was not effective in the acute model of T. cruzi infection (Y strain), reaching 100% animal mortality. Our data demonstrate that although it is very promising against African trypanosomes, cynaropicrin does not show efficacy compared to benznidazole in acute mouse models of T. cruzi infection. PMID:23939901

  10. Phylogenetic Analysis of Bolivian Bat Trypanosomes of the Subgenus Schizotrypanum Based on Cytochrome b Sequence and Minicircle Analyses

    PubMed Central

    García, Lineth; Ortiz, Sylvia; Osorio, Gonzalo; Torrico, Mary Cruz; Torrico, Faustino; Solari, Aldo

    2012-01-01

    The aim of this study was to establish the phylogenetic relationships of trypanosomes present in blood samples of Bolivian Carollia bats. Eighteen cloned stocks were isolated from 115 bats belonging to Carollia perspicillata (Phyllostomidae) from three Amazonian areas of the Chapare Province of Bolivia and studied by xenodiagnosis using the vectors Rhodnius robustus and Triatoma infestans (Trypanosoma cruzi marenkellei) or haemoculture (Trypanosoma dionisii). The PCR DNA amplified was analyzed by nucleotide sequences of maxicircles encoding cytochrome b and by means of the molecular size of hyper variable regions of minicircles. Ten samples were classified as Trypanosoma cruzi marinkellei and 8 samples as Trypanosoma dionisii. The two species have a different molecular size profile with respect to the amplified regions of minicircles and also with respect to Trypanosoma cruzi and Trypanosoma rangeli used for comparative purpose. We conclude the presence of two species of bat trypanosomes in these samples, which can clearly be identified by the methods used in this study. The presence of these trypanosomes in Amazonian bats is discussed. PMID:22590570

  11. Inositol phosphate pathway controls transcription of telomeric expression sites in trypanosomes.

    PubMed

    Cestari, Igor; Stuart, Ken

    2015-05-26

    African trypanosomes evade clearance by host antibodies by periodically changing their variant surface glycoprotein (VSG) coat. They transcribe only one VSG gene at a time from 1 of about 20 telomeric expression sites (ESs). They undergo antigenic variation by switching transcription between telomeric ESs or by recombination of the VSG gene expressed. We show that the inositol phosphate (IP) pathway controls transcription of telomeric ESs and VSG antigenic switching in Trypanosoma brucei. Conditional knockdown of phosphatidylinositol 5-kinase (TbPIP5K) or phosphatidylinositol 5-phosphatase (TbPIP5Pase) or overexpression of phospholipase C (TbPLC) derepresses numerous silent ESs in T. brucei bloodstream forms. The derepression is specific to telomeric ESs, and it coincides with an increase in the number of colocalizing telomeric and RNA polymerase I foci in the nucleus. Monoallelic VSG transcription resumes after reexpression of TbPIP5K; however, most of the resultant cells switched the VSG gene expressed. TbPIP5K, TbPLC, their substrates, and products localize to the plasma membrane, whereas TbPIP5Pase localizes to the nucleus proximal to telomeres. TbPIP5Pase associates with repressor/activator protein 1 (TbRAP1), and their telomeric silencing function is altered by TbPIP5K knockdown. These results show that specific steps in the IP pathway control ES transcription and antigenic switching in T. brucei by epigenetic regulation of telomere silencing.

  12. Inositol phosphate pathway controls transcription of telomeric expression sites in trypanosomes

    PubMed Central

    Cestari, Igor; Stuart, Ken

    2015-01-01

    African trypanosomes evade clearance by host antibodies by periodically changing their variant surface glycoprotein (VSG) coat. They transcribe only one VSG gene at a time from 1 of about 20 telomeric expression sites (ESs). They undergo antigenic variation by switching transcription between telomeric ESs or by recombination of the VSG gene expressed. We show that the inositol phosphate (IP) pathway controls transcription of telomeric ESs and VSG antigenic switching in Trypanosoma brucei. Conditional knockdown of phosphatidylinositol 5-kinase (TbPIP5K) or phosphatidylinositol 5-phosphatase (TbPIP5Pase) or overexpression of phospholipase C (TbPLC) derepresses numerous silent ESs in T. brucei bloodstream forms. The derepression is specific to telomeric ESs, and it coincides with an increase in the number of colocalizing telomeric and RNA polymerase I foci in the nucleus. Monoallelic VSG transcription resumes after reexpression of TbPIP5K; however, most of the resultant cells switched the VSG gene expressed. TbPIP5K, TbPLC, their substrates, and products localize to the plasma membrane, whereas TbPIP5Pase localizes to the nucleus proximal to telomeres. TbPIP5Pase associates with repressor/activator protein 1 (TbRAP1), and their telomeric silencing function is altered by TbPIP5K knockdown. These results show that specific steps in the IP pathway control ES transcription and antigenic switching in T. brucei by epigenetic regulation of telomere silencing. PMID:25964327

  13. In vivo imaging of trypanosome-brain interactions and development of a rapid screening test for drugs against CNS stage trypanosomiasis.

    PubMed

    Myburgh, Elmarie; Coles, Jonathan A; Ritchie, Ryan; Kennedy, Peter G E; McLatchie, Alex P; Rodgers, Jean; Taylor, Martin C; Barrett, Michael P; Brewer, James M; Mottram, Jeremy C

    2013-01-01

    HUMAN AFRICAN TRYPANOSOMIASIS (HAT) MANIFESTS IN TWO STAGES OF DISEASE: firstly, haemolymphatic, and secondly, an encephalitic phase involving the central nervous system (CNS). New drugs to treat the second-stage disease are urgently needed, yet testing of novel drug candidates is a slow process because the established animal model relies on detecting parasitemia in the blood as late as 180 days after treatment. To expedite compound screening, we have modified the GVR35 strain of Trypanosoma brucei brucei to express luciferase, and have monitored parasite distribution in infected mice following treatment with trypanocidal compounds using serial, non-invasive, bioluminescence imaging. Parasites were detected in the brains of infected mice following treatment with diminazene, a drug which cures stage 1 but not stage 2 disease. Intravital multi-photon microscopy revealed that trypanosomes enter the brain meninges as early as day 5 post-infection but can be killed by diminazene, whereas those that cross the blood-brain barrier and enter the parenchyma by day 21 survived treatment and later caused bloodstream recrudescence. In contrast, all bioluminescent parasites were permanently eliminated by treatment with melarsoprol and DB829, compounds known to cure stage 2 disease. We show that this use of imaging reduces by two thirds the time taken to assess drug efficacy and provides a dual-modal imaging platform for monitoring trypanosome infection in different areas of the brain.

  14. The Cyclical Development of Trypanosoma vivax in the Tsetse Fly Involves an Asymmetric Division

    PubMed Central

    Ooi, Cher-Pheng; Schuster, Sarah; Cren-Travaillé, Christelle; Bertiaux, Eloise; Cosson, Alain; Goyard, Sophie; Perrot, Sylvie; Rotureau, Brice

    2016-01-01

    Trypanosoma vivax is the most prevalent trypanosome species in African cattle. It is thought to be transmitted by tsetse flies after cyclical development restricted to the vector mouthparts. Here, we investigated the kinetics of T. vivax development in Glossina morsitans morsitans by serial dissections over 1 week to reveal differentiation and proliferation stages. After 3 days, stable numbers of attached epimastigotes were seen proliferating by symmetric division in the cibarium and proboscis, consistent with colonization and maintenance of a parasite population for the remaining lifespan of the tsetse fly. Strikingly, some asymmetrically dividing cells were also observed in proportions compatible with a continuous production of pre- metacyclic trypomastigotes. The involvement of this asymmetric division in T. vivax metacyclogenesis is discussed and compared to other trypanosomatids. PMID:27734008

  15. Delineation of the regulated Variant Surface Glycoprotein gene expression site domain of Trypanosoma brucei.

    PubMed

    Sheader, Karen; Berberof, Magali; Isobe, Tomoko; Borst, Piet; Rudenko, Gloria

    2003-05-01

    The African trypanosome Trypanosoma brucei is protected in the bloodstream of the mammalian host by a dense Variant Surface Glycoprotein (VSG) coat. Although an individual cell has hundreds of VSG genes, the active VSG is transcribed in a mutually exclusive fashion from one of about twenty telomeric VSG expression sites. Expression sites are regulated domains flanked by 50 bp repeat arrays and extensive tracts of repetitive elements. We have integrated exogenous rDNA and expression site promoters upstream of the 50 bp repeats of the VO2 VSG expression site. Transcription from both types of exogenous promoter is downregulated and comparable to promoters targeted into the VSG Basic Copy arrays. We show that the upstream exogenous rDNA promoter escapes VSG expression site control, as switching the downstream VO2 VSG expression site on and off does not affect its activity. Therefore, the 50 bp repeat arrays appear to be the boundary of the regulated expression site domain.

  16. Morphological and molecular characterization of a marine fish trypanosome from South Africa, including its development in a leech vector

    PubMed Central

    2014-01-01

    and molecular methods indicate that the trypanosomes examined here represent a single pleomorphic species, rather than the three species described originally. This species is identified as Trypanosoma nudigobii Fantham, 1919 with the leech Z. arugamensis as its vector, and T. capigobii Fantham, 1919 and T. blenniclini Fantham, 1930 are regarded as junior synonyms of the species. Phylogenetic analysis establishes its affinity with marine fish trypanosomes off Norway. PMID:24460725

  17. Control of gene expression in trypanosomes.

    PubMed Central

    Vanhamme, L; Pays, E

    1995-01-01

    Trypanosomes are protozoan agents of major parasitic diseases such as Chagas' disease in South America and sleeping sickness of humans and nagana disease of cattle in Africa. They are transmitted to mammalian hosts by specific insect vectors. Their life cycle consists of a succession of differentiation and growth phases requiring regulated gene expression to adapt to the changing extracellular environment. Typical of such stage-specific expression is that of the major surface antigens of Trypanosoma brucei, procyclin in the procyclic (insect) form and the variant surface glycoprotein (VSG) in the bloodstream (mammalian) form. In trypanosomes, the regulation of gene expression is effected mainly at posttranscriptional levels, since primary transcription of most of the genes occurs in long polycistronic units and is constitutive. The transcripts are processed by transsplicing and polyadenylation under the influence of intergenic polypyrimidine tracts. These events show some developmental regulation. Untranslated sequences of the mRNAs seem to play a prominent role in the stage-specific control of individual gene expression, through a modulation of mRNA abundance. The VSG and procyclin transcription units exhibit particular features that are probably related to the need for a high level of expression. The promoters and RNA polymerase driving the expression of these units resemble those of the ribosomal genes. Their mutually exclusive expression is ensured by controls operating at several levels, including RNA elongation. Antigenic variation in the bloodstream is achieved through DNA rearrangements or alternative activation of the telomeric VSG gene expression sites. Recent discoveries, such as the existence of a novel nucleotide in telomeric DNA and the generation of point mutations in VSG genes, have shed new light on the mechanisms and consequences of antigenic variation. PMID:7603410

  18. Trypanosoma teixeirae: A new species belonging to the T. cruzi clade causing trypanosomosis in an Australian little red flying fox (Pteropus scapulatus).

    PubMed

    Barbosa, Amanda D; Mackie, John T; Stenner, Robyn; Gillett, Amber; Irwin, Peter; Ryan, Una

    2016-06-15

    Little is known about the genetic diversity and pathogenicity of trypanosomes in Australian bats. Recently a novel trypanosome species was identified in an adult female little red flying fox (Pteropus scapulatus) with clinical and pathological evidence of trypanosomosis. The present study used morphology and molecular methods to demonstrate that this trypanosome is a distinct species and we propose the name Trypanosoma teixeirae sp. n. Morphological comparison showed that its circulating trypomastigotes were significantly different from those of Trypanosoma pteropi and Trypanosoma hipposideri, two species previously described from Australian bats. Genetic information was not available for T. pteropi and T. hipposideri but phylogenetic analyses at the 18S ribosomal RNA (rRNA) and glycosomal glyceraldehyde phosphate dehydrogenase (gGAPDH) loci indicated that T. teixeirae sp. n. was genetically distinct and clustered with other bat-derived trypanosome species within the Trypanosoma cruzi clade.

  19. The life cycle of Trypanosoma (Nannomonas) congolense in the tsetse fly

    PubMed Central

    2012-01-01

    Background The tsetse-transmitted African trypanosomes cause diseases of importance to the health of both humans and livestock. The life cycles of these trypanosomes in the fly were described in the last century, but comparatively few details are available for Trypanosoma (Nannomonas) congolense, despite the fact that it is probably the most prevalent and widespread pathogenic species for livestock in tropical Africa. When the fly takes up bloodstream form trypanosomes, the initial establishment of midgut infection and invasion of the proventriculus is much the same in T. congolense and T. brucei. However, the developmental pathways subsequently diverge, with production of infective metacyclics in the proboscis for T. congolense and in the salivary glands for T. brucei. Whereas events during migration from the proventriculus are understood for T. brucei, knowledge of the corresponding developmental pathway in T. congolense is rudimentary. The recent publication of the genome sequence makes it timely to re-investigate the life cycle of T. congolense. Methods Experimental tsetse flies were fed an initial bloodmeal containing T. congolense strain 1/148 and dissected 2 to 78 days later. Trypanosomes recovered from the midgut, proventriculus, proboscis and cibarium were fixed and stained for digital image analysis. Trypanosomes contained in spit samples from individually caged flies were analysed similarly. Mensural data from individual trypanosomes were subjected to principal components analysis. Results Flies were more susceptible to infection with T. congolense than T. brucei; a high proportion of flies infected with T. congolense established a midgut and subsequent proboscis infection, whereas many T. brucei infections were lost in the migration from foregut to salivary glands. In T. congolense, trypomastigotes ceased division in the proventriculus and became uniform in size. The trypanosomes retained trypomastigote morphology during migration via the foregut to the

  20. Lipid metabolism in Trypanosoma brucei

    PubMed Central

    Smith, Terry K.; Bütikofer, Peter

    2013-01-01

    Trypanosoma brucei membranes consist of all major eukaryotic glycerophospholipid and sphingolipid classes. These are de novo synthesized from precursors obtained either from the host or from catabolised endocytosed lipids. In recent years, substantial progress has been made in the molecular and biochemical characterisation of several of these lipid biosynthetic pathways, using gene knockout or RNA interference strategies or by enzymatic characterization of individual reactions. Together with the completed genome, these studies have highlighted several possible differences between mammalian and trypanosome lipid biosynthesis that could be exploited for the development of drugs against the diseases caused by these parasites. PMID:20382188

  1. Phylogenetic analysis of the Trypanosoma genus based on the heat-shock protein 70 gene.

    PubMed

    Fraga, Jorge; Fernández-Calienes, Aymé; Montalvo, Ana Margarita; Maes, Ilse; Deborggraeve, Stijn; Büscher, Philippe; Dujardin, Jean-Claude; Van der Auwera, Gert

    2016-09-01

    Trypanosome evolution was so far essentially studied on the basis of phylogenetic analyses of small subunit ribosomal RNA (SSU-rRNA) and glycosomal glyceraldehyde-3-phosphate dehydrogenase (gGAPDH) genes. We used for the first time the 70kDa heat-shock protein gene (hsp70) to investigate the phylogenetic relationships among 11 Trypanosoma species on the basis of 1380 nucleotides from 76 sequences corresponding to 65 strains. We also constructed a phylogeny based on combined datasets of SSU-rDNA, gGAPDH and hsp70 sequences. The obtained clusters can be correlated with the sections and subgenus classifications of mammal-infecting trypanosomes except for Trypanosoma theileri and Trypanosoma rangeli. Our analysis supports the classification of Trypanosoma species into clades rather than in sections and subgenera, some of which being polyphyletic. Nine clades were recognized: Trypanosoma carassi, Trypanosoma congolense, Trypanosoma cruzi, Trypanosoma grayi, Trypanosoma lewisi, T. rangeli, T. theileri, Trypanosoma vivax and Trypanozoon. These results are consistent with existing knowledge of the genus' phylogeny. Within the T. cruzi clade, three groups of T. cruzi discrete typing units could be clearly distinguished, corresponding to TcI, TcIII, and TcII+V+VI, while support for TcIV was lacking. Phylogenetic analyses based on hsp70 demonstrated that this molecular marker can be applied for discriminating most of the Trypanosoma species and clades.

  2. Screening North American plant extracts in vitro against Trypanosoma brucei, the causative agent for Human African Trypanosomiasis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Natural products extracts from 522 plants collected from different parts of the North America were screened in vitro against trypamastigote forms of Trypanosoma brucei. The active extracts(150)with >90% inhibition at 20ug/mL concentrations from the plants namely, Alnus rubra, Hoita macrostachya, S...

  3. The essential neutral sphingomyelinase is involved in the trafficking of the variant surface glycoprotein in the bloodstream form of Trypanosoma brucei

    PubMed Central

    Young, Simon A; Smith, Terry K

    2010-01-01

    Sphingomyelin is the main sphingolipid in Trypanosoma brucei, the causative agent of African sleeping sickness. In vitro and in vivo characterization of the T. brucei neutral sphingomyelinase demonstrates that it is directly involved in sphingomyelin catabolism. Gene knockout studies in the bloodstream form of the parasite indicate that the neutral sphingomyelinase is essential for growth and survival, thus highlighting that the de novo biosynthesis of ceramide is unable to compensate for the loss of sphingomyelin catabolism. The phenotype of the conditional knockout has given new insights into the highly active endocytic and exocytic pathways in the bloodstream form of T. brucei. Hence, the formation of ceramide in the endoplasmic reticulum affects post-Golgi sorting and rate of deposition of newly synthesized GPI-anchored variant surface glycoprotein on the cell surface. This directly influences the corresponding rate of endocytosis, via the recycling endosomes, of pre-existing cell surface variant surface glycoprotein. The trypanosomes use this coupled endocytic and exocytic mechanism to maintain the cell density of its crucial variant surface glycoprotein protective coat. TbnSMase is therefore genetically validated as a drug target against African trypanosomes, and suggests that interfering with the endocytic transport of variant surface glycoprotein is a highly desirable strategy for drug development against African trypanosomasis. PMID:20398210

  4. Antioxidant Therapy Against Trypanosome Infections: A Review Update.

    PubMed

    Ibrahim, Mohammed Auwal; Bindawa Isah, Murtala; Abdullahi Salman, Abdulmalik

    2016-01-01

    Trypanosomiasis is a serious parasitic disease that affects humans and animals resulting in heavy health and economic burdens. Disturbance of redox equilibrium represents a classical challenge for both the host and the parasite during infections with either extracellular African or intracellular American trypanosomes species. This is in spite of existing detoxification mechanisms in both the host and the parasite for maintaining oxidative balance. However, oxidative stress still plays vital roles in the induction of numerous host-associated pathological damages such as anemia, hepatic and renal damages as well as cardiomyopathy while on the other hand, drugs that specifically induce oxidative stress to the parasite have been effective. Therefore, antioxidants have been deemed to play a role in modulating trypanosome infections. This review provides a current update on most of the studies conducted on the potential use of antioxidants as therapeutic agents against trypanosomes. The most frequently studied plant-derived phenolic antioxidants are resveratrol, cucurmin, gallic acid and quercetin while other antioxidants such as vitamins (A, C, E) and trace elements (selenium and iron) have been investigated. Some of the investigations monitored the direct trypanocidal or trypanostatic effects of the antioxidants while others studied the potentials of the antioxidants as adjuncts to trypanocidal drugs. So far, none of these approaches has sufficient data to allow a definite statement on the actual therapeutic potential of antioxidants in the treatment of clinical trypanosomiasis. Therefore, suggestions are made on the most therapeutically and clinically relevant role of antioxidants in trypanosome infections.

  5. New Insights into the Molecular Mechanisms of Mitosis and Cytokinesis in Trypanosomes

    PubMed Central

    Zhou, Qing; Hu, Huiqing; Li, Ziyin

    2015-01-01

    Trypanosoma brucei, a unicellular eukaryote and the causative agent of human sleeping sickness, possesses multiple single-copy organelles that all need to be duplicated and segregated during cell division. Trypanosomes undergo a closed mitosis in which the mitotic spindle is anchored on the nuclear envelope and connects the kinetochores made of novel protein components. Cytokinesis in trypanosomes is initiated from the anterior tip of the new flagellum attachment zone, and proceeds along the longitudinal axis without the involvement of the actomyosin contractile ring, the well-recognized cytokinesis machinery conserved from yeast to humans. Trypanosome appears to employ both evolutionarily conserved and trypanosome-specific proteins to regulate its cell cycle, and has evolved certain cell cycle regulatory pathways that are either distinct between its life cycle stages or different from its human host. Understanding the mechanisms of mitosis and cytokinesis in trypanosomes not only would shed novel light on the evolution of cell cycle control, but also could provide new drug targets for chemotherapy. PMID:24411171

  6. Trypanocidal action of bisphosphonium salts through a mitochondrial target in bloodstream form Trypanosoma brucei

    PubMed Central

    Alkhaldi, Abdulsalam A.M.; Martinek, Jan; Panicucci, Brian; Dardonville, Christophe; Zíková, Alena; de Koning, Harry P.

    2015-01-01

    Lipophilic bisphosphonium salts are among the most promising antiprotozoal leads currently under investigation. As part of their preclinical evaluation we here report on their mode of action against African trypanosomes, the etiological agents of sleeping sickness. The bisphosphonium compounds CD38 and AHI-9 exhibited rapid inhibition of Trypanosoma brucei growth, apparently the result of cell cycle arrest that blocked the replication of mitochondrial DNA, contained in the kinetoplast, thereby preventing the initiation of S-phase. Incubation with either compound led to a rapid reduction in mitochondrial membrane potential, and ATP levels decreased by approximately 50% within 1 h. Between 4 and 8 h, cellular calcium levels increased, consistent with release from the depolarized mitochondria. Within the mitochondria, the Succinate Dehydrogenase complex (SDH) was investigated as a target for bisphosphonium salts, but while its subunit 1 (SDH1) was present at low levels in the bloodstream form trypanosomes, the assembled complex was hardly detectable. RNAi knockdown of the SDH1 subunit produced no growth phenotype, either in bloodstream or in the procyclic (insect) forms and we conclude that in trypanosomes SDH is not the target for bisphosphonium salts. Instead, the compounds inhibited ATP production in intact mitochondria, as well as the purified F1 ATPase, to a level that was similar to 1 mM azide. Co-incubation with azide and bisphosphonium compounds did not inhibit ATPase activity more than either product alone. The results show that, in T. brucei, bisphosphonium compounds do not principally act on succinate dehydrogenase but on the mitochondrial FoF1 ATPase. PMID:27054061

  7. A nested PCR for the ssrRNA gene detects Trypanosoma binneyi in the platypus and Trypanosoma sp. in wombats and kangaroos in Australia.

    PubMed

    Noyes, H A; Stevens, J R; Teixeira, M; Phelan, J; Holz, P

    1999-02-01

    Trypanosome infections in their natural hosts are frequently difficult to detect by microscopy, and culture methods are unreliable and not suitable for all species of Trypanosoma. A nested PCR strategy for detecting and identifying Trypanosoma species, suitable for detecting both known and unknown trypanosomes, is presented. Thirty-two blood samples from 23 species of Australian birds and mammals were screened by a nested PCR for the presence of Trypanosoma sp. ssrRNA. Three infections were detected, one in an eastern grey kangaroo (Macropus giganteus), one in a common wombat (Vombatus ursinus) and one in a platypus (Ornithorhynchus anatinus). The kangaroo and wombat are new host records for Trypanosoma sp.; the platypus parasite was Trypanosoma hinneyi. The three parasites could be distinguished by restriction fragment length polymorphisms of the amplified fragment of the ssrRNA gene. The kangaroo and wombat parasites were also isolated in a semi-solid blood agar medium. The culture forms of the kangaroo trypanosome had an expanded flagellar sheath in which structures similar to hemidesmosomes were detected by EM. The nested PCR was at least as sensitive as culture, and analysis of the PCR products gave parasite-specific fingerprints. Therefore this method could be suitable for rapidly screening host animals for the presence of trypanosomes and identifying the infecting strain.

  8. Trypanosoma vivax: a simplified protocol for in vivo growth, isolation and cryopreservation.

    PubMed

    Ndao, M; Magnus, E; Büscher, P; Geerts, S

    2004-03-01

    A rodent adapted clone of Trypanosoma vivax was used to infect cyclophosphamide treated mice and rats. Fresh blood containing trypanosomes, was centrifuged in a density gradient of three Percoll solutions, 1.07, 1.06, 1.05 g/ml, respectively, carefully layered on top of each other. The yields of this simple procedure for trypanosome purification were about six times higher than those obtained with the conventional anion-exchange columns. Cryopreservation of trypanosomes using glycerol yielded 90% viable parasites, whereas using dimethylsulfoxide, a more commonly used cryoprotectant, the viability was only 35%.

  9. Counterflow Dielectrophoresis for Trypanosome Enrichment and Detection in Blood

    NASA Astrophysics Data System (ADS)

    Menachery, Anoop; Kremer, Clemens; Wong, Pui E.; Carlsson, Allan; Neale, Steven L.; Barrett, Michael P.; Cooper, Jonathan M.

    2012-10-01

    Human African trypanosomiasis or sleeping sickness is a deadly disease endemic in sub-Saharan Africa, caused by single-celled protozoan parasites. Although it has been targeted for elimination by 2020, this will only be realized if diagnosis can be improved to enable identification and treatment of afflicted patients. Existing techniques of detection are restricted by their limited field-applicability, sensitivity and capacity for automation. Microfluidic-based technologies offer the potential for highly sensitive automated devices that could achieve detection at the lowest levels of parasitemia and consequently help in the elimination programme. In this work we implement an electrokinetic technique for the separation of trypanosomes from both mouse and human blood. This technique utilises differences in polarisability between the blood cells and trypanosomes to achieve separation through opposed bi-directional movement (cell counterflow). We combine this enrichment technique with an automated image analysis detection algorithm, negating the need for a human operator.

  10. Structural characterization and epitope mapping of the glutamic acid/alanine-rich protein from Trypanosoma congolense: defining assembly on the parasite cell surface.

    PubMed

    Loveless, Bianca C; Mason, Jeremy W; Sakurai, Tatsuya; Inoue, Noboru; Razavi, Morteza; Pearson, Terry W; Boulanger, Martin J

    2011-06-10

    Trypanosoma congolense is an African trypanosome that causes serious disease in cattle in Sub-Saharan Africa. The four major life cycle stages of T. congolense can be grown in vitro, which has led to the identification of several cell-surface molecules expressed on the parasite during its transit through the tsetse vector. One of these, glutamic acid/alanine-rich protein (GARP), is the first expressed on procyclic forms in the tsetse midgut and is of particular interest because it replaces the major surface coat molecule of bloodstream forms, the variant surface glycoprotein (VSG) that protects the parasite membrane, and is involved in antigenic variation. Unlike VSG, however, the function of GARP is not known, which necessarily limits our understanding of parasite survival in the tsetse. Toward establishing the function of GARP, we report its three-dimensional structure solved by iodide phasing to a resolution of 1.65 Å. An extended helical bundle structure displays an unexpected and significant degree of homology to the core structure of VSG, the only other major surface molecule of trypanosomes to be structurally characterized. Immunofluorescence microscopy and immunoaffinity-tandem mass spectrometry were used in conjunction with monoclonal antibodies to map both non-surface-disposed and surface epitopes. Collectively, these studies enabled us to derive a model describing the orientation and assembly of GARP on the surface of trypanosomes. The data presented here suggest the possible structure-function relationships involved in replacement of the bloodstream form VSG by GARP as trypanosomes differentiate in the tsetse vector after a blood meal.

  11. Pharmacokinetics, Trypanosoma brucei gambiense efficacy, and time of drug action of DB829, a preclinical candidate for treatment of second-stage human African trypanosomiasis.

    PubMed

    Wenzler, Tanja; Yang, Sihyung; Braissant, Olivier; Boykin, David W; Brun, Reto; Wang, Michael Zhuo

    2013-11-01

    Human African trypanosomiasis (HAT, also called sleeping sickness), a neglected tropical disease endemic to sub-Saharan Africa, is caused by the parasites Trypanosoma brucei gambiense and T. brucei rhodesiense. Current drugs against this disease have significant limitations, including toxicity, increasing resistance, and/or a complicated parenteral treatment regimen. DB829 is a novel aza-diamidine that demonstrated excellent efficacy in mice infected with T. b. rhodesiense or T. b. brucei parasites. The current study examined the pharmacokinetics, in vitro and in vivo activity against T. b. gambiense, and time of drug action of DB829 in comparison to pentamidine. DB829 showed outstanding in vivo efficacy in mice infected with parasites of T. b. gambiense strains, despite having higher in vitro 50% inhibitory concentrations (IC50s) than against T. b. rhodesiense strain STIB900. A single dose of DB829 administered intraperitoneally (5 mg/kg of body weight) cured all mice infected with different T. b. gambiense strains. No cross-resistance was observed between DB829 and pentamidine in T. b. gambiense strains isolated from melarsoprol-refractory patients. Compared to pentamidine, DB829 showed a greater systemic exposure when administered intraperitoneally, partially contributing to its improved efficacy. Isothermal microcalorimetry and in vivo time-to-kill studies revealed that DB829 is a slower-acting trypanocidal compound than pentamidine. A single dose of DB829 (20 mg/kg) administered intraperitoneally clears parasites from mouse blood within 2 to 5 days. In summary, DB829 is a promising preclinical candidate for the treatment of first- and second-stage HAT caused by both Trypanosoma brucei subspecies.

  12. Evaluation of histone deacetylase inhibitors (HDACi) as therapeutic leads for human African trypanosomiasis (HAT).

    PubMed

    Carrillo, Angela K; Guiguemde, W Armand; Guy, R Kiplin

    2015-08-15

    Two of the histone deacetylases, TbDAC1 and TbDAC3, have been reported to be essential genes in trypanosomes. Therefore, we tested the activity of a panel of human histone deacetylase inhibitors (HDACi) for their ability to block proliferation of Trypanosoma brucei brucei. Among the HDACi's, the hydroxamic acid derivatives panobinostat and belinostat exhibited potency that appeared to make them viable candidates for development due to their reported pharmacokinetic characteristics. However, cellular pharmacodynamic analysis demonstrated that these drugs were unable to kill cultured parasites at exposures seen in patients at their tolerated doses and additionally failed to show any synergistic effects in combination with pentamidine, suramin, melarsoprol, or nifurtimox. Analysis of the potency of the entire HDACi panel revealed no correlations between potency against any human HDAC isoform and inhibition of T. brucei proliferation, suggesting that the trypanosome histone deacetylases possess a unique specificity. These studies confirmed that HDAC inhibitors have potential as leads against human African trypanosomiasis but that none of the current clinical candidates can be directly repurposed. Therefore, development of HDACi's with appropriate specificity and potency may be a viable route to a new class of anti-trypanosomal drugs.

  13. Purine metabolite and energy charge analysis of Trypanosoma brucei cells in different growth phases using an optimized ion-pair RP-HPLC/UV for the quantification of adenine and guanine pools.

    PubMed

    Graven, Patricia; Tambalo, Margherita; Scapozza, Leonardo; Perozzo, Remo

    2014-06-01

    Human African Trypanosomiasis (HAT) is caused by the protozoan parasite Trypanosoma brucei. Although trypanosomes are well-studied model organisms, only little is known about their adenine and guanine nucleotide pools. Besides being building blocks of RNA and DNA, these nucleotides are also important modulators of diverse biochemical cellular processes. Adenine nucleotides also play an important role in the regulation of metabolic energy. The energetic state of cells is evaluated by the energy charge which gives information about how much energy is available in form of high energy phosphate bonds of adenine nucleotides. A sensitive and reproducible ion-pair RP-HPLC/UV method was developed and optimized, allowing the quantification of guanine and adenine nucleosides/nucleotides in T. brucei. With this method, the purine levels and their respective ratios were investigated in trypanosomes during logarithmic, stationary and senescent growth phases. Results of this study showed that all adenine and guanine purines under investigation were in the low mM range. The energy charge was found to decrease from logarithmic to static and to senescent phase whereas AMP/ATP, ADP/ATP and GDP/GTP ratios increased in the same order. In addition, the AMP/ATP ratio varied as the square of the ADP/ATP ratio, indicating AMP to be the key energy sensor molecule in trypanosomes.

  14. Molecular characterization of Trypanosoma spp. infecting cattle (Bos taurus), white-tailed deer (Odocoileus virginianus), and elk (Cervus elaphus canadensis) in the United States

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The benign trypanosomes of cattle and wild ungulates in the United States are designated Trypanosoma theileri and Trypanosoma cervi, respectively. Historically these parasites have been identified based on morphology, host, and vector, if known. No molecular characterization has been reported for T....

  15. Drug resistance in African trypanosomiasis: the melarsoprol and pentamidine story.

    PubMed

    Baker, Nicola; de Koning, Harry P; Mäser, Pascal; Horn, David

    2013-03-01

    Melarsoprol and pentamidine represent the two main classes of drugs, the arsenicals and diamidines, historically used to treat the diseases caused by African trypanosomes: sleeping sickness in humans and Nagana in livestock. Cross-resistance to these drugs was first observed over 60 years ago and remains the only example of cross-resistance among sleeping sickness therapies. A Trypanosoma brucei adenosine transporter is well known for its role in the uptake of both drugs. More recently, aquaglyceroporin 2 (AQP2) loss of function was linked to melarsoprol-pentamidine cross-resistance. AQP2, a channel that appears to facilitate drug accumulation, may also be linked to clinical cases of resistance. Here, we review these findings and consider some new questions as well as future prospects for tackling the devastating diseases caused by these parasites.

  16. African trypanosomiasis and antibodies: implications for vaccination, therapy and diagnosis.

    PubMed

    Magez, Stefan; Radwanska, Magdalena

    2009-10-01

    African trypanosomiasis causes devastating effects on human populations and livestock herds in large parts of sub-Saharan Africa. Control of the disease is hampered by the lack of any efficient vaccination results in a field setting, and the severe side effects of current drug therapies. In addition, with the exception of Trypanosoma brucei gambiense infections, the diagnosis of trypanosomiasis has to rely on microscopic analysis of blood samples, as other specific tools are nonexistent. However, new developments in biotechnology, which include loop-mediated isothermal amplification as an adaptation to conventional PCR, as well as the antibody engineering that has allowed the development of Nanobody technology, offer new perspectives in both the detection and treatment of trypanosomiasis. In addition, recent data on parasite-induced B-cell memory destruction offer new insights into mechanisms of vaccine failure, and should lead us towards new strategies to overcome trypanosome defenses operating against the host immune system.

  17. Host Intracellular Signaling Events and Pro-inflammatory Cytokine Production in African Trypanosomiasis

    PubMed Central

    Kuriakose, Shiby M.; Singh, Rani; Uzonna, Jude E.

    2016-01-01

    Pathogens, such as bacteria, viruses, and parasites, possess specific molecules or proteins that are recognized by several host innate immune receptors, leading to the activation of several intracellular signaling molecules and pathways. The magnitude and quality of these events significantly affect the outcome of infection. African trypanosomes, including Trypanosoma congolense, are capable of manipulating the host immune response, including the activity of macrophages, which are the key immune cells that contribute to the immunopathogenesis of African trypanosomiasis. Although it is known that immune hyperactivation and excessive pro-inflammatory cytokine production are the hallmarks of African trypanosomiasis, the mechanisms through which these events are triggered are poorly defined. However, it is known that macrophages may play a significant role in these processes, because phagocytosis of trypanosomes by macrophages initiates intracellular signal transduction cascades that lead to the release of pro-inflammatory cytokines and alteration in cell function. This review highlights recent progress in our understanding of the innate immune receptors, signaling pathways, and transcription factors involved in T. congolense-induced pro-inflammatory cytokine production in macrophages. It will reveal the existence of complex signaling events through which the parasite modulates the host immune response, thus identifying novel targets that could aid in designing strategies to effectively control the disease. PMID:27242788

  18. Identification of Compounds with Anti-Proliferative Activity against Trypanosoma brucei brucei Strain 427 by a Whole Cell Viability Based HTS Campaign

    PubMed Central

    Kaiser, Marcel; Chatelain, Eric; Moawad, Sarah R.; Ganame, Danny; Ioset, Jean-Robert; Avery, Vicky M.

    2012-01-01

    Human African Trypanosomiasis (HAT) is caused by two trypanosome sub-species, Trypanosoma brucei rhodesiense and Trypanosoma brucei gambiense. Drugs available for the treatment of HAT have significant issues related to difficult administration regimes and limited efficacy across species and disease stages. Hence, there is considerable need to find new alternative and less toxic drugs. An approach to identify starting points for new drug candidates is high throughput screening (HTS) of large compound library collections. We describe the application of an Alamar Blue based, 384-well HTS assay to screen a library of 87,296 compounds against the related trypanosome subspecies, Trypanosoma brucei brucei bloodstream form lister 427. Primary hits identified against T.b. brucei were retested and the IC50 value compounds were estimated for T.b. brucei and a mammalian cell line HEK293, to determine a selectivity index for each compound. The screening campaign identified 205 compounds with greater than 10 times selectivity against T.b. brucei. Cluster analysis of these compounds, taking into account chemical and structural properties required for drug-like compounds, afforded a panel of eight compounds for further biological analysis. These compounds had IC50 values ranging from 0.22 µM to 4 µM with associated selectivity indices ranging from 19 to greater than 345. Further testing against T.b. rhodesiense led to the selection of 6 compounds from 5 new chemical classes with activity against the causative species of HAT, which can be considered potential candidates for HAT early drug discovery. Structure activity relationship (SAR) mining revealed components of those hit compound structures that may be important for biological activity. Four of these compounds have undergone further testing to 1) determine whether they are cidal or static in vitro at the minimum inhibitory concentration (MIC), and 2) estimate the time to kill. PMID:23209849

  19. Trypanosomes genetic diversity, polyparasitism and the population decline of the critically endangered Australian marsupial, the brush tailed bettong or woylie (Bettongia penicillata).

    PubMed

    Botero, Adriana; Thompson, Craig K; Peacock, Christopher S; Clode, Peta L; Nicholls, Philip K; Wayne, Adrian F; Lymbery, Alan J; Thompson, R C Andrew

    2013-12-01

    While much is known of the impact of trypanosomes on human and livestock health, trypanosomes in wildlife, although ubiquitous, have largely been considered to be non-pathogenic. We describe the genetic diversity, tissue tropism and potential pathogenicity of trypanosomes naturally infecting Western Australian marsupials. Blood samples collected from 554 live-animals and 250 tissue samples extracted from 50 carcasses of sick-euthanized or road-killed animals, belonging to 10 species of marsupials, were screened for the presence of trypanosomes using a PCR of the 18S rDNA gene. PCR results revealed a rate of infection of 67% in blood and 60% in tissues. Inferred phylogenetic trees using 18S rDNA and glycosomal glyceraldehyde phosphate dehydrogenase (gGAPDH) sequences showed the presence of eight genotypes that clustered into three clades: a clade including Trypanosoma copemani, a new clade closely related to Trypanosoma gilletti, and a clade including Trypanosoma H25 from an Australian kangaroo. Trypanosome infections were compared in a declining and in a stable population of the endangered Australian marsupial, the brush tailed bettong or woylie (Bettongia penicillata). This marsupial showed high rates of infection with Clade A genotypes (96%) in the declining population, whereas in the stable population, Clade B genotypes were predominant (89%). Mixed infections were common in woylies from the declining but not from the stable population. Histopathological findings associated with either mixed or single infections involving Clade A genotypes, showed a strong inflammatory process and tissue degeneration predominantly in heart, oesophagus and tongue. Trypanosomes were successfully grown in culture and for the first time we demonstrate that a genotype within Clade A has the capacity to not only colonize different tissues in the host but also to invade cells in vitro. These results provide evidence for the potential role of trypanosomes in the decline of a formerly

  20. Trypanosomes genetic diversity, polyparasitism and the population decline of the critically endangered Australian marsupial, the brush tailed bettong or woylie (Bettongia penicillata)

    PubMed Central

    Botero, Adriana; Thompson, Craig K.; Peacock, Christopher S.; Clode, Peta L.; Nicholls, Philip K.; Wayne, Adrian F.; Lymbery, Alan J.; Thompson, R.C. Andrew

    2013-01-01

    While much is known of the impact of trypanosomes on human and livestock health, trypanosomes in wildlife, although ubiquitous, have largely been considered to be non-pathogenic. We describe the genetic diversity, tissue tropism and potential pathogenicity of trypanosomes naturally infecting Western Australian marsupials. Blood samples collected from 554 live-animals and 250 tissue samples extracted from 50 carcasses of sick-euthanized or road-killed animals, belonging to 10 species of marsupials, were screened for the presence of trypanosomes using a PCR of the 18S rDNA gene. PCR results revealed a rate of infection of 67% in blood and 60% in tissues. Inferred phylogenetic trees using 18S rDNA and glycosomal glyceraldehyde phosphate dehydrogenase (gGAPDH) sequences showed the presence of eight genotypes that clustered into three clades: a clade including Trypanosoma copemani, a new clade closely related to Trypanosoma gilletti, and a clade including Trypanosoma H25 from an Australian kangaroo. Trypanosome infections were compared in a declining and in a stable population of the endangered Australian marsupial, the brush tailed bettong or woylie (Bettongia penicillata). This marsupial showed high rates of infection with Clade A genotypes (96%) in the declining population, whereas in the stable population, Clade B genotypes were predominant (89%). Mixed infections were common in woylies from the declining but not from the stable population. Histopathological findings associated with either mixed or single infections involving Clade A genotypes, showed a strong inflammatory process and tissue degeneration predominantly in heart, oesophagus and tongue. Trypanosomes were successfully grown in culture and for the first time we demonstrate that a genotype within Clade A has the capacity to not only colonize different tissues in the host but also to invade cells in vitro. These results provide evidence for the potential role of trypanosomes in the decline of a formerly

  1. Excreted/Secreted Proteins from Trypanosome Procyclic Strains

    PubMed Central

    Atyame Nten, Celestine Michelle; Sommerer, Nicolas; Rofidal, Valerie; Hirtz, Christophe; Rossignol, Michel; Cuny, Gerard; Peltier, Jean-Benoit; Geiger, Anne

    2010-01-01

    Trypanosoma secretome was shown to be involved in parasite virulence and is suspected of interfering in parasite life-cycle steps such as establishment in the Glossina midgut, metacyclogenesis. Therefore, we attempted to identify the proteins secreted by procyclic strains of T. brucei gambiense and T. brucei brucei, responsible for human and animal trypanosomiasis, respectively. Using mass spectrometry, 427 and 483 nonredundant proteins were characterized in T. brucei brucei and T. brucei gambiense secretomes, respectively; 35% and 42% of the corresponding secretome proteins were specifically secreted by T. brucei brucei and T. brucei gambiense, respectively, while 279 proteins were common to both subspecies. The proteins were assigned to 12 functional classes. Special attention was paid to the most abundant proteases (14 families) because of their potential implication in the infection process and nutrient supply. The presence of proteins usually secreted via an exosome pathway suggests that this type of process is involved in trypanosome ESP secretion. The overall results provide leads for further research to develop novel tools for blocking trypanosome transmission. PMID:20011064

  2. Drug discovery for human African trypanosomiasis: identification of novel scaffolds by the newly developed HTS SYBR Green assay for Trypanosoma brucei.

    PubMed

    Faria, Joana; Moraes, Carolina B; Song, Rita; Pascoalino, Bruno S; Lee, Nakyung; Siqueira-Neto, Jair L; Cruz, Deu John M; Parkinson, Tanya; Ioset, Jean-Robert; Cordeiro-da-Silva, Anabela; Freitas-Junior, Lucio H

    2015-01-01

    Human African trypanosomiasis (HAT) is a vector-transmitted tropical disease caused by the protozoan parasite Trypanosoma brucei. High-throughput screening (HTS) of small-molecule libraries in whole-cell assays is one of the most frequently used approaches in drug discovery for infectious diseases. To aid in drug discovery efforts for HAT, the SYBR Green assay was developed for T. brucei in a 384-well format. This semi-automated assay is cost- and time-effective, robust, and reproducible. The SYBR Green assay was compared to the resazurin assay by screening a library of 4000 putative kinase inhibitors, revealing a superior performance in terms of assay time, sensitivity, simplicity, and reproducibility, and resulting in a higher hit confirmation rate. Although the resazurin assay allows for comparatively improved detection of slow-killing compounds, it also has higher false-positive rates that are likely to arise from the assay experimental conditions. The compounds with the most potent antitrypanosomal activity were selected in both screens and grouped into 13 structural clusters, with 11 new scaffolds as antitrypanosomal agents. Several of the identified compounds had IC50 <1 µM coupled with high selectivity toward the parasite. The core structures of the scaffolds are shown, providing promising new starting points for drug discovery for HAT.

  3. Global Gene Expression Profiling through the Complete Life Cycle of Trypanosoma vivax.

    PubMed

    Jackson, Andrew P; Goyard, Sophie; Xia, Dong; Foth, Bernardo J; Sanders, Mandy; Wastling, Jonathan M; Minoprio, Paola; Berriman, Matthew

    2015-01-01

    The parasitic flagellate Trypanosoma vivax is a cause of animal trypanosomiasis across Africa and South America. The parasite has a digenetic life cycle, passing between mammalian hosts and insect vectors, and a series of developmental forms adapted to each life cycle stage. Each point in the life cycle presents radically different challenges to parasite metabolism and physiology and distinct host interactions requiring remodeling of the parasite cell surface. Transcriptomic and proteomic studies of the related parasites T. brucei and T. congolense have shown how gene expression is regulated during their development. New methods for in vitro culture of the T. vivax insect stages have allowed us to describe global gene expression throughout the complete T. vivax life cycle for the first time. We combined transcriptomic and proteomic analysis of each life stage using RNA-seq and mass spectrometry respectively, to identify genes with patterns of preferential transcription or expression. While T. vivax conforms to a pattern of highly conserved gene expression found in other African trypanosomes, (e.g. developmental regulation of energy metabolism, restricted expression of a dominant variant antigen, and expression of 'Fam50' proteins in the insect mouthparts), we identified significant differences in gene expression affecting metabolism in the fly and a suite of T. vivax-specific genes with predicted cell-surface expression that are preferentially expressed in the mammal ('Fam29, 30, 42') or the vector ('Fam34, 35, 43'). T. vivax differs significantly from other African trypanosomes in the developmentally-regulated proteins likely to be expressed on its cell surface and thus, in the structure of the host-parasite interface. These unique features may yet explain the species differences in life cycle and could, in the form of bloodstream-stage proteins that do not undergo antigenic variation, provide targets for therapy.

  4. Cloning and expression of the hypoxanthine-guanine phosphoribosyltransferase gene from Trypanosoma brucei.

    PubMed Central

    Allen, T E; Ullman, B

    1993-01-01

    The hypoxanthine-guanine phosphoribosyltransferase (HGPRT) enzyme of Trypanosoma brucei and related parasites provides a rational target for the treatment of African sleeping sickness and several other parasitic diseases. To characterize the T. brucei HGPRT enzyme in detail, the T. brucei hgprt was isolated within a 4.2 kb SalI-KpnI genomic insert and sequenced. Nucleotide sequence analysis revealed an open reading frame of 630 bp that encoded a protein of 210 amino acids with a M(r) = 23.4 kd. After gap alignment, the T. brucei HGPRT exhibited 21-23% amino acid sequence identity, mostly in three clustered regions, with the HGPRTs from human, S. mansoni, and P falciparum, indicating that the trypanosome enzyme was the most divergent of the group. Surprisingly, the T. brucei HGPRT was more homologous to the hypoxanthine phosphoribosyltransferase (HPRT) from the prokaryote V. harveyi than to the eukaryotic HGPRTs. Northern blot analysis revealed two trypanosome transcripts of 1.4 and 1.9 kb, each expressed to equivalent degrees in insect vector and mammalian forms of the parasite. The T. brucei hgprt was inserted into an expression plasmid and transformed into S phi 606 E. coli that are deficient in both HPRT and xanthine-guanine phosphoribosyltransferase activities. Soluble, enzymatically active recombinant T. brucei HGPRT was expressed to high levels and purified to homogeneity by GTP-agarose affinity chromatography. The purified recombinant enzyme recognized hypoxanthine, guanine, and allopurinol, but not xanthine or adenine, as substrates and was inhibited by a variety of nucleotide effectors. The availability of a molecular clone encoding the T. brucei hgprt and large quantities of homogeneous recombinant HGPRT enzyme provides an experimentally manipulable molecular and biochemical system for the rational design of novel therapeutic agents for the treatment of African sleeping sickness and other diseases of parasitic origin. Images PMID:8265360

  5. Structure-function analysis of dynein light chain 1 identifies viable motility mutants in bloodstream-form Trypanosoma brucei.

    PubMed

    Ralston, Katherine S; Kisalu, Neville K; Hill, Kent L

    2011-07-01

    The flagellum of Trypanosoma brucei is an essential and multifunctional organelle that is receiving increasing attention as a potential drug target and as a system for studying flagellum biology. RNA interference (RNAi) knockdown is widely used to test the requirement for a protein in flagellar motility and has suggested that normal flagellar motility is essential for viability in bloodstream-form trypanosomes. However, RNAi knockdown alone provides limited functional information because the consequence is often loss of a multiprotein complex. We therefore developed an inducible system that allows functional analysis of point mutations in flagellar proteins in T. brucei. Using this system, we identified point mutations in the outer dynein light chain 1 (LC1) that allow stable assembly of outer dynein motors but do not support propulsive motility. In procyclic-form trypanosomes, the phenotype of LC1 mutants with point mutations differs from the motility and structural defects of LC1 knockdowns, which lack the outer-arm dynein motor. Thus, our results distinguish LC1-specific functions from broader functions of outer-arm dynein. In bloodstream-form trypanosomes, LC1 knockdown blocks cell division and is lethal. In contrast, LC1 point mutations cause severe motility defects without affecting viability, indicating that the lethal phenotype of LC1 RNAi knockdown is not due to defective motility. Our results demonstrate for the first time that normal motility is not essential in bloodstream-form T. brucei and that the presumed connection between motility and viability is more complex than might be interpreted from knockdown studies alone. These findings open new avenues for dissecting mechanisms of flagellar protein function and provide an important step in efforts to exploit the potential of the flagellum as a therapeutic target in African sleeping sickness.

  6. Transcript Expression Analysis of Putative Trypanosoma brucei GPI-Anchored Surface Proteins during Development in the Tsetse and Mammalian Hosts

    PubMed Central

    Savage, Amy F.; Cerqueira, Gustavo C.; Regmi, Sandesh; Wu, Yineng; El Sayed, Najib M.; Aksoy, Serap

    2012-01-01

    Human African Trypanosomiasis is a devastating disease caused by the parasite Trypanosoma brucei. Trypanosomes live extracellularly in both the tsetse fly and the mammal. Trypanosome surface proteins can directly interact with the host environment, allowing parasites to effectively establish and maintain infections. Glycosylphosphatidylinositol (GPI) anchoring is a common posttranslational modification associated with eukaryotic surface proteins. In T. brucei, three GPI-anchored major surface proteins have been identified: variant surface glycoproteins (VSGs), procyclic acidic repetitive protein (PARP or procyclins), and brucei alanine rich proteins (BARP). The objective of this study was to select genes encoding predicted GPI-anchored proteins with unknown function(s) from the T. brucei genome and characterize the expression profile of a subset during cyclical development in the tsetse and mammalian hosts. An initial in silico screen of putative T. brucei proteins by Big PI algorithm identified 163 predicted GPI-anchored proteins, 106 of which had no known functions. Application of a second GPI-anchor prediction algorithm (FragAnchor), signal peptide and trans-membrane domain prediction software resulted in the identification of 25 putative hypothetical proteins. Eighty-one gene products with hypothetical functions were analyzed for stage-regulated expression using semi-quantitative RT-PCR. The expression of most of these genes were found to be upregulated in trypanosomes infecting tsetse salivary gland and proventriculus tissues, and 38% were specifically expressed only by parasites infecting salivary gland tissues. Transcripts for all of the genes specifically expressed in salivary glands were also detected in mammalian infective metacyclic trypomastigotes, suggesting a possible role for these putative proteins in invasion and/or establishment processes in the mammalian host. These results represent the first large-scale report of the differential expression of

  7. Combining reverse genetics and nuclear magnetic resonance-based metabolomics unravels trypanosome-specific metabolic pathways.

    PubMed

    Bringaud, Frédéric; Biran, Marc; Millerioux, Yoann; Wargnies, Marion; Allmann, Stefan; Mazet, Muriel

    2015-06-01

    Numerous eukaryotes have developed specific metabolic traits that are not present in extensively studied model organisms. For instance, the procyclic insect form of Trypanosoma brucei, a parasite responsible for sleeping sickness in its mammalian-specific bloodstream form, metabolizes glucose into excreted succinate and acetate through pathways with unique features. Succinate is primarily produced from glucose-derived phosphoenolpyruvate in peroxisome-like organelles, also known as glycosomes, by a soluble NADH-dependent fumarate reductase only described in trypanosomes so far. Acetate is produced in the mitochondrion of the parasite from acetyl-CoA by a CoA-transferase, which forms an ATP-producing cycle with succinyl-CoA synthetase. The role of this cycle in ATP production was recently demonstrated in procyclic trypanosomes and has only been proposed so far for anaerobic organisms, in addition to trypanosomatids. We review how nuclear magnetic resonance spectrometry can be used to analyze the metabolic network perturbed by deletion (knockout) or downregulation (RNAi) of the candidate genes involved in these two particular metabolic pathways of procyclic trypanosomes. The role of succinate and acetate production in trypanosomes is discussed, as well as the connections between the succinate and acetate branches, which increase the metabolic flexibility probably required by the parasite to deal with environmental changes such as oxidative stress.

  8. Trypanosoma brucei Invasion and T-Cell Infiltration of the Brain Parenchyma in Experimental Sleeping Sickness: Timing and Correlation with Functional Changes

    PubMed Central

    Laperchia, Claudia; Palomba, Maria; Seke Etet, Paul F.; Rodgers, Jean; Bradley, Barbara; Montague, Paul; Grassi-Zucconi, Gigliola; Bentivoglio, Marina

    2016-01-01

    Background The timing of Trypanosoma brucei entry into the brain parenchyma to initiate the second, meningoencephalitic stage of human African trypanosomiasis or sleeping sickness is currently debated and even parasite invasion of the neuropil has been recently questioned. Furthermore, the relationship between neurological features and disease stage are unclear, despite the important diagnostic and therapeutic implications. Methodology Using a rat model of chronic Trypanosoma brucei brucei infection we determined the timing of parasite and T-cell neuropil infiltration and its correlation with functional changes. Parasite DNA was detected using trypanosome-specific PCR. Body weight and sleep structure alterations represented by sleep-onset rapid eye movement (SOREM) periods, reported in human and experimental African trypanosomiasis, were monitored. The presence of parasites, as well as CD4+ and CD8+ T-cells in the neuropil was assessed over time in the brain of the same animals by immunocytochemistry and quantitative analyses. Principal findings Trypanosome DNA was present in the brain at day 6 post-infection and increased more than 15-fold by day 21. Parasites and T-cells were observed in the parenchyma from day 9 onwards. Parasites traversing blood vessel walls were observed in the hypothalamus and other brain regions. Body weight gain was reduced from day 7 onwards. SOREM episodes started in most cases early after infection, with an increase in number and duration after parasite neuroinvasion. Conclusion These findings demonstrate invasion of the neuropil over time, after an initial interval, by parasites and lymphocytes crossing the blood-brain barrier, and show that neurological features can precede this event. The data thus challenge the current clinical and cerebrospinal fluid criteria of disease staging. PMID:28002454

  9. First record of trypanosomes from the blood of sculpins (Cottus ricei and C. cognatus) from Lake Superior, WI, USA

    USGS Publications Warehouse

    Pronina, Svetlana V.; Pronin, Nikolai M.; Selgeby, Jim H.

    1999-01-01

    During parasitological research of fishes in Lake Superior (USA) in August-September 1994, infection with trypanosomes of the blood of sculpins (Cottus ricei and C. cognatus) was recorded for the first time. The descriptions of three morphological groups of the genus Trypanosoma: T. sp. I, found in blood of C. ricei, T. sp. II and T. sp. III from blood of C. cognatus, have been provided.

  10. Evaluation of the micro-CATT, CATT/Trypanosoma brucei gambiense, and LATEX/T b gambiense methods for serodiagnosis and surveillance of human African trypanosomiasis in West and Central Africa.

    PubMed Central

    Truc, Philippe; Lejon, Veerle; Magnus, Eddy; Jamonneau, Vincent; Nangouma, Auguste; Verloo, Didier; Penchenier, Laurent; Büscher, Philippe

    2002-01-01

    OBJECTIVE: To evaluate the performance of serological tests using dried blood on filter-papers (micro-card agglutination test for trypanosomiasis (micro-CATT)) performed under field and laboratory conditions and using whole blood ((CATT/T.b. gambiense) (wb-CATT) and latex agglutination (LATEX/T.b. gambiense) (wb-LATEX)) for the serodiagnosis and surveillance of human African trypanosomiasis in West and Central Africa. METHODS: We evaluated the micro-CATT, wb-CATT and wb-LATEX methods in Côte d'Ivoire and the Central African Republic by screening 940 people. Sensitivity and specificity were calculated for each serological test; only patients with the confirmed presence of trypanosomes in the blood or lymph aspirate were considered true positives. Positive and negative predictive values were also calculated. FINDINGS: Each of the tests showed a lower sensitivity in the Central African Republic than in Côte d'Ivoire. CONCLUSION: The results confirmed the efficiency of the classic wb-CATT to detect sleeping sickness patients. The micro-CATT method can be used for human African trypanosomiasis surveillance if the test is performed on the same day as the blood collection, or if samples are stored at 4 degrees C. Otherwise, micro-CATT can be used when absolute sensitivity is not required. wb-LATEX should only be used for high-specificity screening. PMID:12481210

  11. Human trypanolytic factor APOL1 forms pH-gated cation-selective channels in planar lipid bilayers: Relevance to trypanosome lysis

    PubMed Central

    Thomson, Russell; Finkelstein, Alan

    2015-01-01

    Apolipoprotein L-1 (APOL1), the trypanolytic factor of human serum, can lyse several African trypanosome species including Trypanosoma brucei brucei, but not the human-infective pathogens T. brucei rhodesiense and T. brucei gambiense, which are resistant to lysis by human serum. Lysis follows the uptake of APOL1 into acidic endosomes and is apparently caused by colloid-osmotic swelling due to an increased ion permeability of the plasma membrane. Here we demonstrate that nanogram quantities of full-length recombinant APOL1 induce ideally cation-selective macroscopic conductances in planar lipid bilayers. The conductances were highly sensitive to pH: their induction required acidic pH (pH 5.3), but their magnitude could be increased 3,000-fold upon alkalinization of the milieu (pKa = 7.1). We show that this phenomenon can be attributed to the association of APOL1 with the bilayer at acidic pH, followed by the opening of APOL1-induced cation-selective channels upon pH neutralization. Furthermore, the conductance increase at neutral pH (but not membrane association at acidic pH) was prevented by the interaction of APOL1 with the serum resistance-associated protein, which is produced by T. brucei rhodesiense and prevents trypanosome lysis by APOL1. These data are consistent with a model of lysis that involves endocytic recycling of APOL1 and the formation of cation-selective channels, at neutral pH, in the parasite plasma membrane. PMID:25730870

  12. Eflornithine is safer than melarsoprol for the treatment of second-stage Trypanosoma brucei gambiense human African trypanosomiasis.

    PubMed

    Chappuis, François; Udayraj, Nitya; Stietenroth, Kai; Meussen, Ann; Bovier, Patrick A

    2005-09-01

    Patients with second-stage human African trypanosomiasis treated with eflornithine (n = 251) in 2003 in Kiri, southern Sudan, had an adjusted relative risk of death of 0.2 and experienced significantly fewer cutaneous and neurological adverse effects than did patients who were treated with melarsoprol in 2001 and 2002 (n = 708).

  13. Intercontinental distribution of a new trypanosome species from Australian endemic Regent Honeyeater (Anthochaera phrygia).

    PubMed

    Šlapeta, Jan; Morin-Adeline, Victoria; Thompson, Paul; McDonell, Denise; Shiels, Michael; Gilchrist, Katrina; Votýpka, Jan; Vogelnest, Larry

    2016-07-01

    Establishing a health screening protocol is fundamental for successful captive breeding and release of wildlife. The aim of this study was to undertake a parasitological survey focusing on the presence of trypanosomes in a cohort of Regent Honeyeaters, Anthochaera phrygia, syn. Xanthomyza phrygia (Aves: Passeriformes) that are part of the breeding and reintroduction programme carried out in Australia. We describe a new blood parasite, Trypanosoma thomasbancrofti sp. n. (Kinetoplastida: Trypanosomatidae) with prevalence of 24·4% (20/81) in a captive population in 2015. The sequence of the small subunit rRNA gene (SSU rDNA) and kinetoplast ultrastructure of T. thomasbancrofti sp. n. are the key differentiating characteristics from other Trypanosoma spp. T. thomasbancrofti sp. n. is distinct from Trypanosoma cf. avium found in sympatric Noisy Miners (Manorina melanocephala). The SSU rDNA comparison suggests an intercontinental distribution of T. thomasbancrofti sp. n. and Culex mosquitoes as a suspected vector. Currently, no information exists on the effect of T. thomasbancrofti sp. n. on its hosts; however, all trypanosome-positive birds remain clinically healthy. This information is useful in establishing baseline health data and screening protocols, particularly prior to release to the wild.

  14. The role of Trypanosoma brucei MRPA in melarsoprol susceptibility.

    PubMed

    Alibu, Vincent P; Richter, Christina; Voncken, Frank; Marti, Gabriela; Shahi, Sanjay; Renggli, Christina Kunz; Seebeck, Thomas; Brun, Reto; Clayton, Christine

    2006-03-01

    We previously showed that over-expression of Trypanosoma brucei MRPA, a member of the multidrug resistance protein family in T. brucei, reproducibly resulted in resistance to the anti-trypanosomal drug melarsoprol in vitro. MRPA is predicted to mediate efflux of melarsoprol as a conjugate with trypanothione, a glutathione-spermidine conjugate which is the major small thiol in trypanosomes. Here, we show that depletion of MRPA by RNA interference resulted in moderate hypersensitivity to both melarsoprol and melarsen oxide. Over-expression of MRPA alone is not sufficient to cause melarsoprol resistance in vivo, although it is sufficient in vitro. This discrepancy is not an effect of drug metabolism since over-expression of MRPA alone conferred resistance to melarsoprol and its principle metabolite, melarsen oxide, in vitro. Over-expression of MRPA was not detected in four melarsoprol-resistant trypanosome isolates from sleeping sickness patients.

  15. Mosaic VSGs and the Scale of Trypanosoma brucei Antigenic Variation

    PubMed Central

    Hall, James P. J.; Wang, Huanhuan; Barry, J. David

    2013-01-01

    A main determinant of prolonged Trypanosoma brucei infection and transmission and success of the parasite is the interplay between host acquired immunity and antigenic variation of the parasite variant surface glycoprotein (VSG) coat. About 0.1% of trypanosome divisions produce a switch to a different VSG through differential expression of an archive of hundreds of silent VSG genes and pseudogenes, but the patterns and extent of the trypanosome diversity phenotype, particularly in chronic infection, are unclear. We applied longitudinal VSG cDNA sequencing to estimate variant richness and test whether pseudogenes contribute to antigenic variation. We show that individual growth peaks can contain at least 15 distinct variants, are estimated computationally to comprise many more, and that antigenically distinct ‘mosaic’ VSGs arise from segmental gene conversion between donor VSG genes or pseudogenes. The potential for trypanosome antigenic variation is probably much greater than VSG archive size; mosaic VSGs are core to antigenic variation and chronic infection. PMID:23853603

  16. African Trypanosomiasis

    DTIC Science & Technology

    2011-06-01

    infection by protozoan hemo- flagellates of the Trypanosoma brucei complex, 2 subspe- cies of which cause disease in humans: Trypanosoma bru- cei gambiense...public release; distribution unlimited 13. SUPPLEMENTARY NOTES See also ADA545141. Chapter 3 from e-book, Topics on the Pathology of Protozoan and...the brief ferry crossing. 2 3 • Topics on The paThology of proTozoan and invasive arThropod diseases Three severe epidemics of African trypanosomiasis

  17. Molecular evidence of a Trypanosoma brucei gambiense sylvatic cycle in the human african trypanosomiasis foci of Equatorial Guinea

    PubMed Central

    Cordon-Obras, Carlos; Rodriguez, Yasmin Fermin; Fernandez-Martinez, Amalia; Cano, Jorge; Ndong-Mabale, Nicolas; Ncogo-Ada, Policarpo; Ndongo-Asumu, Pedro; Aparicio, Pilar; Navarro, Miguel; Benito, Agustin; Bart, Jean-Mathieu

    2015-01-01

    Gambiense trypanosomiasis is considered an anthroponotic disease. Consequently, control programs are generally aimed at stopping transmission of Trypanosoma brucei gambiense (T. b. gambiense) by detecting and treating human cases. However, the persistence of numerous foci despite efforts to eliminate this disease questions this strategy as unique tool to pursue the eradication. The role of animals as a reservoir of T. b. gambiense is still controversial, but could partly explain maintenance of the infection at hypo-endemic levels. In the present study, we evaluated the presence of T. b. gambiense in wild animals in Equatorial Guinea. The infection rate ranged from 0.8% in the insular focus of Luba to more than 12% in Mbini, a focus with a constant trickle of human cases. The parasite was detected in a wide range of animal species including four species never described previously as putative reservoirs. Our study comes to reinforce the hypothesis that animals may play a role in the persistence of T. b. gambiense transmission, being particularly relevant in low transmission settings. Under these conditions the integration of sustained vector control and medical interventions should be considered to achieve the elimination of gambiense trypanosomiasis. PMID:26257727

  18. Identification and lineage genotyping of South American trypanosomes using fluorescent fragment length barcoding.

    PubMed

    Hamilton, P B; Lewis, M D; Cruickshank, C; Gaunt, M W; Yeo, M; Llewellyn, M S; Valente, S A; Maia da Silva, F; Stevens, J R; Miles, M A; Teixeira, M M G

    2011-01-01

    Trypanosoma cruzi and Trypanosoma rangeli are human-infective blood parasites, largely restricted to Central and South America. They also infect a wide range of wild and domestic mammals and are transmitted by a numerous species of triatomine bugs. There are significant overlaps in the host and geographical ranges of both species. The two species consist of a number of distinct phylogenetic lineages. A range of PCR-based techniques have been developed to differentiate between these species and to assign their isolates into lineages. However, the existence of at least six and five lineages within T. cruzi and T. rangeli, respectively, makes identification of the full range of isolates difficult and time consuming. Here we have applied fluorescent fragment length barcoding (FFLB) to the problem of identifying and genotyping T. cruzi, T. rangeli and other South American trypanosomes. This technique discriminates species on the basis of length polymorphism of regions of the rDNA locus. FFLB was able to differentiate many trypanosome species known from South American mammals: T. cruzi cruzi, T. cruzi marinkellei, T. dionisii-like, T. evansi, T. lewisi, T. rangeli, T. theileri and T. vivax. Furthermore, all five T. rangeli lineages and many T. cruzi lineages could be identified, except the hybrid lineages TcV and TcVI that could not be distinguished from lineages III and II respectively. This method also allowed identification of mixed infections of T. cruzi and T. rangeli lineages in naturally infected triatomine bugs. The ability of FFLB to genotype multiple lineages of T. cruzi and T. rangeli together with other trypanosome species, using the same primer sets is an advantage over other currently available techniques. Overall, these results demonstrate that FFLB is a useful method for species diagnosis, genotyping and understanding the epidemiology of American trypanosomes.

  19. Novel Naphthalene-Based Inhibitors of Trypanosoma brucei RNA Editing Ligase 1

    PubMed Central

    Swift, Robert V.; Landon, Melissa; Schnaufer, Achim; Amaro, Rommie E.

    2010-01-01

    Background Neglected tropical diseases, including diseases caused by trypanosomatid parasites such as Trypanosoma brucei, cost tens of millions of disability-adjusted life-years annually. As the current treatments for African trypanosomiasis and other similar infections are limited, new therapeutics are urgently needed. RNA Editing Ligase 1 (REL1), a protein unique to trypanosomes and other kinetoplastids, was identified recently as a potential drug target. Methodology/Principal Findings Motivated by the urgent need for novel trypanocidal therapeutics, we use an ensemble-based virtual-screening approach to discover new naphthalene-based TbREL1 inhibitors. The predicted binding modes of the active compounds are evaluated within the context of the flexible receptor model and combined with computational fragment mapping to determine the most likely binding mechanisms. Ultimately, four new low-micromolar inhibitors are presented. Three of the four compounds may bind to a newly revealed cleft that represents a putative druggable site not evident in any crystal structure. Conclusions/Significance Pending additional optimization, the compounds presented here may serve as precursors for future novel therapies useful in the fight against several trypanosomatid pathogens, including human African trypanosomiasis, a devastating disease that afflicts the vulnerable patient populations of sub-Saharan Africa. PMID:20808768

  20. Comparative genomics reveals multiple genetic backgrounds of human pathogenicity in the Trypanosoma brucei complex.

    PubMed

    Sistrom, Mark; Evans, Benjamin; Bjornson, Robert; Gibson, Wendy; Balmer, Oliver; Mäser, Pascal; Aksoy, Serap; Caccone, Adalgisa

    2014-10-05

    The Trypanosoma brucei complex contains a number of subspecies with exceptionally variable life histories, including zoonotic subspecies, which are causative agents of human African trypanosomiasis (HAT) in sub-Saharan Africa. Paradoxically, genomic variation between taxa is extremely low. We analyzed the whole-genome sequences of 39 isolates across the T. brucei complex from diverse hosts and regions, identifying 608,501 single nucleotide polymorphisms that represent 2.33% of the nuclear genome. We show that human pathogenicity occurs across a wide range of parasite genotypes, and taxonomic designation does not reflect genetic variation across the group, as previous studies have suggested based on a small number of genes. This genome-wide study allowed the identification of significant host and geographic location associations. Strong purifying selection was detected in genomic regions associated with cytoskeleton structure, and regulatory genes associated with antigenic variation, suggesting conservation of these regions in African trypanosomes. In agreement with expectations drawn from meiotic reciprocal recombination, differences in average linkage disequilibrium between chromosomes in T. brucei correlate positively with chromosome size. In addition to insights into the life history of a diverse group of eukaryotic parasites, the documentation of genomic variation across the T. brucei complex and its association with specific hosts and geographic localities will aid in the development of comprehensive monitoring tools crucial to the proposed elimination of HAT by 2020, and on a shorter term, for monitoring the feared merger between the two human infective parasites, T. brucei rhodesiense and T. b. gambiense, in northern Uganda.

  1. Hypothemicin, a fungal natural product, identifies therapeutic targets in Trypanosoma brucei

    PubMed Central

    Nishino, Mari; Choy, Jonathan W; Gushwa, Nathan N; Oses-Prieto, Juan A; Koupparis, Kyriacos; Burlingame, Alma L; Renslo, Adam R; McKerrow, James H; Taunton, Jack

    2013-01-01

    Protein kinases are potentially attractive therapeutic targets for neglected parasitic diseases, including African trypanosomiasis caused by the protozoan, Trypanosoma brucei. How to prioritize T. brucei kinases and quantify their intracellular engagement by small-molecule inhibitors remain unsolved problems. Here, we combine chemoproteomics and RNA interference to interrogate trypanosome kinases bearing a Cys-Asp-Xaa-Gly motif (CDXG kinases). We discovered that hypothemycin, a fungal polyketide previously shown to covalently inactivate a subset of human CDXG kinases, kills T. brucei in culture and in infected mice. Quantitative chemoproteomic analysis with a hypothemycin-based probe revealed the relative sensitivity of endogenous CDXG kinases, including TbGSK3short and a previously uncharacterized kinase, TbCLK1. RNAi-mediated knockdown demonstrated that both kinases are essential, but only TbCLK1 is fully engaged by cytotoxic concentrations of hypothemycin in intact cells. Our study identifies TbCLK1 as a therapeutic target for African trypanosomiasis and establishes a new chemoproteomic tool for interrogating CDXG kinases in their native context. DOI: http://dx.doi.org/10.7554/eLife.00712.001 PMID:23853713

  2. Biochemical diversity in the Trypanosoma congolense trans-sialidase family.

    PubMed

    Gbem, Thaddeus T; Waespy, Mario; Hesse, Bettina; Dietz, Frank; Smith, Joel; Chechet, Gloria D; Nok, Jonathan A; Kelm, Sørge

    2013-01-01

    Trans-sialidases are key enzymes in the life cycle of African trypanosomes in both, mammalian host and insect vector and have been associated with the disease trypanosomiasis, namely sleeping sickness and nagana. Besides the previously reported TconTS1, we have identified three additional active trans-sialidases, TconTS2, TconTS3 and TconTS4, and three trans-sialidase like genes in Trypanosoma congolense. At least TconTS1, TconTS2 and TconTS4 are found in the bloodstream of infected animals. We have characterised the enzymatic properties of recombinant proteins expressed in eukaryotic fibroblasts using fetuin as model blood glycoprotein donor substrate. One of the recombinant trans-sialidases, TconTS2, had the highest specific activity reported thus far with very low sialidase activity. The active trans-sialidases share all the amino acids critical for the catalytic reaction with few variations in the predicted binding site for the leaving or acceptor glycan. However, these differences cannot explain the orders of magnitudes between their transfer activities, which must be due to other unidentified structural features of the proteins or substrates selectivity. Interestingly, the phylogenetic relationships between the lectin domains correlate with their specific trans-sialylation activities. This raises the question whether and how the lectin domains regulate the trans-sialidase reaction. The identification and enzymatic characterisation of the trans-sialidase family in T. congolense will contribute significantly towards the understanding of the roles of these enzymes in the pathogenesis of Animal African Trypanosomiasis.

  3. Trypanosoma (Herpetosoma) leeuwenhoeki in Choloepus hoffmanni and Didelphis marsupialis of the Pacific Coast of Colombia.

    PubMed

    Travi, B L; Zea, A; D'Alessandro, A

    1989-04-01

    Trypanosoma (Herpetosoma) leeuwenhoeki, originally described in Panamanian sloths, was isolated from Didelphis marsupialis (Marsupialia) and Choloepus hoffmanni (Edentata) inhabiting the Pacific coast of Colombia. Trypanosomes were characterized by their large blood forms (total length 51-53 microns), poor infectivity for mice, and lack of development in Rhodnius prolixus. Isoenzyme studies, with either strains or clones, revealed homogeneous profiles clearly distinct from Trypanosoma cruzi and Trypanosoma rangeli reference strains. The present report extends the geographical distribution of T. leeuwenhoeki to South America and broadens its known host range to another order of mammals.

  4. Specific Endocytosis Blockade of Trypanosoma cruzi Exposed to a Poly-LAcNAc Binding Lectin Suggests that Lectin-Sugar Interactions Participate to Receptor-Mediated Endocytosis

    PubMed Central

    Brosson, Sébastien; Fontaine, Frédéric; Vermeersch, Marjorie; Perez-Morga, David; Pays, Etienne; Bousbata, Sabrina; Salmon, Didier

    2016-01-01

    Trypanosoma cruzi is a protozoan parasite transmitted by a triatomine insect, and causing human Chagas disease in South America. This parasite undergoes a complex life cycle alternating between non-proliferative and dividing forms. Owing to their high energy requirement, replicative epimastigotes of the insect midgut display high endocytic activity. This activity is mainly restricted to the cytostome, by which the cargo is taken up and sorted through the endosomal vesicular network to be delivered to reservosomes, the final lysosomal-like compartments. In African trypanosomes tomato lectin (TL) and ricin, respectively specific to poly-N-acetyllactosamine (poly-LacNAc) and β-D-galactose, allowed the identification of giant chains of poly-LacNAc in N-glycoproteins of the endocytic pathway. We show that in T. cruzi epimastigote forms also, glycoproteins of the endocytic pathway are characterized by the presence of N-linked glycans binding to both ricin and TL. Affinity chromatography using both TL and Griffonia simplicifolia lectin II (GSLII), specific to non-reducing terminal residue of N-acetylglucosamine (GlcNAc), led to an enrichment of glycoproteins of the trypanosomal endocytic pathway. Incubation of live parasites with TL, which selectively bound to the cytostome/cytopharynx, specifically inhibited endocytosis of transferrin (Tf) but not dextran, a marker of fluid endocytosis. Taken together, our data suggest that N-glycan modification of endocytic components plays a crucial role in receptor-mediated endocytosis of T. cruzi. PMID:27685262

  5. A new member of a family of site-specific retrotransposons is present in the spliced leader RNA genes of Trypanosoma cruzi.

    PubMed Central

    Villanueva, M S; Williams, S P; Beard, C B; Richards, F F; Aksoy, S

    1991-01-01

    A new member of a family of site-specific retrotransposons is described in the New World trypanosome Trypanosoma cruzi. This element, CZAR (cruzi-associated retrotransposon), resembles two previously described retrotransposons found in the African trypanosome T. brucei gambiense and the mosquito trypanosomatid Crithidia fasciculata in specifically inserting between nucleotides 11 and 12 of the highly conserved 39-mer of the spliced leader RNA (SL-RNA) gene. CZAR is similar in overall organization to the other two SL-RNA-associated elements. It possesses two potential long open reading frames which resemble the gag and pol genes of retroviruses. In the pol open reading frame, all three elements contain similarly arranged endonuclease domains and share extensive amino acid homology in the reverse transcriptase region. All are associated with the SL-RNA gene locus and are present in low copy numbers. They do not appear to have 5' truncated versions. All three retrotransposons are otherwise quite distinct from one another, with no significant overall amino acid homology. The presence of such retroelements inserted into the identical site within SL-RNA gene sequences in at least three evolutionarily distant trypanosomatid species argues for a functional role. Because these elements appear to have a precise target site requirement for integration, we refer to them as SL siteposons. Images PMID:1719380

  6. Evaluation of African medicinal plants for their in vitro trypanocidal activity.

    PubMed

    Freiburghaus, F; Kaminsky, R; Nkunya, M H; Brun, R

    1996-12-01

    Petroleum ether, dichloromethane, methanol and water extracts from 24 plants, belonging to 19 families, which are reported in the literature as traditional remedies for sleeping sickness (human African trypanosomiasis) were screened for in vitro activity against Trypanosoma brucei rhodesiense, as well as fro cytotoxicity for a human fibroblast cell-line (WI-38). The trypanocidal activity of the natural compounds berberine and harmane, both documented as being trypanocidal, was also evaluated. Promising trypanocidal activity with IC50 values below 10 micrograms/ml was found in 32 extracts of 13 plant species. The most active extracts with IC50 below 1 microgram/ml were derived from Annona senegalensis, Bussea occidentalis and Physalis angulata. The plant extracts showed a modest selectivity index, in contrast to commercially available trypanocides which have a more distinct selective toxicity against trypanosomes.

  7. Nanobody conjugated PLGA nanoparticles for active targeting of African Trypanosomiasis.

    PubMed

    Arias, José L; Unciti-Broceta, Juan D; Maceira, José; Del Castillo, Teresa; Hernández-Quero, José; Magez, Stefan; Soriano, Miguel; García-Salcedo, José A

    2015-01-10

    Targeted delivery of therapeutics is an alternative approach for the selective treatment of infectious diseases. The surface of African trypanosomes, the causative agents of African trypanosomiasis, is covered by a surface coat consisting of a single variant surface glycoprotein, termed VSG. This coat is recycled by endocytosis at a very high speed, making the trypanosome surface an excellent target for the delivery of trypanocidal drugs. Here, we report the design of a drug nanocarrier based on poly ethylen glycol (PEG) covalently attached (PEGylated) to poly(D,L-lactide-co-glycolide acid) (PLGA) to generate PEGylated PLGA nanoparticles. This nanocarrier was coupled to a single domain heavy chain antibody fragment (nanobody) that specifically recognizes the surface of the protozoan pathogen Trypanosoma brucei. Nanoparticles were loaded with pentamidine, the first-line drug for T. b. gambiense acute infection. An in vitro effectiveness assay showed a 7-fold decrease in the half-inhibitory concentration (IC50) of the formulation relative to free drug. Furthermore, in vivo therapy using a murine model of African trypanosomiasis demonstrated that the formulation cured all infected mice at a 10-fold lower dose than the minimal full curative dose of free pentamidine and 60% of mice at a 100-fold lower dose. This nanocarrier has been designed with components approved for use in humans and loaded with a drug that is currently in use to treat the disease. Moreover, this flexible nanobody-based system can be adapted to load any compound, opening a range of new potential therapies with application to other diseases.

  8. Genetic Profiling of the Isoprenoid and Sterol Biosynthesis Pathway Genes of Trypanosoma cruzi

    PubMed Central

    Cosentino, Raúl O.; Agüero, Fernán

    2014-01-01

    In Trypanosoma cruzi the isoprenoid and sterol biosynthesis pathways are validated targets for chemotherapeutic intervention. In this work we present a study of the genetic diversity observed in genes from these pathways. Using a number of bioinformatic strategies, we first identified genes that were missing and/or were truncated in the T. cruzi genome. Based on this analysis we obtained the complete sequence of the ortholog of the yeast ERG26 gene and identified a non-orthologous homolog of the yeast ERG25 gene (sterol methyl oxidase, SMO), and we propose that the orthologs of ERG25 have been lost in trypanosomes (but not in Leishmanias). Next, starting from a set of 16 T. cruzi strains representative of all extant evolutionary lineages, we amplified and sequenced ∼24 Kbp from 22 genes, identifying a total of 975 SNPs or fixed differences, of which 28% represent non-synonymous changes. We observed genes with a density of substitutions ranging from those close to the average (∼2.5/100 bp) to some showing a high number of changes (11.4/100 bp, for the putative lathosterol oxidase gene). All the genes of the pathway are under apparent purifying selection, but genes coding for the sterol C14-demethylase, the HMG-CoA synthase, and the HMG-CoA reductase have the lowest density of missense SNPs in the panel. Other genes (TcPMK, TcSMO-like) have a relatively high density of non-synonymous SNPs (2.5 and 1.9 every 100 bp, respectively). However, none of the non-synonymous changes identified affect a catalytic or ligand binding site residue. A comparative analysis of the corresponding genes from African trypanosomes and Leishmania shows similar levels of apparent selection for each gene. This information will be essential for future drug development studies focused on this pathway. PMID:24828104

  9. Pyrimidine Salvage in Trypanosoma brucei Bloodstream Forms and the Trypanocidal Action of Halogenated Pyrimidiness

    PubMed Central

    Ali, Juma A. M.; Creek, Darren J.; Burgess, Karl; Allison, Harriet C.; Field, Mark C.; Mäser, Pascal; De Koning, Harry P.

    2016-01-01

    African trypanosomes are capable of both pyrimidine biosynthesis and salvage of preformed pyrimidines from the host. However, uptake of pyrimidines in bloodstream form trypanosomes has not been investigated, making it difficult to judge the relative importance of salvage and synthesis or to design a pyrimidine-based chemotherapy. Detailed characterization of pyrimidine transport activities in bloodstream form Trypanosoma brucei brucei found that these cells express a high-affinity uracil transporter (designated TbU3) that is clearly distinct from the procyclic pyrimidine transporters. This transporter had low affinity for uridine and 2′deoxyuridine and was the sole pyrimidine transporter expressed in these cells. In addition, thymidine was taken up inefficiently through a P1-type nucleoside transporter. Of importance, the anticancer drug 5-fluorouracil was an excellent substrate for TbU3, and several 5-fluoropyrimidine analogs were investigated for uptake and trypanocidal activity; 5F-orotic acid, 5F-2′deoxyuridine displayed activity in the low micromolar range. The metabolism and mode of action of these analogs was determined using metabolomic assessments of T. brucei clonal lines adapted to high levels of these pyrimidine analogs, and of the sensitive parental strains. The analysis showed that 5-fluorouracil is incorporated into a large number of metabolites but likely exerts toxicity through incorporation into RNA. 5F-2′dUrd and 5F-2′dCtd are not incorporated into nucleic acids but act as prodrugs by inhibiting thymidylate synthase as 5F-dUMP. We present the most complete model of pyrimidine salvage in T. brucei to date, supported by genome-wide profiling of the predicted pyrimidine biosynthesis and conversion enzymes. PMID:23188714

  10. Transcriptome Profiling of Trypanosoma brucei Development in the Tsetse Fly Vector Glossina morsitans

    PubMed Central

    Vigneron, Aurelien; Aksoy, Serap; Tschudi, Christian

    2016-01-01

    African trypanosomes, the causative agents of sleeping sickness in humans and nagana in animals, have a complex digenetic life cycle between a mammalian host and an insect vector, the blood-feeding tsetse fly. Although the importance of the insect vector to transmit the disease was first realized over a century ago, many aspects of trypanosome development in tsetse have not progressed beyond a morphological analysis, mainly due to considerable challenges to obtain sufficient material for molecular studies. Here, we used high-throughput RNA-Sequencing (RNA-Seq) to profile Trypanosoma brucei transcript levels in three distinct tissues of the tsetse fly, namely the midgut, proventriculus and salivary glands. Consistent with current knowledge and providing a proof of principle, transcripts coding for procyclin isoforms and several components of the cytochrome oxidase complex were highly up-regulated in the midgut transcriptome, whereas transcripts encoding metacyclic VSGs (mVSGs) and the surface coat protein brucei alanine rich protein or BARP were extremely up-regulated in the salivary gland transcriptome. Gene ontology analysis also supported the up-regulation of biological processes such as DNA metabolism and DNA replication in the proventriculus transcriptome and major changes in signal transduction and cyclic nucleotide metabolism in the salivary gland transcriptome. Our data highlight a small repertoire of expressed mVSGs and potential signaling pathways involving receptor-type adenylate cyclases and members of a surface carboxylate transporter family, called PADs (Proteins Associated with Differentiation), to cope with the changing environment, as well as RNA-binding proteins as a possible global regulators of gene expression. PMID:28002435

  11. Protein functional links in Trypanosoma brucei, identified by gene fusion analysis

    PubMed Central

    2011-01-01

    Background Domain or gene fusion analysis is a bioinformatics method for detecting gene fusions in one organism by comparing its genome to that of other organisms. The occurrence of gene fusions suggests that the two original genes that participated in the fusion are functionally linked, i.e. their gene products interact either as part of a multi-subunit protein complex, or in a metabolic pathway. Gene fusion analysis has been used to identify protein functional links in prokaryotes as well as in eukaryotic model organisms, such as yeast and Drosophila. Results In this study we have extended this approach to include a number of recently sequenced protists, four of which are pathogenic, to identify fusion linked proteins in Trypanosoma brucei, the causative agent of African sleeping sickness. We have also examined the evolution of the gene fusion events identified, to determine whether they can be attributed to fusion or fission, by looking at the conservation of the fused genes and of the individual component genes across the major eukaryotic and prokaryotic lineages. We find relatively limited occurrence of gene fusions/fissions within the protist lineages examined. Our results point to two trypanosome-specific gene fissions, which have recently been experimentally confirmed, one fusion involving proteins involved in the same metabolic pathway, as well as two novel putative functional links between fusion-linked protein pairs. Conclusions This is the first study of protein functional links in T. brucei identified by gene fusion analysis. We have used strict thresholds and only discuss results which are highly likely to be genuine and which either have already been or can be experimentally verified. We discuss the possible impact of the identification of these novel putative protein-protein interactions, to the development of new trypanosome therapeutic drugs. PMID:21729286

  12. The effect of L-thyroxine on the anaemia response in Trypanosoma congolense infected rabbits.

    PubMed

    Lomo, P O; Makawiti, D W; Konji, V N

    1995-06-01

    The development of anaemia is a major pathological manifestation in chronic trypanosomosis. The anaemia in African trypanosomosis coincides with a marked decrease in plasma concentration of both thyroxine (T4) and 3,5,3' triiodothyronine (T3). To evaluate the effect of trypanosome-induced hypothyroidism on the development of anaemia, sexually mature white New Zealand rabbits were used. Three groups were set up, each of ten rabbits: one group was infected with Trypanosoma congolense; the second group was infected but given replacement doses of thyroxine (treated); the third group was not infected. Small volumes of blood were collected for the determination of parasitaemia and packed cell volume (PCV). The concentrations of T3 and T4 were measured in plasma by radioimmunoassay. The decrease in PCV correlated closely (y = -0.38x + 15.2; r = 0.82, P = 0.001) with the intensity and duration of parasitaemia. The critical PCV value was 0.15 11-1 with a peak parasitaemia of approximately 5 x 10(6) trypanosomes ml-1 of blood. There was a significant correlation between the plasma T3 and PCV (y = 0.049x + 0.57; r = 0.66, P = 0.020). There was also a good positive correlation between T4 and PCV (y = 14.5 + 3.03; r = 0.95, P < 0.001) in the infected untreated group. The PCV levels were significantly different among the three groups of animals (P < 0.05). The infected-treated animals sustained longer periods of infection than the infected and untreated ones. The sustained physiological level of bioactive thyroid hormones T3 and T4 significantly arrested the decline in PCV as the disease progressed.(ABSTRACT TRUNCATED AT 250 WORDS)

  13. Variant surface glycoprotein from Trypanosoma evansi is partially responsible for the cross-reaction between Trypanosoma evansi and Trypanosoma vivax.

    PubMed

    Uzcanga, Graciela L; Perrone, Trina; Noda, José Alfredo; Pérez-Pazos, Jacqueline; Medina, Rafael; Hoebeke, Johan; Bubis, José

    2004-01-27

    Salivarian trypanosomes use antigenic variation of their variant-specific surface glycoprotein (VSG) coat as a defense against the host immune system. Although about 1000 VSG and pseudo-VSG genes are scattered throughout the trypanosome genome, each trypanosome expresses only one VSG, while the rest of the genes are transcriptionally silent. A 64-kDa glycosylated cross-reacting antigen between Trypanosoma evansi and Trypanosoma vivax (p64), which was purified from the TEVA1 T. evansi Venezuelan isolate, was proven here to represent the soluble form of a VSG. Initially, a biochemical characterization of p64 was carried out. Gel filtration chromatography, sedimentation, and chemical cross-linking provided evidences of the dimeric nature of p64. The hydrodynamic parameters indicated that p64 is asymmetrical with a frictional ratio f/fo = 1.57. Isoelectric focusing and two-dimensional polyacrylamide gel electrophoresis revealed that p64 contained two isoforms with isoelectric points of 6.8-6.9 and 7.1-7.2. When p64 and three p64 Staphylococcus aureus V8 proteolytic fragments were sequenced, the same N-termini sequence was obtained: Ala-Pro-Ile-Thr-Asp-Ala-Asp-Leu-Gly-Pro-Ala-Gln-Ile-Ala-Asp, which displayed a significant homology with a putative Trypanosoma brucei VSG gene located on chromosome 4. Additionally, immunofluorescence microscopy on T. evansi and T. vivax established that p64 and its T. vivax homologue were confined to the surface of both parasites. An immunological characterization of this antigen was also carried out using several Venezuelan T. evansi isolates expressing different VSGs, which were obtained from naturally infected animals. Although sera from animals infected with the various T. evansi isolates recognized p64, only one isolate, besides TEVA1, contained polypeptides that were recognized by anti-p64 antibodies. All these results together with prior evidences [Uzcanga, G. et al. (2002) Parasitology 124, 287-299] confirmed that p64 is the

  14. IgM, lgG and IL-6 profiles in the Trypanosoma brucei brucei monkey model of human African trypanosomiasis.

    PubMed

    Waema, Maxwell W; Maina, Naomi W; Ngotho, Maina; Karanja, Simon M; Gachie, Beatrice M; Maranga, Dawn N; Kagira, John M

    2017-04-01

    Human African trypanosomiasis (HAT) patients manifest immunological profiles, whose variations over time can be used to indicate disease progression. However, monitoring of these biomarkers in human patients is beset by several limitations which can be offset by using chronic animal models. A recent improved monkey model of HAT using a Trypanosoma brucei brucei isolate has been developed but the immunological profile has not been elucidated. The objectives of the current study was to determine the IgM, IgG and IL-6 profiles in blood and cerebrospinal fluid (CSF) in vervet monkeys infected with T. b. brucei. Three vervet monkeys were infected intravenously with 10(5)T. b. brucei, monitored for disease development and subsequently treated 28days post infection (dpi) sub-curatively using diminazene aceturate (DA) to induce late stage disease and curatively treated with melarsoprol (Mel B) at 119 dpi, respectively. Matched serum and cerebrospinal fluid (CSF) samples were obtained at regular intervals and immunospecific IgM, immunoglobulin G (IgG) were quantified by ELISA while IL-6 was assayed using a cytometric bead array (CBA) kit. Results showed that following infection, CSF IgM, IgG, IL-6 and serum IL-6 were significantly (p<0.05) elevated with peak levels coinciding with relapse parasitaemia. The IgG levels increased to reach OD peak levels of 0.442±0.5 at 126 dpi. After curative treatment with MelB, the serum IgM and Ig G levels fell rapidly to attain pre-infection levels within 35 and 49days, respectively. This shows that the profile of these immunoglobulins can be used as an indicator of curative treatment. CSF IL-6 concentrations of infected vervet monkeys showed no significant change (P>0.05) between infection and 35 dpi but levels increased significantly (P<0.05) with the highest level of 55.53pg/ml recorded at112 dpi. IL-6 elevation from 35 dpi may be indicative of parasite neuroinvasion hence can be used as possible candidate marker for late stage disease

  15. Impact of Anthropogenic Disturbance on Native and Invasive Trypanosomes of Rodents in Forested Uganda.

    PubMed

    Salzer, Johanna S; Pinto, C Miguel; Grippi, Dylan C; Williams-Newkirk, Amanda Jo; Peterhans, Julian Kerbis; Rwego, Innocent B; Carroll, Darin S; Gillespie, Thomas R

    2016-12-01

    Habitat disturbance and anthropogenic change are globally associated with extinctions and invasive species introductions. Less understood is the impact of environmental change on the parasites harbored by endangered, extinct, and introduced species. To improve our understanding of the impacts of anthropogenic disturbance on such host-parasite interactions, we investigated an invasive trypanosome (Trypanosoma lewisi). We screened 348 individual small mammals, representing 26 species, from both forested and non-forested habitats in rural Uganda. Using microscopy and PCR, we identified 18% of individuals (order Rodentia) as positive for trypanosomes. Further phylogenetic analyses revealed two trypanosomes circulating-T. lewisi and T. varani. T. lewisi was found in seven species both native and invasive, while T. varani was identified in only three native forest species. The lack of T. varani in non-forested habitats suggests that it is a natural parasite of forest-dwelling rodents. Our findings suggest that anthropogenic disturbance may lead to spillover of an invasive parasite (T. lewisi) from non-native to native species, and lead to local co-extinction of a native parasite (T. varani) and native forest-dwelling hosts.

  16. Trypanosoma cf. varani in an imported ball python (Python reginus) from Ghana.

    PubMed

    Sato, Hiroshi; Takano, Ai; Kawabata, Hiroki; Une, Yumi; Watanabe, Haruo; Mukhtar, Maowia M

    2009-08-01

    Peripheral blood from a ball python (Python reginus) imported from Ghana was cultured in Barbour-Stoenner-Kelly (BSK) medium for Borrelia spp. isolation, resulting in the prominent appearance of free, and clusters of, trypanosomes in a variety of morphological forms. The molecular phylogenetic characterization of these cultured trypanosomes, using the small subunit rDNA, indicated that this python was infected with a species closely related to Trypanosoma varani Wenyon, 1908, originally described in the Nile monitor lizard (Varanus niloticus) from Sudan. Furthermore, nucleotide sequences of glycosomal glyceraldehyde-3-phosphate dehydrogenase gene of both isolates showed few differences. Giemsa-stained blood smears, prepared from the infected python 8 mo after the initial observation of trypanosomes in hemoculture, contained trypomastigotes with a broad body and a short, free flagellum; these most closely resembled the original description of T. varani, or T. voltariae Macfie, 1919 recorded in a black-necked spitting cobra (Naja nigricollis) from Ghana. It is highly possible that lizards and snakes could naturally share an identical trypanosome species. Alternatively, lizards and snakes in the same region might have closely related, but distinct, Trypanosoma species as a result of sympatric speciation. From multiple viewpoints, including molecular phylogenetic analyses, reappraisal of trypanosome species from a wide range of reptiles in Africa is needed to clarify the relationship of recorded species, or to unmask unrecorded species.

  17. Developmental and Ultrastructural Characterization and Phylogenetic Analysis of Trypanosoma herthameyeri n. sp. of Brazilian Leptodactilydae Frogs.

    PubMed

    Attias, Márcia; Sato, Lyslaine H; Ferreira, Robson C; Takata, Carmen S A; Campaner, Marta; Camargo, Erney P; Teixeira, Marta M G; de Souza, Wanderley

    2016-09-01

    We described the phylogenetic affiliation, development in cultures and ultrastructural features of a trypanosome of Leptodacylus chaquensis from the Pantanal biome of Brazil. In the inferred phylogeny, this trypanosome nested into the Anura clade of the basal Aquatic clade of Trypanosoma, but was separate from all known species within this clade. This finding enabled us to describe it as Trypanosoma herthameyeri n. sp., which also infects other Leptodacylus species from the Pantanal and Caatinga biomes. Trypanosoma herthameyeri multiplies as small rounded forms clumped together and evolving into multiple-fission forms and rosettes of epimastigotes released as long forms with long flagella; scarce trypomastigotes and glove-like forms are common in stationary-phase cultures. For the first time, a trypanosome from an amphibian was observed by field emission scanning electron microscopy, revealing a cytostome opening, well-developed flagellar lamella, and many grooves in pumpkin-like forms. Transmission electron microscopy showed highly developed Golgi complexes, relaxed catenation of KDNA, and a rich set of spongiome tubules in a regular parallel arrangement to the flagellar pocket as confirmed by electron tomography. Considering the basal position in the phylogenetic tree, developmental and ultrastructural data of T. herthameyeri are valuable for evolutionary studies of trypanosome architecture and cell biology.

  18. The potential impact of native Australian trypanosome infections on the health of koalas (Phascolarctos cinereus).

    PubMed

    McInnes, L M; Gillett, A; Hanger, J; Reid, S A; Ryan, U M

    2011-06-01

    Whole blood collected from koalas admitted to the Australian Zoo Wildlife Hospital (AZWH), Beerwah, QLd, Australia, during late 2006-2009 was tested using trypanosome species-specific 18S rDNA PCRs designed to amplify DNA from Trypanosoma irwini, T. gilletti and T. copemani. Clinical records for each koala sampled were reviewed and age, sex, blood packed cell volume (PCV), body condition, signs of illness, blood loss, trauma, chlamydiosis, bone marrow disease, koala AIDS and hospital admission outcome ('survival'/ 'non-survival') were correlated with PCR results. Overall 73.8% (439/595) of the koalas were infected with at least 1 species of trypanosome. Trypanosoma irwini was detected in 423/595 (71.1%), T. gilletti in 128/595 (21.5%) and T. copemani in 26/595 (4.4%) of koalas. Mixed infections were detected in 125/595 (21%) with co-infections of T. irwini and T. gilletti (101/595, 17%) being most common. There was a statistical association between infection with T. gilletti with lower PCV values and body condition scores in koalas with signs of chlamydiosis, bone marrow disease or koala AIDS. No association between T. gilletti infection and any indicator of health was observed in koalas without signs of concurrent disease. This raises the possibility that T. gilletti may be potentiating other disease syndromes affecting koalas.

  19. Temporal and spatial dynamics of trypanosomes infecting the brush-tailed bettong (Bettongia penicillata): a cautionary note of disease-induced population decline

    PubMed Central

    2014-01-01

    Background The brush-tailed bettong or woylie (Bettongia penicillata) is on the brink of extinction. Its numbers have declined by 90% since 1999, with their current distribution occupying less than 1% of their former Australian range. Woylies are known to be infected with three different trypanosomes (Trypanosoma vegrandis, Trypanosoma copemani and Trypanosoma sp. H25) and two different strains of T. copemani that vary in virulence. However, the role that these haemoparasites have played during the recent decline of their host is unclear and is part of ongoing investigation. Methods Woylies were sampled from five locations in southern Western Australia, including two neighbouring indigenous populations, two enclosed (fenced) populations and a captive colony. PCR was used to individually identify the three different trypanosomes from blood and tissues of the host, and to investigate the temporal and spatial dynamics of trypanosome infections. Results The spatial pattern of trypanosome infection varied among the five study sites, with a greater proportion of woylies from the Perup indigenous population being infected with T. copemani than from the neighbouring Kingston indigenous population. For an established infection, T. copemani detection was temporally inconsistent. The more virulent strain of T. copemani appeared to regress at a faster rate than the less virulent strain, with the infection possibly transitioning from the acute to chronic phase. Interspecific competition may also exist between T. copemani and T. vegrandis, where an existing T. vegrandis infection may moderate the sequential establishment of the more virulent T. copemani. Conclusion In this study, we provide a possible temporal connection implicating T. copemani as the disease agent linked with the recent decline of the Kingston indigenous woylie population within the Upper Warren region of Western Australia. The chronic association of trypanosomes with the internal organs of its host may be

  20. Biosynthesis and uptake of thiamine (vitamin B1) in bloodstream form Trypanosoma brucei brucei and interference of the vitamin with melarsen oxide activity.

    PubMed

    Stoffel, Sabine A; Rodenko, Boris; Schweingruber, Anne-Marie; Mäser, Pascal; de Koning, Harry P; Schweingruber, M Ernst

    2006-02-01

    Bloodstream forms of Trypanosoma brucei brucei were cultivated in the presence and absence of thiamine (vitamin B1) and pyridoxine (vitamin B6). The vitamins do not change growth behaviour, indicating that Trypanosoma brucei is prototrophic for the two vitamins even though in silico no bona-fide thiamine-biosynthetic genes could be identified in the T. brucei genome. Intracellularly, thiamine is mainly present in its diphosphate form. We were unable to detect significant uptake of [3H]thiamine and structural thiamine analogues such as pyrithiamine, oxithiamine and amprolium were not toxic for the bloodstream forms of T. brucei, indicating that the organism does not have an efficient uptake system for thiamine and its analogues. We have previously shown that, in the fission yeast Saccharomyces pombe, the toxicity of melarsen oxide, the pharmacologically active derivative of the frontline sleeping sickness drug melarsoprol, is abolished by thiamine and the drug is taken up by a thiamine-regulated membrane protein which is responsible for the utilization of thiamine. We show here that thiamine also has weak effects on melarsen oxide-induced growth inhibition and lysis in T. brucei. These effects were consistent with a low affinity of thiamine for the P2 adenosine transporter that is responsible for uptake of melaminophenyl arsenicals in African trypanosomes.

  1. Third target of rapamycin complex negatively regulates development of quiescence in Trypanosoma brucei

    PubMed Central

    Barquilla, Antonio; Saldivia, Manuel; Diaz, Rosario; Bart, Jean-Mathieu; Vidal, Isabel; Calvo, Enrique; Hall, Michael N.; Navarro, Miguel

    2012-01-01

    African trypanosomes are protozoan parasites transmitted by a tsetse fly vector to a mammalian host. The life cycle includes highly proliferative forms and quiescent forms, the latter being adapted to host transmission. The signaling pathways controlling the developmental switch between the two forms remain unknown. Trypanosoma brucei contains two target of rapamycin (TOR) kinases, TbTOR1 and TbTOR2, and two TOR complexes, TbTORC1 and TbTORC2. Surprisingly, two additional TOR kinases are encoded in the T. brucei genome. We report that TbTOR4 associates with an Armadillo domain-containing protein (TbArmtor), a major vault protein, and LST8 to form a unique TOR complex, TbTORC4. Depletion of TbTOR4 caused irreversible differentiation of the parasite into the quiescent form. AMP and hydrolysable analogs of cAMP inhibited TbTOR4 expression and induced the stumpy quiescent form. Our results reveal unexpected complexity in TOR signaling and show that TbTORC4 negatively regulates differentiation of the proliferative form into the quiescent form. PMID:22908264

  2. Wild fauna as a probable animal reservoir for Trypanosoma brucei gambiense in Cameroon.

    PubMed

    Njiokou, F; Laveissière, C; Simo, G; Nkinin, S; Grébaut, P; Cuny, G; Herder, S

    2006-03-01

    In order to study the existence of a wild animal reservoir for Trypanosoma brucei gambiense in South Cameroon, blood was collected from wild animals in three human African trypanosomiasis foci and from a nonendemic control area. The 1142 wild animals sampled belonged to 36 different species pertaining to eight orders (407 primates, 347 artiodactyls, 265 rodents, 54 pangolins, 53 carnivores, 11 saurians and crocodilians, and five hyraxes). QBC and KIVI tests detected trypanosomes on 1.7% (13/762) and 18.4% (43/234) of animals examined, respectively. Using specific primers, T. brucei non-gambiense group 1 DNA was detected on 56 animals (4.9%). This infection rate was 5.3% in the endemic zone and 3.8% in the control zone. Of the 832 animals of the endemic zone, PCR revealed T. b. gambiense group 1 DNA in 18 (2.2%). These hosts included two rodents, two artiodactyls, two carnivores and two primates. T. b. gambiense group 1 was absent from animals from the nonendemic zone. A decrease in the prevalence of T. b. gambiense group 1 was observed in wild animals from the Bipindi sleeping sickness focus after a medical survey and vector control in this area. The epidemiological implications of these findings remain to be determined with further investigations.

  3. VSG switching in Trypanosoma brucei: antigenic variation analysed using RNAi in the absence of immune selection.

    PubMed

    Aitcheson, Niall; Talbot, Suzanne; Shapiro, Jesse; Hughes, Katie; Adkin, Carl; Butt, Thomas; Sheader, Karen; Rudenko, Gloria

    2005-09-01

    Trypanosoma brucei relies on antigenic variation of its variant surface glycoprotein (VSG) coat for survival. We show that VSG switching can be efficiently studied in vitro using VSG RNAi in place of an immune system to select for switch variants. Contrary to models predicting an instant switch after inhibition of VSG synthesis, switching was not induced by VSG RNAi and occurred at a rate of 10(-4) per division. We find a highly reproducible hierarchy of VSG activation, which appears to be capable of resetting, whereby more than half of the switch events over 12 experiments were to one of two VSGs. We characterized switched clones according to switch mechanism using marker genes in the active VSG expression site (ES). Transcriptional switches between ESs were the preferred switching mechanism, whereby at least 10 of the 17 ESs identified in T. brucei 427 can be functionally active in vitro. We could specifically select for switches mediated by DNA rearrangements by inducing VSG RNAi in the presence of drug selection for the active ES. Most of the preferentially activated VSGs could be activated by multiple mechanisms. This VSG RNAi-based procedure provides a rapid and powerful means for analysing VSG switching in African trypanosomes entirely in vitro.

  4. Identification of novel guide RNAs from the mitochondria of Trypanosoma brucei.

    PubMed

    Madej, Monika J; Niemann, Moritz; Hüttenhofer, Alexander; Göringer, H Ulrich

    2008-01-01

    The majority of mitochondrial mRNAs in African trypanosomes are subject to an RNA editing reaction, which is characterized by the insertion and/or deletion of U nucleotides only. The reaction creates functional mRNAs and is catalyzed by a high molecular mass enzyme complex, the editosome. Editosomes interact with a unique class of small non-coding, 3'-oligouridylated (oU) RNAs, so-called guide RNAs (gRNAs). Guide RNAs function as transacting templates in the U deletion/insertion reaction and thus, represent key components in the reaction cycle. Furthermore, by utilizing different gRNAs, alternative editing events can take place, thereby expanding the protein diversity in the mitochondria of the parasites. In this study, we have analyzed small, non-coding mitochondrial transcripts from Trypanosoma brucei. By generating cDNA libraries from size-selected RNA populations we identified 51 novel oU-RNAs. For 29 of these RNAs we were able to predict cognate mRNA targets. By Northern blot analysis, we verified the expression of 22 of these oU-RNAs and demonstrate that they share all known gRNA characteristics. Five of these 51 putative gRNAs are characterized by single mismatches to their cognate, fully edited mRNA sequences suggesting that they could act as gRNAs for alternative editing events.

  5. Growth of trypanosomes in vivo, host body weight gains, and food consumption in zinc-deficient mice.

    PubMed Central

    Humphrey, P. A.; Ashraf, M.; Lee, C. M.

    1997-01-01

    This study examined the effect of zinc deficiency on food consumption and the growth of mice infected with Trypanosoma musculi or immunized with parasite products. In addition, the effects of zinc deficiency on the growth and development of parasites in vivo was studied. Infected mice consumed more food than noninfected mice, and the level of food consumption in the zinc-deficient mice was much less and showed general decline during the observation period. Also, infected mice on both full-complement and zinc-deficient diets gained more body weight than control mice. Throughout the observational period, trypanosomes from zinc-deficient mice showed considerably higher variability in size as determined by coefficient of variation. In both dietary groups, the average length of trypanosomes was not significantly different. PMID:9002416

  6. Isolation and in vitro culture of trypanosomes from Leptodactylus ocellatus from the Atlantic Forest in a new experimental culture medium.

    PubMed

    Lemos, M; Souza, C S F; da Costa, S C Gonçalves; Souto-Padrón, T; D'Agosto, M

    2013-02-01

    The purpose of this study was to verify the in vitro development of Trypanosoma sp. isolated from Leptodactylus ocellatus frogs under a new protocol using a biphasic medium composed of Novy, McNeal, and Nicolle (NNN) blood agar medium as a solid phase and liver infusion, brain heart infusion, and tryptose (LIBHIT) medium as a liquid phase. Blood forms, collected by cardiac puncture or after the maceration of different organs, were inoculated in culture tubes containing the biphasic medium composed by NNN and LIBHIT. Trypanosomes were observed 4 days postinoculation; most bloodstream trypomastigotes had differentiated into epimastigotes and amastigotes by this time. Trypomastigotes were again observed in older cultures (7 days). Parasites were successfully subcultured for 8 mo in this medium and successfully cryopreserved. The present study provides a new protocol medium for the isolation and culture of anuran trypanosomes.

  7. Mitochondrial RNA processing in trypanosomes.

    PubMed

    Aphasizhev, Ruslan; Aphasizheva, Inna

    2011-09-01

    The mitochondrial genome of trypanosomes is composed of ∼50 maxicircles and thousands of minicircles. Maxi-(∼25 kb) and mini-(∼1 kb)circles are catenated and packed into a dense structure called a kinetoplast. Both types of circular DNA are transcribed by a phage-like RNA polymerase: maxicircles yield multicistronic rRNA and mRNA precursors, while guide RNA (gRNA) precursors are produced from minicircles. To function in mitochondrial translation, pre-mRNAs must undergo a nucleolytic processing and 3' modifications, and often uridine insertion/deletion editing. gRNAs, which represent short (50-60 nt) RNAs directing editing reactions, are produced by 3' nucleolytic processing of a much longer precursor followed by 3' uridylation. Ribosomal RNAs are excised from precursors and their 3' ends are also trimmed and uridylated. All tRNAs are imported from the cytoplasm and some are further modified and edited in the mitochondrial matrix. Historically, the fascinating phenomenon of RNA editing has been extensively studied as an isolated pathway in which nuclear-encoded proteins mediate interactions of maxi- and minicircle transcripts to create open reading frames. However, recent studies unraveled a highly integrated network of mitochondrial genome expression including critical pre- and post-editing 3' mRNA processing, and gRNA and rRNA maturation steps. Here we focus on RNA 3' adenylation and uridylation as processes essential for biogenesis, stability and functioning of mitochondrial RNAs.

  8. Lead Optimization of a Pyrazole Sulfonamide Series of Trypanosoma bruceiN-Myristoyltransferase Inhibitors: Identification and Evaluation of CNS Penetrant Compounds as Potential Treatments for Stage 2 Human African Trypanosomiasis

    PubMed Central

    2014-01-01

    Trypanosoma bruceiN-myristoyltransferase (TbNMT) is an attractive therapeutic target for the treatment of human African trypanosomiasis (HAT). From previous studies, we identified pyrazole sulfonamide, DDD85646 (1), a potent inhibitor of TbNMT. Although this compound represents an excellent lead, poor central nervous system (CNS) exposure restricts its use to the hemolymphatic form (stage 1) of the disease. With a clear clinical need for new drug treatments for HAT that address both the hemolymphatic and CNS stages of the disease, a chemistry campaign was initiated to address the shortfalls of this series. This paper describes modifications to the pyrazole sulfonamides which markedly improved blood–brain barrier permeability, achieved by reducing polar surface area and capping the sulfonamide. Moreover, replacing the core aromatic with a flexible linker significantly improved selectivity. This led to the discovery of DDD100097 (40) which demonstrated partial efficacy in a stage 2 (CNS) mouse model of HAT. PMID:25412409

  9. Lead optimization of a pyrazole sulfonamide series of Trypanosoma brucei N-myristoyltransferase inhibitors: identification and evaluation of CNS penetrant compounds as potential treatments for stage 2 human African trypanosomiasis.

    PubMed

    Brand, Stephen; Norcross, Neil R; Thompson, Stephen; Harrison, Justin R; Smith, Victoria C; Robinson, David A; Torrie, Leah S; McElroy, Stuart P; Hallyburton, Irene; Norval, Suzanne; Scullion, Paul; Stojanovski, Laste; Simeons, Frederick R C; van Aalten, Daan; Frearson, Julie A; Brenk, Ruth; Fairlamb, Alan H; Ferguson, Michael A J; Wyatt, Paul G; Gilbert, Ian H; Read, Kevin D

    2014-12-11

    Trypanosoma brucei N-myristoyltransferase (TbNMT) is an attractive therapeutic target for the treatment of human African trypanosomiasis (HAT). From previous studies, we identified pyrazole sulfonamide, DDD85646 (1), a potent inhibitor of TbNMT. Although this compound represents an excellent lead, poor central nervous system (CNS) exposure restricts its use to the hemolymphatic form (stage 1) of the disease. With a clear clinical need for new drug treatments for HAT that address both the hemolymphatic and CNS stages of the disease, a chemistry campaign was initiated to address the shortfalls of this series. This paper describes modifications to the pyrazole sulfonamides which markedly improved blood-brain barrier permeability, achieved by reducing polar surface area and capping the sulfonamide. Moreover, replacing the core aromatic with a flexible linker significantly improved selectivity. This led to the discovery of DDD100097 (40) which demonstrated partial efficacy in a stage 2 (CNS) mouse model of HAT.

  10. The role of B-cells and IgM antibodies in parasitemia, anemia, and VSG switching in Trypanosoma brucei-infected mice.

    PubMed

    Magez, Stefan; Schwegmann, Anita; Atkinson, Robert; Claes, Filip; Drennan, Michael; De Baetselier, Patrick; Brombacher, Frank

    2008-08-08

    African trypanosomes are extracellular parasitic protozoa, predominantly transmitted by the bite of the haematophagic tsetse fly. The main mechanism considered to mediate parasitemia control in a mammalian host is the continuous interaction between antibodies and the parasite surface, covered by variant-specific surface glycoproteins. Early experimental studies have shown that B-cell responses can be strongly protective but are limited by their VSG-specificity. We have used B-cell (microMT) and IgM-deficient (IgM(-/-)) mice to investigate the role of B-cells and IgM antibodies in parasitemia control and the in vivo induction of trypanosomiasis-associated anemia. These infection studies revealed that that the initial setting of peak levels of parasitemia in Trypanosoma brucei-infected microMT and IgM(-/-) mice occurred independent of the presence of B-cells. However, B-cells helped to periodically reduce circulating parasites levels and were required for long term survival, while IgM antibodies played only a limited role in this process. Infection-associated anemia, hypothesized to be mediated by B-cell responses, was induced during infection in microMT mice as well as in IgM(-/-) mice, and as such occurred independently from the infection-induced host antibody response. Antigenic variation, the main immune evasion mechanism of African trypanosomes, occurred independently from host antibody responses against the parasite's ever-changing antigenic glycoprotein coat. Collectively, these results demonstrated that in murine experimental T. brucei trypanosomiasis, B-cells were crucial for periodic peak parasitemia clearance, whereas parasite-induced IgM antibodies played only a limited role in the outcome of the infection.

  11. Phenotypic characteristics and trypanosome prevalence of Mursi cattle breed in the Bodi and Mursi districts of South Omo Zone, southwest Ethiopia.

    PubMed

    Terefe, Endashaw; Haile, Aynalem; Mulatu, Wudyalew; Dessie, Tadelle; Mwai, Okeyo

    2015-03-01

    The study was conducted to characterize the morphological features of Mursi cattle breed and to identify the species of trypanosome infecting the cattle and its prevalence in these traditionally managed cattle in the Bodi and Mursi pastoral communities. Cattle body description and measurements were made on 201 matured animals. Blood samples were collected from 409 animals into heparin-treated capillary tubes and were centrifuged to 12,000 rpm for 5 min to identify trypanosome species from the wet smeared buffy coat and to estimate the degree of anemia (PCV). Tsetse flies were collected using phenol-treated biconical trap and the caught flies identified to species level. The breed possesses variable coat color pattern, coat color type, and have small to medium hump size on the thoracic vertebrae. Body measurement of Mursi cattle in the two locations did not show significant differences except chest girth, rump width, and horn length. Trypanosome prevalence in the Mursi cattle breed was 6.1%. The highest trypanosome infection was caused by Trypanosoma congolense (56%) followed by Trypanosoma vivax (40%) and Trypanosoma brucei (4%). Trypanosome prevalence significantly varies between dry (2.0%) and late rainy (10.1%) seasons (P < 0.001) and between lean (11.9%) and medium (2.4%) body condition score (P < 0.01). The PCV value was 22.1 ± 0.5%, which is significantly varied with season (P < 0.01) and parasitism (P < 0.001). Parasitaemic cattle show the lowest PCV value (20.4 ± 1%) than aparasitaemic (23.7 ± 0.3%) cattle and cattle with lean BCS showed the lowest (P < 0.0001) PCV value (20.4 ± 0.6%). Tsetse fly species identified in the study area were Glossina pallidipes, Glossina morsitans submorsitans, and Glossina fuscipes. The number of flies captured in late rainy season was higher than in dry season (P < 0.01). Despite the existence of trypanosome and high tsetse fly infestation in the areas, large proportion of the Mursi

  12. Trypanosome Motion Represents an Adaptation to the Crowded Environment of the Vertebrate Bloodstream

    PubMed Central

    Heddergott, Niko; Krüger, Timothy; Babu, Sujin B.; Wei, Ai; Stellamanns, Erik; Uppaluri, Sravanti; Pfohl, Thomas; Stark, Holger; Engstler, Markus

    2012-01-01

    Blood is a remarkable habitat: it is highly viscous, contains a dense packaging of cells and perpetually flows at velocities varying over three orders of magnitude. Only few pathogens endure the harsh physical conditions within the vertebrate bloodstream and prosper despite being constantly attacked by host antibodies. African trypanosomes are strictly extracellular blood parasites, which evade the immune response through a system of antigenic variation and incessant motility. How the flagellates actually swim in blood remains to be elucidated. Here, we show that the mode and dynamics of trypanosome locomotion are a trait of life within a crowded environment. Using high-speed fluorescence microscopy and ordered micro-pillar arrays we show that the parasites mode of motility is adapted to the density of cells in blood. Trypanosomes are pulled forward by the planar beat of the single flagellum. Hydrodynamic flow across the asymmetrically shaped cell body translates into its rotational movement. Importantly, the presence of particles with the shape, size and spacing of blood cells is required and sufficient for trypanosomes to reach maximum forward velocity. If the density of obstacles, however, is further increased to resemble collagen networks or tissue spaces, the parasites reverse their flagellar beat and consequently swim backwards, in this way avoiding getting trapped. In the absence of obstacles, this flagellar beat reversal occurs randomly resulting in irregular waveforms and apparent cell tumbling. Thus, the swimming behavior of trypanosomes is a surprising example of micro-adaptation to life at low Reynolds numbers. For a precise physical interpretation, we compare our high-resolution microscopic data to results from a simulation technique that combines the method of multi-particle collision dynamics with a triangulated surface model. The simulation produces a rotating cell body and a helical swimming path, providing a functioning simulation method for a

  13. Reduced Mitochondrial Membrane Potential Is a Late Adaptation of Trypanosoma brucei brucei to Isometamidium Preceded by Mutations in the γ Subunit of the F1Fo-ATPase

    PubMed Central

    Munday, Jane C.; Tagoe, Daniel N. A.; Stelmanis, Valters; Schnaufer, Achim

    2016-01-01

    Background Isometamidium is the main prophylactic drug used to prevent the infection of livestock with trypanosomes that cause Animal African Trypanosomiasis. As well as the animal infective trypanosome species, livestock can also harbor the closely related human infective subspecies T. b. gambiense and T. b. rhodesiense. Resistance to isometamidium is a growing concern, as is cross-resistance to the diamidine drugs diminazene and pentamidine. Methodology/Principal Findings Two isometamidium resistant Trypanosoma brucei clones were generated (ISMR1 and ISMR15), being 7270- and 16,000-fold resistant to isometamidium, respectively, which retained their ability to grow in vitro and establish an infection in mice. Considerable cross-resistance was shown to ethidium bromide and diminazene, with minor cross-resistance to pentamidine. The mitochondrial membrane potentials of both resistant cell lines were significantly reduced compared to the wild type. The net uptake rate of isometamidium was reduced 2-3-fold but isometamidium efflux was similar in wild-type and resistant lines. Fluorescence microscopy and PCR analysis revealed that ISMR1 and ISMR15 had completely lost their kinetoplast DNA (kDNA) and both lines carried a mutation in the nuclearly encoded γ subunit gene of F1 ATPase, truncating the protein by 22 amino acids. The mutation compensated for the loss of the kinetoplast in bloodstream forms, allowing near-normal growth, and conferred considerable resistance to isometamidium and ethidium as well as significant resistance to diminazene and pentamidine, when expressed in wild type trypanosomes. Subsequent exposure to either isometamidium or ethidium led to rapid loss of kDNA and a further increase in isometamidium resistance. Conclusions/Significance Sub-lethal exposure to isometamidium gives rise to viable but highly resistant trypanosomes that, depending on sub-species, are infective to humans and cross-resistant to at least some diamidine drugs. The crucial

  14. Intravital Imaging of a Massive Lymphocyte Response in the Cortical Dura of Mice after Peripheral Infection by Trypanosomes

    PubMed Central

    Coles, Jonathan A.; Myburgh, Elmarie; Ritchie, Ryan; Hamilton, Alana; Rodgers, Jean; Mottram, Jeremy C.; Barrett, Michael P.; Brewer, James M.

    2015-01-01

    Peripheral infection by Trypanosoma brucei, the protozoan responsible for sleeping sickness, activates lymphocytes, and, at later stages, causes meningoencephalitis. We have videoed the cortical meninges and superficial parenchyma of C56BL/6 reporter mice infected with T.b.brucei. By use of a two-photon microscope to image through the thinned skull, the integrity of the tissues was maintained. We observed a 47-fold increase in CD2+ T cells in the meninges by 12 days post infection (dpi). CD11c+ dendritic cells also increased, and extravascular trypanosomes, made visible either by expression of a fluorescent protein, or by intravenous injection of furamidine, appeared. The likelihood that invasion will spread from the meninges to the parenchyma will depend strongly on whether the trypanosomes are below the arachnoid membrane, or above it, in the dura. Making use of optical signals from the skull bone, blood vessels and dural cells, we conclude that up to 40 dpi, the extravascular trypanosomes were essentially confined to the dura, as were the great majority of the T cells. Inhibition of T cell activation by intraperitoneal injection of abatacept reduced the numbers of meningeal T cells at 12 dpi and their mean speed fell from 11.64 ± 0.34 μm/min (mean ± SEM) to 5.2 ± 1.2 μm/min (p = 0.007). The T cells occasionally made contact lasting tens of minutes with dendritic cells, indicative of antigen presentation. The population and motility of the trypanosomes tended to decline after about 30 dpi. We suggest that the lymphocyte infiltration of the meninges may later contribute to encephalitis, but have no evidence that the dural trypanosomes invade the parenchyma. PMID:25881126

  15. Suppression of Cell-Mediated Immunity in Experimental African Trypanosomiasis

    PubMed Central

    Mansfield, John M.; Wallace, John H.

    1974-01-01

    Adult New Zealand white rabbits were experimentally infected with a parasitic African hemoflagellate, Trypanosoma congolense, and were subsequently tested for in vivo and in vitro aspects of cell-mediated immune function. Chronically infected rabbits were sensitized to mycobacterial protein and skin-tested with purified protein derivative; all infected animals demonstrated much milder skin-test responses to antigen than control groups. Similarly, peripheral blood lymphocyte responses in vitro to purified protein derivative and, as well, to phytohemagglutinin were markedly suppressed. Supernatant fluids of antigen-stimulated lymph node cell cultures from T. congolense-infected rabbits failed to demonstrate migration inhibitory factor activity but did possess normal levels of blastogenic factor activity. An active infection was necessary for demonstration of suppressed immune responses, and components present in infected rabbit serum were apparently not responsible for the observed abnormalities. Suppression of T-lymphocyte subpopulations may well explain the occurrence of numerous immunological aberrations arising during human and animal infections with the African trypanosomes. PMID:4854532

  16. Induction and regulation of Trypanosoma brucei VSG-specific antibody responses.

    PubMed

    Black, S J; Guirnalda, P; Frenkel, D; Haynes, C; Bockstal, V

    2010-12-01

    The review addresses how infection with Trypanosoma brucei affects the development, survival and functions of B lymphocytes in mice. It discusses (1) the contributions of antibodies to trypanosome clearance from the bloodstream, (2) how B lymphocytes, the precursors of antibody producing plasma cells, interact with membrane form variable surface glycoprotein (VSG), i.e. with monovalent antigen that is free to diffuse within the lipid bilayer of the trypanosome plasma membrane and consequently can cross-link B cell antigen specific receptors by indirect processes only and (3) the extent and underlying causes of dysregulation of humoral immune responses in infected mice, focusing on the impact of wild type and GPI-PLC⁻/⁻ trypanosomes on bone marrow and extramedullary B lymphopoiesis, B cell maturation and survival.

  17. The isolation and identification of Trypanosoma cruzi from raccoons in Maryland

    USGS Publications Warehouse

    Walton, B.C.; Bauman, P.M.; Diamond, L.S.; Herman, C.M.

    1958-01-01

    Five raccoons trapped at Patuxent Research Refuge, Laurel, Maryland, were found to have trypanosomes in the blood which were morphologically indistinguishable from Trypanosoma cruzi on stained smears. The organism grew well in culture. It developed and reproduced in Triatoma protracta, T. infestans, T. phyllosoma, and Rhodnius prolixus. Experimental infections were produced in raccoons, opossums, mice, rats, and monkeys by inoculation of blood, culture, and triatome forms. Typical leishmaniform bodies were found in tissue sections of cardiac muscle fibers from naturally and experimentally infected animals. Cross agglutinations carried out with Iiving cultural forms and rabbit antisera demonstrated a close antigenic relationship between the raccoon trypanosome and T. cruzi (Brazil strain). On the basis of (1) morphology, (2) presence of leishmaniform tissue stages, (3) development in triatomes, (4) infectivity to a variety of mammals, (5) culture characteristics, and (6) cross reactions in serological tests, this parasite is considered conspecific with Trypanosoma cruzi (Chagas, 1909), the causative agent of American human trypanosomiasis.

  18. Wolbachia, Sodalis and trypanosome co-infections in natural populations of Glossina austeni and Glossina pallidipes

    PubMed Central

    2013-01-01

    Background Tsetse flies harbor at least three bacterial symbionts: Wigglesworthia glossinidia, Wolbachia pipientis and Sodalis glossinidius. Wigglesworthia and Sodalis reside in the gut in close association with trypanosomes and may influence establishment and development of midgut parasite infections. Wolbachia has been shown to induce reproductive effects in infected tsetse. This study was conducted to determine the prevalence of these endosymbionts in natural populations of G. austeni and G. pallidipes and to assess the degree of concurrent infections with trypanosomes. Methods Fly samples analyzed originated from Kenyan coastal forests (trapped in 2009–2011) and South African G. austeni collected in 2008. The age structure was estimated by standard methods. G. austeni (n=298) and G. pallidipes (n= 302) were analyzed for infection with Wolbachia and Sodalis using PCR. Trypanosome infection was determined either by microscopic examination of dissected organs or by PCR amplification. Results Overall we observed that G. pallidipes females had a longer lifespan (70 d) than G. austeni (54 d) in natural populations. Wolbachia infections were present in all G. austeni flies analysed, while in contrast, this symbiont was absent from G. pallidipes. The density of Wolbachia infections in the Kenyan G. austeni population was higher than that observed in South African flies. The infection prevalence of Sodalis ranged from 3.7% in G. austeni to about 16% in G. pallidipes. Microscopic examination of midguts revealed an overall trypanosome infection prevalence of 6% (n = 235) and 5% (n = 552), while evaluation with ITS1 primers indicated a prevalence of about 13% (n = 296) and 10% (n = 302) in G. austeni and G. pallidipes, respectively. The majority of infections (46%) were with T. congolense. Co-infection with all three organisms was observed at 1% and 3.3% in G. austeni and G. pallidipes, respectively. Eleven out of the thirteen (85%) co-infected flies

  19. Human trypanosome infection and the presence of intradomicile Rhodnius pallescens in the western border of the Panama Canal, Panama.

    PubMed

    Calzada, José E; Pineda, Vanessa; Montalvo, Edilma; Alvarez, Dayra; Santamaría, Ana María; Samudio, Franklyn; Bayard, Vicente; Cáceres, Lorenzo; Saldaña, Azael

    2006-05-01

    An entomologic search was carried out to collect intradomicile triatomines in dwellings from rural communities in the western border of the Panama Canal, Panama. Sixty-nine triatomines were collected inside 20 houses of 67 houses investigated. Rhodnius pallescens was the only triatomine species found and included adults of both sexes and nymphs. A significantly high Trypanosoma cruzi (72.7%) and T. rangeli (40%) vector infection rate was detected. Blood meal analysis showed that 68% of R. pallescens had fed on humans. Human serologic analysis and hemoculture performed on inhabitants from triatomine-infested houses showed that 32.1% (18 of 56) of the samples were trypanosome infected. Thirteen samples (23.2%) had antibodies against T. cruzi. Six of these seropositive samples were from children less than 15 years old. Trypanosoma rangeli was isolated in five hemoculture samples, all from children less than 11 years old. The epidemiologic implications of these findings in terms of human infection are discussed.

  20. Nuclear structure of Trypanosoma cruzi.

    PubMed

    Schenkman, Sergio; Pascoalino, Bruno dos Santos; Nardelli, Sheila C

    2011-01-01

    The presence of nucleus in living organisms characterizes the Eukaryote domain. The nucleus compartmentalizes the genetic material surrounded by a double membrane called nuclear envelope. The nucleus has been observed since the advent of the light microscope, and sub-compartments such as nucleoli, diverse nuclear bodies and condensed chromosomes have been later recognized, being part of highly organized and dynamic structure. The significance and function of such organization has increased with the understanding of transcription, replication, DNA repair, recombination processes. It is now recognized as consequence of adding complexity and regulation in more complex eukaryotic cells. Here we provide a description of the actual stage of knowledge of the nuclear structure of Trypanosoma cruzi. As an early divergent eukaryote, it presents unique and/or reduced events of DNA replication, transcription and repair as well as RNA processing and transport to the cytosol. Nevertheless, it shows peculiar structure changes accordingly to the cell cycle and stage of differentiation. T. cruzi proliferates only as epimastigote and amastigote stages, and when these forms differentiate in trypomastigote forms, their cell cycle is arrested. This arrested stage is capable of invading mammalian cells and of surviving harsh conditions, such as the gut of the insect vector and mammalian macrophages. Transcription and replication decrease during transformation in trypomastigotes implicating large alterations in the nuclear structure. Recent evidences also suggest that T. cruzi nucleus respond to oxidative and nutritional stresses. Due to the phylogenetic proximity with other well-known trypanosomes, such as Trypanosoma brucei and Leishmania major, they are expected to have similar nuclear organization, although differences are noticed due to distinct life cycles, cellular organizations and the specific adaptations for surviving in different host environments. Therefore, the general

  1. A study on African animal trypanosomosis in four areas of Senegal.

    PubMed

    Ravel, Sophie; Mediannikov, Oleg; Bossard, Geraldine; Desquesnes, Marc; Cuny, Gerard; Davoust, Bernard

    2015-08-18

    In Senegal, several areas provide great potential for agriculture and animal production, but African animal trypanosomosis (AAT) is one of the major constraints to the development of more effective livestock production systems. A study was conducted to assess the current situation of AAT in this country. Surveys were carried out between June 2011 and September 2012 in four different areas: Dakar, Sine Saloum, Kedougou region and Basse Casamance in several animal species: dogs (152), donkeys (23), horses (63), sheep (43), goats (52) and cattle (104), distributed in the four sites. Molecular tools (PCR) indicated 3.4% positive animals including dogs, donkeys, a goat and cattle. The savannah type of Trypanosoma congolense Broden, 1904 (53% of positive cases) and the forest type of T. congolense (subgenus Nannomonas Hoare, 1964) were predominant. Trypanosoma vivax Ziemann, 1905 (subgenus Duttonella Chalmers, 1918) was only present in one animal and no trypanosome of the subgenus Trypanozoon Lühe, 1906 was found. Half of the positive cases were detected in Sine Saloum, where T. congolense savannah-type was predominant, and the other half in Basse Casamance, where T. congolense forest-type was predominant; no cases were found in Dakar or in the Kedougou region. A high risk of infection in dogs with T. congolense savannah-type was shown in Sine Saloum, requiring prevention and control of dogs in this area. The involvement of tsetse flies in the transmission of T. congolense in Sine Saloum and Basse Casamance is discussed.

  2. Kynurenine pathway inhibition reduces central nervous system inflammation in a model of human African trypanosomiasis.

    PubMed

    Rodgers, Jean; Stone, Trevor W; Barrett, Michael P; Bradley, Barbara; Kennedy, Peter G E

    2009-05-01

    Human African trypanosomiasis, or sleeping sickness, is caused by the protozoan parasites Trypanosoma brucei rhodesiense or Trypanosoma brucei gambiense, and is a major cause of systemic and neurological disability throughout sub-Saharan Africa. Following early-stage disease, the trypanosomes cross the blood-brain barrier to invade the central nervous system leading to the encephalitic, or late stage, infection. Treatment of human African trypanosomiasis currently relies on a limited number of highly toxic drugs, but untreated, is invariably fatal. Melarsoprol, a trivalent arsenical, is the only drug that can be used to cure both forms of the infection once the central nervous system has become involved, but unfortunately, this drug induces an extremely severe post-treatment reactive encephalopathy (PTRE) in up to 10% of treated patients, half of whom die from this complication. Since it is unlikely that any new and less toxic drug will be developed for treatment of human African trypanosomiasis in the near future, increasing attention is now being focussed on the potential use of existing compounds, either alone or in combination chemotherapy, for improved efficacy and safety. The kynurenine pathway is the major pathway in the metabolism of tryptophan. A number of the catabolites produced along this pathway show neurotoxic or neuroprotective activities, and their role in the generation of central nervous system inflammation is well documented. In the current study, Ro-61-8048, a high affinity kynurenine-3-monooxygenase inhibitor, was used to determine the effect of manipulating the kynurenine pathway in a highly reproducible mouse model of human African trypanosomiasis. It was found that Ro-61-8048 treatment had no significant effect (P = 0.4445) on the severity of the neuroinflammatory pathology in mice during the early central nervous system stage of the disease when only a low level of inflammation was present. However, a significant (P = 0.0284) reduction in

  3. Trypanosoma humboldti n. sp. from the Chilean catshark, Schroederichthys chilensis (Guichenot, 1848).

    PubMed

    Morillas, J; George-Nascimento, M; Valeria, H; Khan, R A

    1987-08-01

    The morphology of Trypanosoma humboldti n. sp. is described from living and stained specimens obtained from the blood of a catshark, Schroederichthys chilensis. This represents the first report of a trypanosome in fish from the eastern Pacific Ocean. It is distinguished by its size and apparent lack of pleomorphism. The presence of a leech, Branchellion ravenellii, attached to the catshark, raises the possibility that it can act as a vector. Additionally, this leech is recorded for the first time from the Pacific Ocean.

  4. Farnesyl Diphosphate Synthase Localizes to the Cytoplasm of Trypanosoma cruzi and T.brucei

    PubMed Central

    Ferella, Marcela; Li, Zhu-Hong; Andersson, Björn; Docampo, Roberto

    2008-01-01

    The farnesyl diphosphate synthase (FPPS) has previously been characterized in trypanosomes as an essential enzyme for their survival and as the target for bisphosphonates, drugs that are effective both in vitro and in vivo against these parasites. Enzymes from the isoprenoid pathway have been assigned to different compartments in eukaryotes, including trypanosomatids. We here report that FPPS localizes to the cytoplasm of both Trypanosoma cruzi and T. brucei, and is not present in other organelles such as the mitochondria and glycosomes. PMID:18406406

  5. Novel Characteristics of Trypanosoma brucei Guanosine 5'-monophosphate Reductase Distinct from Host Animals

    PubMed Central

    Kimura, Chihiro; Shinohara, Takahiro; Tomiyama, Ai; Imamura, Akira; Kuwamura, Mitsuru; Nishimura, Kazuhiko; Fujimori, Ko; Shuto, Satoshi; Ishibashi, Osamu; Kubata, Bruno Kilunga; Inui, Takashi

    2016-01-01

    The metabolic pathway of purine nucleotides in parasitic protozoa is a potent drug target for treatment of parasitemia. Guanosine 5’-monophosphate reductase (GMPR), which catalyzes the deamination of guanosine 5’-monophosphate (GMP) to inosine 5’-monophosphate (IMP), plays an important role in the interconversion of purine nucleotides to maintain the intracellular balance of their concentration. However, only a few studies on protozoan GMPR have been reported at present. Herein, we identified the GMPR in Trypanosoma brucei, a causative protozoan parasite of African trypanosomiasis, and found that the GMPR proteins were consistently localized to glycosomes in T. brucei bloodstream forms. We characterized its recombinant protein to investigate the enzymatic differences between GMPRs of T. brucei and its host animals. T. brucei GMPR was distinct in having an insertion of a tandem repeat of the cystathionine β-synthase (CBS) domain, which was absent in mammalian and bacterial GMPRs. The recombinant protein of T. brucei GMPR catalyzed the conversion of GMP to IMP in the presence of NADPH, and showed apparent affinities for both GMP and NADPH different from those of its mammalian counterparts. Interestingly, the addition of monovalent cations such as K+ and NH4+ to the enzymatic reaction increased the GMPR activity of T. brucei, whereas none of the mammalian GMPR’s was affected by these cations. The monophosphate form of the purine nucleoside analog ribavirin inhibited T. brucei GMPR activity, though mammalian GMPRs showed no or only a little inhibition by it. These results suggest that the mechanism of the GMPR reaction in T. brucei is distinct from that in the host organisms. Finally, we demonstrated the inhibitory effect of ribavirin on the proliferation of trypanosomes in a dose-dependent manner, suggesting the availability of ribavirin to develop a new therapeutic agent against African trypanosomiasis. PMID:26731263

  6. Redescription of Trypanosoma siniperca Chang 1964 from freshwater fish of China based on morphological and molecular data.

    PubMed

    Gu, Zemao; Wang, Jianguo; Li, Ming; Zhang, Jinyong; Gong, Xiaoning

    2007-01-01

    During the parasite fauna investigation within 2005, the freshwater fish trypanosome Trypanosoma siniperca Chang 1964 was isolated from the blood of Mandarin carp (Siniperca chuatsi) from Niushan Lake, Hubei Province, central China. Blood trypomastigotes were observed only, and the density of infection was low. Light microscopy examinations of this material made it possible to study in detail the morphology of this parasite and redescribe it according to current standards. T. siniperca is characterized also on the molecular level using the sequences of SSU rRNA gene. Phylogenetic analyses based on these sequences allowed clearer phylogenetic relationships to be established with other fish trypanosomes sequenced to date.

  7. New Chemical Scaffolds for Human African Trypanosomiasis Lead Discovery from a Screen of Tyrosine Kinase Inhibitor Drugs

    PubMed Central

    Behera, Ranjan; Thomas, Sarah M.

    2014-01-01

    Human African trypanosomiasis (HAT) is caused by the protozoan Trypanosoma brucei. New drugs are needed to treat HAT because of undesirable side effects and difficulties in the administration of the antiquated drugs that are currently used. In human proliferative diseases, protein tyrosine kinase (PTK) inhibitors (PTKIs) have been developed into drugs (e.g., lapatinib and erlotinib) by optimization of a 4-anilinoquinazoline scaffold. Two sets of facts raise a possibility that drugs targeted against human PTKs could be “hits” for antitrypanosomal lead discoveries. First, trypanosome protein kinases bind some drugs, namely, lapatinib, CI-1033, and AEE788. Second, the pan-PTK inhibitor tyrphostin A47 blocks the endocytosis of transferrin and inhibits trypanosome replication. Following up on these concepts, we performed a focused screen of various PTKI drugs as possible antitrypanosomal hits. Lapatinib, CI-1033, erlotinib, axitinib, sunitinib, PKI-166, and AEE788 inhibited the replication of bloodstream T. brucei, with a 50% growth inhibitory concentration (GI50) between 1.3 μM and 2.5 μM. Imatinib had no effect (i.e., GI50 > 10 μM). To discover leads among the drugs, a mouse model of HAT was used in a proof-of-concept study. Orally administered lapatinib reduced parasitemia, extended the survival of all treated mice, and cured the trypanosomal infection in 25% of the mice. CI-1033 and AEE788 reduced parasitemia and extended the survival of the infected mice. On the strength of these data and noting their oral bioavailabilities, we propose that the 4-anilinoquinazoline and pyrrolopyrimidine scaffolds of lapatinib, CI-1033, and AEE788 are worth optimizing against T. brucei in medicinal chemistry campaigns (i.e., scaffold repurposing) to discover new drugs against HAT. PMID:24468788

  8. New chemical scaffolds for human african trypanosomiasis lead discovery from a screen of tyrosine kinase inhibitor drugs.

    PubMed

    Behera, Ranjan; Thomas, Sarah M; Mensa-Wilmot, Kojo

    2014-01-01

    Human African trypanosomiasis (HAT) is caused by the protozoan Trypanosoma brucei. New drugs are needed to treat HAT because of undesirable side effects and difficulties in the administration of the antiquated drugs that are currently used. In human proliferative diseases, protein tyrosine kinase (PTK) inhibitors (PTKIs) have been developed into drugs (e.g., lapatinib and erlotinib) by optimization of a 4-anilinoquinazoline scaffold. Two sets of facts raise a possibility that drugs targeted against human PTKs could be "hits" for antitrypanosomal lead discoveries. First, trypanosome protein kinases bind some drugs, namely, lapatinib, CI-1033, and AEE788. Second, the pan-PTK inhibitor tyrphostin A47 blocks the endocytosis of transferrin and inhibits trypanosome replication. Following up on these concepts, we performed a focused screen of various PTKI drugs as possible antitrypanosomal hits. Lapatinib, CI-1033, erlotinib, axitinib, sunitinib, PKI-166, and AEE788 inhibited the replication of bloodstream T. brucei, with a 50% growth inhibitory concentration (GI50) between 1.3 μM and 2.5 μM. Imatinib had no effect (i.e., GI50>10 μM). To discover leads among the drugs, a mouse model of HAT was used in a proof-of-concept study. Orally administered lapatinib reduced parasitemia, extended the survival of all treated mice, and cured the trypanosomal infection in 25% of the mice. CI-1033 and AEE788 reduced parasitemia and extended the survival of the infected mice. On the strength of these data and noting their oral bioavailabilities, we propose that the 4-anilinoquinazoline and pyrrolopyrimidine scaffolds of lapatinib, CI-1033, and AEE788 are worth optimizing against T. brucei in medicinal chemistry campaigns (i.e., scaffold repurposing) to discover new drugs against HAT.

  9. Loop Mediated Isothermal Amplification for Detection of Trypanosoma brucei gambiense in Urine and Saliva Samples in Nonhuman Primate Model.

    PubMed

    Ngotho, Maina; Kagira, John Maina; Gachie, Beatrice Muthoni; Karanja, Simon Muturi; Waema, Maxwell Wambua; Maranga, Dawn Nyawira; Maina, Naomi Wangari

    2015-01-01

    Human African trypanosomiasis (HAT) is a vector-borne parasitic zoonotic disease. The disease caused by Trypanosoma brucei gambiense is the most prevalent in Africa. Early diagnosis is hampered by lack of sensitive diagnostic techniques. This study explored the potential of loop mediated isothermal amplification (LAMP) and polymerase chain reaction (PCR) in the detection of T. b. gambiense infection in a vervet monkey HAT model. Six vervet monkeys were experimentally infected with T. b. gambiense IL3253 and monitored for 180 days after infection. Parasitaemia was scored daily. Blood, cerebrospinal fluid (CSF), saliva, and urine samples were collected weekly. PCR and LAMP were performed on serum, CSF, saliva, and urine samples. The detection by LAMP was significantly higher than that of parasitological methods and PCR in all the samples. The performance of LAMP varied between the samples and was better in serum followed by saliva and then urine samples. In the saliva samples, LAMP had 100% detection between 21 and 77 dpi, whereas in urine the detection it was slightly lower, but there was over 80% detection between 28 and 91 dpi. However, LAMP could not detect trypanosomes in either saliva or urine after 140 and 126 dpi, respectively. The findings of this study emphasize the importance of LAMP in diagnosis of HAT using saliva and urine samples.

  10. Loop Mediated Isothermal Amplification for Detection of Trypanosoma brucei gambiense in Urine and Saliva Samples in Nonhuman Primate Model

    PubMed Central

    Ngotho, Maina; Kagira, John Maina; Gachie, Beatrice Muthoni; Karanja, Simon Muturi; Waema, Maxwell Wambua; Maranga, Dawn Nyawira; Maina, Naomi Wangari

    2015-01-01

    Human African trypanosomiasis (HAT) is a vector-borne parasitic zoonotic disease. The disease caused by Trypanosoma brucei gambiense is the most prevalent in Africa. Early diagnosis is hampered by lack of sensitive diagnostic techniques. This study explored the potential of loop mediated isothermal amplification (LAMP) and polymerase chain reaction (PCR) in the detection of T. b. gambiense infection in a vervet monkey HAT model. Six vervet monkeys were experimentally infected with T. b. gambiense IL3253 and monitored for 180 days after infection. Parasitaemia was scored daily. Blood, cerebrospinal fluid (CSF), saliva, and urine samples were collected weekly. PCR and LAMP were performed on serum, CSF, saliva, and urine samples. The detection by LAMP was significantly higher than that of parasitological methods and PCR in all the samples. The performance of LAMP varied between the samples and was better in serum followed by saliva and then urine samples. In the saliva samples, LAMP had 100% detection between 21 and 77 dpi, whereas in urine the detection it was slightly lower, but there was over 80% detection between 28 and 91 dpi. However, LAMP could not detect trypanosomes in either saliva or urine after 140 and 126 dpi, respectively. The findings of this study emphasize the importance of LAMP in diagnosis of HAT using saliva and urine samples. PMID:26504841

  11. Probing the Metabolic Network in Bloodstream-Form Trypanosoma brucei Using Untargeted Metabolomics with Stable Isotope Labelled Glucose

    PubMed Central

    Creek, Darren J.; Mazet, Muriel; Achcar, Fiona; Anderson, Jana; Kim, Dong-Hyun; Kamour, Ruwida; Morand, Pauline; Millerioux, Yoann; Biran, Marc; Kerkhoven, Eduard J.; Chokkathukalam, Achuthanunni; Weidt, Stefan K.; Burgess, Karl E. V.; Breitling, Rainer; Watson, David G.; Bringaud, Frédéric; Barrett, Michael P.

    2015-01-01

    Metabolomics coupled with heavy-atom isotope-labelled glucose has been used to probe the metabolic pathways active in cultured bloodstream form trypomastigotes of Trypanosoma brucei, a parasite responsible for human African trypanosomiasis. Glucose enters many branches of metabolism beyond glycolysis, which has been widely held to be the sole route of glucose metabolism. Whilst pyruvate is the major end-product of glucose catabolism, its transamination product, alanine, is also produced in significant quantities. The oxidative branch of the pentose phosphate pathway is operative, although the non-oxidative branch is not. Ribose 5-phosphate generated through this pathway distributes widely into nucleotide synthesis and other branches of metabolism. Acetate, derived from glucose, is found associated with a range of acetylated amino acids and, to a lesser extent, fatty acids; while labelled glycerol is found in many glycerophospholipids. Glucose also enters inositol and several sugar nucleotides that serve as precursors to macromolecule biosynthesis. Although a Krebs cycle is not operative, malate, fumarate and succinate, primarily labelled in three carbons, were present, indicating an origin from phosphoenolpyruvate via oxaloacetate. Interestingly, the enzyme responsible for conversion of phosphoenolpyruvate to oxaloacetate, phosphoenolpyruvate carboxykinase, was shown to be essential to the bloodstream form trypanosomes, as demonstrated by the lethal phenotype induced by RNAi-mediated downregulation of its expression. In addition, glucose derivatives enter pyrimidine biosynthesis via oxaloacetate as a precursor to aspartate and orotate. PMID:25775470

  12. Troglitazone induces differentiation in Trypanosoma brucei

    SciTech Connect

    Denninger, Viola; Figarella, Katherine; Schoenfeld, Caroline; Brems, Stefanie; Busold, Christian; Lang, Florian; Hoheisel, Joerg; Duszenko, Michael . E-mail: michael.duszenko@uni-tuebingen.de

    2007-05-15

    Trypanosoma brucei, a protozoan parasite causing sleeping sickness, is transmitted by the tsetse fly and undergoes a complex lifecycle including several defined stages within the insect vector and its mammalian host. In the latter, differentiation from the long slender to the short stumpy form is induced by a yet unknown factor of trypanosomal origin. Here we describe that some thiazolidinediones are also able to induce differentiation. In higher eukaryotes, thiazolidinediones are involved in metabolism and differentiation processes mainly by binding to the intracellular receptor peroxisome proliferator activated receptor {gamma}. Our studies focus on the effects of troglitazone on bloodstream form trypanosomes. Differentiation was monitored using mitochondrial markers (membrane potential, succinate dehydrogenase activity, inhibition of oxygen uptake by KCN, amount of cytochrome transcripts), morphological changes (Transmission EM and light microscopy), and transformation experiments (loss of the Variant Surface Glycoprotein coat and increase of dihydroliponamide dehydrogenase activity). To further investigate the mechanisms responsible for these changes, microarray analyses were performed, showing an upregulation of expression site associated gene 8 (ESAG8), a potential differentiation regulator.

  13. Messenger RNA processing sites in Trypanosoma brucei.

    PubMed

    Benz, Corinna; Nilsson, Daniel; Andersson, Björn; Clayton, Christine; Guilbride, D Lys

    2005-10-01

    In Kinetoplastids, protein-coding genes are transcribed polycistronically by RNA polymerase II. Individual mature mRNAs are generated from polycistronic precursors by 5' trans splicing of a 39-nt capped leader RNA and 3' polyadenylation. It was previously known that trans splicing generally occurs at an AG dinucleotide downstream of a polypyrimidine tract, and that polyadenylation is coupled to downstream trans splicing. The few polyadenylation sites that had been examined were 100-400 nt upstream of the polypyrimidine tract which marked the adjacent trans splice site. We wished to define the sequence requirements for trypanosome mRNA processing more tightly and to generate a predictive algorithm. By scanning all available Trypanosoma brucei cDNAs for splicing and polyadenylation sites, we found that trans splicing generally occurs at the first AG following a polypyrimidine tract of 8-25 nt, giving rise to 5'-UTRs of a median length of 68 nt. We also found that in general, polyadenylation occurs at a position with one or more A residues located between 80 and 140 nt from the downstream polypyrimidine tract. These data were used to calibrate free parameters in a grammar model with distance constraints, enabling prediction of polyadenylation and trans splice sites for most protein-coding genes in the trypanosome genome. The data from the genome analysis and the program are available from: .

  14. Ribosomal DNA analysis of tsetse and non-tsetse transmitted Ethiopian Trypanosoma vivax strains in view of improved molecular diagnosis.

    PubMed

    Fikru, Regassa; Matetovici, Irina; Rogé, Stijn; Merga, Bekana; Goddeeris, Bruno Maria; Büscher, Philippe; Van Reet, Nick

    2016-04-15

    Animal trypanosomosis caused by Trypanosoma vivax (T. vivax) is a devastating disease causing serious economic losses. Most molecular diagnostics for T. vivax infection target the ribosomal DNA locus (rDNA) but are challenged by the heterogeneity among T. vivax strains. In this study, we investigated the rDNA heterogeneity of Ethiopian T. vivax strains in relation to their presence in tsetse-infested and tsetse-free areas and its effect on molecular diagnosis. We sequenced the rDNA loci of six Ethiopian (three from tsetse-infested and three from tsetse-free areas) and one Nigerian T. vivax strain. We analysed the obtained sequences in silico for primer-mismatches of some commonly used diagnostic PCR assays and for GC content. With these data, we selected some rDNA diagnostic PCR assays for evaluation of their diagnostic accuracy. Furthermore we constructed two phylogenetic networks based on sequences within the smaller subunit (SSU) of 18S and within the 5.8S and internal transcribed spacer 2 (ITS2) to assess the relatedness of Ethiopian T. vivax strains to strains from other African countries and from South America. In silico analysis of the rDNA sequence showed important mismatches of some published diagnostic PCR primers and high GC content of T. vivax rDNA. The evaluation of selected diagnostic PCR assays with specimens from cattle under natural T. vivax challenge showed that this high GC content interferes with the diagnostic accuracy of PCR, especially in cases of mixed infections with T. congolense. Adding betain to the PCR reaction mixture can enhance the amplification of T. vivax rDNA but decreases the sensitivity for T. congolense and Trypanozoon. The networks illustrated that Ethiopian T. vivax strains are considerably heterogeneous and two strains (one from tsetse-infested and one from tsetse-free area) are more related to the West African and South American strains than to the East African strains. The rDNA locus sequence of six Ethiopian T. vivax

  15. Trypanosome infections in the marmoset (Saguinus geoffroyi) from the Panama Canal Zone.

    PubMed

    Sousa, O E; Dawson, G A

    1976-05-01

    From August 1973 through May 1974 a total of 148 marmosets (Saguinus geoffroyi) were examined for blood parasites. Parasites were detected in 93.2% of the monkeys. Direct examination of blood revealed 82.4% infected with trypanosomes; Trypanosoma cruzi was seen in 1.3% of the animals examined T. minasense in 52.7% and T. rangeli in 25%. However, the use of several diagnostic tests (direct microscopic examination, hemoculture, xenodiagnosis, and animal inoculation) in 15 marmosets revealed T. cruzi in 40%, T. rangeli in 93% and T. minasense in 87%. The high rate of infection among marmosets suggests that they are important natural hosts of T. cruzi and T. rangeli in the Panama Canal Zone.

  16. Lysozyme Activity in the Plasma of Rodents Infected With Their Homologous Trypanosomes

    PubMed Central

    Maraghi, S; Molyneux, DH; Wallbanks, KR

    2012-01-01

    Background In this study the concentration of lysozyme in blood plasma of Microtus agrestis, Clethrinomys glareolus, Apodemus sylvaticus, BK rats and outbred white mice before and after infection with culture forms of Trypanosoma microti, T, evotomys, T. grosi, T. lewisi and T. musculi respectively was measured. Methods Blood samples of rodents, Microtus agrestis, Clethrionomys glareolus, Apodemus sylvaticus, BK rats and outbred mice infected with T. microti, T. evotomys, T. grosi, T. lewisi and T. musculi respectively were collected in heparinized micro- tubes immediately before inoculation and 3, 6, 12, 24, 48, 96 and more than 400 days after intra- perituneal inoculation with 5×105of their homologous trypanosome parasites of which more than half were metacyclic trypomastigote in 0.2 ml of culture medium. Micro- tubes were centrifuged and plasma samples were separated and the lysozyme activity was measured by the agar method. Results Levels of lysozyme rose rapidly three to six days after the inoculation to ten to twenty than their pre- infection levels. They then gradually decreased, although after more than one year they were still two to ten folds higher than controls. The highest level measured occurred in rats infected with T. lewisi and the lowest in A. sylvaticus infected with T. grosi. After one year the highest concentration of lysozyme was in mice infected with T. musculi and lowest in A. sylvaticus. Conclusion Persistent enhanced lysozyme levels may prevent re- infection with trypanosomes. PMID:23323096

  17. Trypanosome species in neo-tropical bats: biological, evolutionary and epidemiological implications.

    PubMed

    Ramírez, Juan David; Tapia-Calle, Gabriela; Muñoz-Cruz, Geissler; Poveda, Cristina; Rendón, Lina M; Hincapié, Eduwin; Guhl, Felipe

    2014-03-01

    Bats (Chiroptera) are the only mammals naturally able to fly. Due to this characteristic they play a relevant ecological role in the niches they inhabit. These mammals spread infectious diseases from enzootic to domestic foci. Rabbies, SARS, fungi, ebola and trypanosomes are the most common pathogens these animals may host. We conducted intensive sampling of bats from the phyllostomidae, vespertilionidae and emballonuridae families in six localities from Casanare department in eastern Colombia. Blood-EDTA samples were obtained and subsequently submitted to analyses of mitochondrial and nuclear genetic markers in order to conduct barcoding analyses to discriminate trypanosome species. The findings according to the congruence of the three molecular markers suggest the occurrence of Trypanosoma cruzi cruzi (51%), T. c. marinkellei (9%), T. dionisii (13%), T. rangeli (21%), T. evansi (4%) and T. theileri (2%) among 107 positive bat specimens. Regarding the T. cruzi DTUs, we observed the presence of TcI (60%), TcII (15%), TcIII (7%), TcIV (7%) and TcBAT (11%) being the first evidence to our concern of the foreseen genotype TcBAT in Colombia. These results allowed us to propose reliable hypotheses regarding the ecology and biology of the bats circulating in the area including the enigmatic question whether TcBAT should be considered a novel DTU. The epidemiological and evolutionary implications of these findings are herein discussed.

  18. Trypanosomes in a declining species of threatened Australian marsupial, the brush-tailed bettong Bettongia penicillata (Marsupialia: Potoroidae).

    PubMed

    Smith, A; Clark, P; Averis, S; Lymbery, A J; Wayne, A F; Morris, K D; Thompson, R C A

    2008-09-01

    The brush-tailed bettong (Bettongia penicillata), or woylie, is a medium-sized macropod marsupial that has undergone a rapid and substantial decline throughout its home range in the Upper Warren region of Western Australia over a period of approximately 5 years. As part of an investigation into possible causes of the decline a morphologically distinct Trypanosoma sp. was discovered by light microscopy in the declining population but was absent in a stable population within the Karakamia Wildlife Sanctuary. Further investigations employing molecular methods targeting variations in the 18s rRNA gene determined that the trypanosome was novel and was also present within the Karakamia population albeit at a much lower overall prevalence and individual parasitaemia levels. Phylogenetic analysis suggests the novel Trypanosoma sp. to be closely related to other trypanosomes isolated from native Australian wildlife species. Although it appears unlikely that the parasite is solely responsible for the decline in woylie population size, it may (singularly or in conjunction with other infectious agents) predispose woylies to increased mortality.

  19. Trypanosoma brucei gambiense Spliced Leader RNA Is a More Specific Marker for Cure of Human African Trypanosomiasis Than T. b. gambiense DNA.

    PubMed

    Ilboudo, Hamidou; Camara, Oumou; Ravel, Sophie; Bucheton, Bruno; Lejon, Veerle; Camara, Mamadou; Kaboré, Jacques; Jamonneau, Vincent; Deborggraeve, Stijn

    2015-12-15

    To assess the efficacy of treatment for human African trypanosomiasis, accurate tests that can discriminate relapse from cure are needed. We report the first data that the spliced leader (SL) RNA is a more specific marker for cure of human African trypanosomiasis than parasite DNA. In blood samples obtained from 61 patients in whom human African trypanosomiasis was cured, SL RNA detection had specificities of 98.4%-100%, while DNA detection had a specificity of only 77%. Data from our proof-of-concept study show that SL RNA detection has high potential as a test of cure.

  20. Generation of anti-trypanosomal agents through concise synthesis and structural diversification of sesquiterpene analogues.

    PubMed

    Oguri, Hiroki; Hiruma, Takahisa; Yamagishi, Yutaka; Oikawa, Hideaki; Ishiyama, Aki; Otoguro, Kazuhiko; Yamada, Haruki; Ōmura, Satoshi

    2011-05-11

    To access high-quality small-molecule libraries to screen lead candidates for neglected diseases exemplified by human African trypanosomiasis, we sought to develop a synthetic process that would produce collections of cyclic scaffolds relevant to an assortment of natural products exhibiting desirable biological activities. By extracting the common structural features among several sesquiterpenes, including artemisinin, anthecularin, and transtaganolides, we designed six types of scaffolds with systematic structural variations consisting of three types of stereochemical relationships on the sp(3) ring-junctions and two distinct arrays of tricyclic frameworks. A modular and stereodivergent assembly of dienynes exploiting a versatile manifold produced a series of cyclization precursors. Divergent cyclizations of the dienynes employing tandem ring-closing metathesis reactions overrode variant reactivities of the cyclization precursors, leading to the six canonical sets of the tricyclic scaffolds incorporating a diene group. Screenings of trypanosomal activities of the canonical sets, as well as regio- and stereoisomers of the tricyclic dienes, allowed generation of several anti-trypanosomal agents defining the three-dimensional shape of the pharmacophore. The candidate tricyclic dienes were selected by primary screenings and further subjected to installation of a peroxide bridge, which generated artemisinin analogues that exhibited potent in vitro anti-trypanosomal activities comparable or even superior to those of artemisinin and the approved drugs, suramin and eflornithine.

  1. A trypanosome metacyclic VSG gene promoter with two functionally distinct, life cycle stage-specific activities.

    PubMed

    Graham, S V; Wymer, B; Barry, J D

    1998-04-15

    In the mammalian bloodstream, African trypanosomes express the variant surface glycoprotein (VSG), continual switching of which allows evasion of the host immune response. Bloodstream VSG genes are transcribed from polycistronic bloodstream expression sites with promoters which are located 45-60 kb upstream. These promoters are not exclusively stage-regulated, being active in the insect midgut stage where VSG is not expressed. However, the metacyclic VSG (M-VSG) genes, a small subset activated when VSG synthesis begins in the metacyclic stage in the tsetse fly salivary glands, are transcriptionally activated specifically in that stage from promoters <3 kb upstream. Using deletion mapping and transient transfection, we show that the entire 1.22 M-VSG gene promoter region (171 bp) is required for full activity in metacyclic-derived trypanosomes. However, a subsidiary, bloodstream stage-specific activity is present in its 5' half which directs transcription initiation very close to the initiation site used in metacyclic-derived trypanosomes. Our results imply that the M-VSG gene promoter is longer and more complex than other VSG gene promoters.

  2. Epidemiology of human African trypanosomiasis

    PubMed Central

    Franco, Jose R; Simarro, Pere P; Diarra, Abdoulaye; Jannin, Jean G

    2014-01-01

    Human African trypanosomiasis (HAT), or sleeping sickness, is caused by Trypanosoma brucei gambiense, which is a chronic form of the disease present in western and central Africa, and by Trypanosoma brucei rhodesiense, which is an acute disease located in eastern and southern Africa. The rhodesiense form is a zoonosis, with the occasional infection of humans, but in the gambiense form, the human being is regarded as the main reservoir that plays a key role in the transmission cycle of the disease. The gambiense form currently assumes that 98% of the cases are declared; the Democratic Republic of the Congo is the most affected country, with more than 75% of the gambiense cases declared. The epidemiology of the disease is mediated by the interaction of the parasite (trypanosome) with the vectors (tsetse flies), as well as with the human and animal hosts within a particular environment. Related to these interactions, the disease is confined in spatially limited areas called “foci”, which are located in Sub-Saharan Africa, mainly in remote rural areas. The risk of contracting HAT is, therefore, determined by the possibility of contact of a human being with an infected tsetse fly. Epidemics of HAT were described at the beginning of the 20th century; intensive activities have been set up to confront the disease, and it was under control in the 1960s, with fewer than 5,000 cases reported in the whole continent. The disease resurged at the end of the 1990s, but renewed efforts from endemic countries, cooperation agencies, and nongovernmental organizations led by the World Health Organization succeeded to raise awareness and resources, while reinforcing national programs, reversing the trend of the cases reported, and bringing the disease under control again. In this context, sustainable elimination of the gambiense HAT, defined as the interruption of the transmission of the disease, was considered as a feasible target for 2030. Since rhodesiense HAT is a zoonosis

  3. In vivo analysis of trypanosome mitochondrial RNA function by artificial site-specific RNA endonuclease-mediated knockdown.

    PubMed

    Szempruch, Anthony J; Choudhury, Rajarshi; Wang, Zefeng; Hajduk, Stephen L

    2015-10-01

    Trypanosomes possess a unique mitochondrial genome called the kinetoplast DNA (kDNA). Many kDNA genes encode pre-mRNAs that must undergo guide RNA-directed editing. In addition, alternative mRNA editing gives rise to diverse mRNAs and several kDNA genes encode open reading frames of unknown function. To better understand the mechanism of RNA editing and the function of mitochondrial RNAs in trypanosomes, we have developed a reverse genetic approach using artificial site-specific RNA endonucleases (ASREs) to directly silence kDNA-encoded genes. The RNA-binding domain of an ASRE can be programmed to recognize unique 8-nucleotide sequences, allowing the design of ASREs to cleave any target RNA. Utilizing an ASRE containing a mitochondrial localization signal, we targeted the extensively edited mitochondrial mRNA for the subunit A6 of the F0F1 ATP synthase (A6) in the procyclic stage of Trypanosoma brucei. This developmental stage, found in the midgut of the insect vector, relies on mitochondrial oxidative phosphorylation for ATP production with A6 forming the critical proton half channel across the inner mitochondrial membrane. Expression of an A6-targeted ASRE in procyclic trypanosomes resulted in a 50% reduction in A6 mRNA levels after 24 h, a time-dependent decrease in mitochondrial membrane potential (ΔΨm), and growth arrest. Expression of the A6-ASRE, lacking the mitochondrial localization signal, showed no significant growth defect. The development of the A6-ASRE allowed the first in vivo functional analysis of an edited mitochondrial mRNA in T. brucei and provides a critical new tool to study mitochondrial RNA biology in trypanosomes.

  4. Trypanosoma from rodents as potential source of infection in human-shaped landscapes of South-East Asia.

    PubMed

    Pumhom, Pornpan; Morand, Serge; Tran, Annelise; Jittapalapong, Sathaporn; Desquesnes, Marc

    2015-03-15

    Reports of atypical human cases of Trypanosoma lewisi or T. lewisi-like and Trypanosoma evansi infections have increased in South-East Asia, urging to investigate the possible links between humans, animal reservoirs and habitats. We tested how habitat structure affects the infection by Trypanosoma species of common murine rodents, inhabiting human-dominated landscapes in South East Asia. For this, we used geo-referenced data of rodents investigated for Trypanosoma infection and land cover maps produced for seven study sites in Thailand, Cambodia and Lao PDR. High prevalence of infection by T. lewisi was observed in rodents living near human settlement and in areas with high cover of built-up habitat, while the infection of rodents by T. evansi was explained by increased landscape patchiness and high cover of rain-fed agriculture lands. These results suggest a likely role of wild rodents as reservoir and possible source of atypical human infection by animal trypanosomes.

  5. Refractory hypoglycaemia in a dog infected with Trypanosoma congolense.

    PubMed

    Deschamps, Jack-Yves; Desquesnes, Marc; Dorso, Laetitia; Ravel, Sophie; Bossard, Géraldine; Charbonneau, Morgane; Garand, Annabelle; Roux, Françoise A

    2016-01-01

    A 20 kg German shepherd dog was presented to a French veterinary teaching hospital for seizures and hyperthermia. The dog had returned 1 month previously from a six-month stay in Senegal and sub-Saharan Africa. Biochemistry and haematology showed severe hypoglycaemia (0.12 g/L), anaemia and thrombocytopenia. Despite administration of large amounts of glucose (30 mL of 30% glucose IV and 10 mL of 70% sucrose by gavage tube hourly), 26 consecutive blood glucose measurements were below 0.25 g/L (except one). Routine cytological examination of blood smears revealed numerous free extracytoplasmic protozoa consistent with Trypanosoma congolense. PCR confirmed a Trypanosoma congolense forest-type infection. Treatment consisted of six injections of pentamidine at 48-hour intervals. Trypanosomes had disappeared from the blood smears four days following the first injection. Clinical improvement was correlated with the normalization of laboratory values. The infection relapsed twice and the dog was treated again; clinical signs and parasites disappeared and the dog was considered cured; however, 6 years after this incident, serological examination by ELISA T. congolense was positive. The status of this dog (infected or non-infected) remains unclear. Hypoglycaemia was the most notable clinical feature in this case. It was spectacular in its severity and in its refractory nature; glucose administration seemed only to feed the trypanosomes, indicating that treatment of hypoglycaemia may in fact have been detrimental.

  6. Refractory hypoglycaemia in a dog infected with Trypanosoma congolense

    PubMed Central

    Deschamps, Jack-Yves; Desquesnes, Marc; Dorso, Laetitia; Ravel, Sophie; Bossard, Géraldine; Charbonneau, Morgane; Garand, Annabelle; Roux, Françoise A.

    2016-01-01

    A 20 kg German shepherd dog was presented to a French veterinary teaching hospital for seizures and hyperthermia. The dog had returned 1 month previously from a six-month stay in Senegal and sub-Saharan Africa. Biochemistry and haematology showed severe hypoglycaemia (0.12 g/L), anaemia and thrombocytopenia. Despite administration of large amounts of glucose (30 mL of 30% glucose IV and 10 mL of 70% sucrose by gavage tube hourly), 26 consecutive blood glucose measurements were below 0.25 g/L (except one). Routine cytological examination of blood smears revealed numerous free extracytoplasmic protozoa consistent with Trypanosoma congolense. PCR confirmed a Trypanosoma congolense forest-type infection. Treatment consisted of six injections of pentamidine at 48-hour intervals. Trypanosomes had disappeared from the blood smears four days following the first injection. Clinical improvement was correlated with the normalization of laboratory values. The infection relapsed twice and the dog was treated again; clinical signs and parasites disappeared and the dog was considered cured; however, 6 years after this incident, serological examination by ELISA T. congolense was positive. The status of this dog (infected or non-infected) remains unclear. Hypoglycaemia was the most notable clinical feature in this case. It was spectacular in its severity and in its refractory nature; glucose administration seemed only to feed the trypanosomes, indicating that treatment of hypoglycaemia may in fact have been detrimental. PMID:26795063

  7. Crystal structures of trypanosomal histidyl-tRNA synthetase illuminate differences between eukaryotic and prokaryotic homologs.

    PubMed

    Merritt, Ethan A; Arakaki, Tracy L; Gillespie, J Robert; Larson, Eric T; Kelley, Angela; Mueller, Natascha; Napuli, Alberto J; Kim, Jessica; Zhang, Li; Verlinde, Christophe L M J; Fan, Erkang; Zucker, Frank; Buckner, Frederick S; van Voorhis, Wesley C; Hol, Wim G J

    2010-03-26

    Crystal structures of histidyl-tRNA synthetase (HisRS) from the eukaryotic parasites Trypanosoma brucei and Trypanosoma cruzi provide a first structural view of a eukaryotic form of this enzyme and reveal differences from bacterial homologs. HisRSs in general contain an extra domain inserted between conserved motifs 2 and 3 of the Class II aminoacyl-tRNA synthetase catalytic core. The current structures show that the three-dimensional topology of this domain is very different in bacterial and archaeal/eukaryotic forms of the enzyme. Comparison of apo and histidine-bound trypanosomal structures indicates substantial active-site rearrangement upon histidine binding but relatively little subsequent rearrangement after reaction of histidine with ATP to form the enzyme's first reaction product, histidyladenylate. The specific residues involved in forming the binding pocket for the adenine moiety differ substantially both from the previously characterized binding site in bacterial structures and from the homologous residues in human HisRSs. The essentiality of the single HisRS gene in T. brucei is shown by a severe depression of parasite growth rate that results from even partial suppression of expression by RNA interference.

  8. Discovery of Infection Associated Metabolic Markers in Human African Trypanosomiasis

    PubMed Central

    Lamour, Sabrina D.; Gomez-Romero, Maria; Vorkas, Panagiotis A.; Alibu, Vincent P.; Saric, Jasmina; Holmes, Elaine; Sternberg, Jeremy M.

    2015-01-01

    Human African trypanosomiasis (HAT) remains a major neglected tropical disease in Sub-Saharan Africa. As clinical symptoms are usually non-specific, new diagnostic and prognostic markers are urgently needed to enhance the number of identified cases and optimise treatment. This is particularly important for disease caused by Trypanosoma brucei rhodesiense, where indirect immunodiagnostic approaches have to date been unsuccessful. We have conducted global metabolic profiling of plasma from T.b.rhodesiense HAT patients and endemic controls, using 1H nuclear magnetic resonance (NMR) spectroscopy and ultra-performance liquid chromatography, coupled with mass spectrometry (UPLC-MS) and identified differences in the lipid, amino acid and metabolite profiles. Altogether 16 significantly disease discriminatory metabolite markers were found using NMR, and a further 37 lipid markers via UPLC-MS. These included significantly higher levels of phenylalanine, formate, creatinine, N-acetylated glycoprotein and triglycerides in patients relative to controls. HAT patients also displayed lower concentrations of histidine, sphingomyelins, lysophosphatidylcholines, and several polyunsaturated phosphatidylcholines. While the disease metabolite profile was partially consistent with previous data published in experimental rodent infection, we also found unique lipid and amino acid profile markers highlighting subtle but important differences between the host response to trypanosome infections between animal models and natural human infections. Our results demonstrate the potential of metabolic profiling in the identification of novel diagnostic biomarkers and the elucidation of pathogenetic mechanisms in this disease. PMID:26505639

  9. Discovery of Infection Associated Metabolic Markers in Human African Trypanosomiasis.

    PubMed

    Lamour, Sabrina D; Gomez-Romero, Maria; Vorkas, Panagiotis A; Alibu, Vincent P; Saric, Jasmina; Holmes, Elaine; Sternberg, Jeremy M

    2015-01-01

    Human African trypanosomiasis (HAT) remains a major neglected tropical disease in Sub-Saharan Africa. As clinical symptoms are usually non-specific, new diagnostic and prognostic markers are urgently needed to enhance the number of identified cases and optimise treatment. This is particularly important for disease caused by Trypanosoma brucei rhodesiense, where indirect immunodiagnostic approaches have to date been unsuccessful. We have conducted global metabolic profiling of plasma from T.b.rhodesiense HAT patients and endemic controls, using 1H nuclear magnetic resonance (NMR) spectroscopy and ultra-performance liquid chromatography, coupled with mass spectrometry (UPLC-MS) and identified differences in the lipid, amino acid and metabolite profiles. Altogether 16 significantly disease discriminatory metabolite markers were found using NMR, and a further 37 lipid markers via UPLC-MS. These included significantly higher levels of phenylalanine, formate, creatinine, N-acetylated glycoprotein and triglycerides in patients relative to controls. HAT patients also displayed lower concentrations of histidine, sphingomyelins, lysophosphatidylcholines, and several polyunsaturated phosphatidylcholines. While the disease metabolite profile was partially consistent with previous data published in experimental rodent infection, we also found unique lipid and amino acid profile markers highlighting subtle but important differences between the host response to trypanosome infections between animal models and natural human infections. Our results demonstrate the potential of metabolic profiling in the identification of novel diagnostic biomarkers and the elucidation of pathogenetic mechanisms in this disease.

  10. A Target-Based High Throughput Screen Yields Trypanosoma brucei Hexokinase Small Molecule Inhibitors with Antiparasitic Activity

    PubMed Central

    Sharlow, Elizabeth R.; Lyda, Todd A.; Dodson, Heidi C.; Mustata, Gabriela; Morris, Meredith T.; Leimgruber, Stephanie S.; Lee, Kuo-Hsiung; Kashiwada, Yoshiki; Close, David; Lazo, John S.; Morris, James C.

    2010-01-01

    Background The parasitic protozoan Trypanosoma brucei utilizes glycolysis exclusively for ATP production during infection of the mammalian host. The first step in this metabolic pathway is mediated by hexokinase (TbHK), an enzyme essential to the parasite that transfers the γ-phospho of ATP to a hexose. Here we describe the identification and confirmation of novel small molecule inhibitors of bacterially expressed TbHK1, one of two TbHKs expressed by T. brucei, using a high throughput screening assay. Methodology/Principal Findings Exploiting optimized high throughput screening assay procedures, we interrogated 220,233 unique compounds and identified 239 active compounds from which ten small molecules were further characterized. Computation chemical cluster analyses indicated that six compounds were structurally related while the remaining four compounds were classified as unrelated or singletons. All ten compounds were ∼20-17,000-fold more potent than lonidamine, a previously identified TbHK1 inhibitor. Seven compounds inhibited T. brucei blood stage form parasite growth (0.03≤EC50<3 µM) with parasite specificity of the compounds being demonstrated using insect stage T. brucei parasites, Leishmania promastigotes, and mammalian cell lines. Analysis of two structurally related compounds, ebselen and SID 17387000, revealed that both were mixed inhibitors of TbHK1 with respect to ATP. Additionally, both compounds inhibited parasite lysate-derived HK activity. None of the compounds displayed structural similarity to known hexokinase inhibitors or human African trypanosomiasis therapeutics. Conclusions/Significance The novel chemotypes identified here could represent leads for future therapeutic development against the African trypanosome. PMID:20405000

  11. The VIPER elements of trypanosomes constitute a novel group of tyrosine recombinase-enconding retrotransposons.

    PubMed

    Lorenzi, Hernan A; Robledo, German; Levin, Mariano J

    2006-02-01

    VIPER was initially characterized as a 2326bp LTR-like retroelement associated to SIRE, a short interspersed repetitive element specific of Trypanosoma cruzi. It carried a single ORF that coded for a putative reverse transcriptase-RNAse H protein, suggesting that it could be a truncated copy of a longer retroelement. Herein we report the identification and characterization of a complete 4480bp long VIPER in the T. cruzi genome. The complete VIPER harbored three non-overlapped domains encoding for a GAG-like, a tyrosine recombinase and a reverse transcriptase-RNAse H proteins. VIPER elements were also found in the genomes of Trypanosoma brucei and Trypanosoma vivax, but not in Leishmania sp. On the basis of its reverse transcriptase phylogeny, VIPER was classified as an LTR retroelement. However, VIPER was structurally related to the tyrosine recombinase encoding retroelements, DIRS and Ngaro. Phylogenetic analysis showed that VIPER's tyrosine recombinase grouped with the transposases RCI1 of Escherichia coli and Ye24 and Ye72 of Haemophilus influenzae within a major branch of prokaryotic recombinases. Taken together, VIPER's structure, the nature of its tyrosine recombinase, the unique features of its reverse transcriptase catalytic consensus motif and the fact that it was found in Trypanosomes, an early branching eukaryote, suggest that VIPER may be the closest relative of the founder element of the tyrosine recombinase encoding retrotransposons known up to date. Our analysis revealed that tyrosine recombinase-encoding retroelements were originated as early in evolution as non-LTR retroelements and suggests that VIPER, Ngaro and DIRS elements may constitute a third group of retrotransposons, distinct from both LTR and non-LTR retroelements.

  12. Localization of the modified base J in telomeric VSG gene expression sites of Trypanosoma brucei.

    PubMed

    van Leeuwen, F; Wijsman, E R; Kieft, R; van der Marel, G A; van Boom, J H; Borst, P

    1997-12-01

    African trypanosomes such as Trypanosoma brucei undergo antigenic variation in the bloodstream of their mammalian hosts by regularly changing the variant surface glycoprotein (VSG) gene expressed. The transcribed VSG gene is invariably located in a telomeric expression site. There are multiple expression sites and one way to change the VSG gene expressed is by activating a new site and inactivating the previously active one. The mechanisms that control expression site switching are unknown, but have been suggested to involve epigenetic regulation. We have found previously that VSG genes in silent (but not active) expression sites contain modified restriction endonuclease cleavage sites, and we have presented circumstantial evidence indicating that this is attributable to the presence of a novel modified base beta-D-glucosyl-hydroxymethyluracil, or J. To directly test this, we have generated antisera that specifically recognize J-containing DNA and have used these to determine the precise location of this modified thymine in the telomeric VSG expression sites. By anti J-DNA immunoprecipitations, we found that J is present in telomeric VSG genes in silenced expression sites and not in actively transcribed telomeric VSG genes. J was absent from inactive chromosome-internal VSG genes. DNA modification was also found at the boundaries of expression sites. In the long 50-bp repeat arrays upstream of the promoter and in the telomeric repeat arrays downstream of the VSG gene, J was found both in silent and active expression sites. This suggests that silencing results in a gradient of modification spreading from repetitive DNA flanks into the neighboring expression site sequences. In this paper, we discuss the possible role of J in silencing of expression sites.

  13. Quantitative sequencing confirms VSG diversity as central to immune evasion by Trypanosoma brucei.

    PubMed

    McCulloch, Richard; Field, Mark C

    2015-08-01

    Antigenic variation is central to the virulence of African trypanosomes, where the VSG coat is used to evade the host immune system. Recent advances in technology have now allowed more secrets of this system to emerge, with the surprising insight that a broad repertoire of VSGs is rapidly expressed. This has major implications for how the parasite must evade the host immune response.

  14. No Gold Standard Estimation of the Sensitivity and Specificity of Two Molecular Diagnostic Protocols for Trypanosoma brucei spp. in Western Kenya

    PubMed Central

    de Clare Bronsvoort, Barend Mark; von Wissmann, Beatrix; Fèvre, Eric Maurice; Handel, Ian Graham; Picozzi, Kim; Welburn, Sue Christina

    2010-01-01

    African animal trypanosomiasis is caused by a range of tsetse transmitted protozoan parasites includingTrypanosoma vivax, Trypanosoma congolense and Trypansoma brucei. In Western Kenya and other parts of East Africa two subspecies of T. brucei, T.b. brucei and the zoonoticT.b. rhodesiense, co-circulate in livestock. A range of polymerase chain reactions (PCR) have been developed as important molecular diagnostic tools for epidemiological investigations of T. brucei s.l. in the animal reservoir and of its zoonotic potential. Quantification of the relative performance of different diagnostic PCRs is essential to ensure comparability of studies. This paper describes an evaluation of two diagnostic test systems for T. brucei using a T. brucei s.l. specific PCR [1] and a single nested PCR targeting the Internal Transcribed Spacer (ITS) regions of trypanosome ribosomal DNA [2]. A Bayesian formulation of the Hui-Walter latent class model was employed to estimate their test performance in the absence of a gold standard test for detecting T.brucei s.l. infections in ear-vein blood samples from cattle, pig, sheep and goat populations in Western Kenya, stored on Whatman FTA cards. The results indicate that the system employing the T. brucei s.l. specific PCR (Se1 = 0.760) had a higher sensitivity than the ITS-PCR (Se2 = 0.640); both have high specificity (Sp1 = 0.998; Sp2 = 0.997). The true prevalences for livestock populations were estimated (pcattle = 0.091, ppigs = 0.066, pgoats = 0.005, psheep = 0.006), taking into account the uncertainties in the specificity and sensitivity of the two test systems. Implications of test performance include the required survey sample size; due to its higher sensitivity and specificity, the T. brucei s.l. specific PCR requires a consistently smaller sample size than the ITS-PCR for the detection of T. brucei s.l. However the ITS-PCR is able to simultaneously screen samples for other pathogenic trypanosomes

  15. The essential polysome-associated RNA-binding protein RBP42 targets mRNAs involved in Trypanosoma brucei energy metabolism

    PubMed Central

    Das, Anish; Morales, Rachel; Banday, Mahrukh; Garcia, Stacey; Hao, Li; Cross, George A.M.; Estevez, Antonio M.; Bellofatto, Vivian

    2012-01-01

    RNA-binding proteins that target mRNA coding regions are emerging as regulators of post-transcriptional processes in eukaryotes. Here we describe a newly identified RNA-binding protein, RBP42, which targets the coding region of mRNAs in the insect form of the African trypanosome, Trypanosoma brucei. RBP42 is an essential protein and associates with polysome-bound mRNAs in the cytoplasm. A global survey of RBP42-bound mRNAs was performed by applying HITS-CLIP technology, which captures protein–RNA interactions in vivo using UV light. Specific RBP42–mRNA interactions, as well as mRNA interactions with a known RNA-binding protein, were purified using specific antibodies. Target RNA sequences were identified and quantified using high-throughput RNA sequencing. Analysis revealed that RBP42 bound mainly within the coding region of mRNAs that encode proteins involved in cellular energy metabolism. Although the mechanism of RBP42's function is unclear at present, we speculate that RBP42 plays a critical role in modulating T. brucei energy metabolism. PMID:22966087

  16. Population genetics of Trypanosoma brucei gambiense in sleeping sickness patients with treatment failures in the focus of Mbuji-Mayi, Democratic Republic of the Congo.

    PubMed

    Pyana, Patient Pati; Sere, Modou; Kaboré, Jacques; De Meeûs, Thierry; MacLeod, Annette; Bucheton, Bruno; Van Reet, Nick; Büscher, Philippe; Belem, Adrien Marie Gaston; Jamonneau, Vincent

    2015-03-01

    Human African trypanosomiasis (HAT) in the Democratic Republic of the Congo (DRC) is caused by the protozoan Trypanosoma brucei gambiense. Until recently, all patients in the second or neurological stage of the disease were treated with melarsoprol. At the end of the past and the beginning of the present century, alarmingly high relapse rates in patients treated with melarsoprol were reported in isolated HAT foci. In the Mbuji-Mayi focus of DRC, a particular mutation that confers cross resistance for pentamidine and melarsoprol was recently found for all strains studied. Nevertheless, treatment successfully cured a significant proportion of patients. To check for the existence of other possible genetic factors of the parasites, we genotyped trypanosomes isolated from patients before and after treatment (relapsing patients) with eight microsatellite markers. We found no evidence of any genetic correlation between parasite genotype and treatment outcome and we concluded that relapse or cure probably depend more on patients' factors such as disease progression, nutritional or immunological status or co-infections with other pathogens. The existence of a melarsoprol and pentamidine resistance associated mutation at such high rates highlights an increasing problem, even for other drugs, especially those using the same transporters as melarsoprol and pentamidine.

  17. The FACT subunit TbSpt16 is involved in cell cycle specific control of VSG expression sites in Trypanosoma brucei.

    PubMed

    Denninger, Viola; Fullbrook, Alexander; Bessat, Mohamed; Ersfeld, Klaus; Rudenko, Gloria

    2010-10-01

    The African trypanosome Trypanosoma brucei monoallelically expresses one of more than 1000 Variant Surface Glycoprotein (VSG) genes. The active VSG is transcribed from one of about 15 telomeric VSG expression sites (ESs). It is unclear how monoallelic expression of VSG is controlled, and how inactive VSG ESs are silenced. Here, we show that blocking synthesis of the T. brucei FACT subunit TbSpt16 triggers a G2/early M phase cell cycle arrest in both bloodstream and insect form T. brucei. Segregation of T. brucei minichromosomes in these stalled cells is impaired, implicating FACT in maintenance of centromeres. Strikingly, knock-down of TbSpt16 results in 20- to 23-fold derepression of silent VSG ES promoters in bloodstream form T. brucei, with derepression specific to the G2/M cell cycle stage. In insect form T. brucei TbSpt16 knock-down results in 16- to 25-fold VSG ES derepression. Using chromatin immunoprecipitation (ChIP), TbSpt16 was found to be particularly enriched at the promoter region of silent but not active VSG ESs in bloodstream form T. brucei. The chromatin remodeler FACT is therefore implicated in maintenance of repressed chromatin present at silent VSG ES promoters, but is also essential for chromosome segregation presumably through maintenance of functional centromeres.

  18. Immunobiology of African Trypanosomes: Need of Alternative Interventions

    PubMed Central

    Baral, Toya Nath

    2010-01-01

    Trypanosomiasis is one of the major parasitic diseases for which control is still far from reality. The vaccination approaches by using dominant surface proteins have not been successful, mainly due to antigenic variation of the parasite surface coat. On the other hand, the chemotherapeutic drugs in current use for the treatment of this disease are toxic and problems of resistance are increasing (see Kennedy (2004) and Legros et al. (2002)). Therefore, alternative approaches in both treatment and vaccination against trypanosomiasis are needed at this time. To be able to design and develop such alternatives, the biology of this parasite and the host response against the pathogen need to be studied. These two aspects of this disease with few examples of alternative approaches are discussed here. PMID:20182644

  19. A comparison of the antigen detection ELISA and parasite detection for diagnosis of Trypanosoma evansi infections in camels.

    PubMed

    Waitumbi, J N; Nantulya, V M

    1993-09-01

    Two herds of 60 camels each, living in Trypanosoma evansi endemic areas, were selected and studied for a period of 18 months. Animals in one herd were treated prophylactically with quinapyramine prosalt (May and Baker, Dagenham, UK), while those in the other herd were treated individually with quinapyramine dimethylsulphate (May and Baker, Dagenham, UK) when proven parasitaemic. The herd on prophylaxis was sampled for antigen and patent infection monthly. The other herd was sampled weekly for patent infection and fortnightly for antigen. The results obtained could be divided into four categories. The first category comprised cases (52 out of 61) in which the presence of trypanosome antigens could be correlated with parasitological diagnosis. In 80% of these animals the antigens disappeared from the circulation within a period of 30 days following chemotherapy. The second category comprised those animals with parasitologically proven infections but which did not have antigens in their sera. This was observed in nine camels, seven of which were from the herd that was being examined weekly for the presence of trypanosomes. These were considered to be animals in early infection, as the subsequent sera were also negative for anti-trypanosome antibodies and immune complexes. The third category comprised camels which were antigen-positive but aparasitaemic. Sera from these animals were also positive for anti-trypanosome antibodies, indicating that antigen-positivity was a true reflection of trypanosome infections in these animals. The last category comprised pre-weaned camel calves which appeared to have some form of protection against trypanosomiasis, as evidenced by the absence of trypanosomes, antigens and antibodies throughout the early period of their lives. Only occasional antigenaemia was found in a few calves. It is concluded that trypanosome antigen detection may give a more accurate idea of the prevalence of T. evansi infections than does whole parasite

  20. Phospholipase A2 from Trypanosoma brucei gambiense and Trypanosoma brucei brucei: inhibition by organotins.

    PubMed

    Shuaibu, M N; Kanbara, H; Yanagi, T; Ameh, D A; Bonire, J J; Nok, A J

    2001-11-01

    Activity and kinetics of phospholipase A2 (PLA2) from Trypanosoma brucei gambiense (Wellcome strain) and Trypanosoma brucei brucei (GUTat 3.1) were examined using two different fluorescent substrates. The activity in the supernatants of sonicated parasites was Ca2+-independent, strongly stimulated by Triton X-100 with optimum activity at 37 degrees C and pH 6.5-8.5. To encourage a possible interaction between the parasite enzyme and organotin compounds, fatty acid derivatives of dibutyltin dichloride were synthesized and evaluated as potential inhibitors of PLA2. The enzyme from the two-trypanosome species differ with respect to kinetic parameters and are noncompetitively inhibited by the organotin compounds. The Michaelis constant (KM) for PLA2 from T. b. brucei is 63.87 and 30.90 microM while for T. b. gambiense it is 119.64 and 32.91 microM for the substrates 1,2-bis-(1-pyrenebutanoyl)-sn-glycero-3-phosphocholine (PBGPC) and 2-(12-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)dodecanoyl-1-hexadecanoyl-sn-glycero-3-phosphocholine (NBDC12-HPC), respectively.

  1. Evaluation of In Vitro Activity of Essential Oils against Trypanosoma brucei brucei and Trypanosoma evansi

    PubMed Central

    Habila, Nathan; Agbaji, Abel S.; Ladan, Zakari; Bello, Isaac A.; Haruna, Emmanuel; Dakare, Monday A.; Atolagbe, Taofiq O.

    2010-01-01

    Essential oils (EOs) from Cymbopogon citratus (CC), Eucalyptus citriodora (EC), Eucalyptus camaldulensis (ED), and Citrus sinensis (CS) were obtained by hydrodistillation process. The EOs were evaluated in vitro for activity against Trypanosoma brucei brucei (Tbb) and Trypanosoma evansi (T. evansi). The EOs were found to possess antitrypanosomal activity in vitro in a dose-dependent pattern in a short period of time. The drop in number of parasite over time was achieved doses of 0.4 g/ml, 0.2 g/mL, and 0.1 g/mL for all the EOs. The concentration of 0.4 g/mL CC was more potent at 3 minutes and 2 minutes for Tbb and T. evansi, respectively. The GC-MS analysis of the EOs revealed presence of Cyclobutane (96.09%) in CS, 6-octenal (77.11%) in EC, Eucalyptol (75%) in ED, and Citral (38.32%) in CC among several other organic compounds. The results are discussed in relation to trypanosome chemotherapy. PMID:20700425

  2. Trypanosoma vivax Adhesion to Red Blood Cells in Experimentally Infected Sheep

    PubMed Central

    Boada-Sucre, Alpidio A.; Rossi Spadafora, Marcello Salvatore; Tavares-Marques, Lucinda M.; Finol, Héctor J.; Reyna-Bello, Armando

    2016-01-01

    Trypanosomosis, a globally occurring parasitic disease, poses as a major obstacle to livestock production in tropical and subtropical regions resulting in tangible economic losses. In Latin America including Venezuela, trypanosomosis of ruminants is mainly caused by Trypanosoma vivax. Biologically active substances produced from trypanosomes, as well as host-trypanosome cellular interactions, contribute to the pathogenesis of anemia in an infection. The aim of this study was to examine with a scanning electron microscope the cellular interactions and alterations in ovine red blood cells (RBC) experimentally infected with T. vivax. Ovine infection resulted in changes of RBC shape as well as the formation of surface holes or vesicles. A frequent observation was the adhesion to the ovine RBC by the trypanosome's free flagellum, cell body, or attached flagellum in a process mediated by the filopodia emission from the trypanosome surface. The observed RBC alterations are caused by mechanical and biochemical damage from host-parasite interactions occurring in the bloodstream. The altered erythrocytes are prone to mononuclear phagocytic removal contributing to the hematocrit decrease during infection. PMID:27293960

  3. Synthesis of macrocyclic trypanosomal cysteine protease inhibitors.

    PubMed

    Chen, Yen Ting; Lira, Ricardo; Hansell, Elizabeth; McKerrow, James H; Roush, William R

    2008-11-15

    The importance of cysteine proteases in parasites, compounded with the lack of redundancy compared to their mammalian hosts makes proteases attractive targets for the development of new therapeutic agents. The binding mode of K11002 to cruzain, the major cysteine protease of Trypanosoma cruzi was used in the design of conformationally constrained inhibitors. Vinyl sulfone-containing macrocycles were synthesized via olefin ring-closing metathesis and evaluated against cruzain and the closely related cysteine protease, rhodesain.

  4. High throughput sequencing analysis of Trypanosoma brucei DRBD3/PTB1-bound mRNAs.

    PubMed

    Das, Anish; Bellofatto, Vivian; Rosenfeld, Jeffrey; Carrington, Mark; Romero-Zaliz, Rocío; del Val, Coral; Estévez, Antonio M

    2015-01-01

    Trypanosomes are early-branched eukaryotes that show an unusual dependence on post-transcriptional mechanisms to regulate gene expression. RNA-binding proteins are crucial in controlling mRNA fate in these organisms, but their RNA substrates remain largely unknown. Here we have analyzed on a global scale the mRNAs associated with the Trypanosoma brucei RNA-binding protein DRBD3/PTB1, by capturing ribonucleoprotein complexes using UV cross-linking and subsequent immunoprecipitation. DRBD3/PTB1 associates with many transcripts encoding ribosomal proteins and translation factors. Consequently, silencing of DRBD3/PTB1 expression altered the protein synthesis rate. DRBD3/PTB1 also binds to mRNAs encoding the enzymes required to obtain energy through the oxidation of proline to succinate. We hypothesize that DRBD3/PTB1 is a key player in RNA regulon-based gene control influencing protein synthesis in trypanosomes.

  5. Characterization of the genes specifying two metacyclic variable antigen types in Trypanosoma brucei rhodesiense.

    PubMed Central

    Lenardo, M J; Rice-Ficht, A C; Kelly, G; Esser, K M; Donelson, J E

    1984-01-01

    Bloodstream trypanosomes evade the immune system of their mammalian host by sequentially expressing a large number of different variable surface glycoproteins (VSGs). In contrast, metacyclic trypanosomes, the final developmental stage in the tsetse fly, express a much more restricted set of VSGs. These metacyclic VSGs are the first to be exposed to the immune system of the mammalian host after infection and may offer the potential for the eventual development of a vaccine. We have identified cDNAs for two VSGs in cDNA libraries prepared from amplified metacyclic populations of Trypanosoma brucei rhodesiense and show that they correspond to two different metacyclic serotypes. Determination of the cDNA sequences shows that metacyclic VSG mRNAs are similar to VSG mRNAs expressed during the bloodstream stage. Southern blots demonstrate that the metacyclic VSG genes are located near chromosomal telomeres. No evidence of gene rearrangement associated with expression of these VSGs was found. Images PMID:6593722

  6. Loop-mediated isothermal amplification test for Trypanosoma vivax based on satellite repeat DNA.

    PubMed

    Njiru, Z K; Ouma, J O; Bateta, R; Njeru, S E; Ndungu, K; Gitonga, P K; Guya, S; Traub, R

    2011-08-25

    Trypanosoma vivax is major cause of animal trypanosomiasis and responsible for enormous economic burden in Africa and South America animal industry. T. vivax infections mostly run low parasitaemia with no apparent clinical symptoms, making diagnosis a challenge. This work reports the design and evaluation of a loop-mediated isothermal amplification (LAMP) test for detecting T. vivax DNA based on the nuclear satellite repeat sequence. The assay is rapid with results obtained within 35 min. The analytical sensitivity is ∼ 1 trypanosome/ml while that of the classical PCR tests ranged from 10 to 10(3)trypanosomes/ml. The T. vivax LAMP test reported here is simple, robust and has future potential in diagnosis of animal trypanosomiasis in the field.

  7. A shuttle vector which facilitates the expression of transfected genes in Trypanosoma cruzi and Leishmania.

    PubMed Central

    Kelly, J M; Ward, H M; Miles, M A; Kendall, G

    1992-01-01

    A Trypanosoma cruzi expression vector has been constructed using sequences derived from the flanking regions of the glyceraldehyde 3-phosphate dehydrogenase (gGAPDH) genes. The neomycin phosphotransferase (neor) gene was incorporated as a selectable marker. Using electroporation we have introduced this vector into both T. cruzi and Leishmania cells and conferred G418 resistance. Transformation is mediated by large extrachromosomal circular elements composed of head-to-tail tandem repeats of the vector. The transformed phenotype is stable for at least 6 months in the absence of G418 and can be maintained during passage through the T. cruzi life-cycle. Foreign genes inserted into an expression site within the vector (pTEX) can be expressed at high levels in transformed cells. To our knowledge this paper describes the first trypanosome shuttle vector and the first vector which functions in both trypanosomes and Leishmania. Images PMID:1324472

  8. Trypanosomal TAC40 constitutes a novel subclass of mitochondrial β-barrel proteins specialized in mitochondrial genome inheritance.

    PubMed

    Schnarwiler, Felix; Niemann, Moritz; Doiron, Nicholas; Harsman, Anke; Käser, Sandro; Mani, Jan; Chanfon, Astrid; Dewar, Caroline E; Oeljeklaus, Silke; Jackson, Christopher B; Pusnik, Mascha; Schmidt, Oliver; Meisinger, Chris; Hiller, Sebastian; Warscheid, Bettina; Schnaufer, Achim C; Ochsenreiter, Torsten; Schneider, André

    2014-05-27

    Mitochondria cannot form de novo but require mechanisms allowing their inheritance to daughter cells. In contrast to most other eukaryotes Trypanosoma brucei has a single mitochondrion whose single-unit genome is physically connected to the flagellum. Here we identify a β-barrel mitochondrial outer membrane protein, termed tripartite attachment complex 40 (TAC40), that localizes to this connection. TAC40 is essential for mitochondrial DNA inheritance and belongs to the mitochondrial porin protein family. However, it is not specifically related to any of the three subclasses of mitochondrial porins represented by the metabolite transporter voltage-dependent anion channel (VDAC), the protein translocator of the outer membrane 40 (TOM40), or the fungi-specific MDM10, a component of the endoplasmic reticulum-mitochondria encounter structure (ERMES). MDM10 and TAC40 mediate cellular architecture and participate in transmembrane complexes that are essential for mitochondrial DNA inheritance. In yeast MDM10, in the context of the ERMES, is postulated to connect the mitochondrial genomes to actin filaments, whereas in trypanosomes TAC40 mediates the linkage of the mitochondrial DNA to the basal body of the flagellum. However, TAC40 does not colocalize with trypanosomal orthologs of ERMES components and, unlike MDM10, it regulates neither mitochondrial morphology nor the assembly of the protein translocase. TAC40 therefore defines a novel subclass of mitochondrial porins that is distinct from VDAC, TOM40, and MDM10. However, whereas the architecture of the TAC40-containing complex in trypanosomes and the MDM10-containing ERMES in yeast is very different, both are organized around a β-barrel protein of the mitochondrial porin family that mediates a DNA-cytoskeleton linkage that is essential for mitochondrial DNA inheritance.

  9. Trypanosomal TAC40 constitutes a novel subclass of mitochondrial β-barrel proteins specialized in mitochondrial genome inheritance

    PubMed Central

    Schnarwiler, Felix; Niemann, Moritz; Doiron, Nicholas; Harsman, Anke; Käser, Sandro; Mani, Jan; Chanfon, Astrid; Dewar, Caroline E.; Oeljeklaus, Silke; Jackson, Christopher B.; Pusnik, Mascha; Schmidt, Oliver; Meisinger, Chris; Hiller, Sebastian; Warscheid, Bettina; Schnaufer, Achim C.; Ochsenreiter, Torsten; Schneider, André

    2014-01-01

    Mitochondria cannot form de novo but require mechanisms allowing their inheritance to daughter cells. In contrast to most other eukaryotes Trypanosoma brucei has a single mitochondrion whose single-unit genome is physically connected to the flagellum. Here we identify a β-barrel mitochondrial outer membrane protein, termed tripartite attachment complex 40 (TAC40), that localizes to this connection. TAC40 is essential for mitochondrial DNA inheritance and belongs to the mitochondrial porin protein family. However, it is not specifically related to any of the three subclasses of mitochondrial porins represented by the metabolite transporter voltage-dependent anion channel (VDAC), the protein translocator of the outer membrane 40 (TOM40), or the fungi-specific MDM10, a component of the endoplasmic reticulum–mitochondria encounter structure (ERMES). MDM10 and TAC40 mediate cellular architecture and participate in transmembrane complexes that are essential for mitochondrial DNA inheritance. In yeast MDM10, in the context of the ERMES, is postulated to connect the mitochondrial genomes to actin filaments, whereas in trypanosomes TAC40 mediates the linkage of the mitochondrial DNA to the basal body of the flagellum. However, TAC40 does not colocalize with trypanosomal orthologs of ERMES components and, unlike MDM10, it regulates neither mitochondrial morphology nor the assembly of the protein translocase. TAC40 therefore defines a novel subclass of mitochondrial porins that is distinct from VDAC, TOM40, and MDM10. However, whereas the architecture of the TAC40-containing complex in trypanosomes and the MDM10-containing ERMES in yeast is very different, both are organized around a β-barrel protein of the mitochondrial porin family that mediates a DNA–cytoskeleton linkage that is essential for mitochondrial DNA inheritance. PMID:24821793

  10. Patterns in age-seroprevalence consistent with acquired immunity against Trypanosoma brucei in Serengeti lions.

    PubMed

    Welburn, Sue; Picozzi, Kim; Coleman, Paul G; Packer, Craig

    2008-01-01

    Trypanosomes cause disease in humans and livestock throughout sub-Saharan Africa. Although various species show evidence of clinical tolerance to trypanosomes, until now there has been no evidence of acquired immunity to natural infections. We discovered a distinct peak and decrease in age prevalence of T. brucei s.l. infection in wild African lions that is consistent with being driven by an exposure-dependent increase in cross-immunity following infections with the more genetically diverse species, T. congolense sensu latu. The causative agent of human sleeping sickness, T. brucei rhodesiense, disappears by 6 years of age apparently in response to cross-immunity from other trypanosomes, including the non-pathogenic subspecies, T. brucei brucei. These findings may suggest novel pathways for vaccinations against trypanosomiasis despite the notoriously complex antigenic surface proteins in these parasites.

  11. Trypanosomes Modify the Behavior of Their Insect Hosts: Effects on Locomotion and on the Expression of a Related Gene

    PubMed Central

    Carrasco, David; Alves-Silva, Juliana; Rodrigues, Juliana de Oliveira; Ferreira, Luciana de Lima; Lara, Luisa de Melo; Lowenberger, Carl; Guarneri, Alessandra Aparecida

    2015-01-01

    Background As a result of evolution, the biology of triatomines must have been significantly adapted to accommodate trypanosome infection in a complex network of vector-vertebrate-parasite interactions. Arthropod-borne parasites have probably developed mechanisms, largely still unknown, to exploit the vector-vertebrate host interactions to ensure their transmission to suitable hosts. Triatomines exhibit a strong negative phototaxis and nocturnal activity, believed to be important for insect survival against its predators. Methodology/Principal Findings In this study we quantified phototaxis and locomotion in starved fifth instar nymphs of Rhodnius prolixus infected with Trypanosoma cruzi or Trypanosoma rangeli. T. cruzi infection did not alter insect phototaxis, but induced an overall 20% decrease in the number of bug locomotory events. Furthermore, the significant differences induced by this parasite were concentrated at the beginning of the scotophase. Conversely, T. rangeli modified both behaviors, as it significantly decreased bug negative phototaxis, while it induced a 23% increase in the number of locomotory events in infected bugs. In this case, the significant effects were observed during the photophase. We also investigated the expression of Rpfor, the triatomine ortholog of the foraging gene known to modulate locomotion in other insects, and found a 4.8 fold increase for T. rangeli infected insects. Conclusions/Significance We demonstrated for the first time that trypanosome infection modulates the locomotory activity of the invertebrate host. T. rangeli infection seems to be more broadly effective, as besides affecting the intensity of locomotion this parasite also diminished negative phototaxis and the expression of a behavior-associated gene in the triatomine vector. PMID:26291723

  12. Iron Homeostasis and Trypanosoma brucei Associated Immunopathogenicity Development: A Battle/Quest for Iron

    PubMed Central

    Stijlemans, Benoit; Beschin, Alain; Magez, Stefan; Van Ginderachter, Jo A.; De Baetselier, Patrick

    2015-01-01

    African trypanosomosis is a chronic debilitating disease affecting the health and economic well-being of developing countries. The immune response during African trypanosome infection consisting of a strong proinflammatory M1-type activation of the myeloid phagocyte system (MYPS) results in iron deprivation for these extracellular parasites. Yet, the persistence of M1-type MYPS activation causes the development of anemia (anemia of chronic disease, ACD) as a most prominent pathological parameter in the mammalian host, due to enhanced erythrophagocytosis and retention of iron within the MYPS thereby depriving iron for erythropoiesis. In this review we give an overview of how parasites acquire iron from the host and how iron modulation of the host MYPS affects trypanosomosis-associated anemia development. Finally, we also discuss different strategies at the level of both the host and the parasite that can/might be used to modulate iron availability during African trypanosome infections. PMID:26090446

  13. Duplicative activation mechanisms of two trypanosome telomeric VSG genes with structurally simple 5' flanks.

    PubMed

    Matthews, K R; Shiels, P G; Graham, S V; Cowan, C; Barry, J D

    1990-12-25

    In the mammalian bloodstream, African trypanosomes express variant surface glycoprotein (VSG) genes from a family of long and complex telomeric expression sites. VSG switching generally occurs by the duplication of different VSG genes into these sites by gene conversion involving a series of 70 base pair (70bp) repeats in the 5' flank. In contrast, when VSG is first synthesised by trypanosomes in the tsetse fly at the metacyclic stage, a separate set of telomeric expression sites is activated. These latter telomeres appear not to act as recipients in gene conversion. We have found that the structure of two such expression sites is simple, with very short 70bp repeat regions and very little other sequence in common with bloodstream expression sites. However, the two telomeres readily act as donors in VSG gene conversion in the bloodstream and we show for one a consistent association of the conversion 5' end point with the short 70bp repeat region. These findings help explain why a very predictable set of VSGs is expressed in the tsetse fly and have implications for VSG gene conversion mechanisms.

  14. High Local Diversity of Trypanosoma in a Common Bat Species, and Implications for the Biogeography and Taxonomy of the T. cruzi Clade

    PubMed Central

    Kalko, Elisabeth K. V.; Cottontail, Iain; Wellinghausen, Nele; Tschapka, Marco; Perkins, Susan L.

    2014-01-01

    The Trypanosoma cruzi clade is a group of parasites that comprises T. cruzi sensu lato and its closest relatives. Although several species have been confirmed phylogenetically to belong to this clade, it is uncertain how many more species can be expected to belong into this group. Here, we present the results of a survey of trypanosome parasites of the bat Artibeus jamaicensis from the Panamá Canal Zone, an important seed disperser. Using a genealogical species delimitation approach, the Poisson tree processes (PTP), we tentatively identified five species of trypanosomes – all belonging to the T. cruzi clade. A small monophyletic group of three putative Trypanosoma species places at the base of the clade phylogeny, providing evidence for at least five independent colonization events of these parasites into the New World. Artibeus jamaicensis presents a high diversity of these blood parasites and is the vertebrate with the highest number of putative trypanosome species reported from a single locality. Our results emphasize the need for continued efforts to survey mammalian trypanosomes. PMID:25268381

  15. High local diversity of Trypanosoma in a common bat species, and implications for the biogeography and taxonomy of the T. cruzi clade.

    PubMed

    Cottontail, Veronika M; Kalko, Elisabeth K V; Cottontail, Iain; Wellinghausen, Nele; Tschapka, Marco; Perkins, Susan L; Pinto, C Miguel

    2014-01-01

    The Trypanosoma cruzi clade is a group of parasites that comprises T. cruzi sensu lato and its closest relatives. Although several species have been confirmed phylogenetically to belong to this clade, it is uncertain how many more species can be expected to belong into this group. Here, we present the results of a survey of trypanosome parasites of the bat Artibeus jamaicensis from the Panamá Canal Zone, an important seed disperser. Using a genealogical species delimitation approach, the Poisson tree processes (PTP), we tentatively identified five species of trypanosomes - all belonging to the T. cruzi clade. A small monophyletic group of three putative Trypanosoma species places at the base of the clade phylogeny, providing evidence for at least five independent colonization events of these parasites into the New World. Artibeus jamaicensis presents a high diversity of these blood parasites and is the vertebrate with the highest number of putative trypanosome species reported from a single locality. Our results emphasize the need for continued efforts to survey mammalian trypanosomes.

  16. Simulating the Complex Cell Design of Trypanosoma brucei and Its Motility

    PubMed Central

    Alizadehrad, Davod; Krüger, Timothy; Engstler, Markus; Stark, Holger

    2015-01-01

    The flagellate Trypanosoma brucei, which causes the sleeping sickness when infecting a mammalian host, goes through an intricate life cycle. It has a rather complex propulsion mechanism and swims in diverse microenvironments. These continuously exert selective pressure, to which the trypanosome adjusts with its architecture and behavior. As a result, the trypanosome assumes a diversity of complex morphotypes during its life cycle. However, although cell biology has detailed form and function of most of them, experimental data on the dynamic behavior and development of most morphotypes is lacking. Here we show that simulation science can predict intermediate cell designs by conducting specific and controlled modifications of an accurate, nature-inspired cell model, which we developed using information from live cell analyses. The cell models account for several important characteristics of the real trypanosomal morphotypes, such as the geometry and elastic properties of the cell body, and their swimming mechanism using an eukaryotic flagellum. We introduce an elastic network model for the cell body, including bending rigidity and simulate swimming in a fluid environment, using the mesoscale simulation technique called multi-particle collision dynamics. The in silico trypanosome of the bloodstream form displays the characteristic in vivo rotational and translational motility pattern that is crucial for survival and virulence in the vertebrate host. Moreover, our model accurately simulates the trypanosome's tumbling and backward motion. We show that the distinctive course of the attached flagellum around the cell body is one important aspect to produce the observed swimming behavior in a viscous fluid, and also required to reach the maximal swimming velocity. Changing details of the flagellar attachment generates less efficient swimmers. We also simulate different morphotypes that occur during the parasite's development in the tsetse fly, and predict a flagellar

  17. Beta-interferon inhibits cell infection by Trypanosoma cruzi

    NASA Technical Reports Server (NTRS)

    Kierszenbaum, F.; Sonnenfeld, G.

    1984-01-01

    Beta interferon has been shown to inhibit the capacity of bloodstream forms of the flagellate Trypanosoma cruzi, the causative agent of Chagas' disease, to associate with and infect mouse peritoneal macrophages and rat heart myoblasts. The inhibitory effect was abrogated in the presence of specific antibodies to the interferon. Pretreatment of the parasites with interferon reduced their infectivity for untreated host cells, whereas pretreament of either type of host cell did not affect the interaction. The effect of interferon on the trypanosomes was reversible; the extent of the inhibitory effect was significantly reduced afer 20 min, and was undetectable after 60 min when macrophages were used as host cells. For the myoblasts, 60 min elapsed before the inhibitory effect began to subside and 120 min elapsed before it became insignificant or undetectable.

  18. Clomipramine kills Trypanosoma brucei by apoptosis.

    PubMed

    de Silva Rodrigues, Jean Henrique; Stein, Jasmin; Strauss, Mariana; Rivarola, Héctor Walter; Ueda-Nakamura, Tânia; Nakamura, Celso Vataru; Duszenko, Michael

    2016-06-01

    Drug repositioning, i.e. use of existing medicals to treat a different illness, is especially rewarding for neglected tropical diseases (NTD), since in this field the pharmaceutical industry is rather reluctant to spend vast investments for drug development. NTDs afflict primarily poor populations in under-developed countries, which minimizes financial profit. Here we investigated the trypanocidal effect of clomipramine, a commercial antipsychotic drug, on Trypanosoma brucei. The data showed that this drug killed the parasite with an IC50 of about 5μM. Analysis of the involved cell death mechanism revealed furthermore an initial autophagic stress response and finally the induction of apoptosis. The latter was substantiated by a set of respective markers such as phosphatidylserine exposition, DNA degradation, loss of the inner mitochondrial membrane potential and characteristic morphological changes. Clomipramine was described as a trypanothione inhibitor, but as judged from our results it also showed DNA binding capacities and induced substantial morphological changes. We thus consider it likely that the drug induces a multifold adverse interaction with the parasite's physiology and induces stress in a way that trypanosomes cannot cope with.

  19. Failure to demonstrate a major role for Kupffer cells and radiosensitive leukocytes in immunoglobulin-mediated elimination of Trypanosoma musculi

    SciTech Connect

    Kongshavn, P.A.; Shaw, K.; Ghadirian, E.; Ulczak, O. )

    1990-06-01

    Previous studies have indicated that elimination of parasitemia in Trypanosoma musculi infection is brought about by immunoglobulin G2a antibodies, C3, and an effector cell. Experiments were designed to identify the putative effector cell by using several approaches. Infected C5-deficient or C5-sufficient mice treated with silica particles or given 900 rads of radiation 3 days earlier effectively eliminated trypanosomes following administration of immune plasma (IP). Silica-treated, noninfected mice given T. musculi preincubated with IP also cleared the parasites. Radiolabeling studies revealed that uptake of the cleared trypanosomes by the liver in normal mice was relatively low and fell only slightly (19%) in silica-treated mice. In contrast, uptake of radiolabeled sheep erythrocytes by the liver was normally much higher and fell drastically (7%) in silica-treated mice. Mice were then immunocompromised by 900 rads of radiation, silica particles, and anti-platelet serum combined before IP-sensitized trypanosomes were given. Leukocyte and platelet counts were both reduced by 95% and sheep erythrocyte uptake by the liver fell from 77 to 5%; however, greater than 99% of the injected trypanosomes were cleared in these mice and uptake of radiolabeled trypanosomes by the liver was similar to that of normal mice. Lastly, in anesthetized mice in which Kupffer cells were excluded surgically from the circulation, greater than 99% of the IP-sensitized trypanosomes disappeared rapidly from the blood. Only 7% of the radiolabel was found in the liver versus 60% in sham-operated mice. The results are interpreted as showing that hepatic Kupffer cells play a minor role in the immune elimination of T. musculi. Likewise, radiosensitive leukocytes and platelets are unlikely to be sole candidates for the putative effector cell that mediates a cure of murine trypanosomiasis.

  20. Exosome secretion affects social motility in Trypanosoma brucei

    PubMed Central

    Shaked, Hadassa; Arvatz, Gil; Tkacz, Itai Dov; Binder, Lior; Waldman Ben-Asher, Hiba; Okalang, Uthman; Chikne, Vaibhav; Cohen-Chalamish, Smadar; Michaeli, Shulamit

    2017-01-01

    Extracellular vesicles (EV) secreted by pathogens function in a variety of biological processes. Here, we demonstrate that in the protozoan parasite Trypanosoma brucei, exosome secretion is induced by stress that affects trans-splicing. Following perturbations in biogenesis of spliced leader RNA, which donates its spliced leader (SL) exon to all mRNAs, or after heat-shock, the SL RNA is exported to the cytoplasm and forms distinct granules, which are then secreted by exosomes. The exosomes are formed in multivesicular bodies (MVB) utilizing the endosomal sorting complexes required for transport (ESCRT), through a mechanism similar to microRNA secretion in mammalian cells. Silencing of the ESCRT factor, Vps36, compromised exosome secretion but not the secretion of vesicles derived from nanotubes. The exosomes enter recipient trypanosome cells. Time-lapse microscopy demonstrated that cells secreting exosomes or purified intact exosomes affect social motility (SoMo). This study demonstrates that exosomes are delivered to trypanosome cells and can change their migration. Exosomes are used to transmit stress signals for communication between parasites. PMID:28257521

  1. Purification of the trypanosome phospholipase C which cleaves the variant surface glycoprotein

    SciTech Connect

    Hereld, D.; Hart, G.W.; Englund, P.T.

    1986-05-01

    The surface coat of Trypanosoma brucei is composed of many copies of the Variant Surface Glycoprotein (VSG). This protein is tethered to the cell membrane by a glycolipid moiety which contains dimyristylphosphatidylinositol. Following cell lysis, an endogenous, membrane-bound phospholipase C cleaves the glycolipid and releases the VSG in soluble form. The authors have purified a lipase which they believe is responsible for VSG release. This enzyme, designated VSG lipase, is assayed by measuring release of butanol-soluble /sup 3/H from VSG labeled with (/sup 3/H)myristate. The purification involves detergent extraction of trypanosome membranes, ammonium sulfate fractionation, hydrophobic chromatography, and cation exchange chromatography. The enzyme is purified roughly 2500 fold and is nearly homogeneous. Based on SDS-PAGE, it has an apparent subunit molecular weight of 37,000 daltons. This polypeptide co-fractionates with the activity during several fractionation procedures. The enzyme has an apparent s/sub 20,w/ of 3.8 S. The purified VSG lipase is active in the presence of EDTA; its activity is inhibited by organomercurials and stimulated by dithiothreitol. The purified enzyme releases dimyristylglycerol from VSG.

  2. Two distinct cytokinesis pathways drive trypanosome cell division initiation from opposite cell ends

    PubMed Central

    Zhou, Qing; Gu, Jianhua; Lun, Zhao-Rong; Ayala, Francisco J.; Li, Ziyin

    2016-01-01

    Cytokinesis in Trypanosoma brucei, an early branching protozoan, occurs along its longitudinal axis uni-directionally from the anterior tip of the new flagellum attachment zone filament toward the cell’s posterior end. However, the underlying mechanisms remain elusive. Here we report that cytokinesis in T. brucei is regulated by a concerted action of Polo-like kinase, Aurora B kinase, and a trypanosome-specific protein CIF1. Phosphorylation of CIF1 by Polo-like kinase targets it to the anterior tip of the new flagellum attachment zone filament, where it subsequently recruits Aurora B kinase to initiate cytokinesis. Consistent with its role, CIF1 depletion inhibits cytokinesis initiation from the anterior end of the cell, but, surprisingly, triggers cytokinesis initiation from the posterior end of the cell, suggesting the activation of an alternative cytokinesis from the opposite cell end. Our results reveal the mechanistic roles of CIF1 and Polo-like kinase in cytokinesis initiation and elucidate the mechanism underlying the recruitment of Aurora B kinase to the cytokinesis initiation site at late anaphase. These findings also delineate a signaling cascade controlling cytokinesis initiation from the anterior end of the cell and uncover a backup cytokinesis that is initiated from the posterior end of the cell when the typical anterior-to-posterior cytokinesis is compromised. PMID:26929336

  3. Molecular demonstration of Trypanosoma evansi and Trypanosoma lewisi DNA in wild rodents from Cambodia, Lao PDR and Thailand.

    PubMed

    Milocco, C; Kamyingkird, K; Desquesnes, M; Jittapalapong, S; Herbreteau, V; Chaval, Y; Douangboupha, B; Morand, S

    2013-02-01

    In this study, we investigated the molecular evidence of Trypanosoma evansi in wild rodents from Cambodia, Lao PDR and Thailand. Between November 2007 and June 2009, 1664 rodents were trapped at eight sites representative of various ecological habitats. Of those animals, 94 were tested by direct microscopic blood examination, 633 using the Card Agglutination Test for Trypanosomes (CATT/T. evansi) and 145 by Polymerase Chain Reaction (PCR) with two sets of primers: TRYP1 (amplifying ITS1 of ribosomal DNA of all trypanosomes) and TBR (amplifying satellite genomic DNA of Trypanozoon parasites). Using TRYP1, based on the size of the PCR products, 15 samples from the three countries were positive for Trypanosoma lewisi (two were confirmed by sequencing), and three were positive for Trypanozoon (one was confirmed by sequencing and three by TBR primers); the specificity of the primers failed as rodent DNA was amplified in some cases. Using TBR, six samples were positive for Trypanozoon (one was confirmed by sequencing); as T. evansi is the only species of the Trypanozoon sub-genus possibly present in Asian rodents, these results confirmed its presence in rodents from Thailand (Rattus tanezumi) and Cambodia (R. tanezumi, Niviventer fulvescens & Maxomys surifer). Further investigations are necessary to establish the situation in Lao PDR. None of the 16 samples most strongly positive to the CATT proved to be positive for Trypanozoon by PCR. The merits of the CATT for such studies were not confirmed. Studying the urban and rural circulation of these parasites in rodents will enable an evaluation of human exposure and infection risk, as human infections by T. evansi were recently described in India and by T. lewisi in India and Thailand. As sequencing PCR products is expensive, the development of new molecular and serological tools for rodents would be very useful.

  4. Activity of Bisnaphthalimidopropyl Derivatives against Trypanosoma brucei

    PubMed Central

    Graça, Nuno A. G.; Gaspar, Luis; Costa, David M.; Loureiro, Inês; Thoo-Lin, Paul Kong; Ramos, Isbaal; Roura, Meritxell; Pruvost, Alain; Pemberton, Ian K.; Loukil, Hadjer; MacDougall, Jane

    2016-01-01

    Current treatments for African trypanosomiasis are either toxic, costly, difficult to administer, or prone to elicit resistance. This study evaluated the activity of bisnaphthalimidopropyl (BNIP) derivatives against Trypanosoma brucei. BNIPDiaminobutane (BNIPDabut), the most active of these compounds, showed in vitro inhibition in the single-unit nanomolar range, similar to the activity in the reference drug pentamidine, and presented low toxicity and adequate metabolic stability. Additionally, using a murine model of acute infection and live imaging, a significant decrease in parasite load in BNIPDabut-treated mice was observed. However, cure was not achieved. BNIPDabut constitutes a new scaffold for antitrypanosomal drugs that deserves further consideration. PMID:26787703

  5. T-cell responses to the trypanosome variant surface glycoprotein are not limited to hypervariable subregions.

    PubMed

    Dagenais, Taylor R; Demick, Karen P; Bangs, James D; Forest, Katrina T; Paulnock, Donna M; Mansfield, John M

    2009-01-01

    Variable subregions within the variant surface glycoprotein (VSG) coat displayed by African trypanosomes are predicted sites for T- and B-cell recognition. Hypervariable subregion 1 (HV-1) is localized to an internal amphipathic alpha helix in VSG monomers and may have evolved due to selective pressure by host T-cell responses to epitopes within this subregion. The prediction of T-cell receptor-reactive sites and major histocompatibility complex class II binding motifs within the HV-1 subregion, coupled with the conservation of amino acid residues in other regions of the molecule sufficient to maintain secondary and tertiary VSG structure, prompted us to test the hypothesis that Th cells may preferentially recognize HV-1 subregion peptides. Thus, we examined the fine specificity of VSG-specific T-cell lines, T-cell hybridomas, and Th cells activated during infection. Our results demonstrate that T-cell epitopes are distributed throughout the N-terminal domain of VSG but are not clustered exclusively within HV-1 or other hypervariable subregions. In contrast, T-cell-reactive sites were not detected within the relatively conserved C-terminal domain of VSG. Overall, this study is the first to dissect the fine specificity of T-cell responses to the trypanosome VSG and suggests that evolution of a conserved HV-1 region may be unrelated to selective pressures exerted by host T-cell responses. This study also demonstrates that T cells do not recognize the relatively invariant C-terminal region of the VSG molecule during infection, suggesting that it could serve as a potential subunit vaccine to provide variant cross-specific immunity for African trypanosomiasis.

  6. Investigating RNA editing factors from trypanosome mitochondria

    PubMed Central

    Aphasizheva, Inna; Zhang, Liye; Aphasizhev, Ruslan

    2016-01-01

    Mitochondrial U-insertion/deletion mRNA editing is carried out by two principal multiprotein assemblies, enzymatic RNA editing core (RECC) and RNA editing substrate binding (RESC) complexes, and a plethora of auxiliary factors. An integral part of mitochondrial gene expression, editing receives inputs from primary mRNA and gRNA precursor processing pathways, and generates substrates for mRNA polyadenylation and translation. Although nearly all RECC-embedded enzymes have been implicated in specific editing reactions, the majority of proteins that populate the RESC are also essential for generating edited mRNAs. However, lack of recognizable motifs in RESC subunits limits the prowess of bioinformatics in guiding biochemical experiments and elucidating their specific biological functions. In this chapter, we describe a generic workflow for investigating mitochondrial mRNA editing in Trypanosoma brucei and focus on several methods that proved instrumental is assigning definitive functions to editing factors lacking known signature sequences. PMID:27020893

  7. Glycosylphosphatidylinositol-dependent secretory transport in Trypanosoma brucei.

    PubMed Central

    McDowell, M A; Ransom, D M; Bangs, J D

    1998-01-01

    We have investigated the role of glycosylphosphatidylinositol (GPI) anchors in forward secretory trafficking using African trypanosomes as a model system. Soluble GPI-minus forms of variant surface glycoprotein (VSG), in which the C-terminal GPI-addition peptide signal is deleted, are secreted from transformed procyclic trypanosomes with 5-fold reduced kinetics, relative to matched GPI-anchored constructs. Cell fractionation and immunofluorescence localization studies indicate that the GPI-minus VSG reporters accumulate in the endoplasmic reticulum (ER). This transport defect is specific, since overexpression of GPI-minus VSG has no effect on the rate of transport of a second soluble secretory reporter (BiPN) when co-expressed in the same cells. Two results suggest that delayed forward transport cannot be accounted for by failure to fold/assemble in the absence of a GPI anchor, thereby leading to prolonged association with ER quality-control machinery. First, no evidence was found for elevated association of GPI-minus VSG with the ER molecular chaperone, BiP. Secondly, newly synthesized GPI-minus VSG is dimerized efficiently, as judged by velocity-sedimentation analysis. GPI-dependent transport is not confined to the VSG reporters, because a similar dependence is found with another trypanosomal GPI-anchored protein, trans-sialidase. These findings suggest that GPI structures act in a positive manner to mediate efficient forward transport of some, and perhaps all, GPI-anchored proteins in the early secretory pathway of trypanosomes. Possible mechanisms for GPI-dependent transport are discussed with respect to current models of vesicular trafficking. PMID:9794811

  8. Drug resistance in human African trypanosomiasis.

    PubMed

    Barrett, Michael P; Vincent, Isabel M; Burchmore, Richard J S; Kazibwe, Anne J N; Matovu, Enock

    2011-09-01

    Human African trypanosomiasis or 'sleeping sickness' is a neglected tropical disease caused by the parasite Trypanosoma brucei. A decade of intense international cooperation has brought the incidence to fewer than 10,000 reported cases per annum with anti-trypanosomal drugs, particularly against stage 2 disease where the CNS is involved, being central to control. Treatment failures with melarsoprol started to appear in the 1990s and their incidence has risen sharply in many foci. Loss of plasma membrane transporters involved in drug uptake, particularly the P2 aminopurine transporter and also a transporter termed the high affinity pentamidine transporter, relate to melarsoprol resistance selected in the laboratory. The same two transporters are also responsible for the uptake of the stage 1 drug pentamidine and, to varying extents, other diamidines. However, reports of treatment failures with pentamidine have been rare from the field. Eflornithine (difluoromethylornithine) has replaced melarsoprol as first-line treatment in many regions. However, a need for protracted and complicated drug dosing regimens slowed widespread implementation of eflornithine monotherapy. A combination of eflornithine with nifurtimox substantially decreases the required dose and duration of eflornithine administration and this nifurtimox-eflornithine combination therapy has enjoyed rapid implementation. Unfortunately, selection of resistance to eflornithine in the laboratory is relatively easy (through loss of an amino acid transporter believed to be involved in its uptake), as is selection of resistance to nifurtimox. The first anecdotal reports of treatment failures with eflornithine monotherapy are emerging from some foci. The possibility that parasites resistant to melarsoprol on the one hand, and eflornithine on the other, are present in the field indicates that genes capable of conferring drug resistance to both drugs are in circulation. If new drugs, that act in ways that will not

  9. Modelling trypanosome chronicity: VSG dynasties and parasite density.

    PubMed

    MacGregor, Paula; Matthews, Keith R

    2008-01-01

    A new mathematical model developed by Lythgoe et al. shows that the semi-predictable order of trypanosome antigenic variation can be generated by two parasite-intrinsic factors. The first is the different probabilities of antigen-gene activation that result from the different molecular mechanisms by which the genes become expressed. The second is the density-dependent differentiation of slender to stumpy cells. The study has important implications for understanding the dynamics of antigenic variation and for modelling the consequences of therapeutic strategies directed against trypanosomes.

  10. Development of a mathematical model for mechanical transmission of trypanosomes and other pathogens of cattle transmitted by tabanids.

    PubMed

    Desquesnes, Marc; Biteau-Coroller, Fabienne; Bouyer, Jérémy; Dia, Mamadou Lamine; Foil, Lane

    2009-02-01

    Mechanical transmission of pathogens by biting insects is a non-specific phenomenon in which pathogens are transmitted from the blood of an infected host to another host during interrupted feeding of the insects. A large range of pathogens can be mechanically transmitted, e.g. hemoparasites, bacteria and viruses. Some pathogens are almost exclusively mechanically transmitted, while others are also cyclically transmitted. For agents transmitted both cyclically and mechanically (mixed transmission), such as certain African pathogenic trypanosomes, the relative impact of mechanical versus cyclical transmission is essentially unknown. We have developed a mathematical model of pathogen transmission by a defined insect population to evaluate the importance of mechanical transmission. Based on a series of experiments aimed at demonstrating mechanical transmission of African trypanosomes by tabanids, the main parameters of the model were either quantified (host parasitaemia, mean individual insect burden, initial prevalence of infection) or estimated (unknown parameters). This model allows us to simulate the evolution of pathogen prevalence under various predictive circumstances, including control measures and could be used to assess the risk of mechanical transmission under field conditions. If adjustments of parameters are provided, this model could be generalized to other pathogenic agents present in the blood of their hosts (Bovine Leukemia virus, Anaplasma, etc.) or other biting insects such as biting muscids (stomoxyines) and hippoboscids.

  11. Platelet-aggregating activity of released factor(s) from Trypanosoma brucei brucei.

    PubMed

    Nwagwu, M; Inyang, A L; Molokwu, R I; Essien, E M

    1989-12-01

    The effect of factors derived from Trypanosoma brucei brucei on rat platelets was studied. T. brucei at a concentration of 4 X 10(9) trypanosomes/ml phosphate saline glucose (PSG) was stored at -20 degrees C for 18 h, thawed, and a supernatant fraction, trypanosome-derived supernatant (TDS) was obtained by spinning the sample at 3000 g for 10 min at 20 degrees C. Normal rat platelets, prepared as platelet-rich plasma (PRP), were then incubated with TDS in the absence or presence of ADP (0.05-0.1 microM). The results showed that approximately 83% platelet aggregation was induced by addition of TDS (50 microliters; 113 micrograms protein) to 100 microliters PRP with a platelet count of 10(6). simultaneous addition of ADP and TDS to PRP produced a synergistic effect. It was also shown that a supernatant fraction, obtained by incubating live T. brucei (4 X 10(9)/microliters PSG) at 0 degrees C 1 h and spinning down the trypanosomes (3000 g for 10 min), also induced platelet aggregation. The nature of the factor(s) derived from, or released by, T. brucei inducing platelet aggregation is being investigated but it has been shown not to be ADP.

  12. Mitochondrial protein import - Functional analysis of the highly diverged Tom22 orthologue of Trypanosoma brucei

    PubMed Central

    Mani, Jan; Rout, Samuel; Desy, Silvia; Schneider, André

    2017-01-01

    The β-barrel protein Tom40 and the α-helically anchored membrane protein Tom22 are the only universally conserved subunits of the protein translocase of the mitochondrial outer membrane (TOM). Tom22 has an N-terminal cytosolic and a C-terminal intermembrane space domain. It occurs in two variants: one typified by the yeast protein which has a cytosolic domain containing a cluster of acidic residues, and a shorter variant typified by the plant protein that lacks this domain. Yeast-type Tom22 functions as a secondary protein import receptor and is also required for the stability of the TOM complex. Much less is known about the more widespread short variant of Tom22, which is also found in the parasitic protozoan Trypanosoma brucei. Here we show that the intermembrane space domain of trypanosomal Tom22 binds mitochondrial precursor proteins and that it is essential for normal growth and mitochondrial protein import. Moreover, complementation experiments indicate that the intermembrane space domain cannot be replaced by the corresponding regions of the yeast or plant Tom22 orthologues. Lack or replacement of the short cytosolic domain, however, does not interfere with protein function. Finally, we show that only the membrane-spanning domain of trypanosomal Tom22 is essential for assembly of the trypanosomal TOM complex analogue. PMID:28094338

  13. Suppression by Trypanosoma brucei of anaphylaxis-mediated ion transport in the small intestine of rats.

    PubMed Central

    Gould, S S; Castro, G A

    1994-01-01

    The hypothesis that failure of hosts infected with Trypanosoma brucei to express type 1 hypersensitivity is related to this parasite's ability to down-regulate IgE production, and not to an innate lack of allergenicity of T. brucei antigens, was tested by studying anaphylaxis-induced changes in net epithelial ion transport in rats. Transport changes were quantified electrophysiologically in vitro, as a change in transmural short-circuit current when sensitized intestine was challenged with homologous antigen. Rats injected parenterally with trypanosome antigen elicited intestinal anaphylaxis in response to antigenic challenge, whereas the intestine of rats infected with T. brucei failed to respond. Infection with T. brucei also suppressed the anaphylactic response in rats sensitized to and challenged with ovalbumin and T. spiralis-derived antigens. In these cases suppression was related to the ability of T. brucei to block production of IgE, and not to the physiological failure of the epithelial response. However, in rats sensitized by infection with T. spiralis, neither the anaphylactic response nor IgE production were inhibited by T. brucei. Furthermore, intestinal mastocytosis normally associated with trichinosis was unaffected by the trypanosome infection. Results support the conclusion that the failure to express anaphylaxis in T. brucei-infected rats is due to the inhibition of IgE production and not to the lack of allergenicity of trypanosome antigens. PMID:8206518

  14. Structure of the C-terminal Domain of Transcription Facto IIB from Trypanosoma brucei

    SciTech Connect

    Ibrahim, B.; Kanneganti, N; Rieckhof, G; Das, A; Laurents, D; Palenchar, J; Bellofatto, V; Wah, D

    2009-01-01

    In trypanosomes, the production of mRNA relies on the synthesis of the spliced leader (SL) RNA. Expression of the SL RNA is initiated at the only known RNA polymerase II promoter in these parasites. In the pathogenic trypanosome, Trypanosoma brucei, transcription factor IIB (tTFIIB) is essential for SL RNA gene transcription and cell viability, but has a highly divergent primary sequence in comparison to TFIIB in well-studied eukaryotes. Here we describe the 2.3 A resolution structure of the C-terminal domain of tTFIIB (tTFIIBC). The tTFIIBC structure consists of 2 closely packed helical modules followed by a C-terminal extension of 32 aa. Using the structure as a guide, alanine substitutions of basic residues in regions analogous to functionally important regions of the well-studied eukaryotic TFIIB support conservation of a general mechanism of TFIIB function in eukaryotes. Strikingly, tTFIIBC contains additional loops and helices, and, in contrast to the highly basic DNA binding surface of human TFIIB, contains a neutral surface in the corresponding region. These attributes probably mediate trypanosome-specific interactions and have implications for the apparent bidirectional transcription by RNA polymerase II in protein-encoding gene expression in these organisms.

  15. Polypeptide profiles of South Indian isolate of Trypanosoma evansi.

    PubMed

    Sivajothi, S; Rayulu, V C; Bhaskar Reddy, B V; Malakondaiah, P; Sreenivasulu, D; Sudhakara Reddy, B

    2016-09-01

    The field isolates of Trypanosoma evansi was collected from the infected cattle and it was propagated in rats. Trypanosoma evansi parasites were separated from the blood of infected rats by using diethylaminoethyl cellulose column chromatography. Whole cell lysate antigen (WCL) was prepared from purified trypanosomes by ultrasonication and centrifugation. The prepared WCL antigen was further purified by 50 % ammonium sulphate precipitation. Protein concentration of WCL antigen of T. evansi was 60 mg/ml. Protein concentration was adjusted to 1.0 mg/ml in PBS, pH 8.0 and stored at -20(0) C.   Polypeptide profiles of WCL antigen of T. evansi was determined by sodium dodecyl sulphate polyacrylamide gel electrophoresis. A total of eight polypeptide bands of the size ranging from 25 to 85 kDa in WCL antigen of T. evansi were obtained. Five prominent bands with molecular weight of 74, 60, 53, 42 and 37 kDa and three light bands with molecular weight of 85, 34 and 25 kDa were observed.

  16. Infestation of Mauritia flexuosa palms by triatomines (Hemiptera: Reduviidae), vectors of Trypanosoma cruzi and Trypanosoma rangeli in the Brazilian savanna.

    PubMed

    Gurgel-Gonçalves, Rodrigo; Cura, Carolina; Schijman, Alejandro G; Cuba, César A Cuba

    2012-02-01

    To determine the infestation and trypanosome infection of triatomines captured in Mauritia flexuosa palm trees across its geographic distribution in the Brazilian savanna (Cerrado), we sampled 42 localities in eight states and in the Federal District, Brazil, between July 2005 and January 2010. Overall, 2154 specimens of the species Rhodnius neglectus, Psammolestes tertius, Triatoma sordida, and Microtriatoma borbai, were collected. Among the 341 palms sampled, 182 (53.3%) were infested with R. neglectus, which resulted in the capture of 1639 specimens (9.0 insects per infested palm). P. tertius occurred in 26 palms (8%), which resulted in the capture of 484 specimens (19 insects per infested palm). T. sordida (n=30) and M. borbai (n=1) occurred in only one location. From 537 R. neglectus examined, 44 were infected (8%) with Trypanosoma rangeli and/or Trypanosoma cruzi (Tc Id). M. flexuosa was previously recognized as a suitable breeding ecotope for R. neglectus in the Brazilian states of Minas Gerais, Goiás, Tocantins and the Federal District. Our results expand this distribution to other states (São Paulo, Bahia, Mato Grosso, Maranhão and Piauí), and also show that this particular palm tree harbors other triatomine species. Finally, we show that R. neglectus plays an important role in maintaining the enzootic circulation of T. cruzi and T. rangeli in the Brazilian savanna.

  17. Discovery and Verification of Osteopontin and Beta-2-microglobulin as Promising Markers for Staging Human African Trypanosomiasis*

    PubMed Central

    Tiberti, Natalia; Hainard, Alexandre; Lejon, Veerle; Robin, Xavier; Ngoyi, Dieudonné Mumba; Turck, Natacha; Matovu, Enock; Enyaru, John; Ndung'u, Joseph Mathu; Scherl, Alexander; Dayon, Loïc; Sanchez, Jean-Charles

    2010-01-01

    Human African trypanosomiasis, or sleeping sickness, is a parasitic disease endemic in sub-Saharan Africa, transmitted to humans through the bite of a tsetse fly. The first or hemolymphatic stage of the disease is associated with presence of parasites in the bloodstream, lymphatic system, and body tissues. If patients are left untreated, parasites cross the blood-brain barrier and invade the cerebrospinal fluid and the brain parenchyma, giving rise to the second or meningoencephalitic stage. Stage determination is a crucial step in guiding the choice of treatment, as drugs used for S2 are potentially dangerous. Current staging methods, based on counting white blood cells and demonstrating trypanosomes in cerebrospinal fluid, lack specificity and/or sensitivity. In the present study, we used several proteomic strategies to discover new markers with potential for staging human African trypanosomiasis. Cerebrospinal fluid (CSF) samples were collected from patients infected with Trypanosoma brucei gambiense in the Democratic Republic of Congo. The stage was determined following the guidelines of the national control program. The proteome of the samples was analyzed by two-dimensional gel electrophoresis (n = 9), and by sixplex tandem mass tag (TMT) isobaric labeling (n = 6) quantitative mass spectrometry. Overall, 73 proteins were overexpressed in patients presenting the second stage of the disease. Two of these, osteopontin and β-2-microglobulin, were confirmed to be potential markers for staging human African trypanosomiasis (HAT) by Western blot and ELISA. The two proteins significantly discriminated between S1 and S2 patients with high sensitivity (68% and 78%, respectively) for 100% specificity, and a combination of both improved the sensitivity to 91%. The levels of osteopontin and β-2-microglobulin in CSF of S2 patients (μg/ml range), as well as the fold increased concentration in S2 compared with S1 (3.8 and 5.5 respectively) make the two markers good

  18. Cohesin regulates VSG monoallelic expression in trypanosomes.

    PubMed

    Landeira, David; Bart, Jean-Mathieu; Van Tyne, Daria; Navarro, Miguel

    2009-07-27

    Antigenic variation allows Trypanosoma brucei to evade the host immune response by switching the expression of 1 out of approximately 15 telomeric variant surface glycoprotein (VSG) expression sites (ESs). VSG ES transcription is mediated by RNA polymerase I in a discrete nuclear site named the ES body (ESB). However, nothing is known about how the monoallelic VSG ES transcriptional state is maintained over generations. In this study, we show that during S and G2 phases and early mitosis, the active VSG ES locus remains associated with the single ESB and exhibits a delay in the separation of sister chromatids relative to control loci. This delay is dependent on the cohesin complex, as partial knockdown of cohesin subunits resulted in premature separation of sister chromatids of the active VSG ES. Cohesin depletion also prompted transcriptional switching from the active to previously inactive VSG ESs. Thus, in addition to maintaining sister chromatid cohesion during mitosis, the cohesin complex plays an essential role in the correct epigenetic inheritance of the active transcriptional VSG ES state.

  19. Optical trapping reveals propulsion forces, power generation and motility efficiency of the unicellular parasites Trypanosoma brucei brucei.

    PubMed

    Stellamanns, Eric; Uppaluri, Sravanti; Hochstetter, Axel; Heddergott, Niko; Engstler, Markus; Pfohl, Thomas

    2014-10-01

    Unicellular parasites have developed sophisticated swimming mechanisms to survive in a wide range of environments. Cell motility of African trypanosomes, parasites responsible for fatal illness in humans and animals, is crucial both in the insect vector and the mammalian host. Using millisecond-scale imaging in a microfluidics platform along with a custom made optical trap, we are able to confine single cells to study trypanosome motility. From the trapping characteristics of the cells, we determine the propulsion force generated by cells with a single flagellum as well as of dividing trypanosomes with two fully developed flagella. Estimates of the dissipative energy and the power generation of single cells obtained from the motility patterns of the trypanosomes within the optical trap indicate that specific motility characteristics, in addition to locomotion, may be required for antibody clearance. Introducing a steerable second optical trap we could further measure the force, which is generated at the flagellar tip. Differences in the cellular structure of the trypanosomes are correlated with the trapping and motility characteristics and in consequence with their propulsion force, dissipative energy and power generation.

  20. Trypanosoma brucei CYP51: Essentiality and Targeting Therapy in an Experimental Model

    PubMed Central

    Dauchy, Frédéric-Antoine; Bonhivers, Mélanie; Landrein, Nicolas; Dacheux, Denis; Courtois, Pierrette; Lauruol, Florian; Daulouède, Sylvie

    2016-01-01

    Trypanosoma brucei gambiense is the main causative agent of Human African Trypanosomiasis (HAT), also known as sleeping sickness. Because of limited alternatives and treatment toxicities, new therapeutic options are urgently needed for patients with HAT. Sterol 14alpha-demethylase (CYP51) is a potential drug target but its essentiality has not been determined in T. brucei. We used a tetracycline-inducible RNAi system to assess the essentiality of CYP51 in T. brucei bloodstream form (BSF) cells and we evaluated the effect of posaconazole, a well-tolerated triazole drug, within a panel of virulent strains in vitro and in a murine model. Expression of CYP51 in several T. brucei cell lines was demonstrated by western blot and its essentiality was demonstrated by RNA interference (CYP51RNAi) in vitro. Following reduction of TbCYP51 expression by RNAi, cell growth was reduced and eventually stopped compared to WT or non-induced cells, showing the requirement of CYP51 in T. brucei. These phenotypes were rescued by addition of ergosterol. Additionally, CYP51RNAi induction caused morphological defects with multiflagellated cells (p<0.05), suggesting cytokinesis dysfunction. The survival of CYP51RNAi Doxycycline-treated mice (p = 0.053) and of CYP51RNAi 5-day pre-induced Doxycycline-treated mice (p = 0.008) were improved compared to WT showing a CYP51 RNAi effect on trypanosomal virulence in mice. The posaconazole concentrations that inhibited parasite growth by 50% (IC50) were 8.5, 2.7, 1.6 and 0.12 μM for T. b. brucei 427 90–13, T. b. brucei Antat 1.1, T. b. gambiense Feo (Feo/ITMAP/1893) and T. b. gambiense Biyamina (MHOM/SD/82), respectively. During infection with these last three virulent strains, posaconazole-eflornithine and nifurtimox-eflornithine combinations showed similar improvement in mice survival (p≤0.001). Our results provide support for a CYP51 targeting based treatment in HAT. Thus posaconazole used in combination may represent a therapeutic

  1. Structure of a glycosylphosphatidylinositol-anchored domain from a trypanosome variant surface glycoprotein.

    PubMed

    Jones, Nicola G; Nietlispach, Daniel; Sharma, Reuben; Burke, David F; Eyres, Isobel; Mues, Marsilius; Mott, Helen R; Carrington, Mark

    2008-02-08

    The cell surface of African trypanosomes is covered by a densely packed monolayer of a single protein, the variant surface glycoprotein (VSG). The VSG protects the trypanosome cell surface from effector molecules of the host immune system and is the mediator of antigenic variation. The sequence divergence between VSGs that is necessary for antigenic variation can only occur within the constraints imposed by the structural features necessary to form the monolayer barrier. Here, the structures of the two domains that together comprise the C-terminal di-domain of VSG ILTat1.24 have been determined. The first domain has a structure similar to the single C-terminal domain of VSG MITat1.2 and provides proof of structural conservation in VSG C-terminal domains complementing the conservation of structure present in the N-terminal domain. The second domain, although based on the same fold, is a minimized version missing several structural features. The structure of the second domain contains the C-terminal residue that in the native VSG is attached to a glycosylphosphatidylinositol (GPI) anchor that retains the VSG on the external face of the plasma membrane. The solution structures of this domain and a VSG GPI glycan have been combined to produce the first structure-based model of a GPI-anchored protein. The model suggests that the core glycan of the GPI anchor lies in a groove on the surface of the domain and that there is a close association between the GPI glycan and protein. More widely, the GPI glycan may be an integral part of the structure of other GPI-anchored proteins.

  2. Identification and detection of Trypanosoma cruzi by using a DNA amplification fingerprint obtained from the ribosomal intergenic spacer.

    PubMed Central

    González, N; Galindo, I; Guevara, P; Novak, E; Scorza, J V; Añez, N; Da Silveira, J F; Ramírez, J L

    1994-01-01

    We designed a PCR assay targeted on repeated elements of the ribosomal intergenic spacer which produces highly polymorphic DNA band patterns for different strains of Trypanosoma cruzi. By labeling the PCR products with digoxigenin and by chemiluminescence detection, we improved the assay sensitivity by three orders of magnitude to get T. cruzi strain fingerprints in feces of the trypanosome-infected triatomine bug vector. We also developed a capture assay for the digoxigenin-labeled PCR products that allowed us to detect T. cruzi in triatomine bug vector feces and in human serum samples with a solid support. Images PMID:8126172

  3. Drug-resistant Trypanosoma congolense in naturally infected donkeys in north Omo Zone, southern Ethiopia.

    PubMed

    Assefa, E; Abebe, G

    2001-08-31

    A three-part study was conducted to determine the efficacy of isometamidium chloride in donkey populations naturally infected with trypanosomes in north Omo Zone, southern Ethiopia. In the first, 373 randomly selected donkeys from four villages were examined for trypanosome infections by the dark ground/phase contrast buffy coat technique (BCT) in November 1999. The trypanosome prevalence was 18.2% (95% confidence interval (CI): 14.4, 22.5) and Trypanosoma congolense was the most common species accounting for 66.2% of the overall infections. In the second part, 40 infected donkeys were selected and treated with a prophylactic dose of 1.0mg/kg of isometamidium chloride and thereafter monitored every 14 days for 90 days. Trypanosomes were detected in eight donkeys within 1 month and in 20 donkeys within 2 months of treatment. About 16% (5/32) of donkeys infected with T. congolense were detected parasitemic 1 month after treatment. In addition, the result also revealed that all relapse/breakthrough infections were due to T. congolense. In the third part of this study mice were infected with two T. congolense field isolates from donkeys that were found to be parasitemic within 1 or 2 months after isometamidium treatment. The mice were treated with ranges of doses of isometamidium chloride or diminazene aceturate and thereafter followed for relapse infection. Isometamidium chloride at doses 0.5-4 mg/kg body weight and diminazene aceturate at doses of 3.5-28 mg/kg body weight failed completely to cure T. congolense infections in any of the mice.

  4. The Dermis as a Delivery Site of Trypanosoma brucei for Tsetse Flies

    PubMed Central

    Caljon, Guy; Van Reet, Nick; De Trez, Carl; Vermeersch, Marjorie; Pérez-Morga, David; Van Den Abbeele, Jan

    2016-01-01

    Tsetse flies are the sole vectors of Trypanosoma brucei parasites that cause sleeping sickness. Our knowledge on the early interface between the infective metacyclic forms and the mammalian host skin is currently highly limited. Glossina morsitans flies infected with fluorescently tagged T. brucei parasites were used in this study to initiate natural infections in mice. Metacyclic trypanosomes were found to be highly infectious through the intradermal route in sharp contrast with blood stream form trypanosomes. Parasite emigration from the dermal inoculation site resulted in detectable parasite levels in the draining lymph nodes within 18 hours and in the peripheral blood within 42 h. A subset of parasites remained and actively proliferated in the dermis. By initiating mixed infections with differentially labeled parasites, dermal parasites were unequivocally shown to arise from the initial inoculum and not from a re-invasion from the blood circulation. Scanning electron microscopy demonstrated intricate interactions of these skin-residing parasites with adipocytes in the connective tissue, entanglement by reticular fibers of the periadipocytic baskets and embedment between collagen bundles. Experimental transmission experiments combined with molecular parasite detection in blood fed flies provided evidence that dermal trypanosomes can be acquired from the inoculation site immediately after the initial transmission. High resolution thermographic imaging also revealed that intradermal parasite expansion induces elevated skin surface temperatures. Collectively, the dermis represents a delivery site of the highly infective metacyclic trypanosomes from which the host is systemically colonized and where a proliferative subpopulation remains that is physically constrained by intricate interactions with adipocytes and collagen fibrous structures. PMID:27441553

  5. Differential expression of midgut proteins in Trypanosoma brucei gambiense-stimulated vs. non-stimulated Glossina palpalis gambiensis flies

    PubMed Central

    Geiger, Anne; Hamidou Soumana, Illiassou; Tchicaya, Bernadette; Rofidal, Valérie; Decourcelle, Mathilde; Santoni, Véronique; Hem, Sonia

    2015-01-01

    The unicellular pathogenic protozoan Trypanosoma brucei gambiense is responsible for the chronic form of sleeping sickness. This vector-borne disease is transmitted to humans by the tsetse fly of the group Glossina palpalis, including the subspecies G. p. gambiensis, in which the parasite completes its developmental cycle. Sleeping sickness control strategies can therefore target either the human host or the fly vector. Indeed, suppression of one step in the parasite developmental cycle could abolish parasite transmission to humans, with consequences on the spreading of the disease. In order to develop this type of approach, we have identified, at the proteome level, events resulting from the tripartite interaction between the tsetse fly G. p. gambiensis, its microbiome, and the trypanosome. Proteomes were analyzed from four biological replicates of midguts from flies sampled 3 days post-feeding on either a trypanosome-infected (stimulated flies) or a non-infected (non-stimulated flies) bloodmeal. Over 500 proteins were identified in the midguts of flies from both feeding groups, 13 of which were shown to be differentially expressed in trypanosome-stimulated vs. non-stimulated flies. Functional annotation revealed that several of these proteins have important functions that could be involved in modulating the fly infection process by trypanosomes (and thus fly vector competence), including anti-oxidant and anti-apoptotic, cellular detoxifying, trypanosome agglutination, and immune stimulating or depressive effects. The results show a strong potential for diminishing or even disrupting fly vector competence, and their application holds great promise for improving the control of sleeping sickness. PMID:26029185

  6. Bloodstream form-specific up-regulation of silent vsg expression sites and procyclin in Trypanosoma brucei after inhibition of DNA synthesis or DNA damage.

    PubMed

    Sheader, Karen; te Vruchte, Daniëlle; Rudenko, Gloria

    2004-04-02

    The African trypanosome Trypanosoma brucei transcribes the active variant surface glycoprotein (VSG) gene from one of about 20 VSG expression sites (ESs). In order to study ES control, we made reporter lines with a green fluorescent protein gene inserted behind the promoter of different ESs. We attempted to disrupt the silencing machinery, and we used fluorescence-activated cell sorter analysis for the rapid and sensitive detection of ES up-regulation. We find that a range of treatments that either block nuclear DNA synthesis, like aphidicolin, or modify DNA-like cisplatin and 1-methyl-3-nitro-1-nitrosoguanidine results in up-regulation of silent ESs. Aphidicolin treatment was the most effective, with almost 80% of the cells expressing green fluorescent protein from a silent ES. All of these treatments blocked the cells in S phase. In contrast, a range of toxic chemicals had little or no effect on expression. These included berenil and pentamidine, which selectively cleave the mitochondrial kinetoplast DNA, the metabolic inhibitors suramin and difluoromethylornithine, and the mitotic inhibitor rhizoxin. Up-regulation also affected other RNA polymerase I (pol I) transcription units, as procyclin genes were also up-regulated after cells were treated with either aphidicolin or DNA-modifying agents. Strikingly, this up-regulation of silent pol I transcription units was bloodstream form-specific and was not observed in insect form T. brucei. We postulate that the redistribution of a limiting bloodstream form-specific factor involved in both silencing and DNA repair results in the derepression of normally silenced pol I transcription units after DNA damage.

  7. The diversity and expansion of the trans-sialidase gene family is a common feature in Trypanosoma cruzi clade members.

    PubMed

    Chiurillo, Miguel Angel; Cortez, Danielle R; Lima, Fábio M; Cortez, Caroline; Ramírez, José Luis; Martins, Andre G; Serrano, Myrna G; Teixeira, Marta M G; da Silveira, José Franco

    2016-01-01

    Trans-sialidase (TS) is a polymorphic protein superfamily described in members of the protozoan genus Trypanosoma. Of the eight TS groups recently described, TS group I proteins (some of which have catalytic activity) are present in the distantly related Trypanosoma brucei and Trypanosoma cruzi phylogenetic clades, whereas other TS groups have only been described in some species belonging to the T. cruzi clade. In the present study we analyzed the repertoire, distribution and phylogenetic relationships of TS genes among species of the T. cruzi clade based on sequence similarity, multiple sequence alignment and tree-reconstruction approaches using TS sequences obtained with the aid of PCR-based strategies or retrieved from genome databases. We included the following representative isolates of the T. cruzi clade from South America: T. cruzi, T. cruzi Tcbat, Trypanosoma cruzi marinkellei, Trypanosoma dionisii, Trypanosoma rangeli and Trypanosoma conorhini. The cloned sequences encoded conserved TS protein motifs Asp-box and VTVxNVxLYNR but lacked the FRIP motif (conserved in TS group I). The T. conorhini sequences were the most divergent. The hybridization patterns of TS probes with chromosomal bands confirmed the abundance of these sequences in species in the T. cruzi clade. Divergence and relationship analysis placed most of the TS sequences in the groups defined in T. cruzi. Further examination of members of TS group II, which includes T. cruzi surface glycoproteins implicated in host cell attachment and invasion, showed that sequences of T. cruzi Tcbat grouped with those of T. cruzi genotype TcI. Our analysis indicates that different members of the T. cruzi clade, with different vertebrate hosts, vectors and pathogenicity, share the extensive expansion and sequence diversification of the TS gene family. Altogether, our results are congruent with the evolutionary history of the T. cruzi clade and represent a contribution to the understanding of the molecular

  8. Proteomics of Trypanosoma evansi Infection in Rodents

    PubMed Central

    Pallavi, Rani; Chakravarthy, Harshini; Chandran, Syama; Kumar, Rajender; Gupta, Ashok Kumar; Singh, Raj Kumar; Yadav, Suresh Chandra; Tatu, Utpal

    2010-01-01

    Background Trypanosoma evansi infections, commonly called ‘surra’, cause significant economic losses to livestock industry. While this infection is mainly restricted to large animals such as camels, donkeys and equines, recent reports indicate their ability to infect humans. There are no World Animal Health Organization (WAHO) prescribed diagnostic tests or vaccines available against this disease and the available drugs show significant toxicity. There is an urgent need to develop improved methods of diagnosis and control measures for this disease. Unlike its related human parasites T. brucei and T. cruzi whose genomes have been fully sequenced T. evansi genome sequence remains unavailable and very little efforts are being made to develop improved methods of prevention, diagnosis and treatment. With a view to identify potential diagnostic markers and drug targets we have studied the clinical proteome of T. evansi infection using mass spectrometry (MS). Methodology/Principal Findings Using shot-gun proteomic approach involving nano-lc Quadrupole Time Of Flight (QTOF) mass spectrometry we have identified over 160 proteins expressed by T. evansi in mice infected with camel isolate. Homology driven searches for protein identification from MS/MS data led to most of the matches arising from related Trypanosoma species. Proteins identified belonged to various functional categories including metabolic enzymes; DNA metabolism; transcription; translation as well as cell-cell communication and signal transduction. TCA cycle enzymes were strikingly missing, possibly suggesting their low abundances. The clinical proteome revealed the presence of known and potential drug targets such as oligopeptidases, kinases, cysteine proteases and more. Conclusions/Significance Previous proteomic studies on Trypanosomal infections, including human parasites T. brucei and T. cruzi, have been carried out from lab grown cultures. For T. evansi infection this is indeed the first ever

  9. Infection rate of Trypanosoma brucei s.l., T. vivax, T. congolense "forest type", and T. simiae in small wild vertebrates in south Cameroon.

    PubMed

    Njiokou, F; Simo, G; Nkinin, S W; Laveissière, C; Herder, S

    2004-10-01

    In order to identify the infection rate of trypanosome species infecting wild animals in four localities (Bipindi, Campo, Fontem and Nditam) of southern Cameroon, 1,141 wild animals were sampled. These animals belonged to 36 species grouped in 8 orders including 407 primates, 347 artiodactyls, 264 rodents, 54 pangolins, 53 small carnivores, 11 saurians and crocodilians and 5 hyraxes. PCR using specific primers for Trypanosoma vivax, T. brucei s.l., T. congolense "forest type", and T. simiae showed that 18.7% of the animals were infected by at least one of these trypanosome species. A positive PCR result may not indicate absolutely an active infection because PCR can detect also transient infections. T. vivax (Duttonella) had the highest infection rate (9.5%) and was found in almost all the host orders studied. T. brucei s.l. mostly infected primates, rodents and some duikers (Cephalophus dorsalis and C. monticola). Trypanosomes of the subgenus Nannomonas had a lower infection rate of 5.5% (2.4% for T. simiae and 3.1% for T. congolense "forest type"). They were harboured mainly by primates, ungulates and rodents. Trypanosome infection rates were highest in Nditam (24.5%) and Bipindi (21%). T. brucei s.l. (Trypanozoon) had its maximum infection rate of 10.4% in Bipindi. The "Quantitative Buffy Coat" (QBC) and Kit for in vitro isolation techniques were used to identify 48 (6.1%) infected animals. 13 were positive using QBC, and 42 were positive by KIVI. However, PCR was negative on 16 of these infected animals, probably due to infections with other trypanosome species. This study showed that trypanosomes of the subgenera Duttonella, Nannomonas and Trypanozoon could infect small wild vertebrates as has been shown for large ungulates and carnivores. The presence of T. brucei s.l. in a large range of wild animals strengthens the hypothesis of the existence of a wild animal reservoir of T. b. gambiense in Cameroon.

  10. Functional mapping of a trypanosome centromere by chromosome fragmentation identifies a 16-kb GC-rich transcriptional “strand-switch” domain as a major feature

    PubMed Central

    Obado, Samson O.; Taylor, Martin C.; Wilkinson, Shane R.; Bromley, Elizabeth V.; Kelly, John M.

    2005-01-01

    Trypanosomatids are an ancient family that diverged from the main eukaryotic lineage early in evolution, which display several unique features of gene organization and expression. Although genome sequencing is now complete, the nature of centromeres in these and other parasitic protozoa has not been resolved. Here, we report the functional mapping of a centromere in the American trypanosome, Trypanosoma cruzi, a parasite with an unusual mechanism of genetic exchange that involves the generation of aneuploidy by nuclear hybridization. Using a telomere-associated chromosome fragmentation approach, we show that the region required for the mitotic stability of chromosome 3 encompasses a transcriptional “strand-switch” domain constituted by a 16-kb GC-rich island. The domain contains several degenerate retrotransposon-like insertions, but atypically, lacks the arrays of satellite repeats normally associated with centromeric regions. This unusual type of organization may represent a paradigm for centromeres in T. cruzi and other primitive eukaryotes. PMID:15632088

  11. How to shorten patient follow-up after treatment for Trypanosoma brucei gambiense sleeping sickness.

    PubMed

    Mumba Ngoyi, Dieudonné; Lejon, Veerle; Pyana, Pati; Boelaert, Marleen; Ilunga, Médard; Menten, Joris; Mulunda, Jean Pierre; Van Nieuwenhove, Simon; Muyembe Tamfum, Jean Jacques; Büscher, Philippe

    2010-02-01

    BACKGROUND. Clinical management of human African trypanosomiasis requires patient follow-up of 2 years' duration. At each follow-up visit, cerebrospinal fluid (CSF) is examined for trypanosomes and white blood cells (WBCs). Shortening follow-up would improve patient comfort and facilitate control of human African trypanosomiasis. METHODS. A prospective study of 360 patients was performed in the Democratic Republic of the Congo. The primary outcomes of the study were cure, relapse, and death. The WBC count, immunoglobulin M level, and specific antibody levels in CSF samples were evaluated to detect treatment failure. The sensitivity and specificity of shortened follow-up algorithms were calculated. RESULTS. The treatment failure rate was 37%. Trypanosomes, a WBC count of > or = 100 cells/microL, and a LATEX/immunoglobulin M titer of 1:16 in CSF before treatment were risk factors for treatment failure, whereas human immunodeficiency virus infection status was not a risk factor. The following algorithm, which had 97.8% specificity and 94.4% sensitivity, is proposed for shortening the duration of follow-up: at 6 months, patients with trypanosomes or a WBC count of > or = 50 cells/microL in CSF are considered to have treatment failure, whereas patients with a CSF WBC count of > or = 5 cells/microL are considered to be cured and can discontinue follow-up. At 12 months, the remaining patients (those with a WBC count of > or = 6-49 cells/microL) need a test of cure, based on trypanosome presence and WBC count, applying a cutoff value of > or = 20 cells/microL. CONCLUSION. Combining criteria for failure and cure allows follow-up of patients with second-stage human African trypanosomiasis to be shortened to a maximum duration of 12 months.

  12. Flagellar membrane fusion and protein exchange in trypanosomes; a new form of cell-cell communication?

    PubMed Central

    Imhof, Simon; Fragoso, Cristina; Hemphill, Andrew; von Schubert, Conrad; Li, Dong; Legant, Wesley; Betzig, Eric; Roditi, Isabel

    2016-01-01

    Diverse structures facilitate direct exchange of proteins between cells, including plasmadesmata in plants and tunnelling nanotubes in bacteria and higher eukaryotes.  Here we describe a new mechanism of protein transfer, flagellar membrane fusion, in the unicellular parasite Trypanosoma brucei. When fluorescently tagged trypanosomes were co-cultured, a small proportion of double-positive cells were observed. The formation of double-positive cells was dependent on the presence of extracellular calcium and was enhanced by placing cells in medium supplemented with fresh bovine serum. Time-lapse microscopy revealed that double-positive cells arose by bidirectional protein exchange in the absence of nuclear transfer.  Furthermore, super-resolution microscopy showed that this process occurred in ≤1 minute, the limit of temporal resolution in these experiments. Both cytoplasmic and membrane proteins could be transferred provided they gained access to the flagellum. Intriguingly, a component of the RNAi machinery (Argonaute) was able to move between cells, raising the possibility that small interfering RNAs are transported as cargo. Transmission electron microscopy showed that shared flagella contained two axonemes and two paraflagellar rods bounded by a single membrane. In some cases flagellar fusion was partial and interactions between cells were transient. In other cases fusion occurred along the entire length of the flagellum, was stable for several hours and might be irreversible. Fusion did not appear to be deleterious for cell function: paired cells were motile and could give rise to progeny while fused. The motile flagella of unicellular organisms are related to the sensory cilia of higher eukaryotes, raising the possibility that protein transfer between cells via cilia or flagella occurs more widely in nature. PMID:27239276

  13. PNT1 Is a C11 Cysteine Peptidase Essential for Replication of the Trypanosome Kinetoplast*

    PubMed Central

    Das, Debanu; Myburgh, Elmarie; Wilkes, Jonathan; Brown, Elaine; Lemgruber, Leandro; Gould, Matthew K.; Burchmore, Richard J.; Coombs, Graham H.; Schnaufer, Achim

    2016-01-01

    The structure of a C11 peptidase PmC11 from the gut bacterium, Parabacteroides merdae, has recently been determined, enabling the identification and characterization of a C11 orthologue, PNT1, in the parasitic protozoon Trypanosoma brucei. A phylogenetic analysis identified PmC11 orthologues in bacteria, archaea, Chromerids, Coccidia, and Kinetoplastida, the latter being the most divergent. A primary sequence alignment of PNT1 with clostripain and PmC11 revealed the position of the characteristic His-Cys catalytic dyad (His99 and Cys136), and an Asp (Asp134) in the potential S1 binding site. Immunofluorescence and cryoelectron microscopy revealed that PNT1 localizes to the kinetoplast, an organelle containing the mitochondrial genome of the parasite (kDNA), with an accumulation of the protein at or near the antipodal sites. Depletion of PNT1 by RNAi in the T. brucei bloodstream form was lethal both in in vitro culture and in vivo in mice and the induced population accumulated cells lacking a kinetoplast. In contrast, overexpression of PNT1 led to cells having mislocated kinetoplasts. RNAi depletion of PNT1 in a kDNA independent cell line resulted in kinetoplast loss but was viable, indicating that PNT1 is required exclusively for kinetoplast maintenance. Expression of a recoded wild-type PNT1 allele, but not of an active site mutant restored parasite viability after induction in vitro and in vivo confirming that the peptidase activity of PNT1 is essential for parasite survival. These data provide evidence that PNT1 is a cysteine peptidase that is required exclusively for maintenance of the trypanosome kinetoplast. PMID:26940875

  14. PNT1 is a C11 cysteine peptidase essential for replication of the Trypanosome Kinetoplast

    SciTech Connect

    Grewal, Jaspreet S.; McLuskey, Karen; Das, Debanu; Myburgh, Elmarie; Wilkes, Jonathan; Brown, Elaine; Lemgruber, Leandro; Gould, Matthew K.; Burchmore, Richard J.; Coombs, Graham H.; Schnaufer, Achim; Mottram, Jeremy C.

    2016-03-03

    The structure of a C11 peptidase PmC11 from the gut bacterium, Parabacteroides merdae, has recently been determined, enabling the identification and characterization of a C11 orthologue, PNT1, in the parasitic protozoon Trypanosoma brucei. A phylogenetic analysis identified PmC11 orthologues in bacteria, archaea, Chromerids, Coccidia, and Kinetoplastida, the latter being the most divergent. A primary sequence alignment of PNT1 with clostripain and PmC11 revealed the position of the characteristic His-Cys catalytic dyad (His99 and Cys136), and an Asp (Asp134) in the potential S1 binding site. Immunofluorescence and cryoelectron microscopy revealed that PNT1 localizes to the kinetoplast, an organelle containing the mitochondrial genome of the parasite (kDNA), with an accumulation of the protein at or near the antipodal sites. Depletion of PNT1 by RNAi in the T. brucei bloodstream form was lethal both in in vitro culture and in vivo in mice and the induced population accumulated cells lacking a kinetoplast. In contrast, overexpression of PNT1 led to cells having mislocated kinetoplasts. RNAi depletion of PNT1 in a kDNA independent cell line resulted in kinetoplast loss but was viable, indicating that PNT1 is required exclusively for kinetoplast maintenance. Expression of a recoded wild-type PNT1 allele, but not of an active site mutant restored parasite viability after induction in vitro and in vivo confirming that the peptidase activity of PNT1 is essential for parasite survival. Furthermore, these data provide evidence that PNT1 is a cysteine peptidase that is required exclusively for maintenance of the trypanosome kinetoplast.

  15. PNT1 is a C11 cysteine peptidase essential for replication of the Trypanosome Kinetoplast

    DOE PAGES

    Grewal, Jaspreet S.; McLuskey, Karen; Das, Debanu; ...

    2016-03-03

    The structure of a C11 peptidase PmC11 from the gut bacterium, Parabacteroides merdae, has recently been determined, enabling the identification and characterization of a C11 orthologue, PNT1, in the parasitic protozoon Trypanosoma brucei. A phylogenetic analysis identified PmC11 orthologues in bacteria, archaea, Chromerids, Coccidia, and Kinetoplastida, the latter being the most divergent. A primary sequence alignment of PNT1 with clostripain and PmC11 revealed the position of the characteristic His-Cys catalytic dyad (His99 and Cys136), and an Asp (Asp134) in the potential S1 binding site. Immunofluorescence and cryoelectron microscopy revealed that PNT1 localizes to the kinetoplast, an organelle containing the mitochondrialmore » genome of the parasite (kDNA), with an accumulation of the protein at or near the antipodal sites. Depletion of PNT1 by RNAi in the T. brucei bloodstream form was lethal both in in vitro culture and in vivo in mice and the induced population accumulated cells lacking a kinetoplast. In contrast, overexpression of PNT1 led to cells having mislocated kinetoplasts. RNAi depletion of PNT1 in a kDNA independent cell line resulted in kinetoplast loss but was viable, indicating that PNT1 is required exclusively for kinetoplast maintenance. Expression of a recoded wild-type PNT1 allele, but not of an active site mutant restored parasite viability after induction in vitro and in vivo confirming that the peptidase activity of PNT1 is essential for parasite survival. Furthermore, these data provide evidence that PNT1 is a cysteine peptidase that is required exclusively for maintenance of the trypanosome kinetoplast.« less

  16. Nuclear pore complex evolution: a trypanosome Mlp analogue functions in chromosomal segregation but lacks transcriptional barrier activity.

    PubMed

    Holden, Jennifer M; Koreny, Ludek; Obado, Samson; Ratushny, Alexander V; Chen, Wei-Ming; Chiang, Jung-Hsien; Kelly, Steven; Chait, Brian T; Aitchison, John D; Rout, Michael P; Field, Mark C

    2014-05-01

    The nuclear pore complex (NPC) has dual roles in nucleocytoplasmic transport and chromatin organization. In many eukaryotes the coiled-coil Mlp/Tpr proteins of the NPC nuclear basket have specific functions in interactions with chromatin and defining specialized regions of active transcription, whereas Mlp2 associates with the mitotic spindle/NPC in a cell cycle-dependent manner. We previously identified two putative Mlp-related proteins in African trypanosomes, TbNup110 and TbNup92, the latter of which associates with the spindle. We now provide evidence for independent ancestry for TbNup92/TbNup110 and Mlp/Tpr proteins. However, TbNup92 is required for correct chromosome segregation, with knockout cells exhibiting microaneuploidy and lowered fidelity of telomere segregation. Further, TbNup92 is intimately associated with the mitotic spindle and spindle anchor site but apparently has minimal roles in control of gene transcription, indicating that TbNup92 lacks major barrier activity. TbNup92 therefore acts as a functional analogue of Mlp/Tpr proteins, and, together with the lamina analogue NUP-1, represents a cohort of novel proteins operating at the nuclear periphery of trypanosomes, uncovering complex evolutionary trajectories for the NPC and nuclear lamina.

  17. Kenyan purple tea anthocyanins and coenzyme-Q10 ameliorate post treatment reactive encephalopathy associated with cerebral human African trypanosomiasis in murine model.

    PubMed

    Rashid, Khalid; Wachira, Francis N; Nyariki, James N; Isaac, Alfred O

    2014-04-01

    Human African trypanosomiasis (HAT) is a tropical disease caused by two subspecies of Trypanosoma brucei, the East African variant T. b. rhodesiense and the West African variant T. b. gambiense. Melarsoprol, an organic arsenical, is the only drug used to treat late stage T. b. rhodesiense infection. Unfortunately, this drug induces an extremely severe post treatment reactive encephalopathy (PTRE) in up to 10% of treated patients, half of whom die from this complication. A highly reproducible mouse model was adapted to assess the use of Kenyan purple tea anthocyanins and/or coenzyme-Q10 in blocking the occurrence of PTRE. Female Swiss white mice were inoculated intraperitoneally with approximately 10(4) trypanosome isolate T. b. rhodesiense KETRI 2537 and treated sub-curatively 21days post infection with 5mg/kg diminazene aceturate (DA) daily for 3days to induce severe late CNS infection that closely mirrors PTRE in human subjects. Thereafter mice were monitored for relapse of parasitemia after which they were treated with melarsoprol at a dosage of 3.6mg/kg body weight for 4days and sacrificed 24h post the last dosage to obtain brain samples. Brain sections from mice with PTRE that did not receive any antioxidant treatment showed a more marked presence of inflammatory cells, microglial activation and disruption of the brain parenchyma when compared to PTRE mice supplemented with either coenzyme-Q10, purple tea anthocyanins or a combination of the two. The mice group that was treated with coenzyme-Q10 or purple tea anthocyanins had higher levels of GSH and aconitase-1 in the brain compared to untreated groups, implying a boost in brain antioxidant capacity. Overall, coenzyme-Q10 treatment produced more beneficial effects compared to anthocyanin treatment. These findings demonstrate that therapeutic intervention with coenzyme-Q10 and/or purple tea anthocyanins can be used in an experimental mouse model to ameliorate PTRE associated with cerebral HAT.

  18. Depletion of Trypanosome CTR9 Leads to Gene Expression Defects

    PubMed Central

    Ouna, Benard A.; Nyambega, Benson; Manful, Theresa; Helbig, Claudia; Males, Matilda; Fadda, Abeer; Clayton, Christine

    2012-01-01

    The Paf complex of Opisthokonts and plants contains at least five subunits: Paf1, Cdc73, Rtf1, Ctr9, and Leo1. Mutations in, or loss of Paf complex subunits have been shown to cause defects in histone modification, mRNA polyadenylation, and transcription by RNA polymerase I and RNA polymerase II. We here investigated trypanosome CTR9, which is essential for trypanosome survival. The results of tandem affinity purification suggested that trypanosome CTR9 associates with homologues of Leo1 and Cdc73; genes encoding homologues of Rtf1 and Paf1 were not found. RNAi targeting CTR9 resulted in at least ten-fold decreases in 131 essential mRNAs: they included several that are required for gene expression and its control, such as those encoding subunits of RNA polymerases, exoribonucleases that target mRNA, RNA helicases and RNA-binding proteins. Simultaneously, some genes from regions subject to chromatin silencing were derepressed, possibly as a secondary effect of the loss of two proteins that are required for silencing, ISWI and NLP1. PMID:22532828

  19. Structural Insights into Inhibition of Sterol 14[alpha]-Demethylase in the Human Pathogen Trypanosoma cruzi

    SciTech Connect

    Lepesheva, Galina I.; Hargrove, Tatiana Y.; Anderson, Spencer; Kleshchenko, Yuliya; Furtak, Vyacheslav; Wawrzak, Zdzislaw; Villalta, Fernando; Waterman, Michael R.

    2010-09-02

    Trypanosoma cruzi causes Chagas disease (American trypanosomiasis), which threatens the lives of millions of people and remains incurable in its chronic stage. The antifungal drug posaconazole that blocks sterol biosynthesis in the parasite is the only compound entering clinical trials for the chronic form of this infection. Crystal structures of the drug target enzyme, Trypanosoma cruzi sterol 14{alpha}-demethylase (CYP51), complexed with posaconazole, another antifungal agent fluconazole and an experimental inhibitor, (R)-4{prime}-chloro-N-(1-(2,4-dichlorophenyl)-2-(1H-imid-azol-1-yl)ethyl)biphenyl-4-carboxamide (VNF), allow prediction of important chemical features that enhance the drug potencies. Combined with comparative analysis of inhibitor binding parameters, influence on the catalytic activity of the trypanosomal enzyme and its human counterpart, and their cellular effects at different stages of the Trypanosoma cruzi life cycle, the structural data provide a molecular background to CYP51 inhibition and azole resistance and enlighten the path for directed design of new, more potent and selective drugs to develop an efficient treatment for Chagas disease.

  20. Evaluating paratransgenesis as a potential control strategy for African trypanosomiasis.

    PubMed

    Medlock, Jan; Atkins, Katherine E; Thomas, David N; Aksoy, Serap; Galvani, Alison P

    2013-01-01

    Genetic-modification strategies are currently being developed to reduce the transmission of vector-borne diseases, including African trypanosomiasis. For tsetse, the vector of African trypanosomiasis, a paratransgenic strategy is being considered: this approach involves modification of the commensal symbiotic bacteria Sodalis to express trypanosome-resistance-conferring products. Modified Sodalis can then be driven into the tsetse population by cytoplasmic incompatibility (CI) from Wolbachia bacteria. To evaluate the effectiveness of this paratransgenic strategy in controlling African trypanosomiasis, we developed a three-species mathematical model of trypanosomiasis transmission among tsetse, humans, and animal reservoir hosts. Using empirical estimates of CI parameters, we found that paratransgenic tsetse have the potential to eliminate trypanosomiasis, provided that any extra mortality caused by Wolbachia colonization is low, that the paratransgene is effective at protecting against trypanosome transmission, and that the target tsetse species comprises a large majority of the tsetse population in the release location.

  1. Trypanosoma caninum n. sp. (Protozoa: Kinetoplastida) isolated from intact skin of a domestic dog ( Canis familiaris) captured in Rio de Janeiro, Brazil.

    PubMed

    Madeira, M F; Sousa, M A; Barros, J H S; Figueiredo, F B; Fagundes, A; Schubach, A; DE Paula, C C; Faissal, B N S; Fonseca, T S; Thoma, H K; Marzochi, M C A

    2009-04-01

    An unknown Trypanosoma species was isolated from an axenic culture of intact skin from a domestic dog captured in Rio de Janeiro, Brazil, which was co-infected with Leishmania (Viannia) braziliensis. Giemsa-stained smears of cultures grown in different media revealed the presence of epimastigotes, trypomastigotes, spheromastigotes, transitional stages, and dividing forms (epimastigotes or spheromastigotes). The highest frequency of trypomastigotes was observed in RPMI (15.2%) and DMEM (9.2%) media containing 5% FCS, with a mean length of these forms of 43.0 and 36.0 mum, respectively. Molecular analysis by sequential application of PCR assays indicated that this trypanosome differs from Trypanosoma cruzi and T. rangeli when specific primers were applied. On the other hand, a PCR strategy targeted to the D7 domain of 24salpha rDNA, using primers D75/D76, amplified products of about 250 bp in that isolate (stock A-27), different from the amplification products obtained with T. cruzi and T. rangeli. This organism differs from T. cruzi mainly by the size of its trypomastigote forms and kinetoplasts and the absence of infectivity for macrophages and triatomine bugs. It is also morphologically distinct from salivarian trypanosomes reported in Brazil. Isoenzyme analysis at 8 loci demonstrated a very peculiar banding pattern clearly distinct from those of T. rangeli and T. cruzi. We conclude that this isolate is a new Trypanosoma species. The name T. caninum is suggested.

  2. Predominance of Trypanosoma rangeli infection in children from a Chagas disease endemic area in the west-shore of the Panama canal.

    PubMed

    Saldaña, Azael; Samudio, Franklyn; Miranda, Aracelis; Herrera, Lissette M; Saavedra, Sara P; Cáceres, Lorenzo; Bayard, Vicente; Calzada, José E

    2005-11-01

    A total of 206 serum samples from children (3-14 years old) living in the Amador County (La Chorrera District, Province of Panama) were screened by indirect immunofluorescence antibody test (IFAT) for the presence of antibodies against Trypanosoma cruzi. Positive sera were confirmed by recombinant enzyme-linked immunosorbent assay (ELISA) and Western blot analysis. The presence of blood trypanosomes was investigated by hemoculture and subsequently identify by a duplex polymerase chain reaction (PCR) followed by dot blot hybridization. The results indicated a prevalence of 9.7% for trypanosome infections, a seroprevalence of 2.9% against T. cruzi and a predominance of T. rangeli infection (6.8%). The immunological and clinical implications of these findings are discussed.

  3. Synthesis and biological evaluation of 2,3-dihydroimidazo[1,2-a]benzimidazole derivatives against Leishmania donovani and Trypanosoma cruzi.

    PubMed

    Oh, Sangmi; Kim, Sungbum; Kong, Sunju; Yang, Gyongseon; Lee, Nakyung; Han, Dawoon; Goo, Junghyun; Siqueira-Neto, Jair L; Freitas-Junior, Lucio H; Song, Rita

    2014-09-12

    A high-throughput (HTS) and high-content screening (HCS) campaign of a commercial library identified 2,3-dihydroimidazo[1,2-a]benzimidazole analogues as a novel class of anti-parasitic agents. A series of synthetic derivatives were evaluated for their in vitro anti-leishmanial and anti-trypanosomal activities against Leishmania donovani and Trypanosoma cruzi, which have been known as the causative parasites for visceral leishmaniasis and Chagas disease, respectively. In the case of Leishmania, the compounds were tested in both intracellular amastigote and extracellular promastigote assays. Compounds 4 and 24 showed promising anti-leishmanial activity against intracellular L. donovani (3.05 and 5.29 μM, respectively) and anti-trypanosomal activity against T. cruzi (1.10 and 2.10 μM, respectively) without serious cytotoxicity toward THP-1 and U2OS cell lines.

  4. Development and evaluation of an ITS1 "Touchdown" PCR for assessment of drug efficacy against animal African trypanosomosis.

    PubMed

    Tran, Thao; Napier, Grant; Rowan, Tim; Cordel, Claudia; Labuschagne, Michel; Delespaux, Vincent; Van Reet, Nick; Erasmus, Heidi; Joubert, Annesca; Büscher, Philippe

    2014-05-28

    Animal African trypanosomoses (AAT) are caused by flagellated protozoa of the Trypanosoma genus and contribute to considerable losses in animal production in Africa, Latin America and South East Asia. Trypanosoma congolense is considered the economically most important species. Drug resistant T. congolense strains present a threat to the control of AAT and have triggered research into discovery of novel trypanocides. In vivo assessment of trypanocidal efficacy relies on monitoring of treated animals with microscopic parasite detection methods. Since these methods have poor sensitivity, follow-up for up to 100 days after treatment is recommended to increase the chance of detecting recurrent parasitaemia waves. Molecular techniques are more amendable to high throughput processing and are generally more sensitive than microscopic detection, thus bearing the potential of shortening the 100-day follow up period. The study presents a "Touchdown" PCR targeting the internal transcribed spacer 1 of the ribosomal DNA (ITS1 TD PCR) that enables detection and discrimination of different Trypanosoma taxa in a single run due to variations in PCR product sizes. The assay achieves analytical sensitivity of 10 parasites per ml of blood for detection of T. congolense savannah type and T. brucei, and 100 parasites per ml of blood for detection of T. vivax in infected mouse blood. The ITS1 TD PCR was evaluated on cattle experimentally infected with T. congolense during an investigational new veterinary trypanocide drug efficacy study. ITS1 TD PCR demonstrated comparable performance to microscopy in verifying trypanocide treatment success, in which parasite DNA became undetectable in cured animals within two days post-treatment. ITS1 TD PCR detected parasite recrudescence three days earlier than microscopy and had a higher positivity rate than microscopy (84.85% versus 57.58%) in 66 specimens of relapsing animals collected after treatments. Therefore, ITS1 TD PCR provides a useful tool

  5. Cell-cycle synchronisation of bloodstream forms of Trypanosoma brucei using Vybrant DyeCycle Violet-based sorting.

    PubMed

    Kabani, Sarah; Waterfall, Martin; Matthews, Keith R

    2010-01-01

    Studies on the cell-cycle of Trypanosoma brucei have revealed several unusual characteristics that differ from the model eukaryotic organisms. However, the inability to isolate homogenous populations of parasites in distinct cell-cycle stages has limited the analysis of trypanosome cell division and complicated the understanding of mutant phenotypes with possible impact on cell-cycle related events. Although hydroxyurea-induced cell-cycle arrest in procyclic and bloodstream forms has been applied recently with success, such block-release protocols can complicate the analysis of cell-cycle regulated events and have the potential to disrupt important cell-cycle checkpoints. An alternative approach based on flow cytometry of parasites stained with Vybrant DyeCycle Orange circumvents this problem, but is restricted to procyclic form parasites. Here, we apply Vybrant Dyecycle Violet staining coupled with flow cytometry to effectively select different cell-cycle stages of bloodstream form trypanosomes. Moreover, the sorted parasites remain viable, although synchrony is rapidly lost. This method enables cell-cycle enrichment of populations of trypanosomes in their mammal infective stage, particularly at the G1 phase.

  6. High prevalence of Trypanosoma brucei gambiense group 1 in pigs from the Fontem sleeping sickness focus in Cameroon.

    PubMed

    Simo, G; Asonganyi, T; Nkinin, S W; Njiokou, F; Herder, S

    2006-06-30

    To understand the importance of domestic pigs in the epidemiology of human trypanosomiasis, PCR was used to identify trypanosome populations in 133 pigs from the Fontem sleeping sickness focus of Cameroon. The results from this study show that 73.7% (98/133) of pigs from the Fontem area carry at least one trypanosome species. Trypanosoma vivax, T. brucei s.l. and T. congolense forest were found in 34.6% (46/133), 40.0% (53/133) and 46.0% (61/133) of the pigs respectively. T. simiae and T. congolense savannah were not identified in these animals. The use of repeated DNA sequences detected T. b. gambiense group 1 in 14.8% (15/101) of the pigs. Such pigs can be possible reservoir hosts for T. b. gambiense group 1 and contribute to the maintenance of the disease in the area. Mixed infections were revealed in 35.3% (47/133) of the pigs. Furthermore, we observed that under natural conditions, 52.4% (11/21) of the pigs from the Fontem focus carry mixed infections with T. b. gambiense group 1. No significant difference was observed between the percentage of T. b. gambiense group 1 single and mixed infections, and between the prevalence of this trypanosome in pigs from villages with and without sleeping sickness patients.

  7. Sensitivity testing of trypanosome detection by PCR from whole blood samples using manual and automated DNA extraction methods.

    PubMed

    Dunlop, J; Thompson, C K; Godfrey, S S; Thompson, R C A

    2014-11-01

    Automated extraction of DNA for testing of laboratory samples is an attractive alternative to labour-intensive manual methods when higher throughput is required. However, it is important to maintain the maximum detection sensitivity possible to reduce the occurrence of type II errors (false negatives; failure to detect the target when it is present), especially in the biomedical field, where PCR is used for diagnosis. We used blood infected with known concentrations of Trypanosoma copemani to test the impact of analysis techniques on trypanosome detection sensitivity by PCR. We compared combinations of a manual and an automated DNA extraction method and two different PCR primer sets to investigate the impact of each on detection levels. Both extraction techniques and specificity of primer sets had a significant impact on detection sensitivity. Samples extracted using the same DNA extraction technique performed substantially differently for each of the separate primer sets. Type I errors (false positives; detection of the target when it is not present), produced by contaminants, were avoided with both extraction methods. This study highlights the importance of testing laboratory techniques with known samples to optimise accuracy of test results.

  8. Are there two classes of VSG gene in Trypanosoma brucei?

    PubMed

    Young, J R; Miller, E N; Williams, R O; Turner, M J

    Antigenic variation in the African trypanosomes involves the sequential expression of genes coding for different variant surface glycoproteins (VSGs) (reviewed in refs 1-3). When expression of some VSG genes is switched on, a newly duplicated copy of the expressed gene has been observed within the trypanosome genome, which is not found after the gene's expression is switched off again. The duplicated copy has therefore been called an expression-linked copy (ELC). The expression of the gene appears to be strictly coupled to the presence of the ELC. This has led to the hypothesis that the duplicative transposition generating the ELC may itself be responsible for the control of VSG expression. With other VSG genes, expression-linked duplication has not been observed, and expression is clearly not controlled in this way. Data are presented here which demonstrate that either of these observations may be obtained with a single VSG gene, depending on the chance selection of particular clones from antigenically switched populations. Thus, the different observations do not imply the existence of two distinct classes of VSG gene controlled by different mechanisms, but different aspects of processes common to all VSG genes.

  9. A systematic review and meta-analysis of trypanosome prevalence in tsetse flies

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: The optimisation of trypanosomosis control programs warrants a good knowledge of the main vector of animal and human trypanosomes in sub-Saharan Africa, the tsetse fly. An important aspect of the tsetse fly population is its trypanosome infection prevalence, as it determines the intensit...

  10. Incidence of trypanosomes in the Canada goose as revealed by bone marrow culture

    USGS Publications Warehouse

    Diamond, L.S.; Herman, C.M.

    1954-01-01

    1. Techniques are described for the cultural isolation of trypanosomes from avian bone marrow obtained from living birds or at autopsy. A new medium SNB-9 (saline-neopeptone-blood) is described. In addition to being a good medium for growing avian trypanosomes, it is excellent for growing trypanosomes of amphibians and mammals. 2. Evidence is presented demonstrating the superiority of (a) cultures over stained smears for detecting the presence of trypanosomes in the Canada goose, and (b) bone marrow over heart blood of this species as a source of trypanosomes for culture. 3. In April 1952, from cultures of bone marrow collected at autopsy it was demonstrated that trypanosome infection occurred in 33 (40.2%) of 82 Canada geese from the Pea Island National Wildlife Refuge. On February 17, 1953, cultures of bone marrow obtained from living birds revealed presence of trypanosomes in 12 (20.7%) of 58 geese from the same refuge. On February 26, 1953, by employing the latter method, 9 (20.4%) of 44 geese from Blackwater National Wildlife Refuge were shown to harbor the parasites. In another survey ninety-two geese from seven national wildlife refuges subjected to the biopsy technique showed evidence of infection in 13 (14.1 %) birds and indicated that trypanosome infection is widely distributed in this host.

  11. Aquaporin 2 mutations in Trypanosoma brucei gambiense field isolates correlate with decreased susceptibility to pentamidine and melarsoprol.

    PubMed

    Graf, Fabrice E; Ludin, Philipp; Wenzler, Tanja; Kaiser, Marcel; Brun, Reto; Pyana, Patient Pati; Büscher, Philippe; de Koning, Harry P; Horn, David; Mäser, Pascal

    2013-01-01

    The predominant mechanism of drug resistance in African trypanosomes is decreased drug uptake due to loss-of-function mutations in the genes for the transporters that mediate drug import. The role of transporters as determinants of drug susceptibility is well documented from laboratory-selected Trypanosoma brucei mutants. But clinical isolates, especially of T. b. gambiense, are less amenable to experimental investigation since they do not readily grow in culture without prior adaptation. Here we analyze a selected panel of 16 T. brucei ssp. field isolates that (i) have been adapted to axenic in vitro cultivation and (ii) mostly stem from treatment-refractory cases. For each isolate, we quantify the sensitivity to melarsoprol, pentamidine, and diminazene, and sequence the genomic loci of the transporter genes TbAT1 and TbAQP2. The former encodes the well-characterized aminopurine permease P2 which transports several trypanocides including melarsoprol, pentamidine, and diminazene. We find that diminazene-resistant field isolates of T. b. brucei and T. b. rhodesiense carry the same set of point mutations in TbAT1 that was previously described from lab mutants. Aquaglyceroporin 2 has only recently been identified as a second transporter involved in melarsoprol/pentamidine cross-resistance. Here we describe two different kinds of TbAQP2 mutations found in T. b. gambiense field isolates: simple loss of TbAQP2, or loss of wild-type TbAQP2 allele combined with the formation of a novel type of TbAQP2/3 chimera. The identified mutant T. b. gambiense are 40- to 50-fold less sensitive to pentamidine and 3- to 5-times less sensitive to melarsoprol than the reference isolates. We thus demonstrate for the first time that rearrangements of the TbAQP2/TbAQP3 locus accompanied by TbAQP2 gene loss also occur in the field, and that the T. b. gambiense carrying such mutations correlate with a significantly reduced susceptibility to pentamidine and melarsoprol.

  12. Dual functions of α-ketoglutarate dehydrogenase E2 in the Krebs cycle and mitochondrial DNA inheritance in Trypanosoma brucei.

    PubMed

    Sykes, Steven E; Hajduk, Stephen L

    2013-01-01

    The dihydrolipoyl succinyltransferase (E2) of the multisubunit α-ketoglutarate dehydrogenase complex (α-KD) is an essential Krebs cycle enzyme commonly found in the matrices of mitochondria. African trypanosomes developmentally regulate mitochondrial carbohydrate metabolism and lack a functional Krebs cycle in the bloodstream of mammals. We found that despite the absence of a functional α-KD, bloodstream form (BF) trypanosomes express α-KDE2, which localized to the mitochondrial matrix and inner membrane. Furthermore, α-KDE2 fractionated with the mitochondrial genome, the kinetoplast DNA (kDNA), in a complex with the flagellum. A role for α-KDE2 in kDNA maintenance was revealed in α-KDE2 RNA interference (RNAi) knockdowns. Following RNAi induction, bloodstream trypanosomes showed pronounced growth reduction and often failed to equally distribute kDNA to daughter cells, resulting in accumulation of cells devoid of kDNA (dyskinetoplastic) or containing two kinetoplasts. Dyskinetoplastic trypanosomes lacked mitochondrial membrane potential and contained mitochondria of substantially reduced volume. These results indicate that α-KDE2 is bifunctional, both as a metabolic enzyme and as a mitochondrial inheritance factor necessary for the distribution of kDNA networks to daughter cells at cytokinesis.

  13. Control of human African trypanosomiasis in the Quiçama focus, Angola.

    PubMed Central

    Ruiz, José Antonio; Simarro, Pere P.; Josenando, Teofilo

    2002-01-01

    OBJECTIVE: To update the epidemiological status of human African trypanosomiasis (HAT), also known as sleeping sickness, in the Quiçama focus, province of Bengo, Angola, and to establish a HAT control programme. METHODS: In 1997, 8796 people (the population of 31 villages) were serologically screened for Trypanosoma brucei gambiense, the causative agent of HAT. In 1998 and 1999, surveys were carried out in villages where HAT cases had been identified in 1997. Individuals were screened using the card agglutination trypanosomiasis test (CATT), and then examined for the presence of the parasite. CATT- positive individuals in whom the presence of the parasite could not be confirmed were further tested with the CATT using serum dilutions, and those with a positive antibody end titre of 1-in-4 or above were followed-up. Patients with < or =10 white cells/micro l and no trypanosomes in their cerebrospinal fluid (CSF) were classified as being in the first stage of the disease. Vector control was not considered necessary or feasible. FINDINGS: The main transmission areas were on the Kwanza riverbanks, where 5042 inhabitants live. In 1997, the HAT prevalence was 1.97%, but this decreased to 0.55% in 1998 and to 0.33% in 1999. The relapse rate was 3% in patients treated with pentamidine and 3.5% in patients treated with melarsoprol. In patients treated with pentamidine, there was no difference in the relapse rate for patients with initial CSF white cell counts of 0-5 cells/ micro l or 6-10 cells/micro l. The overall mortality rate was 0.6% and the rate of reactive arsenical encephalopathy among the melarsoprol-treated patients was 1.7%. CONCLUSION: The epidemiological status of the disease was updated and the transmission areas were defined. The control methods implemented allowed the disease prevalence to be reduced. PMID:12378293

  14. Metabolomics Identifies Multiple Candidate Biomarkers to Diagnose and Stage Human African Trypanosomiasis

    PubMed Central

    Vincent, Isabel M.; Daly, Rónán; Courtioux, Bertrand; Cattanach, Amy M.; Biéler, Sylvain; Ndung’u, Joseph M.; Bisser, Sylvie; Barrett, Michael P.

    2016-01-01

    Treatment for human African trypanosomiasis is dependent on the species of trypanosome causing the disease and the stage of the disease (stage 1 defined by parasites being present in blood and lymphatics whilst for stage 2, parasites are found beyond the blood-brain barrier in the cerebrospinal fluid (CSF)). Currently, staging relies upon detecting the very low number of parasites or elevated white blood cell numbers in CSF. Improved staging is desirable, as is the elimination of the need for lumbar puncture. Here we use metabolomics to probe samples of CSF, plasma and urine from 40 Angolan patients infected with Trypanosoma brucei gambiense, at different disease stages. Urine samples provided no robust markers indicative of infection or stage of infection due to inherent variability in urine concentrations. Biomarkers in CSF were able to distinguish patients at stage 1 or advanced stage 2 with absolute specificity. Eleven metabolites clearly distinguished the stage in most patients and two of these (neopterin and 5-hydroxytryptophan) showed 100% specificity and sensitivity between our stage 1 and advanced stage 2 samples. Neopterin is an inflammatory biomarker previously shown in CSF of stage 2 but not stage 1 patients. 5-hydroxytryptophan is an important metabolite in the serotonin synthetic pathway, the key pathway in determining somnolence, thus offering a possible link to the eponymous symptoms of “sleeping sickness”. Plasma also yielded several biomarkers clearly indicative of the presence (87% sensitivity and 95% specificity) and stage of disease (92% sensitivity and 81% specificity). A logistic regression model including these metabolites showed clear separation of patients being either at stage 1 or advanced stage 2 or indeed diseased (both stages) versus control. PMID:27941966

  15. Quantitative Proteomic Analysis of Replicative and Nonreplicative Forms Reveals Important Insights into Chromatin Biology of Trypanosoma cruzi.

    PubMed

    Leandro de Jesus, Teresa Cristina; Calderano, Simone Guedes; Vitorino, Francisca Nathalia de Luna; Llanos, Ricardo Pariona; Lopes, Mariana de Camargo; de Araújo, Christiane Bezerra; Thiemann, Otavio Henrique; Reis, Marcelo da Silva; Elias, Maria Carolina; Chagas da Cunha, Julia Pinheiro

    2017-01-01

    Chromatin associated proteins are key regulators of many important processes in the cell. Trypanosoma cruzi, a protozoa flagellate that causes Chagas disease, alternates between replicative and nonreplicative forms accompanied by a shift on global transcription levels and by changes in its chromatin architecture. Here, we investigated the T. cruzi chromatin proteome using three different protocols and compared it between replicative (epimastigote) and nonreplicative (trypomastigote) forms by high-resolution mass spectrometry. More than 2000 proteins were identified and quantified both in chromatin and nonchromatin extracts. Besides histones and other known nuclear proteins, trypanosomes chromatin also contains metabolic (mainly from carbohydrate pathway), cytoskeleton and many other proteins with unknown functions. Strikingly, the two parasite forms differ greatly regarding their chromatin-associated factors composition and amount. Although the nucleosome content is the same for both life forms (as seen by MNase digestion), the remaining proteins were much less detected in nonreplicative forms, suggesting that they have a naked chromatin. Proteins associated to DNA proliferation, such as PCNA, RPA, and DNA topoisomerases were exclusively found in the chromatin of replicative stages. On the other hand, the nonreplicative stages have an enrichment of a histone H2B variant. Furthermore, almost 20% of replicative stages chromatin-associated proteins are expressed in nonreplicative forms, but located at nonchromatin space. We identified different classes of proteins including phosphatases and a Ran-binding protein, that may shuttle between chromatin and nonchromatin space during differentiation. Seven proteins, including those with unknown functions, were selected for further validation. We confirmed their location in chromatin and their differential expression, using Western blotting assays and chromatin immunoprecipitation (ChIP). Our results indicate that the

  16. Multilocus phylogeographical analysis of Trypanosoma (Megatrypanum) genotypes from sympatric cattle and water buffalo populations supports evolutionary host constraint and close phylogenetic relationships with genotypes found in other ruminants.

    PubMed

    Garcia, Herakles A; Rodrigues, Adriana C; Martinkovic, Franjo; Minervino, Antonio H H; Campaner, Marta; Nunes, Vânia L B; Paiva, Fernando; Hamilton, Patrick B; Teixeira, Marta M G

    2011-11-01

    Species of the subgenus Trypanosoma (Megatrypanum) have been reported in cattle and other domestic and wild ruminants worldwide. A previous study in Brazil found at least four genotypes infecting cattle (Bos taurus), but only one in water buffalo (Bubalus bubalis). However, the small number of isolates examined from buffalo, all inhabiting nearby areas, has precluded evaluation of their diversity, host associations and geographical structure. To address these questions, we evaluated the genetic diversity and phylogeographical patterns of 25 isolates from water buffalo and 28 from cattle from four separate locations in Brazil and Venezuela. Multigene phylogenetic analyses of ssrRNA, internal transcribed spacer of rDNA (ITSrDNA), 5SrRNA, glycosomal glyceraldehyde 3-phosphate dehydrogenase (gGAPDH), mitochondrial cytochrome b (Cyt b), spliced leader (SL) and cathepsin L-like (CATL) sequences positioned all isolates from sympatric and allopatric buffalo populations into the highly homogeneous genotype TthIA, while the cattle isolates were assigned to three different genotypes, all distinct from TthIA. Polymorphisms in all of these sequences separated the trypanosomes infecting water buffalo, cattle, sheep, antelope and deer, and suggested that they correspond to separate species. Congruent phylogenies inferred with all genes indicated a predominant clonal structure of the genotypes. The multilocus analysis revealed one monophyletic assemblage formed exclusively by trypanosomes of ruminants, which corresponds to the subgenus T. (Megatrypanum). The high degree of host specificity, evidenced by genotypes exclusive to each ruminant species and lack of genotype shared by different host species, suggested that the evolutionary history of trypanosomes of this subgenus was strongly constrained by their ruminant hosts. However, incongruence between ruminant and trypanosome phylogenies did not support host-parasite co-evolution, indicating that host switches have occurred across

  17. MCM-BP is required for repression of life-cycle specific genes transcribed by RNA polymerase I in the mammalian infectious form of Trypanosoma brucei.

    PubMed

    Kim, Hee-Sook; Park, Sung Hee; Günzl, Arthur; Cross, George A M

    2013-01-01

    Trypanosoma brucei variant surface glycoprotein (VSG) expression is a classic example of allelic exclusion. While the genome of T. brucei contains >2,000 VSG genes and VSG pseudogenes, only one allele is expressed at the surface of each infectious trypanosome and the others are repressed. Along with recombinatorial VSG switching, allelic exclusion provides a major host evasion mechanism for trypanosomes, a phenomenon known as antigenic variation. To extend our understanding of how trypanosomes escape host immunity by differential expression of VSGs, we attempted to identify genes that contribute to VSG silencing, by performing a loss-of-silencing screen in T. brucei using a transposon-mediated random insertional mutagenesis. One identified gene, which we initially named LOS1, encodes a T. brucei MCM-Binding Protein (TbMCM-BP). Here we show that TbMCM-BP is essential for viability of infectious bloodstream-form (BF) trypanosome and is required for proper cell-cycle progression. Tandem affinity purification of TbMCM-BP followed by mass spectrometry identified four subunits (MCM4-MCM7) of the T. brucei MCM complex, a replicative helicase, and MCM8, a subunit that is uniquely co-purified with TbMCM-BP. TbMCM-BP is required not only for repression of subtelomeric VSGs but also for silencing of life-cycle specific, insect-stage genes, procyclin and procyclin-associated genes (PAGs), that are normally repressed in BF trypanosomes and are transcribed by RNA polymerase I. Our study uncovers a functional link between chromosome maintenance and RNA pol I-mediated gene silencing in T. brucei.

  18. Standard culture medium allows clonal dilution of Trypanosoma brucei procyclic cells after auto-conditioning.

    PubMed

    Archer, Stuart K

    2009-03-01

    Trypanosoma brucei can be cultured in vitro in the mammalian bloodstream form or in the procyclic (PC) form found in the insect vector. Bloodstream trypanosomes can be cloned by limiting dilution, but PCs can only be diluted in conditioned medium, i.e., medium in which PC cells have previously been grown. It is shown here that this limitation does not apply to the most commonly used PC cell strain, Lister 427, if free radicals are removed from the medium. The reported benefit of conditioning media may arise in part from a process of hemin-catalysed depletion of peroxide ("auto-conditioning") which occurs during extended incubation at growth temperature. Scavenging free radicals by addition of pyruvate also improves PC cell viability. However, other PC cell strains such as Treu 927 require cell-conditioned media unless grown in a 5% CO2 atmosphere. Several other culture parameters that affect growth rates and dilution capability were identified.

  19. Production, purification and crystallization of a trans-sialidase from Trypanosoma vivax.

    PubMed

    Haynes, Carole L F; Ameloot, Paul; Remaut, Han; Callewaert, Nico; Sterckx, Yann G J; Magez, Stefan

    2015-05-01

    Sialidases and trans-sialidases play important roles in the life cycles of various microorganisms. These enzymes can serve nutritional purposes, act as virulence factors or mediate cellular interactions (cell evasion and invasion). In the case of the protozoan parasite Trypanosoma vivax, trans-sialidase activity has been suggested to be involved in infection-associated anaemia, which is the major pathology in the disease nagana. The physiological role of trypanosomal trans-sialidases in host-parasite interaction as well as their structures remain obscure. Here, the production, purification and crystallization of a recombinant version of T. vivax trans-sialidase 1 (rTvTS1) are described. The obtained rTvTS1 crystals diffracted to a resolution of 2.5 Å and belonged to the orthorhombic space group P212121, with unit-cell parameters a = 57.3, b = 78.4, c = 209.0 Å.

  20. JVG9, a benzimidazole derivative, alters the surface and cytoskeleton of Trypanosoma cruzi bloodstream trypomastigotes

    PubMed Central

    Díaz-Chiguer, Dylan L; Hernández-Luis, Francisco; Nogueda-Torres, Benjamín; Castillo, Rafael; Reynoso-Ducoing, Olivia; Hernández-Campos, Alicia; Ambrosio, Javier R

    2014-01-01

    Trypanosoma cruzi has a particular cytoskeleton that consists of a subpellicular network of microtubules and actin microfilaments. Therefore, it is an excellent target for the development of new anti-parasitic drugs. Benzimidazole 2-carbamates, a class of well-known broad-spectrum anthelmintics, have been shown to inhibit the in vitro growth of many protozoa. Therefore, to find efficient anti-trypanosomal (trypanocidal) drugs, our group has designed and synthesised several benzimidazole derivatives. One, named JVG9 (5-chloro-1H-benzimidazole-2-thiol), has been found to be effective against T. cruzi bloodstream trypomastigotes under both in vitro and in vivo conditions. Here, we present the in vitro effects observed by laser scanning confocal and scanning electron microscopy on T. cruzi trypomastigotes. Changes in the surface and the distribution of the cytoskeletal proteins are consistent with the hypothesis that the trypanocidal activity of JVG9 involves the cytoskeleton as a target. PMID:25317703

  1. Assembly mechanism of Trypanosoma brucei BILBO1 at the flagellar pocket collar.

    PubMed

    Vidilaseris, Keni; Lesigang, Johannes; Morriswood, Brooke; Dong, Gang

    2015-01-01

    The flagellar pocket is a bulb-like invagination of the plasma membrane that encloses the base of the single flagellum in trypanosomes. It is the site of all endo- and exocytic activity in the parasite and has thus been proposed to be a therapeutic target. At the neck of the flagellar pocket is an electron-dense cytoskeletal structure named the flagellar pocket collar. The protein BILBO1 was the first characterized and remains the only known component of the flagellar pocket collar, with essential functions in the biogenesis of both the flagellar pocket and flagellar pocket collar. We recently reported that the filamentous assembly of Trypanosoma brucei BILBO1 (TbBILBO1) is mediated by its central coiled coil domain and C-terminal leucine zipper. Here, we discuss how TbBILBO1 might assemble at the flagellar pocket collar in T. brucei.

  2. Trypanosoma brucei parasites occupy and functionally adapt to the adipose tissue in mice

    DOE PAGES

    Trindade, Sandra; Rijo-Ferreira, Filipa; Carvalho, Tania; ...

    2016-05-26

    Trypanosoma brucei is an extracellular parasite that causes sleeping sickness. In mammalian hosts, trypanosomes are thought to exist in two major niches: early in infection, they populate the blood; later, they breach the blood-brain barrier. Working with a well-established mouse model, we discovered that adipose tissue constitutes a third major reservoir for T. brucei. Parasites from adipose tissue, here termed adipose tissue forms (ATFs), can replicate and were capable of infecting a naive animal. ATFs were transcriptionally distinct from bloodstream forms, and the genes upregulated included putative fatty acid β-oxidation enzymes. Consistent with this, ATFs were able to utilize exogenousmore » myristate and form β-oxidation intermediates, suggesting that ATF parasites can use fatty acids as an external carbon source. Lastly, these findings identify the adipose tissue as a niche for T. brucei during its mammalian life cycle and could potentially explain the weight loss associated with sleeping sickness.« less

  3. First report of surra (Trypanosoma evansi infection) in a Tunisian dog

    PubMed Central

    Rjeibi, Mohamed Ridha; Ben Hamida, Taoufik; Dalgatova, Zara; Mahjoub, Tarek; Rejeb, Ahmed; Dridi, Walid; Gharbi, Mohamed

    2015-01-01

    Trypanosoma evansi, the agent of surra, is a salivarian trypanosome, originating from Africa. Surra is a major disease in camels, equines and dogs, in which it can often be fatal in the absence of treatment. Animals exhibit nonspecific clinical signs (anaemia, loss of weight and abortion). In the present survey, a blood sample was collected in Sousse (Central Tunisia) from a dog that presented clinical signs of trypanosomiasis. Giemsa-stained blood smears and PCR were performed. ITS1 sequences from blood had 99.8 and 99.5% homology with published T. evansi sequences from cattle and camels, respectively. To our knowledge, this is the first report of T. evansi in a Tunisian dog. PMID:25654368

  4. Kinetoplastid Specific RNA-Protein Interactions in Trypanosoma cruzi Ribosome Biogenesis.

    PubMed

    Umaer, Khan; Williams, Noreen

    2015-01-01

    RNA binding proteins (RBP) play essential roles in the highly conserved and coordinated process of ribosome biogenesis. Our laboratory has previously characterized two essential and abundant RBPs, P34 and P37, in Trypanosoma brucei which are required for several critical steps in ribosome biogenesis. The genes for these proteins have only been identified in kinetoplastid organisms but not in the host genome. We have identified a homolog of the TbP34 and TbP37 in a T. cruzi strain (termed TcP37/NRBD). Although the N-terminal APK-rich domain and RNA recognition motifs are conserved, the C-terminal region which contains putative nuclear and nucleolar localization signals in TbP34 and TbP37 is almost entirely missing from TcP37/NRBD. We have shown that TcP37/NRBD is expressed in T. cruzi epimastigotes at the level of mature mRNA and protein. Despite the loss of the C-terminal domain, TcP37/NRBD is present in the nucleus, including the nucleolus, and the cytoplasm. TcP37/NRBD interacts directly with Tc 5S rRNA, but does not associate with polyadenylated RNA. TcP37/NRBD also associates in vivo and in vitro with large ribosomal protein TcL5 and, unlike the case of T. brucei, this association is strongly enhanced by the presence of 5S rRNA, suggesting that the loss of the C-terminal domain of TcP37/NRBD may alter the interactions within the complex. These results indicate that the unique preribosomal complex comprised of L5, 5S rRNA, and the trypanosome-specific TcP37/NRBD or TbP34 and TbP37 is functionally conserved in trypanosomes despite the differences in the C-termini of the trypanosome-specific protein components.

  5. Characterisation of the fumarate hydratase repertoire in Trypanosoma cruzi.

    PubMed

    de Pádua, Ricardo A P; Kia, Ali Martin; Filho, Antonio José Costa; Wilkinson, Shane R; Nonato, M Cristina

    2017-03-27

    Nifurtimox and benznidazole represent the only treatments options available targeting Chagas disease, the most important parasitic infection in the Americas. However, use of these is problematic as they are toxic and ineffective against the more severe stages of the disease. In this work, we used a multidisciplinary approach to characterise the fumarases from Trypanosoma cruzi, the causative agent of Chagas Disease. We showed this trypanosome expresses cytosolic and mitochondrial fumarases that via an iron-sulfur cluster mediate the reversible conversion of fumarate to S-malate. Based on sequence, biochemical properties and co-factor binding, both T. cruzi proteins share characteristics with class I fumarases, enzymes found in bacteria and some other protozoa but absent from humans, that possess class II isoforms instead. Gene disruption suggested that although the cytosolic or mitochondrial fumarase activities are individually dispensable their combined activity is essential for parasite viability. Finally, based on the mechanistic differences with the human (host) fumarase, we designed and validated a selective inhibitor targeting the parasite enzyme. This study showed that T. cruzi fumarases should be exploited as targets for the development of new chemotherapeutic interventions against Chagas disease.

  6. Mouse infection and pathogenesis by Trypanosoma brucei motility mutants.

    PubMed

    Kisalu, Neville K; Langousis, Gerasimos; Bentolila, Laurent A; Ralston, Katherine S; Hill, Kent L

    2014-06-01

    The flagellum of Trypanosoma brucei is an essential and multifunctional organelle that drives parasite motility and is receiving increased attention as a potential drug target. In the mammalian host, parasite motility is suspected to contribute to infection and disease pathogenesis. However, it has not been possible to test this hypothesis owing to lack of motility mutants that are viable in the bloodstream life cycle stage that infects the mammalian host. We recently identified a bloodstream-form motility mutant in 427-derived T. brucei in which point mutations in the LC1 dynein subunit disrupt propulsive motility but do not affect viability. These mutants have an actively beating flagellum, but cannot translocate. Here we demonstrate that the LC1 point mutant fails to show enhanced cell motility upon increasing viscosity of the surrounding medium, which is a hallmark of wild type T. brucei, thus indicating that motility of the mutant is fundamentally altered compared with wild type cells. We next used the LC1 point mutant to assess the influence of trypanosome motility on infection in mice. Wesurprisingly found that disrupting parasite motility has no discernible effect on T. brucei bloodstream infection. Infection time-course, maximum parasitaemia, number of waves of parasitaemia, clinical features and disease outcome are indistinguishable between motility mutant and control parasites. Our studies provide an important step toward understanding the contribution of parasite motility to infection and a foundation for future investigations of T. brucei interaction with the mammalian host.

  7. Trypanosoma cruzi: modification of macrophage function during infection

    PubMed Central

    1977-01-01

    Infection of mice with Trypanosoma cruzi and subsequent intraperitoneal challenge with heat-killed trypanosomes elicits peritoneal macrophages which display in vitro microbicidal activity against trypomastigotes of T. cruzi. These cells also display other activated properties including rapid spreading, intense membrane activity, secretion of high levels of plasminogen activator, and ingestion mediated by the C3 receptor. An intravenous infection with BCG, followed by an intraperitoneal challenge with mycobacterial antigens brings about macrophages with similar properties. These criteria of macrophage activation were compared in normal and BCG- or T. cruzi-immune mice, with or without an intraperitoneal challenge with specific or unrelated antigens. Trypanocidal activity is displayed by both BCG- and T. cruzi-immune macrophages after intraperitoneal challenge with either antigen. Resident-immune macrophages from both T. cruzi- and BCG-infected mice show a trypanostatic, rather than trypanocidal activity. Macrophages from noninfected mice, challenged with the same antigens, show neither trypanostatic nor trypanocidal activity. Increased secretion of plasminogen activator shows a definite immunological specificity. Challenge with the specific antigen induces the appearance of macrophages secreting high levels of plasminogen activator, while unrelated antigens induce much smaller levels. Noninfected mice challenged with the same antigens do not display any enchancement in secretion. In contrast, increased spreading and phagocytosis mediated by the complement receptor are also displayed by cells from noninfected mice challenged with any of the agents tested. PMID:327012

  8. Specific Uptake of Tumor Necrosis Factor-α Is Involved in Growth Control of Trypanosoma brucei

    PubMed Central

    Magez, Stefan; Geuskens, Maurice; Beschin, Alain; Favero, Herwig del; Verschueren, Hendrik; Lucas, Ralf; Pays, Etienne; Baetselier, Patrick de

    1997-01-01

    Trypanosoma brucei is lysed by tumor necrosis factor-α (TNF-α) in a dose-dependent way, involving specific binding of the cytokine to a trypanosomal glycoprotein present in the flagellar pocket of the parasite. TNF-α–gold particles are endocytosed via coated pits and vesicles and are directed towards lysosome-like digestive organelles. The specific uptake of the cytokine by the parasite results in a developmentally regulated loss of osmoregulatory capacity. TNF-α specific lysis is prevented when lysis assays are performed at a temperature <26°C, despite uptake of the cytokine. Inhibition of lysis is also observed when a lysosomotropic agent is added during the first 2 h of incubation. Both monomorphic and pleomorphic trypanosomes are lysed but only when isolated during the peak of parasitaemia. Lysis is not observed with early infection stage parasites or procyclic (insect-specific) forms. Anti– TNF-α treatment of T. brucei-infected mice reveals a dramatic increase in parasitaemia in the blood circulation, the spleen, the lymph nodes, and the peritoneal cavity. These data suggest that in the mammalian host, TNF-α is involved in the growth control of T. brucei. PMID:9151676

  9. Modulation of the Immune Response by Nematode Secreted Acetylcholinesterase Revealed by Heterologous Expression in Trypanosoma musculi

    PubMed Central

    Vaux, Rachel; Schnoeller, Corinna; Berkachy, Rita; Roberts, Luke B.; Hagen, Jana; Gounaris, Kleoniki

    2016-01-01

    Nematode parasites secrete molecules which regulate the mammalian immune system, but their genetic intractability is a major impediment to identifying and characterising the biological effects of these molecules. We describe here a novel system for heterologous expression of helminth secreted proteins in the natural parasite of mice, Trypanosoma musculi, which can be used to analyse putative immunomodulatory functions. Trypanosomes were engineered to express a secreted acetylcholinesterase from Nippostrongylus brasiliensis. Infection of mice with transgenic parasites expressing acetylcholinesterase resulted in truncated infection, with trypanosomes cleared early from the circulation. Analysis of cellular phenotypes indicated that exposure to acetylcholinesterase in vivo promoted classical activation of macrophages (M1), with elevated production of nitric oxide and lowered arginase activity. This most likely occurred due to the altered cytokine environment, as splenocytes from mice infected with T. musculi expressing acetylcholinesterase showed enhanced production of IFNγ and TNFα, with diminished IL-4, IL-13 and IL-5. These results suggest that one of the functions of nematode secreted acetylcholinesterase may be to alter the cytokine environment in order to inhibit development of M2 macrophages which are deleterious to parasite survival. Transgenic T. musculi represents a valuable new vehicle to screen for novel immunoregulatory proteins by extracellular delivery in vivo to the murine host. PMID:27802350

  10. Benznidazole Biotransformation and Multiple Targets in Trypanosoma cruzi Revealed by Metabolomics

    PubMed Central

    Trochine, Andrea; Creek, Darren J.; Faral-Tello, Paula; Barrett, Michael P.; Robello, Carlos

    2014-01-01

    Background The first line treatment for Chagas disease, a neglected tropical disease caused by the protozoan parasite Trypanosoma cruzi, involves administration of benznidazole (Bzn). Bzn is a 2-nitroimidazole pro-drug which requires nitroreduction to become active, although its mode of action is not fully understood. In the present work we used a non-targeted MS-based metabolomics approach to study the metabolic response of T. cruzi to Bzn. Methodology/Principal findings Parasites treated with Bzn were minimally altered compared to untreated trypanosomes, although the redox active thiols trypanothione, homotrypanothione and cysteine were significantly diminished in abundance post-treatment. In addition, multiple Bzn-derived metabolites were detected after treatment. These metabolites included reduction products, fragments and covalent adducts of reduced Bzn linked to each of the major low molecular weight thiols: trypanothione, glutathione, γ-glutamylcysteine, glutathionylspermidine, cysteine and ovothiol A. Bzn products known to be generated in vitro by the unusual trypanosomal nitroreductase, TcNTRI, were found within the parasites, but low molecular weight adducts of glyoxal, a proposed toxic end-product of NTRI Bzn metabolism, were not detected. Conclusions/significance Our data is indicative of a major role of the thiol binding capacity of Bzn reduction products in the mechanism of Bzn toxicity against T. cruzi. PMID:24853684

  11. Motility modes of the parasite Trypanosoma brucei

    NASA Astrophysics Data System (ADS)

    Temel, Fatma Zeynep; Qu, Zijie; McAllaster, Michael; de Graffenried, Christopher; Breuer, Kenneth

    2015-11-01

    The parasitic single-celled protozoan Trypanosoma brucei causes African Sleeping Sickness, which is a fatal disease in humans and animals that threatens more than 60 million people in 36 African countries. Cell motility plays a critical role in the developmental phases and dissemination of the parasite. Unlike many other motile cells such as bacteria Escherichia coli or Caulobacter crescentus, the flagellum of T. brucei is attached along the length of its awl-like body, producing a unique mode of motility that is not fully understood or characterized. Here, we report on the motility of T. brucei, which swims using its single flagellum employing both rotating and undulating propulsion modes. We tracked cells in real-time in three dimensions using fluorescent microscopy. Data obtained from experiments using both short-term tracking within the field of view and long-term tracking using a tracking microscope were analyzed. Motility modes and swimming speed were analyzed as functions of cell size, rotation rate and undulation pattern. Research supported by NSF.

  12. Non-natural acetogenin analogues as potent Trypanosoma brucei inhibitors

    PubMed Central

    Florence, Gordon J.; Fraser, Andrew L.; Gould, Eoin R.; King, Elizabeth F.; Menzies, Stefanie K.; Morris, Joanne C.; Tulloch, Lindsay B.; Smith, Terry K.

    2015-01-01

    A series of novel bis-tetrahydropyran 1,4-triazole analogues based on the acetogenin framework display low micromolar trypanocidal activities towards both bloodstream and insect forms of Trypanosoma brucei, the causative agent of African sleeping sickness. A divergent synthetic strategy was adopted for the synthesis of the key tetrahydropyran intermediates to enable rapid access to diastereochemical variation either side of the 1,4-triazole core. The resulting diastereomeric analogues displayed varying degrees of trypanocidal activity and selectivity in structure activity relationship studies. PMID:25145275

  13. Quantitative Proteomics Uncovers Novel Factors Involved in Developmental Differentiation of Trypanosoma brucei

    PubMed Central

    Dejung, Mario; Subota, Ines; Bucerius, Ferdinand; Dindar, Gülcin; Freiwald, Anja; Engstler, Markus; Boshart, Michael; Butter, Falk; Janzen, Christian J.

    2016-01-01

    Developmental differentiation is a universal biological process that allows cells to adapt to different environments to perform specific functions. African trypanosomes progress through a tightly regulated life cycle in order to survive in different host environments when they shuttle between an insect vector and a vertebrate host. Transcriptomics has been useful to gain insight into RNA changes during stage transitions; however, RNA levels are only a moderate proxy for protein abundance in trypanosomes. We quantified 4270 protein groups during stage differentiation from the mammalian-infective to the insect form and provide classification for their expression profiles during development. Our label-free quantitative proteomics study revealed previously unknown components of the differentiation machinery that are involved in essential biological processes such as signaling, posttranslational protein modifications, trafficking and nuclear transport. Furthermore, guided by our proteomic survey, we identified the cause of the previously observed differentiation impairment in the histone methyltransferase DOT1B knock-out strain as it is required for accurate karyokinesis in the first cell division during differentiation. This epigenetic regulator is likely involved in essential chromatin restructuring during developmental differentiation, which might also be important for differentiation in higher eukaryotic cells. Our proteome dataset will serve as a resource for detailed investigations of cell differentiation to shed more light on the molecular mechanisms of this process in trypanosomes and other eukaryotes. PMID:26910529

  14. Quantitative Proteomics Uncovers Novel Factors Involved in Developmental Differentiation of Trypanosoma brucei.

    PubMed

    Dejung, Mario; Subota, Ines; Bucerius, Ferdinand; Dindar, Gülcin; Freiwald, Anja; Engstler, Markus; Boshart, Michael; Butter, Falk; Janzen, Christian J

    2016-02-01

    Developmental differentiation is a universal biological process that allows cells to adapt to different environments to perform specific functions. African trypanosomes progress through a tightly regulated life cycle in order to survive in different host environments when they shuttle between an insect vector and a vertebrate host. Transcriptomics has been useful to gain insight into RNA changes during stage transitions; however, RNA levels are only a moderate proxy for protein abundance in trypanosomes. We quantified 4270 protein groups during stage differentiation from the mammalian-infective to the insect form and provide classification for their expression profiles during development. Our label-free quantitative proteomics study revealed previously unknown components of the differentiation machinery that are involved in essential biological processes such as signaling, posttranslational protein modifications, trafficking and nuclear transport. Furthermore, guided by our proteomic survey, we identified the cause of the previously observed differentiation impairment in the histone methyltransferase DOT1B knock-out strain as it is required for accurate karyokinesis in the first cell division during differentiation. This epigenetic regulator is likely involved in essential chromatin restructuring during developmental differentiation, which might also be important for differentiation in higher eukaryotic cells. Our proteome dataset will serve as a resource for detailed investigations of cell differentiation to shed more light on the molecular mechanisms of this process in trypanosomes and other eukaryotes.

  15. Trypanosoma Infection Rates in Glossina Species in Mtito Andei Division, Makueni County, Kenya

    PubMed Central

    Nthiwa, Daniel Mutiso; Odongo, David O.; Ochanda, Horace; Khamadi, Samoel; Gichimu, Bernard M.

    2015-01-01

    African Animal Trypanosomiasis (AAT) transmitted cyclically by tsetse fly (Glossina spp.) is a major obstacle to livestock production in the tropical parts of Africa. The objective of this study was to determine the infection rates of trypanosomes in Glossina species in Mtito Andei Division, Makueni County, Kenya. Tsetse fly species, G. longipennis and G. pallidipes, were trapped and DNA was isolated from their dissected internal organs (proboscis, salivary glands, and midguts). The DNA was then subjected to a nested PCR assay using internal transcribed spacer primers and individual trypanosome species were identified following agarose gel electrophoresis. Out of the 117 flies trapped in the area 39 (33.3%) were teneral while 78 (67%) were nonteneral. G. pallidipes constituted the largest percentage of 58% while G. longipennis were 42%. The overall trypanosomes infection rate in all nonteneral Glossina spp. was 11.53% with G. longipennis recording the highest infection rate of 23.08% while G. pallidipes had an infection rate of 5.77%. T. vivax was the most infectious (10.26%) compared to T. congolense (1.28%). Mean apparent densities were strongly positively correlated with infection rates (r = 0.95) confirming the importance of this parameter as an indicator of AAT transmission risk. PMID:26617992

  16. Development of a New Chemotherapy for Human African Trypanosomias Using an Animal Model: Suramin with DL-Alpha-Difluoromethylornithine (DFMO)

    DTIC Science & Technology

    1988-09-14

    WITH DL-ALPHA-DIFLUOROMETHYLORNiTHINE (DFMO) SUBTITLE: Chemotherapy for African Trypanosomiasis by Polyamine Synthesis Inhibition PRINCIPAL...PAGE COUNT Annual Report I FROM 8/15/87 TO 814/88 1988 September 14 22 16. SUPPLEMENTARY NOTATION Subtitle: Chemotherapy for African Trypanosomiasis ...block number) Towards developing a new chemotherapy for African trypanosomiasis , nine strains of Trypanosoma brucei rhodesiense were acquired and used

  17. Tsetse GmmSRPN10 Has Anti-complement Activity and Is Important for Successful Establishment of Trypanosome Infections in the Fly Midgut

    PubMed Central

    Ooi, Cher-Pheng; Haines, Lee R.; Southern, Daniel M.; Lehane, Michael J.; Acosta-Serrano, Alvaro

    2015-01-01

    The complement cascade in mammalian blood can damage the alimentary tract of haematophagous arthropods. As such, these animals have evolved their own repertoire of complement-inactivating factors, which are inadvertently exploited by blood-borne pathogens to escape complement lysis. Unlike the bloodstream stages, the procyclic (insect) stage of Trypanosoma brucei is highly susceptible to complement killing, which is puzzling considering that a tsetse takes a bloodmeal every 2–4 days. In this study, we identified four tsetse (Glossina morsitans morsitans) serine protease inhibitors (serpins) from a midgut expressed sequence tag (EST) library (GmmSRPN3, GmmSRPN5, GmmSRPN9 and GmmSRPN10) and investigated their role in modulating the establishment of a T. brucei infection in the midgut. Although not having evolved in a common blood-feeding ancestor, all four serpins have an active site sharing remarkable homology with the human complement C1-inhibitor serpin, SerpinG1. RNAi knockdown of individual GmmSRPN9 and GmmSRPN10 genes resulted in a significant decreased rate of infection by procyclic form T. brucei. Furthermore, recombinant GmmSRPN10 was both able to inhibit the activity of human complement-cascade serine proteases, C1s and Factor D, and to protect the in vitro killing of procyclic trypanosomes when incubated with complement-activated human serum. Thus, the secretion of serpins, which may be part of a bloodmeal complement inactivation system in tsetse, is used by procyclic trypanosomes to evade an influx of fresh trypanolytic complement with each bloodmeal. This highlights another facet of the complicated relationship between T. brucei and its tsetse vector, where the parasite takes advantage of tsetse physiology to further its chances of propagation and transmission. PMID:25569180

  18. A Glycosylation Mutant of Trypanosoma brucei Links Social Motility Defects In Vitro to Impaired Colonization of Tsetse Flies In Vivo.

    PubMed

    Imhof, Simon; Vu, Xuan Lan; Bütikofer, Peter; Roditi, Isabel

    2015-06-01

    Transmission of African trypanosomes by tsetse flies requires that the parasites migrate out of the midgut lumen and colonize the ectoperitrophic space. Early procyclic culture forms correspond to trypanosomes in the lumen; on agarose plates they exhibit social motility, migrating en masse as radial projections from an inoculation site. We show that an Rft1(-/-) mutant needs to reach a greater threshold number before migration begins, and that it forms fewer projections than its wild-type parent. The mutant is also up to 4 times less efficient at establishing midgut infections. Ectopic expression of Rft1 rescues social motility defects and restores the ability to colonize the fly. These results are consistent with social motility reflecting movement to the ectoperitrophic space, implicate N-glycans in the signaling cascades for migration in vivo and in vitro, and provide the first evidence that parasite-parasite interactions determine the success of transmission by the insect host.

  19. Genetic Engineering of Trypanosoma (Dutonella) vivax and In Vitro Differentiation under Axenic Conditions

    PubMed Central

    D'Archivio, Simon; Medina, Mathieu; Cosson, Alain; Chamond, Nathalie; Rotureau, Brice; Minoprio, Paola; Goyard, Sophie

    2011-01-01

    Trypanosoma vivax is one of the most common parasites responsible for animal trypanosomosis, and although this disease is widespread in Africa and Latin America, very few studies have been conducted on the parasite's biology. This is in part due to the fact that no reproducible experimental methods had been developed to maintain the different evolutive forms of this trypanosome under laboratory conditions. Appropriate protocols were developed in the 1990s for the axenic maintenance of three major animal Trypanosoma species: T. b. brucei, T. congolense and T. vivax. These pioneer studies rapidly led to the successful genetic manipulation of T. b. brucei and T. congolense. Advances were made in the understanding of these parasites' biology and virulence, and new drug targets were identified. By contrast, challenging in vitro conditions have been developed for T. vivax in the past, and this per se has contributed to defer both its genetic manipulation and subsequent gene function studies. Here we report on the optimization of non-infective T. vivax epimastigote axenic cultures and on the process of parasite in vitro differentiation into metacyclic infective forms. We have also constructed the first T. vivax specific expression vector that drives constitutive expression of the luciferase reporter gene. This vector was then used to establish and optimize epimastigote transfection. We then developed highly reproducible conditions that can be used to obtain and select stably transfected mutants that continue metacyclogenesis and are infectious in immunocompetent rodents. PMID:22216367

  20. Effects of Trypanocidal Drugs on the Function of Trypanosomes.

    DTIC Science & Technology

    1978-09-01

    34 Identification of New Trypanocidal Drugs The need for new trypanocides cannot be overemphasized. At present, chemotherapy of African trypanosomiasis is...The African Trypanosomiasis , pp. XII-IX. Mulligan, H.W. (ed.). (George Allen and Unwin Ltd., London). 4. Newton, B.A. 1974. Chemotherapy of...BACKGROUND African trypanosomiasis is confined to Africa by the distribution of its vectors. T. gambiense infection occurs over a broad belt from

  1. Cyclin-Dependent Kinase CRK9, Required for Spliced Leader trans Splicing of Pre-mRNA in Trypanosomes, Functions in a Complex with a New L-Type Cyclin and a Kinetoplastid-Specific Protein.

    PubMed

    Badjatia, Nitika; Park, Sung Hee; Ambrósio, Daniela L; Kirkham, Justin K; Günzl, Arthur

    2016-03-01

    In eukaryotes, cyclin-dependent kinases (CDKs) control the cell cycle and critical steps in gene expression. The lethal parasite Trypanosoma brucei, member of the phylogenetic order Kinetoplastida, possesses eleven CDKs which, due to high sequence divergence, were generically termed CDC2-related kinases (CRKs). While several CRKs have been implied in the cell cycle, CRK9 was the first trypanosome CDK shown to control the unusual mode of gene expression found in kinetoplastids. In these organisms, protein-coding genes are arranged in tandem arrays which are transcribed polycistronically. Individual mRNAs are processed from precursor RNA by spliced leader (SL) trans splicing and polyadenylation. CRK9 ablation was lethal in cultured trypanosomes, causing a block of trans splicing before the first transesterification step. Additionally, CRK9 silencing led to dephosphorylation of RNA polymerase II and to hypomethylation of the SL cap structure. Here, we tandem affinity-purified CRK9 and, among potential CRK9 substrates and modifying enzymes, discovered an unusual tripartite complex comprising CRK9, a new L-type cyclin (CYC12) and a protein, termed CRK9-associated protein (CRK9AP), that is only conserved among kinetoplastids. Silencing of either CYC12 or CRK9AP reproduced the effects of depleting CRK9, identifying these proteins as functional partners of CRK9 in vivo. While mammalian cyclin L binds to CDK11, the CRK9 complex deviates substantially from that of CDK11, requiring CRK9AP for efficient CRK9 complex formation and autophosphorylation in vitro. Interference with this unusual CDK rescued mice from lethal trypanosome infections, validating CRK9 as a potential chemotherapeutic target.

  2. Crovirin, a Snake Venom Cysteine-Rich Secretory Protein (CRISP) with Promising Activity against Trypanosomes and Leishmania

    PubMed Central

    Adade, Camila M.; Carvalho, Ana Lúcia O.; Tomaz, Marcelo A.; Costa, Tatiana F. R.; Godinho, Joseane L.; Melo, Paulo A.; Lima, Ana Paula C. A.; Rodrigues, Juliany C. F.; Zingali, Russolina B.; Souto-Padrón, Thaïs

    2014-01-01

    Background The neglected human diseases caused by trypanosomatids are currently treated with toxic therapy with limited efficacy. In search for novel anti-trypanosomatid agents, we showed previously that the Crotalus viridis viridis (Cvv) snake venom was active against infective forms of Trypanosoma cruzi. Here, we describe the purification of crovirin, a cysteine-rich secretory protein (CRISP) from Cvv venom with promising activity against trypanosomes and Leishmania. Methodology/Principal Findings Crude venom extract was loaded onto a reverse phase analytical (C8) column using a high performance liquid chromatographer. A linear gradient of water/acetonitrile with 0.1% trifluoroacetic acid was used. The peak containing the isolated protein (confirmed by SDS-PAGE and mass spectrometry) was collected and its protein content was measured. T. cruzi trypomastigotes and amastigotes, L. amazonensis promastigotes and amastigotes and T. brucei rhodesiense procyclic and bloodstream trypomastigotes were challenged with crovirin, whose toxicity was tested against LLC-MK2 cells, peritoneal macrophages and isolated murine extensor digitorum longus muscle. We purified a single protein from Cvv venom corresponding, according to Nano-LC MS/MS sequencing, to a CRISP of 24,893.64 Da, henceforth referred to as crovirin. Human infective trypanosomatid forms, including intracellular amastigotes, were sensitive to crovirin, with low IC50 or LD50 values (1.10–2.38 µg/ml). A considerably higher concentration (20 µg/ml) of crovirin was required to elicit only limited toxicity on mammalian cells. Conclusions This is the first report of CRISP anti-protozoal activity, and suggests that other members of this family might have potential as drugs or drug leads for the development of novel agents against trypanosomatid-borne neglected diseases. PMID:25330220

  3. Drugs and drug resistance in African trypanosomiasis.

    PubMed

    Delespaux, Vincent; de Koning, Harry P

    2007-01-01

    Despite the many decades of use of most of the current trypanocides, we know little of their mode of action. This may in part be because most of these will act on multiple targets once inside the cell, and they derive their selective action on the parasite from selective accumulation by the pathogen. Loss of this capacity for drug uptake by the trypanosome would thus be a major cause for drug resistance. We here discuss the use of current drugs against human and veterinary African trypanosomiasis, the prevalence, causes and mechanisms of drug resistance and new developments in trypanosomiasis therapy such as the introduction of nifurtimox and DB289.

  4. Human African trypanosomiasis, chemotherapy and CNS disease.

    PubMed

    Rodgers, Jean

    2009-06-25

    Trypanosomes have been recognised as human pathogens for over a century. Human African trypanosomiasis is endemic in an area sustaining 60 million people and is fatal without chemotherapeutic intervention. Available trypanocidal drugs require parenteral administration and are associated with adverse reactions including the development of a severe post-treatment reactive encephalopathy (PTRE). Following infection the parasites proliferate in the systemic compartment before invading the CNS where a cascade of events results in neuroinflammation. This review summarises the clinical manifestations of the infection and chemotherapeutic regimens as well as the current research findings and hypotheses regarding the neuropathogenesis of the disease.

  5. An evaluation of Minor Groove Binders as anti-Trypanosoma brucei brucei therapeutics.

    PubMed

    Scott, Fraser J; Khalaf, Abedawn I; Giordani, Federica; Wong, Pui Ee; Duffy, Sandra; Barrett, Michael; Avery, Vicky M; Suckling, Colin J

    2016-06-30

    A series of 32 structurally diverse MGBs, derived from the natural product distamycin, was evaluated for activity against Trypanosoma brucei brucei. Four compounds have been found to possess significant activity, in the nanomolar range, and represent hits for further optimisation towards novel treatments for Human and Animal African Trypanosomiases. Moreover, SAR indicates that the head group linking moiety is a significant modulator of biological activity.

  6. In vitro simulation of immunosuppression caused by Trypanosoma brucei: active involvement of gamma interferon and tumor necrosis factor in the pathway of suppression.

    PubMed Central

    Darji, A; Beschin, A; Sileghem, M; Heremans, H; Brys, L; De Baetselier, P

    1996-01-01

    Experimental infections of mice with the African trypanosome Trypanosoma brucei lead to a profound state of T-cell unresponsiveness in the lymph node cell (LNC) compartment. This suppression is mediated by macrophage-like cells which inhibit interleukin 2 (IL-2) secretion and down-regulate IL-2 receptor expression (M. Sileghem, A. Darji, R. Hamers, M. Van de Winkel, and P. De Baetselier, Eur. J. Immunol. 19:829-835, 1989). Similar suppressive cells can be generated in vitro by pulsing 2C11-12 macrophage hybridoma cells with opsonized T. brucei parasites (2C11-12P cells). Cocultures of 2C11-12P cells and LNCs secrete higher levels of gamma interferon (IFN-gamma), and the hyperproduction of IFN-gamma was found to be confined to CD8+ lymphoid cells. Elimination of CD8+ cells from cocultures of 2C11-12P cells and LNCs restores the T-cell proliferative response. Furthermore, addition of neutralizing anti-IFN-gamma antibodies to the cocultures reduces the level of suppression and concomitantly restores the level of IL-2 receptor expression. Hence, IFN-gamma plays a cardinal role in this in vitro model for T. brucei-elicited immunosuppression. Cocultures of LNCs and 2C11-12P cells in a two-chamber culture system further demonstrated that cell-cell contact is required for hyperproduction of IFN-gamma and, moreover, that IFN-gamma cooperates with a 2C11-12P-derived diffusible factor to exert its suppressive activity. Finally, tumor necrosis factor alpha (TNF-alpha produced by 2C11-12P cells was found to be implicated in the hyperproduction of IFN-gamma, since addition of neutralizing anti-TNF-alpha antibodies to cocultures reduced the level of suppression and concomitantly abrogated the hyperproduction of IFN-gamma. Collectively, our findings indicate that T. brucei-elicited suppressive 2C11-12 macrophage cells differentially influence T-cell subpopulations: (i) CD8+ cells are signaled via cell-cell contact to produce IFN-gamma, and TNF-alpha is implicated in this process

  7. A Protein Complex Map of Trypanosoma brucei

    PubMed Central

    Mehta, Vaibhav; Najafabadi, Hamed S.; Moshiri, Houtan; Jardim, Armando; Salavati, Reza

    2016-01-01

    The functions of the majority of trypanosomatid-specific proteins are unknown, hindering our understanding of the biology and pathogenesis of Trypanosomatida. While protein-protein interactions are highly informative about protein function, a global map of protein interactions and complexes is still lacking for these important human parasites. Here, benefiting from in-depth biochemical fractionation, we systematically interrogated the co-complex interactions of more than 3354 protein groups in procyclic life stage of Trypanosoma brucei, the protozoan parasite responsible for human African trypanosomiasis. Using a rigorous methodology, our analysis led to identification of 128 high-confidence complexes encompassing 716 protein groups, including 635 protein groups that lacked experimental annotation. These complexes correlate well with known pathways as well as for proteins co-expressed across the T. brucei life cycle, and provide potential functions for a large number of previously uncharacterized proteins. We validated the functions of several novel proteins associated with the RNA-editing machinery, identifying a candidate potentially involved in the mitochondrial post-transcriptional regulation of T. brucei. Our data provide an unprecedented view of the protein complex map of T. brucei, and serve as a reliable resource for further characterization of trypanosomatid proteins. The presented results in this study are available at: www.TrypsNetDB.org. PMID:26991453

  8. Blocking Synthesis of the Variant Surface Glycoprotein Coat in Trypanosoma brucei Leads to an Increase in Macrophage Phagocytosis Due to Reduced Clearance of Surface Coat Antibodies

    PubMed Central

    Cheung, Jackie L. Y.; Wand, Nadina V.; Ooi, Cher-Pheng; Ridewood, Sophie

    2016-01-01

    The extracellular bloodstream form parasite Trypanosoma brucei is supremely adapted to escape the host innate and adaptive immune system. Evasion is mediated through an antigenically variable Variant Surface Glycoprotein (VSG) coat, which is recycled at extraordinarily high rates. Blocking VSG synthesis triggers a precytokinesis arrest where stalled cells persist for days in vitro with superficially intact VSG coats, but are rapidly cleared within hours in mice. We therefore investigated the role of VSG synthesis in trypanosome phagocytosis by activated mouse macrophages. T. brucei normally effectively evades macrophages, and induction of VSG RNAi resulted in little change in phagocytosis of the arrested cells. Halting VSG synthesis resulted in stalled cells which swam directionally rather than tumbling, with a significant increase in swim velocity. This is possibly a consequence of increased rigidity of the cells due to a restricted surface coat in the absence of VSG synthesis. However if VSG RNAi was induced in the presence of anti-VSG221 antibodies, phagocytosis increased significantly. Blocking VSG synthesis resulted in reduced clearance of anti-VSG antibodies from the trypanosome surface, possibly as a consequence of the changed motility. This was particularly marked in cells in the G2/ M cell cycle stage, where the half-life of anti-VSG antibody increased from 39.3 ± 4.2 seconds to 99.2 ± 15.9 seconds after induction of VSG RNAi. The rates of internalisation of bulk surface VSG, or endocytic markers like transferrin, tomato lectin or dextran were not significantly affected by the VSG synthesis block. Efficient elimination of anti-VSG-antibody complexes from the trypanosome cell surface is therefore essential for trypanosome evasion of macrophages. These experiments highlight the essentiality of high rates of VSG recycling for the rapid removal of host opsonins from the parasite surface, and identify this process as a key parasite virulence factor during a

  9. Blocking Synthesis of the Variant Surface Glycoprotein Coat in Trypanosoma brucei Leads to an Increase in Macrophage Phagocytosis Due to Reduced Clearance of Surface Coat Antibodies.

    PubMed

    Cheung, Jackie L Y; Wand, Nadina V; Ooi, Cher-Pheng; Ridewood, Sophie; Wheeler, Richard J; Rudenko, Gloria

    2016-11-01

    The extracellular bloodstream form parasite Trypanosoma brucei is supremely adapted to escape the host innate and adaptive immune system. Evasion is mediated through an antigenically variable Variant Surface Glycoprotein (VSG) coat, which is recycled at extraordinarily high rates. Blocking VSG synthesis triggers a precytokinesis arrest where stalled cells persist for days in vitro with superficially intact VSG coats, but are rapidly cleared within hours in mice. We therefore investigated the role of VSG synthesis in trypanosome phagocytosis by activated mouse macrophages. T. brucei normally effectively evades macrophages, and induction of VSG RNAi resulted in little change in phagocytosis of the arrested cells. Halting VSG synthesis resulted in stalled cells which swam directionally rather than tumbling, with a significant increase in swim velocity. This is possibly a consequence of increased rigidity of the cells due to a restricted surface coat in the absence of VSG synthesis. However if VSG RNAi was induced in the presence of anti-VSG221 antibodies, phagocytosis increased significantly. Blocking VSG synthesis resulted in reduced clearance of anti-VSG antibodies from the trypanosome surface, possibly as a consequence of the changed motility. This was particularly marked in cells in the G2/ M cell cycle stage, where the half-life of anti-VSG antibody increased from 39.3 ± 4.2 seconds to 99.2 ± 15.9 seconds after induction of VSG RNAi. The rates of internalisation of bulk surface VSG, or endocytic markers like transferrin, tomato lectin or dextran were not significantly affected by the VSG synthesis block. Efficient elimination of anti-VSG-antibody complexes from the trypanosome cell surface is therefore essential for trypanosome evasion of macrophages. These experiments highlight the essentiality of high rates of VSG recycling for the rapid removal of host opsonins from the parasite surface, and identify this process as a key parasite virulence factor during a

  10. Outcome of acute East African trypanosomiasis in a Polish traveller treated with pentamidine

    PubMed Central

    2014-01-01

    Background African trypanosomiasis is a parasitic infection sporadically imported to Europe by tourists or immigrants returning from endemic areas. We present the first and an unusual case of East African trypanosomiasis imported to Poland by a patient returning from a tourist trip to Uganda and Rwanda, which was successfully treated with pentamidine. Case presentation A 61-year-old Polish man was admitted to the Department because of high-grade fever and multi-organ dysfunction after a tourist trip to East Africa. He experienced a single tsetse fly bite during a safari trip to the Queen Elizabeth National Park in Uganda. On admission, his clinical status was severe, with high fever of 41ºC, preceded by chills, bleeding from the gums and oral mucosa, haemorrhages at the sites of venipuncture, numerous ecchymoses, fine-spotted skin rash, tachycardia, hepatosplenomegaly, dehydration, jaundice, dyspnoea, hypoxaemia, generalised oedema and oliguria. There was a typical non-painful trypanosomal chancre with central necrosis and peripheral erythema on his left arm. Laboratory investigations showed leucopenia, thrombocytopenia, haemolytic anaemia, hyperbilirubinaemia, hypoglycaemia, elevated creatinine and urea, high activity of aminotransferases, elevated levels of inflammatory markers, hypoproteinaemia, proteinuria, abnormal clotting and bleeding times, low fibrinogen level, metabolic acidosis, and electrolyte disturbances. A peripheral blood smear showed numerous Trypanosoma brucei trypomastigotes with a massive parasitaemia of 100,000/μl. T. brucei rhodesiense subspecies was finally identified on the basis of the characteristic serum resistance-associated gene using a polymerase chain reaction, and a seroconversion of specific immunoglobulin M and G antibodies in the peripheral blood by enzyme-linked immunosorbent assay. Serological tests for T. brucei gambiense subspecies were negative. A severe clinical course of acute rhodesiense trypanosomiasis with renal

  11. Experimental chemotherapy of Trypanosoma cruzi infection: persistence of parasite antigens and positive serology in parasitologically cured mice.

    PubMed Central

    Andrade, S. G.; Freitas, L. A.; Peyrol, S.; Pimentel, A. R.; Sadigursky, M.

    1991-01-01

    Mice infected with Trypanosoma cruzi, but parasitologically cured after specific chemotherapy, continued to exhibit positive indirect immunofluorescence serological tests 3-6 months after the therapy. Treatment of trypanosome antigens with monospecific antisera produced in rabbits, and examination by immunoelectron-microscopy following peroxidase labelling disclosed the presence of membrane deposits in cell processes in the spleens of the mice. Similar deposits were observed in the external membranes of T. cruzi amastigotes in the spleens of acutely infected mice, but not in normal control mice. No reaction occurred in tissues not previously treated with the monospecific anti-T. cruzi serum. Positive cells in treated and cured mice, as well as in the not cured or untreated control mice, were located in germinal centres of the splenic white pulp and presented long and branching cytoplasmic processes, which are indicative of dendritic cells of the lymphoid follicles of the spleen. Images Fig. 1 Fig. 2 Fig. 3 PMID:1907221

  12. Depletion of CD8+ T cells suppresses growth of Trypanosoma brucei brucei and interferon-gamma) production in infected rats.

    PubMed Central

    Bakhiet, M; Olsson, T; van der Meide, P; Kristensson, K

    1990-01-01

    Sprague-Dawley rats infected with Trypanosoma brucei brucei showed a strong and rapid induction of splenocyte IFN-gamma (within 12 h post-infection) as measured by a single cell assay for IFN-gamma secretion. Depletion of CD8+ cells in infected rats abrogated the IFN-gamma production, suppressed parasite growth and increased survival of the animals. Induction of MHC class I antigens in the paraventricular and supra-optic hypothalamic nuclei caused by the trypanosome infection was also inhibited by the CD8+ cell depletion. It is suggested that the CD8+ cells are involved directly or indirectly in growth regulation of the parasite and that IFN-gamma induced by the parasite may be one of the factors that trigger MHC expression and immunosuppression. Images Fig. 4 Fig. 5 PMID:2143706

  13. The nuclear RNA binding protein RBP33 influences mRNA and spliced leader RNA abundance in Trypanosoma brucei.

    PubMed

    Cirovic, Olivera; Trikin, Roman; Hoffmann, Anneliese; Doiron, Nicholas; Jakob, Martin; Ochsenreiter, Torsten

    2017-03-01

    RNA recognition motif (RRM) containing proteins are important regulators of gene expression in trypanosomes. Here we expand our current knowledge on the exclusively nuclear localized RRM domain containing protein RBP33 of Trypanosoma brucei. Overexpression of RBP33 leads to a quick growth arrest in G2/M in bloodstream form cells likely due to an overall mRNA- and spliced leader abundance decrease while the ribosomal RNAs remain unaffected. The recombinant RBP33 binds to poly(A) and random sequence RNA in vitro confirming its role as a RNA binding protein. Finally super-resolution microscopy detects RBP33 in small punctae throughout the nucleus and surrounding the nucleolus, however the signal is depleted inside the nucleolus.

  14. Endemic type of animal trypanosomiasis is not associated with lower genotype variability of Trypanosoma congolense isolates circulating in livestock.

    PubMed

    Masumu, J; Geysen, D; Van den Bossche, P

    2009-10-01

    In order to verify whether the low impact on livestock production in endemic areas is related to a low number of trypanosome strains circulating in livestock, 37 Trypanosoma congolense isolates collected from cattle in 11 sites in an endemic trypanosomiasis area in Eastern Zambia were characterised for genotype variability using a modified amplified fragment length polymorphism technique (AFLP). Isolates were further cloned to evaluate the occurrence of mixed infections in individuals. The results obtained revealed a high genotype diversity (94.6%) among these isolates. Apart from one site, all isolates gave different AFLP profiles in each of the sites. When clones were compared, three (8%) of the 37 isolates had mixed infections. These results indicate the circulation of a high number of strains in this trypanosomiasis endemic area despite the low impact the disease has on livestock production.

  15. Dihydrofolate reductase: A potential drug target in trypanosomes and leishmania

    NASA Astrophysics Data System (ADS)

    Zuccotto, Fabio; Martin, Andrew C. R.; Laskowski, Roman A.; Thornton, Janet M.; Gilbert, Ian H.

    1998-05-01

    Dihydrofolate reductase has successfully been used as a drug target in the area of anti-cancer, anti-bacterial and anti-malarial chemotherapy. Little has been done to evaluate it as a drug target for treatment of the trypanosomiases and leishmaniasis. A crystal structure of Leishmania major dihydrofolate reductase has been published. In this paper, we describe the modelling of Trypanosoma cruzi and Trypanosoma brucei dihydrofolate reductases based on this crystal structure. These structures and models have been used in the comparison of protozoan, bacterial and human enzymes in order to highlight the different features that can be used in the design of selective anti-protozoan agents. Comparison has been made between residues present in the active site, the accessibility of these residues, charge distribution in the active site, and the shape and size of the active sites. Whilst there is a high degree of similarity between protozoan, human and bacterial dihydrofolate reductase active sites, there are differences that provide potential for selective drug design. In particular, we have identified a set of residues which may be important for selective drug design and identified a larger binding pocket in the protozoan than the human and bacterial enzymes.

  16. Allosteric regulation of an essential trypanosome polyamine biosynthetic enzyme by a catalytically dead homolog

    PubMed Central

    Willert, Erin K.; Fitzpatrick, Richard; Phillips, Margaret A.

    2007-01-01

    African sleeping sickness is a fatal disease that is caused by the protozoan parasite Trypanosoma brucei. Polyamine biosynthesis is an essential pathway in the parasite and is a validated drug target for treatment of the disease. S-adenosylmethionine decarboxylase (AdoMetDC) catalyzes a key step in polyamine biosynthesis. Here, we show that trypanosomatids uniquely contain both a functional AdoMetDC and a paralog designated prozyme that has lost catalytic activity. The T. brucei prozyme forms a high-affinity heterodimer with AdoMetDC that stimulates its activity by 1,200-fold. Both genes are expressed in T. brucei, and analysis of AdoMetDC activity in T. brucei extracts supports the finding that the heterodimer is the functional enzyme in vivo. Thus, prozyme has evolved to be a catalytically dead but allosterically active subunit of AdoMetDC, providing an example of how regulators of multimeric enzymes can evolve through gene duplication and mutational drift. These data identify a distinct mechanism for regulating AdoMetDC in the parasite that suggests new strategies for the development of parasite-specific inhibitors of the polyamine biosynthetic pathway. PMID:17485680

  17. The Trypanosome Flagellar Pocket Collar and Its Ring Forming Protein—TbBILBO1

    PubMed Central

    Perdomo, Doranda; Bonhivers, Mélanie; Robinson, Derrick R.

    2016-01-01

    Sub-species of Trypanosoma brucei are the causal agents of human African sleeping sickness and Nagana in domesticated livestock. These pathogens have developed an organelle-like compartment called the flagellar pocket (FP). The FP carries out endo- and exocytosis and is the only structure this parasite has evolved to do so. The FP is essential for parasite viability, making it an interesting structure to evaluate as a drug target, especially since it has an indispensible cytoskeleton component called the flagellar pocket collar (FPC). The FPC is located at the neck of the FP where the flagellum exits the cell. The FPC has a complex architecture and division cycle, but little is known concerning its organization. Recent work has focused on understanding how the FP and the FPC are formed and as a result of these studies an important calcium-binding, polymer-forming protein named TbBILBO1 was identified. Cellular biology analysis of TbBILBO1 has demonstrated its uniqueness as a FPC component and until recently, it was unknown what structural role it played in forming the FPC. This review summarizes the recent data on the polymer forming properties of TbBILBO1 and how these are correlated to the FP cytoskeleton. PMID:26950156

  18. Developmental regulation and extracellular release of a VSG expression-site-associated gene product from Trypanosoma brucei bloodstream forms.

    PubMed

    Barnwell, Eleanor M; van Deursen, Frederick J; Jeacock, Laura; Smith, Katherine A; Maizels, Rick M; Acosta-Serrano, Alvaro; Matthews, Keith

    2010-10-01

    Trypanosomes evade host immunity by exchanging variant surface glycoprotein (VSG) coats. VSG genes are transcribed from telomeric expression sites, which contain a diverse family of expression-site-associated genes (ESAGs). We have discovered that the mRNAs for one ESAG family, ESAG9, are strongly developmentally regulated, being enriched in stumpy forms, a life-cycle stage in the mammalian bloodstream that is important for the maintenance of chronic parasite infections and for tsetse transmission. ESAG9 gene sequences are highly diverse in the genome and encode proteins with weak similarity to the massively diverse MASP proteins in Trypanosoma cruzi. We demonstrate that ESAG9 proteins are modified by N-glycosylation and can be shed to the external milieu, this being dependent upon coexpression with at least one other family member. The expression profile and extracellular release of ESAG9 proteins represents a novel and unexpected aspect of the transmission biology of trypanosomes in their mammalian host. We suggest that these molecules might interact with the external environment, with possible implications for infection chronicity or parasite transmission.

  19. Antiproliferative effect of dihydroxyacetone on Trypanosoma brucei bloodstream forms: cell cycle progression, subcellular alterations, and cell death.

    PubMed

    Uzcátegui, Néstor L; Carmona-Gutiérrez, Didac; Denninger, Viola; Schoenfeld, Caroline; Lang, Florian; Figarella, Katherine; Duszenko, Michael

    2007-11-01

    We evaluated the effects of dihydroxyacetone (DHA) on Trypanosoma brucei bloodstream forms. DHA is considered an energy source for many different cell types. T. brucei takes up DHA readily due to the presence of aquaglyceroporins. However, the parasite is unable to use it as a carbon source because of the absence of DHA kinase (DHAK). We could not find a homolog of the relevant gene in the genomic database of T. brucei and have been unable to detect DHAK activity in cell lysates of the parasite, and the parasite died quickly if DHA was the sole energy source in the medium. In addition, during trypanosome cultivation, DHA induced growth inhibition with a 50% inhibitory concentration of about 1 mM, a concentration that is completely innocuous to mammals. DHA caused cell cycle arrest in the G(2)/M phase of up to 70% at a concentration of 2 mM. Also, DHA-treated parasites showed profound ultrastructural alterations, including an increase of vesicular structures within the cytosol and the presence of multivesicular bodies, myelin-like structures, and autophagy-like vacuoles, as well as a marked disorder of the characteristic mitochondrion structure. Based on the toxicity of DHA for trypanosomes compared with mammals, we consider DHA a starting point for a rational design of new trypanocidal drugs.

  20. 1H, 13C and 15N resonance assignment of the cytosolic dithiol glutaredoxin 1 from the pathogen Trypanosoma brucei.

    PubMed

    Stefani, Monica; Sturlese, Mattia; Manta, Bruno; Löhr, Frank; Mammi, Stefano; Comini, Marcelo; Bellanda, Massimo

    2016-04-01

    Trypanosomatids are parasites responsible for several tropical and subtropical diseases, such as Chaga's disease, sleeping sickness and Leishmaniasis. In contrast to the mammalian host, the thiol-redox metabolism of these pathogens depends on trypanothione [bis-glutathionylspermidine, T(SH)2] instead of glutathione (GSH) providing a set of lineage-specific proteins as drug target candidates. Glutaredoxins (Grx) are ubiquitous small thiol-disulfide oxidoreductases that belong to the thioredoxin-fold family. They play a central role in redox homeostasis and iron sulfur-cluster biogenesis. Each species, including trypanosomes, possesses its own set of isoforms distributed in different subcellular compartments. The genome of trypanosomatids encodes for two class I (dithiolic) Grxs named 2-C-Grx1 and 2-C-Grx2. Both proteins were shown to efficiently reduce different disulfides at the expenses of T(SH)2 using a mechanism that involves the two cysteines in the active site. Moreover, the cytosolic Trypanosoma brucei 2-C-Grx1 but not the mitochondrial 2-C-Grx2 was able to coordinate an iron-sulfur cluster with T(SH)2 or GSH as ligand. As a first step to unravel the structural basis for the specificity observed in the trypanosomal glutaredoxins, we present here the NMR resonance assignment of 2-C-Grx1 from the parasite T. brucei brucei.

  1. Reactive oxygen species activate a Ca2+-dependent cell death pathway in the unicellular organism Trypanosoma brucei brucei.

    PubMed

    Ridgley, E L; Xiong, Z H; Ruben, L

    1999-05-15

    Here we examine a cell death process induced by reactive oxygen species (ROS) in the haemoflagellate Trypanosoma brucei brucei. Ca2+ distribution in cellular compartments was measured with stable transformants expressing aequorin targeted to the cytosol, nucleus or mitochondrion. Within 1.5 h of ROS production, mitochondrial Ca2+ transport was impaired and the Ca2+ barrier between the nuclear envelope and cytosol was disrupted. Consequently the mitochondrion did not accumulate Ca2+ efficiently in response to an extracellular stimulus, and excess Ca2+ accumulated in the nucleus. The terminal transferase deoxytidyl uridine end labelling assay revealed that, 5 h after treatment with ROS, extensive fragmentation of nuclear DNA occurred in over 90% of the cells. Permeability changes in the plasma membrane did not occur until an additional 2 h had elapsed. The intracellular Ca2+ buffer, EGTA acetoxymethyl ester, prevented DNA fragmentation and prolonged the onset of changes in cell permeability. Despite some similarities to apoptosis, nuclease activation was not a consequence of caspase 3, caspase 1, calpain, serine protease, cysteine protease or proteasome activity. Moreover, trypanosomes expressing mouse Bcl-2 were not protected from ROS even though protection from mitochondrial dysfunction and ROS have been reported for mammalian cells. Overall, these results demonstrate that Ca2+ pathways can induce pathology in trypanosomes, although the specific proteins involved might be distinct from those in metazoans.

  2. Targeted Screening Strategies to Detect Trypanosoma cruzi Infection in Children

    PubMed Central

    Levy, Michael Z.; Kawai, Vivian; Bowman, Natalie M.; Waller, Lance A.; Cabrera, Lilia; Pinedo-Cancino, Viviana V.; Seitz, Amy E.; Steurer, Frank J.; Cornejo del Carpio, Juan G.; Cordova-Benzaquen, Eleazar; Maguire, James H.; Gilman, Robert H.; Bern, Caryn

    2007-01-01

    Background Millions of people are infected with Trypanosoma cruzi, the causative agent of Chagas disease in Latin America. Anti-trypanosomal drug therapy can cure infected individuals, but treatment efficacy is highest early in infection. Vector control campaigns disrupt transmission of T. cruzi, but without timely diagnosis, children infected prior to vector control often miss the window of opportunity for effective chemotherapy. Methods and Findings We performed a serological survey in children 2–18 years old living in a peri-urban community of Arequipa, Peru, and linked the results to entomologic, spatial and census data gathered during a vector control campaign. 23 of 433 (5.3% [95% CI 3.4–7.9]) children were confirmed seropositive for T. cruzi infection by two methods. Spatial analysis revealed that households with infected children were very tightly clustered within looser clusters of households with parasite-infected vectors. Bayesian hierarchical mixed models, which controlled for clustering of infection, showed that a child's risk of being seropositive increased by 20% per year of age and 4% per vector captured within the child's house. Receiver operator characteristic (ROC) plots of best-fit models suggest that more than 83% of infected children could be identified while testing only 22% of eligible children. Conclusions We found evidence of spatially-focal vector-borne T. cruzi transmission in peri-urban Arequipa. Ongoing vector control campaigns, in addition to preventing further parasite transmission, facilitate the collection of data essential to identifying children at high risk of T. cruzi infection. Targeted screening strategies could make integration of diagnosis and treatment of children into Chagas disease control programs feasible in lower-resource settings. PMID:18160979

  3. Arginine and Lysine Transporters Are Essential for Trypanosoma brucei

    PubMed Central

    Hürlimann, Daniel; Wirdnam, Corina; Haindrich, Alexander C.; Suter Grotemeyer, Marianne; González-Salgado, Amaia; Schmidt, Remo S.; Inbar, Ehud; Mäser, Pascal; Bütikofer, Peter; Zilberstein, Dan; Rentsch, Doris

    2017-01-01

    For Trypanosoma brucei arginine and lysine are essential amino acids and therefore have to be imported from the host. Heterologous expression in Saccharomyces cerevisiae mutants identified cationic amino acid transporters among members of the T. brucei AAAP (amino acid/auxin permease) family. TbAAT5-3 showed high affinity arginine uptake (Km 3.6 ± 0.4 μM) and high selectivity for L-arginine. L-arginine transport was reduced by a 10-times excess of L-arginine, homo-arginine, canavanine or arginine-β-naphthylamide, while lysine was inhibitory only at 100-times excess, and histidine or ornithine did not reduce arginine uptake rates significantly. TbAAT16-1 is a high affinity (Km 4.3 ± 0.5 μM) and highly selective L-lysine transporter and of the compounds tested, only L-lysine and thialysine were competing for L-lysine uptake. TbAAT5-3 and TbAAT16-1 are expressed in both procyclic and bloodstream form T. brucei and cMyc-tagged proteins indicate localization at the plasma membrane. RNAi-mediated down-regulation of TbAAT5 and TbAAT16 in bloodstream form trypanosomes resulted in growth arrest, demonstrating that TbAAT5-mediated arginine and TbAAT16-mediated lysine transport are essential for T. brucei. Growth of induced RNAi lines could partially be rescued by supplementing a surplus of arginine or lysine, respectively, while addition of both amino acids was less efficient. Single and double RNAi lines indicate that additional low affinity uptake systems for arginine and lysine are present in T. brucei. PMID:28045943

  4. The molecular size of the extra-membrane domain influences the diffusion of the GPI-anchored VSG on the trypanosome plasma membrane.

    PubMed

    Hartel, Andreas J W; Glogger, Marius; Guigas, Gernot; Jones, Nicola G; Fenz, Susanne F; Weiss, Matthias; Engstler, Markus

    2015-06-11

    A plethora of proteins undergo random and passive diffusion in biological membranes. While the contribution of the membrane-embedded domain to diffusion is well established, the potential impact of the extra-membrane protein part has been largely neglected. Here, we show that the molecular length influences the diffusion coefficient of GPI-anchored proteins: smaller proteins diffuse faster than larger ones. The distinct diffusion properties of differently sized membrane proteins are biologically relevant. The variant surface glycoprotein (VSG) of African trypanosomes, for example, is sized for an effective diffusion-driven randomization on the cell surface, a process that is essential for parasite virulence. We propose that the molecular sizes of proteins dominating the cell surfaces of other eukaryotic pathogens may also be related to diffusion-limited functions.

  5. Rhodnius prolixus: from physiology by Wigglesworth to recent studies of immune system modulation by Trypanosoma cruzi and Trypanosoma rangeli.

    PubMed

    Azambuja, P; Garcia, E S; Waniek, P J; Vieira, C S; Figueiredo, M B; Gonzalez, M S; Mello, C B; Castro, D P; Ratcliffe, N A

    This review is dedicated to the memory of Professor Sir Vincent B. Wigglesworth (VW) in recognition of his many pioneering contributions to insect physiology which, even today, form the basis of modern-day research in this field. Insects not only make vital contributions to our everyday lives by their roles in pollination, balancing eco-systems and provision of honey and silk products, but they are also outstanding models for studying the pathogenicity of microorganisms and the functioning of innate immunity in humans. In this overview, the immune system of the triatomine bug, Rhodnius prolixus, is considered which is most appropriate to this dedication as this insect species was the favourite subject of VW's research. Herein are described recent developments in knowledge of the functioning of the R. prolixus immune system. Thus, the roles of the cellular defences, such as phagocytosis and nodule formation, as well as the role of eicosanoids, ecdysone, antimicrobial peptides, reactive oxygen and nitrogen radicals, and the gut microbiota in the immune response of R. prolixus are described. The details of many of these were unknown to VW although his work gives indications of his awareness of the importance to R. prolixus of cellular immunity, antibacterial activity, prophenoloxidase and the gut microbiota. This description of R. prolixus immunity forms a backdrop to studies on the interaction of the parasitic flagellates, Trypanosoma cruzi and Trypanosoma rangeli, with the host defences of this important insect vector. These parasites remarkably utilize different strategies to avoid/modulate the triatomine immune response in order to survive in the extremely hostile host environments present in the vector gut and haemocoel. Much recent information has also been gleaned on the remarkable diversity of the immune system in the R. prolixus gut and its interaction with trypanosome parasites. This new data is reviewed and gaps in our knowledge of R. prolixus immunity are

  6. Depletion of the Trypanosome Pumilio Domain Protein PUF2 or of Some Other Essential Proteins Causes Transcriptome Changes Related to Coding Region Length

    PubMed Central

    Jha, Bhaskar Anand; Fadda, Abeer; Merce, Clementine; Mugo, Elisha; Droll, Dorothea

    2014-01-01

    Pumilio domain RNA-binding proteins are known mainly as posttranscriptional repressors of gene expression that reduce mRNA translation and stability. Trypanosoma brucei has 11 PUF proteins. We show here that PUF2 is in the cytosol, with roughly the same number of molecules per cell as there are mRNAs. Although PUF2 exhibits a low level of in vivo RNA binding, it is not associated with polysomes. PUF2 also decreased reporter mRNA levels in a tethering assay, consistent with a repressive role. Depletion of PUF2 inhibited growth of bloodstream-form trypanosomes, causing selective loss of mRNAs with long open reading frames and increases in mRNAs with shorter open reading frames. Reexamination of published RNASeq data revealed the same trend in cells depleted of some other proteins. We speculate that these length effects could be caused by inhibition of the elongation phase of transcription or by an influence of translation status or polysomal conformation on mRNA decay. PMID:24681684

  7. A phylogenetic lineage of closely related trypanosomes (Trypanosomatidae, Kinetoplastida) of anurans and sand flies (Psychodidae, Diptera) sharing the same ecotopes in brazilian amazonia.

    PubMed

    Ferreira, Robson C; De Souza, Adelson A; Freitas, Rui A; Campaner, Marta; Takata, Carmem S A; Barrett, Toby V; Shaw, Jeffrey J; Teixeira, Marta M G

    2008-01-01

    Analysis of the phylogenetic relationships among trypanosomes from vertebrates and invertebrates disclosed a new lineage of trypanosomes circulating among anurans and sand flies that share the same ecotopes in Brazilian Amazonia. This assemblage of closely related trypanosomes was determined by comparing whole SSU rDNA sequences of anuran trypanosomes from the Brazilian biomes of Amazonia, the Pantanal, and the Atlantic Forest and from Europe, North America, and Africa, and from trypanosomes of sand flies from Amazonia. Phylogenetic trees based on maximum likelihood and parsimony corroborated the positioning of all new anuran trypanosomes in the aquatic clade but did not support the monophyly of anuran trypanosomes. However, all analyses always supported four major clades (An01-04) of anuran trypanosomes. Clade An04 is composed of trypanosomes from exotic anurans. Isolates in clades An01 and An02 were from Brazilian frogs and toads captured in the three biomes studied, Amazonia, the Pantanal and the Atlantic Forest. Clade An01 contains mostly isolates from Hylidae whereas clade An02 comprises mostly isolates from Bufonidae; and clade An03 contains trypanosomes from sand flies and anurans of Bufonidae, Leptodactylidae, and Leiuperidae exclusively from Amazonia. To our knowledge, this is the first study describing morphological and growth features, and molecular phylogenetic affiliation of trypanosomes from anurans and phlebotomines, incriminating these flies as invertebrate hosts and probably also as important vectors of Amazonian terrestrial anuran trypanosomes.

  8. Anti-trypanosomal activity of non-peptidic nitrile-based cysteine protease inhibitors

    PubMed Central

    Burtoloso, Antonio C. B.; de Albuquerque, Sérgio; Furber, Mark; Gomes, Juliana C.; Gonçalez, Cristiana; Kenny, Peter W.; Leitão, Andrei; Quilles, José Carlos; Ribeiro, Jean F. R.; Rocha, Josmar R.

    2017-01-01

    The cysteine protease cruzipain is considered to be a validated target for therapeutic intervention in the treatment of Chagas disease. Anti-trypanosomal activity against the CL Brener strain of T. cruzi was observed in the 0.1 μM to 1 μM range for three nitrile-based cysteine protease inhibitors based on two scaffolds known to be associated with cathepsin K inhibition. The two compounds showing the greatest potency against the trypanosome were characterized by EC50 values (0.12 μM and 0.25 μM) that were an order of magnitude lower than the corresponding Ki values measured against cruzain, a recombinant form of cruzipain, in an enzyme inhibition assay. This implies that the anti-trypanosomal activity of these two compounds may not be explained only by the inhibition of the cruzain enzyme, thereby triggering a putative polypharmacological profile towards cysteine proteases. PMID:28222138

  9. The blood parasites of anurans from Costa Rica with reflections on the taxonomy of their trypanosomes.

    PubMed

    Desser, S S

    2001-02-01

    During May 1997, specimens of 7 species of anurans, that included 5 Phrynohyas venulosa Laurenti, 5 Rana forreri Boulenger, 7 Rana vaillanti Brucchi, 6 Eleutherodactylus fitzingeri Schimdt, 4 Smilisca baudinii Duméril and Bibron, 1 Leptodactylus melanonotus, and 3 Bufo marinus Linneaus, from the Guanacaste Conservation Area, Costa Rica were examined for blood parasites. Their hematozoan fauna included intraerythrocytic and intraleukocytic icosahedral viruses, a rickettsia (Aegyptianella sp.), 2 species of Hepatozoon, Lankesterella minima, 2 unknown species of apicomplexans, 9 morphologically distinct types of trypanosomes, and 2 species of microfilariae. Rana vaillanti, the most aquatic species of frog, harbored the most species of parasites. Recent evidence indicates that morphological changes in the highly pleomorphic trypanosomes of anurans from different geographical regions have not kept pace with biochemical (isozyme) and molecular (DNA sequence) changes. Describing new species based solely on bloodstream trypomastigotes is discouraged. Additional criteria described herein should be applied when naming new species of anuran trypanosomes.

  10. Detection of trypanosomes in suspected sleeping sickness patients in Uganda using the polymerase chain reaction.

    PubMed Central

    Kyambadde, J. W.; Enyaru, J. C.; Matovu, E.; Odiit, M.; Carasco, J. F.

    2000-01-01

    Diagnosis of sleeping sickness (trypanosomiasis) is difficult because of the fluctuating levels of parasitaemia encountered in patients. In the present study we found that the polymerase chain reaction (PCR) demonstrated trypanosome infection in 20 out of 35 (57.1%) blood samples and in 21 out of 34 (61.7%) cerebrospinal fluid (CSF) samples collected from an area endemic for sleeping sickness in north-west Uganda. A total of 14 blood samples and 13 CSF samples that were positive for trypanosomes by double centrifugation were also positive by PCR, demonstrating good concordance between the two methods. However, 6 (28.6%) of the 21 blood samples that were parasitologically negative were positive by PCR, while 8 (38.0%) out of 21 CSF samples that were negative by double centrifugation were positive by PCR. These 14 negative samples could therefore be from sleeping sickness cases even though a positive PCR test is not evidence for the presence of trypanosomes. Furthermore, of these 8 CSF samples, 4 had been designated as early cases, based on the absence of trypanosomes and on a count of < or = 5 white blood cells (WBC) per microliter. This suggests that some late-stage cases could potentially be missed according to the present criteria, and it is therefore important to perform clinical trials to determine whether these cases could be treated successfully with the first-stage drug alone. The remaining four CSF samples had been classified as late-stage cases, based on a count of > 6 WBC per microliter, even though trypanosomes could not be detected in these samples by either double centrifugation or PCR. A cut-off point of 5 WBC per microliter, which is used as a rule of thumb to stage sleeping sickness patients, seems to leave some late-stage cases undetected since trypanosomes were detected in four CSF samples from suspected cases with < 5 WBC per microliter. PMID:10686746

  11. Detection of trypanosomes in suspected sleeping sickness patients in Uganda using the polymerase chain reaction.

    PubMed

    Kyambadde, J W; Enyaru, J C; Matovu, E; Odiit, M; Carasco, J F

    2000-01-01

    Diagnosis of sleeping sickness (trypanosomiasis) is difficult because of the fluctuating levels of parasitaemia encountered in patients. In the present study we found that the polymerase chain reaction (PCR) demonstrated trypanosome infection in 20 out of 35 (57.1%) blood samples and in 21 out of 34 (61.7%) cerebrospinal fluid (CSF) samples collected from an area endemic for sleeping sickness in north-west Uganda. A total of 14 blood samples and 13 CSF samples that were positive for trypanosomes by double centrifugation were also positive by PCR, demonstrating good concordance between the two methods. However, 6 (28.6%) of the 21 blood samples that were parasitologically negative were positive by PCR, while 8 (38.0%) out of 21 CSF samples that were negative by double centrifugation were positive by PCR. These 14 negative samples could therefore be from sleeping sickness cases even though a positive PCR test is not evidence for the presence of trypanosomes. Furthermore, of these 8 CSF samples, 4 had been designated as early cases, based on the absence of trypanosomes and on a count of < or = 5 white blood cells (WBC) per microliter. This suggests that some late-stage cases could potentially be missed according to the present criteria, and it is therefore important to perform clinical trials to determine whether these cases could be treated successfully with the first-stage drug alone. The remaining four CSF samples had been classified as late-stage cases, based on a count of > 6 WBC per microliter, even though trypanosomes could not be detected in these samples by either double centrifugation or PCR. A cut-off point of 5 WBC per microliter, which is used as a rule of thumb to stage sleeping sickness patients, seems to leave some late-stage cases undetected since trypanosomes were detected in four CSF samples from suspected cases with < 5 WBC per microliter.

  12. Specific primers for PCR amplification of the ITS1 (ribosomal DNA) of Trypanosoma lewisi.

    PubMed

    Desquesnes, Marc; Marc, Desquesnes; Kamyingkird, Ketsarin; Ketsarin, Kamyingkird; Yangtara, Sarawut; Sarawut, Yangtara; Milocco, Cristina; Cristina, Milocco; Ravel, Sophie; Sophie, Ravel; Wang, Ming-Hui; Ming-Hui, Wang; Lun, Zhao-Rong; Zhao-Rong, Lun; Morand, Serge; Serge, Morand; Jittapalapong, Sathaporn; Sathaporn, Jittapalapong

    2011-08-01

    Trypanosoma lewisi is a mild or non-pathogenic parasite of the sub-genus Herpetosoma transmitted by fleas to rats. In a previous study we described pan-trypanosome specific primers TRYP1 which amplify the ITS1 of ribosomal DNA by hybridizing in highly conserved regions of 18S and 5.8S genes. These primers proved to be useful for detecting T. lewisi DNA in laboratory rats, but a recent large scale survey in wild rodents demonstrated a lack of specificity. In the present study, we designed and evaluated mono-specific primers LEW1S and LEW1R, for the detection and identification of T. lewisi by a single-step PCR. These primers were designed inside the highly variable region of the ITS1 sequence of T. lewisi ribosomal DNA. The product size of 220 bp is specific to T. lewisi. The sensitivity limit was estimated between 0.055 and 0.55 pg of DNA per reaction, equivalent to 1-10 organisms per reaction. All the PCR products obtained from 6 different T. lewisi isolates were more than 98% similar with each other and similar to the sequences of T. lewisi already published in Genbank. All DNA of 7 T. lewisi stocks from China gave the specific 220 bp product. We showed that LEW1S and LEW1R primers enabled sensitive detection and identification of T. lewisi infection in laboratory and wild rats. This assay is recommended for monitoring T. lewisi infections in rat colonies or for studying infections in the wild fauna. An absence of cross reaction with human DNA means that these primers can be used to investigate atypical trypanosome infections in humans. Given the risk of T. lewisi infection in human, we believe that these primers will be beneficial for public health diagnosis and rodents investigation programmes.

  13. Capturing the variant surface glycoprotein repertoire (the VSGnome) of Trypanosoma brucei Lister 427.

    PubMed

    Cross, George A M; Kim, Hee-Sook; Wickstead, Bill

    2014-06-01

    Trypanosoma brucei evades the adaptive immune response through the expression of antigenically distinct Variant Surface Glycoprotein (VSG) coats. To understand the progression and mechanisms of VSG switching, and to identify the VSGs expressed in populations of trypanosomes, it is desirable to predetermine the available repertoire of VSG genes (the 'VSGnome'). To date, the catalog of VSG genes present in any strain is far from complete and the majority of current information regarding VSGs is derived from the TREU927 strain that is not commonly used as an experimental model. We have assembled, annotated and analyzed 2563 distinct and previously unsequenced genes encoding complete and partial VSGs of the widely used Lister 427 strain of T. brucei. Around 80% of the VSGnome consists of incomplete genes or pseudogenes. Read-depth analysis demonstrated that most VSGs exist as single copies, but 360 exist as two or more indistinguishable copies. The assembled regions include five functional metacyclic VSG expression sites. One third of minichromosome sub-telomeres contain a VSG (64-67 VSGs on ∼96 minichromosomes), of which 85% appear to be functionally competent. The minichromosomal repertoire is very dynamic, differing among clones of the same strain. Few VSGs are unique along their entire length: frequent recombination events are likely to have shaped (and to continue to shape) the repertoire. In spite of their low sequence conservation and short window of expression, VSGs show evidence of purifying selection, with ∼40% of non-synonymous mutations being removed from the population. VSGs show a strong codon-usage bias that is distinct from that of any other group of trypanosome genes. VSG sequences are generally very divergent between Lister 427 and TREU927 strains of T. brucei, but those that are highly similar are not found in 'protected' genomic environments, but may reflect genetic exchange among populations.

  14. Active infection and morphometric study of Trypanosoma evansi among horses in Peninsula Malaysia.

    PubMed

    Elshafie, E I; Sani, R A; Hassan, L; Sharma, R; Bashir, A; Abubakar, I A

    2013-09-01

    Apart from occasional reports of clinical disease affecting horses, there is no information about Trypanosoma evansi in horses in Peninsula Malaysia. Thus, a cross-sectional study was conducted in eight states in Peninsula Malaysia to determine the active presence of T. evansi in horses. A total of 527 blood samples were obtained and examined by haematocrit centrifugation technique (HCT), Giemsa-stained thin blood smear (GSS), morphometric measurements, polymerase chain reaction (PCR) and cloning of PCR products. The results showed an overall parasitological prevalence of 0.57% (3/527, CI: 1.6-0.19%) with both HCT and GSS. Morphometric study revealed the mean total length of the trypanosomes including the free flagellum was 27.94 ± 2.63 μm. PCR successfully amplified a trypanosome specific 257 bp in 1.14% of samples (6/527, CI: 2.4-0.52%) and was confirmed by nucleotide sequences. The mean packed cell volume (PCV) for the positive cases detected by HCT was lower (23% ± 7.00) compared to the positive cases detected by PCR alone in the state of Terengganu (35% ± 4.73). In conclusion, this study showed T. evansi infection occurred in low frequency in horses in Peninsula Malaysia, and anaemia coincided with parasitaemic animals. PCR is considered as a sensitive diagnostic tool when parasitaemia is undetectable. The slight lengthier mean of parasite and anaemia may indicate a virulent strain of T. evansi circulating throughout the country. Thus, it's highly recommended to shed light on host-parasite relationship for better epidemiological understanding.

  15. Distribution and Characterization of Antigens Found in Subcellular Fractions of African Trypanosomes.

    DTIC Science & Technology

    1979-08-01

    and T. brucei Voorhies et al 1979), with the possible exception of Acanthamoeba custellani (Schultz and Thompson 1969), all demonstrate low...in membrane fragments isolated from Acanthamoeba sp. Biochem. Biophys. Acta 193 203-211. Voorheis, H.P. Gale, J.S., Owen, M.J. and Edwards W. (1979

  16. Distribution and Characterization of Antigens Found in Subcellular Fractions of African Trypanosomes.

    DTIC Science & Technology

    1985-09-01

    affinity Ca-ATPase which we have described (2). Less specific acid phosphatases were also considered as potential surface membrane 3 markers since... acid phosphatase (0-glycerophosphate), arylamidase; promito- chondria -- DCPIP linked c-glycerophosphate dehydrogenase; lysosome -- proteinase...glucose-6- phosphatase , that were present in a I. brucei surface membrane preparation (22) are almost certainly due to the tartrate resistant acid

  17. Distribution and Characterization of Antigens Found in Subcellular Fractions of African Trypanosomes.

    DTIC Science & Technology

    1982-08-01

    measured for relative fluorescence. These details are ndicated in Fig. A. ii. Lecting affinity chromatography. Either lentil lectin seph- arose 4B or...Zwaal, R.F.A. 1976. The use of phospholipases in the determination of asymmetric phospholipid distribution in membranes. In Methods in Membrane Biology 7...research. In Methods in Membrane Biology , Vol. 8 (Korn, E.D., ed.), pp. 1-50. 26 Enzyme Membrane Fraction Phosphatase SM FPM -glycerophosphate 10 15

  18. Anti-trypanosomal activity of pentacyclic triterpenes isolated from Austroplenckia populnea (Celastraceae).

    PubMed

    Duarte, Lucienir Pains; Vieira Filho, Sidney Augusto; Silva, Grácia Divina de Fátima; de Sousa, José Rego; Pinto, Artur da Silveira

    2002-01-01

    Four pentacyclic triterpenes isolated from Austroplenckia populnea and four compounds of known anti T. cruzi or anti-malarial activity were tested. Of those triterpenes tested 20alpha-hydroxy-tingenone showed high activity, epikatonic acid was less active, while populnilic and populninic acids were inactive against the trypanosome of the subgenus Schizotrypanum tested. Benzonidazole, nifurtimox, ketoconazole and primaquine presented a remarkable dose-dependent inhibitory effect reaching practically to a total growth inhibition of the parasite at the end of incubation time. The trypanosome tested appear to be a suitable model for preliminary screen for anti T. (S.) cruzi compounds.

  19. First Detection of Leishmania tropica DNA and Trypanosoma Species in Sergentomyia Sand Flies (Diptera: Psychodidae) from an Outbreak Area of Cutaneous Leishmaniasis in Ghana

    PubMed Central

    Nzelu, Chukwunonso O.; Kato, Hirotomo; Puplampu, Naiki; Desewu, Kwame; Odoom, Shirley; Wilson, Michael D.; Sakurai, Tatsuya; Katakura, Ken; Boakye, Daniel A.

    2014-01-01

    Background Leishmania major and an uncharacterized species have been reported from human patients in a cutaneous leishmaniasis (CL) outbreak area in Ghana. Reports from the area indicate the presence of anthropophilic Sergentomyia species that were found with Leishmania DNA. Methodology/Principal Findings In this study, we analyzed the Leishmania DNA positive sand fly pools by PCR-RFLP and ITS1 gene sequencing. The trypanosome was determined using the SSU rRNA gene sequence. We observed DNA of L. major, L. tropica and Trypanosoma species to be associated with the sand fly infections. This study provides the first detection of L. tropica DNA and Trypanosoma species as well as the confirmation of L. major DNA within Sergentomyia sand flies in Ghana and suggests that S. ingrami and S. hamoni are possible vectors of CL in the study area. Conclusions/Significance The detection of L. tropica DNA in this CL focus is a novel finding in Ghana as well as West Africa. In addition, the unexpected infection of Trypanosoma DNA within S. africana africana indicates that more attention is necessary when identifying parasitic organisms by PCR within sand fly vectors in Ghana and other areas where leishmaniasis is endemic. PMID:24516676

  20. The Oral Antimalarial Drug Tafenoquine Shows Activity against Trypanosoma brucei

    PubMed Central

    Carvalho, Luis; Martínez-García, Marta; Pérez-Victoria, Ignacio; Manzano, José Ignacio; Yardley, Vanessa

    2015-01-01

    The protozoan parasite Trypanosoma brucei causes human African trypanosomiasis, or sleeping sickness, a neglected tropical disease that requires new, safer, and more effective treatments. Repurposing oral drugs could reduce both the time and cost involved in sleeping sickness drug discovery. Tafenoquine (TFQ) is an oral antimalarial drug belonging to the 8-aminoquinoline family which is currently in clinical phase III. We show here that TFQ efficiently kills different T. brucei spp. in the submicromolar concentration range. Our results suggest that TFQ accumulates into acidic compartments and induces a necrotic process involving cell membrane disintegration and loss of cytoplasmic content, leading to parasite death. Cell lysis is preceded by a wide and multitarget drug action, affecting the lysosome, mitochondria, and acidocalcisomes and inducing a depolarization of the mitochondrial membrane potential, elevation of intracellular Ca2+, and production of reactive oxygen species. This is the first report of an 8-aminoquinoline demonstrating significant in vitro activity against T. brucei. PMID:26195527

  1. PCR amplification of RoTat 1.2 VSG gene in Trypanosoma evansi isolates in Kenya.

    PubMed

    Ngaira, J M; Njagi, E N M; Ngeranwa, J J N; Olembo, N K

    2004-02-26

    A direct card agglutination test for Trypanosoma evansi, CATT/T. evansi based on the predominant variable antigen-type (pVAT) RoTat 1.2 was evaluated previously in the field in Isiolo District, Kenya. Sixteen out of 51 (31.4%) parasitologically positive camels were negative by the antibody detection test. In the present study, trypanosomes isolated from the camels were analysed in an attempt to determine the cause of the false negative results of CATT/T. evansi. A total of 20 field isolates comprised 16 stocks from camels that were negative by CATT/T. evansi, and 4 from CATT/T. evansi-positive camels. In addition, 15 known T. evansi and four T. brucei were used as reference. Purified DNA samples were tested using an established RoTat 1.2-based polymerase chain reaction (PCR) that yields a 488 bp product for the specific detection of T. evansi. Antibodies to RoTat 1.2 variant surface glycoprotein (VSG) were used in Western blotting to detect RoTat 1.2 VSG linear epitopes. Results of PCR and Western blot showed that the 16 stocks isolated from CATT/T. evansi-negative camels fell into three groups. In Group 1, both the RoTat 1.2 VSG gene and the VSG were absent in three stocks. In five trypanosome stocks in Group 2, the RoTat 1.2 VSG gene was detected, but Western blot was negative indicating absence of the expressed VSG. Five other stocks containing the RoTat 1.2 VSG gene were also in this group. The RoTat 1.2 VSG gene was detected and Western blot was positive in all four trypanosome stocks in Group 3. All four stocks from CATT/T. evansi-positive camels contained the RoTat 1.2 VSG gene and the expressed VSG. The reference T. evansi KETRI 2479 lacked the RoTat 1.2 VSG gene and there was no immune reactivity detected by Western blot. The rest of the reference T. evansi stocks examined contained the RoTat 1.2 VSG gene. All the four T. brucei samples examined were negative by PCR and Western blot. In conclusion, this study showed that the RoTat 1.2 VSG gene was absent

  2. Unraveling the differences of the hydrolytic activity of Trypanosoma cruzi trans-sialidase and Trypanosoma rangeli sialidase: a quantum mechanics-molecular mechanics modeling study.

    PubMed

    Bueren-Calabuig, Juan A; Pierdominici-Sottile, Gustavo; Roitberg, Adrian E

    2014-06-05

    Chagas' disease, also known as American trypanosomiasis, is a lethal, chronic disease that currently affects more than 10 million people in Central and South America. The trans-sialidase from Trypanosoma cruzi (T. cruzi, TcTS) is a crucial enzyme for the survival of this parasite: sialic acids from the host are transferred to the cell surface glycoproteins of the trypanosome, thereby evading the host's immune system. On the other hand, the sialidase of T. rangeli (TrSA), which shares 70% sequence identity with TcTS, is a strict hydrolase and shows no trans-sialidase activity. Therefore, TcTS and TrSA represent an excellent framework to understand how different catalytic activities can be achieved with extremely similar structures. By means of combined quantum mechanics-molecular mechanics (QM/MM, SCC-DFTB/Amberff99SB) calculations and umbrella sampling simulations, we investigated the hydrolysis mechanisms of TcTS and TrSA and computed the free energy profiles of these reactions. The results, together with our previous computational investigations, are able to explain the catalytic mechanism of sialidases and describe how subtle differences in the active site make TrSA a strict hydrolase and TcTS a more efficient trans-sialidase.

  3. Characterization of Antibody-Dependent Killing of Trypanosomes by Macrophages.

    DTIC Science & Technology

    1985-01-01

    T. RHODESIENSE TO MACROPHAGES The role of complement in resistance to African trypanosomiasis remains controversial (Ferrante and Jenkins, 1978... trypanosomiasis . 59:283-292. 17. Silverstein, S.C. 1977. Endocytic uptake of particles by mononuclear phagocytes and the penetration of obligate

  4. Isolation of Trypanosoma brucei from the monitor lizard (Varanus niloticus) in an endemic focus of Rhodesian sleeping sickness in Kenya.

    PubMed

    Njagu, Z; Mihok, S; Kokwaro, E; Verloo, D

    1999-03-15

    Monitor lizards were sampled along the shores of Lake Victoria to detect natural infections of potentially human-infective trypanosomes. In an area with endemic rhodesian sleeping sickness, one of 19 lizards was infected (Busia, Kenya). Six of ten lizards also showed indirect evidence of infection with Trypanosoma brucei (antibody ELISA). In an area with no recent history of human disease (Rusinga Island), no parasites were found and no antibodies to T. brucei were detected. The isolate was identified as T. brucei through xenodiagnosis (completion of the life cycle in the salivary glands of tsetse), and through molecular techniques (positive reactions with a PCR primer and a microsatellite DNA probe characteristic of the subgenus Trypanozoon). Experimental infections of monitor lizards were also attempted with a variety of parasites and tsetse species. It was possible to infect monitor lizards with T. brucei but not with forest or savannah genotypes of Trypanosoma congolense. Parasites reached low levels of parasitaemia for a short period without generating any pathology; they also remained infective to tsetse and laboratory rats. The implications of these findings are discussed in relation to the endemicity of sleeping sickness.

  5. Trypanosoma evansi and Surra: A Review and Perspectives on Origin, History, Distribution, Taxonomy, Morphology, Hosts, and Pathogenic Effects

    PubMed Central

    Desquesnes, Marc; Holzmuller, Philippe; Lai, De-Hua; Dargantes, Alan; Lun, Zhao-Rong; Jittaplapong, Sathaporn

    2013-01-01

    Trypanosoma evansi, the agent of “surra,” is a salivarian trypanosome, originating from Africa. It is thought to derive from Trypanosoma brucei by deletion of the maxicircle kinetoplastic DNA (genetic material required for cyclical development in tsetse flies). It is mostly mechanically transmitted by tabanids and stomoxes, initially to camels, in sub-Saharan area. The disease spread from North Africa towards the Middle East, Turkey, India, up to 53° North in Russia, across all South-East Asia, down to Indonesia and the Philippines, and it was also introduced by the conquistadores into Latin America. It can affect a very large range of domestic and wild hosts including camelids, equines, cattle, buffaloes, sheep, goats, pigs, dogs and other carnivores, deer, gazelles, and elephants. It found a new large range of wild and domestic hosts in Latin America, including reservoirs (capybaras) and biological vectors (vampire bats). Surra is a major disease in camels, equines, and dogs, in which it can often be fatal in the absence of treatment, and exhibits nonspecific clinical signs (anaemia, loss of weight, abortion, and death), which are variable from one host and one place to another; however, its immunosuppressive effects interfering with intercurrent diseases or vaccination campaigns might be its most significant and questionable aspect. PMID:24024184

  6. GPI anchor transamidase of Trypanosoma brucei: in vitro assay of the recombinant protein and VSG anchor exchange.

    PubMed

    Kang, Xuedong; Szallies, Alexander; Rawer, Marc; Echner, Hartmut; Duszenko, Michael

    2002-06-15

    GPI8 from Trypanosoma brucei was cloned and expressed in Escherichia coli. TbGPI8 encodes a 37 kDa protein (35 kDa after removal of the putative signal sequence) with a pI of 5.5. It contains one potential N-glycosylation site near the N-terminus but no C-terminal hydrophobic region. Enzyme activity assays using trypanosomal lysates or recombinant TbGpi8 exhibited cleavage of the synthetic peptide acetyl-S-V-L-N-aminomethyl-coumarine, indicating that TbGpi8 is indeed directly involved in the proteolytic processing of the GPI anchoring signal. Intracellular localization of TbGpi8 within tubular structures, such as the endoplasmic reticulum, was observed by using specific anti-TbGpi8 antibodies. The transamidase mechanism of GPI anchoring was studied in bloodstream forms of Trypanosoma brucei using media containing hydrazine or biotinylated hydrazine. In the presence of the latter nucleophile, part of the newly formed VSG was linked to this instead of the GPI anchor and was not transferred to the cell surface. VSG-hydrazine-biotin was detected by streptavidin in western blots and intracellularly in Golgi-like compartments.

  7. Trypanosoma evansi and Surra: A Review and Perspectives on Transmission, Epidemiology and Control, Impact, and Zoonotic Aspects

    PubMed Central

    Desquesnes, Marc; Dargantes, Alan; Lai, De-Hua; Lun, Zhao-Rong; Holzmuller, Philippe; Jittapalapong, Sathaporn

    2013-01-01

    This paper reviews the transmission modes of Trypanosoma evansi. Its worldwide distribution is attributed to mechanical transmission. While the role of tabanids is clear, we raise questions on the relative role of Haematobia sp. and the possible role of Stomoxys sp. in delayed transmission. A review of the available trypanocidal drugs and their efficacy in various host species is useful for understanding how they interact in disease epidemiology, which is complex. Although there are similarities with other mechanically transmitted trypanosomes, T. evansi has a more complex epidemiology due to the diversity of its hosts and vectors. The impact of clinical and subclinical disease is difficult to establish. A model was developed for buffaloes in the Philippines, which could be transferred to other places and livestock systems. Since Trypanosoma evansi was reported in humans, further research is required to investigate its zoonotic potential. Surra remains a potentially emerging disease that is a threat to Australia, Spain, and France. A number of questions about the disease have yet to be resolved. This brief review of the basic knowledge of T. evansi suggests that there is renewed interest in the parasite, which is spreading and has a major economic impact. PMID:24151595

  8. Trypanosoma evansi and surra: a review and perspectives on transmission, epidemiology and control, impact, and zoonotic aspects.

    PubMed

    Desquesnes, Marc; Dargantes, Alan; Lai, De-Hua; Lun, Zhao-Rong; Holzmuller, Philippe; Jittapalapong, Sathaporn

    2013-01-01

    This paper reviews the transmission modes of Trypanosoma evansi. Its worldwide distribution is attributed to mechanical transmission. While the role of tabanids is clear, we raise questions on the relative role of Haematobia sp. and the possible role of Stomoxys sp. in delayed transmission. A review of the available trypanocidal drugs and their efficacy in various host species is useful for understanding how they interact in disease epidemiology, which is complex. Although there are similarities with other mechanically transmitted trypanosomes, T. evansi has a more complex epidemiology due to the diversity of its hosts and vectors. The impact of clinical and subclinical disease is difficult to establish. A model was developed for buffaloes in the Philippines, which could be transferred to other places and livestock systems. Since Trypanosoma evansi was reported in humans, further research is required to investigate its zoonotic potential. Surra remains a potentially emerging disease that is a threat to Australia, Spain, and France. A number of questions about the disease have yet to be resolved. This brief review of the basic knowledge of T. evansi suggests that there is renewed interest in the parasite, which is spreading and has a major economic impact.

  9. Malleable mitochondrion of Trypanosoma brucei.

    PubMed

    Verner, Zdeněk; Basu, Somsuvro; Benz, Corinna; Dixit, Sameer; Dobáková, Eva; Faktorová, Drahomíra; Hashimi, Hassan; Horáková, Eva; Huang, Zhenqiu; Paris, Zdeněk; Peña-Diaz, Priscila; Ridlon, Lucie; Týč, Jiří; Wildridge, David; Zíková, Alena; Lukeš, Julius

    2015-01-01

    The importance of mitochondria for a typical aerobic eukaryotic cell is undeniable, as the list of necessary mitochondrial processes is steadily growing. Here, we summarize the current knowledge of mitochondrial biology of an early-branching parasitic protist, Trypanosoma brucei, a causative agent of serious human and cattle diseases. We present a comprehensive survey of its mitochondrial pathways including kinetoplast DNA replication and maintenance, gene expression, protein and metabolite import, major metabolic pathways, Fe-S cluster synthesis, ion homeostasis, organellar dynamics, and other processes. As we describe in this chapter, the single mitochondrion of T. brucei is everything but simple and as such rivals mitochondria of multicellular organisms.

  10. Transcriptome analysis of differentiating trypanosomes reveals the existence of multiple post-transcriptional regulons

    PubMed Central

    Queiroz, Rafael; Benz, Corinna; Fellenberg, Kurt; Hoheisel, Jörg D; Clayton, Christine

    2009-01-01

    Background Trypanosome gene expression is regulated almost exclusively at the post-transcriptional level, with mRNA degradation playing a decisive role. When trypanosomes are transferred from the blood of a mammal to the midgut of a Tsetse fly, they transform to procyclic forms: gene expression is reprogrammed, changing the cell surface and switching the mode of energy metabolism. Within the blood, trypanosomes can pre-adapt for Tsetse transmission, becoming growth-arrested stumpy forms. We describe here the transitions in gene expression that occur during differentiation of in-vitro cultured bloodstream forms to procyclic forms. Results Some mRNAs showed changes within 30 min of cis-aconitate addition, whereas others responded 12-24 hours later. For the first 12 h after addition of cis-aconitate, cells accumulated at the G1 phase of the cell cycle, and showed decreases in mRNAs required for proliferation, mimicking the changes seen in stumpy forms: many mRNAs needed for ribosomal and flagellar biogenesis showed striking co-regulation. Other mRNAs encoding components of signal transduction pathways and potential regulators were specifically induced only during differentiation. Messenger RNAs encoding proteins required for individual metabolic pathways were often co-regulated. Conclusion Trypanosome genes form post-transcriptional regulons in which mRNAs with functions in particular pathways, or encoding components of protein complexes, show almost identical patterns of regulation. PMID:19857263

  11. A pol I transcriptional body associated with VSG mono-allelic expression in Trypanosoma brucei.

    PubMed

    Navarro, M; Gull, K

    2001-12-13

    In the mammalian host, African trypanosomes generate consecutive waves of parasitaemia by changing their antigenic coat. Because this coat consists of a single type of variant surface glycoprotein (VSG), the question arises of how a trypanosome accomplishes the transcription of only one of a multi-allelic family of VSG expression site loci to display a single VSG type on the surface at any one time. No major differences have been detected between the single active expression site and the cohort of inactive expression sites. Here we identify an extranucleolar body containing RNA polymerase I (pol I) that is transcriptionally active and present only in the bloodstream form of the parasite. Visualization of the active expression site locus by tagging with green fluorescent protein shows that it is specifically located at this unique pol I transcriptional factory. The presence of this transcriptional body in postmitotic nuclei and its stability in the nucleus after DNA digestion provide evidence for a coherent structure. We propose that the recruitment of a single expression site and the concomitant exclusion of inactive loci from a discrete transcriptional body define the mechanism responsible for VSG mono-allelic expression.

  12. Two flagellar BAR domain proteins in Trypanosoma brucei with stage-specific regulation

    PubMed Central

    Cicova, Zdenka; Dejung, Mario; Skalicky, Tomas; Eisenhuth, Nicole; Hans