Associations of gender and age groups on the knowledge and use of drug information resources by American pharmacists

PubMed Central

Carvajal, Manuel J.; Clauson, Kevin A.; Gershman, Jennifer; Polen, Hyla H.

Objective To explore knowledge and use of drug information resources by pharmacists and identify patterns influenced by gender and age-group classification. Methods A survey questionnaire was mailed nationwide to 1,000 practitioners working in community (n = 500) and hospital (n = 500) settings who answer drug information questions as part of their expected job responsibilities. Responses pertaining to drug information resource use and knowledge of different types of drug-related queries, resource media preferences, and perceived adequacy of resources maintained in the pharmacy were analyzed by gender and age group. The t statistic was used to test for significant differences of means and percentages between genders and between age groups. Descriptive statistics were used to characterize other findings. Results Gender and age group classification influenced patterns of knowledge and use of drug information resources by pharmacists. They also affected pharmacists’ perceptions of the most common types of questions prompting them to consult a drug information reference, as well as the resources consulted. Micromedex, exclusively available in electronic format, was the most commonly consulted resource overall by pharmacists. Lexi-Comp Online was the leading choice by women, preferred over Micromedex, but was not one of the top two resources selected by men. Conclusions This study successfully identified the influence of gender and age-group classification in assessing drug information resource knowledge and use of general and specific types of drug-related queries. PMID:24155853

Completion of the Circle of Willis Varies by Gender, Age, and Indication for Computed Tomography Angiography.

PubMed

Zaninovich, Orel A; Ramey, Wyatt L; Walter, Christina M; Dumont, Travis M

2017-10-01

The circle of Willis (CoW) is the foremost anastomosis and blood distribution center of the brain. Its effectiveness depends on its completion and the size and patency of its vessels. Gender-related and age-related anatomic variations in the CoW may play an important role in the pathogenesis of cerebrovascular diseases. In this study, we analyzed computed tomography angiograms (CTAs) to assess for differences in CoW completion related to gender, age, and indication for CTA. A total of 834 CTAs were retrospectively analyzed for all CoW vessels to compare the incidence of complete CoW and variation frequency based on gender, age, and indication. The incidence of complete CoW was 37.1% overall. CoW completion showed a statistically significant decrease with increasing age for all age groups in both men (47.0%, 29.4%, 18.8%) and women (59.1%, 44.2%, 30.9%). Completion was greater in women (43.8%) than in men (31.2%) overall and for all age groups. These gender differences were all statistically significant except for the 18-39 years age group. The most frequent of the 28 CoW variations were absent posterior communicating artery (PCOM) bilaterally (17.1%), right PCOM (15.3%), and left PCOM (10.9%). Ischemic stroke and the 18-39 years age group of hemorrhagic stroke showed a statistically significant reduction in completion relative to trauma. The incidence of complete CoW is likely greater in women for all age groups and likely decreases with age in both genders. The most frequently absent vessel is likely the PCOM, either unilaterally or bilaterally. Completion may play a role in ischemic stroke and a subset of patients with hemorrhagic stroke. Copyright © 2017 Elsevier Inc. All rights reserved.

75 FR 4526 - Privacy Act of 1974, System of Records

Federal Register 2010, 2011, 2012, 2013, 2014

2010-01-28

... address, country, work address, professional affiliations, age, gender, phone number, and other... of certain age groups, and analysis of differences between genders and region. The results of the..., title, role, company, country, age, gender, username, password, professional biographical information...

Effects of age, gender, and stimulus presentation period on visual short-term memory.

PubMed

Kunimi, Mitsunobu

2016-01-01

This study focused on age-related changes in visual short-term memory using visual stimuli that did not allow verbal encoding. Experiment 1 examined the effects of age and the length of the stimulus presentation period on visual short-term memory function. Experiment 2 examined the effects of age, gender, and the length of the stimulus presentation period on visual short-term memory function. The worst memory performance and the largest performance difference between the age groups were observed in the shortest stimulus presentation period conditions. The performance difference between the age groups became smaller as the stimulus presentation period became longer; however, it did not completely disappear. Although gender did not have a significant effect on d' regardless of the presentation period in the young group, a significant gender-based difference was observed for stimulus presentation periods of 500 ms and 1,000 ms in the older group. This study indicates that the decline in visual short-term memory observed in the older group is due to the interaction of several factors.

Gender differences in mental rotation across adulthood.

PubMed

Jansen, Petra; Heil, Martin

2010-01-01

Although gender differences in mental rotation in younger adults are prominent in paper-pencil tests as well as in chronometric tests with polygons as stimuli, less is known about this topic in the older age ranges. Therefore, performance was assessed with the Mental Rotation Test (MRT) paper-pencil test as well as with a computer-based two-stimulus same-different task with polygons in a sample of 150 adults divided into three age groups, 20-30, 40-50, and 60-70 years. Performance decreased with age, and men outperformed women in all age groups. The gender effect decreased with age in the MRT, possibly due to a floor effect. Gender differences remained constant across age, however, in the error rates of the computer-based task.

Few differences in diet and health behaviors and perceptions were observed in adult urban Native American Indians by tribal association, gender, and age grouping.

PubMed

Carter, Tina L; Morse, Kristin L; Giraud, David W; Driskell, Judy A

2008-12-01

Diet and health behaviors and perceptions of adult urban Native American Indians in a large Midwestern city were evaluated for differences by tribal association, gender, and age grouping. The hypothesis was that human behavior is influenced by tribal association, gender, and age grouping in the subject population. The subjects included 33 men and 32 women, with 26 being Sioux; 22 Omaha; and 17 a combination of other tribes. The descriptive survey included two interviewer-administered 24-hour recalls. The majority of subjects were overweight or obese. Significant differences (P< .05) were observed in vitamin A and calcium intakes by tribal association. Men reported consuming significantly more (P< .05) kilocalories, vitamin C, and sodium. Over half the subjects consumed more than the recommended 20% to 35% kcal from fat, >or=10% kcal from saturated fat, and >or=300 mg cholesterol/d. Less than Estimated Average Requirements for vitamin A, vitamin C, and iron were consumed by 31%, 59%, and 6%, respectively; 79% consumed less than Adequate Intakes for calcium. Ninety-two percent consumed more than the Tolerable Upper Intake Level for sodium. Few differences were observed in the kilocalorie, vitamin A, vitamin C, calcium, and sodium intakes of these Native American Indians by tribal association, gender, or age grouping. Significant differences in percentages consuming alcohol were observed by gender (P< .05) and by age grouping (P< .01). A significant difference (P< .01) was observed by gender regarding the subjects' perceptions of their being alcoholics. Overall, few differences were observed in diet and health behaviors and perceptions of adult urban Native American Indians by tribal association, gender, and age grouping.

Gender differences among older heroin users.

PubMed

Hamilton, Alison B; Grella, Christine E

2009-01-01

This purpose of this study was to explore the following question: Are there gender differences among older individuals with a history of heroin addiction with regard to social and family relationships and health problems? Eight gender-specific focus groups were conducted with 38 (19 women, 19 men) older (50+ years) individuals with long-term histories of heroin dependence. Four groups were conducted in a methadone maintenance (MM) clinic and four groups were derived from the Los Angeles community. Modest gender differences were observed, but mainly in the focus-group dynamics. Women typically described the impact of their addiction on their families, while men typically described their surprise at still being alive. Hepatitis C was the primary health concern in all groups; mental health issues were also discussed. Remarkable gender differences were not apparent in the qualitative experiences of these participants. Instead, we found overriding similarities related to the interactive effects of drug use and aging. Longitudinal studies of this population as they age and interact with the health-care system and other social systems will help to untangle the complicated relationship between aging, drug addiction, gender, and health.

Does whom you work with matter? Effects of referent group gender and age composition on managers' compensation.

PubMed

Ostroff, Cheri; Atwater, Leanne E

2003-08-01

Much research has examined gender and age effects on compensation, concluding that a wage gap exists favoring men and negative stereotypes against older workers persist. Although the effect of an employee's gender or age has been widely studied, little work has examined the impact of the demographic characteristics of a focal employee's immediate referent groups (e.g., subordinates, peers, or supervisors) on pay. The effect of the gender and age composition of a focal manager's subordinates, peers, and supervisor on the manager's compensation levels was investigated in a sample of 2,178 managers across a wide range of organizations and functional areas. After controlling for a number of human capital variables, results indicated that not only does a wage gap favoring men exist, but also managerial pay is lower when managers' referent groups are largely female, when subordinates are outside the prime age group, and when peers and supervisors are younger.

Age and Gender Differences in Relationships Among Emotion Regulation, Mood, and Mental Health.

PubMed

Masumoto, Kouhei; Taishi, Nozomi; Shiozaki, Mariko

2016-01-01

Objective: We investigated the effects of age on mood and mental health-mediated emotion regulation, such as cognitive reappraisal and expressive suppression, and examined whether these relationships differ according to gender. Method: We recruited 936 Japanese participants. They comprised six age groups ranging from 20 to 70 years old, with 156 participants in each age group and equal numbers of men and women. Results: Structural equation model analysis showed that older participants were more likely to use cognitive reappraisal, further enhancing positive mood and reducing negative mood, whereas, age did not affect expressive suppression. Moreover, expressive suppression had a smaller impact on mood than cognitive reappraisal. A multi-group analysis showed significant gender differences. In men, cognitive reappraisal increased with age and influenced mood more positively than in women. Discussion: Our findings indicated gender differences in aging effects on emotion regulation. We discussed about these results from the cognitive process, motivation to emotion regulation, and cultural differences.

Effects of message framing on self-report and accelerometer-assessed physical activity across age and gender groups.

PubMed

Li, Kin-Kit; Cheng, Sheung-Tak; Fung, Helene H

2014-02-01

This study compared message-framing effects on physical activity (PA) across age and gender groups. Participants included 111 younger and 100 older adults (68% were women), randomly assigned to read gain-framed or loss-framed PA messages in promotion pamphlets, and who wore accelerometers for the following 14 days. Using regression analyses controlling for demographic and health factors, we found significant age-by-gender-by-framing interactions predicting self-report (B = -4.39, p = .01) and accelerometer-assessed PA (B = -2.44, p = .02) during the follow-up period. Gain-framed messages were more effective than loss-framed messages in promoting PA behaviors only among older men. We speculated that the age-related positivity effect, as well as the age and gender differences in issue involvement, explained the group differences in framing. In addition, more time availability and higher self-efficacy among older men might have contributed to the results.

Gender-Related and Age-Related Differences in Implantable Defibrillator Recipients: Results From the Pacemaker and Implantable Defibrillator Leads Survival Study ("PAIDLESS").

PubMed

Feldman, Alyssa M; Kersten, Daniel J; Chung, Jessica A; Asheld, Wilbur J; Germano, Joseph; Islam, Shahidul; Cohen, Todd J

2015-12-01

The purpose of this study was to investigate the influences of gender and age on defibrillator lead failure and patient mortality. The specific influences of gender and age on defibrillator lead failure have not previously been investigated. This study analyzed the differences in gender and age in relation to defibrillator lead failure and mortality of patients in the Pacemaker and Implantable Defibrillator Leads Survival Study ("PAIDLESS"). PAIDLESS includes all patients at Winthrop University Hospital who underwent defibrillator lead implantation between February 1, 1996 and December 31, 2011. Male and female patients were compared within each age decile, beginning at 15 years old, to analyze lead failure and patient mortality. Statistical analyses were performed using Wilcoxon rank-sum test, Fisher's exact test, Kaplan-Meier analysis, and multivariable Cox regression models. P<.05 was considered statistically significant. No correction for multiple comparisons was performed for the subgroup analyses. A total of 3802 patients (2812 men and 990 women) were included in the analysis. The mean age was 70 ± 13 years (range, 15-94 years). Kaplan-Meier analysis found that between 45 and 54 years of age, leads implanted in women failed significantly faster than in men (P=.03). Multivariable Cox regression models were built to validate this finding, and they confirmed that male gender was an independent protective factor of lead failure in the 45 to 54 years group (for male gender: HR, 0.37; 95% confidence interval, 0.14-0.96; P=.04). Lead survival time for women in this age group was 13.4 years (standard error, 0.6), while leads implanted in men of this age group survived 14.7 years (standard error, 0.3). Although there were significant differences in lead failure, no differences in mortality between the genders were found for any ages or within each decile. This study is the first to compare defibrillator lead failure and patient mortality in relation to gender and age deciles at a single large implanting center. Within the 45 to 54 years group, leads implanted in women failed faster than in men. Male gender was found to be an independent protective factor in lead survival. This study emphasizes the complex interplay between gender and age with respect to implantable defibrillator lead failure and mortality.

Different dimensions of ageist attitudes among men and women: a multigenerational perspective.

PubMed

Bodner, Ehud; Bergman, Yoav S; Cohen-Fridel, Sara

2012-06-01

Ageism, a form of prejudice in which one relates negatively to people due to their age, exists throughout life. However, no attempt has been made to compare ageist attitudes across the life cycle, from young adulthood to old age. Consequently, the current study examined age and gender differences in ageism throughout adulthood. 955 Israeli participants (age range: 18-98 years) were divided into three age-groups: young (18-39), middle-aged (40-67), and old (68-98), and were administered the Fraboni Scale of Ageism. Age and gender differences were examined both for the three groups and for subgroups within the older adult cohort. Multivariate analysis of variance revealed that middle-aged participants were significantly more ageist than younger and older groups. Across all age groups, men exhibited more avoidance and stereotypical attitudes toward older adults than women. Among the old age group, participants aged 81-98 held more ageist stereotypes and reported more avoidance of older adults than those aged 68-73. Within the older adult cohort, gender was a significant predictor for ageist attitudes among those aged 68-73 and 81-98, but not for people aged 74-80. Ageism demonstrates a changing pattern across the life span. While gender differences remain stable, ageist attitudes toward growing old as we age ourselves are constantly changing. In order to gain a better understanding of ageism as a general and global phenomenon, we need to consider the role of such attitudes in different stages of life.

Normal reference values of diastolic strain rate in healthy individuals: Chronological trends and the comparison according to genders.

PubMed

Sun, Byung Joo; Park, Jae-Hyeong; Kim, Jeongai; Choi, Jin-Oh; Lee, Ju-Hee; Shin, Mi-Seung; Kim, Mi-Jeong; Jung, Hae Ok; Park, Jeong Rang; Sohn, Il Suk; Kim, Hyungseop; Kim, Hyung-Kwan; Cho, Goo-Yeong; Park, Jin-Sun; Shim, Chi Young; Shin, Sung Hee; Kim, Kye Hun; Kim, Woo-Shik; Park, Seung Woo

2018-06-19

Recently, the diastolic strain rate (DSR) utilizing speckle-tracking echocardiography has been proposed as a novel parameter for left ventricular diastolic function. We aimed to present normal reference data for those in a large-sized, selected group of healthy individuals. The current study was a part of the Normal echOcardiogRaphic Measurements in KoreAn popuLation (NORMAL), a prospective nationwide survey from 23 centers in Korea. We analyzed 447 subjects (age 48 ± 15 years, 234 females) without any history of cardiovascular disease and presented the early and late DSRs (SR e and SR a , respectively) in a total and gender-/age-specified groups. Among the total subjects, the mean SR e and SR a were 1.6 ± 0.4 S -1 and 0.8 ± 0.3 S -1 , respectively. With increasing age, there were significant trends of decreasing SR e and increasing SR a . Although both gender groups showed comparable age, the female group presented significantly higher SR e compared to male subjects with age of 20-59 years, which diminished after the age of 60 years. However, the SR a was comparable between genders in all age groups. On multiple linear regression, age showed independent associations with both SR e (β = -0.132, P = .010) and SR a (β = 0.440, P < .001), whereas gender did not show any association with SR e or SR a . We present normal reference data of a novel parameter, DSR, in a large-sized selected group with healthy Korean subjects. Additionally, we present significant age-related changes both in SR e and SR a without the impact of their gender. © 2018 Wiley Periodicals, Inc.

Effect of age and gender on the surface electromyogram during various levels of isometric contraction.

PubMed

Arjunan, Sridhar; Kumar, Dinesh; Kalra, Chandan; Burne, John; Bastos, Teodiano

2011-01-01

This study reports the effects of age and gender on the surface electromyogram while performing isometric contraction. Experiments were conducted with two age groups--Young (Age: 20-29) and Old (Age: 60-69) where they performed sustained isometric contractions at various force levels (50%, 75%, 100% of maximum voluntary contraction). Traditional features such as root mean square (RMS) and median frequency (MDF) were computed from the recorded sEMG. The result indicates that the MDF of sEMG was not significantly affected by age, but was impacted by gender in both age groups. Also there was a significant change in the RMS of sEMG with age and gender at all levels of contraction. The results also indicate a large inter-subject variation. This study will provide an understanding of the underlying physiological effects of muscle contraction and muscle fatigue in different cohorts.

The Cardioprotective Effect of Vitamin E (Alpha-Tocopherol) Is Strongly Related to Age and Gender in Mice

PubMed Central

Li, Yan; Lin, Ze-Bang; Liu, Xiang; Wang, Jing-Feng; Chen, Yang-Xin; Wang, Zhi-Ping; Zhang, Xi; Ou, Zhi-Jun; Ou, Jing-Song

2015-01-01

Vitamin E (VitE) only prevented cardiovascular diseases in some patients and the mechanisms remain unknown. VitE levels can be affected by aging and gender. We hypothesize that age and gender can influence VitE’s cardioprotective effect. Mice were divided into 4 groups according to age and gender, and each group of mice were divided into a control group and a VitE group. The mice were administered water or VitE for 21 days; Afterward, the cardiac function and myocardial infarct size and cardiomyocyte apoptosis were measured after myocardial ischemia reperfusion(MI/R). VitE may significantly improved cardiac function in young male mice and aged female mice by enhancing ERK1/2 activity and reducing JNK activity. Enhanced expression of HSP90 and Bcl-2 were also seen in young male mice. No changes in cardiac function and cardiac proteins were detected in aged male mice and VitE was even liked to exert a reverse effect in cardiac function in young mice by enhancing JNK activity and reducing Bcl-2 expression. Those effects were in accordance with the changes of myocardial infarction size and cardiomyocyte apoptosis in each group of mice. VitE may reduce MI/R injury by inhibiting cardiomyocyte apoptosis in young male mice and aged female mice but not in aged male mice. VitE was possibly harmful for young female mice, shown as increased cardiomyocyte apoptosis after MI/R. Thus, we speculated that the efficacy of VitE in cardiac protection was associated with age and gender. PMID:26331272

Waist Circumference, Waist-to-Height Ratio and Body Mass Index of Thai Children: Secular Changes and Updated Reference Standards.

PubMed

Rerksuppaphol, Sanguansak; Rerksuppaphol, Lakkana

2014-11-01

The prevalence of obesity in pediatric age group has been increasing globally. Body mass index (BMI), waist circumference (WC) and waist-to-height ratio (WHtR) are commonly used to define obesity. The cut-off references for these parameters vary between racial and ethnic groups. We aimed to measure the secular changes and update the reference standards for these three parameters for Thai children in this study. We completed a cross-sectional survey of 3,885 school children 6.0-12.99 y of age in Ongkharak district of central Thailand during May to June 2013. Weight, height and WC were recorded by trained staff using sensitive and calibrated instruments. BMI and WHtR were calculated by standard formulae. The summary estimates were described by gender and whole year age groups. Age and gender specific smoothened percentile curves were created by using least mean squares method. The data was compared with that from a 2008 cohort from the same area. Age and gender specific percentile data and curves of WC, WHtR and BMI have been provided for Thai children. BMI and WC increased but WHtR changed relatively little with age in both genders. In comparison to 2008, WC and WHtR have increased consistently across all age groups and both genders. The 75th percentile for WHtR corresponded closely to 0.50 in both genders which has been the suggested cut-off. Since 2008, there have been significant increase in WC and WHtR across all age groups and in both genders in Thai children. These indicate increasing prevalence of central obesity and upcoming cardio-metabolic health problems. This needs to be tackled urgently by creating awareness and promotion of healthy diets and physical activities in school children. WC and WHtR should be routinely measured in paediatric examination for early diagnosis of central obesity.

Influence of gender on prevalence of overweight and obesity in Nigerian schoolchildren and adolescents.

PubMed

Maruf, Fatai A; Aronu, Uzochukwu; Chukwuegbu, Kenneth; Aronu, Ann E

2013-10-01

Overweight and obesity are serious health concerns for children. However, only a few studies have investigated the influence of gender on prevalence of overweight and obesity in children and adolescents in Nigeria. The objective of this study was to investigate gender influence on prevalence of overweight and obesity among Nigerian school children and adolescents. Information on age and gender of the participants was collected from the school register. Data on height, weight and BMI was collected using standard techniques. A total of 9,014 children and adolescents (male = 4392; female = 4622), aged 2-18 years, from 28 randomly selected schools were analyzed. Overweight and obesity were determined using the International Obesity Task Force cut-off points by age and gender. Males had higher BMI than females at age group 2-6 years, whereas females had higher BMI than males at age groups 11-14 years and 15-18 years. Females had significantly higher prevalence of overweight (P < 0.05) than males at age group 11-14 and 15-18 years. However, there was no gender difference in the prevalence of obesity from childhood through adolescence. In conclusion, BMI is larger in males in early childhood but larger in females in during adolescence. More female adolescents are at risk of obesity than males.

The influence of gender and gender typicality on autobiographical memory across event types and age groups.

PubMed

Grysman, Azriel; Fivush, Robyn; Merrill, Natalie A; Graci, Matthew

2016-08-01

Gender differences in autobiographical memory emerge in some data collection paradigms and not others. The present study included an extensive analysis of gender differences in autobiographical narratives. Data were collected from 196 participants, evenly split by gender and by age group (emerging adults, ages 18-29, and young adults, ages 30-40). Each participant reported four narratives, including an event that had occurred in the last 2 years, a high point, a low point, and a self-defining memory. Additionally, all participants completed self-report measures of masculine and feminine gender typicality. The narratives were coded along six dimensions-namely coherence, connectedness, agency, affect, factual elaboration, and interpretive elaboration. The results indicated that females expressed more affect, connection, and factual elaboration than males across all narratives, and that feminine typicality predicted increased connectedness in narratives. Masculine typicality predicted higher agency, lower connectedness, and lower affect, but only for some narratives and not others. These findings support an approach that views autobiographical reminiscing as a feminine-typed activity and that identifies gender differences as being linked to categorical gender, but also to one's feminine gender typicality, whereas the influences of masculine gender typicality were more context-dependent. We suggest that implicit gendered socialization and more explicit gender typicality each contribute to gendered autobiographies.

Examining aging sexual stigma attitudes among adults by gender, age, and generational status.

PubMed

Syme, Maggie L; Cohn, Tracy J

2016-01-01

Stigma related to later life sexuality could produce detrimental effects for older adults, through individual concerns and limited sexual health care for older adults. Identifying groups at risk for aging sexual stigma will help to focus interventions to reduce it. Accordingly, the purpose of this study was to examine cross-sectional trends in aging sexual stigma attitudes by age group, generational status, and gender. An online survey was administered to a national sample of adults via a crowdsourcing tool, in order to examine aging sexual stigma across age groups, generational status, and gender (N = 962; 47.0% male, 52.5% female, and .5% other; mean age = 45 years). An aging sexual stigma index was formulated from the attitudinal items of the Aging Sexual Knowledge and Attitudes Scale. This sample reported moderately permissive attitudes toward aging sexuality, indicating a low level of aging sexual stigma. Though descriptive data showed trends of stigma attitudes increasing with age and later generations, there were no significant differences between age groups or generations in terms of aging sexual stigma beliefs. Men, regardless of age and/or generation, were found to espouse significantly higher stigmatic beliefs than women or those reporting 'other' gender. Aging sexual stigma beliefs may not be prevalent among the general population as cohorts become more sexually liberal over time, though men appear more susceptible to these beliefs. However, in order to more comprehensively assess aging sexual stigma, future research may benefit from measuring explicit and implicit aging sexual stigma beliefs.

Lack of Gender and Age Differences in Pain Measurements Following Exercise in People with Chronic Whiplash-Associated Disorders.

PubMed

Ickmans, Kelly; Malfliet, Anneleen; De Kooning, Margot; Goudman, Lisa; Hubloue, Ives; Schmitz, Tom; Goubert, Dorien; Aguilar-Ferrandiz, Maria Encarnacion

2017-09-01

Individuals with chronic whiplash associated disorders (WAD) present persistent pain in the absence of structural pathology. In these people, altered central pain processing and central sensitization are observed. The role of personal factors, such as gender and age, on pain processing mechanisms in chronic WAD, however, is still unclear. This study investigated possible gender- and age-related differences in self-reported and experimental pain measurements in people with chronic WAD. Besides the exercise-induced response on pain measurements between gender and age subgroups was recorded. Case-control study. University Hospital, Brussels. Self-reported pain and experimental pain measurements (pressure pain thresholds [PPT], occlusion cuff pressure, temporal summation, and conditioned pain modulation) were performed in 52 individuals (26 chronic WAD patients and 26 healthy controls), before and after a submaximal cycle exercise. Lower PPTs and occlusion cuff pressures were shown in chronic WAD in comparison with healthy controls. No gender and age differences regarding PPTs, occlusion cuff pressures and conditioned pain modulation were found in chronic WAD. Within the chronic WAD group, men showed higher self-reported pain compared to women and younger adults showed enhanced generalized pain facilitation compared to older adults. In addition, chronic WAD patients are able to inhibit exercise-induced hyperalgesia, but no gender and age differences in pain response following exercise were found. This study was sufficiently powered to detect differences between the chronic WAD and control group. However, a sufficient power was not reached when patients were divided in age and gender groups. Furthermore, only mechanical stimuli were included in the experimental pain measurements. Besides, psychosocial factors were not taken into account. Some alterations of altered pain processing are present in chronic WAD patients, however not in response to exercise. No gender and age differences in pain measurements were observed in people with chronic WAD.Key words: Neck pain, whiplash associated disorders, chronic pain, personal factors, age, gender, central sensitization, exercise induced hyperalgesia, pressure pain thresholds, self reported pain.

Gender Attitudes in Early Childhood: Behavioral Consequences and Cognitive Antecedents

PubMed Central

Halim, May Ling D.; Ruble, Diane N.; Tamis-LeMonda, Catherine S.; Shrout, Patrick E.; Amodio, David M.

2016-01-01

This study examined factors that predicted children’s gender intergroup attitudes at age 5 and the implications of these attitudes for intergroup behavior. Ethnically-diverse children from low-income backgrounds (N=246, Mexican-, Chinese-, Dominican-, and African-American) were assessed at ages 4 and 5. On average, children reported positive same-gender and negative other-gender attitudes. Positive same-gender attitudes were associated with knowledge of gender stereotypes. In contrast, positive other-gender attitudes were associated with flexibility in gender cognitions (stereotype flexibility, gender consistency). Other-gender attitudes predicted gender-biased behavior. These patterns were observed in all ethnic groups. These findings suggest that early learning about gender categories shape young children’s gender attitudes, and that these gender attitudes already have consequences for children’s intergroup behavior at age 5. PMID:27759886

Gender and geographical inequalities in fatal drug overdose in Iran: A province-level study in 2006 and 2011.

PubMed

Rostami, Mehran; Karamouzian, Mohammad; Khosravi, Ardeshir; Rezaeian, Shahab

2018-06-01

We aimed to compare the fatal drug overdose rates in Iran in 2006 and 2011. This analysis was performed based on data on fatal drug overdose cases from the Iranian death registration system. The crude and adjusted rates per 100,000 populations for geographical regions stratified by gender and age groups were calculated using the 2006 and 2011 census of Iranian population. Annual percentage change was calculated to examine annual changes of fatal drug overdose rates across different regions. The overall age-adjusted rate of fatal drug overdose decreased from 3.62 in 2006 to 2.77 in 2011. A substantial difference in the distribution of fatal drug overdoses was found across geographical regions by gender and age groups. Rates of fatal drug overdose were higher among Iranian men and in both younger and older age groups which call for scaling up harm reduction and increasing access to gender- and age-specific substance use treatment services. Copyright © 2018 Elsevier Ltd. All rights reserved.

Age and sex based reference values for incidental coronary artery and thoracic aorta calcifications on routine clinical chest CT: a powerful tool to appreciate available imaging findings.

PubMed

Jairam, Pushpa M; de Jong, Pim A; Mali, Willem P Th M; Gondrie, Martijn J A; Jacobs, Peter C A; van der Graaf, Yolanda

2014-08-01

To establish age and gender specific reference values for incidental coronary artery and thoracic aorta calcification scores on routine diagnostic CT scans. These reference values can aid in structured reporting and interpretation of readily available imaging data by chest CT readers in routine practice. A random sample of 1572 (57% male, median age 61 years) was taken from a study population of 12,063 subjects who underwent diagnostic chest CT for non-cardiovascular indications between January 2002 and December 2005. Coronary artery and thoracic aorta calcifications were graded using a validated ordinal score. The 25th, 50th and 75th percentile cut points were calculated for the coronary artery and thoracic aorta calcification scores within each age/gender stratum. The 75th percentile cut points for coronary artery calcification scores were higher for men than for women across all age groups, with the exception of the lowest age group. The 75th percentile cut points for thoracic aorta calcifications scores were comparable for both genders across all age groups. Based on the obtained age and gender reference values a calculation tool is provided, that allows one to enter an individual's age, gender and calcification scores to obtain the corresponding estimated percentiles. The calculation tool as provided in this study can be used in daily practice by CT readers to examine whether a subject has high calcifications scores relative to others with the same age and gender. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

School Anxiety Inventory-Short Version: Factorial Invariance and Latent Mean Differences Across Gender and Age in Spanish Adolescents

ERIC Educational Resources Information Center

Ingles, Candido J.; Garcia-Fernandez, Jose M.; Marzo, Juan C.; Martinez-Monteagudo, Maria C.; Estevez, Estefania

2015-01-01

This study examined the factorial invariance and latent mean differences of the School Anxiety Inventory-Short Version across gender and age groups for 2,367 Spanish students, ranging in age from 12 to 18 years. Configural and measurement invariance were found across gender and age samples for all dimensions of the School Anxiety Inventory-Short…

Influence of pedestrian age and gender on spatial and temporal distribution of pedestrian crashes.

PubMed

Toran Pour, Alireza; Moridpour, Sara; Tay, Richard; Rajabifard, Abbas

2018-01-02

Every year, about 1.24 million people are killed in traffic crashes worldwide and more than 22% of these deaths are pedestrians. Therefore, pedestrian safety has become a significant traffic safety issue worldwide. In order to develop effective and targeted safety programs, the location- and time-specific influences on vehicle-pedestrian crashes must be assessed. The main purpose of this research is to explore the influence of pedestrian age and gender on the temporal and spatial distribution of vehicle-pedestrian crashes to identify the hotspots and hot times. Data for all vehicle-pedestrian crashes on public roadways in the Melbourne metropolitan area from 2004 to 2013 are used in this research. Spatial autocorrelation is applied in examining the vehicle-pedestrian crashes in geographic information systems (GIS) to identify any dependency between time and location of these crashes. Spider plots and kernel density estimation (KDE) are then used to determine the temporal and spatial patterns of vehicle-pedestrian crashes for different age groups and genders. Temporal analysis shows that pedestrian age has a significant influence on the temporal distribution of vehicle-pedestrian crashes. Furthermore, men and women have different crash patterns. In addition, results of the spatial analysis shows that areas with high risk of vehicle-pedestrian crashes can vary during different times of the day for different age groups and genders. For example, for those between ages 18 and 65, most vehicle-pedestrian crashes occur in the central business district (CBD) during the day, but between 7:00 p.m. and 6:00 a.m., crashes among this age group occur mostly around hotels, clubs, and bars. This research reveals that temporal and spatial distributions of vehicle-pedestrian crashes vary for different pedestrian age groups and genders. Therefore, specific safety measures should be in place during high crash times at different locations for different age groups and genders to increase the effectiveness of the countermeasures in preventing and reducing vehicle-pedestrian crashes.

ANTHROPOMETRIC DIFFERENCES RELATED TO GENDERS AND AGE IN THE ELDERLY.

PubMed

Canaan Rezende, Fabiane Aparecida; Queiroz Ribeiro, Andréia; Priore, Sílvia Eloiza; Castro Franceschini, Sylvia do Carmo

2015-08-01

anthropometry facilitates the evaluation of the risks associated with reduced lean body mass, as well as of excess adiposity. However, very little is known regarding the anthropometric standards among the elderly and the differences observed between the genders and among the various age groups Objective: to compare indicators and indices anthropometrics of the elderly by gender and age group. a cross-sectional study was undertaken using a representative probability sample, involving 621 elderly. We evaluated the weight, height, circumferences (waist, hip, calf and arm); body mass index, body adiposity index, waist-hip ratio and waist-stature ratio. women were found to have a higher mean body mass index, waist-stature ratio, body adiposity index and arm circumference (p < 0.001), whereas men had higher values for weight, height and waist-hip ratio (p < 0.001). The average arm and calf circumference, however, did not differ between the genders (p > 0.05). Weight, and calf and arm circumferences were observed to be lower in the older age groups (p < 0.001) and the same was true for the body mass index and height only in men (p < 0.05). The waist circumference, waist-hip ratio, body adiposity index and waist-stature ratio did not differ among the age groups (p > 0.05). the total and peripheral body mass, for the men, in particular, was lower among the older subjects. Central adiposity did not differ among the age groups in both the genders. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

Explaining gender differences in ill-health in South Korea: the roles of socio-structural, psychosocial, and behavioral factors.

PubMed

Chun, Heeran; Khang, Young-Ho; Kim, Il-Ho; Cho, Sung-Il

2008-09-01

This study examines and explains the gender disparity in health despite rapid modernization in South Korea where the social structure is still based on traditional gender relations. A nationally representative sample of 2897 men and 3286 women aged 25-64 from the 2001 Korean National Health and Nutrition Examination Survey was analyzed. Health indicators included self rated health and chronic disease. Age-adjusted prevalence was computed according to a gender and odds ratios (OR) derived from logistic regression. Percentage changes in OR by inclusion of determinant variables (socio-structural, psychosocial, and behavioral) into the base logistic regression model were used to estimate the contributions to the gender gap in two morbidity measures. Results showed a substantial female excess in ill-health in both measures, revealing an increasing disparity in the older age group. Group-specific age-adjusted prevalence of ill-health showed an inverse relationship to socioeconomic position. When adjusting for each determinant, employment status, education, and depression contributed the greatest to the gender gap. After adjusting for all suggested determinants, 78% for self rated health and 86% for chronic disease in excess OR could be explained. After stratifying for age, the full model provided a complete explanation for the female excess in chronic illness, but for self rated health a female excess was still evident for the younger age group. Socio-structural factors played a crucial role in accounting for female excess in ill-health. This result calls for greater attention to gender-based health inequality stemming from socio-structural determinants in South Korea. Cross-cultural validation studies are suggested for further discussion of the link between changing gender relations and the gender health gap in morbidity in diverse settings.

Gestational age, gender and parity specific centile charts for placental weight for singleton deliveries in Aberdeen, UK.

PubMed

Wallace, J M; Bhattacharya, S; Horgan, G W

2013-03-01

The weight of the placenta is a crude but useful proxy for its function in vivo. Accordingly extremes of placental weight are associated with adverse pregnancy outcomes while even normal variations in placental size may impact lifelong health. Centile charts of placental weight for gestational age and gender are used to identify placental weight extremes but none report the effect of parity. Thus the objective was to produce gender and gestational age specific centile charts for placental weight in nulliparous and multiparous women. Data was extracted from the Aberdeen Maternity and Neonatal Databank for all women delivering singleton babies in Aberdeen city and district after 24 weeks gestation. Gestational age specific centile charts for placental weight by gender and parity grouping (n = 88,649 deliveries over a 30 year period) were constructed using the LMS method after exclusion of outliers (0.63% of deliveries meeting study inclusion criteria). Tables and figures are presented for placental weight centiles according to gestational age, gender and parity grouping. Tables are additionally presented for the birth weight to placental weight ratio by gender. Placental weight and the fetal:placental weight ratio were higher in male versus female deliveries. Placental weight was greater in multiparous compared with nulliparous women. We present strong evidence that both gender and parity grouping influence placental weight centiles. The differences at any given gestational age are small and the effects of parity are greater overall than those of gender. In contrast the birth weight to placental weight ratio differs by gender only. These UK population specific centile charts may be useful in studies investigating the role of the placenta in mediating pregnancy outcome and lifelong health. Copyright © 2012 Elsevier Ltd. All rights reserved.

Consumers' Preferences for Electronic Nicotine Delivery System Product Features: A Structured Content Analysis.

PubMed

Kistler, Christine E; Crutchfield, Trisha M; Sutfin, Erin L; Ranney, Leah M; Berman, Micah L; Zarkin, Gary A; Goldstein, Adam O

2017-06-07

To inform potential governmental regulations, we aimed to develop a list of electronic nicotine delivery system (ENDS) product features important to U.S. consumers by age and gender. We employed qualitative data methods. Participants were eligible if they had used an ENDS at least once. Groups were selected by age and gender (young adult group aged 18-25, n = 11; middle-age group aged 26-64, n = 9; and women's group aged 26-64, n = 9). We conducted five individual older adult interviews (aged 68-80). Participants discussed important ENDS features. We conducted a structured content analysis of the group and interview responses. Of 34 participants, 68% were white and 56% were female. Participants mentioned 12 important ENDS features, including: (1) user experience; (2) social acceptability; (3) cost; (4) health risks/benefits; (5) ease of use; (6) flavors; (7) smoking cessation aid; (8) nicotine content; (9) modifiability; (10) ENDS regulation; (11) bridge between tobacco cigarettes; (12) collectability. The most frequently mentioned ENDS feature was modifiability for young adults, user experience for middle-age and older adults, and flavor for the women's group. This study identified multiple features important to ENDS consumers. Groups differed in how they viewed various features by age and gender. These results can inform ongoing regulatory efforts.

Consumers’ Preferences for Electronic Nicotine Delivery System Product Features: A Structured Content Analysis

PubMed Central

Kistler, Christine E.; Crutchfield, Trisha M.; Sutfin, Erin L.; Ranney, Leah M.; Berman, Micah L.; Zarkin, Gary A.; Goldstein, Adam O.

2017-01-01

To inform potential governmental regulations, we aimed to develop a list of electronic nicotine delivery system (ENDS) product features important to U.S. consumers by age and gender. We employed qualitative data methods. Participants were eligible if they had used an ENDS at least once. Groups were selected by age and gender (young adult group aged 18–25, n = 11; middle-age group aged 26–64, n = 9; and women’s group aged 26–64, n = 9). We conducted five individual older adult interviews (aged 68–80). Participants discussed important ENDS features. We conducted a structured content analysis of the group and interview responses. Of 34 participants, 68% were white and 56% were female. Participants mentioned 12 important ENDS features, including: (1) user experience; (2) social acceptability; (3) cost; (4) health risks/benefits; (5) ease of use; (6) flavors; (7) smoking cessation aid; (8) nicotine content; (9) modifiability; (10) ENDS regulation; (11) bridge between tobacco cigarettes; (12) collectability. The most frequently mentioned ENDS feature was modifiability for young adults, user experience for middle-age and older adults, and flavor for the women’s group. This study identified multiple features important to ENDS consumers. Groups differed in how they viewed various features by age and gender. These results can inform ongoing regulatory efforts. PMID:28590444

Antidepressant Prescription and Suicide Rates: Effect of Age and Gender

ERIC Educational Resources Information Center

Kalmar, Sandor; Szanto, Katalin; Rihmer, Zoltan; Mazumdar, Sati; Harrison, Katrin; Mann, J. John

2008-01-01

To determine whether the effect of antidepressant exposure on suicide rate is modified by age and gender in Hungary, annual antidepressant prescription rates and suicide rates of about 10 million inhabitants between 1999-2005 were analyzed by age and gender groups. The suicide rate was inversely related to the increased use of antidepressants in…

Diabetes and work: 12-year national follow-up study of the association of diabetes incidence with socioeconomic group, age, gender and country of origin.

PubMed

Poulsen, Kjeld; Cleal, Bryan; Willaing, Ingrid

2014-12-01

To investigate the extent and socioeconomic distribution of incident diabetes among the Danish working-age population. The Danish National Diabetes Register was linked with socioeconomic and population-based registers covering the entire population. We analysed the 12-year diabetes incidence using multivariate Poisson regression for 2,086,682 people, adjusting for gender, 10-year age groups, main population groups defined by country of origin, and seven socioeconomic groups: professionals, managers, technicians, workers skilled at basic level, unskilled workers, unemployed and pensioners. The crude 12-year incidence of diabetes was 5.8%. The saturated multivariate model, adjusted for gender, age, country of origin and socioeconomic status; showed a relative risk (RR) for diabetes incidence of 1.44 for male (reference: female), 3.95 for the age range of 50-59 years (reference: 30-39 years), 2.07 for unskilled workers (reference: professionals) and 2.15 for people from countries of 'non-Western origin' (reference: Danish origin). Diabetes incidence increases with age, male gender and low socioeconomic status; and also among people from countries of 'non-Western origin'. The results indicate that getting a more senior workforce will substantially increase the proportion of workers with diabetes, especially among already vulnerable groups. © 2014 the Nordic Societies of Public Health.

Gender differences in nigrostriatal dopaminergic innervation are present at young-to-middle but not at older age in normal adults.

PubMed

Wong, Ka Kit; Müller, Martijn L T M; Kuwabara, Hiroto; Studenski, Stephanie A; Bohnen, Nicolaas I

2012-01-01

Gender differences in brain dopaminergic activity have been variably reported in the literature. We performed an evaluation for gender effects on striatal dopamine transporter (DAT) binding in a group of normal subjects. Community-dwelling adults (n = 85, 50F/35M, mean age 62.7 ± 16.2 SD, range 20-85) underwent DAT [(11)C]2-β-carbomethoxy-3β-(4-fluorophenyl) tropane (β-CFT) positron emission tomography (PET) imaging. Gender effects for DAT binding were compared using ANCOVA for two subgroups; young-to-middle aged adults and older adults, using an age threshold of 60 years. There were 54 subjects (24M/30F; mean age 72.9 ± 7.3) 60 years and older and 31 (11M/20F; mean age 45.0 ± 11.4) subjects younger than 60. Age-adjusted striatal DAT gender effects were present in the young-to-middle (F = 10.4, P = 0.003) but not in the elderly age group (F = 0.5, ns). Gender differences in nigrostriatal dopaminergic innervation are present, with higher levels of DAT binding in young-to-middle age women compared to men, but not present in the elderly. Published by Elsevier Ltd.

[Appraisal of occupational stress in different gender, age, work duration, educational level and marital status groups].

PubMed

Yang, Xin-Wei; Wang, Zhi-Ming; Jin, Tai-Yi

2006-05-01

This study was conducted to assess occupational stress in different gender, age, work duration, educational level and marital status group. A test of occupational stress in different gender, age, work duration, educational level and marital status group, was carried out with revised occupational stress inventory (OSI-R) for 4278 participants. The results of gender show that there are heavier occupational role, stronger interpersonal and physical strain in male than that in female, and the differences are statistically significant (P < 0.01). The score of recreation in the male is higher than that in female, but the score of self-care in the female is higher than that in male, and the differences are statistically significant (P < 0.01). Difference in the scores of occupational role, personal resource among various age groups is significant (P < 0.01). Vocational, interpersonal strain scores among various age groups is significant (P < 0.05). The results of educational level analyses suggest that the difference in the scores of occupational stress and strain among various educational levels show statistically significant (P < 0.05), whereas there are no statistic significance of coping resources among the groups (P > 0.05). The occupational stress so as to improve the work ability of different groups. Different measure should be taken to reduce the occupational stress so as to improve the work ability of different groups.

How to Improve Adolescents' Sun Protection Behavior? Age and Gender Issues

ERIC Educational Resources Information Center

Paul, Christine; Tzelepis, Flora; Parfitt, Nicholas; Girgis, Afaf

2008-01-01

Objective: To explore adolescents' self-reported reasons for sun protection, as adolescents as a group continue to have poor sun protection practices. Methods: Seventeen age- and gender-segregated focus groups were conducted in Australian high schools. Results: Reasons for using sun protection included personal comfort, appearance, policies, fear…

Effect of gender, age and deprivation on key performance indicators in a FOBT-based colorectal screening programme.

PubMed

Steele, R J C; Kostourou, I; McClements, P; Watling, C; Libby, G; Weller, D; Brewster, D H; Black, R; Carey, F A; Fraser, C

2010-01-01

To assess the effect of gender, age and deprivation on key performance indicators in a colorectal cancer screening programme. Between March 2000 and May 2006 a demonstration pilot of biennial guaiac faecal occult blood test (gFOBT) colorectal screening was carried out in North-East Scotland for all individuals aged 50-69 years. The relevant populations were subdivided, by gender, into four age groups and into five deprivation categories according to the Scottish Index of Multiple Deprivation (SIMD), and key performance indicators analysed within these groups. In all rounds, uptake of the gFOBT increased with age (P < 0.001), decreased with increasing deprivation in both genders (P < 0.001), and was consistently higher in women than in men in all age and all SIMD groups. In addition, increasing deprivation was negatively associated with uptake of colonoscopy in men with a positive gFOBT (P < 0.001) although this effect was not observed in women. Positivity rates increased with age (P < 0.001) and increasing deprivation (P < 0.001) in both genders in all rounds, although they were higher in men than in women for all age and SIMD categories. Cancer detection rates increased with age (P < 0.001), were higher in men than in women in all age and SIMD categories, but were not consistently related to deprivation. In both genders, the positive predictive value (PPV) for cancer increased with age (P < 0.001) and decreased with increasing deprivation (P < 0.001) in all rounds and was consistently higher in men than in women in all age and SIMD categories. In this population-based colorectal screening programme gender, age, and deprivation had marked effects on key performance indicators, and this has implications both for the evaluation of screening programmes and for strategies designed to reduce inequalities.

Examining aging sexual stigma attitudes among adults by gender, age, and generational status

PubMed Central

Syme, Maggie L.; Cohn, Tracy J.

2016-01-01

Objectives Stigma related to later life sexuality could produce detrimental effects for older adults, through individual concerns and limited sexual healthcare for older adults. Identifying groups at risk for aging sexual stigma will help to focus interventions to reduce it. Accordingly, the purpose of this study was to examine cross-sectional trends in aging sexual stigma attitudes by age group, generational status, and gender. Method An online survey was administered to a national sample of adults via a crowdsourcing tool, in order to examine aging sexual stigma across age groups, generational status, and gender (N=962; 47.0% male, 52.5% female, and .5% other; mean age = 45 yrs.). An aging sexual stigma index was formulated from the attitudinal items of the Aging Sexual Knowledge and Attitudes Scale. Results This sample reported moderately permissive attitudes toward aging sexuality, indicating a low level of aging sexual stigma. Though descriptive data showed trends of stigma attitudes increasing with age and later generations, there were no significant differences between age groups or generations in terms of aging sexual stigma beliefs. Men, regardless of age and/or generation, were found to espouse significantly higher stigmatic beliefs than women or those reporting “other” gender. Conclusions Aging sexual stigma beliefs may not be prevalent among the general population as cohorts become more sexually liberal over time, though men appear more susceptible to these beliefs. However, in order to more comprehensively assess aging sexual stigma, future research may benefit from measuring explicit and implicit aging sexual stigma beliefs. PMID:25703148

Quantification of pediatric and adult cervical vertebra-anatomical characteristics by age and gender for automotive application.

PubMed

Parenteau, Chantal S; Wang, Nicholas C; Zhang, Peng; Caird, Michelle S; Wang, Stewart C

2014-01-01

The cervical anatomy has been shown to affect injury patterns in vehicle crashes. Characterizing the spine anatomy and changes associated with growth and gender is important when assessing occupant protection. In this study, selected cervical characteristics were quantified. Computed tomography (CT) scans of 750 patients were selected from the University of Michigan trauma database; 314 were children and 436 were adults. Four variables were obtained: the maximum spinal canal radius, vertebral body depth, facet angles, and retroversion angles. The cervical spine measurements varied with age and gender. The body depth increased nonlinearly with age. The average vertebral body depth at C4 was 9.2 ± 0.38 mm in the 0-3 age group, 15.7 ± 0.29 mm in the 18-29 age group, and 17.2 ± 0.46 mm in the 60+ age group. Pediatric and adult males had larger vertebral body depth than females overall, irrespective of vertebral level (P <.001). Compared to females, the vertebral body depth was 8-9 percent greater in male children and 13-16 percent greater in adult males. The average radius varied with gender, with male children generally having a larger radius than females irrespective of vertebral level (P <.001). Overall, spinal canal radius was smallest in the 0-3 and 60+ age groups and largest in the 18-29 age group. The C4 radius was 5.91 ± 0.17, 6.28 ± 0.14, and 6.73 ± 0.17 mm respectively. The radius was larger in the 4-7 age group than in the 0-3 age group, irrespective of vertebral level (P <.0001). There were nonsignificant radius changes between the 4-7 and 8-11 age groups and the 8-11 and age 12-17 groups, suggesting that the size of the spinal cord reaches near maturation by the age of 7. Facet angles decreased with age in children and increased with age in adults. The average facet angles were largest in the 0-3 age group (P <.1, C2-C6). Adult facet angles were greater in the 60+ age group than in the 18-29 age group (P <.0001, C2-C6). Males had larger facet angles than females overall (P <.01 at C2, C5-C7). The retroversion angles were largest at C6 and C7. They increased with age in children and decreased in the adult population; they were larger (5-22%) in the 18-29 age group than in the 60+ age group (P <.0001, C2-C6). The results obtained in this study help explain variations in cervical anatomical changes associated with age and gender. The information is useful when assessing differences in injury patterns between different segments of the population. Anatomical measurements of the cervical spine should be considered for the development of models used to assess injury mechanisms for various occupant age groups.

Missing links in some curious auditory phenomena: a tale from the middle ear.

PubMed

Carpenter, Michelle S; Cacace, Anthony T; Mahoney, Marty J

2012-02-01

Broadband middle ear power reflectance (BMEPR) is an emerging noninvasive electroacoustic measure that evaluates transmission/reflection properties of the middle ear in high resolution. It is applicable over the entire age continuum and is rapid to perform. However, it remains to be determined if BMEPR is just an incremental step in the evolution of middle ear assessment or a major advance in the way middle ear function can be evaluated. To evaluate effects of age, gender, ear, and frequency on BMEPR measurements in adults without a history of middle ear disease and to assess whether these factors require consideration in test development; to review how these data may influence active physiologic process within the inner ear; to consider how they reconcile with previously published results; and to suggest applications for future research. Prospective, cross-sectional, multivariate analysis to evaluate the effects of age, gender, ear, and frequency on BMEPR in humans without a history of middle ear disease and no air-bone gaps exceeding 10 dB for any frequency. Fifty-six adults in two age groups (Group 1: 18-25 yr, n = 28; Group 2: ≥50 and <66 yr, n = 28). Each age group was stratified by ear and gender in a balanced design. Pure tone air conduction and bone-conduction audiometry was conducted in a commercial sound booth, using a clinical audiometer with standard earphones enclosed in supra-aural ear cushions, and a standard bone-conduction oscillator and headband to evaluate for air-bone gaps. Broadband middle ear power reflectance was measured using a calibrated, commercially available computer-controlled system that incorporated a high quality probe assembly to transduce stimuli and record acoustic responses from the ear canal. Data were analyzed with a four-way (2 × 2 × 2 × 16) repeated measures analysis-of-variance (ANOVA) to evaluate the effects of age group (young vs. old), gender (male vs. female), ear (left vs. right), and frequency (258 to 5040 Hz) on BMEPR. The ANOVA revealed a significant main effect of frequency. There were also gender × ear, gender × frequency, and age × gender × ear interactions. The three-way, age × gender × ear interaction captured the essence of results and revealed lowest power reflectance values in younger females and for right ears. This trend partially reversed in the older age group where higher power reflectance values were observed only in right ears of older females. The significant effects of age, gender, ear, and frequency on BMEPR parallel ear- and gender-related differences in hearing sensitivity, ear, and gender differences in the prevalence of spontaneous otoacoustic emissions (OAEs), gender differences in the magnitude of transient evoked OAEs, and ear differences in transient evoked contralateral OAE suppression effects reported in the literature. While original discussions of these aforementioned effects focused primarily on endocochlear and olivocochlear mechanisms, the BMEPR measurements reported herein suggest that middle ear transmission characteristics may also play a role. American Academy of Audiology.

Has life satisfaction in Norway increased over a 20-year period? Exploring age and gender differences in a prospective longitudinal study, HUNT.

PubMed

Lysberg, Frode; Gjerstad, PåL; Småstuen, Milada Cvancarova; Innstrand, Siw Tone; Høie, Magnhild Mjåvatn; Arild Espnes, Geir

2018-02-01

The aim of the present study was to investigate the change in overall life satisfaction for different age groups and between genders over a 20-year period. Data from 1984 to 2008 were extracted from a large prospective longitudinal health study of Nord-Trøndelag (HUNT), Norway. The study included more than 176,000 participants ranging from 20 to 70+ years of age. Data were analysed using logistic regression and adjusted for gender. The analyses revealed an increase in life satisfaction for all age groups from 1984-1986 (HUNT 1) to 1995-1997 (HUNT 2), with the highest levels being reached at 2006-2008 (HUNT 3). For all age groups, the data showed an increase of about 20% for the period from 1984-1986 (HUNT 1) to 1995-1997 (HUNT 2). From 1995-1997 (HUNT 2) to 2006-2008 (HUNT 3), the increase in overall life satisfaction was 16% for the younger age groups, and about 32% for the older age groups (40-69 and 70+ years). Women's scores for overall life satisfaction were higher for nearly all age groups when compared to men using HUNT 3 as a reference. These findings suggest an increase in life satisfaction for all age groups from 1984 to 2008, especially for the older age group (40-69 and 70+ years). The data indicate that women score higher on life satisfaction for most age groups as compared to men.

Association between glycated hemoglobin A1c levels with age and gender in Chinese adults with no prior diagnosis of diabetes mellitus

PubMed Central

MA, QINGLIN; LIU, HOUMING; XIANG, GUANGXIN; SHAN, WANSHUI; XING, WANLI

2016-01-01

The present cross-sectional study consisted of 18,265 Chinese patients not previously diagnosed with diabetes mellitus, and who underwent physical examination at the Third People's Hospital of Shenzhen between June 2014 and May 2015 (mean patient age, 51.312±15.252 years). The study was composed of 11,770 males and 6,495 females. The aim was to investigate the association between glycated hemoglobin A1c (HbA1c) levels, gender and age. HbA1c values were measured using a Bio-Rad VARIANT™ II HbA1c Reorder Pack. All data was collected for analysis of the HbA1c levels in different gender and age groups, in order to investigate the association between HbA1c levels and age. Analysis of the 18,265 total cases and 16,734 cases with HbA1c levels <6.5%, demonstrated a positive correlation between levels of HbA1c and patient age. Linear regression for patient age and HbA1c levels demonstrated that HbA1c (%) = 0.020 × age (years) + 4.523 (r=0.369, P<0.0001) and HbA1c (%) = 0.014 × age (years) + 4.659 (r=0.485, P<0.0001), respectively. HbA1c levels of the male group were significantly higher than those of the female group (P<0.0001). Furthermore, in different gender groups, HbA1c levels gradually rose with increasing age. Therefore, HbA1c levels are associated with age and gender in Chinese populations, and this should be considered when selecting HbA1c as a criterion for future diabetes screening. PMID:27284415

The evaluation of MCI, MI, PMI and GT on both genders with different age and dental status.

PubMed

Bozdag, G; Sener, S

2015-01-01

The aim of this study was to measure the mandibular cortical index (MCI), mental index (MI), panoramic mandibular index (PMI) and cortical bone thickness in the zone of the gonial angle (GT) in panoramic radiographies from a large sample of males and females and to determine how they relate to patients' age, gender and dental status. 910 panoramic radiographs were obtained and grouped into age, dental status and gender. The MCI, MI, PMI and GT were analysed. Remarkable differences were observed for MCI and GT regarding gender, age groups and dental status on both sides (p < 0.05). While age and dental status had an effect on the MI and PMI in females, dental status had an effect on the MI and PMI in males (p < 0.05). Also, gender had an effect on the MI and PMI (p < 0.05). The effects of age and tooth loss are different in females and males. In females, the harmful effects of tooth loss and age are more prominent according to the PMI and MI measurements. The effects of age and tooth loss in the GT and MCI measurements are similar, and these indices can be accepted as more reliable in studies including both genders.

The evaluation of MCI, MI, PMI and GT on both genders with different age and dental status

PubMed Central

Sener, S

2015-01-01

Objectives: The aim of this study was to measure the mandibular cortical index (MCI), mental index (MI), panoramic mandibular index (PMI) and cortical bone thickness in the zone of the gonial angle (GT) in panoramic radiographies from a large sample of males and females and to determine how they relate to patients' age, gender and dental status. Methods: 910 panoramic radiographs were obtained and grouped into age, dental status and gender. The MCI, MI, PMI and GT were analysed. Results: Remarkable differences were observed for MCI and GT regarding gender, age groups and dental status on both sides (p < 0.05). While age and dental status had an effect on the MI and PMI in females, dental status had an effect on the MI and PMI in males (p < 0.05). Also, gender had an effect on the MI and PMI (p < 0.05). Conclusions: The effects of age and tooth loss are different in females and males. In females, the harmful effects of tooth loss and age are more prominent according to the PMI and MI measurements. The effects of age and tooth loss in the GT and MCI measurements are similar, and these indices can be accepted as more reliable in studies including both genders. PMID:26133366

Neighbourhood socioeconomic inequalities in incidence of acute myocardial infarction: a cohort study quantifying age- and gender-specific differences in relative and absolute terms.

PubMed

Koopman, Carla; van Oeffelen, Aloysia A M; Bots, Michiel L; Engelfriet, Peter M; Verschuren, W M Monique; van Rossem, Lenie; van Dis, Ineke; Capewell, Simon; Vaartjes, Ilonca

2012-08-07

Socioeconomic status has a profound effect on the risk of having a first acute myocardial infarction (AMI). Information on socioeconomic inequalities in AMI incidence across age-gender-groups is lacking. Our objective was to examine socioeconomic inequalities in the incidence of AMI considering both relative and absolute measures of risk differences, with a particular focus on age and gender. We identified all patients with a first AMI from 1997 to 2007 through linked hospital discharge and death records covering the Dutch population. Relative risks (RR) of AMI incidence were estimated by mean equivalent household income at neighbourhood-level for strata of age and gender using Poisson regression models. Socioeconomic inequalities were also shown within the stratified age-gender groups by calculating the total number of events attributable to socioeconomic disadvantage. Between 1997 and 2007, 317,564 people had a first AMI. When comparing the most deprived socioeconomic quintile with the most affluent quintile, the overall RR for AMI was 1.34 (95 % confidence interval (CI): 1.32-1.36) in men and 1.44 (95 % CI: 1.42-1.47) in women. The socioeconomic gradient decreased with age. Relative socioeconomic inequalities were most apparent in men under 35 years and in women under 65 years. The largest number of events attributable to socioeconomic inequalities was found in men aged 45-74 years and in women aged 65-84 years. The total proportion of AMIs that was attributable to socioeconomic inequalities in the Dutch population of 1997 to 2007 was 14 % in men and 18 % in women. Neighbourhood socioeconomic inequalities were observed in AMI incidence in the Netherlands, but the magnitude across age-gender groups depended on whether inequality was expressed in relative or absolute terms. Relative socioeconomic inequalities were high in young persons and women, where the absolute burden of AMI was low. Absolute socioeconomic inequalities in AMI were highest in the age-gender groups of middle-aged men and elderly women, where the number of cases was largest.

Neighbourhood socioeconomic inequalities in incidence of acute myocardial infarction: a cohort study quantifying age- and gender-specific differences in relative and absolute terms

PubMed Central

2012-01-01

Background Socioeconomic status has a profound effect on the risk of having a first acute myocardial infarction (AMI). Information on socioeconomic inequalities in AMI incidence across age- gender-groups is lacking. Our objective was to examine socioeconomic inequalities in the incidence of AMI considering both relative and absolute measures of risk differences, with a particular focus on age and gender. Methods We identified all patients with a first AMI from 1997 to 2007 through linked hospital discharge and death records covering the Dutch population. Relative risks (RR) of AMI incidence were estimated by mean equivalent household income at neighbourhood-level for strata of age and gender using Poisson regression models. Socioeconomic inequalities were also shown within the stratified age-gender groups by calculating the total number of events attributable to socioeconomic disadvantage. Results Between 1997 and 2007, 317,564 people had a first AMI. When comparing the most deprived socioeconomic quintile with the most affluent quintile, the overall RR for AMI was 1.34 (95 % confidence interval (CI): 1.32 – 1.36) in men and 1.44 (95 % CI: 1.42 – 1.47) in women. The socioeconomic gradient decreased with age. Relative socioeconomic inequalities were most apparent in men under 35 years and in women under 65 years. The largest number of events attributable to socioeconomic inequalities was found in men aged 45–74 years and in women aged 65–84 years. The total proportion of AMIs that was attributable to socioeconomic inequalities in the Dutch population of 1997 to 2007 was 14 % in men and 18 % in women. Conclusions Neighbourhood socioeconomic inequalities were observed in AMI incidence in the Netherlands, but the magnitude across age-gender groups depended on whether inequality was expressed in relative or absolute terms. Relative socioeconomic inequalities were high in young persons and women, where the absolute burden of AMI was low. Absolute socioeconomic inequalities in AMI were highest in the age-gender groups of middle-aged men and elderly women, where the number of cases was largest. PMID:22870916

[Stratified analysis of the relationship between traditional Chinese medicine constitutional types and health status in the general population based on data of 8,448 cases].

PubMed

Zhu, Yan-bo; Wang, Qi; Chen, Ke-fan; Wu, Yu-e; Hong, Wei-li; Liu, Li

2011-04-01

To examine the relationship between traditional Chinese medicine (TCM) constitutional types and health status among groups of different age or gender in the general population of China. Data of 8 448 cases were randomly sampled from a database of 21 948 cases of a cross-sectional survey on the TCM constitutional types and health status which was carried out in 9 provinces or municipalities of China (Jiangsu, Anhui, Gansu, Qinghai, Fujian, Beijing, Jilin, Jiangxi and Henan) according to gender and age structure of the Chinese population in 2005. Scores of health-related quality of life scale--the Medical Outcomes Study 36-Item Short-Form Health Survey (MOS SF-36)--were analyzed by Nemenyi test to compare the health status of individuals with different constitutional types. Compared with the gentleness type, the MOS SF-36 scores of the 8 types of pathological constitution were significantly low (P<0.05) among groups of different age or gender. The MOS SF-36 score was the lowest in men of the qi-deficiency, qi-depression and blood-stasis types, while it was the lowest in women of the phlegm-dampness, qi-depression and qi-deficiency types. For the age group of 15 to 34, the special diathesis, qi-depression and blood-stasis types had the lowest MOS SF-36 scores; for the age group of 35 to 59, the qi-deficiency, qi-depression and blood-stasis types had the lowest MOS SF-36 scores; for the age group of over 60, the qi-deficiency, qi-depression and phlegm-dampness types had the lowest MOS SF-36 scores. In groups of different gender or age, the MOS SF-36 scores of the 8 types of pathological constitution were significantly lower than that of the gentleness type, indicating a deficient health status. The health status of different types of constitution showed different characteristics in groups of different gender or age.

Relationship between Body Mass Index (BMI) and body fat percentage, estimated by bioelectrical impedance, in a group of Sri Lankan adults: a cross sectional study.

PubMed

Ranasinghe, Chathuranga; Gamage, Prasanna; Katulanda, Prasad; Andraweera, Nalinda; Thilakarathne, Sithira; Tharanga, Praveen

2013-09-03

Body Mass Index (BMI) is used as a useful population-level measure of overweight and obesity. It is used as the same for both sexes and for all ages of adults. The relationship between BMI and body fat percentage (BF %) has been studied in various ethnic groups to estimate the capacity of BMI to predict adiposity. We aimed to study the BMI-BF% relationship, in a group of South Asian adults who have a different body composition compared to presently studied ethnic groups. We examined the influence of age, gender in this relationship and assessed its' linearity or curvilinearity. A cross sectional study was conducted, where adults of 18-83 years were grouped into young (18-39 years) middle aged (40-59 years) and elderly (>60 years). BF% was estimated from bioelectrical impedance analysis. Pearsons' correlation coefficient(r) was calculated to see the relationship between BMI-BF% in the different age groups. Multiple regression analysis was performed to determine the effect of age and gender in the relationship and polynomial regression was carried out to see its' linearity. The relationships between age-BMI, age-BF % were separately assessed. Out of 1114 participants, 49.1% were males. The study sample represented a wide range of BMI values (14.8-41.1 kg/m2,Mean 23.8 ± 4.2 kg/m2). A significant positive correlation was observed between BMI-BF%, in males (r =0.75, p < 0.01; SEE = 4.17) and in females (r = 0.82, p < 0.01; SEE = 3.54) of all ages. Effect of age and gender in the BMI-BF% relationship was significant (p < 0.001); with more effect from gender. Regression line found to be curvilinear in nature at higher BMI values where females (p < 0.000) having a better fit of the curve compared to males (p < 0.05). In both genders, with increase of age, BMI seemed to increase in curvilinear fashion, whereas BF% increased in a linear fashion. BMI strongly correlate with BF % estimated by bioelectrical impedance, in this sub population of South Asian adults. This relationship was curvilinear in nature and was significantly influenced by age and gender. Our findings support the importance of taking age and gender in to consideration when using BMI to predict body fat percentage/obesity, in a population.

Impact energy absorption by specimens from the upper end of the human femur.

PubMed

Panagiotopoulos, E; Kostopoulos, V; Tsantzalis, S; Fortis, A P; Doulalas, A

2005-05-01

A cadaveric biomechanical study was performed to investigate the fracture energy absorbed by strips of bone from the proximal femur in relation to age and gender, under impact loading conditions. Four groups (young male, young female, old male, old female) of four cadaveric proximal femurs were used in each case. Four bone strips were taken from the neck and four from the subtrochanteric area and these were tested under dynamic-impact conditions using the Charpy impact test. The fracture energy was calculated as the energy needed to achieve fracture per unit area, and expressed in J/m2. Bone specimens from young males are significantly tougher under impact conditions to those of females (p = 0.001), whereas between the old male and female groups, fracture energy does not significantly differ (p = 0.165). There was also significant difference (p < 0.0005) between the young and the old groups in both genders. The fracture energy absorption of the subtrochanteric area compared to that of the femoral neck for the same group of age and gender is in general slightly higher for all groups. In conclusion, gender in the young age group played a significant role in bone resistance in breaking whereas in the older age group it played a less important role.

"You Have to Approach Us Right": A Qualitative Framework Analysis for Recruiting African Americans Into mHealth Research.

PubMed

James, Delores C S; Harville, Cedric; Efunbumi, Orisatalabi; Babazadeh, Ida; Ali, Sheriza

2017-10-01

Despite the high ownership of smartphones, African Americans (AAs) remain underrepresented in health research and specifically mobile health (mHealth) research. This may be due to ineffective recruitment efforts. To explore strategies for recruiting AAs into mHealth research and examine how these strategies may vary by gender and age-group. Twenty triad focus groups ( n = 60) were conducted with AA males ( n = 9 groups) and females ( n = 11 groups). The framework method was used to manage, organize, synthesize, and analyze data themes by gender and age-group (18-29, 30-50, 51+). Most participants owned smartphones (71%) and were willing to participate in mHealth research (62%). The participants' narrative revealed the tension between mistrust of researchers and the excitement of participating in technology-based research. Both genders and all age-groups can be reached via word-of-mouth because it is "the best advertisement." Personal contact must precede traditional and electronic recruitment strategies because "we have to know you." Churches are excellent places for recruitment because they are "trustworthy" and have a "repeat audience." Facebook may be effective for both genders and all age-groups because "everybody is on Facebook" and it can "reach more people than text and e-mail." Beauty/barber shops may be limited in reaching both genders and age-groups, but especially young women who style their own hair natural, and young men who wear braids and dreadlocks. Personal contact must precede traditional and electronic recruitment strategies because "we have to know you." A tailored, multipronged strategy that combines traditional recruitment methods with texting, e-mail, and social media may be effective in recruiting AA adults into mHealth research.

Gender-dependent differences in degree of facial wrinkles.

PubMed

Tsukahara, Kazue; Hotta, Mitsuyuki; Osanai, Osamu; Kawada, Hiromitsu; Kitahara, Takashi; Takema, Yoshinori

2013-02-01

This study aimed to reveal gender-dependent differences in the degree of facial wrinkles. Subjects comprised 173 Japanese men and women, divided into four groups according to age. Photographs were taken from nine facial regions and used to classify the intensity of wrinkles into five grades. In addition, replicas were taken from five facial sites and used to measure surface roughness. Data were compared between men and women within each age group. In all age groups, men showed increased forehead wrinkles compared with women. In contrast, no gender-dependent differences were found in upper eyelid wrinkles. Other facial wrinkles were greater in men than in women in all except the oldest group (age, 65-75 years), in which wrinkles in women were greater than or equal to those in men. Our results showed that gender-dependent differences exist in the degree of facial wrinkles. In general, men tend to have more severe wrinkles than women. This tendency disappeared or was reversed in some regions of the face and in individuals more than 60 years old. © 2011 John Wiley & Sons A/S.

Weather and age-gender effects on the projection of future emergency ambulance demand in Hong Kong.

PubMed

Lai, Poh-Chin; Wong, Ho-Ting

2015-03-01

An accurate projection for ambulance demand is essential to enable better resource planning for the future that strives to either maintain current levels of services or reconsider future standards and expectations. More than 2 million cases of emergency room attendance in 2008 were obtained from the Hong Kong Hospital Authority to project the demand for its ambulance services in 2036. The projection of ambulance demand in 2036 was computed in consideration of changes in the age-gender structure between 2008 and 2036. The quadratic relation between average daily temperature and daily ambulance demand in 2036 was further explored by including and excluding age-gender demographic changes. Without accounting for changes in the age-gender structure, the 2036 ambulance demand for age groups of 65 and above were consistently underestimated (by 38%-65%), whereas those of younger age groups were overestimated (by 6%-37%). Moreover, changes in the 2008 to 2036 age-gender structure also shift upward and emphasize relationships between average daily temperature and daily ambulance demand at both ends of the quadratic U-shaped curve. Our study reveals a potential societal implication of ageing population on the demand for ambulance services. © 2012 APJPH.

Cross-Cultural and Gender Differences in ADHD Among Young Adults.

PubMed

Gómez-Benito, Juana; Van de Vijver, Fons J R; Balluerka, Nekane; Caterino, Linda

2015-10-29

This study explored the effect of cultural and gender differences in ADHD among Spanish, African American, Hispanic American, and European American young adults. Structural equivalence between the four groups was examined by Tucker's phi coefficient. A MANCOVA was carried out with cultural groups and gender as factors and age as covariate. Structural equivalence was observed across all groups, and no differential item functioning was found. No significant effect was found for gender, although, with the exception of the Hispanic group, males scored higher than females. Furthermore, small, though significant, cultural differences were found. The lowest levels of ADHD were observed in the European American group and the highest in the Hispanic American group. ADHD symptoms, notably inattention, showed some decline with age. Findings extend existing data and suggest a relationship between culture and the development of ADHD, which might be mediated by parenting style. © The Author(s) 2015.

How to improve adolescents' sun protection behavior? Age and gender issues.

PubMed

Paul, Christine; Tzelepis, Flora; Parfitt, Nicholas; Girgis, Afaf

2008-01-01

To explore adolescents' self-reported reasons for sun protection, as adolescents as a group continue to have poor sun protection practices. Seventeen age- and gender-segregated focus groups were conducted in Australian high schools. Reasons for using sun protection included personal comfort, appearance, policies, fear of skin cancer, expectations of authority figures, peer actions, and habit. Reasons for not using sun protection included desire for a tan, inconvenience, low perceived risk, and fashion. Age and gender effects were found. Avenues for intervention with adolescents include authority figures, peer advocacy, the fashion industry, and improved sun protection products.

Age and Gender Differences in Emotion Regulation Strategies: Autobiographical Memory, Rumination, Problem Solving and Distraction.

PubMed

Ricarte Trives, Jorge Javier; Navarro Bravo, Beatriz; Latorre Postigo, José Miguel; Ros Segura, Laura; Watkins, Ed

2016-07-18

Our study tested the hypothesis that older adults and men use more adaptive emotion regulatory strategies but fewer negative emotion regulatory strategies than younger adults and women. In addition, we tested the hypothesis that rumination acts as a mediator variable for the effect of age and gender on depression scores. Differences in rumination, problem solving, distraction, autobiographical recall and depression were assessed in a group of young adults (18-29 years) compared to a group of older adults (50-76 years). The older group used more problem solving and distraction strategies when in a depressed state than their younger counterparts (ps .06). Ordinary least squares regression analyses with bootstrapping showed that rumination mediated the association between age, gender and depression scores. These results suggest that older adults and men select more adaptive strategies to regulate emotions than young adults and women with rumination acting as a significant mediator variable in the association between age, gender, and depression.

34 CFR 373.23 - What additional requirements must be met?

Code of Federal Regulations, 2013 CFR

2013-07-01

..., gender, age, or disabilities. (2) Encourage applications for employment from persons who are members of groups that have traditionally been underrepresented based on race, color, national origin, gender, age...

34 CFR 373.23 - What additional requirements must be met?

Code of Federal Regulations, 2012 CFR

2012-07-01

..., gender, age, or disabilities. (2) Encourage applications for employment from persons who are members of groups that have traditionally been underrepresented based on race, color, national origin, gender, age...

34 CFR 373.23 - What additional requirements must be met?

Code of Federal Regulations, 2014 CFR

2014-07-01

..., gender, age, or disabilities. (2) Encourage applications for employment from persons who are members of groups that have traditionally been underrepresented based on race, color, national origin, gender, age...

34 CFR 373.23 - What additional requirements must be met?

Code of Federal Regulations, 2010 CFR

2010-07-01

..., gender, age, or disabilities. (2) Encourage applications for employment from persons who are members of groups that have traditionally been underrepresented based on race, color, national origin, gender, age...

34 CFR 373.23 - What additional requirements must be met?

Code of Federal Regulations, 2011 CFR

2011-07-01

..., gender, age, or disabilities. (2) Encourage applications for employment from persons who are members of groups that have traditionally been underrepresented based on race, color, national origin, gender, age...

Pediatric normative data for the KayPENTAX phonatory aerodynamic system model 6600.

PubMed

Weinrich, Barbara; Brehm, Susan Baker; Knudsen, Courtney; McBride, Stephanie; Hughes, Michael

2013-01-01

The objectives of this study were to (1) establish a preliminary pediatric normative database for the KayPENTAX Phonatory Aerodynamic System (PAS) Model 6600 (KayPENTAX Corp, Montvale, NJ) and (2) identify whether the data obtained were age- and/or gender-dependent. Prospective data collection across groups. A sample of 60 children (30 females and 30 males) with normal voices was divided into three age groups (6.0-9.11, 10.0-13.11, 14.0-17.11 years) with equal distribution of males and females within each group. Five PAS protocols (vital capacity, maximum sustained phonation, comfortable sustained phonation, variation in sound pressure level, voicing efficiency) were used to collect 45 phonatory aerodynamic measures. Measurements for the 45 PAS parameters examined revealed 13 parameters to have a difference that was statistically significant by age and/or gender. There was a significant age×gender interaction for mean pitch in the four protocols that reported this measure. Males in the oldest group had significantly lower mean pitch values than the middle and young groups. Statistically significant main effect differences were noted for seven parameters across three age groups (expiratory volume, expiratory airflow duration, phonation time, pitch range (in 2 protocols), aerodynamic resistance, acoustic ohms). Significant main effect differences for genders (males > females) were found for expiratory volume and peak expiratory airflow. The age- and gender-related differences found for some parameters within each of the five protocols are important for the interpretation of data obtained from PAS. These results could be explained by developmental changes that occur in the male and female respiratory and laryngeal systems. Copyright © 2013 The Voice Foundation. Published by Mosby, Inc. All rights reserved.

[Characteristics of children and adolescents with gender dysphoria referred to the Hamburg Gender Identity Clinic].

PubMed

Becker, Inga; Gjergji-Lama, Voltisa; Romer, Georg; Möller, Birgit

2014-01-01

Given the increasing demand for counselling in gender dysphoria in childhood in Germany, there is a definite need for empirical data on characteristics and developmental trajectories of this clinical group. This study aimed to provide a first overview by assessing demographic characteristics and developmental trajectories of a group of gender variant boys and girls referred to the specialised Gender Identity Clinic in Hamburg. Data were extracted from medical charts, transcribed and analysed using qualitative content analysis methods. Categories were set up by inductive-deductive reasoning based on the patients' parents' and clinicians' information in the files. Between 2006 and 2010, 45 gender variant children and adolescents were seen by clinicians; 88.9% (n = 40) of these were diagnosed with gender identity disorder (ICD-10). Within this group, the referral rates for girls were higher than for boys (1:1.5). Gender dysphoric girls were on average older than the boys and a higher percentage of girls was referred to the clinic at the beginning of adolescence (> 12 years of age). At the same time, more girls reported an early onset age. More girls made statements about their (same-sex) sexual orientation during adolescence and wishes for gender confirming medical interventions. More girls than boys revealed self-mutilation in the past or present as well as suicidal thoughts and/or attempts. Results indicate that the presentation of clinically referred gender dysphoric girls differs from the characteristics boys present in Germany; especially with respect to the most salient age differences. Therefore, these two groups require different awareness and individual treatment approaches.

[Aging negative stereotypes and their relationship with sociodemographic variables over 65 elderly].

PubMed

Sánchez Palacios, Concepción; Trianes Torres, M Victoria; Blanca Mena, M José

2009-01-01

The aim of the present study was to determine whether there are any associations between the degree of belief in negative stereotypes of aging in 65- to 96-year-old and the following sociodemographic variables: gender, age, marital status and educational level. The sample consisted of 757 non-institutionalized people divided into four age groups. Gender was homogeneously distributed in all groups. During an interview, the participants responded to a questionnaire that was organized in two parts. The first part collected data on age, educational level, gender and marital status. The second part consisted of a scale of negative stereotype of aging (Cuestionario de Estereotipos Negativos hacia la Vejez [CENVE]), with three factors: health, social-motivational and character-personality. Significant differences were found in relation to age but not in relation to gender. In relation to the health factor, participants aged more than 80 showed weaker stereotypes than the remaining age groups. In relation to the social-motivational factor, the older the participants, the stronger the negative stereotypes in relation to a decrease in interests in life. Persons with lower educational level scored higher on the health and character-personality factors of the CENVE. The results are discussed in relation to their potential applications in psychosocial interventions.

Gender Attitudes in Early Childhood: Behavioral Consequences and Cognitive Antecedents.

PubMed

Halim, May Ling D; Ruble, Diane N; Tamis-LeMonda, Catherine S; Shrout, Patrick E; Amodio, David M

2017-05-01

This study examined factors that predicted children's gender intergroup attitudes at age 5 and the implications of these attitudes for intergroup behavior. Ethnically diverse children from low-income backgrounds (N = 246; Mexican-, Chinese-, Dominican-, and African American) were assessed at ages 4 and 5. On average, children reported positive same-gender and negative other-gender attitudes. Positive same-gender attitudes were associated with knowledge of gender stereotypes. In contrast, positive other-gender attitudes were associated with flexibility in gender cognitions (stereotype flexibility, gender consistency). Other-gender attitudes predicted gender-biased behavior. These patterns were observed in all ethnic groups. These findings suggest that early learning about gender categories shape young children's gender attitudes and that these gender attitudes already have consequences for children's intergroup behavior at age 5. © 2016 The Authors. Child Development © 2016 Society for Research in Child Development, Inc.

Proposed shade guide for human facial skin and lip: a pilot study.

PubMed

Wee, Alvin G; Beatty, Mark W; Gozalo-Diaz, David J; Kim-Pusateri, Seungyee; Marx, David B

2013-08-01

Currently, no commercially available facial shade guide exists in the United States for the fabrication of facial prostheses. The purpose of this study was to measure facial skin and lip color in a human population sample stratified by age, gender, and race. Clustering analysis was used to determine optimal color coordinates for a proposed facial shade guide. Participants (n=119) were recruited from 4 racial/ethnic groups, 5 age groups, and both genders. Reflectance measurements of participants' noses and lower lips were made by using a spectroradiometer and xenon arc lamp with a 45/0 optical configuration. Repeated measures ANOVA (α=.05), to identify skin and lip color differences, resulting from race, age, gender, and location, and a hierarchical clustering analysis, to identify clusters of skin colors) were used. Significant contributors to L*a*b* facial color were race and facial location (P<.01). b* affected all factors (P<.05). Age affected only b* (P<.001), while gender affected only L* (P<.05) and b* (P<.05). Analyses identified 5 clusters of skin color. The study showed that skin color caused by age and gender primarily occurred within the yellow-blue axis. A significant lightness difference between gender groups was also found. Clustering analysis identified 5 distinct skin shade tabs. Copyright © 2013 The Editorial Council of the Journal of Prosthetic Dentistry. Published by Mosby, Inc. All rights reserved.

Quantitative scintigraphy of sacroiliac joints: effects of age, gender, and laterality

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vyas, K.; Eklem, M.; Seto, H.

The effects of age, gender, and laterality on sacroiliac/sacral ratios obtained during quantitative joint imaging were assessed in 97 nonarthritic control subjects. For the entire group, the right sacroiliac-to-sacral mean ratio of 1.27 in 54 males was significantly higher than the right mean ratio of 1.18 in 53 females. In both genders the right joint ratio tended to be higher than the left in all age groups. The difference in mean ratio between the two joints was wider for males than for females. The age did not afect the joint ratio in either gender. It is concluded that the rangemore » of normal sacroiliac-to-sacral ratios are different for males and females and should be taken into account during a quantitative sacroiliac joint imaging examination.« less

Osteoporosis Health Beliefs among Younger and Older Men and Women

ERIC Educational Resources Information Center

Johnson, C. Shanthi; McLeod, William; Kennedy, Laura; McLeod, Katherine

2008-01-01

The purpose of this study was to compare osteoporosis health beliefs among different age and gender groups. This study used a cross-sectional design, involved 300 participants that represent both genders and three age groups (18 to 25, 30 to 50, and 50-plus), and assessed osteoporosis health beliefs using the Osteoporosis Health Belief Scale…

Age and Gender Effects on Coping in Children and Adolescents.

ERIC Educational Resources Information Center

Hampel, Petra; Petermann, Franz

2005-01-01

The aim of this study was to investigate age and gender effects of children's and adolescents' coping with common stressors in 3 age groups (late childhood, early, and middle adolescence). Furthermore, age and developmental differences in situation-specific coping with 2 stress domains were examined. N = 1,123 participants (ages 8 to 13 years)…

The validity of the 12-item Bem Sex Role Inventory in older Spanish population: an examination of the androgyny model.

PubMed

Vafaei, Afshin; Alvarado, Beatriz; Tomás, Concepcion; Muro, Carmen; Martinez, Beatriz; Zunzunegui, Maria Victoria

2014-01-01

The Bem Sex Role Inventory (BSRI) is the most commonly used and validated gender role measurement tool across countries and age groups. However, it has been rarely validated in older adults and sporadically used in aging and health studies. Perceived gender role is a crucial part of a person's identity and an established determinant of health. Androgyny model suggests that those with high levels of both masculinity and femininity (androgynous) are more adaptive and hence have better health. Our objectives were to explore the validity of BSRI in an older Spanish population, to compare different standard methods of measuring gender roles, and to examine their impact on health indicators. The BSRI and health indicator questions were completed by 120 community-dwelling adults aged 65+ living in Aragon, Spain. Exploratory factor analysis was performed to examine psychometric properties of the BSRI. Androgyny was measured by three approaches: geometric mean, t-ratio, and traditional four-gender groups classification. Relationships between health indicators and gender roles were explored. Factor analysis resulted in two-factor solution consistent with the original masculine and feminine items with high loadings and good reliability. There were no associations between biological sex and gender roles. Different gender role measurement approaches classified participants differently into gender role groups. Overall, androgyny was associated with better mobility and physical and mental health. The traditional four groups approach showed higher compatibility with the androgyny model and was better able to disentangle the differential impact of gender roles on health. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Children's judgments about prosocial decisions and emotions: gender of the helper and recipient matters.

PubMed

Weller, Drika; Lagattuta, Kristin Hansen

2014-01-01

Children ages 5-13 years (N = 82) responded to prosocial and prohibitive moral dilemmas featuring characters whose desires conflicted with another person's need for help or ownership rights. The gender of the characters matched for half the trials (in-group version) and mismatched for the other half (out-group version). Both boys and girls judged that people would more likely help and not harm the gender in-group versus out-group. Only girls exhibited gender bias in emotion attributions, expecting girls to feel happier helping girls and better ignoring the needs of boys. With increasing age, children exhibited greater awareness of the emotional benefits of prosocial sacrifice and made stronger distinctions by need level when evaluating prosocial decisions, obligations, and permissibility. © 2014 The Authors. Child Development © 2014 Society for Research in Child Development, Inc.

Age, gender, social contacts, and psychological distress: findings from the 45 and up study.

PubMed

Phongsavan, Philayrath; Grunseit, Anne C; Bauman, Adrian; Broom, Dorothy; Byles, Julie; Clarke, Judith; Redman, Sally; Nutbeam, Don

2013-09-01

The study examined the relationships between social contact types and psychological distress among mid-older adults. Self-completed data from 236,490 Australian adults aged 45+ years. There was a consistent relationship between increased frequency in phone contacts, social visits, and social group contacts and reduced risk of psychological distress adjusted for demographic and health factors. However, stratified analyses by age showed, with one exception, that no significant associations were found between social group contact frequency and risk of psychological distress for those aged 85 years and older. Furthermore, significant interaction terms revealed that women experience a steeper reduction in risk than men at age 65 to 74 years and 75 to 84 years compared with those aged 45 to 64 years. Social contacts have age and gender differential effects on psychological distress of mid-older Australian adults. Interventions addressing social interaction need to be sensitive to gender and age differences.

Age-related gender differences in reporting ictal fear: analysis of case histories and review of the literature.

PubMed

Chiesa, Valentina; Gardella, Elena; Tassi, Laura; Canger, Raffaele; Lo Russo, Giorgio; Piazzini, Ada; Turner, Katherine; Canevini, Maria Paola

2007-12-01

To determine if there are age or gender-related differences in reporting fear as a symptom of epileptic seizure, all clinical charts of patients evaluated at the "C. Munari - Epilepsy Surgery Center" of Milan from 1990 to June 2005 were analyzed, looking for patients with ictal fear. Among the 2,530 clinical charts examined (1,330 male and 1,200 female), 265 patients were found with ictal fear (100 men, 165 women). The gender difference in reporting ictal fear was not so marked in the pediatric age group (98 girls, 74 boys), whereas in adult patients the difference was significant (158 women, 83 men). Interestingly, more men than women (14:3) had ictal fear during childhood that disappeared during adulthood. The literature review confirmed that ictal fear is significantly more common in women, though there is no gender difference in the pediatric age group.

Motivators of and Barriers to Engaging in Physical Activity: Perspectives of Low-Income Culturally Diverse Adolescents and Adults.

PubMed

Bragg, Marie A; Tucker, Carolyn M; Kaye, Lily B; Desmond, Frederic

2009-01-01

Obesity rates are rising in the United States, especially among low-income and racial/ethnic minority individuals. Exploring motivators and barriers relative to engaging in physical activity is imperative. The purpose of this study was to identify motivators and barriers relative to engagement in physical activity as reported by culturally diverse low-income adolescents and adults. A total of 91 adolescent (11 to 15 years of age) and adult (18 years of age or older) participants who self-identified as African American, Hispanic, or non-Hispanic White engaged in age group-, race/ethnicity-, and gender-concordant focus groups. Qualitative data analysis indicated that the motivators and barriers most commonly identified among the adolescent and adult focus groups were: social influence; time and priorities; physical environment; fun and enjoyment; inherently physical activities; weight concerns; fatigue, physical discomfort and current fitness level; and immediate positive feelings. Findings were generally similar across age group, gender and race/ethnicity. Age group-specific, gender-specific and race/ethnicity-specific motivators and barriers were related to how commonly the motivators and barriers were identified among each group. Implications for increasing physical activity among low-income culturally diverse adolescents and adults are discussed.

Defining functional groups based on running kinematics using Self-Organizing Maps and Support Vector Machines.

PubMed

Hoerzer, Stefan; von Tscharner, Vinzenz; Jacob, Christian; Nigg, Benno M

2015-07-16

A functional group is a collection of individuals who react in a similar way to a specific intervention/product such as a sport shoe. Matching footwear features to a functional group can possibly enhance footwear-related comfort, improve running performance, and decrease the risk of movement-related injuries. To match footwear features to a functional group, one has to first define the different groups using their distinctive movement patterns. Therefore, the main objective of this study was to propose and apply a methodological approach to define functional groups with different movement patterns using Self-Organizing Maps and Support Vector Machines. Further study objectives were to identify differences in age, gender and footwear-related comfort preferences between the functional groups. Kinematic data and subjective comfort preferences of 88 subjects (16-76 years; 45 m/43 f) were analysed. Eight functional groups with distinctive movement patterns were defined. The findings revealed that most of the groups differed in age or gender. Certain functional groups differed in their comfort preferences and, therefore, had group-specific footwear requirements to enhance footwear-related comfort. Some of the groups, which had group-specific footwear requirements, did not show any differences in age or gender. This is important because when defining functional groups simply using common grouping criteria like age or gender, certain functional groups with group-specific movement patterns and footwear requirements might not be detected. This emphasises the power of the proposed pattern recognition approach to automatically define groups by their distinctive movement patterns in order to be able to address their group-specific product requirements. Copyright © 2015 Elsevier Ltd. All rights reserved.

Gender Differences in Physical Health and Psychosocial Well Being among Four Age-Groups of Elderly People in Israel

ERIC Educational Resources Information Center

Carmel, Sara; Bernstein, Judith H.

2003-01-01

The purpose of this study was to investigate the extent to which the well-established gender differences in physical and psychosocial well being in adulthood persist throughout different age groups of elderly persons, in order to support one of two opposing hypotheses: the convergence and divergence hypotheses. Data were collected by structured…

Examining Preschoolers' Nutrition Knowledge Using a Meal Creation and Food Group Classification Task: Age and Gender Differences

ERIC Educational Resources Information Center

Holub, Shayla C.; Musher-Eizenman, Dara R.

2010-01-01

Eating behaviours begin to develop during early childhood, but relatively little is known about preschoolers' nutrition knowledge. The current study examined age and gender differences in this knowledge using two tasks: food group classification and the creation of unhealthy, healthy and preferred meals. Sixty-nine three- to six-year-old children…

The Effects of Age, Gender, and Hand on Force Control Capabilities of Healthy Adults.

PubMed

Lee, Baekhee; Lee, Mina; Yoh, Myeung Sook; You, Heecheon; Park, Hyunji; Jung, Kihyo; Lee, Byung Hwa; Na, Duk L; Kim, Geon Ha

2015-12-01

The present study examined the effects of age (20s to 70s), gender (male and female), and hand (dominant and nondominant) on force control capabilities (FCCs) in four force control phases (initiation, development, maintenance, and termination). Normative data of FCCs by force control phase are needed for various populations in age and gender to identify a type of motor performance reduction and its severity. FCCs of 360 participants (30 for each combination of age group and gender) were measured using a finger dynamometer and quantified in terms of initiation time (IT), development time (DT), maintenance error (ME), and termination time (TT). Although gradual increases (1%~28%) by age were shown in IT, DT, and TT, a dramatic increase in ME was observed among participants in their 50s (26%), 60s (68%), and 70s (160%) compared to those in their 20s~40s. The most distinctive interaction effect of age and gender was found in ME out of the four FCC measures. Lastly, hand and its related interactions were not found significant. Normative FCC data were established for four age groups (20s~40s, 50s, 60s, and 70s) and gender. The normative FCC data can be used for evaluating an individual's motor performance, screening patients with brain disorders, and designing input devices triggered and/or operated by the finger. © 2015, Human Factors and Ergonomics Society.

Does the small fit them all? The utility of Disabkids-10 Index for the assessment of pediatric health-related quality of life across age-groups, genders, and informants.

PubMed

Carona, Carlos; Silva, Neuza; Moreira, Helena; Canavarro, Maria Cristina; Bullinger, Monika

2015-12-01

The objective of this study was twofold: First, to conduct a confirmatory factor analysis of the Portuguese versions of Disabkids-10; and second, to examine potential differences in factor structures between age-groups, genders, and informants. The sample included 293 school-aged children and adolescents with chronic health conditions and 197 parents. Both family members (whenever possible) completed the self- and proxy-report versions of Disabkids-10. The factorial model of Disabkids-10 had good fit for self-reported data and minimally acceptable fit for proxy-reported data. The multigroup analyses confirmed the model invariance across age-groups (children vs. adolescents), genders (boys vs. girls), and informants (children vs. parents). The generic developmental applicability of these questionnaires makes them recommended for health care routine assessments on pediatric intervention needs and outcomes. © The Author(s) 2014.

Menopause and benign paroxysmal positional vertigo

PubMed Central

Ogun, Oluwaseye Ayoola; Büki, Bela; Cohn, Edward S.; Janky, Kristen L.; Lundberg, Yunxia Wang

2014-01-01

Objective This study was designed to examine the age and gender distribution and the effect of menopause in a large cohort of participants diagnosed with benign paroxysmal positional vertigo (BPPV). Methods We analyzed 1,377 BPPV patients and surveyed 935 women from this group, all diagnosed at Boys Town National Research Hospital (BTNRH) over the last decade. Results A detailed age- and gender- distribution analysis of BPPV onset showed that aging had a profound impact on BPPV occurrence in both genders, and that peri-menopausal women were especially susceptible to BPPV (3.2:1 female to male). The latter is a novel finding and was confirmed by a direct survey of female BPPV patients (168 participated). In addition, there was a pronounced female preponderance (6.8:1) for BPPV in the teenage group despite the low prevalence in this age group. Conclusions The data suggest that hormonal fluctuations (especially during menopause) may increase the tendency to develop BPPV. PMID:24496089

The Forensic Symptoms Inventory-Revised (FSI-R Adults): Measurement and Structural Invariance Across Gender and Age Groups.

PubMed

van Horn, Joan E

2018-06-01

This article investigates the measurement and structural invariance of a newly developed self-report questionnaire, the Forensic Symptoms Inventory-Revised, aimed at measuring eight cognitive, emotional, and behavioral deficits (aggression, lack of social support, problematic substance use, lack of concentration, anger, poor self-regulation, impulsivity, and sexual problems) among adult forensic outpatients. The sample consisted of 716 outpatients (603 males, 113 females) with a mean age of 38.19 (SD = 12.47). Multi-Group Confirmatory Factor Analyses supported the measurement and structural invariance with respect to gender and age groups (18-23 years and ≥24 years). Between-group comparisons revealed that, compared to females, male outpatients reported more substance related problems, as well as incapacities to control verbal and/or physical aggression. Compared to adults, young adults displayed more inadequate self-regulation skills and reported more social support. These findings may promote the formulation of gender- and age-specific treatment goals.

Reasons for dropout in swimmers, differences between gender and age and intentions to return to competition.

PubMed

Monteiro, Diogo M; Marinho, Daniel A; Moutão, João M; Vitorino, Anabela P; Antunes, Raúl N; Cid, Luís

2018-01-01

This study's main purpose was to analyze reasons for dropout in competitive swimmers and differences between gender and age groups. The influence of dropout on swimmers intentions to return to competition, invariance across gender and validation of Questionnaire of Reasons for Attrition were also analyzed. Study 1 - 366 athletes participated (N.=366; mean age 15.96, SD 5.99) and the data gathered was used for the exploratory analysis, and data gathered on 1008 athletes were used for the confirmatory analysis and the structural equations (N.=1008; mean age 16.26, SD 6.12); Study 2: 1008 athletes participated (N.=1008; mean age 16.26, SD 6.12) on the descriptive and inferential analysis of the reasons behind the practice dropout. The Questionnaire of Reasons Attrition was used in both studies to assess the reasons associated with the practice dropout. In study 1, the results showed an acceptable fit of the measurement model and invariance across gender and also predictive validity regarding swimmers intentions to return to competition (e.g., "demands/pressure" negatively predict intentions). In study 2, the main results showed that the most significant reason for dropout in both genders and all age groups was "dissatisfaction/other priorities"; the study also showed there to be differences between gender and age groups (e.g., female and younger athletes valued "demands/ pressure "more). This study offers useful guidelines for the training process and to support decisions on sports politics to be implemented to overcome the dropout rate. However, it is important to broaden the evidence to other sports and implement programs on identified priority areas based on longitudinal perspectives.

Increasing Trends in Schedule II Opioid Use and Doctor Shopping during 1999–2007 in California

PubMed Central

Han, Huijun; Kass, Philip H.; Wilsey, Barth L.; Li, Chin-Shang

2013-01-01

Purpose To examine the age and gender-specific trends of schedule II opioid use among California residents, with special reference to multiple provider users (“doctor shoppers”). Methods Utilizing data from the California Prescription Drug Monitoring Program, we examined age and gender-specific trends of Schedule II opioid use during calendar years 1999–2007. Specifically, we analyzed: 1) the prevalence of Schedule II opioid users among California’s population, and 2) the proportion of these opioid users who were doctor shoppers (defined as an individual who used more than five different prescribers for all schedule II opioids he/she obtained in a calendar year). Results Among all age and gender groups, the prevalence of Schedule II opioid users in California increased by 150%–280% and the prevalence of doctor shoppers among users increased by 111%–213% over nine years. The prevalence of opioid users was lowest among 18–44 year-old males (1.25%) and highest among 65 years and older females (5.31%) by 2007. The prevalence of doctor shoppers was approximately 1.4% among those up to age 64 and 0.5% among those 65 years and older. The gender difference in doctor shoppers among all age groups was negligible. On average, the cumulative morphine-equivalent amount of Schedule II opioid per individual obtained per year was three- to six-fold higher for doctor shoppers than for the general population across different age and gender groups. Conclusions Age and gender differences in opioid use were relatively small, while the trends for use of opioids and multiple providers grew at a disquieting rate. PMID:23956137

Gender influences headache characteristics with increasing age in migraine patients.

PubMed

Bolay, Hayrunnisa; Ozge, Aynur; Saginc, Petek; Orekici, Gulhan; Uludüz, Derya; Yalın, Osman; Siva, Aksel; Bıçakçi, Şebnem; Karakurum, Başak; Öztürk, Musa

2015-08-01

Migraine headache is one of the most common primary headache disorders and is three times more prevalent in women than in men, especially during the reproductive ages. The neurobiological basis of the female dominance has been partly established. The present study aimed to investigate the effect of gender on the headache manifestations in migraine patients. The study group consisted of 2082 adult patients from five different hospitals' tertiary care-based headache clinics. The relationship between headache characteristics and gender was evaluated in migraine with aura (MwA) and migraine without aura (MwoA). The duration, severity, frequency of headache and associated symptoms were evaluated in both genders and age-dependent variations and analyzed in two subgroups. Women with migraine were prone to significantly longer duration and intensity of headache attacks. Nausea, phonophobia and photophobia were more prevalent in women. Median headache duration was also longer in women than in men in MwA (p = 0.013) and MwoA (p < 0.001). Median headache intensity was higher in women than in men in MwA (p = 0.010) and MwoA (p = 0.009). The frequency of nausea was significantly higher in women than in men in MwA (p = 0.049). Throbbing headache quality and associated features (nausea, photophobia, and phonophobia) were significantly more frequent in women than in men in MwoA. The gender impact varied across age groups and significant changes were seen in female migraineurs after age 30. No age-dependent variation was observed in male migraineurs. Gender has an influence on the characteristics of the headache as well as on the associated symptoms in migraine patients, and this impact varies across the age groups, particularly in women. © International Headache Society 2014.

Exploratory Temporal and Spatial Analysis of Myocardial Infarction Hospitalizations in Calgary, Canada

PubMed Central

Liu, Xiaoxiao; Bertazzon, Stefania

2017-01-01

Spatial and temporal analyses are critical to understand the pattern of myocardial infarction (MI) hospitalizations over space and time, and to identify their underlying determinants. In this paper, we analyze MI hospitalizations in Calgary from 2004 to 2013, stratified by age and gender. First, a seasonal trend decomposition analyzes the seasonality; then a linear regression models the trend component. Moran’s I and hot spot analyses explore the spatial pattern. Though exploratory, results show that most age and gender groups feature a statistically significant decline over the 10 years, consistent with previous studies in Canada. Decline rates vary across ages and genders, with the slowest decline observed for younger males. Each gender exhibits a seasonal pattern with peaks in both winter and summer. Spatially, MI hot spots are identified in older communities, and in socioeconomically and environmentally disadvantaged communities. In the older communities, higher MI rates appear to be more highly associated with demographics. Conversely, worse air quality appears to be locally associated with higher MI incidence in younger age groups. The study helps identify areas of concern, where MI hot spots are identified for younger age groups, suggesting the need for localized public health policies to target local risk factors. PMID:29232910

Incidence of Mental Health Diagnoses in Veterans of Operations Iraqi Freedom, Enduring Freedom, and New Dawn, 2001-2014.

PubMed

Ramsey, Christine; Dziura, James; Justice, Amy C; Altalib, Hamada Hamid; Bathulapalli, Harini; Burg, Matthew; Decker, Suzanne; Driscoll, Mary; Goulet, Joseph; Haskell, Sally; Kulas, Joseph; Wang, Karen H; Mattocks, Kristen; Brandt, Cynthia

2017-02-01

To evaluate gender, age, and race/ethnicity as predictors of incident mental health diagnoses among Operations Iraqi Freedom, Enduring Freedom, and New Dawn veterans. We used US Veterans Health Administration (VHA) electronic health records from 2001 to 2014 to examine incidence rates and sociodemographic risk factors for mental health diagnoses among 888 142 veterans. Posttraumatic stress disorder (PTSD) was the most frequently diagnosed mental health condition across gender and age groups. Incidence rates for all mental health diagnoses were highest at ages 18 to 29 years and declined thereafter, with the exceptions of major depressive disorder (MDD) in both genders, and PTSD among women. Risk of incident bipolar disorder and MDD diagnoses were greater among women; risk of incident schizophrenia, and alcohol- and drug-use disorders diagnoses were greater in men. Compared with Whites, risk incident PTSD, MDD, and alcohol-use disorder diagnoses were lower at ages 18 to 29 years and higher at ages 45 to 64 years for both Hispanics and African Americans. Differentiating high-risk demographic and gender groups can lead to improved diagnosis and treatment of mental health diagnoses among veterans and other high-risk groups.

Differences in nativity, age and gender may impact health behavior and perspectives among Asian Indians.

PubMed

Dhar, Sohini; Gor, Beverly; Banerjee, Deborah; Krishnan, Sunil; Dorai, V K; Jones, Lovell; Kabad, Kanchan; Naik, Lakshmi Rai; Legha, Sewa S; Pande, Mala

2017-07-03

Identify health perspectives among Asian Indians in greater Houston area, to guide a tailored community wide survey. Four focus groups of different ages, gender, and nativity were conducted at which participants were asked for their opinions about specific health topics. Key informant interviews were conducted with ten community leaders to validate focus group responses. Recordings from focus groups and key informant interviews were transcribed and analyzed. Diabetes, cancer, and hypertension were primary health concerns. Common themes were sedentary lifestyle and poor health literacy. Older participants were more accepting of having familial hypertension and high cholesterol. Women were more concerned about health of family members and dietary habits. Perspectives differed on eating habits, physical activity, use of Western medicine, and smoking based on nativity. Responses from key informant interviews validated focus group findings. Perspectives on health may differ among Asian Indians depending on gender, age, and nativity.

Gender and age differences in lean soft tissue mass and sarcopenia among healthy elderly.

PubMed

Kirchengast, Sylvia; Huber, Johannes

2009-06-01

Sarcopenia, the age related decline in skeletal muscle mass has dramatic consequences. It leads to impaired performance, increased vulnerability, frailty and an increased risk of falls. Various extrinsic and intrinsic factors contribute to the aetiology of sarcopenia. The aims of the present study was to analyse gender differences in the prevalence of sarcopenia and document gender differences in lean soft tissue mass in healthy elderly. 139 healthy subjects ageing between 59 and 92 years (x = 71.5 +/- 7.8), 77 females and 64 males, were enrolled in the study. Body composition was measured by means of dual energy X-ray absorptiometry. Additionally appendicular muscle mass (ASM) was calculated. While no linear decrease in lean soft tissue mass was found for both sexes, the prevalence of sarcopenia increased significantly with increasing age in females as well as in males. Significant gender differences in the prevalence of sarcopenia were found for people younger than 70 years and those older than 80 years. In the youngest age group (< 70 years) sarcopenia was found more frequently among women, while in the oldest age group (> 80 years) the opposite was true. It can be concluded that the prevalence of sarcopenia differs between the two genders however these differences are influenced by age.

Age-Related Gray and White Matter Changes in Normal Adult Brains

PubMed Central

Farokhian, Farnaz; Yang, Chunlan; Beheshti, Iman; Matsuda, Hiroshi; Wu, Shuicai

2017-01-01

Normal aging is associated with both structural changes in many brain regions and functional declines in several cognitive domains with advancing age. Advanced neuroimaging techniques enable explorative analyses of structural alterations that can be used as assessments of such age-related changes. Here we used voxel-based morphometry (VBM) to investigate regional and global brain volume differences among four groups of healthy adults from the IXI Dataset: older females (OF, mean age 68.35 yrs; n=69), older males (OM, 68.43 yrs; n=66), young females (YF, 27.09 yrs; n=71), and young males (YM, 27.91 yrs; n=71), using 3D T1-weighted MRI data. At the global level, we investigated the influence of age and gender on brain volumes using a two-way analysis of variance. With respect to gender, we used the Pearson correlation to investigate global brain volume alterations due to age in the older and young groups. At the regional level, we used a flexible factorial statistical test to compare the means of gray matter (GM) and white matter (WM) volume alterations among the four groups. We observed different patterns in both the global and regional GM and WM alterations in the young and older groups with respect to gender. At the global level, we observed significant influences of age and gender on global brain volumes. At the regional level, the older subjects showed a widespread reduction in GM volume in regions of the frontal, insular, and cingulate cortices compared to the young subjects in both genders. Compared to the young subjects, the older subjects showed a widespread WM decline prominently in the thalamic radiations, in addition to increased WM in pericentral and occipital areas. Knowledge of these observed brain volume differences and changes may contribute to the elucidation of mechanisms underlying aging as well as age-related brain atrophy and disease. PMID:29344423

Waist-height ratio in children of 7 to 11 years with high weight at birth and its relationship with gender, age and diet.

PubMed

Rodríguez Vargas, Nuris; Fernandez-Britto, Jose Emilio; Martinez Perez, Tania Paula; Martinez Garcia, Rolando; Castañeda Garcia, Cecilia Margarita; Garriga Reyes, Mailin; Cabrera Estrada, Claudia; Plana Labrada, Rossana; García Niebla, Rosa María; Blanco Aranguren, Fabiola

2018-03-26

Obesity (OB), considered as one of the Non-Transmissible Chronic Diseases, has as its fundamental characteristics that of being prevalent at a global level, increasing in number, affecting developed and developing countries, affecting both genders, and all ages and social groups. To identify if high birth weight is a predictive factor (risk factor) for abdominal obesity in children 7 to 11 years old, and its relationship to gender, age and diet. A case-control descriptive study was carried out with children born between January 1992 and December 1995, in order to identify early risk factors (atherosclerotic accelerators) such as abdominal obesity in children aged 7 to 11, and who have a history of macrosomia or high birth weight, as well as their relationship with gender, age and diet. It was observed that the waist/height value was normal in 60.8% of the study group and in 64.00% in the control group. The difference between groups, gender, and age was not significant (P=.6859). As regards the diet in the study group (macrosomic), there was no significant association between the type of diet and waist circumference/height values, with an χ 2 =0.223 and P=.6373 (not significant). In the control group (with normal weight at birth), it was found that there is a significant statistical association between the type of diet and waist circumference/height values. This means that it can be stated, with 95% reliability, that the type of diet is associated with waist/height values. High birth weight is not a predictive factor (risk factor) for abdominal obesity (increased waist/height index). Gender and age are independent for abdominal obesity (macrosomic and normal weight at birth). The diet in high birth weight children is not related to the index waist-height index, which is not the case in those born with normal weight under the same conditions. The marked increase in abdominal obesity (Waist/height index) in children between 7 and 11 years old in both groups is worrying. Copyright © 2018 Sociedad Española de Arteriosclerosis. Publicado por Elsevier España, S.L.U. All rights reserved.

A Preliminary Study of Gender Differences in Autobiographical Memory in Children with an Autism Spectrum Disorder

ERIC Educational Resources Information Center

Goddard, Lorna; Dritschel, Barbara; Howlin, Patricia

2014-01-01

Autobiographical memory was assessed in 24 children (12 male, 12 female, aged between 8 and 16 years) with autism spectrum disorder (ASD) and a comparison group of 24 typically developing (TD) children matched for age, IQ, gender and receptive language. Results suggested that a deficit in specific memory retrieval in the ASD group was more…

Gender-Specific Peer Groups and Choice at 16

ERIC Educational Resources Information Center

Webber, Don J.; Walton, Fiona

2006-01-01

The purpose of this paper is to examine the influence of gender-specific peer groups on students' intentions and realisations to stay on into post-compulsory education at the age of 16. This is an important area for research as one of the UK government's aims is to achieve a 50% staying on rate in higher education at the age of 16. However, this…

Age and gender might influence big five factors of personality: a preliminary report in Indian population.

PubMed

Magan, Dipti; Mehta, Manju; Sarvottam, Kumar; Yadav, Raj Kumar; Pandey, R M

2014-01-01

Age and gender are two important physiological variables which might influence the personality of an individual. The influence of age and gender on big five personality domains in Indian population was assessed in this cross-sectional study that included 155 subjects (female = 76, male = 79) aged from 16-75 years. Big five personality factors were evaluated using 60-item NEO-Five Factor Inventory (NEO-FFI) at a single point in time. Among the big five factors of personality, Conscientiousness was positively correlated (r = 0.195; P < 0.05) with age in total study population, and retained the significance (P < 0.05) in men only when analyzed by gender subgroups. Further, age and gender sub-group analysis also showed that Neuroticism was inversely correlated with age in women aged 26-35 years (P < 0.05). Neuroticism and Extraversion showed a positive correlation with age in men aged 36-45 years (P < 0.001 and P < 0.05, respectively). Neuroticism was inversely correlated with age in men aged 46-55 years (P < 0.05). This preliminary report suggested that personality traits might change with age, and is gender-dependent.

Gender-specific mortality in DTP-IPV- and MMR±MenC-eligible age groups to determine possible sex-differential effects of vaccination: an observational study.

PubMed

Schurink-van't Klooster, Tessa M; Knol, Mirjam J; de Melker, Hester E; van der Sande, Marianne A B

2015-03-24

Several studies suggested that vaccines could have non-specific effects on mortality depending on the type of vaccine. Non-specific effects seem to be different in boys and girls. In this study we want to investigate whether there are differences in gender-specific mortality among Dutch children according to the last vaccination received. We tested the hypothesis that the mortality rate ratio for girls versus boys is more favourable for girls following MMR±MenC vaccination (from 14 months of age) compared with the ratio following DTP-IPV vaccination (2-13 months of age). Secondarily, we investigated whether there were gender-specific changes in mortality following booster vaccination at 4 years of age. This observational study included all Dutch children aged 0-11 years from 2000 until 2011. Age groups were classified according to the last vaccination offered. The mortality rates for all natural causes of death were calculated by gender and age group. Incidence rate ratios (IRRs) were computed using a multivariable Poisson analysis to compare mortality in boys and girls across different age groups. The study population consisted of 6,261,472 children. During the study period, 14,038 children (0.22%) died, 91% of which were attributed to a known natural cause of death. The mortality rate for natural causes was higher among boys than girls in all age groups. Adjusted IRRs for girls compared with boys ranged between 0.81 (95% CI 0.74-0.89) and 0.91 (95% CI 0.77-1.07) over the age groups. The IRR did not significantly differ between all vaccine-related age groups (p=0.723), between children 2-13 months (following DTP-IPV vaccination) and 14 months-3 years (following MMR±MenC vaccination) (p=0.493) and between children 14 months-3 years and 4-8 years old (following DTP-IPV vaccination) (p=0.868). In the Netherlands, a high income country, no differences in gender-specific mortality related to the type of last vaccination received were observed in DTP-IPV- and MMR ± MenC eligible age groups. The inability to detect this effect indicates that when non-specific effects were present the effects were not reflected in changes in the differences in mortality between boys and girls. The findings in this large population-based study are reassuring for the continued trust in the safety of the national vaccination programme.

Hispanic ethnicity and fatal fall risk: do age, gender, and community modify the relationship?

PubMed

Landy, David C; Mintzer, Michael J; Silva, Amanda K; Dearwater, Stephen R; Schulman, Carl I

2012-06-01

Hispanic ethnicity is associated with a reduced risk of fatal falls in the elderly despite lower socioeconomic standing. The factors responsible for this "Hispanic paradox" are unknown. We hypothesized that age and gender would modify this relationship and that the association would be accentuated in a community with prominent Hispanic culture. The number of fatal falls in a 3-year period in the United States (US) and in Miami-Dade County, Florida (MDC) were obtained through the CDC's WISQARS database and the Florida Office of Vital Statistics. US Census Bureau data were used to define the total at-risk populations by age group and gender. Age group- and gender-specific ratios of the risk of fatal fall in Hispanic to white non-Hispanic individuals were calculated. In the US and MDC, Hispanic ethnicity was associated with a reduced risk of fatal fall across all age and gender subgroups. In the US, the risk reduction associated with Hispanic ethnicity grew from 11% and 23% in 65- to 74-year-old men and women, respectively, to 43% for both men and women over 84-years-old. This relationship was stronger in MDC than nationally in five of the six age and gender subgroups examined. Older individuals, women, and residents of communities with prominent Hispanic culture have the greatest reduction in fatal fall risk associated with Hispanic ethnicity. Copyright © 2012 Elsevier Inc. All rights reserved.

Analysis of the width ratio and wear rate of maxillary anterior teeth in the Korean population.

PubMed

Oh, Yeon-Ah; Yang, Hong-So; Park, Sang-Won; Lim, Hyun-Pil; Yun, Kwi-Dug; Park, Chan

2017-04-01

The purpose of this study was to compare the width ratio of maxillary anterior teeth according to age in the Korean population and to evaluate the maxillary central incisor width-to-length (W/L) ratio, given differences in age and gender. Ninety-three Korean adults were divided into 3 groups (n = 31) by age. Group I was 20 - 39 years old, Group II was 40 - 59 years old, and Group III was over 60 years of age. After taking an impression and a cast model of the maxillary arch, the anterior teeth width ratio and central incisor W/L ratio were calculated from standard digital images of the cast models using a graph paper with a digital single lens reflex (DSLR) camera. The calculated ratios were compared among all groups and central incisor W/L ratio were analyzed according to age and gender. All comparative data were statistically analyzed with one-sample t-tests, one-way ANOVAs with Tukey tests, and independent t-tests. No significant differences in maxillary anterior teeth ratios were found among the age groups. The maxillary central incisor W/L ratios in Group III were the greatest and were significantly higher than those in the other groups. The central incisor W/L ratio of men was higher than that of women in Group II. Maxillary anterior teeth width ratios were similar in all age groups in the Korean population. The maxillary central incisor was observed as worn teeth in the group over 60 years of age, and a significant difference between genders was found in 40 to 50 year olds.

Shoulder strength value differences between genders and age groups.

PubMed

Balcells-Diaz, Eudald; Daunis-I-Estadella, Pepus

2018-03-01

The strength of a normal shoulder differs according to gender and decreases with age. Therefore, the Constant score, which is a shoulder function measurement tool that allocates 25% of the final score to strength, differs from the absolute values but likely reflects a normal shoulder. To compare group results, a normalized Constant score is needed, and the first step to achieving normalization involves statistically establishing the gender differences and age-related decline. In this investigation, we sought to verify the gender difference and age-related decline in strength. We obtained a randomized representative sample of the general population in a small to medium-sized Spanish city. We then invited this population to participate in our study, and we measured their shoulder strength. We performed a statistical analysis with a power of 80% and a P value < .05. We observed a statistically significant difference between the genders and a statistically significant decline with age. To the best of our knowledge, this is the first investigation to study a representative sample of the general population from which conclusions can be drawn regarding Constant score normalization. Copyright © 2017 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

Euro-Education: Employability for all (EEE4all). Design and implementation of an international course for future health-care professionals.

PubMed

Lindh Falk, Annika E; Sandqvist, Jan L; Liedberg, Gunilla M

2012-01-01

Employment is a priority in the European Union, and it is essential to address the needs of individuals disadvantaged at the labour market on grounds such as ethnicity, age, gender or disability, to increase the opportunities for these groups to gain employment. The Council of the European Union recognize the important role of national organisations in increasing gender equality and the need to integrate a gender perspective in all policies. Gender equality perspectives should also, according to the EU Plan of Action and Gender Equality be integrated in education. To equip students in higher education with knowledge, about gender, age, disability and ethnicity in relation to employability, a European group initiated a project; Euro-Education: Employability for all (EEE4all). The project, funded by the European Lifelong Learning Programme, was aimed to develop and implement four course modules, each relating to employability with different focus: gender, age, disability or ethnicity. In this paper design, implementation, and evaluation of the course focused on gender, provided by the Occupational Therapy Programme at Linkoping University, is described. The students highlighted the importance of awareness and knowledge about gender theory and its application in relation to employability and client-centred approach.

The effect of gender on the early results of coronary artery bypass surgery in the younger patients' group

PubMed Central

Uncu, Hasan; Acipayam, Mehmet; Altinay, Levent; Doğan, Pinar; Davarcı, Isil; Özsöyler, İbrahim

2014-01-01

Introduction In this retrospective study, we aimed to determine the risk factors for coronary artery bypass surgery in patients under 45 years of age, and evaluate the early postoperative results and the effect of gender. Methods A total of 324 patients under 45 years of age who undergone on-pump coronary artery bypass surgery between April 12, 2004 and January 10, 2012 were included to the study. Patients divided into groups as follows: Group 1 consisted of 269 males (mean age 41.3), Group 2 consisted of 55 females (mean age 41.6). Preoperative risk factors, intraoperative and postoperative data and early mortality rates of the groups were compared. Results Smoking rate was significantly higher in Group 1. Diabetes mellitus incidence and body mass index were significantly higher in Group 2 (P values P=0.01; P=0.0001; P=0.04 respectively). The aortic cross-clamping and cardiopulmonary bypass time and number of grafts per patient were significantly higher in Group 1 (P values P=0.04; P=0.04; P=0.002 respectively). There were no deaths in either group. Conclusion We found that gender has no effect on early mortality rates of the coronary bypass surgery patients under 45 years. PMID:25714211

Frontal lobe morphometry with MRI in a normal age group of 6-17 year-olds.

PubMed

Ilkay Koşar, M; Otağ, Ilhan; Sabancıoğulları, Vedat; Atalar, Mehmet; Tetiker, Hasan; Otağ, Aynur; Cimen, Mehmet

2012-12-01

Morphometric data of the frontal lobe are important for surgical planning of lesions in the frontal lobe and its surroundings. Magnetic resonance imaging (MRI) techniques provide suitable data for this purpose. In our study, the morphometric data of mid-sagittal MRI of the frontal lobe in certain age and gender groups of children have been presented. In a normal age group of 6-17-year-old participants, the length of the line passing through predetermined different points, including the frontal pole (FP), commissura anterior (AC), commissura posterior (PC), the outermost point of corpus callosum genu (AGCC), the innermost point of corpus callosum genu (IGCC), tuberculum sella (TS), AGCC and IGCC points parallel to AC-PC line and the point such line crosses at the frontal lobe surface (FCS) were measured in three age groups (6-9, 10-13 and 14-17 years) for each gender. The frontal lobe morphometric data were higher in males than females. Frontal lobe measurements peak at the age group of 10-13 in the male and at the age group of 6-13 in the female. In boys, the length of FP-AC increases 4.1% in the 10-13 age group compared with the 6-9-year-old group, while this increase is 2.3% in girls. Differences in age and gender groups were determined. While the length of AGCC-IGCC increases 10.4% in adults, in children aged 6-17, the length of AC-PC is 11.5% greater than adults. These data will contribute to the preliminary assessment for developing a surgical plan in fine interventions in the frontal lobe and its surroundings in children.

Childhood Gender Nonconformity and Body Dissatisfaction in Gay and Heterosexual Men.

ERIC Educational Resources Information Center

Strong, Scott M.; Singh, Devendra; Randall, Patrick K.

2000-01-01

Employed a measure of recalled childhood gender nonconformity to examine gender role behaviors in association with body dissatisfaction among ethnically diverse, homosexual and heterosexual, predominantly college-aged males. Gay males reported more body dissatisfaction and recalled more childhood gender atypical behaviors. Group differences in…

Motivators of and Barriers to Engaging in Physical Activity: Perspectives of Low-Income Culturally Diverse Adolescents and Adults

PubMed Central

Bragg, Marie A.; Tucker, Carolyn M.; Kaye, Lily B.; Desmond, Frederic

2017-01-01

Background Obesity rates are rising in the United States, especially among low-income and racial/ethnic minority individuals. Exploring motivators and barriers relative to engaging in physical activity is imperative. Purpose The purpose of this study was to identify motivators and barriers relative to engagement in physical activity as reported by culturally diverse low-income adolescents and adults. Methods A total of 91 adolescent (11 to 15 years of age) and adult (18 years of age or older) participants who self-identified as African American, Hispanic, or non-Hispanic White engaged in age group-, race/ethnicity-, and gender-concordant focus groups. Results Qualitative data analysis indicated that the motivators and barriers most commonly identified among the adolescent and adult focus groups were: social influence; time and priorities; physical environment; fun and enjoyment; inherently physical activities; weight concerns; fatigue, physical discomfort and current fitness level; and immediate positive feelings. Discussion Findings were generally similar across age group, gender and race/ethnicity. Age group-specific, gender-specific and race/ethnicity-specific motivators and barriers were related to how commonly the motivators and barriers were identified among each group. Translation to Health Education Practice Implications for increasing physical activity among low-income culturally diverse adolescents and adults are discussed. PMID:29527247

Self-perception and satisfaction with dental appearance and aesthetics with respect to patients’ age, gender, and level of education.

PubMed

Strajnić, Ljiljana; Bulatović, Dijana; Stančić, Ivica; Živković, Rade

2016-01-01

Patient’s subjective evaluation of dental appearance and aesthetics is becoming an increasingly important factor in aesthetic treatments and prosthetic therapy. The aim of this study was to investigate the influence of age, education level, gender, and different dental status and the appearance of the upper anterior teeth (color, size, shape, position and alignment of the anterior teeth) on the satisfaction of the respondents with dental appearance and aesthetics of their upper anterior teeth and their desire for improvement. The study encompassed 480 people aged 20 to 50 years with an average age of 30.84 years. There were 236 male and 244 female subjects. The respondents were interviewed using a questionnaire specially designed for the purpose of this research. For the study, the subjects were divided into the following three age groups: the younger age group (20–30 years of age), the middle age group (31–40 years of age), and the older age group (41–50 years of age). The conducted study did not reveal statistical significance with respect to gender in any of the examined parameters (p > 0.05). A little more than one half of the respondents in each age group were satisfied with their dental appearance and aesthetics (60.3% of the respondents in the age group of 20–30 years, 55.7% in the age group of 31–40, and 53.7% in the age group of 41–50 years of age). Satisfaction with dental appearance and aesthetics increases linearly with the increase in the level of education and was the highest among the respondents with university degree (33.3%). Female respondents were more dissatisfied with their dental appearance and aesthetics as compared with male respondents, but the difference was found to be non-significant. Patients with higher education level were more satisfied with their dental appearance and aesthetics than those with lower education.

Gender Differences in Youths' Political Engagement and Participation. The Role of Parents and of Adolescents' Social and Civic Participation

ERIC Educational Resources Information Center

Cicognani, Elvira; Zani, Bruna; Fournier, Bernard; Gavray, Claire; Born, Michel

2012-01-01

Research examining youths' political development mostly focused on young people as a general group; comparatively less attention has been devoted to the examination of gender pathways toward citizenship. Two studies were conducted addressing (a) the role of parents' participation and the moderating role of adolescent gender and age group (n =…

Factorial Invariance and Latent Mean Differences of Scores on the Achievement Goal Tendencies Questionnaire across Gender and Age in a Sample of Spanish Students

ERIC Educational Resources Information Center

Ingles, Candido J.; Marzo, Juan C.; Castejon, Juan L.; Nunez, Jose Carlos; Valle, Antonio; Garcia-Fernandez, Jose M.; Delgado, Beatriz

2011-01-01

This study examined the factorial invariance and latent mean differences of scores on the Spanish version of the "Achievement Goal Tendencies Questionnaire" (AGTQ) across gender and age groups in 2022 Spanish students (51.1% boys) in grades 7 through 10. The equality of factor structures was compared using multi-group confirmatory factor…

Demographic, health-related, and work-related factors associated with body mass index and body fat percentage among workers at six Connecticut manufacturing companies across different age groups: a cohort study.

PubMed

Garza, Jennifer L; Dugan, Alicia G; Faghri, Pouran D; Gorin, Amy A; Huedo-Medina, Tania B; Kenny, Anne M; Cherniack, Martin G; Cavallari, Jennifer M

2015-01-01

Effective workplace interventions that consider the multifactorial nature of obesity are needed to reduce and prevent obesity among adults. Furthermore, the factors associated with obesity may differ for workers across age groups. Therefore, the objective of this study was to identify demographic, health-related, and work-related factors associated with baseline and changes in body mass index (BMI) and body fat percentage (BFP) and among Connecticut manufacturing workers acrossage groups. BMI and BFPof 758 workers from six Connecticut manufacturing companies were objectively measuredat two time points approximately 36 months apart. Demographic, health-related, and work-related factors wereassessed via questionnaire. All variables were included in linear regression models to identify factors associated with baseline and changes in BMI and BFP for workers in 3 age groups: <45 years (35 %), 45-55 years (37 %), >55 years (28 %). There were differences in baseline and changes in BMI and BFP among manufacturing workers across age groups. Being interested in changing weight was significantly (p < 0.01) associated with higher baseline BMI and BFP across all age categories. Other factors associated with higher baseline BMI and BFP differed by age group and included: male gender (BMI p = 0.04), female gender (BFP p < 0.01), not having a college education (BMI p = 0.01, BFP p = 0.04), having childcare responsibilities (BMI p = 0.04), and working less overtime (p = 0.02) among workers in the <45 year age category, male gender (BMI p = 0.02), female gender (BFP p < 0.01) and reporting higher stress in general (BMI p = 0.04) among workers in the 45-55 year age category, and female gender (BFP p < 0.01) and job tenure (BFP p = 0.03) among workers in the >55 year age category. Few factors were associated with change in BMI or BFP across any age category. Among manufacturing workers, we identified associations between individual, health-related, and work-related factors and baseline BMIand BFP that differed by age. Such results support the use of strategies tailored to the challenges faced by workers in specific age groups rather than adopting a one size fits all approach. Effective interventions should consider a full range of individual, health-related, and work-related factors. More work must be done to identify factors or strategies associated with changes in obesity over time.

Suicides in Hong Kong and Australia.

PubMed

Yip, P S

1998-01-01

Although the suicide rate for both Hong Kong and Australia was about 12 per 100,000 in 1994, the age- and gender-specific rates, methods of suicide, and time trends vary greatly for these two places. This paper explores the possible social, economic, and cultural background to explain this discrepancy. We used the official suicide death statistics of Hong Kong and Australia for the period 1984-1994. We calculated age-standardized suicide rates in order to take into account the differences in the age composition between the two countries and years. We employed a log-linear (Poisson) model to detect the age- and gender-specific trends, and to determine whether there were specific age or gender groups whose suicide behavior had changed significantly between 1984 and 1994. Hong Kong experienced a slight increase in suicide rate for both genders in the years 1984-1994, whereas Australia experienced a cubic trend for both genders during the same period and a rise in suicide rate in recent years. The suicide rate in Hong Kong increased with age, with a sharp increase (nearly four times the average) among the group aged 75 or over. A relatively low gender ratio (male:female) was also observed in Hong Kong, whereas in Australia there was not much difference in suicide rates among all age groups, though the suicide rate of the group aged 75 or over was 1.2 times the average. The gender ratio in Australia was higher, and the male suicide rate was four times higher than that of females. The Hong Kong suicide rate in females was twice that of Australia, whereas the Hong Kong male suicide rate was about half that of Australia. Jumping and hanging were the most common methods of suicide in Hong Kong, accounting for more than 80% of all suicide deaths. Poisoning (including gas poisoning) was the most common method used in Australia, with firearms being more common among young males. Australia had a higher years of potential life lost (YPLL) than Hong Kong because of the higher suicide rate among young males (aged 15-24). The high suicide rate among the elderly in Hong Kong raises the possibility that medical and social support to the elderly could be enhanced. The high female suicide rate in Hong Kong could be related to workload, responsibility, and expectations. The high suicide rate in Australia among males aged 15-24 was disturbing. Availability of the suicide methods is certainly one explanation for the difference in suicide methods used in Hong Kong and Australia.

Motives for adult participation in physical activity: type of activity, age, and gender.

PubMed

Molanorouzi, Keyvan; Khoo, Selina; Morris, Tony

2015-01-31

In recent years, there has been a decline in physical activity among adults. Motivation has been shown to be a crucial factor in maintaining physical activity. The purpose of this study was to examine whether motives for participation could accurately discriminate gender, age, and type of physical activity. A quantitative, cross-sectional descriptive research design was employed. The Physical Activity and Leisure Motivation Scale (PALMS) was used to assess motives for physical activity in 1,360 adults (703 males, 657 females) who had been exercising regularly for at least six months. The PALMS consists of 40 items that constitute eight sub-scales (mastery, enjoyment, psychological condition, physical condition, appearance, others' expectations, affiliation, competition/ego). Respondents were divided into two age groups (young adults aged 20 to 40 years and middle-aged adults 41 to 64 years) and five types of activity (individual racing sports plus bowls, team sports, racquet sports, martial arts, and exercise). The group discriminant function analyses revealed significant canonical functions correctly classifying the cases into gender (82%), age group (83%), team sport players 76%, individual racing sport plus bowls players 91%, racquet sport players 90%, exercisers 84%, and martial art players 91%. The competition/ego, appearance, physical condition, and mastery sub-scales contributed most to gender differences. Five sub-scales (mastery, psychological condition, others' expectations, affiliation, and enjoyment) contributed most to the discriminant function for age. For type of activity, different sub-scales were the strongest contributors to the discriminant function for each type of PA. The findings in this study suggest that strong and important motives for participation in physical activity are different across type of activity, age, and gender in adults. Understanding the motives that influence physical activity participation is critical for developing interventions to promote higher levels of involvement.

Recent age- and gender-specific trends in mortality during stroke hospitalization in the United States.

PubMed

Ovbiagele, Bruce; Markovic, Daniela; Towfighi, Amytis

2011-10-01

Advancements in diagnosis and treatment have resulted in better clinical outcomes after stroke; however, the influence of age and gender on recent trends in death during stroke hospitalization has not been specifically investigated. We assessed the impact of age and gender on nationwide patterns of in-hospital mortality after stroke. Data were obtained from all US states that contributed to the Nationwide Inpatient Sample. All patients admitted to hospitals between 1997 and 1998 (n=1 351 293) and 2005 and 2006 (n=1 202 449), with a discharge diagnosis of stroke (identified by the International Classification of Diseases, Ninth Revision procedure codes), were included. Time trends for in-hospital mortality after stroke were evaluated by gender and age group based on 10-year age increments (<55, 55-64, 65-74, 75-84, >84) using multivariable logistic regression. Between 1997 and 2006, in-hospital mortality rates decreased across time in all sub-groups (all P<0·01), except in men >84 years. In unadjusted analysis, men aged >84 years in 1997-1998 had poorer mortality outcomes than similarly aged women (odds ratio 0·93, 95% confidence interval=0·88-0·98). This disparity worsened by 2005-2006 (odds ratio 0·88, 95% confidence interval=0·84-0·93). After adjusting for confounders, compared with similarly aged women, the mortality outcomes among men aged >84 years were poorer in 1997-1998 (odds ratio 0·97, 95% confidence interval=0·92-1·02) and were poorer in 2005-2006 (odds ratio 0·92, 95% confidence interval=0·87-0·96), P=0·04, for gender × time trend. Over the last decade, in-hospital mortality rates after stroke in the United States have declined for every age/gender group, except men aged >84 years. Given the rapidly ageing US population, avenues for boosting in-hospital survival among very elderly men with stroke need to be explored. © 2011 The Authors. International Journal of Stroke © 2011 World Stroke Organization.

Rigidity in Gender-Typed Behaviors in Early Childhood: A Longitudinal Study of Ethnic Minority Children

PubMed Central

Ruble, Diane; Tamis-LeMonda, Catherine; Shrout, Patrick E.

2014-01-01

A key prediction of cognitive theories of gender development concerns developmental trajectories in the relative strength or rigidity of gender typing. To examine these trajectories in early childhood, 229 children (African American, Mexican, Dominican) were followed annually from age 3 to 5 and gender-stereotypical appearance, dress-up play, toy play, and sex segregation were examined. High gender-typing was found across ethnic group, and most behaviors increased in rigidity, especially from age 3 to 4. In addressing controversy surrounding the stability and structure of gender-typing it was found that from year to year, most behaviors showed moderately stable individual differences. Behaviors were uncorrelated within age, but showed more concordance in change across time, suggesting that aspects of gender-typing are multidimensional but still show coherence. PMID:23432471

Efficacy of Transcutaneous Electric Nerve Stimulation on Parotid Saliva Flow Rate in Relation to Age and Gender

PubMed Central

Dhillon, Manu; M Raju, Srinivasa; S Mohan, Raviprakash; Tomar, Divya

2016-01-01

Statement of the Problem Treatment with salivary substitutes and stimulation of salivary flow by either mechanical or pharmacologic methods has side effects and only provides symptomatic relief but no long-lasting results. Purpose To assess the effectiveness of extraoral transcutaneous electric nerve stimulation (TENS) as a mean of stimulating salivary function in healthy adult subjects; as well as to determine the gender and age-dependent changes in salivary flow rates of unstimulated and stimulated parotid saliva. Materials and Method Hundred patients were divided into two groups; Group I aged 20-40 and Group II aged ≥ 60 years. The TENS electrode pads were externally placed on the skin overlying the parotid glands. Unstimulated and stimulated parotid saliva was collected for 5 minutes each by using standardized collection techniques. Results Eighty seven of 100 subjects demonstrated increased salivary flow when stimulated via the TENS unit. Ten experienced no increase and 3 experienced a decrease. The mean unstimulated salivary flow rate was 0.01872 ml/min in Group I and 0.0088 ml/min in Group II. The mean stimulated salivary flow rate was 0.03084 ml/min (SD= 0.01248) in Group I, and 0.01556 ml/min (SD 0.0101) in Group II. After stimulation, the amount of salivary flow increased significantly in both groups (p< 0.001). Statistical comparison of the two groups revealed them to be significantly different (p< 0.001), with Group I producing more saliva. Gender-wise, no statistically significant difference was seen among the subjects in Group I (p = 0.148), and those in Group II (p= 0.448). Out of 12 subjects with 0 baseline flows, 7 continued to have no flow. Five subjects observed side effects, although minimal and transient. Conclusion The TENS unit was effective in increasing parotid gland salivary flow in healthy subjects. There was age-related but no gender-related variability in parotid salivary flow rate. PMID:27602390

Efficacy of Transcutaneous Electric Nerve Stimulation on Parotid Saliva Flow Rate in Relation to Age and Gender.

PubMed

Dhillon, Manu; M Raju, Srinivasa; S Mohan, Raviprakash; Tomar, Divya

2016-09-01

Treatment with salivary substitutes and stimulation of salivary flow by either mechanical or pharmacologic methods has side effects and only provides symptomatic relief but no long-lasting results. To assess the effectiveness of extraoral transcutaneous electric nerve stimulation (TENS) as a mean of stimulating salivary function in healthy adult subjects; as well as to determine the gender and age-dependent changes in salivary flow rates of unstimulated and stimulated parotid saliva. Hundred patients were divided into two groups; Group I aged 20-40 and Group II aged ≥ 60 years. The TENS electrode pads were externally placed on the skin overlying the parotid glands. Unstimulated and stimulated parotid saliva was collected for 5 minutes each by using standardized collection techniques. Eighty seven of 100 subjects demonstrated increased salivary flow when stimulated via the TENS unit. Ten experienced no increase and 3 experienced a decrease. The mean unstimulated salivary flow rate was 0.01872 ml/min in Group I and 0.0088 ml/min in Group II. The mean stimulated salivary flow rate was 0.03084 ml/min (SD= 0.01248) in Group I, and 0.01556 ml/min (SD 0.0101) in Group II. After stimulation, the amount of salivary flow increased significantly in both groups (p< 0.001). Statistical comparison of the two groups revealed them to be significantly different (p< 0.001), with Group I producing more saliva. Gender-wise, no statistically significant difference was seen among the subjects in Group I (p = 0.148), and those in Group II (p= 0.448). Out of 12 subjects with 0 baseline flows, 7 continued to have no flow. Five subjects observed side effects, although minimal and transient. The TENS unit was effective in increasing parotid gland salivary flow in healthy subjects. There was age-related but no gender-related variability in parotid salivary flow rate.

Schizotypy in adolescence: the role of gender and age.

PubMed

Fonseca-Pedrero, Eduardo; Lemos-Giráldez, Serafín; Muñiz, José; García-Cueto, Eduardo; Campillo-Alvarez, Angela

2008-02-01

Schizotypy is a multidimensional personality construct that appears to indicate psychosis proneness. Supposedly, schizotypal traits behave differently depending on a person's age and gender, but few studies have examined this relationship. In our study we used the Thinking and Perceptual Style Questionnaire and the Junior Schizotypy Scales. The sample was made up of 321 students (169 males) with an age range of 12 to 17 years. The results show significant differences in gender and age groups. Males score higher than females on Physical Anhedonia, Social Anhedonia, and Impulsive Non-Conformity scales, while females score higher or Positive Symptoms, Negative Evaluation, and Social Paranoia scales. Significant differences were also found among age groups: Unusual experiences, self-referent ideation, social paranoia, thought disorder, and negative evaluation were more frequent in later stages of adolescence. However, the meaning of this difference could be interpreted in terms of emotional turbulence rather than as a direct indicator of vulnerability to psychosis.

Gender-related difference in the upper airway dimensions and hyoid bone position in Chinese Han children and adolescents aged 6-18 years using cone beam computed tomography.

PubMed

Jiang, Ying-Ying; Xu, Xin; Su, Hong-Li; Liu, Dong-Xu

2015-07-01

To investigate the gender-related differences in upper airway dimensions and hyoid bone position in Chinese Han children and adolescents (6-18 years) using cone-beam computed tomography (CBCT). CBCT-scans of 119 boys and 135 girls were selected and divided into four groups (group 1: 6-9 years; group 2: 10-12 years; group 3: 13-15 years; group 4: 16-18 years). The airway dimensions including the cross-sectional area (CSA), anteroposterior (AP) and lateral (LAT) width, length (L), mean CSA and volume (VOL) of upper airway segmentations and hyoid bone position including 11 linear and three angular measurements were investigated using Materialism's interactive medical image control system (MIMICS) 16.01 software. Gender-related differences were analyzed by two independent sample t-tests. No gender-related difference was found in values of the facial morphology, airway dimensions and hyoid bone position for group 1 (p > 0.05). The children and adolescents in groups 2, 3 and 4 showed significant gender-related differences in the measurement results of facial morphology, airway dimensions and hyoid bone positions (p < 0.05). What's more, the measurement values of boys were obviously larger than those of girls except some measurements in group 2. The measurements of airway dimensions and hyoid bone positions have gender-related differences in children and adolescents aged 10-18 years. These results could be taken into consideration during orthodontic diagnosis and treatment.

Sex-sensitive cognitive performance in untreated patients with early onset gender identity disorder.

PubMed

Haraldsen, I R; Opjordsmoen, S; Egeland, T; Finset, A

2003-10-01

We explored whether the cognitive performance of gender identity disorder patients (GID) was comparable to that of their biological sex or skewed towards that of their gender identity. We tested four potentially sex-sensitive cognitive factors (rotation, visualization, perception, and verbalization) as well as two neutral factors (logic and arithmetic) in GID patients from Norway (GID-N, n = 33) or the USA (GID-US, n = 19) and in a control group (C, n = 29). The testing was undertaken prior to cross sex hormone treatment. Four-way ANOVA was applied in the final analysis of the cognitive performance and its dependency on different predictors (age, biological sex, education, group). In both GID groups as well as in the control group (C) males excelled in visualization and rotation, also when controlling for potential confounders (biological sex, group, age and education). No female advantage was detected. Furthermore, no interaction between biological sex and group assignment was revealed in the samples. In this study the cognitive pattern of GID patients is consistent with that of their biological sex and not that of their gender identity.

Age, gender, and socioeconomic gradients in metabolic syndrome: biomarker evidence from a large sample in Taiwan, 2005-2013.

PubMed

Wu, Hania F; Tam, Tony; Jin, Lei; Lao, Xiang Q; Chung, Roger Yat-Nork; Su, Xue F; Zee, Benny

2017-05-01

To examine the age and gender heterogeneities in the association between socioeconomic status (SES) and the risk of metabolic syndrome (MetS) with biomarker data from Taiwan. Subjects included 102,201 men and 112,015 women aged 25 and above, from the 2005-2013 MJ Health Survey in Taiwan. SES was measured by education and family income. MetS was defined by the Adult Treatment Panel III criteria for Asian population. Logistic regression analyses were performed by age and gender groups. (1) Higher education level was associated with significantly lower risk of MetS. (2) Higher income was associated with lower MetS risk among women aged under 65, but no association among men of all ages. (3) SES gradients were generally much stronger among women than among men of the same age group. (4) SES gradients reduced over the life course with the exception that income gradient remains flat among men of all ages. Among Chinese in Taiwan, the gender and age heterogeneities in the SES gradients in MetS are similar to those reported for Western societies. This cross-cultural convergence is broadly consistent with the general hypothesis that social conditions are fundamental causes of diseases and health disparities. Copyright © 2017 Elsevier Inc. All rights reserved.

Gender differences in episodic memory and visual working memory including the effects of age.

PubMed

Pauls, Franz; Petermann, Franz; Lepach, Anja Christina

2013-01-01

Analysing the relationship between gender and memory, and examining the effects of age on the overall memory-related functioning, are the ongoing goals of psychological research. The present study examined gender and age group differences in episodic memory with respect to the type of task. In addition, these subgroup differences were also analysed in visual working memory. A sample of 366 women and 330 men, aged between 16 and 69 years of age, participated in the current study. Results indicate that women outperformed men on auditory memory tasks, whereas male adolescents and older male adults showed higher level performances on visual episodic and visual working memory measures. However, the size of gender-linked effects varied somewhat across age groups. Furthermore, results partly support a declining performance on episodic memory and visual working memory measures with increasing age. Although age-related losses in episodic memory could not be explained by a decreasing verbal and visuospatial ability with age, women's advantage in auditory episodic memory could be explained by their advantage in verbal ability. Men's higher level visual episodic memory performance was found to result from their advantage in visuospatial ability. Finally, possible methodological, biological, and cognitive explanations for the current findings are discussed.

Exploring a motivation of medical staff.

PubMed

Goncharuk, Anatoliy G

2018-06-08

This paper aims to identify the true motivators (needs) of medical staff, compare them with the current labor incentives, and detect possible differences in motivators for main groups of medical staff. Observing personnel of 5 hospitals and students of the medical institute by special questionnaires, the author confirmed the hypothesis of different motivators for groups of medical staff with different ages, professions, and gender. The author used special questionnaires to collect the data. Study results confirmed the hypothesis of different motivators for groups of medical staff with different ages, professions, and gender. The author also found significant differences between the motivation of Ukrainian health workers and their colleagues from other countries. The main conclusion is that no matter how we would like to satisfy gender and age equality, all people are individual and what is good for an elderly male doctor cannot be acceptable for a young female nurse. Therefore, forming the motivation system for employees of medical institutions, it is necessary to take into account the age, gender, professions, and other characteristics of each employee. In this way, we can achieve the highest health-care performance. Copyright © 2018 John Wiley & Sons, Ltd.

Differences in lightness, chroma, and hue in the anterior teeth of quinquagenarians and septuagenarians.

PubMed

Eiffler, Constantin; Cevirgen, Engin; Helling, Stephan; Zornek, Juanita; Pritsch, Maria; Hassel, Alexander Jochen

2010-10-01

The purpose of this study was to evaluate, for both genders and two elderly age groups, differences in lightness, chroma, and hue of pairs of natural anterior teeth, so that more accurate information on color would be available for the production of dentures with a natural appearance. The subjects in the younger group (YG) were 54 to 56 years of age, those in the older group 73 to 75 (N = 195, 48% women). Tooth color was measured using a spectrophotometer. Mixed models were calculated for each pair of teeth, with gender as a fixed factor. Gender did not have a significant effect in either age group. In both groups, differences in chroma between upper canines and lateral incisors and in lightness and hue between upper and lower canines were observed. In the YG, additional differences were found, with the only exception of the comparison between upper central and lateral incisors. The nongender-specific color differences observed should be considered when producing denture teeth for these groups of patients, in order to come as close as possible to the natural color ideal.

Electrical properties of human skin as aging biomarkers.

PubMed

Simić-Krstić, Jovana B; Kalauzi, Aleksandar J; Ribar, Srdjan N; Matija, Lidija R; Misevic, Gradimir N

2014-09-01

A non-invasive bioimpedance spectroscopy (BIS) and Cole-Cole impedance model parameters (R0, R∞, τ and α) were used to analyze electrical properties of intact and stripped human skin for both gender subjects divided into younger and older age groups. R0, R∞ and τ significantly increased while α significantly decreased with age in stripped skin for both genders (p<0.031). Using pooled data with respect to age, gender and skin stripping, R0, R∞ and τ values were shown to increase with age (p<0.0034), R0, τ and α were different between genders (p<0.024) and R0, R∞ and τ decreased with skin stripping (p<0.000008). All of four Cole-Cole parameters were age dependent with specific differences observed for genders and intact and stripped skin layers. Therefore, Cole-Cole parameters, obtained by non-invasive BIS measurements, are a new type of age dependent biomarkers. Copyright © 2014 Elsevier Inc. All rights reserved.

Nystagmus responses in a group of normal humans during earth-horizontal axis rotation

NASA Technical Reports Server (NTRS)

Wall, Conrad, III; Furman, Joseph M. R.

1989-01-01

Horizontal eye movement responses to earth-horizontal yaw axis rotation were evaluated in 50 normal human subjects who were uniformly distributed in age (20-69 years) and each age group was then divided by gender. Subjects were rotated with eyes open in the dark, using clockwise and counter-clockwise 60 deg velocity trapezoids. The nystagmus slow component velocity is analyzed. It is shown that, despite large intersubject variability, parameters which describe earth-horizontal yaw axis responses are loosely interrelated, and some of them vary significantly with gender and age.

Three-Dimensional Model of Strengths: Examination of Invariance Across Gender, Age, Education Levels, and Marriage Status.

PubMed

Duan, Wenjie; Ho, Samuel Mun Yin

2017-02-01

Strengths are positive qualities that significantly contributed to well-being of individuals and community. Therefore, a reliable and valid measure of strengths for research and practice is needed. The Brief Strengths Scale (BSS) is a newly developed tool for measuring the three-dimensional strengths model (i.e., temperance, intellectual, and interpersonal strength). However, empirical support for the measurement invariance of the BSS has not been obtained. This study examined the three-factor structure of BSS across gender, age, education, and marriage groups in a community sample (n = 375) using multi-group confirmatory factor analysis. After removing one item of each subscale from the original version, the revised model provided a good fit to the data at different subgroups. The revised nine-item BSS indicated that measurement invariance across gender and age groups was achieved. In addition, the measurement was more influenced by social-cultural factors than biological factors.

Special Gender Studies for Engineering?

ERIC Educational Resources Information Center

Ihsen, Susanne

2005-01-01

Today we are confronted with a new challenge in product development: "Diversity" needs to be implemented in the engineering design and development teams. Such diversity means to "mirror" within the teams the characteristics of different customer groups: the two genders, the different age groups, and the different cultural…

Mental health and developmental outcomes for children born after ART: a comparative prospective study on child gender and treatment type.

PubMed

Punamäki, Raija-Leena; Tiitinen, Aila; Lindblom, Jallu; Unkila-Kallio, Leila; Flykt, Marjo; Vänskä, Mervi; Poikkeus, Piia; Tulppala, Maija

2016-01-01

Do children born after assisted reproductive techniques (ART; IVF/ICSI) display more mental health issues or social and cognitive developmental problems at 7-8 years than naturally conceived (NC) controls, and does child gender play a role? ART children do not differ with regard to mental health or social and cognitive developmental problems when compared with controls, but some gender-specific differences do exist. Systematic reviews have not found any evidence of delays in neurocognitive or sensorimotor development in ART children. However findings on the effect of the type of ART treatment (IVF versus ICSI) on the offspring's physical and mental development have not been uniform. Knowledge of the role of child gender in ART research is scarce. This prospective follow-up study compares mental health and social and cognitive developmental problems between 7-8-year-old ART and NC children, controlling for the father's age, length of the parents' partnership, mother's parity, child's gestational age, and the need of neonatal intensive care unit (NICU). Further, within the ART group, we analysed whether the treatment type (IVF versus ICSI) and the child's gender are associated with the mental health and developmental outcomes. In this study, 255 singleton ART children (IVF and ICSI) were compared with 278 NC children on parent-reported internalizing and externalizing symptoms, and social (social skills and peer relations) and cognitive development (executive functioning, perception, memory, and language). Within the ART group, 164 IVF and 76 ICSI children were compared on the same outcomes. Statistics included analyses of covariates (ANCOVA) with group main effects, group and gender interaction effects, and Bonferroni post hoc tests. ART and NC children did not differ generally in terms of their internalizing and externalizing symptoms or in the number of social and cognitive developmental problems (Group main effects, P > 0.05), but gender-specific group differences existed. The ART boys showed lower levels of cognitive problems than the NC boys, whereas ART girls showed higher levels of cognitive problems than the NC girls (Group × Gender-interaction effects with Bonferroni post hoc tests on mother-reports, P < 0.01). Further, unlike in the NC group, where boys showed more externalizing symptoms and social and cognitive developmental problems than girls (Group × Gender-interaction effects with Bonferroni post hoc tests for both parents' reports, P < 0.05), gender differences were not found in the ART group. Within the ART group, IVF and ICSI children did not differ in terms of mental health or developmental outcomes, and no significant gender differences emerged. The information on children's mental health and development was based on parental reports only. The dropout rate between the child's first year and the school age assessments was very high for fathers (57.4%) and substantial for mothers (30.1%), and the participating group was biased for older age of both parents and for better education of the fathers. The findings indicate the importance of considering child gender in learning about multiple developmental outcomes among children born after ART. This study was supported by the Academy of Finland (#11232276), the Emil Aaltonen Foundation, The Family Federation of Finland, Helsinki University Central Hospital Research Funds, and the National Graduate School of Psychology. None of authors has any competing interests to declare. © The Author 2015. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Insights into the effects of tensile and compressive loadings on human femur bone.

PubMed

Havaldar, Raviraj; Pilli, S C; Putti, B B

2014-01-01

Fragile fractures are most likely manifestations of fatigue damage that develop under repetitive loading conditions. Numerous microcracks disperse throughout the bone with the tensile and compressive loads. In this study, tensile and compressive load tests are performed on specimens of both the genders within 19 to 83 years of age and the failure strength is estimated. Fifty five human femur cortical samples are tested. They are divided into various age groups ranging from 19-83 years. Mechanical tests are performed on an Instron 3366 universal testing machine, according to American Society for Testing and Materials International (ASTM) standards. The results show that stress induced in the bone tissue depends on age and gender. It is observed that both tensile and compression strengths reduces as age advances. Compressive strength is more than tensile strength in both the genders. The compression and tensile strength of human femur cortical bone is estimated for both male and female subjecting in the age group of 19-83 years. The fracture toughness increases till 35 years in male and 30 years in female and reduces there after. Mechanical properties of bone are age and gender dependent.

34 CFR 366.27 - What selection criteria does the Secretary use?

Code of Federal Regulations, 2012 CFR

2012-07-01

... race, color, national origin, gender, age, or disability; and (v) The extent to which the applicant, as... racial or ethnic minority groups; (B) Women; (C) Persons with disabilities; and (D) Elderly individuals... are selected without regard to race, color, national origin, gender, age, or disability; and (6) A...

Hearing history influences voice gender perceptual performance in cochlear implant users.

PubMed

Kovačić, Damir; Balaban, Evan

2010-12-01

The study was carried out to assess the role that five hearing history variables (chronological age, age at onset of deafness, age of first cochlear implant [CI] activation, duration of CI use, and duration of known deafness) play in the ability of CI users to identify speaker gender. Forty-one juvenile CI users participated in two voice gender identification tasks. In a fixed, single-interval task, subjects listened to a single speech item from one of 20 adult male or 20 adult female speakers and had to identify speaker gender. In an adaptive speech-based voice gender discrimination task with the fundamental frequency difference between the voices as the adaptive parameter, subjects listened to a pair of speech items presented in sequential order, one of which was always spoken by an adult female and the other by an adult male. Subjects had to identify the speech item spoken by the female voice. Correlation and regression analyses between perceptual scores in the two tasks and the hearing history variables were performed. Subjects fell into three performance groups: (1) those who could distinguish voice gender in both tasks, (2) those who could distinguish voice gender in the adaptive but not the fixed task, and (3) those who could not distinguish voice gender in either task. Gender identification performance for single voices in the fixed task was significantly and negatively related to the duration of deafness before cochlear implantation (shorter deafness yielded better performance), whereas performance in the adaptive task was weakly but significantly related to age at first activation of the CI device, with earlier activations yielding better scores. The existence of a group of subjects able to perform adaptive discrimination but unable to identify the gender of singly presented voices demonstrates the potential dissociability of the skills required for these two tasks, suggesting that duration of deafness and age of cochlear implantation could have dissociable effects on the development of different skills required by CI users to identify speaker gender.

Age and gender related changes of salivary total protein levels for forensic application.

PubMed

Bhuptani, D; Kumar, S; Vats, M; Sagav, R

2018-05-30

Saliva is one of the most commonly encountered biological fluids found at the crime scene. Forensic science including forensic odontology is focused on the positive identification of individuals. The salivary protein profiling can help in personalization by the changes associated with age throughout life and gender. These changes also seem to vary with the dietary habits, environmental factors and geographical areas. Thus, the aim of present study is to estimate these changes in salivary total protein concentration and profiling in individuals of Gujarat, India. The association of total protein concentration and protein content with the age, gender, tooth eruption, functions of the protein and its physiological significance are also intended for study in this population. One hundred unstimulated whole saliva samples from study subjects of Gujarat population were collected and grouped based on age and gender. Total protein concentration was determined by Bradford assay; also protein was separated and analyzed using Sodium dodecylsulphate polyacrylamide gel electrophoresis (SDS PAGE). T Test and ANOVA were used for statistical analysis. The concentration of Total Protein was found to be between 2-4 mg/ml. It showed a positive correlation with age and gender. It can be concluded more protein bands were prominently present in the adolescents group followed by children and lastly in the adults groups.More high (more than 80 kDa) and low (less than 30 kDa) molecular weight proteins are seen in children and adolescents than adults. SDS PAGE allowed identification and comparison of group variabilities in protein profiles. The total salivary protein showed an association between the parameters under this study which will aid in the individual identification in the field of forensics.

Rigidity in gender-typed behaviors in early childhood: a longitudinal study of ethnic minority children.

PubMed

Halim, May Ling; Ruble, Diane; Tamis-LeMonda, Catherine; Shrout, Patrick E

2013-01-01

A key prediction of cognitive theories of gender development concerns developmental trajectories in the relative strength or rigidity of gender typing. To examine these trajectories in early childhood, 229 children (African American, Mexican American, and Dominican American) were followed annually from age 3 to 5 years, and gender-stereotypical appearance, dress-up play, toy play, and sex segregation were examined. High gender-typing was found across ethnic groups, and most behaviors increased in rigidity, especially from age 3 to 4 years. In addressing controversy surrounding the stability and structure of gender-typing it was found that from year to year, most behaviors showed moderately stable individual differences. Behaviors were uncorrelated within age but showed more concordance in change across time, suggesting that aspects of gender-typing are multidimensional, but still show coherence. © 2013 The Authors. Child Development © 2013 Society for Research in Child Development, Inc.

Recognizing Age-Separated Face Images: Humans and Machines

PubMed Central

Yadav, Daksha; Singh, Richa; Vatsa, Mayank; Noore, Afzel

2014-01-01

Humans utilize facial appearance, gender, expression, aging pattern, and other ancillary information to recognize individuals. It is interesting to observe how humans perceive facial age. Analyzing these properties can help in understanding the phenomenon of facial aging and incorporating the findings can help in designing effective algorithms. Such a study has two components - facial age estimation and age-separated face recognition. Age estimation involves predicting the age of an individual given his/her facial image. On the other hand, age-separated face recognition consists of recognizing an individual given his/her age-separated images. In this research, we investigate which facial cues are utilized by humans for estimating the age of people belonging to various age groups along with analyzing the effect of one's gender, age, and ethnicity on age estimation skills. We also analyze how various facial regions such as binocular and mouth regions influence age estimation and recognition capabilities. Finally, we propose an age-invariant face recognition algorithm that incorporates the knowledge learned from these observations. Key observations of our research are: (1) the age group of newborns and toddlers is easiest to estimate, (2) gender and ethnicity do not affect the judgment of age group estimation, (3) face as a global feature, is essential to achieve good performance in age-separated face recognition, and (4) the proposed algorithm yields improved recognition performance compared to existing algorithms and also outperforms a commercial system in the young image as probe scenario. PMID:25474200

Recognizing age-separated face images: humans and machines.

PubMed

Yadav, Daksha; Singh, Richa; Vatsa, Mayank; Noore, Afzel

2014-01-01

Humans utilize facial appearance, gender, expression, aging pattern, and other ancillary information to recognize individuals. It is interesting to observe how humans perceive facial age. Analyzing these properties can help in understanding the phenomenon of facial aging and incorporating the findings can help in designing effective algorithms. Such a study has two components--facial age estimation and age-separated face recognition. Age estimation involves predicting the age of an individual given his/her facial image. On the other hand, age-separated face recognition consists of recognizing an individual given his/her age-separated images. In this research, we investigate which facial cues are utilized by humans for estimating the age of people belonging to various age groups along with analyzing the effect of one's gender, age, and ethnicity on age estimation skills. We also analyze how various facial regions such as binocular and mouth regions influence age estimation and recognition capabilities. Finally, we propose an age-invariant face recognition algorithm that incorporates the knowledge learned from these observations. Key observations of our research are: (1) the age group of newborns and toddlers is easiest to estimate, (2) gender and ethnicity do not affect the judgment of age group estimation, (3) face as a global feature, is essential to achieve good performance in age-separated face recognition, and (4) the proposed algorithm yields improved recognition performance compared to existing algorithms and also outperforms a commercial system in the young image as probe scenario.

Influence of donor–recipient gender mismatch on graft function and survival following lung transplantation†

PubMed Central

Alvarez, Antonio; Moreno, Paula; Illana, Jennifer; Espinosa, Dionisio; Baamonde, Carlos; Arango, Elisabet; Algar, Francisco Javier; Salvatierra, Angel

2013-01-01

OBJECTIVES In current practice, donors and recipients are not matched for gender in lung transplantation. However, some data have suggested a possible effect of gender combinations on lung transplant outcomes. We examined whether donor–recipient (D/R) gender mismatch is related to adverse outcomes after lung transplantation in terms of early and long-term graft function and survival. METHODS We reviewed 256 donors and lung transplant recipients over a 14-year period. Patients were distributed into four groups: Group A (D/R: female/female), Group B (D/R: male/male), Group C (D/R: female/male), Group D (D/R: male/female). Donor and recipient variables were compared among groups, including early graft function, 30-day mortality, freedom from bronchiolitis obliterans syndrome (BOS), and long-term survival. RESULTS Group A: 57 (22%), Group B: 99 (39%), Group C: 62 (24%), Group D: 38 (15%) transplants (P = 0.001). Donor age was 29 ± 14, 27 ± 12, 33 ± 13 and 23 ± 12 years for Groups A, B, C and D, respectively (P = 0.004). Recipient age was 31 ± 15, 44 ± 17, 42 ± 16 and 30 ± 16 years for Groups A, B, C and D, respectively (P = 0.000). PaO2/FiO2 (mmHg) 24 h post-transplant was: Group A: 276 ± 144, Group B: 297 ± 131, Group C: 344 ± 133 and Group D: 238 ± 138 (P = 0.015). Primary graft dysfunction developed in 23, 14, 17 and 21% of recipients from Groups A, B, C and D, respectively (P = 0.45). Operative mortality was 4.4, 6.5, 5.2 and 2%, for recipients from Groups A, B, C and D, respectively (P = 0.66). Freedom from BOS was 73, 59 and 36% for gender-matched transplants vs 76, 67 and 40% for gender-mismatched transplants at 3, 5 and 10 years, respectively (P = 0.618), without differences among groups. A non-significant survival benefit was observed for female recipients, irrespective of the donor gender. CONCLUSIONS Donor–recipient gender mismatch does not have a negative impact on early graft function and mortality following lung transplantation. There is a trend towards a survival benefit for female recipients, irrespective of the donor gender. PMID:23322094

Women's health: explaining the trend in gender ratio in Iran over half a century (1956-2006).

PubMed

Farzadi, F; Ahmadi, B; Shariati, B; Alimohamadian, M; Mohamad, K

2010-02-01

Changes in gender ratio generally reflect differences in mortality rates in men and women. Female mortality rates, on the other hand, can be used as an index of the trends in women's health. This study looks at the trend in the population gender ratio from 1956 to 2006, with a focus on analysing mortality rates and hence the overall health of Iranian women over the last 50 years. Cohort-type analysis using data from the last five population censuses in Iran. Data were used to calculate gender ratios and analyse their trends over the 50-year period from 1956 to 2006. According to the 1956 Census, there were 98 men for every 100 women in the 25-34 years age group (male:female ratio=0.98). In the next census, conducted 10 years later (1966), the gender ratio increased to 121 in the 39-44 years age group. The discrepancy increased in later censuses; this trend indicates that mortality in the 25-34 years age group was significantly higher in 1956-1966 compared with subsequent decades. The social and economic crises of the 1940s probably left women of reproductive age exceptionally vulnerable to a wide range of adverse health outcomes. The fact that the trend ceased in 1976 with no further increase in the gender ratio may be due to improving social conditions and greater effectiveness of healthcare programmes directed at women. As life expectancy is calculated on the basis of the conditional probability of death over specific intervals, the apparent discrepancy between the current gender ratios and life expectancy data may be due to higher female death rates before 1976. Copyright 2010 The Royal Society for Public Health. Published by Elsevier Ltd. All rights reserved.

Body weight and the medial longitudinal foot arch: high-arched foot, a hidden problem?

PubMed

Woźniacka, R; Bac, A; Matusik, S; Szczygieł, E; Ciszek, E

2013-05-01

This study had two objectives. First, to determine the prevalence of hollow (high-arched) and flat foot among primary school children in Cracow (Poland). Second, to evaluate the relationship between the type of medial longitudinal arch (MLA; determined by the Clarke's angle) and degree of fatness. The prevalence of underweight, overweight, and obesity was determined by means of IOTF cut-offs with respect to age and gender. A sample of 1,115 children (564 boys and 551 girls) aged between 3 and 13 years was analyzed. In all age groups, regardless of gender, high-arched foot was diagnosed in the majority of children. A distinct increase in the number of children with high-arched foot was observed between 7- and 8-year olds. Regardless of the gender, high-arched foot was more common among underweight children. In the group of obese children, the biggest differences were attributed to gender. High-arched foot was the most frequently observed among boys. In all gender and obesity level groups, the flat foot was more common among boys than among girls. High-arched foot is the most common foot defect among children 3-13 years old regardless of gender. Flat foot is least frequently observed in children 3-13 years old. A statistic correlation between MLA and adiposity is observed. Stronger correlation is observed among girls.

Age and gender differences in conviction and crash occurrence subsequent to being directed to Iowa's driver improvement program.

PubMed

Zhang, Wei; Gkritza, Konstantina; Keren, Nir; Nambisan, Shashi

2011-10-01

This paper investigates potential gender and age differences in conviction and crash occurrence subsequent to being directed to attend Iowa's Driver Improvement Program (DIP). Binary logit models were developed to investigate the factors that influence conviction occurrence after DIP by gender and age. Because of the low crash occurrence subsequent to DIP, association rules were applied to investigate the factors that influence crash occurrence subsequent to DIP, in lieu of econometric models. There were statistical significant differences by driver gender, age, and conviction history in the likelihood of subsequent convictions. However, this paper found no association between DIP outcome, crash history, and crash occurrence. Evaluating the differences in conviction and crash occurrence subsequent to DIP between female and male drivers, and among different age groups can lead to improvements of the effectiveness of DIPs and help to identify low-cost intervention measures, customized based on drivers' gender and age, for improving driving behaviors. Copyright © 2011 National Safety Council and Elsevier Ltd. All rights reserved.

Age and Gender Differences in Facial Attractiveness, but Not Emotion Resemblance, Contribute to Age and Gender Stereotypes

PubMed Central

Palumbo, Rocco; Adams, Reginald B.; Hess, Ursula; Kleck, Robert E.; Zebrowitz, Leslie

2017-01-01

Considerable research has shown effects of facial appearance on trait impressions and group stereotypes. We extended those findings in two studies that investigated the contribution of resemblance to emotion expressions and attractiveness to younger adults (YA) and older adults (OA) age and gender stereotypes on the dimensions of warmth and competence. Using connectionist modeling of facial metrics of 240 neutral younger and older faces, Study 1 found that, neutral expression older faces or female faces showed greater structural resemblance to happy expressions and less resemblance to angry expressions than did younger or male faces, respectively. In addition, neutral female faces showed greater resemblance to surprise expressions. In Study 2, YA and OA rated the faces of Study 1 for attractiveness and for 4 traits that we aggregated on the dimensions of competence (competent, healthy) and warmth (trustworthy, not shrewd). We found that YA, but not OA, age stereotypes replicated previous research showing higher perceived warmth and lower perceived competence in older adults. In addition, previously documented gender stereotypes were moderated by face age for both YA and OA. The greater attractiveness of younger than older faces and female than male faces influenced age and gender stereotypes, including these deviations from prior research findings using category labels rather than faces. On the other hand, face age and face sex differences in emotion resemblance did not influence age or gender stereotypes, contrary to prediction. Our results provide a caveat to conclusions about age and gender stereotypes derived from responses to category labels, and they reveal the importance of assessing stereotypes with a methodology that is sensitive to influences of group differences in appearance that can exacerbate or mitigate stereotypes in more ecologically valid contexts. Although the gender differences in attractiveness in the present study may not have generalizability, the age differences likely do, and the fact that they can weaken the attribution of greater warmth and strengthen the attribution of lower competence to older than younger individuals has important practical implications. PMID:29033881

Age and Gender Differences in Facial Attractiveness, but Not Emotion Resemblance, Contribute to Age and Gender Stereotypes.

PubMed

Palumbo, Rocco; Adams, Reginald B; Hess, Ursula; Kleck, Robert E; Zebrowitz, Leslie

2017-01-01

Considerable research has shown effects of facial appearance on trait impressions and group stereotypes. We extended those findings in two studies that investigated the contribution of resemblance to emotion expressions and attractiveness to younger adults (YA) and older adults (OA) age and gender stereotypes on the dimensions of warmth and competence. Using connectionist modeling of facial metrics of 240 neutral younger and older faces, Study 1 found that, neutral expression older faces or female faces showed greater structural resemblance to happy expressions and less resemblance to angry expressions than did younger or male faces, respectively. In addition, neutral female faces showed greater resemblance to surprise expressions. In Study 2, YA and OA rated the faces of Study 1 for attractiveness and for 4 traits that we aggregated on the dimensions of competence (competent, healthy) and warmth (trustworthy, not shrewd). We found that YA, but not OA, age stereotypes replicated previous research showing higher perceived warmth and lower perceived competence in older adults. In addition, previously documented gender stereotypes were moderated by face age for both YA and OA. The greater attractiveness of younger than older faces and female than male faces influenced age and gender stereotypes, including these deviations from prior research findings using category labels rather than faces. On the other hand, face age and face sex differences in emotion resemblance did not influence age or gender stereotypes, contrary to prediction. Our results provide a caveat to conclusions about age and gender stereotypes derived from responses to category labels, and they reveal the importance of assessing stereotypes with a methodology that is sensitive to influences of group differences in appearance that can exacerbate or mitigate stereotypes in more ecologically valid contexts. Although the gender differences in attractiveness in the present study may not have generalizability, the age differences likely do, and the fact that they can weaken the attribution of greater warmth and strengthen the attribution of lower competence to older than younger individuals has important practical implications.

Ideological Cause and Hero Worship Related Suicides: Indian Perspective and Changing Trends During 2001–2014: An Exploratory Study

PubMed Central

Mohandoss, Anusa Arunachalam

2016-01-01

Background: Of the various causes of suicides in India, very less number commit it for an ideological cause or due to hero worship (IHW). The prevalence and changing trends in IHW suicides are not much discussed. An attempt is made to draw attention to this subset of suicides during 2001–2014. Materials and Methods: Accessible data from the National Crime Bureau Records in open domain was employed for this study. As only whole sum numbers associated with state, age groups, and genders and years were only available parameters, descriptive statistics of rate of suicides, linear trend with age groups, gender, and geographical divisions are presented. Results: In 14 years period, 1,721,946 suicides with an average of 122,996 suicides per year were observed. In total, a sum of 2395 IHW related suicides was noted accounting an average 171 suicides per year was observed. The difference among genders and age group with respect to various parts of India is presented. Southern India and in particular, Tamil Nadu consistently had the highest IHW related suicides. Discussion: The possible causes behind this unique phenomenon, cultural ethos, and implication are presented. In addition, the implication of changing trends in terms of geographical distribution, age group distribution, and gender dynamics are presented and discussed. PMID:28031592

The relationship between age-stereotypes and health locus of control across adult age-groups.

PubMed

Sargent-Cox, Kerry; Anstey, Kaarin J

2015-01-01

This study integrates healthy ageing and health psychology theories to explore the mechanisms underlying the relationship between health control expectancies and age-attitudes on the process of ageing well. Specifically, the aim of this study is to investigate the relationship between age-stereotypes and health locus of control. A population-based survey of 739 adults aged 20-97 years (mean = 57.3 years, SD = 13.66; 42% female) explored attitudes towards ageing and health attitudes. A path-analytical approach was used to investigate moderating effects of age and gender. Higher age-stereotype endorsement was associated with higher chance (β = 2.91, p < .001) and powerful other (β = 1.07, p = .012) health expectancies, after controlling for age, gender, education and self-rated health. Significant age and gender interactions were found to influence the relationship between age-stereotypes and internal health locus of control. Our findings suggest that the relationship between age-stereotypes and health locus of control dimensions must be considered within the context of age and gender. The findings point to the importance of targeting health promotion and interventions through addressing negative age-attitudes.

Changing gender roles and attitudes and their implications for well-being around the new millennium.

PubMed

Sweeting, Helen; Bhaskar, Abita; Benzeval, Michaela; Popham, Frank; Hunt, Kate

2014-05-01

Given evidence that gender role attitudes (GRAs) and actual gender roles impact on well-being, we examine associations between GRAs, three roles (marital status, household chore division, couple employment) and psychological distress in working-age men and women. We investigate time-trends reflecting broader social and economic changes, by focusing on three age groups at two dates. We used British Household Panel Survey data from 20- to 64-year-olds in heterosexual couple households in 1991 (N = 5,302) and 2007 (N = 6,621). We examined: levels of traditional GRAs according to gender, age, date, household and employment roles; associations which GRAs and roles had with psychological distress (measured via the GHQ-12); whether psychological distress increased when GRAs conflicted with actual roles; and whether any of these associations differed according to gender, age or date. Gender traditionalism was lower among women, younger people, those participating in 2007 and in 'less traditional' relationships and households. Psychological distress was higher among those with more traditional GRAs and, particularly among men, for those not employed, and there was some evidence of different patterns of association according to age-group. There was limited evidence, among women only, of increased psychological distress when GRAs and actual roles conflicted and/or reductions when GRAs and roles agreed, particularly in respect of household chores and paid employment. Although some aspects of gender roles and attitudes (traditionalism and paid employment) are associated with well-being, others (marital status and household chores), and attitude-role consistency, may have little impact on the well-being of contemporary UK adults.

Isoniazid preventive therapy for tuberculosis. Decision analysis considering ethnicity and gender.

PubMed

Jordan, T J; Lewit, E M; Reichman, L B

1991-12-01

The decision to prescribe or withhold isoniazid (INH) preventive therapy for low-risk tuberculin reactors has been highly controversial, primarily due to isoniazid's possible hepatotoxic effects. Previous analyses have explored the INH decision only from the perspective of patient age, recognizing that the risks of INH-induced hepatotoxicity are age related. Decision analyses presented in this paper assess the impact of gender and ethnic group, as well as age, on the INH decision. Results for low-risk patients favor prescribing INH preventive therapy for all 20-yr-olds, all 35-yr-olds except black women, and no 50-yr-olds, projecting life expectancy benefits that range from 3 to 19 days. A comparison set of analyses performed for high-risk patients favors prescribing INH for all groups except 50-yr-old black women. These findings suggest that ethnicity, gender, and age should be considered when making the decision to prescribe or withhold INH preventive therapy.

The influence of age and gender on party drug use among young adults attending dance events, clubs, and rock festivals in Belgium.

PubMed

Van Havere, Tina; Vanderplasschen, Wouter; Broekaert, Eric; De Bourdeaudhui, Ilse

2009-01-01

A random sample of visitors of dance events, clubs, and rock festivals in Belgium (Flanders) was selected to complete an anonymous survey regarding their use of "party" drugs (alcohol, cannabis, xtc, cocaine, and amphetamines) and patterns of going out. The results of 670 respondents recruited in 2005 are reported and compared with 2003 for gender and age. Drug use in these nightlife settings is higher than in the general population. In younger age groups, the illegal drug use increases, but it decreases in older age groups. This might be linked to more responsibilities. Men still use drugs more often than women, but the gender differences seem to decrease. The changing role of women in society could be an explanation for this evolution. Limitations and implications of this research are discussed.

Does Group Size Matter for Behavior in Online Trust Dilemmas?

PubMed

Artinger, Sabrina; Vulkan, Nir

2016-01-01

How does group size influence behavior in online trust dilemmas? We investigate cooperation in groups of 4 to 100 players. While overall levels of cooperation are stable across group sizes, we find significant gender differences: women increase cooperation with group size and cooperate significantly more than men in large groups. These results are robust when controlling for risk aversion, age, and other individual differences. They highlight the importance of studying behavior and gender differences in large groups.

Age and gender interactions in short distance triathlon performance.

PubMed

Etter, Franziska; Knechtle, Beat; Bukowski, Arkadiusz; Rüst, Christoph Alexander; Rosemann, Thomas; Lepers, Romuald

2013-01-01

This study investigated the participation and performance trends as well as the age and gender interaction at the Olympic distance 'Zürich Triathlon' (1.5 km swim, 40 km cycle and 10 km run) from 2000 to 2010 in 7,939 total finishers (1,666 females and 6,273 males). Female triathletes aged from 40 to 54 years significantly (P < 0.05) increased their participation while the participation of younger females and males remained stable. Males of 50-54 years of age and females of 45-49 years of age improved their total race time. For elite top five overall triathletes, mean gender differences in swimming, cycling, running and overall race time were 15.2 ± 4.6%, 13.4 ± 2.3%, 17.1 ± 2.5%, and 14.8 ± 1.8%, respectively. For both elite and age group athletes, the gender difference in cycling time was significantly (P <0.001) lower than for swimming and running. The gender difference in overall Olympic distance triathlon performance increased after the age of 35 years, which appeared earlier compared to long distance triathlon as suggested by previous studies. Future investigations should compare gender difference in performance for different endurance events across age to confirm a possible effect of exercise duration on gender difference with advancing age.

Convergence in Sleep Time Accomplished? Gender Gap in Sleep Time for Middle-Aged Adults in Korea

PubMed Central

Eun, Ki-Soo

2018-01-01

Although the gender gap in sleep time has narrowed significantly in the last decade, middle-aged women between ages 35 and 60 still sleep less than their male counterparts in Korea. This study examines and provides evidence for factors contributing to the gender gap in this age group. Using Korean Time Use Survey (KTUS) data from 2004, 2009 and 2014, we find that middle-aged women’s difficulty in managing work-life balance and traditional role expectations placed upon women are the main causes of the gender gap in sleep time. The decomposition analysis reveals that the improved socioeconomic status and recent changes in familial expectations for women may have helped them sleep more than in the past. However, there remain fundamental differences in attitude and time use patterns between men and women that prevent middle-aged women from getting the same amount of sleep. PMID:29671824

Convergence in Sleep Time Accomplished? Gender Gap in Sleep Time for Middle-Aged Adults in Korea.

PubMed

Cha, Seung-Eun; Eun, Ki-Soo

2018-04-19

Although the gender gap in sleep time has narrowed significantly in the last decade, middle-aged women between ages 35 and 60 still sleep less than their male counterparts in Korea. This study examines and provides evidence for factors contributing to the gender gap in this age group. Using Korean Time Use Survey (KTUS) data from 2004, 2009 and 2014, we find that middle-aged women’s difficulty in managing work-life balance and traditional role expectations placed upon women are the main causes of the gender gap in sleep time. The decomposition analysis reveals that the improved socioeconomic status and recent changes in familial expectations for women may have helped them sleep more than in the past. However, there remain fundamental differences in attitude and time use patterns between men and women that prevent middle-aged women from getting the same amount of sleep.

Invariance of an Extended Technology Acceptance Model Across Gender and Age Group

ERIC Educational Resources Information Center

Ahmad, Tunku Badariah Tunku; Madarsha, Kamal Basha; Zainuddin, Ahmad Marzuki; Ismail, Nik Ahmad Hisham; Khairani, Ahmad Zamri; Nordin, Mohamad Sahari

2011-01-01

In this study, we examined the likelihood of a TAME (extended technology acceptance model), in which the interrelationships among computer self-efficacy, perceived usefulness, intention to use and self-reported use of computer-mediated technology were tested. In addition, the gender- and age-invariant of its causal structure were evaluated. The…

Facial anthropometric differences among gender, ethnicity, and age groups.

PubMed

Zhuang, Ziqing; Landsittel, Douglas; Benson, Stacey; Roberge, Raymond; Shaffer, Ronald

2010-06-01

The impact of race/ethnicity upon facial anthropometric data in the US workforce, on the development of personal protective equipment, has not been investigated to any significant degree. The proliferation of minority populations in the US workforce has increased the need to investigate differences in facial dimensions among these workers. The objective of this study was to determine the face shape and size differences among race and age groups from the National Institute for Occupational Safety and Health survey of 3997 US civilian workers. Survey participants were divided into two gender groups, four racial/ethnic groups, and three age groups. Measurements of height, weight, neck circumference, and 18 facial dimensions were collected using traditional anthropometric techniques. A multivariate analysis of the data was performed using Principal Component Analysis. An exploratory analysis to determine the effect of different demographic factors had on anthropometric features was assessed via a linear model. The 21 anthropometric measurements, body mass index, and the first and second principal component scores were dependent variables, while gender, ethnicity, age, occupation, weight, and height served as independent variables. Gender significantly contributes to size for 19 of 24 dependent variables. African-Americans have statistically shorter, wider, and shallower noses than Caucasians. Hispanic workers have 14 facial features that are significantly larger than Caucasians, while their nose protrusion, height, and head length are significantly shorter. The other ethnic group was composed primarily of Asian subjects and has statistically different dimensions from Caucasians for 16 anthropometric values. Nineteen anthropometric values for subjects at least 45 years of age are statistically different from those measured for subjects between 18 and 29 years of age. Workers employed in manufacturing, fire fighting, healthcare, law enforcement, and other occupational groups have facial features that differ significantly than those in construction. Statistically significant differences in facial anthropometric dimensions (P < 0.05) were noted between males and females, all racial/ethnic groups, and the subjects who were at least 45 years old when compared to workers between 18 and 29 years of age. These findings could be important to the design and manufacture of respirators, as well as employers responsible for supplying respiratory protective equipment to their employees.

Vulnerability to unhealthy behaviours across different age groups in Swedish Adolescents: a cross-sectional study

PubMed Central

Paulsson Do, Ulrica; Edlund, Birgitta; Stenhammar, Christina; Westerling, Ragnar

2014-01-01

Purpose: There is lack of evidence on the effects of health-promoting programmes among adolescents. Health behaviour models and studies seldom compare the underlying factors of unhealthy behaviours between different adolescent age groups. The main objective of this study was to investigate factors including sociodemographic parameters that were associated with vulnerability to health-damaging behaviours and non-adoption of health-enhancing behaviours in different adolescent age groups. Methods: A survey was conducted among 10,590 pupils in the age groups of 13–14, 15–16 and 17–18 years. Structural equation modelling was performed to determine whether health-damaging behaviours (smoking and alcohol consumption) and non-adoption of health-enhancing behaviours (regular meal habits and physical activity) shared an underlying vulnerability. This method was also used to determine whether gender and socio-economic status were associated with an underlying vulnerability to unhealthy behaviours. Results: The findings gave rise to three models, which may reflect the underlying vulnerability to health-damaging behaviours and non-adoption of health-enhancing behaviours at different ages during adolescence. The four behaviours shared what was interpreted as an underlying vulnerability in the 15–16-year-old age group. In the youngest group, all behaviours except for non-participation in physical activity shared an underlying vulnerability. Similarly, alcohol consumption did not form part of the underlying vulnerability in the oldest group. Lower socio-economic status was associated with an underlying vulnerability in all the age groups; female gender was associated with vulnerability in the youngest adolescents and male gender among the oldest adolescents. Conclusions: These results suggest that intervention studies should investigate the benefits of health-promoting programmes designed to prevent health-damaging behaviours and promote health-enhancing behaviours in adolescents of different ages. Future studies should examine other factors that may contribute to the underlying vulnerability in different age groups. PMID:25750783

Variability in neurocognitive performance: Age, gender, and school-related differences in children and from ages 6 to 12.

PubMed

Kochhann, Renata; Gonçalves, Hosana Alves; Pureza, Janice da Rosa; Viapiana, Vanisa Fante; Fonseca, Flavia Dos Passos; Salles, Jerusa Fumagali; Fonseca, Rochele Paz

2017-04-20

Cognitive development in children presents peculiarities according to groups of age, gender, and type of school. Few studies have been investigating the effects of all these factors. The aim of this study was to investigate the main effects and the interactions of age, gender, and type of school in 419 children from ages 6 to 12 years old evaluated by the Child Brief Neuropsychological Assessment Battery (NEUPSILIN-Inf). Older children, children in private schools and girls presented better results. Interactions between all three independent variables were observed in different cognitive domains. The results highlight both the heterogeneity and the influence of multiple factors in children's neuropsychological development.

Gender Differences in Symptom Reporting on Baseline Sport Concussion Testing Across the Youth Age Span.

PubMed

Moser, Rosemarie Scolaro; Olek, Lauren; Schatz, Philip

2018-02-06

Little is known regarding gender differences in concussion symptom reporting developmentally across the age span, specifically in pre-adolescent athletes. The present study asks: Do boys and girls differ in symptom reporting across the pre-adolescent to post-adolescent age span? This retrospective study utilized baseline assessments from 11,695 10-22 year-old athletes assigned to 3 independent groups: Pre-adolescent 10-12 year olds (n = 1,367; 12%), Adolescent 13-17 year olds (n = 2,974; 25%), and Late Adolescent 18-22 year olds (n = 7,354; 63%). Males represented 60% of the sample. Baseline ImPACT composite scores and Post-Concussion Symptom Scale scores (Total, Physical, Cognitive, Emotional, Sleep) were analyzed for the effects of age and gender. Statistically significant main effects were found for age and gender on all ImPACT composites, Total Symptoms, and Symptom factors. Significant interaction effects were noted between age and gender for all ImPACT composites, Total Symptoms, and Symptom factors. Total Symptoms and all Symptom factors were highest in adolescents (ages 13-17) for males and females. In the 10-12 age group, females displayed lower Total Symptoms, Physical, and Sleep factors than males. The notion of females being more likely than males to report symptoms does not appear to apply across the developmental age span, particularly prior to adolescence. Females show greater emotional endorsement across the youth age span (10-22 years). Adolescence (13-17 years) appears to be a time of increased symptomatology that may lessen after the age of 18. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Evaluation of styloid process morphology and calcification types in both genders with different ages and dental status.

PubMed

Magat, Guldane; Ozcan, Sevgi

2017-01-01

The purpose of this study was to investigate the morphology and calcification pattern of the styloid process (SP) and to determine their relations with subjects' age, gender, and dental status. 910 panoramic radiographs were stratified by age, dental status and gender. The distance between the points where SP leaves the tympanic plate of the temporal bone and the bony tip of SP was measured. Calcification patterns were classified as : (A) Region 1, tympanohyal alone (B) Region 2, stylohyal alone (C) Region 1 and 2, separate (D) Regions 1 and 2, continuous (E) Regions 1, 2, and 3, continuous (F) Regions 1, 2, and 3, separate (G) Regions 1 and 2, continuous, but separate from 3 (H) Regions 2 and 3, separate (I) Regions 2 and 3, continuous, but separate from 1 (J) Region 3 alone (K) Region 3 and 4, continuous (may include calcification in one other region) (L) No styloid process visible. The right SPs were found to be longer than the left (p<0.05). Types D (right 42.9%, left 42%) and E (right 33.3%, left 30.8%) were the most common morphological calcifications on both sides. No statistical difference was found for bilateral SP length between gender, age, and dental status groups. A significant difference was found only for right SP morphological calcification types as to age groups in both genders (p<0.05). No significant difference was found for SP morphological calcification types according to gender and dental status. The morphological types are formed at their present area. Even though SP calcification type was determined according to the length of SP, age was not an effective factor on the length, but the morphological calcification type of SP. Therefore, factors other than age may have a role in the development of morphological calcification types. Structural characteristics of SP are not associated with age, gender and dental status.

Gender-related differences in the multi-pathway effect of social determinants on quality of life in older age-the COURAGE in Europe project.

PubMed

Tobiasz-Adamczyk, Beata; Galas, Aleksander; Zawisza, Katarzyna; Chatterji, Somnath; Haro, Josep Maria; Ayuso-Mateos, José Luis; Koskinen, Seppo; Leonardi, Matilde

2017-07-01

Gender-related differences in life expectancy, prevalence of chronic conditions and level of disability in the process of ageing have been broadly described. Less is known about social determinants, which may have different impacts on quality of life in men and women. The investigation aims to reveal gender-related differences in social determinants on quality of life assessed by a multi-pathway model including health, social, demographic and living place characteristics. The study group consisted of 5099 participants aged 50+ representing general populations of three different European regions (Finland, Poland, Spain) who participated in COURAGE in EUROPE Project. Standardized tools were used to measure quality of life (WHOQOL-AGE) and social determinants (COURAGE Social Network Index, OSLO-3 Social Support Scale, UCLA Loneliness Scale, participation scale and trust). A multipath model considering exogenous predictors (demographic, economic), mediators (social) and endogenous outcome (QOL) was created to reveal the role of determinants. Gender-related differences were investigated across three age categories: 50-64; 65-79 and 80+. The model (RMSEA = 0.058; CFI = 0.939) showed the effects of all of the investigated determinants. Gender-related differences in the association between social constructs and QOL were observed for social networks in the group of 80+, for social support in the group of 50-64 and 65-79 years, and for social participation in the group of 65-79 years. Males benefited more (in QOL) from social networks and social support, and women from social participation. The research provides valuable knowledge about the role of social determinants in QOL considering complex relations between different social constructs. Additionally, the results showed gender-related differences in the associations between social networks, social support, social participation and QOL, suggesting that men might benefit more from the interventions in the first two. Although our research did not investigate the effects of interventions, the results show directions for future investigations, how to shape social interventions at the population level to improve quality of life of older adults, and thus help achieve successful ageing.

[Distribution of Enterobius vermicularis among the schoolchildren of two primary schools with different social-economic status in the Ankara province].

PubMed

Hazir, Canan; Gündeşli, Hülya; Ozkirim, Asli; Keskin, Nevin

2009-01-01

In this study, 207 cellophane-tape specimens were taken from children at two different primary schools in Ankara province. Twenty two out of 207 samples were positive for Enterobius vermicularis (10.6%). A questionnaire including the major factors affecting the distribution of E. vermicularis such as the students' ages, genders and socio-economic status was made. No relationship was found between children's gender and E. vermicularis infection, whereas a higher infection rate was seen in the low-income families. When the 6-9 age group was taken into consideration, the incidence of E. vermicularis was higher for the 8-9 age group than for the 6-7 age group. Abdominal pain was the most common clinical symptom among the children.

Bone age in cerebral palsy

PubMed Central

Miranda, Eduardo Régis de Alencar Bona; Palmieri, Maurício D'arc; de Assumpção, Rodrigo Montezuma César; Yamada, Helder Henzo; Rancan, Daniela Regina; Fucs, Patrícia Maria de Moraes Barros

2013-01-01

Objective To compare the chronological age and bone age among cerebral palsy patients in the outpatient clinic and its correlation with the type of neurological involvement, gender and functional status. Methods 401 patients with spastic cerebral palsy, and ages ranging from three months to 20 years old, submitted to radiological examination for bone age and analyzed by two independent observers according Greulich & Pyle. Results In the topographic distribution, there was a significant delay (p<0.005) in tetraparetic (17.7 months), hemiparetic (10.1 months), and diparetic patients (7.9 months). In the hemiparetic group, the mean bone age in the affected side was 96.88 months and the uncompromised side was 101.13 months (p<0.005). Regarding functional status, the ambulatory group showed a delay of 18.73 months in bone age (p<0.005). Comparing bone age between genders, it was observed a greater delay in males (13.59 months) than in females (9.63 months), but not statistically significant (p = 0.54). Conclusion There is a delay in bone age compared to chronological age influenced by the topography of spasticity, functional level and gender in patients with cerebral palsy. Level of Evidence IV, Case Series. PMID:24453693

The influence of age and gender on motor and non-motor features of early Parkinson's disease: initial findings from the Oxford Parkinson Disease Center (OPDC) discovery cohort.

PubMed

Szewczyk-Krolikowski, Konrad; Tomlinson, Paul; Nithi, Kannan; Wade-Martins, Richard; Talbot, Kevin; Ben-Shlomo, Yoav; Hu, Michele T M

2014-01-01

Identifying factors influencing phenotypic heterogeneity in Parkinson's Disease is crucial for understanding variability in disease severity and progression. Age and gender are two most basic epidemiological characteristics, yet their effect on expression of PD symptoms is not fully defined. We aimed to delineate effects of age and gender on the phenotype in an incident cohort of PD patients and healthy controls from the Oxford Parkinson Disease Centre (OPDC). Clinical features, including demographic and medical characteristics and non-motor and motor symptoms, were analyzed in a group of PD patients within 3 years of diagnosis and a group of healthy controls from the OPDC cohort. Disease features were stratified according to age and compared between genders, controlling for effects of common covariates. 490 PD patients and 176 healthy controls were analyzed. Stratification by age showed increased disease severity with age on motor scales. Some non-motor features showed similar trend, including cognition and autonomic features. Comparison across genders highlighted a pattern of increased severity and greater symptom symmetricality in the face, neck and arms in men with women having more postural problems. Amongst the non-motor symptoms, men had more cognitive impairment, greater rate of REM behavior disorder (RBD), more orthostatic hypotension and sexual dysfunction. Age in PD is a strong factor contributing to disease severity even after controlling for the effect of disease duration. Gender-related motor phenotype can be defined by a vertical split into more symmetrical upper-body disease in men and disease dominated by postural symptoms in women. Copyright © 2013 Elsevier Ltd. All rights reserved.

Age and gender differences regarding physical performance in the elderly from Barbados and Cuba.

PubMed

Rodrigues-Barbosa, Aline; de Miranda, Leticia Miranda; Vieira-Guimarães, Alexsander; Xavier-Corseuil, Herton; Weber-Corseuil, Marui

2011-02-01

Presenting physical performance tests' (PPTs) descriptive reference values and prevalence according to gender and age-group regarding a representative sample of non-institutionalised older adults (aged 60 and over) living in Bridgetown (Barbados) and Havana (Cuba). This was a cross-sectional, population-based household survey. In Bridgetown and Havana, respectively, 1,508 and 1,905 subjects were examined who had been selected by probabilistic sampling. PPTs included handgrip strength, standing balance, timed repeated "chair stand" and "pick up a pen." The results from Bridgetown and Havana showed that values (mean ± standard deviations and percentiles) for men were greater than women in handgrip strength and "chair stand" tests (p≤0.01). Increasing age led to both genders having reduced (p≤0.001) prevalence of people having better results for each test (based on chi-square). Men had proportionately better scores than women in the four tests. The data suggested that younger people and men had better physical performance. Men and women in both countries had differences regarding the prevalence of people unable to perform the tests and better test results, according to the test and age-group. The data provided information about the range of performance that can be expected from people in different ages and helped understand usual rates of change in age-groups.

Challenging gender stereotypes: resistance and exclusion.

PubMed

Mulvey, Kelly Lynn; Killen, Melanie

2015-01-01

The likelihood of resisting gender-stereotypic peer group norms, along with expectations about personal resistance, was investigated in 9- to 10-year-olds and 13- to 14-year-olds (N = 292). Participants were told about a stereotype conforming group (boys playing football; girls doing ballet) and a stereotype nonconforming group (boys doing ballet; girls playing football). Contrary to expectations from gender-stereotyping research, participants stated that they would personally resist gender-stereotypic norms, and more so than they would expect their peers to resist. However, expecting peers to resist declined with age. Participants expected that exclusion from the group was a consequence for challenging the peer group, and understood the asymmetrical status of gender stereotypes with an expectation that it would be more difficult for boys to challenge stereotypes than for girls. © 2014 The Authors. Child Development © 2014 Society for Research in Child Development, Inc.

Gender and age differences in components of traffic-related pedestrian death rates: exposure, risk of crash and fatality rate.

PubMed

Onieva-García, María Ángeles; Martínez-Ruiz, Virginia; Lardelli-Claret, Pablo; Jiménez-Moleón, José Juan; Amezcua-Prieto, Carmen; de Dios Luna-Del-Castillo, Juan; Jiménez-Mejías, Eladio

2016-12-01

This ecological study aimed i) to quantify the association of age and gender with the three components of pedestrians' death rates after a pedestrian-vehicle crash: exposure, risk of crash and fatality, and ii) to determine the contribution of each component to differences in death rates according to age and gender in Spain. We analyzed data for 220 665 pedestrians involved in road crashes recorded in the Spanish registry of road crashes with victims from 1993 to 2011, and a subset of 39 743 pedestrians involved in clean collisions (in which the pedestrian did not commit an infraction). Using decomposition and quasi-induced exposure methods, we obtained the proportion of increase in death rates for each age and gender group associated with exposure, risk of collision and fatality. Death rates increased with age. The main contributor to this increase was fatality, although exposure also increased with age. In contrast, the risk of collision decreased with age. Males had higher death rates than females, especially in the 24-54 year old group. Higher fatality rates in males were the main determinant of this difference, which was also related with a higher risk of collision in males. However, exposure rates were higher in females. The magnitude and direction of the associations between age and gender and each of the three components of pedestrians' death rates differed depending on the specific component explored. These differences need to be taken into account in order to prioritize preventive strategies intended to decrease mortality among pedestrians.

Gender and age differences in components of traffic-related pedestrian death rates: exposure, risk of crash and fatality rate.

PubMed

Onieva-García, María Ángeles; Martínez-Ruiz, Virginia; Lardelli-Claret, Pablo; Jiménez-Moleón, José Juan; Amezcua-Prieto, Carmen; de Dios Luna-Del-Castillo, Juan; Jiménez-Mejías, Eladio

This ecological study aimed i) to quantify the association of age and gender with the three components of pedestrians' death rates after a pedestrian-vehicle crash: exposure, risk of crash and fatality, and ii) to determine the contribution of each component to differences in death rates according to age and gender in Spain. We analyzed data for 220 665 pedestrians involved in road crashes recorded in the Spanish registry of road crashes with victims from 1993 to 2011, and a subset of 39 743 pedestrians involved in clean collisions (in which the pedestrian did not commit an infraction). Using decomposition and quasi-induced exposure methods, we obtained the proportion of increase in death rates for each age and gender group associated with exposure, risk of collision and fatality. Death rates increased with age. The main contributor to this increase was fatality, although exposure also increased with age. In contrast, the risk of collision decreased with age. Males had higher death rates than females, especially in the 24-54 year old group. Higher fatality rates in males were the main determinant of this difference, which was also related with a higher risk of collision in males. However, exposure rates were higher in females. The magnitude and direction of the associations between age and gender and each of the three components of pedestrians' death rates differed depending on the specific component explored. These differences need to be taken into account in order to prioritize preventive strategies intended to decrease mortality among pedestrians.

Correlation between Age, Gender, Waist-Hip Ratio and Intra Ocular Pressure in Adult North Indian Population.

PubMed

Baisakhiya, Shikha; Singh, Surjit; Manjhi, Prafulla

2016-12-01

Intraocular pressure (IOP) is affected by various systemic and local factors. The significance of studying the factors affecting IOP is because of its association with potentially blinding condition known as glaucoma. Present study was conducted with the aim to find out the correlation between gender, age, Waist-Hip Ratio (WHR) and IOP. The study included 300 healthy individuals between 40-79years of age. The subjects were divided into 2 categories according to gender i.e., male and female. The subjects were divided into 4 categories according to age i.e., 40-49years, 50-59years, 60-69years and 70-79years. The subjects were divided into two groups according to Waist-hip ratio (WHR) as per WHO guidelines: WHR <0.9 and WHR >0.9 in males and WHR <0.85 and WHR >0.85 in females. IOP was recorded in each group using Goldmann Applanation tonometer and statistical comparisons were made to find correlation between gender, age, Waist-hip ratio and IOP. There was no statistically significant difference between IOP of males and females (p=0.235). The age and IOP were positively correlated with each other i.e., IOP increases with increasing age (r=0.511, p<0.001). Higher WHR is associated with significantly higher IOP in both the genders (males r =0.644, p<0.001; females r=0.794, p<0.001). There is no significant difference in IOP amongst males and females. Increasing age and higher WHR are risk factors for raised IOP.

Gender identity and adjustment in black, Hispanic, and white preadolescents.

PubMed

Corby, Brooke C; Hodges, Ernest V E; Perry, David G

2007-01-01

The generality of S. K. Egan and D. G. Perry's (2001) model of gender identity and adjustment was evaluated by examining associations between gender identity (felt gender typicality, felt gender contentedness, and felt pressure for gender conformity) and social adjustment in 863 White, Black, and Hispanic 5th graders (mean age = 11.1 years). Relations between gender identity and adjustment varied across ethnic/racial groups, indicating that S. K. Egan and D. G. Perry's model requires amendment. It is suggested that the implications of gender identity for adjustment depend on the particular meanings that a child attaches to gender (e.g., the specific attributes the child regards as desirable for each sex); these meanings may vary across and within ethnic/racial groups. Cross-ethnic/racial investigation can aid theory building by pointing to constructs that are neglected in research with a single ethnic/racial group but that are crucial components of basic developmental processes. Copyright 2006 APA, all rights reserved.

[Reference values of energy for the Venezuelan population].

PubMed

Landaeta-Jiménez, Maritza; Aliaga, Carla; Sifontes, Yaritza; Vásquez, Maura; Ramírez, Guillermo; Falque Madrid, Luís; Herrera, Marianella; María Reyes, Ana; Emilia, Elzakem; Herrera, Ctor; Bernal, Jennifer

2013-12-01

The project of updating the Venezuelan energy reference values respond to the recommendations made by an FAO experts committee, several decades ago for the countries assuming this work. Because of the dramatic changes experienced globally regarding energy intake/expenditure and particularly variations on the Venezuelan nutritional scenario with the presence of "the double burden of malnutrition" it a review of Energy Reference Values (VRE) from a more integral approach is pertinent. This report follows the methodology proposed by FAO/WHO/UNU 2004 experts committee and energy reference values were established by group of age and gender, also average energy values for Venezuelan population were obtained. For calculation of these requirements, the energy expenditure was included by taking into account Basal Metabolic Rate and physical activity level for some specific groups. The score average values updated in 2012 of 2.200 kcal/dia reported to be lower than those of 2000 at all ages for masculine gender except for the 16-17 age group and for feminine gender just until ages 10-12 years and from there are slightly above the values obtained in 2000.

Pineal Gland Calcification in Kurdistan: A Cross-Sectional Study of 480 Roentgenograms.

PubMed

Mohammed, Kahee A; Adjei Boakye, Eric; Ismail, Honer A; Geneus, Christian J; Tobo, Betelihem B; Buchanan, Paula M; Zelicoff, Alan P

2016-01-01

The goal of this study was to compare the incidence of Pineal Gland Calcification (PGC) by age group and gender among the populations living in the Kurdistan Region-Iraq. This prospective study examined skull X-rays of 480 patients between the ages of 3 and 89 years who sought care at a large teaching public hospital in Duhok, Iraq from June 2014 to November 2014. Descriptive statistics and a binary logistic regression were used for analysis. The overall incidence rate of PGC among the study population was 26.9% with the 51-60 age group and males having the highest incidence. PGC incidence increased after the first decade and remained steady until the age of 60. Thereafter the incidence began to decrease. Logistic regression analysis revealed that both age and gender significantly affected the risk of PGC. After adjusting for age, males were 1.94 (95% CI, 1.26-2.99) times more likely to have PGC compared to females. In addition, a one year increase in age increases the odds of developing PGC by 1.02 (95% CI, 1.01-1.03) units after controlling for the effects of gender. Our analysis demonstrated a close relationship between PGC and age and gender, supporting a link between the development of PGC and these factors. This study provides a basis for future researchers to further investigate the nature and mechanisms underlying pineal gland calcification.

Psychometric properties of a short form of the Center for Epidemiologic Studies Depression (CES-D-10) scale for screening depressive symptoms in healthy community dwelling older adults.

PubMed

Mohebbi, Mohammadreza; Nguyen, Van; McNeil, John J; Woods, Robyn L; Nelson, Mark R; Shah, Raj C; Storey, Elsdon; Murray, Anne M; Reid, Christopher M; Kirpach, Brenda; Wolfe, Rory; Lockery, Jessica E; Berk, Michael

The 10-item Center for the Epidemiological Studies of Depression Short Form (CES-D-10) is a widely used self-report measure of depression symptomatology. The aim of this study is to investigate the psychometric properties of the CES-D-10 in healthy community dwelling older adults. The sample consists of 19,114 community-based individuals residing in Australia and the United States who participated in the ASPREE trial baseline assessment. All individuals were free of any major illness at the time. We evaluated construct validity by performing confirmatory factor analysis, examined measurement invariance across country and gender followed by evaluating item discrimination bias in age, gender, race, ethnicity and education level, and assessing internal consistency. High item-total correlations and Cronbach's alpha indicated high internal consistency. The factor analyses suggested a unidimensional factor structure. Construct validity was supported in the overall sample, and by country and gender sub-groups. The CES-D-10 was invariant across countries, and although evidence of marginal gender non-invariance was observed there was no evidence of notable gender specific item discrimination bias. No notable differences in discrimination parameters or group membership measurement non-invariance were detected by gender, age, race, ethnicity, and education level. These findings suggest the CES-D-10 is a reliable and valid measure of depression in a volunteer sample. No noteworthy evidence of invariance and/or item discrimination bias is observed across gender, age, race, language and ethnic groups. Copyright © 2017 Elsevier Inc. All rights reserved.

Aging changes and gender differences in response to median nerve stimulation measured with MEG.

PubMed

Stephen, Julia M; Ranken, Doug; Best, Elaine; Adair, John; Knoefel, Janice; Kovacevic, Sanja; Padilla, Denise; Hart, Blaine; Aine, Cheryl J

2006-01-01

The current study uses magnetoencephalography (MEG) to characterize age-related changes and gender differences in the amplitudes and timing of cortical sources evoked by median nerve stimulation. Thirty-four healthy subjects from two age groups: 20-29 and >64 years of age were examined. After measuring the MEG responses, we modeled the data using a spatio-temporal multi-dipole modeling approach to determine the source locations and their associated timecourses. We found early, large amplitude responses in the elderly in primary somatosensory (approximately 20 ms) and pre-central sulcus timecourses (approximately 22 ms) and lower amplitude responses in the elderly later in primary somatosensory (approximately 32 ms) and contralateral secondary somatosensory timecourses (approximately 90 ms). In addition, females had larger peak amplitude responses than males in the contralateral secondary somatosensory timecourse (approximately 28 and 51 ms). These results show that the median nerve stimulation paradigm provides considerable sensitivity to age- and gender-related differences. The results are consistent with the theory that increased amplitudes identified in the elderly may be associated with decreased inhibition. The results emphasize that an examination of two discrete age groups, collapsed across gender, cannot provide a complete understanding of the fundamental changes that occur in the brain across the lifetime.

Implications of gender differences for human health risk assessment and toxicology

EPA Science Inventory

This paper from The Human Health working group of SGOMSEC 16 examines a broad range of issues on gender effects in toxicology. Gender differences in toxicology begin at the gamete and embryo stage, continuing through development and maturation and into old age. Sex influences exp...

Injury patterns among various age and gender groups of trauma patients in southern Iran

PubMed Central

Bolandparvaz, Shahram; Yadollahi, Mahnaz; Abbasi, Hamid Reza; Anvar, Mehrdad

2017-01-01

Abstract Administrative data from trauma referral centers are useful sources while studying epidemiologic aspects of injuries. We aimed to provide a hospital-based view of injuries in Shiraz considering victims’ age and gender, using administrative data from trauma research center. A cross-sectional registry-based study of adult trauma patients (age ≥15 years) sustaining injury through traffic accidents, violence, and unintentional incidents was conducted. Information was retrieved from 3 hospital administrative databases. Data on demographics, injury mechanisms, injured body regions, and injury descriptions; outcomes of hospitalization; and development of nosocomial infections were recorded. Injury Severity Score (ISS) was calculated by crosswalking from ICD-10 (International Classification of Diseases) injury diagnosis codes to AIS-98 (Abbreviated Injury Scale) severity codes. Patients were compared based on age groups and gender differences. A total of 47,295 trauma patients with a median age of 30 (interquartile range: 24–44 years) were studied, of whom 73.1% were male and the remaining 26.9% were female (M/F = 2.7:1.0). The most common injury mechanisms in the male group were car and motorcycle accidents whereas females were mostly victims of falls and pedestrian accidents (P < .01). As age increased, a shift from transportation-related to unintentionally caused injuries occurred. Overall, young men had their most severe injuries on head, whereas elderly women suffered more severe extremity injuries. Injury severity was similar between men and women; however, elderly had a significantly higher ISS. Although incidence of nosocomial infections was independent of victims’ age and gender, elderly men had a significantly higher mortality rate. Based on administrative data from our trauma center, male gender and age >65 years are associated with increased risk of injury incidence, prolonged hospitalizations, and in-hospital death following trauma. Development of a regional trauma surveillance system may provide further opportunities for studying injuries and evaluating preventive actions. PMID:29019874

Injury patterns among various age and gender groups of trauma patients in southern Iran: A cross-sectional study.

PubMed

Bolandparvaz, Shahram; Yadollahi, Mahnaz; Abbasi, Hamid Reza; Anvar, Mehrdad

2017-10-01

Administrative data from trauma referral centers are useful sources while studying epidemiologic aspects of injuries. We aimed to provide a hospital-based view of injuries in Shiraz considering victims' age and gender, using administrative data from trauma research center.A cross-sectional registry-based study of adult trauma patients (age ≥15 years) sustaining injury through traffic accidents, violence, and unintentional incidents was conducted. Information was retrieved from 3 hospital administrative databases. Data on demographics, injury mechanisms, injured body regions, and injury descriptions; outcomes of hospitalization; and development of nosocomial infections were recorded. Injury Severity Score (ISS) was calculated by crosswalking from ICD-10 (International Classification of Diseases) injury diagnosis codes to AIS-98 (Abbreviated Injury Scale) severity codes. Patients were compared based on age groups and gender differences.A total of 47,295 trauma patients with a median age of 30 (interquartile range: 24-44 years) were studied, of whom 73.1% were male and the remaining 26.9% were female (M/F = 2.7:1.0). The most common injury mechanisms in the male group were car and motorcycle accidents whereas females were mostly victims of falls and pedestrian accidents (P < .01). As age increased, a shift from transportation-related to unintentionally caused injuries occurred. Overall, young men had their most severe injuries on head, whereas elderly women suffered more severe extremity injuries. Injury severity was similar between men and women; however, elderly had a significantly higher ISS. Although incidence of nosocomial infections was independent of victims' age and gender, elderly men had a significantly higher mortality rate.Based on administrative data from our trauma center, male gender and age >65 years are associated with increased risk of injury incidence, prolonged hospitalizations, and in-hospital death following trauma. Development of a regional trauma surveillance system may provide further opportunities for studying injuries and evaluating preventive actions.

Psychiatric Comorbidity among Children with Gender Identity Disorder

ERIC Educational Resources Information Center

Wallien, Madeleine S.C.; Swaab, Hanna; Cohen-Kettenis, Peggy T.

2007-01-01

Objective: To investigate the prevalence and type of comorbidity in children with gender identity disorder (GID). Method: The Diagnostic Interview Schedule for Children--Parent Version was used to assess psychopathology according to the DSM in two groups of children. The first group consisted of 120 Dutch children (age range 4-11 years) who were…

Mining of hospital laboratory information systems: a model study defining age- and gender-specific reference intervals and trajectories for plasma creatinine in a pediatric population.

PubMed

Søeby, Karen; Jensen, Peter Bjødstrup; Werge, Thomas; Sørensen, Steen

2015-09-01

The knowledge of physiological fluctuation and variation of even commonly used biochemical quantities in extreme age groups and during development is sparse. This challenges the clinical interpretation and utility of laboratory tests in these age groups. To explore the utility of hospital laboratory data as a source of information, we analyzed enzymatic plasma creatinine as a model analyte in two large pediatric hospital samples. Plasma creatinine measurements from 9700 children aged 0-18 years were obtained from hospital laboratory databases and partitioned into high-resolution gender- and age-groups. Normal probability plots were used to deduce parameters of the normal distributions from healthy creatinine values in the mixed hospital datasets. Furthermore, temporal trajectories were generated from repeated measurements to examine developmental patterns in periods of changing creatinine levels. Creatinine shows great age dependence from birth throughout childhood. We computed and replicated 95% reference intervals in narrow gender and age bins and showed them to be comparable to those determined in healthy population studies. We identified pronounced transitions in creatinine levels at different time points after birth and around the early teens, which challenges the establishment and usefulness of reference intervals in those age groups. The study documents that hospital laboratory data may inform on the developmental aspects of creatinine, on periods with pronounced heterogeneity and valid reference intervals. Furthermore, part of the heterogeneity in creatinine distribution is likely due to differences in biological and chronological age of children and should be considered when using age-specific reference intervals.

Mental Health of Transgender Children Who Are Supported in Their Identities

PubMed Central

Durwood, Lily; DeMeules, Madeleine; McLaughlin, Katie A.

2016-01-01

OBJECTIVE: Transgender children who have socially transitioned, that is, who identify as the gender “opposite” their natal sex and are supported to live openly as that gender, are increasingly visible in society, yet we know nothing about their mental health. Previous work with children with gender identity disorder (GID; now termed gender dysphoria) has found remarkably high rates of anxiety and depression in these children. Here we examine, for the first time, mental health in a sample of socially transitioned transgender children. METHODS: A community-based national sample of transgender, prepubescent children (n = 73, aged 3–12 years), along with control groups of nontransgender children in the same age range (n = 73 age- and gender-matched community controls; n = 49 sibling of transgender participants), were recruited as part of the TransYouth Project. Parents completed anxiety and depression measures. RESULTS: Transgender children showed no elevations in depression and slightly elevated anxiety relative to population averages. They did not differ from the control groups on depression symptoms and had only marginally higher anxiety symptoms. CONCLUSIONS: Socially transitioned transgender children who are supported in their gender identity have developmentally normative levels of depression and only minimal elevations in anxiety, suggesting that psychopathology is not inevitable within this group. Especially striking is the comparison with reports of children with GID; socially transitioned transgender children have notably lower rates of internalizing psychopathology than previously reported among children with GID living as their natal sex. PMID:26921285

Haptic Foot Pedal: Influence of Shoe Type, Age, and Gender on Subjective Pulse Perception.

PubMed

Geitner, Claudia; Birrell, Stewart; Krehl, Claudia; Jennings, Paul

2018-06-01

This study investigates the influence of shoe type (sneakers and safety boots), age, and gender on the perception of haptic pulse feedback provided by a prototype accelerator pedal in a running stationary vehicle. Haptic feedback can be a less distracting alternative to traditionally visual and auditory in-vehicle feedback. However, to be effective, the device delivering the haptic feedback needs to be in contact with the person. Factors such as shoe type vary naturally over the season and could render feedback that is perceived well in one situation, unnoticeable in another. In this study, we evaluate factors that can influence the subjective perception of haptic feedback in a stationary but running car: shoe type, age, and gender. Thirty-six drivers within three age groups (≤39, 40-59, and ≥60) took part. For each haptic feedback, participants rated intensity, urgency, and comfort via a questionnaire. The perception of the haptic feedback is significantly influenced by the interaction between the pulse's duration and force amplitude and the participant's age and gender but not shoe type. The results indicate that it is important to consider different age groups and gender in the evaluation of haptic feedback. Future research might also look into approaches to adapt haptic feedback to the individual driver's preferences. Findings from this study can be applied to the design of an accelerator pedal in a car, for example, for a nonvisual in-vehicle warning, but also to plan user studies with a haptic pedal in general.

Age and gender patterns of thyroid cancer incidence in Ukraine depending on thyroid radiation doses from radioactive iodine exposure after the Chornobyl NPP accident.

PubMed

Fuzik, M M; Prysyazhnyuk, A Y; Shibata, Y; Romanenko, A Y; Fedorenko, Z P; Gudzenko, N A; Gulak, L O; Trotsyuk, N K; Goroh, Y L; Khukhrianska, O M; Sumkina, O V; Saenko, V A; Yamashita, S

2013-01-01

The objective of this study was to investigate the thyroid cancer incidence in a whole territory of Ukraine and to clear up its age and gender patterns depending on average regional (oblast) thyroid doses from radioactive iodine due to the Chornobyl accident. MATERIALS AND METHODS. On the basis of average accumulated thyroid doses from radioactive iodine the geographical regions of Ukraine with low and high average thyroid doses were identified for a comparative analysis performance. Methods of descriptive epidemiology were used. The level and dynamics of thyroid cancer incidence were analyzed in different gender and age groups (both for attained age and age at the moment of the Chornobyl accident). Results of this study confirmed the radiation excess of thyroid cancer in individuals who were children and adolescents in 1986. Some excess was observed in elder age groups too. Especial situation was observed in female age group 40-49 at the moment of the Chornobyl accident i.e. the age-specific thyroid cancer incidence rates were significantly higher in "high exposure" regions comparing with "low exposure" ones during all years of observation within 1989-2009. A probable radiation excess of thyroid cancer was suggested not only in children and adolescents but also in adult age groups. In elder age groups this excess was less expressed and manifested after a longer period of time. The origin of the phenomenon in female age group of 40-49 is unclear now. Hypothesis of combined effect of radiation and natural changing of hormonal status in this age should be checked in the future studies. Fuzik M. M, Prysyazhnyuk A. Ye, Shibata Y., Romanenko A. Yu., Fedorenko Z. P., Gudzenko N. A., Gulak L. O., Trotsyuk N. K., Goroh Ye. L., Khukhrianska O. M., Sumkina O. V., Saenko V. A., Yamashita Sh., 2013.

Explaining IT Professionals' Organizational Commitment Based on Age, Gender, and Personality Trait Factor

ERIC Educational Resources Information Center

Syed, Javaid A.

2017-01-01

The purpose of the present study was to test the Emotional Stability dimension of the Big Five factors of personality traits theory to predict or explain a relationship with Employee Organizational Commitment, when the relationship between Emotional Stability (ES) and Employee Organizational Commitment (EOC) was moderated by Gender and AgeGroup.…

Aging and Psychological Distress: Are There Gender Differences?

ERIC Educational Resources Information Center

Feinson, Marjorie Chary

Although there is consensus in the mental health literature that women report more distress and depressive symptoms than men, it is not clear if this applies to all age groups. To examine the relationship of gender and distress among older adults, two methods were employed. First, a review was conducted of all random community surveys conducted…

The 1991 International Assessment of Educational Progress in Mathematics and Sciences: The Gender Differences Perspective.

ERIC Educational Resources Information Center

Beller, Michal; Gafni, Naomi

1996-01-01

Analysis of data from the 1991 International Assessment of Educational Progress for 34 countries and 3,300 students ages 9 and 13 years in each indicates that gender differences in performance were generally small in mathematics, but were larger for science, with male scores higher in both age groups. (SLD)

The forgotten guidelines: cross-sectional analysis of participation in muscle strengthening and balance & co-ordination activities by adults and older adults in Scotland.

PubMed

Strain, Tessa; Fitzsimons, Claire; Kelly, Paul; Mutrie, Nanette

2016-10-21

In 2011, the UK physical activity guidelines were updated to include recommendations for muscle strengthening and balance & coordination (at least two sessions of relevant activities per week). However, monitoring and policy efforts remain focussed on aerobic activity. This study aimed to assess differences by gender and age in the a) prevalence of muscle strengthening and balance & co-ordination guidelines, and b) participation in guideline-specific activities. The sample for the muscle strengthening analyses was 10,488 adult (16-64 years) and 3857 older adult (≥65 years) 2012-2014 Scottish Health Survey respondents. The balance & co-ordination analyses used only the older adult responses. Differences by gender and (where possible) age in guideline prevalence and activity participation were assessed using logistic regression and t-tests. Thirty-one percent of men and 24 % of women met the muscle strengthening guideline, approximately half that of published figures for aerobic physical activity. Nineteen percent of older men and 12 % of older women met the balance & co-ordination guidelines. The oldest age groups were less likely to meet both guidelines compared to the youngest age groups. Differences by gender were only evident for muscle strengthening: more men met the guidelines than women in all age groups, with the largest difference amongst 16-24 year olds (55 % men compared with 40 % women). Participation in relevant activities differed by gender for both guidelines. 'Workout at gym' was the most popular activity to improve muscle strength for men (18 % participated), while swimming was for women (15 % participated). Golf was the most popular activity to improve balance & co-ordination for older men (11 % participated) and aerobics was for older women (6 % participated). Participation decreased in most muscle strengthening activities for both men and women. One exception was golf, where participation levels were as high amongst older men as in younger age groups, although overall levels were low (3 % of all men). Physical activity policy should aim to increase prevalence of these 'forgotten' guidelines, particularly amongst young women (for muscle strengthening) and older age groups (both guidelines). Gender and age participation differences should be considered when designing population-level interventions.

Validating the Student-Teacher Relationship Scale: testing factor structure and measurement invariance across child gender and age in a Dutch sample.

PubMed

Koomen, Helma M Y; Verschueren, Karine; van Schooten, Erik; Jak, Suzanne; Pianta, Robert C

2012-04-01

The Student-Teacher Relationship Scale (STRS) is widely used to examine teachers' relationships with young students in terms of closeness, conflict, and dependency. This study aimed to verify the dimensional structure of the STRS with confirmatory factor analysis, test its measurement invariance across child gender and age, improve its measurement of the dependency construct, and extend its age range. Teachers completed a slightly adapted STRS for a Dutch sample of 2335 children aged 3 to 12. Overall, the 3-factor model showed an acceptable fit. Results indicated metric invariance across gender and age up to 8years. Scalar invariance generally did not hold. Lack of metric invariance at ages 8 to 12 primarily involved Conflict items, whereas scale differences across gender and age primarily involved Closeness items. The adapted Dependency scale showed strong invariance and higher internal consistencies than the original scale for this Dutch sample. Importantly, the revealed non-invariance for gender and age did not influence mean group comparisons. Copyright © 2011 Society for the Study of School Psychology. Published by Elsevier Ltd. All rights reserved.

Regime and Periphery in Northern Yemen: The Huthi Phenomenon

DTIC Science & Technology

2010-01-01

ENVIRONMENT HEALTH AND HEALTH CARE INTERNATIONAL AFFAIRS NATIONAL SECURITY POPULATION AND AGING PUBLIC SAFETY SCIENCE AND TECHNOLOGY SUBSTANCE ABUSE...31 1.3. Age Groups as...125 A.1. Estimated Population of Yemen Governorates, by Age Groups and Gender . . . 282 A.2. Population and Size of Sa‘da Districts, and

Association between Ambient Air Pollution and Asthma Prevalence in Different Population Groups Residing in Eastern Texas, USA.

PubMed

Gorai, Amit Kr; Tchounwou, Paul B; Tuluri, Francis

2016-03-29

Air pollution has been an on-going research focus due to its detrimental impact on human health. However, its specific effects on asthma prevalence in different age groups, genders and races are not well understood. Thus, the present study was designed to examine the association between selected air pollutants and asthma prevalence in different population groups during 2010 in the eastern part of Texas, USA.The pollutants considered were particulate matter (PM2.5 with an aerodynamic diameter less than 2.5 micrometers) and surface ozone. The population groups were categorized based on age, gender, and race. County-wise asthma hospital discharge data for different age, gender, and racial groups were obtained from Texas Asthma Control Program, Office of Surveillance, Evaluation and Research, Texas Department of State Health Services. The annual means of the air pollutants were obtained from the United States Environmental Protection Agency (U.S. EPA)'s air quality system data mart program. Pearson correlation analyzes were conducted to examine the relationship between the annual mean concentrations of pollutants and asthma discharge rates (ADR) for different age groups, genders, and races. The results reveal that there is no significant association or relationship between ADR and exposure of air pollutants (PM2.5, and O₃). The study results showed a positive correlation between PM2.5 and ADR and a negative correlation between ADR and ozone in most of the cases. These correlations were not statistically significant, and can be better explained by considering the local weather conditions. The research findings facilitate identification of hotspots for controlling the most affected populations from further environmental exposure to air pollution, and for preventing or reducing the health impacts.

Association between Ambient Air Pollution and Asthma Prevalence in Different Population Groups Residing in Eastern Texas, USA

PubMed Central

Gorai, Amit Kr.; Tchounwou, Paul B.; Tuluri, Francis

2016-01-01

Air pollution has been an on-going research focus due to its detrimental impact on human health. However, its specific effects on asthma prevalence in different age groups, genders and races are not well understood. Thus, the present study was designed to examine the association between selected air pollutants and asthma prevalence in different population groups during 2010 in the eastern part of Texas, USA.The pollutants considered were particulate matter (PM2.5 with an aerodynamic diameter less than 2.5 micrometers) and surface ozone. The population groups were categorized based on age, gender, and race. County-wise asthma hospital discharge data for different age, gender, and racial groups were obtained from Texas Asthma Control Program, Office of Surveillance, Evaluation and Research, Texas Department of State Health Services. The annual means of the air pollutants were obtained from the United States Environmental Protection Agency (U.S. EPA)’s air quality system data mart program. Pearson correlation analyzes were conducted to examine the relationship between the annual mean concentrations of pollutants and asthma discharge rates (ADR) for different age groups, genders, and races. The results reveal that there is no significant association or relationship between ADR and exposure of air pollutants (PM2.5, and O3). The study results showed a positive correlation between PM2.5 and ADR and a negative correlation between ADR and ozone in most of the cases. These correlations were not statistically significant, and can be better explained by considering the local weather conditions. The research findings facilitate identification of hotspots for controlling the most affected populations from further environmental exposure to air pollution, and for preventing or reducing the health impacts. PMID:27043587

What vehicle features are considered important when buying an automobile? An examination of driver preferences by age and gender.

PubMed

Vrkljan, Brenda H; Anaby, Dana

2011-02-01

Certain vehicle features can help drivers avoid collisions and/or protect occupants in the event of a crash, and therefore, might play an important role when deciding which vehicle to purchase. The objective of this study was to examine the importance attributed to key vehicle features (including safety) that drivers consider when buying a car and its association with age and gender. A sample of 2,002 Canadian drivers aged 18 years and older completed a survey that asked them to rank the importance of eight vehicle features if they were to purchase a vehicle (storage, mileage, safety, price, comfort, performance, design, and reliability). ANOVA tests were performed to: (a) determine if there were differences in the level of importance between features and; (b) examine the effect of age and gender on the importance attributed to these features. Of the features examined, safety and reliability were the most highly rated in terms of importance, whereas design and performance had the lowest rating. Differences in safety and performance across age groups were dependent on gender. This effect was most evident in the youngest and oldest age groups. Safety and reliability were considered the most important features. Age and gender play a significant role in explaining the importance of certain features. Targeted efforts for translating safety-related information to the youngest and oldest consumers should be emphasized due to their high collision, injury, and fatality rates. Copyright © 2011 National Safety Council and Elsevier Ltd. All rights reserved.

Epidemiology of psoriasis in malaysia: a hospital based study.

PubMed

Sinniah, B; Saraswathy Devi, S; Prashant, B S

2010-06-01

Psoriasis is a complex chronic inflammatory skin disease with a worldwide distribution. To determine the prevalence of psoriasis according to age, gender and ethnicity among outpatients attending the dermatology clinic in Hospital Tengku Ampuan Rahimah, Klang Malaysia. All outpatients attending the specialist clinic of the dermatology department in Hospital Tengku Ampuan Rahimah, Klang, Malaysia from January 2003 to December 2005. This is a retrospective descriptive study of all outpatients who attended the specialist clinic from January 2003 to December 2005 and diagnosed for psoriasis. The study population consisted of patients of all ages, both gender and different ethnic groups (Malay, Chinese, Indians and foreign workers) living in the Klang Valley and the surrounding areas. A total of 5607 patients were examined during a period of three years and 9.5% were found to be suffering with psoriasis. It was more common in males (11.6%) than in females (7.2%). Patients within the 40-60 year age group had the highest (17.2%) rate and were lower in the younger age group including those aged over 60 years (8.1%). With regards to ethnicity, it was more common in Indians followed by Malays, Chinese and migrant foreign workers respectively. The study indicates that psoriasis is common in Malaysia and its distribution varies with age, ethnicity and gender.

The Effect of Habitual Smoking on VO2max

NASA Technical Reports Server (NTRS)

Wier, Larry T.; Suminski, Richard R.; Poston, Walker S.; Randles, Anthony M.; Arenare, Brian; Jackson, Andrew S.

2008-01-01

VO2max is associated with many factors, including age, gender, physical activity, and body composition. It is popularly believed that habitual smoking lowers aerobic fitness. PURPOSE: to determine the effect of habitual smoking on VO2max after controlling for age, gender, activity and BMI. METHODS: 2374 men and 375 women employed at the NASA/Johnson Space Center were measured for VO2max by indirect calorimetry (RER>=1.1), activity by the 11 point (0-10) NASA Physical Activity Status Scale (PASS), BMI and smoking pack-yrs (packs day*y of smoking). Age was recorded in years and gender was coded as M=1, W=0. Pack.y was made a categorical variable consisting of four levels as follows: Never Smoked (0), Light (1-10), Regular (11-20), Heavy (>20). Group differences were verified by ANOVA. A General Linear Models (GLM) was used to develop two models to examine the relationship of smoking behavior on VO2max. GLM #1(without smoking) determined the combined effects of age, gender, PASS and BMI on VO2max. GLM #2 (with smoking) determined the added effects of smoking (pack.y groupings) on VO2max after controlling for age, gender, PASS and BMI. Constant errors (CE) were calculated to compare the accuracy of the two models for estimating the VO2max of the smoking subgroups. RESULTS: ANOVA affirmed the mean VO2max of each pack.y grouping decreased significantly (p<0.01) as the level of smoking exposure increased. GLM #1 showed that age, gender, PASS and BMI were independently related with VO2max (R2 = 0.642, SEE = 4.90, p<0.001). The added pack.y variables in GLM #2 were statistically significant (R2 change = 0.7%, p<0.01). Post hoc analysis showed that compared to Never Smoked, the effects on VO2max from Light and Regular smoking habits were -0.83 and -0.85 ml.kg- 1.min-1 respectively (p<0.05). The effect of Heavy smoking on VO2max was -2.56 ml.kg- 1.min-1 (p<0.001). The CE s of each smoking group in GLM #2 was smaller than the CE s of the smoking group counterparts in GLM #1. CONCLUSIONS: After accounting for the effects of gender, age, PASS and BMI the effect of habitual smoking on reducing VO2max is minimal, about 0.85 ml/kg/min, until the habit exceeds 20 pack.y at which point an additional decrease of 1.71 ml/kg/min is noted. Adding pack.y data improves the accuracy of predicting the VO2max of smokers.

The role of exposure on differences in driver death rates by gender and age: Results of a quasi-induced method on crash data in Spain.

PubMed

Pulido, José; Barrio, Gregorio; Hoyos, Juan; Jiménez-Mejías, Eladio; Martín-Rodríguez, María Del Mar; Houwing, Sjoerd; Lardelli-Claret, Pablo

2016-09-01

Part of the differences by age and gender in driver death rates from traffic injuries depends on the amount of exposure (km/year travelled). Unfortunately, direct indicators of exposure are not available in many countries. Our aim was to compare the age and gender differences in death rates with and without adjustment by exposure using a quasi-induced exposure approach in Spain, during 2004-2012. Crude and adjusted death rate ratios (CDRR and ADRR, respectively) were calculated for each age and gender group. To obtain the latter estimates, in accordance with quasi-exposure reasoning, the number of registered drivers was replaced by the number of non-infractor drivers, passively involved in collisions with another vehicle whose driver committed an infraction. 18-29 years and female drivers were chosen as the reference categories for age and gender. Striking differences were found between CDRR and ADRR estimates. When CDRR were estimated, we found the highest traffic mortality among the youngest drivers, except for females in non-urban roads. ADRR however showed the highest mortality among the oldest groups, especially in females, peaking among drivers >74 years in all types of roads. Regarding differences by gender, both estimates revealed higher traffic mortality in males, although the differences were much smaller when using ADRR. CDRR and ADRR for males tended to converge as age increased. Death risk from traffic injuries among drivers is clearly influenced by the amount of exposure. These findings further emphasize the need to obtain direct traffic exposure estimates by subgroups of drivers. Copyright © 2016 Elsevier Ltd. All rights reserved.

The impact of age and gender on cardiac resynchronization therapy outcome.

PubMed

Zardkoohi, Omeed; Nandigam, Veena; Murray, Lorne; Heist, E Kevin; Mela, Theofanie; Orencole, Mary; Ruskin, Jeremy N; Singh, Jagmeet P

2007-11-01

Cardiac resynchronization therapy (CRT) outcome varies significantly among patients. We aimed to determine the impact of age, gender, and heart failure etiology on the long-term outcome of patients receiving CRT. A total of 117 patients with drug-refractory heart failure, New York Heart Association (NYHA) Class III or IV, and a wide QRS complex, who received CRT, were followed for one year. Long-term outcome was measured as a combined end point of hospitalization for heart failure and/or all cause mortality. Efficacy of CRT was compared between men and women, between older and younger patients, and between patients with ischemic and nonischemic heart disease. Time to the primary end point was estimated by the Kaplan-Meier method and comparisons were made using the Breslow-Wilcoxon test. Baseline clinical characteristics were comparable between gender, age, and heart failure etiology subgroups. There was no significant difference in the combined end point between older versus younger (age >70, (n = 71), versus age < 70, (n = 46), P = 0.52); both genders (men, n = 91 vs women, n = 26, P = 0.46) and etiology of the cardiomyopathy (ischemic (n = 79) vs nonischemic (n = 38), P = 0.12). Substratification of the genders by the etiology of the cardiomyopathy, showed that women with ischemic cardiomyopathy (IW, n = 10) had a trend to a worse outcome compared to the other groups i.e., nonischemic women (NIW, n = 16), ischemic men (IM, n = 69), and nonischemic men (NIM, n = 22), P = 0.04. After adjusting for potential covariates, a Cox regression analysis showed no significant difference between the groups (P = 0.61). CRT outcome appears independent of age, gender, and heart failure etiology in this single institution study.

Decision Tree Analysis of Traditional Risk Factors of Carotid Atherosclerosis and a Cutpoint-Based Prevention Strategy

PubMed Central

Lv, Lihong; Xiao, Yufei; Tu, Jiangfeng; Tao, Lisha; Wu, Jiaqi; Tang, Xiaoxiao; Pan, Wensheng

2014-01-01

Background Reducing the exposure to risk factors for the prevention of cardio-cerebral vascular disease is a crucial issue. Few reports have described practical interventions for preventing cardiovascular disease in different genders and age groups, particularly detailed and specific cutpoint-based prevention strategies. Methods We collected the health examination data of 5822 subjects between 20 and 80 years of age. The administration of medical questionnaires and physical examinations and the measurement of blood pressure, fasting plasma glucose (FPG) and blood lipids [total cholesterol (TC), triglycerides (TG), high density lipoprotein–cholesterol (HDL-C), and low density lipoprotein-cholesterol (LDL-C)] were performed by physicians. Carotid ultrasound was performed to examine the carotid intima-media thickness (CIMT), which was defined as carotid atherosclerosis when CIMT ≥0.9 mm. Decision tree analysis was used to screen for the most important risk factors for carotid atherosclerosis and to identify the relevant cutpoints. Results In the study population, the incidence of carotid atherosclerosis was 12.20% (men: 14.10%, women: 9.20%). The statistical analysis showed significant differences in carotid atherosclerosis incidence between different genders (P<0.0001) and age groups (P<0.001). The decision tree analysis showed that in men, the most important traditional risk factors for carotid atherosclerosis were TC (cutpoint [CP]: 6.31 mmol/L) between the ages of 20–40 and FPG (CP: 5.79 mmol/L) between the ages of 41–59. By comparison, LDL-C (CP: 4.27 mmol/L) became the major risk factor when FPG ≤5.79 mmol/L. FPG (CP: 5.52 mmol/L) and TG (CP: 1.51 mmol/L) were the most important traditional risk factors for women between 20–40 and 41–59 years of age, respectively. Conclusion Traditional risk factors and relevant cutpoints were not identical in different genders and age groups. A specific gender and age group-based cutpoint strategy might contribute to preventing cardiovascular disease. PMID:25398126

Suicide Means among Decedents Aged 50+ Years, 2005-2014: Trends and Associations with Sociodemographic and Precipitating Factors.

PubMed

Choi, Namkee G; DiNitto, Diana M; Marti, C Nathan; Kaplan, Mark S; Conwell, Yeates

2017-12-01

To examine 1) temporal trends between 2005 and 2014 in the three most frequently used suicide means (firearms, hanging/suffocation, alcohol/drug/medicine overdose) by decedents aged 50+ years and 2) associations of suicide means with sociodemographic and precipitating factors. The National Violent Death Reporting System, 2005-2014, provided data (N = 46,857). Suicide means were identified from ICD-10 codes for underlying cause of death and coroner/medical examiner (CME) reports. Precipitating factors are based on either CME or law enforcement report. Age-group (50-64 and 65+ years) and gender-separate logistic regression analyses were used to examine study questions. In the 50-64 years age group, each advancing year (i.e., from 2005 to 2014) was associated with a 1% decrease in the odds of firearm use and a 6% increase in the odds of hanging/suffocation among men; a 9% increase in the odds of hanging/suffocation among women; and a 4% decrease in the odds of overdose among each gender. In the 65+ years age group, each advancing year was associated with a 4% increase in the odds of overdose among men. Physical health was a significant factor for firearm use among men (adjusted odds ratio: 1.47; 95% CI: 1.39-1.55) only. Regardless of gender and age, mental health and substance abuse problems and prior suicide attempts were associated with hanging/suffocation and overdose. Firearm use decreased among men aged 50-64 years between 2005 and 2014, but its use did not change among the other gender by age groups. With rapidly growing numbers of older adults, routine suicide risk assessments, firearm safety monitoring, and interventions to improve quality of life are needed. Copyright © 2017 American Association for Geriatric Psychiatry. Published by Elsevier Inc. All rights reserved.

[Influence of age and gender on plasma norepinephrine changes produced by orthostatic stress].

PubMed

Arata de Bellabarba, G; Molina, C; Dávila Spinetti, D; Villarroel, V; Bellabarba, S A; Torres, A

2001-01-01

The aim of this work was to determine the effect of aging and gender on plasma norepinephrine (NE) response to orthostatic stress. Fifty-six men and sixty women non-smokers, sedentary, non-obese, were studied at supine and standing positions. On the basis of the age of the subjects, they were divided into three groups of either men or women. Group A, young, range 17-34 years, Group B, middle-age, range 40-60 years, and Group C: senescent, range 61-91 years. Senescent subjects had the highest absolute supine values of NE and significant differences between women and men were found in groups B Men: 298 +/- 15 pg/mL; Women: 348 +/- 14 pg/mL), and C (M: 386 +/- 29 pg/mL; W: 473 +/- 19 pg/mL), but not between young (M: 246 +/- 21 pg/mL; W: 261 +/- 18 pg/mL). NE increased markedly in response to the orthostatic stress but the relative (percentage) increases were smaller in the older subjects perhaps related to their elevated baseline levels. The highest percent positive variation was observed in group A (M: 85%; W: 82%). The oldest group (C), had the lowest variation (M: 23%; W: 21%). The relative increases in NE responses were not different in men and women. The orthostatic-induced variation in NE was negatively related to aging in both men and women (M: r = -0.654; p < 0.0001; W: r = -0.557; p < 0.0001). It is concluded that orthostatic stress induced rise of blood NE is attenuated by age but does not appear to be dependent on gender.

Impact of radiation history, gender and age on bone quality in sites for orthodontic skeletal anchorage device placement.

PubMed

Konermann, A; Appel, T; Wenghoefer, M; Sirokay, S; Dirk, C; Jäger, A; Götz, W

2015-05-01

Stability of orthodontic miniscrew implants is prerequisite to their success and durability in orthodontic treatment. As investigations revealed a positive correlation of miniscrew stability to periimplant bone quality, it has been the aim of this study to analyze the bone structure of resection preparations of human mandibles histologically by investigating the samples according to age, gender and exposure to radiotherapy. Inflammation- and tumor-free alveolar bone sections from human mandibles (n = 31) with previously diagnosed carcinoma, chronic osteomyelitis or cysts were analyzed histomorphologically and histomorphometrically as to the dimension of trabeculae in cancellous areas. Group A investigated the impact of a history of radiation therapy, group B of gender and group C contrasted biopsies from individuals aging under 60 or over 60 years. Statistics were performed using the Kruskal-Wallis-test. Radiation, gender and age did not significantly influence bone density. The mean bone density averaged 40.7 ± 15.0% of spongiosa for the total collective with a median age of 58.4 years ± 14.7 years. Our findings provide new information on bone quality, thus contributing to a more precise evaluation of the parameters affecting and those not affecting miniscrew implant stability. On the basis of these results, the formulation of clinical guidelines for risk assessment of therapeutic approaches in patients prior to insertion of orthodontic skeletal anchorage devices seems to be conceivable. Copyright © 2014 Elsevier GmbH. All rights reserved.

Auditory brainstem response in neonates: influence of gender and weight/gestational age ratio

PubMed Central

Angrisani, Rosanna M. Giaffredo; Bautzer, Ana Paula D.; Matas, Carla Gentile; de Azevedo, Marisa Frasson

2013-01-01

OBJECTIVE: To investigate the influence of gender and weight/gestational age ratio on the Auditory Brainstem Response (ABR) in preterm (PT) and term (T) newborns. METHODS: 176 newborns were evaluated by ABR; 88 were preterm infants - 44 females (22 small and 22 appropriate for gestational age) and 44 males (22 small and 22 appropriate for gestational age). The preterm infants were compared to 88 term infants - 44 females (22 small and 22 appropriate for gestational age) and 44 males (22 small and 22 appropriate for gestational age). All newborns had bilateral presence of transient otoacoustic emissions and type A tympanometry. RESULTS: No interaural differences were found. ABR response did not differentiate newborns regarding weight/gestational age in males and females. Term newborn females showed statistically shorter absolute latencies (except on wave I) than males. This finding did not occur in preterm infants, who had longer latencies than term newborns, regardless of gender. CONCLUSIONS: Gender and gestational age influence term infants' ABR, with lower responses in females. The weight/gestational age ratio did not influence ABR response in either groups. PMID:24473955

Look, Mom, I'm a Boy--Don't Tell Anyone I Was a Girl"

ERIC Educational Resources Information Center

Ehrensaft, Diane

2013-01-01

Interventions with a school-aged youth are presented to demonstrate a child's gender transition from female to male with the support of a single mother, grandmother, therapist, pediatric endocrinologist, gender education and advocacy group, and gender-affirming school. This single case study illustrates both the positive psychological effects of…

Gender-Related Processes and Drug Use: Self-Expression with Parents, Peer Group Selection, and Achievement Motivation

ERIC Educational Resources Information Center

Razzino, Brian E.; Ribordy, Sheila C.; Grant, Kathryn; Ferrari, Joseph R.; Bowden, Blake S.; Zeisz, Jennifer

2004-01-01

This investigation examined gender differences in communication with parents, peer group selection, and academic motivation as related to drug use among adolescents (290 girls, 237 boys; age range = 12-19 years). For girls, increased self-expression with parents was associated with greater academic motivation, more academically motivated friends,…

Do gender differences in audio-visual benefit and visual influence in audio-visual speech perception emerge with age?

PubMed Central

Alm, Magnus; Behne, Dawn

2015-01-01

Gender and age have been found to affect adults’ audio-visual (AV) speech perception. However, research on adult aging focuses on adults over 60 years, who have an increasing likelihood for cognitive and sensory decline, which may confound positive effects of age-related AV-experience and its interaction with gender. Observed age and gender differences in AV speech perception may also depend on measurement sensitivity and AV task difficulty. Consequently both AV benefit and visual influence were used to measure visual contribution for gender-balanced groups of young (20–30 years) and middle-aged adults (50–60 years) with task difficulty varied using AV syllables from different talkers in alternative auditory backgrounds. Females had better speech-reading performance than males. Whereas no gender differences in AV benefit or visual influence were observed for young adults, visually influenced responses were significantly greater for middle-aged females than middle-aged males. That speech-reading performance did not influence AV benefit may be explained by visual speech extraction and AV integration constituting independent abilities. Contrastingly, the gender difference in visually influenced responses in middle adulthood may reflect an experience-related shift in females’ general AV perceptual strategy. Although young females’ speech-reading proficiency may not readily contribute to greater visual influence, between young and middle-adulthood recurrent confirmation of the contribution of visual cues induced by speech-reading proficiency may gradually shift females AV perceptual strategy toward more visually dominated responses. PMID:26236274

Comprehensive haematological indices reference intervals for a healthy Omani population: First comprehensive study in Gulf Cooperation Council (GCC) and Middle Eastern countries based on age, gender and ABO blood group comparison.

PubMed

Al-Mawali, Adhra; Pinto, Avinash Daniel; Al-Busaidi, Raiya; Al-Lawati, Rabab H; Morsi, Magdi

2018-01-01

Reference intervals for venous blood parameters differs with age, gender, geographic region, and ethnic groups. Hence local laboratory reference intervals are important to improve the diagnostic accuracy of health assessments and diseases. However, there have been no comprehensive published reference intervals established in Oman, the Gulf Cooperation Council or Middle Eastern countries. Hence, the aim of this study was to establish reference intervals for full blood count in healthy Omani adults. Venous blood specimens were collected from 2202 healthy individuals aged 18 to 69 years from January 2012 to April 2017, and analysed by Sysmex XS-1000i and Cell-Dyn Sapphire automated haematology analysers. Results were statistically analysed and compared by gender, age, and ABO blood group. The lower and upper reference limits of the haematology reference intervals were established at the 2.5th and 97.5th percentiles respectively. Reference intervals were calculated for 17 haematology parameters which included red blood cell, white blood cell, and platelet parameters. Red blood cell (RBC), haemoglobin (HGB), haematocrit (HCT), platelet and platelet haematocrit counts of the healthy donors were significantly different between males and females at all ages (p < 0.05), with males having higher mean values of RBC, HGB and HCT than females. Other complete blood count parameters showed no significant differences between genders, age groups, instruments, or blood groups. Our study showed a lower haemoglobin limit for the normal reference interval in males and females than the currently used in Oman. Data from this study established specific reference intervals which could be considered for general use in Oman. The differences in haematology reference intervals highlights the necessity to establish reference intervals for venous blood parameters among the healthy population in each country or at least in each region.

Normative values for volume and fat content of the hip abductor muscles and their dependence on side, age and gender in a healthy population.

PubMed

Marcon, Magda; Berger, Nicole; Manoliu, Andrei; Fischer, Michael A; Nanz, Daniel; Andreisek, Gustav; Ulbrich, Erika J

2016-04-01

To determine normative values for volume and fat content of the gluteus medius (GMed) and minimus (GMin) muscle in healthy volunteers and to evaluate their dependence on age, gender and leg dominance. The IRB approval was obtained for this study. 80 healthy volunteers (females, 40; males, 40; age range 20-62 years), divided into four age groups, were included. Fat- and water-signal-separated MR images of the pelvis were acquired on a 3.0 T MR with a 3-point mDIXON sequence. Normalized volume and fat-signal fraction (FSF) of the GMed (ViGMed, FSFGMed) and GMin (ViGMin, FSFGMin) muscles were determined. The overall mean volumes (normalized) and FSF ± SD: ViGMed 105.13 ± 16.30 cm(3); ViGMin 30.24 ± 5.15 cm(3); FSFGMed 8.13 ± 1.70 % and FSFGMin 9.89 ± 2.72 %. Comparing different age subgroups within each gender no significant differences were found concerning the volumes and FSFs (except FSFGMin in male subgroup aged 20-29 versus 50-62 years, P = 0.014). Comparing FSFs differences between the two genders, only in 20-29 years subgroup, FSFGMed (P =0.003) and FSFGMin (P =0.002) were greater in female. Volume differences between the two legs were not significant (P > 0.077); FSFGMed and FSFGMin (P =0.005 for both) were significantly lower in the dominant leg in female but not in male group (P = 0.454 for FSFGMed and P = 0.643 for FSFMin). No age dependency was evident for volume normative data for GMed and GMin and normative data for FSF values showed no age- or gender dependency.

Coping strategies: gender differences and development throughout life span.

PubMed

Meléndez, Juan Carlos; Mayordomo, Teresa; Sancho, Patricia; Tomás, José Manuel

2012-11-01

Development during life-span implies to cope with stressful events, and this coping may be done with several strategies. It could be useful to know if these coping strategies differ as a consequence of personal characteristics. This work uses the Coping with Stress Questionnaire with this aim using a sample of 400 participants. Specifically, the effects of gender and age group (young people, middle age and elderly), as well as its interaction on coping strategies is studied. With regard to age, on one hand, it is hypothesised a decrement in the use of coping strategies centred in problem solving and social support seeking as age increases. On the other hand, the use of emotional coping is hypothesised to increase with age. With respect to gender, it is hypothesised a larger use of emotional coping and social support seeking within women, and a larger use of problem solving within men. A MANOVA found significant effects for the two main effects (gender and age) as well as several interactions. Separate ANOVAs allowed us to test for potential differences in each of the coping strategies measured in the CAE. These results partially supported the hypotheses. Results are discussed in relation to scientific literature on coping, age and gender.

MenCare+ in South Africa: Findings from a Gender Transformative Young Men's Group Education on Sexual and Reproductive Health and Rights

ERIC Educational Resources Information Center

Kedde, Harald; Rehse, Kerryn; Nobre, Giovanni; van den Berg, Wessel

2018-01-01

This paper details findings from an evaluation of a gender-transformative sexual and reproductive health and rights group education programme facilitated with young men aged 15-24 years in South Africa. A total of 475 young men participated in the group education programme. A self-administered pre- and post-questionnaire survey was conducted with…

The Effect of 3D-Modeling Training on Students' Spatial Reasoning Relative to Gender and Grade

ERIC Educational Resources Information Center

Šafhalter, Andrej; Vukman, Karin Bakracevic; Glodež, Srecko

2016-01-01

The aim of this research was to establish whether gender and age have an impact on spatial reasoning and its development through the use of 3D modeling. The study was conducted on a sample of 196 children from sixth to ninth grade, of whom 95 represented the experimental group and 101 the control group. The experimental group received 3D modeling…

Using Multiple-hierarchy Stratification and Life Course Approaches to Understand Health Inequalities: The Intersecting Consequences of Race, Gender, SES, and Age.

PubMed

Brown, Tyson H; Richardson, Liana J; Hargrove, Taylor W; Thomas, Courtney S

2016-06-01

This study examines how the intersecting consequences of race-ethnicity, gender, socioeconomics status (SES), and age influence health inequality. We draw on multiple-hierarchy stratification and life course perspectives to address two main research questions. First, does racial-ethnic stratification of health vary by gender and/or SES? More specifically, are the joint health consequences of racial-ethnic, gender, and socioeconomic stratification additive or multiplicative? Second, does this combined inequality in health decrease, remain stable, or increase between middle and late life? We use panel data from the Health and Retirement Study (N = 12,976) to investigate between- and within-group differences in in self-rated health among whites, blacks, and Mexican Americans. Findings indicate that the effects of racial-ethnic, gender, and SES stratification are interactive, resulting in the greatest racial-ethnic inequalities in health among women and those with higher levels of SES. Furthermore, racial-ethnic/gender/SES inequalities in health tend to decline with age. These results are broadly consistent with intersectionality and aging-as-leveler hypotheses. © American Sociological Association 2016.

Using Multiple-hierarchy Stratification and Life Course Approaches to Understand Health Inequalities: The Intersecting Consequences of Race, Gender, SES, and Age

PubMed Central

Brown, Tyson H.; Richardson, Liana J.; Hargrove, Taylor W.; Thomas, Courtney S.

2016-01-01

This study examines how the intersecting consequences of race-ethnicity, gender, socioeconomics status (SES), and age influence health inequality. We draw on multiple-hierarchy stratification and life course perspectives to address two main research questions. First, does racial-ethnic stratification of health vary by gender and/or SES? More specifically, are the joint health consequences of racial-ethnic, gender, and socioeconomic stratification additive or multiplicative? Second, does this combined inequality in health decrease, remain stable, or increase between middle and late life? We use panel data from the Health and Retirement Study (N = 12,976) to investigate between- and within-group differences in in self-rated health among whites, blacks, and Mexican Americans. Findings indicate that the effects of racial-ethnic, gender, and SES stratification are interactive, resulting in the greatest racial-ethnic inequalities in health among women and those with higher levels of SES. Furthermore, racial-ethnic/gender/SES inequalities in health tend to decline with age. These results are broadly consistent with intersectionality and aging-as-leveler hypotheses. PMID:27284076

Asthenopia (eyestrain) in working children of gem-polishing industries.

PubMed

Tiwari, Rajnarayan R; Saha, Asim; Parikh, Jagdish R

2011-04-01

Working children of gem-polishing units are exposed to poor illumination and improper workstations. Also processes require lot of visual and mental concentration for precision. This may result in eyestrain. The study included 432 exposed and 569 comparison group subjects. Self-reported eyestrain was recorded through personal interview. Eyestrain included symptoms like itching, burning, or irritated eyes; tired or heavy eyes; difficulty seeing clearly (including blurred or double vision); and headache. The study variables included age, gender, daily working hours, and duration of exposure. The prevalence of eyestrain in child labourers was 32.2%, which was significantly more than the comparison group subjects. Also, the working children of gem-polishing units were at 1.4 times higher risk of developing eyestrain. Age (3)14 years and female gender were significantly associated with the eyestrain. The prevalence of eyestrain in child labourers was 32.2% and was associated with age (3)14 years and female gender.

Adjustment among Different Age and Ethnic Groups of Indochinese in the United States.

ERIC Educational Resources Information Center

Tran, Thanh V.

1992-01-01

Examined adjustment among different age and ethnic groups of Indochinese refugees in the United States. Findings from national probability sample of 3,414 respondents revealed that education, occupational status, urban/rural location in country of origin, English language ability, financial problems, gender, age, and length of U.S. residence had…

Age- and gender-related variations of emotion recognition in pseudowords and faces.

PubMed

Demenescu, Liliana R; Mathiak, Krystyna A; Mathiak, Klaus

2014-01-01

BACKGROUND/STUDY CONTEXT: The ability to interpret emotionally salient stimuli is an important skill for successful social functioning at any age. The objective of the present study was to disentangle age and gender effects on emotion recognition ability in voices and faces. Three age groups of participants (young, age range: 18-35 years; middle-aged, age range: 36-55 years; and older, age range: 56-75 years) identified basic emotions presented in voices and faces in a forced-choice paradigm. Five emotions (angry, fearful, sad, disgusted, and happy) and a nonemotional category (neutral) were shown as encoded in color photographs of facial expressions and pseudowords spoken in affective prosody. Overall, older participants had a lower accuracy rate in categorizing emotions than young and middle-aged participants. Females performed better than males in recognizing emotions from voices, and this gender difference emerged in middle-aged and older participants. The performance of emotion recognition in faces was significantly correlated with the performance in voices. The current study provides further evidence for a general age and gender effect on emotion recognition; the advantage of females seems to be age- and stimulus modality-dependent.

Is gender more important and meaningful than race? An analysis of racial and gender identity among Black, White, and mixed-race children.

PubMed

Rogers, Leoandra Onnie; Meltzoff, Andrew N

2017-07-01

Social categories shape children's lives in subtle and powerful ways. Although research has assessed children's knowledge of social groups, most prominently race and gender, few studies have examined children's understanding of their own multiple social identities and how they intersect. This paper explores how children evaluate the importance and meaning of their racial and gender identities, and variation in these evaluations based on the child's own age, gender, and race. Participants were 222 Black, White, and Mixed-Race children (girls: n = 136; Mage = 9.94 years). Data were gathered in schools via 1-on-1 semistructured interviews. Analyses focused on specific measures of the importance and meaning of racial and gender identity for children. We found that: (a) children rate gender as a more important identity than race; (b) the meanings children ascribe to gender identity emphasized inequality and group difference whereas the meaning of race emphasized physical appearance and humanism/equality; and (c) children's assessments of importance and meaning varied as a function of child race and gender, but not age. The findings extend research on young children's social identity development and the role of culture and context in children's emerging racial and gender identities. Implications for identity theory and development and intergroup relations are discussed. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

Effects of chronic low back pain, age and gender on vertical spinal creep.

PubMed

Kanlayanaphotporn, R; Trott, P; Williams, M; Fulton, I

2003-05-15

This study investigated the effect of chronic low back pain, age, gender, and time of measurement on the magnitude of vertical spinal creep (VSC) and its recovery. A mixed design, involving three independent variables (chronic low back pain, age, and gender) and one repeated variable (time), was used. One hundred and six subjects of both genders, with and without chronic low back pain, aged between 20 and 60 years, participated in the study. The measurement of VSC and its recovery was performed using a seated stadiometer that allowed continuous measurement of VSC without changing the subject's posture over 25 min. Unloaded VSC was measured during the initial 5 min, followed by 10 min with an additional load of 15% of the subject's body weight and then for a further 10 min after the removal of the load. Subjects were grouped into one of eight categories according to the presence of chronic low back pain, age (20-39 years or 40-60 years) and gender. Repeated measures analysis of variance was computed. A significant increase in VSC with time of measurement was observed (p<0.001). No significant main effects for chronic low back pain, age, or gender were found at any time during the 25-min VSC testing protocol. Significant interactions were found between age and gender during the loaded (p=0.02) and unloaded (p=0.02) phases. A significant interaction was found between chronic low back pain and gender at the end of the unloaded phase (p=0.04). These findings suggest a combined influence of chronic low back pain, age, and gender on VSC and its recovery and that the dominance of each variable changed with the time of the measurement. Thus, subjects who differ in the presence of chronic low back pain, age, and gender should not be combined for statistical analysis of VSC and its recovery.

An evaluation of cause-of-death trends from recent decades based on registered deaths in Turkey.

PubMed

Özdemir, R; Dinç Horasan, G; Rao, C; Sözmen, M K; Ünal, B

2017-10-01

Although cause-of-death analyses are very important to define public health policy priorities and to evaluate health programs, there is very limited knowledge about mortality profiles and trends in Turkey. The aim of this study was to measure the trends in mortality within three broad cause-of-death groups and their distribution by age groups and gender and to describe the changes of leading causes of death between 1980 and 2013 in Turkey. Descriptive study. In the study, data on the number of deaths by year, gender, age and cause was obtained from the Turkish Statistical Institute. The causes of death were classified as group I: communicable, maternal, perinatal, and nutritional conditions; group II: non-communicable diseases (NCDs); and group III: injuries. Unknown or ill-defined causes of death were distributed within group I and group II. The percentage distribution of the cause-of-death groups by gender and age groups between 1980 and 2013 was identified. Age-standardized mortality rates (ASMRs) per 100,000 of broad causes-of-death groups were calculated using European Standard Population 1976 between 1980 and 2008. Changes in mortality rates per hundred were calculated using the formula ([the rate of last year of the period-the rate of the first year of the period]/the rate of the first year of the period). Gender and age-specific data were analyzed using the Joinpoint software to examine trends and significant changes in trends of mortality rates. Crude death rates for group I, group II, and group III were 157.3, 147.2, and 21.4 per 100,000 in 1980 and 35.3, 377.5, and 15.8 in 2008 for males; 161.8, 120.2, and 5.8 in 1980 and 38.6, 318.4, and 6.4 in 2008 for females, respectively. ASMRs for group I, group II, and group III were 146.3, 394.3, and 29.3 per 100,000 in 1980 and 49.7, 723.6, and 18.8 in 2008 for males; 138.0, 291.5, and 7.6 per 100,000 in 1980 and 47.7, 478.8, and 7.2 in 2008 for females, respectively. The mortality rates of group I for almost all age groups particularly below 5 years of age decreased significantly. This study indicates that Turkey is at an advanced stage in the epidemiological transition, with the majority of the causes of death from NCDs. Considering the regional differences, it is necessary to carry out studies on the specific details of epidemiological transition and the social determinants of deaths in Turkey. Copyright © 2017 The Royal Society for Public Health. All rights reserved.

Trends in educational differentials in suicide mortality between 1993-2006 in Korea.

PubMed

Lee, Weon Young; Khang, Young-Ho; Noh, Manegseok; Ryu, Jae-In; Son, Mia; Hong, Yeon-Pyo

2009-08-31

This study aims to examine how inequalities in suicide by education changed during and after macroeconomic restructuring following the economic crisis of 1997 in South Korea. Using Korea's 1995, 2000, and 2005 census data aggregately linked to mortality data (1993-2006), relative and absolute differentials in suicide mortality by education were calculated by gender and age among Korean population aged 35 and over. Average annual suicide mortality rates have steadily increased from 1993-1997 to 2003-2006 in almost all sociodemographic groups stratified by gender, age, and education. Based on the relative index of inequality (RII) and slope index of inequality (SII), educational differentials in suicide mortality generally increased over time in men and women aged 45 years+. Although RII did not increase with year among men and women aged 35 - 44 years, SII showed a significantly increasing trend in this age group. These worsening absolute inequalities in suicide mortality indicate that the governmental suicide prevention policy should be directed toward socially disadvantaged groups of the Korean population.

Developmental Continuity and Stability of Emotional Availability in the Family: Two Ages and Two Genders in Child-Mother Dyads from Two Regions in Three Countries

PubMed Central

Bornstein, Marc H.; Suwalsky, Joan T. D.; Putnick, Diane L.; Gini, Motti; Venuti, Paola; de Falco, Simona; Heslington, Marianne; de Galperín, Celia Zingman

2010-01-01

This study employs an intra-national and cross-national, prospective and longitudinal design to examine age, gender, region, and country variation in group mean-level continuity and individual-differences stability of emotional availability in child-mother dyads. Altogether, 220 Argentine, Italian, and U.S. American metropolitan and rural residence mothers and their daughters and sons were observed at home when children were 5 and 20 months of age. Similar patterns of continuity and discontinuity of emotional availability from 5 to 20 months were observed across regions and countries, but not between genders. Stability of emotional availability from 5 to 20 months was moderate and similar across genders, regions, and countries. Universal and gender-specific developmental processes in child-mother emotional availability as revealed in intra- and cross-national study are discussed. PMID:20824179

Normative static grip strength of population of Turkey, effects of various factors and a comparison with international norms.

PubMed

Ekşioğlu, Mahmut

2016-01-01

Normative data are of importance in ergonomics and clinical settings. Applying normative data internationally is questionable. To this end, this study aimed to establish gender- and age-specific reference values for static (isometric) hand grip strength of normal population of Turkey with special regard to occupational demand, and compare them with the international norms. The secondary aims were to investigate the effects of gender, age-group, weight-group, job-group, hand and several anthropometric variables on static grip strength. A sample of 211 (128 male and 83 female) volunteers aged between 18 and 69 with various occupations participated in the study. Grip strength data were collected using a Jamar dynamometer with standard testing position, protocol and instructions. The mean and std deviation of maximum voluntary static grip strength values (in N) for dominant and non-dominant hands respectively were 455.2 ± 73.6 and 441.5 ± 72.6 for males, and 258 ± 46.1 and 246.2 ± 49.1 for females. The mean female strength was about 57% of the mean male strength value for both dominant and non-dominant hands. There was a curvilinear relationship of grip strength to age, significant differences between genders, hands, and some age-groups, and a correlation to height, body-mass, BMI and hand dimensions depending on the gender. The comparisons with the norms of other world populations indicate that there are cross-national grip strength variations among some nations but not all. Copyright © 2015 Elsevier Ltd and The Ergonomics Society. All rights reserved.

Does the Aging Process Significantly Modify the Mean Heart Rate?

PubMed Central

Santos, Marcos Antonio Almeida; Sousa, Antonio Carlos Sobral; Reis, Francisco Prado; Santos, Thayná Ramos; Lima, Sonia Oliveira; Barreto-Filho, José Augusto

2013-01-01

Background The Mean Heart Rate (MHR) tends to decrease with age. When adjusted for gender and diseases, the magnitude of this effect is unclear. Objective To analyze the MHR in a stratified sample of active and functionally independent individuals. Methods A total of 1,172 patients aged ≥ 40 years underwent Holter monitoring and were stratified by age group: 1 = 40-49, 2 = 50-59, 3 = 60-69, 4 = 70-79, 5 = ≥ 80 years. The MHR was evaluated according to age and gender, adjusted for Hypertension (SAH), dyslipidemia and non-insulin dependent diabetes mellitus (NIDDM). Several models of ANOVA, correlation and linear regression were employed. A two-tailed p value <0.05 was considered significant (95% CI). Results The MHR tended to decrease with the age range: 1 = 77.20 ± 7.10; 2 = 76.66 ± 7.07; 3 = 74.02 ± 7.46; 4 = 72.93 ± 7.35; 5 = 73.41 ± 7.98 (p < 0.001). Women showed a correlation with higher MHR (p <0.001). In the ANOVA and regression models, age and gender were predictors (p < 0.001). However, R2 and ETA2 < 0.10, as well as discrete standardized beta coefficients indicated reduced effect. Dyslipidemia, hypertension and DM did not influence the findings. Conclusion The MHR decreased with age. Women had higher values of MHR, regardless of the age group. Correlations between MHR and age or gender, albeit significant, showed the effect magnitude had little statistical relevance. The prevalence of SAH, dyslipidemia and diabetes mellitus did not influence the results. PMID:24029962

Age- and gender-related characteristics of the pubic symphysis and triradiate cartilage in pediatric computed tomography.

PubMed

Bayer, Jörg; Neubauer, Jakob; Saueressig, Ulrich; Südkamp, Norbert P; Reising, Kilian

2016-11-01

There is little information on the pubic symphysis' normal CT appearance in children. We sought to generate age-, gender- and maturity-related symphyseal width appearances in CT scans. Pelvic CT scans performed for any reason during a 6-year period in patients younger than 18 years were retrospectively analyzed. The symphysis width was measured in the axial plane and the triradiate cartilage was classified as open or closed. Four hundred twenty-seven CT scans were evaluated and 350 remained for analysis. Age- and gender-related measurements of the symphysis width are illustrated on various centile graphs. When grouping children by age in years 0-6, 7-11, 12-15 and 16-17, mean (standard deviation) symphysis width was 5.4 mm (0.9), 5.3 mm (1.1), 4.1 mm (1.1) and 3.5 mm (1.0), respectively, in girls and 5.9 mm (1.3), 5.4 mm (1.2), 5.2 mm (1.1) and 4.0 mm (1.0), respectively, in boys. Boys and girls were significantly different in the age groups 12-15 years (P<0.001) and 16-17 years (P=0.04). In the mature pelvis, the symphyseal gap is significantly (P<0.001) shorter in both genders, and in girls compared to boys (P=0.04). The pubic symphysis width in children differs according to age, gender and maturity. The reference values published herein may help detect symphyseal injury.

Articulation rate across dialect, age, and gender

PubMed Central

Jacewicz, Ewa; Fox, Robert A.; O’Neill, Caitlin; Salmons, Joseph

2009-01-01

The understanding of sociolinguistic variation is growing rapidly, but basic gaps still remain. Whether some languages or dialects are spoken faster or slower than others constitutes such a gap. Speech tempo is interconnected with social, physical and psychological markings of speech. This study examines regional variation in articulation rate and its manifestations across speaker age, gender and speaking situations (reading vs. free conversation). The results of an experimental investigation show that articulation rate differs significantly between two regional varieties of American English examined here. A group of Northern speakers (from Wisconsin) spoke significantly faster than a group of Southern speakers (from North Carolina). With regard to age and gender, young adults read faster than older adults in both regions; in free speech, only Northern young adults spoke faster than older adults. Effects of gender were smaller and less consistent; men generally spoke slightly faster than women. As the body of work on the sociophonetics of American English continues to grow in scope and depth, we argue that it is important to include fundamental phonetic information as part of our catalog of regional differences and patterns of change in American English. PMID:20161445

The effects of dating violence, substance use and risky sexual behavior among a diverse sample of Illinois youth.

PubMed

Alleyne, Binta; Coleman-Cowger, Victoria H; Crown, Laurel; Gibbons, Maya A; Vines, Linda Nicole

2011-02-01

This study examines the relationship between dating violence, forced sexual intercourse (FSI), and four measures of sexual risk taking (i.e., age at first sex, number of recent (within the last three months) sex partners, alcohol/drug use at last sex, and condom use at last sex) among a sample of 1124 ethnically diverse sexually active adolescents in Illinois. Given conflicting reports regarding the role of gender in dating violence, and the dearth of research examining the role of gender in relations between dating violence, sexual violence, and sexual risk taking, we also examine whether gender moderates the relation between these constructs. The findings indicate significant relationships among dating violence and FSI and age at first sex, number of sexual partners, and condom use across various ethnic groups. Findings also show that when controlling for gender, dating violence and FSI are related to number of sexual partners and age at first intercourse regardless of ethnic group identification. Copyright © 2010 The Association for Professionals in Services for Adolescents. Published by Elsevier Ltd. All rights reserved.

Abacavir Pharmacokinetics During Chronic Therapy in HIV-1-Infected Adolescents and Young Adults

PubMed Central

Sleasman, JW; Robbins, BL; Cross, SJ; Lindsey, JC; Kraimer, JM; Heckman, BE; Sprenger, HL; Tustin, NB; Rose, CH; Poston, PA; Neal, EF; Pakes, GE; Nikanjam, M; Capparelli, EV

2009-01-01

The pharmacokinetics of abacavir and its metabolites were investigated in 30 human immunodeficiency virus (HIV)-infected adolescents and young adults 13-25 years of age, equally divided into two groups: <18 years of age and ≥18 years of age. All the subjects received the recommended adult dose of 300 mg twice daily. The area under the plasma concentration-time curve (AUC) and half-life of abacavir did not differ significantly between the age groups or by gender or race, and there were only modest associations of age with apparent abacavir clearance and with volume of distribution. There were no significant correlations of carboxylate or glucuronide metabolite levels with age or gender, although glucuronide AUC was higher in Hispanic subjects than in African-American subjects. Zidovudine and lamivudine concentration profiles were also similar in the two age groups. A novel aspect of the study included an assessment of intracellular carbovir, zidovudine, and lamivudine triphosphate levels, and these were found to be similar in the two age-based groups. Overall, these findings suggest that current recommendations relating to adult dosages are appropriate for adolescents and young adults. PMID:19118380

Influenza Vaccination Coverage and Its Associated Factors among North Korean Defectors Living in the Republic of Korea.

PubMed

Song, In Gyu; Lee, Haewon; Yi, Jinseon; Kim, Min Sun; Park, Sang Min

2015-09-01

This study aimed to examine influenza vaccination coverage of North Korean defectors (NKD) in the Republic of Korea (Korea) and explore the factors affected the vaccination coverage. Total 378 NKD were analyzed. Four Korean control subjects were randomly matched by age and gender from the Korea National Health and Nutrition Examination Survey V (n = 1,500). The adjusted vaccination coverage revealed no statistical difference between the defectors group and indigenous group (29.1% vs. 29.5%, P = 0.915). In the aged under 50 group, the vaccination coverage of NKD was higher than that of Korean natives (37.8% vs. 25.8%, P = 0.016). However in the aged 50 yr and over group, the vaccination coverage of North Korean defectors was lower than that of the natives (28.0% vs. 37.6%, P = 0.189). Even the gap was wider in the aged 65 yr and over group (36.4% vs. 77.8%, P = 0.007). Gender and medical check-up experience within 2 yr showed association with the vaccination coverage of NKD. Influenza vaccination coverage of aged defectors' group (aged 50 yr and over) was lower than indigenous people though overall vaccination coverage was similar. Further efforts to increase influenza vaccination coverage of this group are needed.

Body shape ideals across gender, sexual orientation, socioeconomic status, race, and age in personal advertisements.

PubMed

Epel, E S; Spanakos, A; Kasl-Godley, J; Brownell, K D

1996-04-01

To assess body shape ideals across gender, sexual orientation, race, socio-economic status, and age, An analysis of personal advertisements was conducted across seven different publications which targeted the groups of interest. Women advertised body weight much less often than men, and lesbians reported body shape descriptors significantly less often than heterosexual women. Gay men and African-American men described their body shape significantly more often than did other groups. However, their reported body mass indices (BMI) were significantly different-African-American men reported a higher BMI, and gay men a lower BMI, than Euro-American heterosexual men. Race and sexual orientation may influence the importance of size of body shape ideals for men. For women, however, their advertised weights conformed to the thin ideal across all groups surveyed. Gender roles affecting body shape ideals and mate attraction are discussed.

Voice characteristics of children aged between 6 and 13 years: impact of age, gender, and vocal training.

PubMed

Pribuisiene, Ruta; Uloza, Virgilijus; Kardisiene, Vilija

2011-12-01

To determine impact of age, gender, and vocal training on voice characteristics of children aged 6-13 years. Voice acoustic and phonetogram parameters were determined for the group of 44 singing and 31 non-singing children. No impact of gender and/or age on phonetogram, acoustic voice parameters, and maximum phonation time was detected. Voice ranges of all children represented a pre-pubertal soprano type with a voice range of 22 semitones for non-singing and of 26 semitones for singing individuals. The mean maximum voice intensity was 81 dB. Vocal training had a positive impact on voice intensity parameters in girls. The presented data on average voice characteristics may be applicable in the clinical practice and provide relevant support for voice assessment.

Examining the components of children's peer liking as antecedents of school adjustment.

PubMed

Betts, Lucy R; Rotenberg, Ken J; Trueman, Mark; Stiller, James

2012-06-01

Children's social interactions with their peers influence their psychosocial adjustment; consequently, the relationship between class-wide peer liking, same-gender peer liking, and school adjustment was explored in two age groups. Peer liking was analysed using the social relations model (SRM). In Study 1, 205 children (103 female and 102 male, M(age) = 7.15, SD= 7 months) completed measures of peer liking and school adjustment, and teachers completed the Short-Form Teacher Rating Scale of School Adjustment (Short-Form TRSSA). In Study 2, 197 children (98 female and 90 male, M(age) = 9.87, SD= 5.9 months) completed measures of peer liking and school adjustment. Both studies yielded evidence of reciprocal liking and individual differences in the ratings of liking awarded to, and elicited from, both peer groups. Multigroup path analysis, with groups created according to gender, revealed that elements of liking predicted different aspects of school adjustment with some variation according to age and gender. Together, these findings suggest that the SRM can be used to examine peer liking and underscore the importance of children's peers for school adjustment. © 2011 The British Psychological Society.

The effects of age and gender on sleep EEG power spectral density in the middle years of life (ages 20-60 years old)

NASA Technical Reports Server (NTRS)

Carrier, J.; Land, S.; Buysse, D. J.; Kupfer, D. J.; Monk, T. H.

2001-01-01

The effects of age and gender on sleep EEG power spectral density were assessed in a group of 100 subjects aged 20 to 60 years. We propose a new statistical strategy (mixed-model using fixed-knot regression splines) to analyze quantitative EEG measures. The effect of gender varied according to frequency, but no interactions emerged between age and gender, suggesting that the aging process does not differentially influence men and women. Women had higher power density than men in delta, theta, low alpha, and high spindle frequency range. The effect of age varied according to frequency and across the night. The decrease in power with age was not restricted to slow-wave activity, but also included theta and sigma activity. With increasing age, the attenuation over the night in power density between 1.25 and 8.00 Hz diminished, and the rise in power between 12.25 and 14.00 Hz across the night decreased. Increasing age was associated with higher power in the beta range. These results suggest that increasing age may be related to an attenuation of homeostatic sleep pressure and to an increase in cortical activation during sleep.

Bystander cardiopulmonary resuscitation training experience and self-efficacy of age and gender group: a nationwide community survey.

PubMed

Ro, Young Sun; Shin, Sang Do; Song, Kyoung Jun; Hong, Sung Ok; Kim, Young Taek; Cho, Sung-Il

2016-08-01

We hypothesized that recent hands-on practice for cardiopulmonary resuscitation (CPR) would be strongly associated with a higher likelihood of self-efficacy in bystander CPR among laypersons according to age and gender group. We used the National Korean Community Health Survey database of 228921 representatively sampled responders from 253 counties in 2012. Laypersons who had previous CPR training were eligible. Exposure variables were having had CPR training with hands-on practice session with a manikin (Practical-CPR-Training) and CPR training within the last 2 years (Recent-CPR-Training). Primary outcome was self-efficacy in bystander CPR. Multivariable logistic regression analysis was performed. The final model with an interaction term was evaluated to compare the effects of CPR training across different age and gender groups. Of 62425 eligible respondents who have had CPR training, 20213 (32.4%) had Practical-CPR-Training. Adjusted odds ratios (AORs) for self-efficacy were 4.08 (3.78-4.41) in Practical-CPR-Training, 2.61 (2.50-2.73) in male, 1.26 (1.16-1.36) in good self-rated health, 1.19 (1.10-1.29) in high school graduate, 1.19 (1.01-1.39) in persons living with stroke patients in household, and 1.17 (1.10-1.24) in Recent-CPR-Training. In interaction models, Practical-CPR-Training showed higher self-efficacy in all age and gender groups, whereas Recent-CPR-Training was not associated with better self-efficacy in elderly group, male (AOR, 0.90 [0.69-1.18]) and female (AOR, 0.94 [0.72-1.23]). Self-efficacy in bystander CPR was higher in person with recent CPR training with hands-on practice with a manikin. Copyright © 2015 Elsevier Inc. All rights reserved.

Age- and gender-related hemorheological alterations in intestinal ischemia-reperfusion in the rat.

PubMed

Mester, Anita; Magyar, Zsuzsanna; Molnar, Akos; Somogyi, Viktoria; Tanczos, Bence; Peto, Katalin; Nemeth, Norbert

2018-05-01

Intestinal ischemia-reperfusion (I/R) is a life-threatening clinical disorder. During I/R, the microrheological parameters of blood (red blood cell deformability and aggregation) worsen, which may contribute to microcirculatory deterioration. Age and gender also have a great influence on hemorheological parameters. We aimed to investigate the gender and age-related microrheological alterations during intestinal I/R. After the cannulation of the left femoral artery, median laparotomy was performed in Crl:WI rats under general anesthesia. In the young control animals there were no other interventions (female n = 7; male n = 7). In the young (female n = 7; male n = 7) and older I/R groups (female n = 6; male n = 6), the superior mesenteric artery was clipped for 30 min, and a 120-min reperfusion period was observed afterward. Blood samples were taken before and at the 30-min ischemia, in the 30th, 60th, and 120th min of the reperfusion. Hematological parameters, erythrocyte deformability, and aggregation were determined. Hematocrit increased significantly in the younger female I/R group. Red blood cell count was higher in male and older animals. In case of white blood cell count, male animals had higher values compared with females. Platelet count elevated in the younger male and older female I/R animals. Red blood cell deformability worsened, mainly in the male and older I/R groups. Enhanced erythrocyte aggregation was seen in all groups, being more expressed in the female I/R groups. Microrheological parameters show gender and age-related differences during intestinal I/R. These observations have importance in the planning and evaluation of experimental data. Copyright © 2018 Elsevier Inc. All rights reserved.

Gender and age differences among youth, in utilization of mental health services in the year preceding suicide in Taiwan.

PubMed

Chang, Hsiu-Ju; Lai, Yuen-Liang; Chang, Chia-Ming; Kao, Ching-Chiu; Shyu, Meei-Ling; Lee, Ming-Been

2012-12-01

The primary objective of this study was to explore gender and age differences in the use of medical services during the year preceding suicide. Data were obtained from the mortality dataset of Department of Health and National Health Insurance Database. Included in the sample were 862 persons aged 12-24 years who committed suicide in Taiwan between 2001 and 2004. We compared the records of medical service utilization of adolescents (ages 12-18 years) with young adults (ages 19-24 years). Persons in both age groups contacted general practitioners more often than other types of medical providers in the year preceding suicide, with the exception of the month before suicide. Females made greater use of medical services than males in both age groups. Suicide prevention strategies should increase the emphasis in training non-psychiatric medical practitioners to identify and treat young persons at suicide risk.

[Comparative biochemistry of process of ageing in men and women].

PubMed

Miakotnykh, V S; Berezina, D A; Borovkova, T A; Gavrilov, I V

2014-01-01

In the research of a number of biochemical indicators in 858 men and 899 women aged from 20 till 70 years divided into 6 compared groups depending on age and gender clear distinctions in the dynamics of the components of the lipid status, status of lipid peroxidation and antioxidant activity of the blood system, the content of middlemolecular peptides are revealed. Simultaneous determination of the biological age of the subjects also revealed a distinct gender differencies testifying to lower rate of aging of men, despite the probability of earlier, in comparison with women, development of dislipidemia and atherosclerosis. Association of the received gender distinctions both with changes of level of estrogen in women due to menopause and with the peculiarities of stressful impacts on male and female organism in different age periods is supposed.

Distant but relative: Similarities and differences in gender role beliefs among African American and Vietnamese American women.

PubMed

Abrams, Jasmine A; Javier, Sarah J; Maxwell, Morgan L; Belgrave, Faye Z; Nguyen, Boa Anh

2016-04-01

Research attempting to identify similarities or disentangle differences in ethnic minority gender role beliefs has been largely absent in the literature, and a gap remains for qualitative examinations of such phenomena. The purpose of this study is to fill this gap in the literature by providing a qualitative examination of the differences and similarities of gender role beliefs among African American and Vietnamese American women. Thematic analyses were conducted with data gathered from 8 focus groups with 44 African American women (mean age = 44 years) and 4 focus Groups 47 Vietnamese American women (mean age = 42 years). Women were diverse in generational, religious, and educational backgrounds. Two similar primary themes emerged: (a) women's roles as chief caretakers and (b) women's responsibility to fulfill multiple roles. There were also similar experiences of a need to convey strength and be self-sacrificial. Two distinct differences that emerged from the focus groups were beliefs about interpersonal interactions and perceptions of societal expectations. This study demonstrates that the conceptualization of gender role beliefs, although at times similar, diverges among culturally different groups. To account for these and other culturally nuanced differences, measures of gender role beliefs should be culturally tailored and culturally specific. However, researchers have largely excluded ethnic minority women in the development of the most widely used measures of gender role beliefs in the U.S. The inclusion of diverse women in research will help prevent pitfalls of conflating and ignoring intragroup differences among different groups of marginalized women. (c) 2016 APA, all rights reserved).

Measuring Gender Dysphoria: A Multicenter Examination and Comparison of the Utrecht Gender Dysphoria Scale and the Gender Identity/Gender Dysphoria Questionnaire for Adolescents and Adults.

PubMed

Schneider, Catharina; Cerwenka, Susanne; Nieder, Timo O; Briken, Peer; Cohen-Kettenis, Peggy T; De Cuypere, Griet; Haraldsen, Ira R; Kreukels, Baudewijntje P C; Richter-Appelt, Hertha

2016-04-01

This study examined two instruments measuring gender dysphoria within the multicenter study of the European Network for the Investigation of Gender Incongruence (ENIGI). The Utrecht Gender Dysphoria Scale (UGDS) and the Gender Identity/Gender Dysphoria Questionnaire for Adolescents and Adults (GIDYQ-AA) were examined for their definitions of gender dysphoria and their psychometric properties, and evaluated for their congruence in assessing the construct. The sample of 318 participants consisted of 178 male-to-females (MtF) and 140 female-to-males (FtM) who were recruited from the four ENIGI gender clinics. Both instruments were significantly correlated in the group of MtFs. For the FtM group, there was a trend in the same direction but smaller. Gender dysphoria was found to be defined differently in the two instruments, which led to slightly different findings regarding the subgroups. The UGDS detected a difference between the subgroups of early and late onset of gender identity disorder in the group of MtFs, whereas the GIDYQ-AA did not. For the FtM group, no significant effect of age of onset was found. Therefore, both instruments seem to capture not only similar but also different aspects of gender dysphoria. The UGDS focusses on bodily aspects, gender identity, and gender role, while the GIDYQ-AA addresses subjective, somatic, social, and sociolegal aspects. For future research, consistency in theory and definition of gender dysphoria is needed and should be in line with the DSM-5 diagnosis of gender dysphoria in adolescents and adults.

Influence of mandatory generic substitution on pharmaceutical sales patterns: a national study over five years.

PubMed

Andersson, Karolina A; Petzold, Max G; Allebeck, Peter; Carlsten, Anders

2008-02-29

Mandatory generic substitution was introduced in Sweden in October 2002 in order to try to curb escalating pharmaceutical expenditure. The aim of this study was to investigate how sales patterns for substitutable and non-substitutable pharmaceuticals have developed since the introduction of mandatory generic substitution; furthermore, to compare sales patterns in different groups of the population, based on patients' age and gender. Five therapeutic groups comprising both substitutable and non-substitutable pharmaceuticals were included. The study period was from January 2000 to June 2005. National sales data were used, covering volumes of dispensed prescription medicines (expressed in defined daily doses per 1000 inhabitants and day) of each pharmacological substance in the therapeutic groups for each age and gender group. Sales patterns for substitutable and non-substitutable pharmaceuticals were compared using a descriptive approach. In most therapeutic groups there has been an increase in the volumes of substitutable pharmaceuticals sold since the introduction of the reform, ranging from one third to three times the initial volume; whereas the volumes of non-substitutable pharmaceuticals have levelled out or declined. There were few gender differences in sales patterns of substitutable and non-substitutable drugs. In three therapeutic groups, sales patterns differed across different age groups, and there was a tendency for volumes of recently introduced non-substitutable pharmaceuticals to be proportionally higher in the youngest age groups. Since the introduction of the reform, there has been a proportionally larger increase in sales of substitutable pharmaceuticals compared with sales of non-substitutable pharmaceuticals. This indicates that the reform might have contributed to larger sales of less expensive pharmaceuticals.

Generational Differences in Internalized Transnegativity and Psychological Distress Among Feminine Spectrum Transgender People.

PubMed

Jackman, Kasey B; Dolezal, Curtis; Bockting, Walter O

2018-01-01

This study examined internalized transnegativity and psychological distress in two age groups of transgender individuals who identified their gender identity on the feminine spectrum (rather than congruent with their male sex assigned at birth). Due to greater visibility and acceptance of gender diversity in the United States, we hypothesized that internalized transnegativity would be lower in the younger compared with the older group, and that the younger generation would, therefore, report lower levels of psychological distress than the older generation. The study sample consisted of trans-feminine individuals (N = 440) who completed a online survey of the U.S. transgender population and comprised a younger group aged 18-24 years (n = 133) and an older group aged 40 years and older (n = 307). Internalized transnegativity was assessed using the Transgender Identity Survey, and psychological distress was assessed with the Brief Symptom Inventory 18. We used regression and mediation analysis to examine differences between the two groups. Contrary to our expectations, the older group reported significantly lower levels of both internalized transnegativity and psychological distress compared with the younger group. Internalized transnegativity partially mediated the relationship between age group and psychological distress. Despite greater visibility of transgender people and increasing acceptance of gender diversity in the United States, the younger trans-feminine individuals reported more psychological distress than the older transfeminine individuals, which was, in part, related to internalized transnegativity. Trans-feminine individuals may benefit from culturally sensitive and clinically competent mental health services to alleviate internalized transnegativity and psychological distress.

Generational Differences in Internalized Transnegativity and Psychological Distress Among Feminine Spectrum Transgender People

PubMed Central

Dolezal, Curtis; Bockting, Walter O.

2018-01-01

Abstract Purpose: This study examined internalized transnegativity and psychological distress in two age groups of transgender individuals who identified their gender identity on the feminine spectrum (rather than congruent with their male sex assigned at birth). Due to greater visibility and acceptance of gender diversity in the United States, we hypothesized that internalized transnegativity would be lower in the younger compared with the older group, and that the younger generation would, therefore, report lower levels of psychological distress than the older generation. Methods: The study sample consisted of trans-feminine individuals (N = 440) who completed a online survey of the U.S. transgender population and comprised a younger group aged 18–24 years (n = 133) and an older group aged 40 years and older (n = 307). Internalized transnegativity was assessed using the Transgender Identity Survey, and psychological distress was assessed with the Brief Symptom Inventory 18. We used regression and mediation analysis to examine differences between the two groups. Results: Contrary to our expectations, the older group reported significantly lower levels of both internalized transnegativity and psychological distress compared with the younger group. Internalized transnegativity partially mediated the relationship between age group and psychological distress. Conclusion: Despite greater visibility of transgender people and increasing acceptance of gender diversity in the United States, the younger trans-feminine individuals reported more psychological distress than the older transfeminine individuals, which was, in part, related to internalized transnegativity. Trans-feminine individuals may benefit from culturally sensitive and clinically competent mental health services to alleviate internalized transnegativity and psychological distress. PMID:29099335

The Opinions and Attitudes of the Foreign Language Learners and Teachers Related to the Traditional and Digital Games: Age and Gender Differences

ERIC Educational Resources Information Center

Uzun, Levent; Ekin, M. Tugba Yildiz; Kartal, Erdogan

2013-01-01

The present study aimed at investigating the differences between the teachers and the "new generation" of learners, their opinions about which language skills would benefit more from games, and the nuances of the two genders (male and female), while also revealing the profiles and tendencies of different age groups in relation to their…

Fatal accident distribution by age, gender and head injury, and death probability at accident scene in Mashhad, Iran, 2006-2009.

PubMed

Zangooei Dovom, Hossein; Shafahi, Yousef; Zangooei Dovom, Mehdi

2013-01-01

Several studies have investigated road traffic deaths, but few have compared by road user type. Iran, with an estimated 44 road traffic deaths per 100,000 population in 2002 had higher road traffic deaths than any other country for which reliable estimates can be made. So, the present study was conducted on road death data and identified fatal accident distribution by age, gender and head injury as well as the influences of age and gender on deaths at accident scenes for all road user groups. Data used in this study are on fatal road accidents recorded by forensic medicine experts of the Khorasan Razavi province in Mashhad, the capital of the province, the second largest city and the largest place of pilgrimage, immigration and tourism in Iran. Chi-square test and odds ratio were used to identify the relation of death place with age and gender in 2495 fatal road accidents from 2006 to 2009. The t-test and analysis of variance were employed for continues variable, age, to compare males' and females' mean age for all road user categories. For two genders, all three groups of fatalities (pedestrian, motorcyclist and motor vehicle occupant) had a peak at the ages of 21-30. The youngest were male motorcyclists (mean age = 28). Old pedestrians were included in road deaths very much, too. Male/female overall ratio was 3.41 and the highest male/female ratio was related to motorcyclists (14). The overall ratio of head injury to other organ injuries (torso and underbody) was 2.51 and pedestrians had the largest amount of head injury (38.2%). Regarding death at accident scene, for all road users, gender did not have any significant relation with death at the scene (P-value > 0.1); on the contrary, age had significant relation (P-value < 0.05). Females were more vulnerable at accident scenes (male/female ratio at accident sense < 1). Pedestrians aged 21-30, motorcyclists 41-50 and motor vehicle occupants 31-40 died the most at accident scenes. Identifying the most endangered groups of road accident fatalities, which was conducted in this study, is invaluable for the appropriate design of prevention strategies and allocation of financial resources for each group of road user fatalities - since in developing nations, there are insufficient financial resources to traffic safety and we should consider superiorities, i.e. the most risky groups. Steps which may contribute to safety promotion for local conditions include suitable facilities for old pedestrians, a training course before obtaining motorcycle license for motorcyclists, informing young road users by provincial media about death risk of road users and improving management of the head-injured patients. Finally, suggestions for future researches were made.

Development of Gender Typicality and Felt Pressure in European French and North African French Adolescents.

PubMed

Hoffman, Adam J; Dumas, Florence; Loose, Florence; Smeding, Annique; Kurtz-Costes, Beth; Régner, Isabelle

2017-11-14

Trajectories of gender identity were examined from Grade 6 (M age  = 11.9 years) to Grade 9 in European French (n = 570) and North African French (n = 534) adolescents, and gender and ethnic group differences were assessed in these trajectories. In Grade 6, boys of both ethnic groups reported higher levels of gender typicality and felt pressure for gender conformity than girls. European French girls and boys and North African French girls reported decreasing gender typicality from Grade 6 to Grade 9, whereas North African French boys did not change. Felt pressure decreased among girls, did not change in European French boys, and increased in North African French boys. Ethnic and gender differences in gender identity development are discussed. © 2017 The Authors. Child Development © 2017 Society for Research in Child Development, Inc.

Knowledge, attitudes and behaviour of Greek adults towards salt consumption: a Hellenic Food Authority project.

PubMed

Marakis, Georgios; Tsigarida, Eirini; Mila, Spyridoula; Panagiotakos, Demosthenes B

2014-08-01

To investigate the knowledge, attitudes and behaviour of Greek adults towards salt as well as their differences with respect to gender, age and level of education. Cross-sectional, observational survey. Voluntary participation to a telephone interview, using a seventeen-item questionnaire. Greek adults aged over 25 years (n 3609), nationally representative according to age, gender and geographical distribution of the Greek population, were interviewed. More women of all age groups compared with men reported adding salt during cooking (P < 0·001), while less reported adding salt on the plate (P < 0·001). Also, more women believed that salt added during cooking was the main source of salt in the diet (P < 0·001). Participants aged 25-34, 35-44 and 45-54 years old had better knowledge of the harmful effects of salt on health compared with the 55+ years age group (P = 0·002, P = 0·001, P < 0·001, respectively); respondents in the aforementioned age groups also knew that children should consume less salt than adults compared with 55+ years age group (P = 0·004, P < 0·001, P < 0·001, respectively). Respondents with secondary and higher educational status were more likely to avoid consumption of processed foods (P < 0·001) and to check the nutrition information on food packaging as compared with respondents having basic education status (P < 0·001). Awareness needs to be raised regarding salt recommendations for adults and children, sources of sodium in the diet and adding less salt during cooking, as well as reading food labels. Future campaigns for salt reduction should consider gender, age and level of education differences regarding knowledge, attitudes and behaviour towards salt.

Pedestrian crossing behavior, an observational study in the city of Ushuaia, Argentina.

PubMed

Poó, Fernando Martín; Ledesma, Ruben Daniel; Trujillo, Roberto

2018-04-03

Pedestrian crashes are a critical problem in Latin American countries. However, little research has been published about pedestrians and even less about their behaviors in a naturalistic context. The objective of the present research was to explore risky pedestrian crossing behaviors in traffic intersections in an argentine city (Ushuaia). It is focused in different stages of the crossing process, traffic code violations, and other potentially risky behaviors such as distractions. A high frequency of risky behaviors among pedestrians was expected. Moreover, according to previous findings, it was hypothesized that men and younger pedestrians would show riskier behaviors. Participants were 802 pedestrians (53.9% females) observed at several intersections (with and without traffic lights) in the city of Ushuaia. Behaviors were codified following a standardized observation protocol. Observers documented information on behavior previous to, during, and after crossing. Gender and age were also registered. Data were gathered through video recording. Frequency analyses of observed behaviors were conducted for the total sample, as well as by gender and by age group. A general crossing risk index was calculated to facilitate comparisons between the genders and age groups. We conducted an analysis of variance to evaluate gender and age differences for this index. A high proportion of risky behaviors were observed among pedestrians. The majority of pedestrian waited in the street (as opposed to on the sidewalk) before crossing, did not comply with traffic lights, or crossed outside the crosswalk. A large number of pedestrians were distracted while crossing. Men presented higher scores on risky behaviors than women. No differences were observed by age group. The high level of risk behaviors during the different stages of street crossing is worrisome and reinforces the idea that pedestrians are responsible for many of the conflicts with motorists. Many of the risky behaviors seem to be associated with gender, which is in line with the previous literature showing more risk behaviors among men than among women. No differences were found for age group. Findings are interpreted considering some features of the Argentine road culture.

Gender differences in cognitive development.

PubMed

Ardila, Alfredo; Rosselli, Monica; Matute, Esmeralda; Inozemtseva, Olga

2011-07-01

The potential effect of gender on intellectual abilities remains controversial. The purpose of this research was to analyze gender differences in cognitive test performance among children from continuous age groups. For this purpose, the normative data from 7 domains of the newly developed neuropsychological test battery, the Evaluación Neuropsicológica Infantil [Child Neuropsychological Assessment] (Matute, Rosselli, Ardila, & Ostrosky-Solis, 2007), were analyzed. The sample included 788 monolingual children (350 boys, 438 girls) ages 5 to 16 years from Mexico and Colombia. Gender differences were observed in oral language (language expression and language comprehension), spatial abilities (recognition of pictures seen from different angles), and visual (Object Integration Test) and tactile perceptual tasks, with boys outperforming girls in most cases, except for the tactile tasks. Gender accounted for only a very small percentage of the variance (1%-3%). Gender x Age interactions were observed for the tactile tasks only. It was concluded that gender differences during cognitive development are minimal, appear in only a small number of tests, and account for only a low percentage of the score variance. PsycINFO Database Record (c) 2011 APA, all rights reserved

Racial/Ethnic and gender prevalences in reported common pains in a national sample.

PubMed

Plesh, Octavia; Adams, Sally H; Gansky, Stuart A

2011-01-01

To compare prevalences of self-reported temporomandibular joint and muscle disorders (TMJMD)-type pain, headaches, and neck and back pains in the 2000 to 2005 US National Health Interview Survey (NHIS) by gender and age for non-Hispanic Whites (Whites), Hispanics, and non-Hispanic Blacks (Blacks). Data from the 2000 to 2005 NHIS included information on gender, age, race, ethnicity, and different common types of pain specifically: TMJMD-type pain, severe headaches/migraine, neck, and low back pains. A total of 189,992 people were included: 52% female and 48% male, 73% White, 12% Hispanic, 11% Black, and 4% "Other." The overall prevalence of TMJMD-type pain was 4.6%; severe headaches/migraine was 15.4%; neck, 14.9%; and low back, 28.0%. Survey logistic regression models estimating race-specific, age-adjusted curves revealed race by age pain differences. For TMJMD-type pain, White females presented the highest prevalence at younger ages, decreasing after age 40. Prevalences for Hispanic and Black females, although lower at younger ages, increased up to age 60 and remained higher than Whites. Males showed less racial/ethnic and age variation. Severe headaches/migraines presented an age pattern similar to TMJMD-type pain for White females and little overall variation for males, but without racial differences. Neck pain showed some similarities to TMJMD-type pain: higher in Whites at younger ages, lower at older ages, with Hispanics having the highest rates after their 60's. For low back pain, the rates peaked around the sixth decade for all racial/ethnic groups. The patterns of TMJMD-type pain varied greatly within and across racial/ethnic groups by gender and across the adult lifespan. Similarities and differences for the other pains were noted.

Gender typicality in children's speech: A comparison of boys with and without gender identity disorder.

PubMed

Munson, Benjamin; Crocker, Laura; Pierrehumbert, Janet B; Owen-Anderson, Allison; Zucker, Kenneth J

2015-04-01

This study examined whether boys with gender identity disorder (GID) produced less prototypically male speech than control boys without GID, a possibility that has been suggested by clinical observations. Two groups of listeners participated in tasks where they rated the gender typicality of single words (group 1) or sentences (group 2) produced by 15 5-13 year old boys with GID and 15 age-matched boys without GID. Detailed acoustic analyses of the stimuli were also conducted. Boys with GID were rated as less boy-like than boys without GID. In the experiment using sentence stimuli, these group differences were larger than in the experiment using single-word stimuli. Listeners' ratings were predicted by a variety of acoustic parameters, including ones that differ between the two groups and ones that are stereotypically associated with adult men's and women's speech. Future research should examine how these variants are acquired.

Gender stereotypes in occupational choice: a cross-sectional study on a group of Italian adolescents

PubMed Central

Ramaci, Tiziana; Pellerone, Monica; Ledda, Caterina; Presti, Giovambattista; Squatrito, Valeria; Rapisarda, Venerando

2017-01-01

Background Gender beliefs represent cultural schemas for interpreting or making sense of the social and employment world, as they can influence attitudes, career aspirations, and the vocational decision process of young people, especially the adolescence. Materials and methods This study examined the influence of gender stereotypes on the choice of career in adolescents. A group of 120 students were recruited to complete an ad hoc questionnaire, Scale of Perceived Occupational Self-Efficacy, and Semantic Differentials. The objectives of the study were to analyze the relationship between occupational self-efficacy and professional preference; to measure the influence of independent variables, such as age and gender, on the representation that students have of themselves and of the profession; and to identify the predictor variables of self-efficacy in the vocational decision. Results Data showed that the distance between professional identity and social identity increases with age. Results underline that males seem to perceive themselves more self-efficient in military, scientific–technological, and agrarian professions than females. Furthermore, the type of job performed by parents appears to be a self-efficacy predictor variable in the choice of professions in the services area. Conclusion Individuals’ perceived occupational self-efficacy, gender, age, and parents’ profession have implications for exploratory behavior. The conditions that make gender differences salient are more likely to favor self-representations of the career and consistent assessments with these representations. PMID:28458587

Gender stereotypes in occupational choice: a cross-sectional study on a group of Italian adolescents.

PubMed

Ramaci, Tiziana; Pellerone, Monica; Ledda, Caterina; Presti, Giovambattista; Squatrito, Valeria; Rapisarda, Venerando

2017-01-01

Gender beliefs represent cultural schemas for interpreting or making sense of the social and employment world, as they can influence attitudes, career aspirations, and the vocational decision process of young people, especially the adolescence. This study examined the influence of gender stereotypes on the choice of career in adolescents. A group of 120 students were recruited to complete an ad hoc questionnaire, Scale of Perceived Occupational Self-Efficacy, and Semantic Differentials. The objectives of the study were to analyze the relationship between occupational self-efficacy and professional preference; to measure the influence of independent variables, such as age and gender, on the representation that students have of themselves and of the profession; and to identify the predictor variables of self-efficacy in the vocational decision. Data showed that the distance between professional identity and social identity increases with age. Results underline that males seem to perceive themselves more self-efficient in military, scientific-technological, and agrarian professions than females. Furthermore, the type of job performed by parents appears to be a self-efficacy predictor variable in the choice of professions in the services area. Individuals' perceived occupational self-efficacy, gender, age, and parents' profession have implications for exploratory behavior. The conditions that make gender differences salient are more likely to favor self-representations of the career and consistent assessments with these representations.

Homophily, Close Friendship, and Life Satisfaction among Gay, Lesbian, Heterosexual, and Bisexual Men and Women

PubMed Central

Gillespie, Brian Joseph; Frederick, David; Harari, Lexi; Grov, Christian

2015-01-01

Friends play important roles throughout our lives by providing expressive, instrumental, and companionate support. We examined sexual orientation, gender, and age differences in the number of friends people can rely on for expressive, instrumental, and companionate support. Additionally, we examined the extent to which people relied on same-gender versus cross-gender friends for these types of support. Participants (N = 25,185) completed a survey via a popular news website. Sexual orientation differences in number of same-gender and cross-gender friends were generally small or non-existent, and satisfaction with friends was equally important to overall life satisfaction for all groups. However, the extent to which people’s friendship patterns demonstrated gender-based homophily varied by sexual orientation, gender, and age. Young adult gay and bisexual men, and to some extent bisexual women and older bisexual men, did not conform to gendered expectations that people affiliate primarily with their own gender. PMID:26087008

Decreasing the overall environmental impact of the Dutch diet: how to find healthy and sustainable diets with limited changes.

PubMed

Kramer, Gerard Fh; Tyszler, Marcelo; Veer, Pieter Van't; Blonk, Hans

2017-06-01

To find diets optimised on nutrition and environmental impact close to the current Dutch diet and to identify the most effective and acceptable options for mitigating environmental impact. Linear programming was used to optimise diets of Dutch men and women aged 9-69 years, divided into ten age-gender groups. The analysis included nutrient composition, a metric for popularity and life cycle assessments of 207 food products. Greenhouse gas emissions, fossil energy use and land occupation were used to calculate a weighted score for the overall environmental impact. Optimised diets were solutions that minimised changes to the current diet while satisfying all nutritional constraints, with stepwise reductions in environmental impact. The Netherlands. Dutch children and adults aged 9-69 years. Meat was always reduced. Vegetable, fruit and dairy contents remained similar, while bread, fatty fish and legumes increased. The extent of changes depended on age and gender. Beverages were not heavily reduced. Nutrients critical for the outcome were α-linoleic acid, retinol, Ca, Na, Se, dietary fibre, SFA, thiamin and Fe (women of childbearing age). Total protein, essential amino acids and carbohydrates were not critical. Reducing meat is the most effective option for lowering the environmental impact of diets in all age-gender groups. Reducing alcoholic and non-alcoholic beverages is another option. Leaving out fish and dairy products are not. The differences in nutritional requirements related to age and gender have a significant effect on the composition of the optimised diets.

Perceptions of gender and tuberculosis in a south Indian urban community.

PubMed

Ganapathy, Sudha; Thomas, Beena E; Jawahar, M S; Selvi, K Josephine Arockia; Sivasubramaniam; Weiss, Mitchell

2008-01-01

The Revised National Tuberculosis Control Programme (RNTCP) in India advocating Directly Observed Treatment-Short course (DOTS) detects nearly three times more male than female TB patients. The reasons for this difference are unclear. An understanding of the community's health beliefs, perceptions on the disease and behaviour towards TB patients may throw some light on this issue. A qualitative study using focus group discussions was conducted among men and women of younger and older age groups from lower income neighbourhoods. The information obtained was grouped into themes which included, understanding of TB, vulnerability, access to health care and social responses. Gender differences in community perceptions on TB seem to be critical in issues related to marriage. The stigma of TB is more visible in women than men when it comes to marriage. Men and children were perceived to get preferential attention by their families during illness. While the younger age group, irrespective of gender, accessed care from private providers, the older group preferred a government facility. Awareness of TB was acceptable but it seemed more associated as a respiratory disease and the common symptom associated with TB was cough. This study highlights the need for gender specific intervention strategies to enhance better access of TB services.

Gender ratio in a clinical population sample, age of diagnosis and duration of assessment in children and adults with autism spectrum disorder.

PubMed

Rutherford, Marion; McKenzie, Karen; Johnson, Tess; Catchpole, Ciara; O'Hare, Anne; McClure, Iain; Forsyth, Kirsty; McCartney, Deborah; Murray, Aja

2016-07-01

This article reports on gender ratio, age of diagnosis and the duration of assessment procedures in autism spectrum disorder diagnosis in a national study which included all types of clinical services for children and adults. Findings are reported from a retrospective case note analysis undertaken with a representative sample of 150 Scottish children and adults recently diagnosed with autism spectrum disorder. The study reports key findings that the gender ratio in this consecutively referred cohort is lower than anticipated in some age groups and reduces with increasing age. The gender ratio in children, together with the significant difference in the mean age of referral and diagnosis for girls compared to boys, adds evidence of delayed recognition of autism spectrum disorder in younger girls. There was no significant difference in duration of assessment for males and females suggesting that delays in diagnosis of females occur prior to referral for assessment. Implications for practice and research are considered. © The Author(s) 2016.

Cross-sectional growth changes in skeletal and soft tissue cephalometric landmarks of children.

PubMed

Inada, Emi; Saitoh, Issei; Hayasaki, Haruaki; Yamada, Chiaki; Iwase, Yoko; Takemoto, Yoshihiko; Matsumoto, Yuko; Yamasaki, Youichi

2008-07-01

In order to provide standard values for craniofacial growth of normal children, we evaluated the growth changes of skeletal and soft tissue cephalometric landmarks from lateral cephalograms of 180 Japanese children. They were divided into three groups: primary dentition, mixed dentition, and permanent dentition. Specific skeletal angles and distances showed significant gender differences with increasing age. The only significant soft tissue gender difference was nose height in the oldest group. Upper pharynx dimension and nose height differed significantly among the groups in both genders. Positions of both the upper and lower lip changed significantly between the intermediate and oldest groups of both genders. Nasolabial angle did not change significantly with growth. The results of this study should be useful for predicting craniofacial growth and development or determining the effect of orthodontic treatment.

Differences in Activities of Daily Living Performance Between Long-Term Pediatric Sarcoma Survivors and a Matched Comparison Group on Standardized Testing

PubMed Central

Parks, Rebecca; Rasch, Elizabeth K.; Mansky, Patrick J.; Oakley, Frances

2009-01-01

BACKGROUND: In a cross-sectional study examining late effects of pediatric sarcoma therapy, long-term survivors were evaluated on their activities of daily living (ADL) performance. PROCEDURE: Thirty-two persons with Ewing sarcoma family of tumors, rhabdomyosarcoma, and non-rhabdomysarcoma-soft tissue sarcoma enrolled an average of 17 years after treatment. Participants were evaluated using the Assessment of Motor and Process Skills (AMPS) [1], a standardized observational evaluation of ADL task performance. Means and 95% confidence intervals for ADL motor and ADL process ability measures were calculated for four groups: 1) sarcoma survivors, 2) “well” adults matched for age and gender, 3) “well” adults matched for gender that were 10 years older; and 4) “well” adults matched for gender that were 20 years older. RESULTS: ADL motor ability was significantly lower for sarcoma survivors than for the age and gender matched comparison group (p<0.05). There was no significant difference between ADL motor ability of sarcoma survivors and the comparison group 10 years older, but sarcoma survivors had significantly better ADL motor ability (p<0.05) than the oldest comparison group (20 years older). Sarcoma survivors had significantly worse ADL process ability than the age matched group (p<0.05). There was no difference in ADL process ability between the sarcoma survivors and comparison groups that were 10 and 20 years older. CONCLUSIONS: This first report of a clinical evaluation of ADL limitation in pediatric sarcoma survivors treated with intensive multimodal cancer therapy suggests that influences on performance of daily life activities are more common than previously reported. PMID:19533662

Refractive errors characteristic of the patients at the Children’s Ophthalmology Outpatient Department of Kauno klinikos Hospital (Lithuanian University of Health Sciences) from 1 January 2012 to 31 December 2012

PubMed Central

Čiumbaraitė, Rasa; Liutkevičienė, Rasa

2017-01-01

Background. The purpose of our study was to assess the distribution and patterns of refractive errors in children for the proper planning of paediatric eye care at the centre. Material and methods. The study was conducted in the hospital of the Lithuanian University of Health Sciences in Kaunas, from 1 January 2012 to 31 December 2012. During this period, a total of 11,406 children, aged 0–18 years, were evaluated at the outpatient department of paediatric ophthalmology, Kauno klinikos, the Lithuanian University of Health Sciences. All the children underwent a complete ophthalmic examination with cycloplegic refraction. Results. Myopia increased from 1.5% (95% CI:1.2, 1.8) in the age group of 0–1 to 44.7% (95% CI:43.46, 45.94) in the age group of 14–18 (p < 0.001). Myopia was associated with older age, female gender (20.3%; 95% CI:19.3, 21.3; p < 0.001). Hypermetropia decreased from 84.6% (95% CI:83.7, 85.5) in the cohort of 0–1 to 11.4% (95% CI: 10.61, 12.19) in the 14–18 age group (p < 0.001). Hypermetropia was associated with younger age, male gender (43.4%; 95% CI:42.16, 44.64; p < 0.001), preterm birth (56.1%; 95% CI:54.86, 57.34; 43.4%; p < 0.001), low birth weight (61.8%; 95% CI:60.59, 63.01; p < 0.001), and birth by Caesarean section (57.1%; 95% CI: 55.87; 58.33) (p < 0.001). The prevalence of astigmatism was 25.5% (95% CI: 24.41; 26.59) (p < 0.001). Astigmatism was associated with female gender (20.1%; 95%. CI: 19.1; 21.1) and too big pregnancy weight (22.1%.; 95%. CI: 21.06; 23.14) (p < 0.001). Conclusions. Of the 14–18 age group, 44.7% of the patients were myopic. Of the 0–1 age group, 84.6% were hypermetropic. Astigmatism was detected in about 25.5% of children. The prevalence of refractive errors was associated with age, gender, gestation age, gestation weight, and parental refractive error. PMID:28845125

Gender differences in vocational rehabilitation service predictors of successful competitive employment for transition-aged individuals with autism.

PubMed

Sung, Connie; Sánchez, Jennifer; Kuo, Hung-Jen; Wang, Chia-Chiang; Leahy, Michael J

2015-10-01

As males and females with autism spectrum disorder (ASD) experience different symptomology, their needs for vocational rehabilitation (VR) are unique as they transition into adulthood. This study examined the effects of gender differences in VR service predictors on employment outcomes for transition-aged individuals with ASD. A total of 1696 individuals (857 males and 839 females) were analyzed from a sample of RSA-911 data of FY 2011. Hierarchical logistic regression analyses were conducted. Results revealed both gender-independent VR service predictors (with job placement and on-the-job supports more beneficial for both genders) and gender-specific predictors of employment (with counseling and guidance, job search assistance, and other services more beneficial for the male group). This study provides support for individualized gender-specific VR services for people with ASD.

Level of emotional awareness in the general French population: effects of gender, age, and education level.

PubMed

Nandrino, Jean-Louis; Baracca, Margaret; Antoine, Pascal; Paget, Virginie; Bydlowski, Sarah; Carton, Solange

2013-01-01

The Levels of Emotional Awareness Scale (LEAS) developed by Lane et al. (1990) measures the ability of a subject to discriminate his or her own emotional state and that of others. The scale is based on a cognitive-developmental model in which emotional awareness increases in a similar fashion to intellectual functions. Because studies performed using North American and German populations have demonstrated an effect of age, gender, and level of education on the ability to differentiate emotional states, our study attempts to evaluate whether these factors have the same effects in a general French population. 750 volunteers (506 female, 244 male), who were recruited from three regions of France (Lille, Montpellier, Paris), completed the LEAS. The sample was divided into five age groups and three education levels. The results of the LEAS scores for self and others and the total score showed a difference in the level of emotional awareness for different age groups, by gender and education level. A higher emotional level was observed for younger age groups, suggesting that emotional awareness depends on the cultural context and generational societal teachings. Additionally, the level of emotional awareness was higher in women than in men and lower in individuals with less education. This result might be explained by an educational bias linked to gender and higher education whereby expressive ability is reinforced. In addition, given the high degree of variability in previously observed scores in the French population, we propose a standard based on our French sample.

Gender attribution and gender agreement in French Williams syndrome.

PubMed

Boloh, Yves; Ibernon, Laure; Royer, Stéphanie; Escudier, Frédérique; Danillon, Aurélia

2009-01-01

Previous studies on grammatical gender in French individuals with Williams syndrome (WS) have led to conflicting findings and interpretations regarding keys abilities--gender attribution and gender agreement. New production data from a larger WS sample (N=24) showed that gender attribution scores in WS participants exactly mirrored those of controls: all groups overwhelmingly relied on the masculine as the default gender. WS participants' agreement scores were far lower than those of CA-controls though not significantly below those of MA-controls. They also did not improve with age, which might suggest a permanent disability in this area.

Correlation between fetal mild ventriculomegaly and biometric parameters.

PubMed

Fishel-Bartal, Michal; Shai, Daniel; Shina, Avi; Achiron, Reuven; Katorza, Eldad

2017-09-19

The aim of this study was to assess the correlation between fetal lateral ventricle width and biometric measurements. A prospective study on 335 fetuses, 101 fetuses with isolated mild ventriculomegaly and a control group of 234 fetuses with a normal US examination. All fetuses underwent a detailed brain ultrasound scan and a full biometric evaluation. To further compare biometric parameters, we matched, according to gestational week and gender, 91 fetuses from the study group to 91 fetuses from the control group. The mean gestational week during the exam was significantly different between the groups (29.6 weeks in the study group versus 28.3 in the control group, p = .001). The mean maternal age, obstetrical history, mode of conception, or fetal gender did not differ between the groups. After matching according to gestational age and fetal gender, the mean gestational week between the matched groups did not differ and was 29 + 5 weeks in both groups. The study group had significantly larger head circumference (p = .009), biparietal diameter (p < .001), femur length (p = .023), and estimated fetal weight (p = .024) compared with the control group. Isolated mild ventriculomegaly could be related to other larger fetal biometric measurements and does not necessarily mean a pathological condition.

Relationships among age, gender, anthropometric characteristics, and dynamic balance in children 5 to 12 years old.

PubMed

Butz, Sarah M; Sweeney, Jane K; Roberts, Pamela L; Rauh, Mitchell J

2015-01-01

To examine relationships among age, gender, anthropometrics, and dynamic balance. Height, weight, and arm and foot length were measured in 160 children with typical development aged 5 to 12 years. Dynamic balance was assessed using the Timed Up and Go (TUG) test, Pediatric Reach Test (PRT), and Pediatric Balance Scale (PBS). Moderate to good positive relationships (r = 0.61 and r = 0.56) were found between increasing age and PRT and PBS scores. A fair negative relationship (r = -0.49) was observed between age and TUG test. No significant gender-by-age group difference was observed. Age had the strongest influence on TUG and PBS scores; arm length had the strongest influence on PRT scores. Dynamic balance ability is directly related to chronological age. Age and arm length have the strongest relationships with balance scores. These findings may assist pediatric therapists in selecting dynamic balance tests according to age rather than specific diagnosis.

Gender differences in quality of life and functional disability for depression outpatients with or without residual symptoms after acute phase treatment in China.

PubMed

Zhao, Na; Wang, Xiaohong; Wu, Wenyuan; Hu, Yongdong; Niu, Yajuan; Wang, Xueyi; Gao, Chengge; Zhang, Ning; Fang, Yiru; Huang, Jizhong; Liu, Tiebang; Jia, Fujun; Zhu, Xuequan; Hu, Jian; Wang, Gang

2017-09-01

Depression is associated with substantial personal suffering and reduced quality of life and functioning. The aim of this study was to investigate gender differences on quality of life and functional impairment of outpatients with depression after acute phase treatment. 1503 depression outpatients were recruited from eleven hospitals in China. Subjects were evaluated with sociodemographic characteristics, history and self-report instruments, related to severity of symptoms, function and quality of life. All data were analyzed to determine the gender differences. Men had a younger age at onset and the first onset age, higher education compared to women in total patients and with or without residual symptoms group. Using regression analysis, it was found that gender was significantly statistically related to severity scores of SDS and had no correlation with Q-LES-Q-SF total scores. In the residual symptoms group, greater functional impairment was noted by men in the area of work and social life. Significant gender differences of mood, work and sexual life in quality of life were observed. This is a cross-sectional study of depressed outpatients and duration of acute phase treatment may not an adequate time to measure changes. Depression appears to affect men more seriously than women after acute phase treatment. Men had a younger age at onset and the first onset age, higher education, more functional impairment and lower satisfaction of quality of life in mood, work and sexual life. Gender differences affect acute treatment, remission and recovery. Copyright © 2017 Elsevier B.V. All rights reserved.

Gender and Age Differences in Short- and Long-Term Outcomes Following Primary Percutaneous Coronary Intervention for ST-Elevation Myocardial Infarction.

PubMed

Chua, Su-Kiat; Shyu, Kou-Gi; Hung, Huei-Fong; Cheng, Jun-Jack; Lo, Huey-Ming; Liu, Shih-Chi; Chen, Lung-Ching; Chiu, Chiung-Zuan; Chang, Che-Ming; Lin, Shen-Chang; Liou, Jer-Young; Lee, Shih-Huang

2014-07-01

Studies have reported that women with ST elevation myocardial infarction (STEMI) have worse short- and long-term outcomes than men. It has not yet been confirmed whether these differences reflect differences in age between men and women. We retrospectively enrolled 1035 consecutive STEMI patients treated with primary percutaneous coronary intervention (PCI). Baseline clinical characteristics, coronary anatomy, and outcome were compared between young (< 65 years old) and older patients (≥ 65 years old) of both sexes. Younger women presented with a lower incidence of typical angina (83% vs. 93%, p = 0.03), single-vessel disease (21% vs. 35%, p = 0.03), and total occlusion of infarct-related artery (65% vs. 83%, p = 0.001) than younger men, with no gender difference noted in the older group. Younger women in the study had a higher incidence of reinfarction, heart failure requiring admission, or mortality (23% vs. 6%, p < 0.001) during follow-up, compared with younger men, with no gender difference in the older group. Using the Kaplan-Meier analysis, younger women had lower rates of event-free survival (p < 0.001 by log-rank test) than younger men, with no gender difference in the older group. In multivariate analysis, age could predict long-term outcome in men (Hazard ratio 4.43, 95% confidence interval: 2.89-6.78, p < 0.001) but not in women. In STEMI patients receiving primary PCI, sex-related long-term outcome differences were age-dependent, with younger women likely to have a worse long-term outcome when compared with younger men. Coronary heart disease; Gender; Myocardial infarction.

Gender trouble: The World Health Organization, the International Statistical Classification of Diseases and Related Health Problems (ICD)-11 and the trans kids.

PubMed

Winter, Sam

2017-10-01

The World Health Organization (WHO) is revising its diagnostic manual, the International Statistical Classification of Diseases and Related Health Problems (ICD). At the time of writing, and based on recommendations from its ICD Working Group on Sexual Disorders and Sexual Health, WHO is proposing a new ICD chapter titled Conditions Related to Sexual Health, and that the gender incongruence diagnoses (replacements for the gender identity disorder diagnoses used in ICD-10) should be placed in that chapter. WHO is proposing that there should be a Gender incongruence of childhood (GIC) diagnosis for children below the age of puberty. This last proposal has come under fire. Trans community groups, as well as many healthcare professionals and others working for transgender health and wellbeing, have criticised the proposal on the grounds that the pathologisation of gender diversity at such a young age is inappropriate, unnecessary, harmful and inconsistent with WHO's approach in regard to other aspects of development in childhood and youth. Counter proposals have been offered that do not pathologise gender diversity and instead make use of Z codes to frame and document any contacts that young gender diverse children may have with health services. The author draws on his involvement in the ICD revision process, both as a member of the aforementioned WHO Working Group and as one of its critics, to put the case against the GIC proposal, and to recommend an alternative approach for ICD in addressing the needs of gender diverse children.

Diabetes mellitus and sensorineural hearing loss: is there an association? Baseline of the Brazilian Longitudinal Study of Adult Health (ELSA-Brasil).

PubMed

Samelli, Alessandra G; Santos, Itamar S; Moreira, Renata R; Rabelo, Camila M; Rolim, Laurie P; Bensenõr, Isabela J; Lotufo, Paulo A

2017-01-01

Although several studies have investigated the effects of diabetes on hearing loss, the relationship between these two conditions remains unclear. Some studies have suggested that diabetes may cause sensorineural hearing loss, whereas others have failed to find an association. The biggest challenge in investigating the association between diabetes and hearing loss is the presence of confounding variables and the complexity of the auditory system. Our study investigated the association between diabetes and sensorineural hearing loss. We evaluated the influence of time from diabetes diagnosis on this association after controlling for age, gender, and hypertension diagnosis and excluding those subjects with exposure to noise. This cross-sectional study evaluated 901 adult and elderly Brazilian Longitudinal Study of Adult Health (ELSA-Brasil) participants from São Paulo, Brazil who underwent audiometry testing as part of ELSA-Brasil's baseline assessment. Hearing thresholds and speech test results were significantly worse in the group with diabetes than in the group without diabetes. However, no significant differences were found between participants with and without diabetes after adjusting for age, gender, and the presence of hypertension. Hearing thresholds were not affected by occupational noise exposure in the groups with and without diabetes. In addition, no association between the duration of diabetes and hearing thresholds was observed after adjusting for age, gender, and hypertension. We found no association between the duration of diabetes and worse hearing thresholds after models were adjusted for age, gender, and the presence of hypertension.

The Process of Integration of Newcomers at School: Students and Gender Networking during School Recess

ERIC Educational Resources Information Center

Rodriguez-Navarro, Henar; García-Monge, Alfonso; Rubio-Campos, Maria del Carmen

2014-01-01

This article examines the data obtained through a year-long ethnographic study of students from a Spanish primary school, and sheds light on their use of gender code networks during school recess. The results of this analysis confirm the conclusions on student interaction drawn by other studies (group segregation regarding age and gender and,…

"Girls Don't Play Soccer": Children Policing Gender on the Playground in a Township Primary School in South Africa

ERIC Educational Resources Information Center

Mayeza, Emmanuel

2017-01-01

This paper is based on an ethnographic study conducted between 2012 and 2014 with a group of 64 boys and girls aged 6-10, all attending the same township primary school in South Africa. The paper explores how the young children construct gender "boundaries" and "police" gender "transgressions" on the school playground…

Development of inhibitory control among prenatally cocaine exposed and non-cocaine exposed youths from late childhood to early adolescence: The effects of gender and risk and subsequent aggressive behavior.

PubMed

Bridgett, David J; Mayes, Linda C

2011-01-01

The goal of the present investigation was to characterize the development of inhibitory control, an aspect of executive functions, in a sample of prenatally cocaine exposed (CE; n=165) children compared to an at risk, but prenatally cocaine unexposed (NCE; n=119) sample across time (i.e. 7.5 to 11.5 years of age). Gender and cumulative risk, a combination of postnatal medical (i.e. low birth weight and APGAR scores) and demographic risk, indexed by maternal educational attainment, were examined as predictors of change in inhibitory control across time and aggression was modeled as an outcome when children reached 14 years of age. Multiple group latent growth models indicated that CE children made more errors at 7.5 years of age during a standard Stroop interference task, however, over time CE children had greater age-related improvements, narrowing the initial gap, with NCE children in the ability to inhibit errors. Gender effects at 7.5 years within the NCE group were identified with NCE boys making initially more errors than NCE girls; both NCE and CE girls improved faster across development compared to NCE and CE boys, respectively. Greater cumulative risk was associated with more errors at 7.5 years in the CE and NCE groups. No differences were observed between CE and NCE children on time to complete the Stroop task at 7.5 years. However, NCE children had greater age-related improvements in their time to complete the Stroop interference task relative to their CE counterparts. NCE girls improved the fastest over time relative to NCE boys; a similar trend emerged (p<0.10) with CE girls improving faster over time than CE boys. Although all participants improved across development, higher cumulative risk in both groups was associated with slower age-related improvements (i.e. higher slopes) in the time to complete the Stroop task across development. After accounting for gender and cumulative risk, findings in both groups indicated that those who made more errors at 7.5 years of age and/or who had slower age-related changes (i.e. higher slopes) of time to complete the Stroop task across development were more aggressive as rated by caregivers at 14 years of age. Although qualified by gender and cumulative risk, these findings are consistent with reduced cognitive processing efficiency and executive function difficulties in CE children relative to NCE children. Findings suggest that executive function difficulties in CE children may be subtle as development continues to unfold over time. Furthermore, these findings indicate that development of inhibitory control may be an important mechanism linking prenatal cocaine exposure, gender, and cumulative risk to later adverse outcomes. Copyright © 2010 Elsevier Inc. All rights reserved.

The effect of obesity and gender on body segment parameters in older adults

PubMed Central

Chambers, April J.; Sukits, Alison L.; McCrory, Jean L.; Cham, Rakié

2010-01-01

Background Anthropometry is a necessary aspect of aging-related research, especially in biomechanics and injury prevention. Little information is available on inertial parameters in the geriatric population that account for gender and obesity effects. The goal of this study was to report body segment parameters in adults aged 65 years and older, and to investigate the impact of aging, gender and obesity. Methods Eighty-three healthy old (65–75 yrs) and elderly (>75 yrs) adults were recruited to represent a range of body types. Participants underwent a whole body dual energy x-ray absorptiometry scan. Analysis was limited to segment mass, length, longitudinal center of mass position, and frontal plane radius of gyration. A mixed-linear regression model was performed using gender, obesity, age group and two-way and three-way interactions (α=0.05). Findings Mass distribution varied with obesity and gender. Males had greater trunk and upper extremity mass while females had a higher lower extremity mass. In general, obese elderly adults had significantly greater trunk segment mass with less thigh and shank segment mass than all others. Gender and obesity effects were found in center of mass and radius of gyration. Non-obese individuals possessed a more distal thigh and shank center of mass than obese. Interestingly, females had more distal trunk center of mass than males. Interpretation Age, obesity and gender have a significant impact on segment mass, center of mass and radius of gyration in old and elderly adults. This study underlines the need to consider age, obesity and gender when utilizing anthropometric data sets. PMID:20005028

Gender differences in alcohol consumption among middle-aged and older adults in Australia, the United States and Korea.

PubMed

French, Davina J; Sargent-Cox, Kerry A; Kim, Sarang; Anstey, Kaarin J

2014-08-01

To compare gender differences in alcohol use and the socioeconomic correlates of at-risk drinking among middle-aged and older adults in Australia, the United States (US) and South Korea. Data were drawn from large nationally representative surveys of people aged 45 years and older, collected in 2006. Rates of any drinking and at-risk drinking (>14 US standard drinks/week) were higher for males than females in all countries and these gender differences were largest in Korea. Socioeconomic differentials for at-risk drinking varied by country and gender. In the US, at-risk drinking was associated with lower educational levels among men, but higher educational levels among women; in Korea, it was associated with being unpartnered, particularly for women; and in Australia, at-risk drinking was associated with higher income. Gender-role expectations differ between countries and may influence both the levels at which older adults consume alcohol and the ways in which at-risk drinking is associated with socioeconomic factors. Heavy alcohol use in middle-aged and older adults is a cause for concern. Health promotion strategies should target older age groups and consider the ways in which gender, marital status and education influence norms and opportunities for risky alcohol use. © 2014 Public Health Association of Australia.

Children's reasoning about gender-atypical preferences in different settings.

PubMed

Conry-Murray, Clare

2013-05-01

Two age groups of children, 5- and 6-year-olds (n=30) and 8- and 9-year-olds (n=26), made judgments about which of two items a character should choose: a gender-typical item or a gender-atypical item that was preferred by the character. Judgments were made about situations where the character was (a) in a familiar public setting and (b) in a country where the reversed preference was typical for that culture. At both ages and in both settings, a majority of responses endorsed the character's atypical preference. However, at both ages, endorsements of the atypical preferences were significantly less frequent in the familiar public setting that in the norm-reversed setting, and justifications indicated that there would be social consequences for defying gender norms in the familiar setting. Copyright © 2012 Elsevier Inc. All rights reserved.

[Socioeconomic inequalities and age and gender differences in cardiovascular risk factors].

PubMed

López-González, Ángel A; Bennasar-Veny, Miquel; Tauler, Pedro; Aguilo, Antoni; Tomàs-Salvà, Matias; Yáñez, Aina

2015-01-01

To describe the cardiovascular risk factors in a working population in the Balearic Islands and to examine whether differences by social class vary according to age and gender. A cross-sectional study was carried out in a sample of active workers aged 20-65 years in the Balearic Islands. The participants were included in the study during their annual work health assessment in 2011. The following variables were collected: occupation, social class, age, gender, height, weight, smoking, blood pressure, lipid profile, and glucose levels. Cardiovascular risk was calculated using two different equations (Framingham and REGICOR). Differences by social class were observed for most cardiovascular risk factors. The pattern of these differences differed depending on age group and gender. Differences in obesity by social class increased with age in women but decreased in men. More differences in hypertension by social class were found among women than among men, with differences increasing with age in both genders. Significant differences by social class were found among women in lipid profile, and these differences increased with age, mainly for low levels of high-density lipoprotein-cholesterol. Inequalities in cardiovascular risk factors by social class were higher among women than among men. Some cardiovascular risk factors such as smoking and obesity showed significant inequalities from a very early age. Copyright © 2014 SESPAS. Published by Elsevier Espana. All rights reserved.

Gender Constancy and the Effects of Sex-typed Televised Toy Commercials.

ERIC Educational Resources Information Center

Ruble, Diane N.; And Others

1981-01-01

Presents a cognitive-developmental analysis of the effects of televised, sex-stereotypic information on children's behavior and attitudes towards toy play. Subjects were 100 children, ages four to six divided into groups exhibiting high and low gender-constancy. (Author/CM)

Children's exposure to violent political conflict stimulates aggression at peers by increasing emotional distress, aggressive script rehearsal, and normative beliefs favoring aggression.

PubMed

Huesmann, L Rowell; Dubow, Eric F; Boxer, Paul; Landau, Simha F; Gvirsman, Shira Dvir; Shikaki, Khalil

2017-02-01

We examine the hypothesis that children's exposure to ethnic-political conflict and violence over the course of a year stimulates their increased aggression toward their own in-group peers in subsequent years. In addition, we examine what social cognitive and emotional processes mediate these effects and how these effects are moderated by gender, age, and ethnic group. To accomplish these aims, we collected three waves of data from 901 Israeli and 600 Palestinian youths (three age cohorts: 8, 11, and 14 years old) and their parents at 1-year intervals. Exposure to ethnic-political violence was correlated with aggression at in-group peers among all age cohorts. Using a cross-lagged structural equation model from Year 1 to Year 3, we found that the relation between exposure and aggression is more plausibly due to exposure to ethnic-political violence stimulating later aggression at peers than vice versa, and this effect was not moderated significantly by gender, age cohort, or ethnic group. Using three-wave structural equation models, we then showed that this effect was significantly mediated by changes in normative beliefs about aggression, aggressive script rehearsal, and emotional distress produced by the exposure. Again the best fitting model did not allow for moderation by gender, age cohort, or ethnic group. The findings are consistent with recent theorizing that exposure to violence leads to changes both in emotional processes promoting aggression and in the acquisition through observational learning of social cognitions promoting aggression.

Application of a Brazilian test of expressive vocabulary in European Portuguese children.

PubMed

Cáceres-Assenço, Ana Manhani; Ferreira, Sandra Cristina Araújo; Santos, Anabela Cruz; Befi-Lopes, Debora Maria

2018-01-01

Objective to investigate the performance of European Portuguese children in a Brazilian test of expressive vocabulary, seeking to identify differences between age groups and gender, and to verify its applicability in this population. Methods the sample consisted of 150 typical developed children, of both genders, between the ages of 5 and 6. All children attended public schools in the north area of Portugal. To assess the semantic performance, the expressive vocabulary sub-test of the language test (ABFW) was used, considering the percentage of usual verbal assignments and the classification (adequate/inadequate) according to the Brazilian reference values. Results the performance of the European Portuguese children indicated that at age 6 they have a higher percentage of correct answers in expressive vocabulary. As for the gender, there were only occasional differences: the girls showed a greater dominance in the semantic fields of clothing (both ages) and furniture and utensils (at age 5), whereas the boys showed more dominance in the semantic field means of transportation (6 years). Regarding classification, there was no difference between age groups in overall performance. Only the semantic field shapes and colors had more individuals of 6 years with inadequate performance. Conclusion the reference values adopted in the Brazilian population for semantic performance indicated that more than 80% of the children of each age group could have their performance classified as adequate. Such evidence suggests that this tool shows potential as an instrument of quantitative vocabulary's assessment of 5 and 6-years old children in European Portuguese.

Disease profiles of detainees in the Canton of Vaud in Switzerland: gender and age differences in substance abuse, mental health and chronic health conditions.

PubMed

Moschetti, Karine; Stadelmann, Pierre; Wangmo, Tenzin; Holly, Alberto; Bodenmann, Patrick; Wasserfallen, Jean-Blaise; Elger, Bernice S; Gravier, Bruno

2015-09-10

Literature on the disease profile of prisoners that differentiates by age and gender remains sparse. This study aimed to describe the health of correctional inmates in terms of substance abuse problems and mental and somatic health conditions, and compare it by gender and age. This study examined cross-sectional data from the Canton of Vaud in Switzerland on the health conditions of detainees who were in prison on January 1, 2011 or entered prison in 2011. Health conditions validated by physician examination were reported using the International Classification of Diseases (ICD) version 10. The analyses were descriptive by groups of prisoners: the entire sample (All), Men, Older adults and Women. A total of 1,664 individuals were included in the analysis. Men comprised 91.5 % of the sample and had a mean age of 33 years. The other 8.5 % were women and had an average age of 39. Older adults (i.e., age 50 and older) represented 7 % of the total sample. Overall, 80 % of inmates were non-Swiss citizens, but the proportion of Swiss prisoners was higher among the older adults (51 %) and women (29 %). Overall, 41 % of inmates self-reported substance abuse problems. Of those, 27 % were being treated by psychiatrists for behavioral disorders related to substance abuse. Chronic infectious diseases were found in 9 % of the prison population. In addition, 27 % of detainees suffered from serious mental health conditions. Gender and age had an influence on the disease profile of this sample: compared to the entire prison population, the older inmates were less likely to misuse illegal drugs and to suffer from communicable infections but exhibited more problems with alcohol and a higher burden of chronic health conditions. Female prisoners were more disposed to mental health problems (including drug abuse) and infectious diseases. In terms of chronic diseases, women suffered from the same conditions as men, but the diseases were more prevalent in women. It is important to understand the different disease profiles of prisoners by gender and age, as it helps identify the needs of different groups and tailor age-and gender-specific interventions.

ADL ability characteristics of partially dependent older people: Gender and age differences in ADL ability.

PubMed

Sato, S; Demura, S; Tanaka, K; Kasuga, K; Kobayashi, H

2001-07-01

Age and gender differences in ADL ability were investigated using 568 Japanese partially dependent older people (PD, Mean age=82.2±7.76 years) living in welfare institutions. The subjects were asked about 17 ADL items representing 7 ADL domains by the professional staff working at subjects' institutions. Each item was assessed by a dichotomous scale of "possible" or "impossible". Item proportions of "possible" response were calculated for gender and age groups (60s, 70s, 80s and 90s). Two-way analysis of variance (ANOVA) using the arcsine transformation method indicated no gender differences. Significant decreases in ADL ability with aging were found in 13 of the 17 items. The dependency of ADL in the PD significantly increases with aging, and there is no significant difference in this trend between men and women. The dependency of more difficult activities using lower limb increase from the 70s, and independency of low-difficult activities such as manual activities, feeding and changing posture while lying is maintained until the 80s and over.

Changes in gross grasp strength and fine motor skills in adolescents with pediatric multiple sclerosis.

PubMed

Squillace, Mary; Ray, Sharon; Milazzo, Maria

2015-01-01

This study examined the gross grasp strength and fine motor dexterity of adolescents, who are diagnosed with multiple sclerosis (MS). A total sample size of 72 participants between the ages of 13 to 17 was studied. Thirty six with a diagnosis of pediatric relapse remitting MS and 36 matched control participants were selected from various local youth groups. Data on hand strength and dexterity was collected using a dynamometer, nine hole peg board and Purdue pegboard on both groups. Utilizing ANCOVA to describe the differences across the two groups by diagnosis, controlling for age and gender, it was found that the MS group demonstrated significantly decreased dexterity when compared to age and gender matched controls. There was no significant difference in gross grasp strength by diagnostic group. This preliminary study showed that children with a diagnosis of pediatric MS may have differences in fine motor dexterity, but not gross grasp strength from their peers who do not have the diagnosis. Further study is indicated to examine this phenomenon.

The impact of sociodemographic factors vs. gender roles on female hospital workers' health: do we need to shift emphasis?

PubMed

Musshauser, Doris; Bader, Angelika; Wildt, Beatrice; Hochleitner, Margarethe

2006-09-01

The aim of the present study was to evaluate the physical and mental health status of female workers from five different occupational groups and to identify possible sociodemographic and gender-coded family-related factors as well as work characteristics influencing women's health. The identified predictors of health status were subjected to a gender-sensitive analysis and their relations to one another are discussed. A total of 1083 female hospital workers including medical doctors, technical and administrative personnel, nurses and a group mainly consisting of scientific personnel and psychologists completed a questionnaire measuring work- and family-related variables, sociodemographic data and the Short-form 36 Health Questionnaire (SF-36). Data were analysed by multivariate regression analyses. Female medical doctors reported highest scores for all physical health dimensions except General Health. Our study population showed general low mental health status among administrative personnel and the heterogeneous group, others, scored highest on all mental health component scores. A series of eight regression analyses were performed. Three variables contributed highly significantly to all SF-36 subscale scores: age, satisfaction with work schedule, and the unpaid work variable. Age had the strongest influence on all physical dimensions except General Health (beta=-0.17) and had no detectable influence on mental health scores. The unpaid work variable (beta=-0.23; p<0.001) exerted a stronger influence on General Health than did age. Nevertheless, these variables were limited predictors of physical and mental health status. In all occupational groups the amount of time spent daily on child care and household tasks, as a traditional gender-coded factor, and satisfaction with work schedule were the only contributors to mental health among working women in this study. Traditional sociodemographic data had no effect on mental health status. In addition to age, these factors were shown to be the only predictors of physical health status of female workers. Gender coded-factors matter. These findings underline the importance of including gender-coded family- and work-related variables in medical research over and above basic sociodemographic data in order to describe study populations more clearly.

An updated Italian normative dataset for the Stroop color word test (SCWT).

PubMed

Brugnolo, A; De Carli, F; Accardo, J; Amore, M; Bosia, L E; Bruzzaniti, C; Cappa, S F; Cocito, L; Colazzo, G; Ferrara, M; Ghio, L; Magi, E; Mancardi, G L; Nobili, F; Pardini, M; Rissotto, R; Serrati, C; Girtler, N

2016-03-01

The Stroop color and word test (SCWT) is widely used to evaluate attention, information processing speed, selective attention, and cognitive flexibility. Normative values for the Italian population are available only for selected age groups, or for the short version of the test. The aim of this study was to provide updated normal values for the full version, balancing groups across gender, age decades, and education. Two kinds of indexes were derived from the performance of 192 normal subjects, divided by decade (from 20 to 90) and level of education (4 levels: 3-5; 6-8; 9-13; >13 years). They were (i) the correct answers achieved for each table in the first 30 s (word items, WI; color items, CI; color word items, CWI) and (ii) the total time required for reading the three tables (word time, WT; color time, CT; color word time, CWT). For each index, the regression model was evaluated using age, education, and gender as independent variables. The normative data were then computed following the equivalent scores method. In the regression model, age and education significantly influenced the performance in each of the 6 indexes, whereas gender had no significant effect. This study confirms the effect of age and education on the main indexes of the Stroop test and provides updated normative data for an Italian healthy population, well balanced across age, education, and gender. It will be useful to Italian researchers studying attentional functions in health and disease.

Is it possible a new definition of metabolic syndrome in childhood?

PubMed

Martino, F; Pannarale, G; Puddu, P E; Colantoni, C; Zanoni, C; Martino, E; Torromeo, C; Paravati, V; Perla, F M; Barillà, F

2015-11-01

To investigate whether a group of Italian children and adolescents who were diagnosed to have metabolic syndrome (MS) according to a new ethnic age and gender specific definition had, in comparison with a control group, other signs and metabolic risk factors which are commonly associated with MS. The cross-sectional study population included 300 subjects (51% boys, age range 6-14 years), who were divided into 2 groups according to the presence of MS, diagnosed on the basis of 3/5 factors derived from the age and gender specific quantile distribution of MS components in a large regional Italian population survey (Calabrian Sierras Community Study, CSCS). In all subjects the following data were collected: anthropometric measures, blood pressure, liver function, C-reactive protein (hsCRP), uric acid blood levels, lipid and glucose profile. Triglycerides/HDL-cholesterol (TG/HDL-C) ratio was calculated. There were 38 subjects (13%) with MS, who had higher indices of growth and fat distribution and higher blood levels of uric acid, alanine aminotransferase and gamma-glutamyltransferase. TG/HDL ratio was higher (median 3.11 vs. 1.14, p = 0.00001) in MS subjects who had lower apolipoprotein A and higher apolipoprotein B and non-HDL-C levels. hsCRP was not different between groups. Our ethnic age and gender specific definition of MS in Italian children and adolescents was able to identify in a youth group different cardiometabolic risk factors related to insulin resistance, endothelial damage and nonalcoholic fatty liver disease, which are commonly associated with MS diagnosis.

A field study on thermal comfort in an Italian hospital considering differences in gender and age.

PubMed

Del Ferraro, S; Iavicoli, S; Russo, S; Molinaro, V

2015-09-01

The hospital is a thermal environment where comfort must be calibrated by taking into account two different groups of people, that is, patients and medical staff. The study involves 30 patients and 19 medical staff with a view to verifying if Predicted Mean Vote (PMV) index can accurately predict thermal sensations of both groups also taking into account any potential effects of age and gender. The methodology adopted is based on the comparison between PMV values (calculated according to ISO 7730 after having collected environmental data and estimated personal parameters) and perceptual judgments (Actual Mean Vote, AMV), expressed by the subjects interviewed. Different statistical analyses show that PMV model finds his best correlation with AMV values in a sample of male medical staff under 65 years of age. It has been observed that gender and age are factors that must be taken into account in the assessment of thermal comfort in the hospital due to very weak correlation between AMV and PMV values. Copyright © 2015 Elsevier Ltd and The Ergonomics Society. All rights reserved.

Cultural background shapes spatial reference frame proclivity

PubMed Central

Goeke, Caspar; Kornpetpanee, Suchada; Köster, Moritz; Fernández-Revelles, Andrés B.; Gramann, Klaus; König, Peter

2015-01-01

Spatial navigation is an essential human skill that is influenced by several factors. The present study investigates how gender, age, and cultural background account for differences in reference frame proclivity and performance in a virtual navigation task. Using an online navigation study, we recorded reaction times, error rates (confusion of turning axis), and reference frame proclivity (egocentric vs. allocentric reference frame) of 1823 participants. Reaction times significantly varied with gender and age, but were only marginally influenced by the cultural background of participants. Error rates were in line with these results and exhibited a significant influence of gender and culture, but not age. Participants’ cultural background significantly influenced reference frame selection; the majority of North-Americans preferred an allocentric strategy, while Latin-Americans preferred an egocentric navigation strategy. European and Asian groups were in between these two extremes. Neither the factor of age nor the factor of gender had a direct impact on participants’ navigation strategies. The strong effects of cultural background on navigation strategies without the influence of gender or age underlines the importance of socialized spatial cognitive processes and argues for socio-economic analysis in studies investigating human navigation. PMID:26073656

Sex Differences in Balance Among Alpine Ski Racers: Cross-Sectional Age Comparisons.

PubMed

Raschner, Christian; Hildebrandt, Carolin; Mohr, Johanna; Müller, Lisa

2017-12-01

Although balance is a key ability in the strength demands of alpine ski racing, affecting both performance and injury prevention, few studies have examined balance or related sex differences among still-maturing athletes. In this 10-year study, we investigated cross-sectional balance performances at different age periods of a representative sample of over 500 11-18-year-old elite skiers of both genders. Participants performed balance tests using the MFT S3-Check. Left-right and forward-backward movements were used to calculate sensory and symmetry balance scores, which were both incorporated into a stability score. Mann-Whitney U tests assessed gender-specific differences by age-group with a significance level set at p < .05. Results showed gender differences only on forward-backward measurements for 14-16-year-olds, with females showing better stability and sensory (but not symmetry) scores than males. Thus, gender interacted with age and maturation to influence balance ability in these participants. Additionally, these rare 10-year data support coaches in their training and talent development of maturing athletes by providing important sport-, age-, and gender-specific normative comparison data for individual trainees.

The effects of gender and age on forensic personal identification from frontal sinus in a Turkish population

PubMed Central

Tatlisumak, Ertugrul; Asirdizer, Mahmut; Bora, Aydin; Hekimoglu, Yavuz; Etli, Yasin; Gumus, Orhan; Keskin, Siddik

2017-01-01

Objectives: To define the dimensions of the frontal sinus in groups standardized for age and gender and to discuss the reasons and the effects of the variations. Methods: Frontal sinus measurements were obtained from paranasal CT scans of 180 males and 180 females in the Radiology Department of Dursun Odabas Medical Center of Yuzuncu Yil University, Van, which is located in Eastern Turkey, between February and March 2016. The width and height of sinuses were measured on a coronal plane, and the anteroposterior length was measured on an axial plane. Volumes were calculated using the Hospital Information Management Systems and Image Archiving and Management System program. The Statistical Package of the Social Science version 13 was used for statistical analyses. Results: We determined differences in the frontal sinus measurements of different age groups in a Turkish adult population. Frontal sinus dimensions were usually higher in females and lower in males after 40-49 years of age than their younger counterparts, but the measurements were lower in females and higher in males in 70≤ years of age group than 60-69 years of age. Left frontal sinus was dominant in young age groups but right frontal sinus was dominant in groups 40-49 years of age or older. Conclusion: We observed crossing of the measurements between the different age groups, which we could not find clear explanations. The results of such studies may affect forensic identification from frontal sinus measurements. PMID:28042629

Walking speed and peak plantar pressure distribution during barefoot walking in persons with diabetes.

PubMed

Ko, Mansoo; Hughes, Lynne; Lewis, Harriet

2012-03-01

The impact of walking speed has not been evaluated as a feasible outcome measure associated with peak plantar pressure (PPP) distribution, which may result in tissue damage in persons with diabetic foot complications. The objective of this pilot study was to determine the walking speed and PPP distribution during barefoot walking in persons with diabetes.   Nine individuals with diabetes and nine age-gender matched individuals without diabetes participated in this study. Each individual was marked at 10 anatomical landmarks for vibration and tactile pressure sensation tests to determine the severity of sensory deficits on the plantar surface of the dominant limb foot. A steady state walking speed, PPP, the fore and rear foot (F/R) PPP ratio and gait variables were measured during barefoot walking.   Persons with diabetes had a significantly slower walking speed than the age-gender matched group resulting in a significant reduction of PPP at the F/R foot during barefoot walking (p < 0.05). There was no significant difference in F/R foot PPP ratio in the diabetic group compared with the age-gender matched group during barefoot walking (p > 0.05). There was a significant difference between the diabetic and non-diabetic groups for cadence, step time, toe out angle and the anterior-posterior excursion (APE) for centre of force (p < 0.05).   Walking speed may be a potential indicator for persons with diabetes to identify PPP distribution during barefoot walking in a diabetic foot. However, the diabetic group demonstrated a more cautious walking pattern than the age-gender matched group by decreasing cadence, step length and APE, and increasing step time and toe in/out angle. People with diabetes may reduce the risk of foot ulcerations as long as they are able to prevent severe foot deformities such as callus, hammer toe or charcot foot. Copyright © 2011 John Wiley & Sons, Ltd.

Reference Values for The Triglyceride to High-Density Lipoprotein Cholesterol Ratio and Non-High-Density Lipoprotein Cholesterol in Korean Children and Adolescents: The Korean National Health and Nutrition Examination Surveys 2007–2013

PubMed Central

Shim, Young Suk; Baek, Joon Woo; Kang, Min Jae; Oh, Yeon Jeong; Yang, Seung

2016-01-01

Aim: Cholesterol levels vary throughout childhood and adolescence. The aim of the present study was to evaluate and identify age- and gender-specific reference values for serum lipid concentrations including non-high-density lipoprotein cholesterol (non-HDL-C) and the triglyceride to HDL-C ratio (TG/HDL-C ratio) in apparently healthy Korean children and adolescents. Methods: A total of 6197 participants aged 10 to 19 years old from the 2007–2013 Korean National Health and Nutrition Examination Survey were analyzed. Serum lipid concentrations were evaluated according to age and gender. Results: The overall mean concentration of non-HDL-C was 105.5 ± 25.6 mg/dL, with a significant gender difference: 103.3 ± 26.1 mg/dL in boys and 107.9 ± 24.7 mg/dL in girls (p = 0.028). The median values of non-HDL-C concentrations in boys and girls, respectively, were 111 and 112 mg/dL in the 10-year-old age group, 95 and 103 mg/dL in the 15-year-old age group, and 109 and 103 mg/dL in the 19-year-old age group. The overall mean TG/HDL-C ratio was 1.74 ± 1.22, and there were no significant gender differences: 1.77 ± 1.25 in boys and 1.72 ± 1.22 in girls (p = 0.183). The median values of the TG/HDL-C ratio in boys and girls were 1.16 and 1.00 in the 10-year-olds, 1.54 and 0.95 in the 15-year-olds, and 1.74 and 0.84 in the 19-year-olds, respectively. Conclusions: Age- and gender-specific reference values for non-HDL-C and for the TG/HDL-C ratio in children and adolescents could provide valuable information for individualized interpretations of lipid profiles and interventions as well as for strategies to prevent and manage childhood and adolescent dyslipidemia. PMID:27373984

Understanding how race/ethnicity and gender define age-trajectories of disability: an intersectionality approach.

PubMed

Warner, David F; Brown, Tyson H

2011-04-01

A number of studies have demonstrated wide disparities in health among racial/ethnic groups and by gender, yet few have examined how race/ethnicity and gender intersect or combine to affect the health of older adults. The tendency of prior research to treat race/ethnicity and gender separately has potentially obscured important differences in how health is produced and maintained, undermining efforts to eliminate health disparities. The current study extends previous research by taking an intersectionality approach (Mullings & Schulz, 2006), grounded in life course theory, conceptualizing and modeling trajectories of functional limitations as dynamic life course processes that are jointly and simultaneously defined by race/ethnicity and gender. Data from the nationally representative 1994-2006 US Health and Retirement Study and growth curve models are utilized to examine racial/ethnic/gender differences in intra-individual change in functional limitations among White, Black and Mexican American Men and Women, and the extent to which differences in life course capital account for group disparities in initial health status and rates of change with age. Results support an intersectionality approach, with all demographic groups exhibiting worse functional limitation trajectories than White Men. Whereas White Men had the lowest disability levels at baseline, White Women and racial/ethnic minority Men had intermediate disability levels and Black and Hispanic Women had the highest disability levels. These health disparities remained stable with age-except among Black Women who experience a trajectory of accelerated disablement. Dissimilar early life social origins, adult socioeconomic status, marital status, and health behaviors explain the racial/ethnic disparities in functional limitations among Men but only partially explain the disparities among Women. Net of controls for life course capital, Women of all racial/ethnic groups have higher levels of functional limitations relative to White Men and Men of the same race/ethnicity. Findings highlight the utility of an intersectionality approach to understanding health disparities. Copyright © 2011 Elsevier Ltd. All rights reserved.

Adherence rates to ferric citrate as compared to active control in patients with end stage kidney disease on dialysis.

PubMed

Jalal, Diana; McFadden, Molly; Dwyer, Jamie P; Umanath, Kausik; Aguilar, Erwin; Yagil, Yoram; Greco, Barbara; Sika, Mohammed; Lewis, Julia B; Greene, Tom; Goral, Simin

2017-04-01

Oral phosphate binders are the main stay of treatment of hyperphosphatemia. Adherence rates to ferric citrate, a recently approved phosphate binder, are unknown. We conducted a post-hoc analysis to evaluate whether adherence rates were different for ferric citrate vs. active control in 412 subjects with end stage kidney disease (ESKD) who were randomized to ferric citrate vs. active control (sevelamer carbonate and/or calcium acetate). Adherence was defined as percent of actual number of pills taken to total number of pills prescribed. There were no significant differences in baseline characteristics including gender, race/ethnicity, and age between the ferric citrate and active control groups. Baseline phosphorus, calcium, and parathyroid hormone levels were similar. Mean (SD) adherence was 81.4% (17.4) and 81.7% (15.9) in the ferric citrate and active control groups, respectively (P = 0.88). Adherence remained similar between both groups after adjusting for gender, race/ethnicity, age, cardiovascular disease (CVD), and diabetic nephropathy (mean [95% CI]: 81.4% [78.2, 84.6] and 81.5% [77.7, 85.2] for ferric citrate and active control, respectively). Gender, race/ethnicity, age, and diagnosis of diabetic nephropathy did not influence adherence to the prescribed phosphate binder. Subjects with CVD had lower adherence rates to phosphate binder; this was significant only in the active control group. Adherence rates to the phosphate binder, ferric citrate, were similar to adherence rates to active control. Similar adherence rates to ferric citrate are notable since tolerance to active control was an entry criteria and the study was open label. Gender, race/ethnicity, nor age influenced adherence. © 2016 International Society for Hemodialysis.

Prevalence of overweight/obesity and economical status of schoolchildren.

PubMed

Azambuja, Ana Paula de O; Netto-Oliveira, Edna Regina; de Oliveira, Amauri Aparecido B; Azambuja, Maximiliano dos Anjos; Rinaldi, Wilson

2013-06-01

To associate the nutritional status of elementary schoolchildren with their gender, age group, and economic status based on a cross-sectional study carried out at public schools in the municipality of Cruzeiro do Oeste, Southern Brazil. The study was performed in 2010 including 939 schoolchildren aged six to ten years-old. The economical status of the families was classified based on a socioeconomic ranking questionnaire (Brazilian Association of Survey Companies), and the body mass index was calculated. Data were analyzed by descriptive statistics, and differences between independent groups were verified by Mann-Whitney and Kruskal-Wallis tests, while possible associations were verified by the chi-square test, being significant p<0.05. The prevalence of obesity in the sample was 8.0%, and overweight, 16.4%. No association was found between the socioeconomic and nutritional status or between the nutritional status and gender. A high prevalence of overweight and obesity was found in this study, indicating that children of both genders are affected regardless of their economical status and age.

Trends in Educational Differentials in Suicide Mortality between 1993 - 2006 in Korea

PubMed Central

Lee, Weon Young; Khang, Young-Ho; Noh, Manegseok; Ryu, Jae-In; Son, Mia

2009-01-01

Purpose This study aims to examine how inequalities in suicide by education changed during and after macroeconomic restructuring following the economic crisis of 1997 in South Korea. Materials and Methods Using Korea's 1995, 2000, and 2005 census data aggregately linked to mortality data (1993 - 2006), relative and absolute differentials in suicide mortality by education were calculated by gender and age among Korean population aged 35 and over. Results Average annual suicide mortality rates have steadily increased from 1993 - 1997 to 2003 - 2006 in almost all sociodemographic groups stratified by gender, age, and education. Based on the relative index of inequality (RII) and slope index of inequality (SII), educational differentials in suicide mortality generally increased over time in men and women aged 45 years +. Although RII did not increase with year among men and women aged 35 - 44 years, SII showed a significantly increasing trend in this age group. Conclusion These worsening absolute inequalities in suicide mortality indicate that the governmental suicide prevention policy should be directed toward socially disadvantaged groups of the Korean population. PMID:19718395

The influence of age and gender on the likelihood of endorsing cannabis abuse/dependence criteria.

PubMed

Delforterie, Monique J; Creemers, Hanneke E; Agrawal, Arpana; Lynskey, Michael T; Jak, Suzanne; Huizink, Anja C

2015-03-01

Higher prevalence rates of cannabis abuse/dependence and abuse/dependence criteria in 18-24year old versus older cannabis users and in males versus females might reflect true differences in the prevalence of these disorders across age and gender or, alternatively, they could arise from age- and gender-related measurement bias. To understand differences in endorsement across important subgroups, we examined the influence of age and gender simultaneously on the likelihood of endorsement of the various abuse/dependence criteria. The sample consisted of 1603 adult past year cannabis users participating in the National Epidemiological Survey on Alcohol and Related Conditions (NESARC), a U.S. population study (39.6% aged 18-24; 62.1% male). Past year DSM-IV cannabis abuse/dependence criteria and withdrawal were assessed with the AUDADIS-IV. A restricted factor analysis with latent moderated structures was used to detect measurement bias. Although cannabis abuse and dependence diagnoses and various individual abuse/dependence criteria showed different prevalence rates across younger and older male and female cannabis users, none of the items showed uniform or non-uniform measurement bias with respect to age or gender. The results indicate that, although prevalence rates of cannabis abuse/dependence criteria differ across age and gender, past year abuse/dependence criteria function similarly across these groups. It can thus be concluded that the criteria are applicable to younger and older, as well as male and female, adult cannabis users. Copyright © 2014 Elsevier Ltd. All rights reserved.

Preschool Gender-Typed Play Behavior at Age 3.5 Years Predicts Physical Aggression at Age 13 Years.

PubMed

Kung, Karson T F; Li, Gu; Golding, Jean; Hines, Melissa

2018-05-01

Gender differences in play behavior and physical aggression have been consistently reported. Theoretical perspectives concerning evolutionary, social, and social-cognitive mechanisms suggest that male-typical play behavior during childhood increases subsequent physical aggression. The evidence supporting these connections is limited, however. The present study investigated the association between gender-typed play behavior in early childhood and physical aggression in early adolescence using a sample drawn from a longitudinal, population study, the Avon Longitudinal Study of Parents and Children. Based on gender-typed play behavior as measured by the Pre-School Activities Inventory at age 3.5 years, samples of masculine (64 boys, 60 girls), feminine (80 boys, 66 girls), and randomly selected control children (55 boys, 67 girls) were recruited at age 13 years and administered the Reinisch Aggression Inventory. After controlling for a range of sociodemographic variables, maternal characteristics, and behavioral problems, including hyperactivity and conduct problems at age 3.5, significant group differences in physical aggression at age 13 were found among children classified as masculine, control, and feminine at age 3.5. Masculine children exhibited significantly more physical aggression than control children or feminine children, and control children exhibited significantly more physical aggression than feminine children. The association between gender-typed play behavior and physical aggression was not moderated by sex. These results suggest that the degree of childhood gender-typed play behavior independently predicts the degree of physical aggression at adolescence in boys and in girls.

Age and body composition influence TSH concentrations after administration of rhTSH.

PubMed

Holthausen, F F; von Müller, F; Happel, C; Kranert, W T; Grünwald, F

2015-01-01

Previous studies listed body surface area (BSA), lean body mass (LBM), and age as modifying factors on the TSH concentrations after administration of recombinant human thyrotropin (rhTSH). The purpose of this study was to identify the main modifying factors on serum TSH levels and to compare the stimulation via single rhTSH injection after a short thyroid hormone withdrawal (THW) with that of the standard stimulating protocol. 106 patients with differentiated thyroid cancer (DTC) undergoing radioiodine therapy (RIT) after rhTSH administration were obtained through chart review. Two groups were evaluated: Group I was treated with a single rhTSH administration after two weeks of T3 therapy followed by one week of THW. Group II was stimulated according to the international standard protocol via rhTSH injections for two consecutive days. Serum TSH concentrations were documented prior to rhTSH administration (day 1 TSH), one day after (day 3 TSH) and 3-6 days after (mean 4.2 days, day 6 TSH) the last rhTSH injection. The following data was collected: age, gender, weight, height, BMI, LBM, BSA, residual thyroid tissue, CRP, creatinine, GFR, liver enzymes, alkaline phosphatase, cholesterol, and triglycerides. Group I: Age combined with anthropometric factors like BMI (TSH increase and day 6 TSH), BSA (TSH decrease), and gender (day 6 TSH) are the main modifying factors on serum TSH concentrations after rhTSH administration. Group II: Age and lean body mass (LBM) showed a significant impact on day 3 TSH, TSH increase (day 3-day 1), and TSH decrease (day 6-day 3). Day 6 TSH was found to be influenced by GFR (group II). Age and anthropometric parameters have significant independent influence on TSH concentrations after rhTSH injection in both groups. Anthropometric parameters (BSA, LBM) and demographic parameters (female gender) show strong influence on TSH concentrations. Further research should be conducted to examine the influence of body compartments on TSH levels through measuring total body water.

Frontal and temporal volumes in Childhood Absence Epilepsy.

PubMed

Caplan, Rochelle; Levitt, Jennifer; Siddarth, Prabha; Wu, Keng Nei; Gurbani, Suresh; Sankar, Raman; Shields, W Donald

2009-11-01

This study compared frontotemporal brain volumes in children with childhood absence epilepsy (CAE) to age- and gender-matched children without epilepsy. It also examined the association of these volumes with seizure, demographic, perinatal, intelligence quotient (IQ), and psychopathology variables. Twenty-six children with CAE, aged 7.5-11.8 years, and 37 children without epilepsy underwent brain magnetic resonance imaging (MRI) scans at 1.5 Tesla. Tissue was segmented, and total brain, frontal lobe, frontal parcellations, and temporal lobe volumes were computed. All children had IQ testing and structured psychiatric interviews. Parents provided seizure, perinatal, and behavioral information on each child. The CAE group had significantly smaller gray matter volumes of the left orbital frontal gyrus as well as both left and right temporal lobes compared to the age- and gender-matched children without epilepsy. In the CAE group these volumes were related to age, gender, ethnicity, and pregnancy complications but not to seizure, IQ, and psychopathology variables. In the group of children without epilepsy, however, the volumes were related to IQ. These findings suggest that CAE impacts brain development in regions implicated in behavior, cognition, and language. In addition to supporting the cortical focus theory of CAE, these findings also imply that CAE is not a benign disorder.

Early adulthood: an overlooked age group in national sodium reduction initiatives in South Korea.

PubMed

Park, Sohyun; Lee, Jounghee; Kwon, Kwang-Il; Kim, Jong-Wook; Byun, Jae-Eon; Kang, Baeg-Won; Choi, Bo Youl; Park, Hye-Kyung

2014-12-01

South Korean's sodium consumption level is more than twice the upper limit level suggested by the WHO. Steep increases in the prevalence of hypertension and cardiovascular disease in Korea necessitate more effective sodium reduction programs. This study was conducted in order to compare sodium intake-related eating behaviors and key psychosocial factors according to age group and gender. Using an online survey, a total of 1,564 adults (20-59 years old) considered to be geographically representative of South Korea were recruited and surveyed. The major outcomes were perceived behaviors, knowledge, intentions, and self-efficacy related to sodium intake. The results show that perceived behavior and level of self-efficacy related to low sodium consumption differed by age and gender. Female participants showed better behavior and intention towards low sodium intake than male counterparts. Young participants in their 20s showed the lowest intention to change their current sodium intake as well as lowest self-efficacy measures. Future sodium reduction interventions should be developed with tailored messages targeting different age and gender groups. Specifically, interventions can be planned and implemented at the college level or for workers in their early career to increase their intention and self-efficacy as a means of preventing future health complications associated with high sodium intake.

Orthodontic treatment need and demand among 12- and 16 year-old school children in Malaysia.

PubMed

Zreaqat, Maen; Hassan, Rozita; Ismail, Abdul Rashid; Ismail, Noorliza Mastura; Aziz, Fadi Abdul

2013-12-01

Assessment of orthodontic treatment need and demand helps in planning orthodontic services and estimating the required resources and man power. The aim of this study was to assess the orthodontic treatment need and demand and to assess the association between the orthodontic treatment demand and factors such as ITON, gender, and age. Treatment need was assessed using the DHC and AC of IOTN among 12- and 16-year-old Malay school children. The treatment demand was also assessed through a modified health questionnaire and its association with IOTN, age, and gender. A total number of 837 Malay school children were randomly recruited (389 males and 448 females divided into two age groups; 12-year olds; and 16-year olds). Findings showed that 51.4% of 12-year-old school children had definite need for treatment (DHC>4) while 22% of them desired treatment. Among 16-year-old subjects, 56.4% showed definite need for treatment while 47.2% desired treatment. The 16-year-old group was more interested in orthodontic treatment than the 12-year-old group (P<0.001). Only age was associated with treatment demand while gender had no effect (P>0.05). There is a high level of need for treatment among Malay school children which was not associated with orthodontic demand. Age was associated with orthodontic demand.

Implications of diadochokinesia in children with speech sound disorder.

PubMed

Wertzner, Haydée Fiszbein; Pagan-Neves, Luciana de Oliveira; Alves, Renata Ramos; Barrozo, Tatiane Faria

2013-01-01

To verify the performance of children with and without speech sound disorder in oral motor skills measured by oral diadochokinesia according to age and gender and to compare the results by two different methods of analysis. Participants were 72 subjects aged from 5 years to 7 years and 11 months divided into four subgroups according to the presence of speech sound disorder (Study Group and Control Group) and age (<6 years and 5 months and >6 years and 5 months). Diadochokinesia skills were assessed by the repetition of the sequences 'pa', 'ta', 'ka' and 'pataka' measured both manually and by the software Motor Speech Profile®. Gender was statistically different for both groups but it did not influence on the number of sequences per second produced. Correlation between the number of sequences per second and age was observed for all sequences (except for 'ka') only for the control group children. Comparison between groups did not indicate differences between the number of sequences per second and age. Results presented strong agreement between the values of oral diadochokinesia measured manually and by MSP. This research demonstrated the importance of using different methods of analysis on the functional evaluation of oro-motor processing aspects of children with speech sound disorder and evidenced the oro-motor difficulties on children aged under than eight years old.

The Distribution of Thai Mental State Examination Scores among Non-Demented Elderly in Suburban Bangkok Metropolitan and Associated Factors.

PubMed

Muangpaisan, Weerasak; Assantachai, Prasert; Sitthichai, Kobkul; Richardson, Kathryn; Brayne, Carol

2015-09-01

To obtain the distribution of Thai Mental State Examination (TMSE) scores in the Thai population across different age groups and educational levels in men and women aged 50 years and older and its relationship with demographic factors. The different cutpoints in literate and illiterate participants and item performance in both groups were also determined. Community-dwelling participants aged 50 years and over were invited to join the study. Personal information, general health history, and specific illness questionnaires including the activities of daily living, designed by the Survey in Europe on Nutrition and the Elderly, a ConcertedAction (SENECA), and the Thai Mental State Examination (TMSE) were completed in the face-to-face interview. There were 4,459 participants with no specific reported conditions that could potentially influence cognitive performance. The mean (SD) age was 64.2 (7.9) years and mostparticipants were women (71.7%). The median (interquartile range) of the TMSE was 27 (25-29) and 23 (19-26) in literate and illiterate participants, respectively. The distribution of TMSE scores were reported here determined by age, gender and educational level. Percentage of correct response in each TMSE item was low in recall and calculation performance. TMSE score declined with age in both genders and had greater variation with increasing age. TMSE score also increased with increasing levels of education and better financial status. Gender was not associated with the TMSE score adjusting for age, educational level, and economic status. Age, education, and economic status have an influence on the TMSE performance. Controllingfor these three factors, genders does not contribute to significant differences in TMSE performance. Norms adjustedfor these factors should be considered before employing single cutpoints to identify impairment.

Gender Identity in Patients with Congenital Adrenal Hyperplasia.

PubMed

Razzaghy-Azar, Maryam; Karimi, Sakineh; Shirazi, Elham

2017-07-01

Sex assignment in infancy for patients with disorder of sex development (DSD) is a challenging problem. Some of the patients with congenital adrenal hyperplasia (CAH) have DSD that may affect their gender identity. The study aimed to assess gender identity in patients with CAH. In this study, 52 patients with CAH, including 22 prepubertal children and 30 adolescents and adults, were assessed using two separate gender identity questionnaires for children and adults based on the criteria of diagnostic and statistical manual of mental disorders, 5th edition. In the children group, compatibility was seen between gender identity and rearing gender. In the adult group, there were three cases of mismatching between gender identity and sex assignment composed of two females with poor control and one male with good control with 21-hydroxylase deficiency (21-OHD). Three girls with 11-hydroxylase deficiency (11-OHD) were reared as boy. Two of them with late diagnosis at 5 and 6 years of age had pseudoprecocious puberty. Parents and children did not accept to change the gender. One of them is 36 years old now, is depressed and unsatisfied with her gender, another girl is still child and has male sexual identity. One girl with 11-OHD and early diagnosis at birth with Prader 5 virilization but with good hormonal control was changed to female gender at 12 years of age when female sexual characteristics appeared; she is 34-years-old now, married, and with two children, and she is satisfied with her gender. In patients with CAH, gender identity disorder is a rare finding. Hormonal control, social, familial, and religious beliefs have impacts on gender identity of these patients.

Gender Identity in Patients with Congenital Adrenal Hyperplasia

PubMed Central

Razzaghy-Azar, Maryam; Karimi, Sakineh; Shirazi, Elham

2017-01-01

Background Sex assignment in infancy for patients with disorder of sex development (DSD) is a challenging problem. Some of the patients with congenital adrenal hyperplasia (CAH) have DSD that may affect their gender identity. Objectives The study aimed to assess gender identity in patients with CAH. Methods In this study, 52 patients with CAH, including 22 prepubertal children and 30 adolescents and adults, were assessed using two separate gender identity questionnaires for children and adults based on the criteria of diagnostic and statistical manual of mental disorders, 5th edition. Results In the children group, compatibility was seen between gender identity and rearing gender. In the adult group, there were three cases of mismatching between gender identity and sex assignment composed of two females with poor control and one male with good control with 21-hydroxylase deficiency (21-OHD). Three girls with 11-hydroxylase deficiency (11-OHD) were reared as boy. Two of them with late diagnosis at 5 and 6 years of age had pseudoprecocious puberty. Parents and children did not accept to change the gender. One of them is 36 years old now, is depressed and unsatisfied with her gender, another girl is still child and has male sexual identity. One girl with 11-OHD and early diagnosis at birth with Prader 5 virilization but with good hormonal control was changed to female gender at 12 years of age when female sexual characteristics appeared; she is 34-years-old now, married, and with two children, and she is satisfied with her gender. Conclusions In patients with CAH, gender identity disorder is a rare finding. Hormonal control, social, familial, and religious beliefs have impacts on gender identity of these patients. PMID:29201068

Can Motor Proficiency in Preschool Age Affect Physical Activity in Adolescence?

PubMed

Venetsanou, Fotini; Kambas, Antonis

2017-05-01

This study investigated if motor proficiency (MP) in preschool age associate with physical activity (PA) in adolescence. In 2004, the Bruininks-Oseretsky Test of Motor Proficiency-Short Form (BOTMP-SF) (7) was administered to 413 children, aged 4-6 years, who were classified to MP groups according to their BOTMP-SF total score (TS). In 2014, the PA of 106 former participants (47 boys, 59 girls) was measured with Omron pedometers. MP [three (high; above average; average)] × gender (two) ANOVA and Bonferroni tests were computed on average of steps/week. A significant interaction between the two factors was revealed (F = 15.27, p < .001, η 2 =.153), indicating that MP influenced male and female PA differently. Only in average MP group, males presented higher PA than females, whereas there were no differences between the two genders in the higher MP groups. Moreover, the only significant difference in PA among male groups was that between high and above average MP groups, while in females there were significant differences among all groups. High MP at preschool age positively associated with the PA in adolescence, especially in females. Emphasis on the development of proficient young movers might be beneficial for lifelong PA.

Masculine Traits and Depressive Symptoms in Older and Younger Men and Women.

PubMed

Price, Elizabeth C; Gregg, Jeffrey J; Smith, Merideth D; Fiske, Amy

2018-01-01

Evidence suggests that men who strongly endorse masculine traits display an atypical presentation of depression, including more externalizing symptoms (e.g., anger or substance use), but fewer typical, internalizing symptoms (e.g., depressed mood or crying). This phenomenon has not been adequately explored in older adults or women. The current study used the externalizing subscale of the Masculine Depression Scale in older and younger men and women to detect atypical symptoms. It was predicted that individuals who more strongly endorsed masculine traits would have higher scores on the measure of externalizing symptoms relative to a measure of typical depressive symptoms Center for Epidemiologic Studies-Depression Scale. It was anticipated that results would differ by age-group but not by gender. Multigroup path analysis was used to test the hypothesis. The hypothesized path model, in which endorsement of masculine traits was associated with lower scores on the Center for Epidemiologic Studies-Depression Scale and with scores on the externalizing, but not internalizing, factor of the Masculine Depression Scale, fit the data well. Results differed significantly by age-group and gender. Masculine individuals reported lower levels of typical depressive symptoms relative to externalizing symptoms, but further research is needed within age- and gender groups. Results are consistent with the gendered responding framework and suggest that current assessment tools, which tend to focus on internalizing symptoms of depression, may not detect depression in individuals who endorse masculine traits.

Anatomic characteristics of ruptured abdominal aortic aneurysm on conventional CT scans: Implications for rupture risk.

PubMed

Fillinger, Mark F; Racusin, Jessica; Baker, Robert K; Cronenwett, Jack L; Teutelink, Arno; Schermerhorn, Marc L; Zwolak, Robert M; Powell, Richard J; Walsh, Daniel B; Rzucidlo, Eva M

2004-06-01

The purpose of this study was to analyze anatomic characteristics of patients with ruptured abdominal aortic aneurysms (AAAs), with conventional two-dimensional computed tomography (CT), including comparison with control subjects matched for age, gender, and size. Records were reviewed to identify all CT scans obtained at Dartmouth-Hitchcock Medical Center or referring hospitals before emergency AAA repair performed because of rupture or acute severe pain (RUP group). CT scans obtained before elective AAA repair (ELEC group) were reviewed for age and gender match with patients in the RUP group. More than 40 variables were measured on each CT scan. Aneurysm diameter matching was achieved by consecutively deleting the largest RUP scan and the smallest ELEC scan to prevent bias. CT scans were analyzed for 259 patients with AAAs: 122 RUP and 137 ELEC. Patients were well matched for age, gender, and other demographic variables or risk factors. Maximum AAA diameter was significantly different in comparisons of all patients (RUP, 6.5 +/- 2 cm vs ELEC, 5.6 +/- 1 cm; P <.0001), and mean diameter of ruptured AAAs was 5 mm smaller in female patients (6.1 +/- 2 cm vs 6.6 +/- 2 cm; P =.007). Two hundred patients were matched for diameter, gender, and age (100 from each group; maximum AAA diameter, 6.0 +/- 1 cm vs 6.0 +/- 1 cm). Analysis of diameter-matched AAAs indicated that most variables were statistically similar in the two groups, including infrarenal neck length (17 +/- 1 mm vs 19 +/- 1 mm; P =.3), maximum thrombus thickness (25 +/- 1 mm vs 23 +/- 1 mm, P =.4), and indices of body habitus, such as [(maximum AAA diameter)/(normal suprarenal aorta diameter)] or [(maximum AAA diameter)/(L3 transverse diameter)]. Multivariate analysis controlling for gender indicated that the most significant variables for rupture were aortic tortuosity (odds ratio [OR] 3.3, indicating greater risk with no or mild tortuosity), diameter asymmetry (OR, 3.2 for a 1-cm difference in major-minor axis), and current smoking (OR, 2.7, with the greater risk in current smokers). When matched for age, gender, and diameter, ruptured AAAs tend to be less tortuous, yet have greater cross-sectional diameter asymmetry. On conventional two-dimensional CT axial sections, it appears that when diameter asymmetry is associated with low aortic tortuosity, the larger diameter on axial sections more accurately reflects rupture risk, and when diameter asymmetry is associated with moderate or severe aortic tortuosity, the smaller diameter on axial sections more accurately reflects rupture risk. Current smoking is significantly associated with rupture, even when controlling for gender and AAA anatomy.

Taste perception in kidney disease and relationship to dietary sodium intake.

PubMed

McMahon, Emma J; Campbell, Katrina L; Bauer, Judith D

2014-12-01

Taste abnormalities are prevalent in Chronic Kidney Disease (CKD) potentially affecting food palatability and intake, and nutrition status. The TASTE CKD study aimed to assess taste and explore the relationship of dietary sodium intake with taste disturbance in CKD subjects. This was a cross-sectional study of 91 adult stage 3-5 CKD participants (78% male) aged 65.9 ± 13.5 years with mean estimated glomerular filtration rate of 33.1 ± 12.7 ml/min/1.73 m(2), and 30 controls (47% male) aged 55.2 ± 7.4 years without kidney dysfunction. Taste assessment was performed in both groups, presenting five basic tastes (sweet, sour, salty, umami and bitter) in blinded 2 ml solution which the participants tasted, identified (identification) and rated perceived strength (intensity) on a 10 cm visual analogue scale. Sodium intake was measured in the CKD group using validated food frequency questionnaire to determine high or low sodium intake (cut-off 100 mmol sodium/day). Differences between groups (CKD vs controls; high vs low sodium intake) were analysed using chi-square for identification and t-test for intensity. Multivariate analysis was used to adjust for age and gender differences between CKD and controls. The control group identified mean 3.9 ± 1.0 tastants correctly compared with 3.0 ± 1.2 for CKD group (p < 0.001), which remained significant after adjustment for age and gender. After adjustment for age and gender, sour identification and intensity and salty and umami intensity were impaired in CKD compared with controls. Participants with low sodium intake were more likely to correctly identify salty and umami, and rated intensity of umami and bitter significantly higher than those with high sodium intake. These findings add to the body of evidence suggesting that taste changes occur with CKD, independent of age and gender differences, with specific impairment in sour, umami and salty tastes. Our finding that sodium intake is related to umami and bitter disturbance as well as salty taste warrants further investigation. Crown Copyright © 2014. Published by Elsevier Ltd. All rights reserved.

Children's assignment of gender to animal characters in pictures.

PubMed

Arthur, A G; White, H

1996-09-01

In previous research (DeLoache, Cassidy, & Carpenter, 1987), mothers' descriptions of gender-neutral animal characters were influenced by subtle gender stereo-types. The present research was an investigation of children's assignment of gender to the same neutral characters. The youngest children, 4 to 5 years old, usually assigned their own gender to the characters (bears). The 7- to 8-year-old and 10- to 11-year-old children were influenced by gender stereotypes. Solitary or noninteracting bears were less likely to receive female gender labels than were bears involved in adult-child interactions. Boys in the oldest age group were most influenced by the stereotypes.

Testing the Invariance of the National Health and Nutrition Examination Survey's Sexual Behavior Questionnaire Across Gender, Ethnicity/Race, and Generation.

PubMed

Zhou, Anne Q; Hsueh, Loretta; Roesch, Scott C; Vaughn, Allison A; Sotelo, Frank L; Lindsay, Suzanne; Klonoff, Elizabeth A

2016-02-01

Federal and state policies are based on data from surveys that examine sexual-related cognitions and behaviors through self-reports of attitudes and actions. No study has yet examined their factorial invariance--specifically, whether the relationship between items assessing sexual behavior and their underlying construct differ depending on gender, ethnicity/race, or age. This study examined the factor structure of four items from the sexual behavior questionnaire part of the National Health and Nutrition Examination Survey (NHANES). As NHANES provided different versions of the survey per gender, invariance was tested across gender to determine whether subsequent tests across ethnicity/race and generation could be done across gender. Items were not invariant across gender groups so data files for women and men were not collapsed. Across ethnicity/race for both genders, and across generation for women, items were configurally invariant, and exhibited metric invariance across Latino/Latina and Black participants for both genders. Across generation for men, the configural invariance model could not be identified so the baseline models were examined. The four item one factor model fit well for the Millennial and GenerationX groups but was a poor fit for the baby boomer and silent generation groups, suggesting that gender moderated the invariance across generation. Thus, comparisons between ethnic/racial and generational groups should not be made between the genders or even within gender. Findings highlight the need for programs and interventions that promote a more inclusive definition of "having had sex."

A Reliability and Validity Study of the Defining Issues Test: The Relationship of Age, Education, Gender and Parental Education with Moral Development

ERIC Educational Resources Information Center

Cesur, Sevim; Topcu, Mustafa Sami

2010-01-01

The aim of the study is twofold: First and main aim was to develop a valid and reliable Turkish version of the DIT which is one of the most important instruments in the psychology and education research; second is to explore the relationships between moral development and age, gender, education, and parental education. The study group consists of…

Gender and age differences in prevalence and incidence of child sexual abuse in Croatia

PubMed Central

Ajduković, Marina; Sušac, Nika; Rajter, Miroslav

2013-01-01

Aim To examine age and gender differences in the prevalence and incidence of child sexual abuse, the level of acquaintance of the child and the perpetrator, and correlations between experiencing family violence and sexual abuse on a nationally representative sample of 11, 13, and 16 years old children. Method A probabilistic stratified cluster sample included 2.62% of the overall population of children aged 11 (n = 1223), 13 (n = 1188), and 16 (n = 1233) from 40 primary and 29 secondary schools. A modified version of ISPCAN Child Abuse Screening Tool – Children's Version was used. Five items referred to child sexual abuse (CSA) for all age groups. Results In Croatia, 10.8% of children experienced some form of sexual abuse (4.8% to 16.5%, depending on the age group) during childhood and 7.7% of children experienced it during the previous year (3.7% to 11.1%, depending on the age group). Gender comparison showed no difference in the prevalence of contact sexual abuse, whereas more girls than boys experienced non-contact sexual abuse. Correlations between sexual abuse and physical and psychological abuse in the family were small, but significant. Conclusion Comparisons with international studies show that Croatia is a country with a low prevalence of CSA. The fact that the majority of perpetrators of sexual abuse are male and female peers indicates the urgent need to address risks of sexual victimization in the health education of children. PMID:24170726

Gender and age differences in prevalence and incidence of child sexual abuse in Croatia.

PubMed

Ajdukovic, Marina; Susac, Nika; Rajter, Miroslav

2013-10-28

To examine age and gender differences in the prevalence and incidence of child sexual abuse, the level of acquaintance of the child and the perpetrator, and correlations between experiencing family violence and sexual abuse on a nationally representative sample of 11, 13, and 16 years old children. A probabilistic stratified cluster sample included 2.62% of the overall population of children aged 11 (n=1223), 13 (n=1188), and 16 (n=1233) from 40 primary and 29 secondary schools. A modified version of ISPCAN Child Abuse Screening Tool - Children's Version was used. Five items referred to child sexual abuse (CSA) for all age groups. In Croatia, 10.8% of children experienced some form of sexual abuse (4.8% to 16.5%, depending on the age group) during childhood and 7.7% of children experienced it during the previous year (3.7% to 11.1%, depending on the age group). Gender comparison showed no difference in the prevalence of contact sexual abuse, whereas more girls than boys experienced non-contact sexual abuse. Correlations between sexual abuse and physical and psychological abuse in the family were small, but significant. Comparisons with international studies show that Croatia is a country with a low prevalence of CSA. The fact that the majority of perpetrators of sexual abuse are male and female peers indicates the urgent need to address risks of sexual victimization in the health education of children.

Cannabis use in early adolescence is associated with higher negative schizotypy in females.

PubMed

Albertella, L; Le Pelley, M E; Copeland, J

2017-09-01

The current study examined the relationship between early onset cannabis use (before age 16) and different schizotypy dimensions, and whether gender moderates these associations. Participants were 162 cannabis users, aged 15-24 years, who completed an online assessment examining alcohol and other drug use, psychological distress, and schizotypy. Participants were divided according to whether or not they had started using cannabis before the age of 16 (early onset=47; later onset=115) and gender (males=66; females=96). The interaction between gender and onset group was significantly associated with the dimension of introvertive anhedonia. Follow-up analyses showed that early onset cannabis use was associated with higher levels of introvertive anhedonia in females only. The current findings suggest that gender is an important moderator in the association between early onset cannabis use, schizotypy, and possibly, psychosis risk. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Trunk extensor and flexor strength capacity in healthy young elite athletes aged 11-15 years.

PubMed

Mueller, Juliane; Mueller, Steffen; Stoll, Josefine; Baur, Heiner; Mayer, Frank

2014-05-01

Differences in trunk strength capacity because of gender and sports are well documented in adults. In contrast, data concerning young athletes are sparse. The purpose of this study was to assess the maximum trunk strength of adolescent athletes and to investigate differences between genders and age groups. A total of 520 young athletes were recruited. Finally, 377 (n = 233/144 M/F; 13 ± 1 years; 1.62 ± 0.11 m height; 51 ± 12 kg mass; training: 4.5 ± 2.6 years; training sessions/week: 4.3 ± 3.0; various sports) young athletes were included in the final data analysis. Furthermore, 5 age groups were differentiated (age groups: 11, 12, 13, 14, and 15 years; n = 90, 150, 42, 43, and 52, respectively). Maximum strength of trunk flexors (Flex) and extensors (Ext) was assessed in all subjects during isokinetic concentric measurements (60°·s(-1); 5 repetitions; range of motion: 55°). Maximum strength was characterized by absolute peak torque (Flexabs, Extabs; N·m), peak torque normalized to body weight (Flexnorm, Extnorm; N·m·kg(-1) BW), and Flexabs/Extabs ratio (RKquot). Descriptive data analysis (mean ± SD) was completed, followed by analysis of variance (α = 0.05; post hoc test [Tukey-Kramer]). Mean maximum strength for all athletes was 97 ± 34 N·m in Flexabs and 140 ± 50 N·m in Extabs (Flexnorm = 1.9 ± 0.3 N·m·kg(-1) BW, Extnorm = 2.8 ± 0.6 N·m·kg(-1) BW). Males showed statistically significant higher absolute and normalized values compared with females (p < 0.001). Flexabs and Extabs rose with increasing age almost 2-fold for males and females (Flexabs, Extabs: p < 0.001). Flexnorm and Extnorm increased with age for males (p < 0.001), however, not for females (Flexnorm: p = 0.26; Extnorm: p = 0.20). RKquot (mean ± SD: 0.71 ± 0.16) did not reveal any differences regarding age (p = 0.87) or gender (p = 0.43). In adolescent athletes, maximum trunk strength must be discussed in a gender- and age-specific context. The Flexabs/Extabs ratio revealed extensor dominance, which seems to be independent of age and gender. The values assessed may serve as a basis to evaluate and discuss trunk strength in athletes.

Young people's views of mental health education in secondary schools: a Scottish study.

PubMed

Woolfson, R; Woolfson, L; Mooney, L; Bryce, D

2009-11-01

This exploratory study used mixed methods to investigate young people's preferences in the delivery of mental health education and to investigate possible age and gender differences. Information was gathered about the delivery of mental health education in three secondary schools. Nine pupil focus groups were carried out to identify key themes which were then further developed and administered through questionnaires to a larger sample of 773 pupils. Gender and age differences were found in young people's preferences about who should deliver mental health education, and what, when, where and how this should be delivered. Mental health education should reflect the needs of young people. Age and gender preferences should be considered when designing these programmes.

Age and gender are important considerations in choosing the sniffing position for laryngoscopic view.

PubMed

Park, Sung-Wook; Lee, Kang-Woo; Jang, Myung-Soo; Jung, Jun-Young; Lee, Bong-Jae; Kang, Jong-Man

2014-01-01

The sniffing position is considered to be the standard position for direct laryngoscopic viewing. This crossover study evaluated age and gender as variables in comparing the benefits of the sniffing position over simple head extension for laryngeal view during direct laryngoscopy. Laryngoscopy with a curved blade was performed on 200 anesthetized adults (100 males, 100 females) presenting for routine elective surgery. Glottic visualization was assessed by using the percentage of glottic opening (POGO) score in both simple extension and sniffing positions without the aid of the assistant or external laryngeal manipulation. Each gender group was divided into a younger group (< 50 years) and an older group (≥ 50 years). POGO scores were compared between both positions within each group. Mean (SD) POGO scores increased significantly only in younger male patients from 43% (39%) in the head extension position to 76% (30%) in the sniffing position. The sniffing position seems to be advantageous for getting a better laryngeal view during laryngoscopy for tracheal intubation in adult male patients less than 50 years old.

Drinking with mixed-gender groups is associated with heavy weekend drinking among young adults.

PubMed

Thrul, Johannes; Labhart, Florian; Kuntsche, Emmanuel

2017-03-01

To investigate how gender composition of the drinking group affects young adults' alcohol consumption on weekend evenings over and above the effect of drinking-group size. Using the internet-based cellphone-optimized assessment technique (ICAT), participants completed online questionnaires on their cell phones every hour from 8 p.m. to midnight on Thursday, Friday and Saturday evenings during five consecutive weekends. French-speaking Switzerland. Convenience sample of 183 young adults (53.0% female, mean age = 23.1) who completed a total of 4141 hourly assessments. Alcohol consumption and number of male and female friends present assessed at 8 p.m., 9 p.m., 10 p.m., 11 p.m. and midnight. Results of three-level negative binomial regression analyses showed that women consumed significantly more drinks per hour when drinking in mixed-gender groups (Z-values ranging from 2.9 to 5.3, all P < 0.01) and significantly fewer drinks when drinking with men only (Z = -2.7, P < 0.01), compared with drinking with women only. Men reported consuming more drinks per hour in mixed-gender groups of equal gender composition (Z = 2.4, P < 0.05) or mixed-gender groups with men in the majority (Z = 2.2, P < 0.05) and fewer hourly drinks when drinking with women only (Z = -4.9, P < 0.001), compared with drinking with men only. Drinking-group size predicted the hourly number of drinks for women (Z = 6.0, P < 0.001) and men (Z = 5.5, P < 0.001). Drinking-group gender composition is associated with number of drinks consumed per hour, over and above the impact of the drinking-group size. Young adults report consuming more drinks per hour when drinking with mixed-gender groups than with same-gender groups. © 2016 Society for the Study of Addiction.

Who uses NHS health checks? Investigating the impact of ethnicity and gender and method of invitation on uptake of NHS health checks.

PubMed

Cook, Erica J; Sharp, Chloe; Randhawa, Gurch; Guppy, Andy; Gangotra, Raj; Cox, Jonathon

2016-01-20

NHS Health Checks is a national risk assessment prevention programme for all individuals aged 40-74 that reside in England. Through the systematic assessment of an individual's ten year disease risk, this programme aims to provide early identification and subsequent management of this risk. However, there is limited evidence on how socio-demographic factors impact on uptake and what influence the invitation method has on uptake to this programme. NHS Health Check data from April 2013 to March 2014 was analysed (N = 50,485) for all 30 GP Practices in Luton, a culturally diverse town in England, UK. Data was collected for age, ethnicity, uptake (attendance and non attendance) and invitation method (letter written, verbal face-to-face, telephone). Actual usage of NHS Health Checks was determined for each ethnic group of the population and compared using Chi-square analysis. The overall uptake rate for Luton was 44 %, markedly lower that the set target of 50-75 %. The findings revealed a variation of uptake in relation to age, gender, level of deprivation. Ethnicity and gender variations were also found, with 'White British' 'Black Caribbean' and 'Indian' patients most likely to take up a NHS Health Check. However, patients from 'Any Other White Background' and 'Black African' were significantly less likely to uptake an NHS Health Check compared to all other ethnic groups. Ethnicity and gender differences were also noted in relation to invitation method. The findings revealed that different invitation methods were effective for different ethnic and gender groups. Therefore, it is suggested that established protocols of invitation are specifically designed for maximizing the response rate for each population group. Future research should now focus on uncovering the barriers to uptake in particular culturally diverse population groups to determine how public health teams can better engage with these communities.

Retrospective study of cancer types in different ethnic groups and genders at Karachi.

PubMed

Khaliq, Sheikh Abdul; Naqvi, Syed Baqir; Fatima, Anab

2013-12-01

Retrospective study of Cancer types in different ethnic groups & genders determines the pattern of cancers in different ethnic groups & genders during the last eight years reported in Oncology wards of hospitals of Karachi, Pakistan. Every single one male & female case with histologically and cytologically established cancer was enrolled from January 2003 to December 2010. Data for all patients were collected retrospectively by patient's file & charts, which represents the population of Karachi, Interior Sindh & Balochistan. 5134 patients (Male = 2432 / Female = 2702) investigated for their diagnosis of cancer type, ethnicity, age & gender. Classification of malignancy was done according to the International Classification of Disease coding system by W.H.O (ICD-10). The statistical analysis was performed for mean, standard error & proportions for ethnic groups & genders. Proportionately 47.37% males and among which major ethnic groups 17% Sindhi, 17% Immigrant, 4% Baloch, 3% Pukhtoon, ≈ 4% Punjabi, 1% Siraiki, 2% Minorities and 52.62% females, in which 16% Sindhi, 21% Immigrant, 4% Baloch 3% Pukhtoon, 5% Punjabi, 1% Siraiki, 3% Minorities. Mean age of males = 45.75 years, SE ± 0.227 and for females = 44.07, SE ± 0.183. The three most occurring tumors in all cancers of male were found Head & Neck, Adenoma/Carcinoma of Glands & Body cavity membranes, GIT, and females Breast, Head & Neck, Adenoma/Carcinoma of Glands & Body cavity membranes, GIT. The analysis of data indicates Head & Neck is most common cancer among male, in the similar way Breast cancer is the most common malignancy among female.

When and Why Dropouts Leave High School

ERIC Educational Resources Information Center

Stearns, Elizabeth; Glennie, Elizabeth J.

2006-01-01

Teens may leave school because of academic failure, disciplinary problems, or employment opportunities. In this article, the authors test whether the reasons dropouts leave school differ by grade level and age. We compare dropout rates and reasons across grade levels and ages for all high school students, ethnic groups, and gender groups. Across…

Postural control assessment in students with normal hearing and sensorineural hearing loss.

PubMed

Melo, Renato de Souza; Lemos, Andrea; Macky, Carla Fabiana da Silva Toscano; Raposo, Maria Cristina Falcão; Ferraz, Karla Mônica

2015-01-01

Children with sensorineural hearing loss can present with instabilities in postural control, possibly as a consequence of hypoactivity of their vestibular system due to internal ear injury. To assess postural control stability in students with normal hearing (i.e., listeners) and with sensorineural hearing loss, and to compare data between groups, considering gender and age. This cross-sectional study evaluated the postural control of 96 students, 48 listeners and 48 with sensorineural hearing loss, aged between 7 and 18 years, of both genders, through the Balance Error Scoring Systems scale. This tool assesses postural control in two sensory conditions: stable surface and unstable surface. For statistical data analysis between groups, the Wilcoxon test for paired samples was used. Students with hearing loss showed more instability in postural control than those with normal hearing, with significant differences between groups (stable surface, unstable surface) (p<0.001). Students with sensorineural hearing loss showed greater instability in the postural control compared to normal hearing students of the same gender and age. Copyright © 2014 Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Published by Elsevier Editora Ltda. All rights reserved.

Dimensionality and measurement invariance in the Satisfaction with Life Scale in Norway.

PubMed

Clench-Aas, Jocelyne; Nes, Ragnhild Bang; Dalgard, Odd Steffen; Aarø, Leif Edvard

2011-10-01

Results from previous studies examining the dimensionality and factorial invariance of the Satisfaction with Life Scale (SWLS) are inconsistent and often based on small samples. This study examines the factorial structure and factorial invariance of the SWLS in a Norwegian sample. Confirmatory factor analysis (AMOS) was conducted to explore dimensionality and test for measurement invariance in factor structure, factor loadings, intercepts, and residual variance across gender and four age groups in a large (N = 4,984), nationally representative sample of Norwegian men and women (15-79 years). The data supported a modified unidimensional structure. Factor loadings could be constrained to equality between the sexes, indicating metric invariance between genders. Further testing indicated invariance also at the strong and strict levels, thus allowing analyses involving group means. The SWLS was shown to be sensitive to age, however, at the strong and strict levels of invariance testing. In conclusion, the results in this Norwegian study seem to confirm that a unidimensional structure is acceptable, but that a modified single-factor model with correlations between error terms of items 4 and 5 is preferred. Additionally, comparisons may be made between the genders. Caution must be exerted when comparing age groups.

Cycling provision separated from motor traffic: a systematic review exploring whether stated preferences vary by gender and age.

PubMed

Aldred, Rachel; Elliott, Bridget; Woodcock, James; Goodman, Anna

2017-01-02

In this paper, we represent a systematic review of stated preference studies examining the extent to which cycle infrastructure preferences vary by gender and by age. A search of online, English-language academic and policy literature was followed by a three-stage screening process to identify relevant studies. We found 54 studies that investigated whether preferences for cycle infrastructure varied by gender and/or by age. Forty-four of these studies considered the extent of separation from motor traffic. The remainder of the studies covered diverse topics, including preferred winter maintenance methods and attitudes to cycle track lighting. We found that women reported stronger preferences than men for greater separation from motor traffic. There was weaker evidence of stronger preferences among older people. Differences in preferences were quantitative rather than qualitative; that is, preferences for separated infrastructure were stronger in some groups than in others, but no group preferred integration with motor traffic. Thus, in low-cycling countries seeking to increase cycling, this evidence suggests focusing on the stronger preferences of under-represented groups as a necessary element of universal design for cycling.

Cycling provision separated from motor traffic: a systematic review exploring whether stated preferences vary by gender and age

PubMed Central

Aldred, Rachel; Elliott, Bridget; Woodcock, James; Goodman, Anna

2017-01-01

ABSTRACT In this paper, we represent a systematic review of stated preference studies examining the extent to which cycle infrastructure preferences vary by gender and by age. A search of online, English-language academic and policy literature was followed by a three-stage screening process to identify relevant studies. We found 54 studies that investigated whether preferences for cycle infrastructure varied by gender and/or by age. Forty-four of these studies considered the extent of separation from motor traffic. The remainder of the studies covered diverse topics, including preferred winter maintenance methods and attitudes to cycle track lighting. We found that women reported stronger preferences than men for greater separation from motor traffic. There was weaker evidence of stronger preferences among older people. Differences in preferences were quantitative rather than qualitative; that is, preferences for separated infrastructure were stronger in some groups than in others, but no group preferred integration with motor traffic. Thus, in low-cycling countries seeking to increase cycling, this evidence suggests focusing on the stronger preferences of under-represented groups as a necessary element of universal design for cycling. PMID:28190905

The role of adolescents' morality and identity in volunteering. Age and gender differences in a process model.

PubMed

van Goethem, Anne A J; van Hoof, Anne; van Aken, Marcel A G; Raaijmakers, Quinten A W; Boom, Jan; de Castro, Bram Orobio

2012-06-01

The aim of this study was to explain adolescents' volunteering in terms of their morality and identity and to examine the moderation effect of gender and age in this process. Data were collected among 698 Dutch adolescents aged 12 to 20 (M = 15.19; SD = 1.43). Adolescents' moral reasoning was positively associated with understanding moral issues and thinking about public responsibility towards these issues. In turn, moral understanding, along with being personally committed to act upon moral issues, were positively associated with identity. Extending the number of identity contexts tended to be related to being more likely to volunteer and to more volunteering involvement. Adolescents' identity integration was not related to how likely they were to volunteer, and was negatively related to their volunteering involvement. Clearer effects were found when differentiating between adolescent gender and age groups. Future research could examine this process over time, along with additional factors that may further explain adolescents' volunteering, and examine their age and gender specific effects. Copyright © 2011 The Foundation for Professionals in Services for Adolescents. Published by Elsevier Ltd. All rights reserved.

Evaluative ratings and attention across the life span: emotional arousal and gender.

PubMed

Ferrari, Vera; Bruno, Nicola; Chattat, Rabih; Codispoti, Maurizio

2017-04-01

This study was designed to investigate the evolution of emotional processing over the whole adult life span as a function of stimulus arousal and participants' gender. To this end, self-reported affective evaluation and attentional capture prompted by pleasant and unpleasant pictures varying in arousal were measured in a large sample of participants (n = 211) balanced by gender and equally spread across seven decades from 20 to 90 years. Results showed age differences only for affective evaluation of pleasant stimuli, with opposite patterns depending on stimulus arousal. As age increased, low-arousing pleasant cues (e.g. images of babies) were experienced as more pleasant and arousing by both males and females, whereas high-arousing stimuli (e.g. erotic images) were experienced as less pleasant only by females. In contrast, emotional pictures (both pleasant and unpleasant) were effective at capturing attention in a similar way across participants, regardless of age and gender. Taken together, these findings suggest that specific emotional cues prompt different subjective responses across different age groups, while basic mechanisms involved in attentional engagement towards both pleasant and unpleasant stimuli are preserved in healthy ageing.

Immunohistochemical Patterns in the Interfollicular Caucasian Scalps: Influences of Age, Gender, and Alopecia

PubMed Central

Piérard-Franchimont, Claudine; Loussouarn, Geneviève; Panhard, Ségolène; Saint Léger, Didier; Mellul, Myriam; Piérard, Gérald E.

2013-01-01

Skin ageing and gender influences on the scalp have been seldom studied. We revisited the changes in the interfollicular scalp. The study was performed on a population of 650 volunteers (300 women and 350 men) for over 7 years. Three age groups were selected in both genders, namely, subjects aged 20–35, 50–60, and 60–70 years. The hair status was further considered according to nonalopecic and alopecic patterns and severity (discrete, moderate, and severe). Biopsies from the parietal area were processed for immunohistochemistry. Stromal cells were distinguished according to the presence of vimentin, Factor XIIIa, CD117, and versican. Blood and lymphatic vessels were highlighted by Ulex europaeus agglutinin-1 and human podoplanin immunoreactivities, respectively. Actinic elastosis was identified by the lysozyme coating of elastic fibres. The epidermis was explored using the CD44 variant 3 and Ki67 immunolabellings. Biplot analyses were performed. Immunohistochemistry revealed a prominent gender effect in young adults. Both Factor XIIIa+ dermal dendrocytes and the microvasculature size decreased with scalp ageing. Alopecia changes mimicked stress-induced premature senescence. PMID:24455724

Behavioral Health Treatment Patterns Among Employer-Insured Adults in Same- and Different-Gender Marriages and Domestic Partnerships.

PubMed

Tran, Linda Diem; Xu, Haiyong; Azocar, Francisca; Ettner, Susan L

2018-05-01

This study examined specialty behavioral health treatment patterns among employer-insured adults in same- and different-gender domestic partnerships and marriages. The study used behavioral health service claims (2008-2013) from Optum to estimate gender-stratified penetration rates of behavioral health service use by couple type and partnership status among partnered adults ages 18-64 (N=12,727,292 person-years) and levels of use among those with any use (conditional analyses). Least-squares, logistic, and zero-truncated negative binomial regression analyses adjusted for age, employer and plan characteristics, and provider supply and for sociodemographic factors in sensitivity analyses. Generalized estimating equations were used to address within-group correlation of adults clustered in employer groups. Both women and men in same-gender marriages or domestic partnerships had higher rates of behavioral health service use, particularly diagnostic evaluation, individual psychotherapy, and medication management, and those in treatment had, on average, more psychotherapy visits than those in different-gender marriages. Behavioral health treatment patterns were similar between women in same-gender domestic partnerships and same-gender marriages, but they diverged between men in same-gender domestic partnerships and same-gender marriages. Moderation analysis results indicated that adults with same-gender partners living in states with fewer legal protections for lesbian, gay, bisexual, and transgender persons were less likely than adults with same-gender partners in LGBT-friendly states to receive behavioral health treatment. Sensitivity analyses did not affect findings. Behavioral health treatment patterns varied by couple type, partnership status, and gender. Results highlight the importance of increasing service acceptability and delivering inclusive, culturally relevant behavioral health treatment for lesbian, gay, and bisexual persons.

[Gender and age dependent mortality from nervous diseases in Azerbaijan].

PubMed

Mamedbeyli, A K

2015-01-01

To assess age- and sex-related changes in the mortality from nervous diseases at the population level. Methods of descriptive statistics and analysis of qualitative traits were applied. We analyzed 13580 medical certificates of cause of death from nervous diseases (all classes of ICD-10). The mortality rate varied with age, the main trend of which was the dynamic growth. Age-specific mortality rates for men and women differed from each other: in most ages (20-24, 30-34, 45-49, 50-54, 55-59, 65-69), the likelihood of mortality was higher in men, and at the age of 5-9, 15-19, 60-64, 70 and more years in women. After the standardization of gender differences by age, the mortality risk of nervous illnesses disappeared (146.74 and 144.16 per 100 thousand for men and women, respectively).  There were significant differences in the proportion of nervous diseases of all-cause mortality among the population in the groups stratified by age and sex. It is believed that situational factors is a cause of actual prevailing of gender age- and sex-related mortality risks. Gender features of age-related risk of mortality from nervous diseases are characterized by the multidirectional dynamics of likelihood of mortality and specific weight of nervous diseases among all causes of mortality. The actual gender features of age-related risk of mortality from nervous diseases are generally caused by situational factors (different age structure and unequal level of the general mortality among male and female population) which disappear after standardization.

Birth order and sibling sex ratio of children and adolescents referred to a gender identity service.

PubMed

Vanderlaan, Doug P; Blanchard, Ray; Wood, Hayley; Zucker, Kenneth J

2014-01-01

In adult male samples, homosexuality is associated with a preponderance of older brothers (i.e., the fraternal birth order effect). In several studies comparing gender dysphoric youth, who are likely to be homosexual in adulthood, to clinical or non-clinical control groups, the findings have been consistent with the fraternal birth order effect in males; however, less is known about unique sibship characteristics of gender dysphoric females. The current study investigated birth order and sibling sex ratio in a large sample of children and adolescents referred to the same Gender Identity Service (N = 768). Probands were classified as heterosexual males, homosexual males, or homosexual females based on clinical diagnostic information. Groups differed significantly in age and sibship size, and homosexual females were significantly more likely to be only children. Subsequent analyses controlled for age and for sibship size. Compared to heterosexual males, homosexual males had a significant preponderance of older brothers and homosexual females had a significant preponderance of older sisters. Similarly, the older sibling sex ratio of homosexual males showed a significant excess of brothers whereas that of homosexual females showed a significant excess of sisters. Like previous studies of gender dysphoric youth and adults, these findings were consistent with the fraternal birth order effect. In addition, the greater frequency of only children and elevated numbers of older sisters among the homosexual female group adds to a small literature on sibship characteristics of potential relevance to the development of gender identity and sexual orientation in females.

Trends in overweight or obesity and other anthropometric indices in adults aged 18-60 years in western Saudi Arabia.

PubMed

Azzeh, Firas Sultan; Bukhari, Hassan Mazzhar; Header, Eslam Ahmed; Ghabashi, Mai Adil; Al-Mashi, Salma Saad; Noorwali, Nafeesah Mohammed

2017-01-01

The prevalence of overweight and obesity has increased considerably in Saudi Arabia in the past two decades. We conducted this study because to examine trends in weight gain with age and related anthropometric measurements in Saudi Arabia such data are limited. To determine trends in overweight and obesity and examine anthropometric indices by age group. Analytical cross-sectional study. Universities, malls, and hospitals in the cities of Mecca, Jeddah, and Al-Taif. Participants were selected by convenience sampling. Body weight, body fat percentage, visceral fat percentage, and skeletal muscle percentage were measured with the Omron body composition monitor device. Waist circumference, height, and body mass index (BMI) were also measured. Changes in BMI, body fat percentage, visceral fat percentage, and skel-etal muscle with age for both genders. We selected 2548 Saudis, 1423 males and 1125 females, aged 18 to 60 years. A significant trend (ptrend < .001) for BMI and all anthropometric indices was observed with age for both genders. About 55.1% of the participants were overweight and obese (BMI > 25 kg/m2). Obesity and overweight were more prevalent in men than in women and was observed early in both genders, at the ages of 18-19 in men and 30-39 years for women. In the age range of 40-60 years, muscle mass dropped significantly (P < .05) for both genders. Mean waist circumference and visceral fat were significantly (P < .001) higher in men than in women, but the mean total body fat percentage was higher in females than in males (P < .001). Significant trends were observed for BMI, WC, body fat, visceral fat, and muscle mass for both genders with age. National programs should be maintained to encourage physical activity and weight reduction as well as focusing on obesity-related lifestyle and behaviors at early ages to prevent weight gain and possibly muscle wasting with age. There was an unequal distribution in numbers of subjects between study groups. Convenience sampling was used to recruit the participants.

Revisiting the impact of macroeconomic conditions on health behaviours.

PubMed

Di Pietro, Giorgio

2018-02-01

This paper estimates the average population effect of macroeconomic conditions on health behaviours accounting for the heterogeneous impact of the business cycle on individuals. While previous studies use models relying on area-specific unemployment rates to estimate this average effect, this paper employs a model based on area-specific unemployment rates by gender and age group. The rationale for breaking down unemployment rates is that the severity of cyclical upturns and downturns does not only significantly vary across geographical areas, but also across gender and age. The empirical analysis uses microdata from the Italian Multipurpose Household Survey on Everyday Life Issues. The estimates suggest that models employing aggregated and disaggregated unemployment rate measures as a proxy for the business cycle produce similar findings for some health behaviours (such as smoking), whereas different results are obtained for others. While using unemployment rates by gender and age group, fruits and/or vegetables consumption turns out to be procyclical (a 1pp increase in this unemployment rate decreases the probability of consuming at least five daily fruit and/or vegetable servings by 0.0016pp), the opposite effect, though statistically insignificant, is observed once general unemployment rates are used. While both models conclude that physical activity declines during economic downturns, the size of the procyclical effect is much smaller when employing disaggregated rather than aggregated unemployment rates (a 1pp increase in the unemployment rate by gender and age group decreases the probability of doing any physical activity by 0.0017pp). Copyright © 2017 Elsevier B.V. All rights reserved.

Age- and gender-related difference of vocal fold vibration and glottal configuration in normal speakers: analysis with glottal area waveform.

PubMed

Yamauchi, Akihito; Yokonishi, Hisayuki; Imagawa, Hiroshi; Sakakibara, Ken-Ichi; Nito, Takaharu; Tayama, Niro; Yamasoba, Tatsuya

2014-09-01

Glottal area waveform (GAW) analysis is widely used in the assessment of vocal fold vibration by high-speed digital imaging (HSDI). Because normative GAW data obtained from a large number of subjects have not been reported, we conducted a prospective study to obtain normative results for GAW analysis of HSDI findings and clarify normal variations associated with gender and age. Vocally healthy adults were divided into a young group (aged ≤ 35 years) and an elderly group (aged ≥ 65 years). The configuration and size of the glottal area were assessed at different phases of the glottal cycle, and gender- and age-related differences were evaluated. A total of 26 young subjects (nine men and 17 women; mean age: 27 years) and 20 elderly subjects (eight men and 12 women; mean age: 73 years) were investigated. The glottal area at different points of the glottal cycle showed a negative correlation with frequency. Although the GAW parameters of young women appeared to be different from those of the other subgroups, the differences were not statistically significant. Young women predominantly had a triangular- or vase-shaped glottal configuration at all frequencies, whereas the other subgroups showed various glottal shapes. The present study clarified gender- and age-related differences of GAW parameters obtained with HSDI. Young women were likely to show different glottal configurations and different responses to frequency changes from those of young men, elderly men, and elderly women. Phonosurgeons should pay attention to the normal variations detected in the present study. Copyright © 2014 The Voice Foundation. Published by Elsevier Inc. All rights reserved.

Effects of vernal and allergic conjunctivitis on severity of keratoconus

PubMed Central

Cingu, Abdullah Kursat; Cinar, Yasin; Turkcu, Fatih Mehmet; Sahin, Alparslan; Ari, Seyhmus; Yuksel, Harun; Sahin, Muhammed; Caca, Ihsan

2013-01-01

AIM To demonstrate the effects of two different types of allergic conjunctivitis on severity of keratoconus (KC). METHODS We retrospectively reviewed the medical records of 171 KC patients referred between June 2010 and June 2011. The KC patients were divided into 3 groups as KC (group A), KC with vernal keratoconjunctivitis (VKC) (group B) and KC with allergic conjunctivitis (AC) (group C). Main outcome measures were demographic and ocular clinical features including age at presentation, gender, spherical equivalent (SE), best spectacle corrected visual acuity (BCVA), mean keratometric measurement (Km), central corneal thickness (CCT), and intraocular pressure (IOP). Groups were compared in term of study variables. RESULTS The median age at presentation was significantly lower in group B (P<0.001). According to the median SE (P=0.003), BCVA (P=0.022), Km (P<0.001), CCT (P=0.015) and Amsler–Krumeich classification (P<0.001), KC was more severe in group B. There was no significant difference in terms of IOP and corrected IOP among the groups (P=0.44), however there were 4 patients who had increased corrected IOP developed after topical corticosteroid use in group B. The differences among the groups persisted even after controlling for age and gender. CONCLUSION Our findings demonstrated a more severe KC in VKC patients despite their younger age which suggests evaluation of VKC patients as a separate group in keratoconus disease. PMID:23826535

Effects of vernal and allergic conjunctivitis on severity of keratoconus.

PubMed

Cingu, Abdullah Kursat; Cinar, Yasin; Turkcu, Fatih Mehmet; Sahin, Alparslan; Ari, Seyhmus; Yuksel, Harun; Sahin, Muhammed; Caca, Ihsan

2013-01-01

To demonstrate the effects of two different types of allergic conjunctivitis on severity of keratoconus (KC). We retrospectively reviewed the medical records of 171 KC patients referred between June 2010 and June 2011. The KC patients were divided into 3 groups as KC (group A), KC with vernal keratoconjunctivitis (VKC) (group B) and KC with allergic conjunctivitis (AC) (group C). Main outcome measures were demographic and ocular clinical features including age at presentation, gender, spherical equivalent (SE), best spectacle corrected visual acuity (BCVA), mean keratometric measurement (Km), central corneal thickness (CCT), and intraocular pressure (IOP). Groups were compared in term of study variables. The median age at presentation was significantly lower in group B (P<0.001). According to the median SE (P=0.003), BCVA (P=0.022), Km (P<0.001), CCT (P=0.015) and Amsler-Krumeich classification (P<0.001), KC was more severe in group B. There was no significant difference in terms of IOP and corrected IOP among the groups (P=0.44), however there were 4 patients who had increased corrected IOP developed after topical corticosteroid use in group B. The differences among the groups persisted even after controlling for age and gender. Our findings demonstrated a more severe KC in VKC patients despite their younger age which suggests evaluation of VKC patients as a separate group in keratoconus disease.

Changing patterns in the association between regional socio-economic context and dental caries experience according to gender and age: a multilevel study in Korean adults.

PubMed

Lee, Hoo-Yeon; Choi, Youn-Hee; Park, Hyoung Wook; Lee, Sang Gyu

2012-07-28

Little is known about the effects of socio-environmental factors on dental caries in different demographic situations in Asian populations. We investigated whether the nature of the association between regional socio-economic context and dental caries experience differed according to gender and age groups in Korean adults. We obtained a linked data set containing individual information from the 2000 Korean National Oral Health Survey and regional information from the "Major statistical indices of Si-Gun-Gu" (city-county-ward), published by the Korean Statistical Office. We stratified participants into women and men and into four 10-year-interval age groups (19-34, 35-44, 45-54, and 55-64 years) and analysed the linked data using a multilevel analysis. In total, 5,259 individuals were included in the final study population. Regional socio-economic context was significantly associated with dental caries experience in men, but not in women. The patterns of the association between regional contextual variables and dental caries experience differed among age groups. People 35-44 years of age living in areas less dependent on the manufacturing industry and those 45-54 years of age living in areas where local government was relatively poor were more prone to have caries experience. The results of this study indicated that socio-economic factors affecting residents' dental health status may operate through different mechanisms or degrees according to geographic location, suggesting that some gender- and age-defined subgroups may be likely to benefit from different types of intervention, including the development of specific health policies.

Item response theory analyses of the Delis-Kaplan Executive Function System card sorting subtest.

PubMed

Spencer, Mercedes; Cho, Sun-Joo; Cutting, Laurie E

2018-02-02

In the current study, we examined the dimensionality of the 16-item Card Sorting subtest of the Delis-Kaplan Executive Functioning System assessment in a sample of 264 native English-speaking children between the ages of 9 and 15 years. We also tested for measurement invariance for these items across age and gender groups using item response theory (IRT). Results of the exploratory factor analysis indicated that a two-factor model that distinguished between verbal and perceptual items provided the best fit to the data. Although the items demonstrated measurement invariance across age groups, measurement invariance was violated for gender groups, with two items demonstrating differential item functioning for males and females. Multigroup analysis using all 16 items indicated that the items were more effective for individuals whose IRT scale scores were relatively high. A single-group explanatory IRT model using 14 non-differential item functioning items showed that for perceptual ability, females scored higher than males and that scores increased with age for both males and females; for verbal ability, the observed increase in scores across age differed for males and females. The implications of these findings are discussed.

Is child walking conditioned by gender? Surface EMG patterns in female and male children.

PubMed

Di Nardo, Francesco; Laureati, Giulio; Strazza, Annachiara; Mengarelli, Alessandro; Burattini, Laura; Agostini, Valentina; Nascimbeni, Alberto; Knaflitz, Marco; Fioretti, Sandro

2017-03-01

EMG-based differences between females and males during walking are generally acknowledged in adults. Aim of the study was the quantification of possible gender differences in myoelectric activity of gastrocnemius lateralis (GL) and tibialis anterior (TA) during walking in school-age children. Gender-related comparison with adults was also provided to get possible novel insight in maturation of gait. To this aim, Statistical gait analysis, a recent methodology performing a statistical characterization of gait by averaging spatial-temporal and surface-EMG-based parameters over hundreds of strides, was performed in100 healthy school-age children (C-group) and in 33 healthy young adults (YA-group). On average, 301±110 consecutive strides were analyzed for each subject. In C-group, no significant differences (p>0.05) were observed between females and males in GL and TA, considering mean onset/offset instants of activation and occurrence frequency. Stratifying the C-group for age, small differences between females and males in occurrence frequency of GL arose in oldest children. In YA-group, females showed a significant propensity for a more complex recruitment of TA and GL (higher number of activations during gait cycle, quantified by occurrence frequency) compared to males. These outcomes suggest that gender-related differences in sEMG parameters do not characterize the recruitment of GL and TA during child walking in early years (6-8 years), start occurring when adolescence is approaching (10-12 years), and are acknowledged in both ankle muscles only in adults. Present findings seem to support previous studies on maturation of gait which indicate adolescence as the time-range where gait is completing its maturation path. Copyright © 2017 Elsevier B.V. All rights reserved.

Parental satisfaction in Ugandan children with cleft lip and palate following synchronous lip and palatal repair.

PubMed

Luyten, Anke; D'haeseleer, Evelien; Budolfsen, Dorte; Hodges, Andrew; Galiwango, George; Vermeersch, Hubert; Van Lierde, Kristiane

2013-01-01

The purpose of the present case control study was to assess parental satisfaction with speech and facial appearance in Ugandan children with complete unilateral or bilateral cleft lip and palate (CLP), who underwent a synchronous lip and palatal closure. The results are compared with an age- and gender-matched control group. The experimental group consisted of the parents or guardians of 44 Ugandan patients (21 males, 23 females) with complete unilateral or bilateral CLP (mean age: 3;1 years). The control group included the foster mothers of 44 orphan children matched by age and gender (mean age: 3;7 years). A survey based on the Cleft Evaluation Profile was used to assess the perceived satisfaction for individual features related to cleft care. Overall high levels of satisfaction were observed in the experimental group for all features (range: 56-100%). No significant differences could be established regarding age, gender, age of lip and palatal closure, cleft type or maternal vs. paternal judgments. In participants who were dissatisfied with the appearance of the lip, the time period between the cleft closure and the survey was significantly larger compared with satisfied participants. Furthermore, significantly lower levels of satisfaction were observed in the cleft group for speech and the appearance of the teeth and the nose compared with the control group. Satisfaction with speech and facial appearance in Ugandan children with cleft lip and/or palate is important since normal esthetics and speech predominantly determine the children's social acceptance in the Ugandan society. As a result of reading this manuscript, the reader will be able to explain the attitudes of parents toward the surgical repair of their children's cleft lip and palate. As a result of reading this manuscript, the reader will be able to identify differences in parental attitudes toward synchronous lip and palate repair. Copyright © 2013 Elsevier Inc. All rights reserved.

Beyond the Binary: Differences in Eating Disorder Prevalence by Gender Identity in a Transgender Sample.

PubMed

Diemer, Elizabeth W; White Hughto, Jaclyn M; Gordon, Allegra R; Guss, Carly; Austin, S Bryn; Reisner, Sari L

2018-01-01

Purpose: To investigate whether the prevalence of eating disorders (EDs) differs across diverse gender identity groups in a transgender sample. Methods: Secondary analysis of data from Project VOICE, a cross-sectional study of stress and health among 452 transgender adults (ages 18-75 years) residing in Massachusetts. Age-adjusted logistic regression models were fit to compare the prevalence of self-reported lifetime EDs in female-to-male (FTM), male-to-female (MTF), and gender-nonconforming participants assigned male at birth (MBGNC) to gender-nonconforming participants assigned female at birth (FBGNC; referent). Results: The age-adjusted odds of self-reported ED in MTF participants were 0.14 times the odds of self-reported ED in FBGNC participants ( p =0.022). In FTM participants, the age-adjusted odds of self-reported ED were 0.46 times the odds of self-reported ED in FBGNC participants, a marginally significant finding ( p =0.068). No statistically significant differences in ED prevalence were found for MBGNC individuals. Conclusions: Gender nonconforming individuals assigned a female sex at birth appear to have heightened lifetime risk of EDs relative to MTF participants. Further research into specific biologic and psychosocial ED risk factors and gender-responsive intervention strategies are urgently needed. Training clinical providers and ensuring competency of treatment services beyond the gender binary will be vital to addressing this disparity.

Beyond the Binary: Differences in Eating Disorder Prevalence by Gender Identity in a Transgender Sample

PubMed Central

Diemer, Elizabeth W.; White Hughto, Jaclyn M.; Gordon, Allegra R.; Guss, Carly; Austin, S. Bryn; Reisner, Sari L.

2018-01-01

Abstract Purpose: To investigate whether the prevalence of eating disorders (EDs) differs across diverse gender identity groups in a transgender sample. Methods: Secondary analysis of data from Project VOICE, a cross-sectional study of stress and health among 452 transgender adults (ages 18–75 years) residing in Massachusetts. Age-adjusted logistic regression models were fit to compare the prevalence of self-reported lifetime EDs in female-to-male (FTM), male-to-female (MTF), and gender-nonconforming participants assigned male at birth (MBGNC) to gender-nonconforming participants assigned female at birth (FBGNC; referent). Results: The age-adjusted odds of self-reported ED in MTF participants were 0.14 times the odds of self-reported ED in FBGNC participants (p=0.022). In FTM participants, the age-adjusted odds of self-reported ED were 0.46 times the odds of self-reported ED in FBGNC participants, a marginally significant finding (p=0.068). No statistically significant differences in ED prevalence were found for MBGNC individuals. Conclusions: Gender nonconforming individuals assigned a female sex at birth appear to have heightened lifetime risk of EDs relative to MTF participants. Further research into specific biologic and psychosocial ED risk factors and gender-responsive intervention strategies are urgently needed. Training clinical providers and ensuring competency of treatment services beyond the gender binary will be vital to addressing this disparity. PMID:29359198

"No Silly Girls' Films!" Analysis of Estonian Preschool Children's Gender Specific Tastes in Media Favourites and Their Possible Implications for Preschool Learning Practices

ERIC Educational Resources Information Center

Siibak, Andra; Vinter, Kristi

2014-01-01

Although children often look for guidance on what is gender-appropriate behaviour from the media, children's media favourites are still an underused learning resource in preschools, especially in the context of engaging in gender and values education. Focus-group interviews were conducted with 61 children aged from 5.5 to 7 years from three…

Enculturation and attitudes toward intimate partner violence and gender roles in an asian Indian population: implications for community-based prevention.

PubMed

Yoshihama, Mieko; Blazevski, Juliane; Bybee, Deborah

2014-06-01

This study examined the relationships among enculturation, attitudes supporting intimate partner violence (IPV-supporting attitudes), and gender role attitudes among one of the largest Asian Indian population groups in the US. Data were collected via computer-assisted telephone interviews with a random sample of Gujarati men and women aged 18-64 in Metropolitan Detroit. Using structural equation modeling, we modeled the effects of three components of enculturation (behavior, values, and community participation) on gender role attitudes and IPV-supporting attitudes among married respondents (N = 373). Analyses also accounted for the effects of respondent age, education, religious service attendance, perceived financial difficulty, and lengths of residence in the US. The second-order, overall construct of enculturation was the strongest predictor of IPV-supporting attitudes (standardized B = 0.61), but not gender role attitudes. Patriarchal gender role attitudes were positively associated with IPV-supporting attitudes (B = 0.49). In addition to the overall effect of the enculturation construct, two of the components of enculturation had specific effects. "Enculturation-values" had a specific positive indirect association with IPV-supporting attitudes, through its relationship with patriarchal gender role attitudes. However, "enculturation-community participation" was negatively associated with IPV-supporting attitudes, suggesting the importance of community-based prevention of IPV among this immigrant population group.

Analysis of IR spectra of mineralized deposits on human cardiac valves

NASA Astrophysics Data System (ADS)

Ivanov-Omskii, V. I.; Yastrebov, S. G.; Gulyaev, N. I.

2017-05-01

IR spectroscopy in the range of vibration of hydroxy groups has been used to analyze the binding energy of mineralized deposits to cardiac valves of patients of varied gender and age. A tendency was revealed toward a gender-independent rise in the binding energy of mineralized deposits to valve tissues with increasing age of patients. The analysis enables making recommendations concerning the early diagnostics of valve calcination, monitoring of its development, and therapy of calcinoses.

Gender and theory of mind in preschoolers' group effort: evidence for timing differences behind children's earliest social loafing.

PubMed

Thompson, R Bruce; Thornton, Bill

2014-01-01

This study explored mental state reasoning within the context of group effort and possible differences in development between boys and girls. Preschool children (59 girls, 47 boys) were assessed for theory of mind (ToM) ability using classic false belief tests. Children participated in group effort conditions that alternated from one condition, where individual effort was transparent and obvious, to one where individual effort remained anonymous. The aim was to investigate if emergent mental state reasoning, after controlling for age, was associated with the well-known phenomenon of reduced effort in group tasks ("social loafing"). Girls had slightly higher ToM scores and social loafing than boys. Hierarchical regression, controlling for age, indicated that understanding of others' false beliefs uniquely predicted social loafing and interacted weakly with gender status.

Gender, age, and cultural differences in the Japanese version of the Infant-Toddler Social and Emotional Assessment.

PubMed

Yago, Satoshi; Hirose, Taiko; Kawamura, Aki; Omori, Takahide; Okamitsu, Motoko

2015-01-01

This study aimed to clarify the characteristics of the Japanese version of the Infant-Toddler Social and Emotional Assessment (J-ITSEA), a parentreport questionnaire concerning social-emotional/behavioral problems and delays in competence in 1- to 3-year-old children. The differences in score between genders, ages, and between the J-ITSEA and the original Infant-Toddler Social and Emotional Assessment were examined. The data of 617 participants recruited from Saitama prefecture through stratified two-stage sampling were analyzed. The Cronbach's alpha ranged from 0.76 to 0.93. Gender differences emerged for some problems and all competence scales, with boys rated higher in the Externalizing problem domain and Activity/Impulsivity subscale and girls rated higher in the Internalizing problem domain, Inhibition to Novelty subscale, and all Competence scales. The Competence domain score increased across age groups. Compared with a normative sample in the US, participants in this study rated higher in Aggression/Defiance and Separation Distress, and rated lower in Peer Aggression and most of the Competence scales. The results indicate that the J-ITSEA scores should be interpreted in comparison with standard scores assigned for gender and 6-month age groups, and that specific criteria for the cut-off points for the J-ITSEA are required instead of those in the original questionnaire.

Varying age-gender associations between body mass index and urban greenspace.

PubMed

Sander, Heather A; Ghosh, Debarchana; Hodson, Cody B

2017-08-01

Urban greenspace benefits urbanites in numerous ways ranging from regulating flooding, air quality, and local climate to providing opportunities for exercise and relaxation. These benefits may influence human health. Greenspace, for example, may facilitate exercise, thereby helping to reduce body mass index (BMI) and combat obesity, a current epidemic of great public health concern. Little evidence exists to support this assertion, however, and we lack a full understanding of the mechanisms whereby this relationship operates, the populations for whom greenspace is linked to weight status, and the aspects of urban greenspace that are linked to weight status. This study seeks to identify relationships among the composition and arrangement of greenspace and BMI for different populations using regression models for eight age and gender groups in Cleveland, Ohio, US. We find that several greenspace variables are related to BMI for women under 65 years and males under 51 years, but not for older groups, and that the aspects and types of greenspace that are significantly related to BMI vary among groups. Relationships between greenspace attributes and BMI are generally stronger for female groups and for younger groups. Providing access to greenspace with particular attributes such as greenspaces with water, canopy cover, or connected greenspaces could support a healthy weight status for some populations, but these attributes are not consistent across age and gender groups. These results could help to inform policy aimed at designing urban greenspace to benefit the health of different population subgroups.

Quantitative evaluation of hyaline articular cartilage T2 maps of knee and determine the relationship of cartilage T2 values with age, gender, articular changes.

PubMed

Cağlar, E; Şahin, G; Oğur, T; Aktaş, E

2014-11-01

To identify changes in knee joint cartilage transverse relaxation values depending on the patient's age and gender and to investigate the relationship between knee joint pathologies and the transverse relaxation time. Knee MRI images of 107 symptomatic patients with various pathologic knee conditions were analyzed retrospectively. T2 values were measured at patellar cartilage, posteromedial and posterolateral femoral cartilage adjacent to the central horn of posterior meniscus. 963 measurements were done for 107 knees MRI. Relationship of T2 values with seven features including subarticular bone marrow edema, subarticular cysts, marginal osteophytes, anterior-posterior cruciate and collateral ligament tears, posterior medial and posterior lateral meniscal tears, synovial thickening and effusion were analyzed. T2 values in all three compartments were evaluated according to age and gender. A T2 value increase correlated with age was present in all three compartments measured in the subgroup with no knee joint pathology and in all patient groups. According to the ROC curve, an increase showing a statistically significant difference was present in the patient group aged over 40 compared to the patient group aged 40 and below in all patient groups. There is a statistically difference at T2 values with and without subarticular cysts, marginal osteophytes, synovial thickening and effusion. T2 relaxation time showed a statistically significant increase in the patients with a medial meniscus tear compared to those without a tear and no statistically significant difference was found in T2 relaxation times of patients with and without a posterior lateral meniscus tear. T2 cartilage mapping on MRI provides opportunity to exhibit biochemical and structural changes related with cartilage extracellular matrix without using invasive diagnostic methods.

Traumatic Brain Injury History is Associated with Earlier Age of Onset of Alzheimer Disease

PubMed Central

LoBue, Christian; Wadsworth, Hannah; Wilmoth, Kristin; Clem, Matthew; Hart, John; Womack, Kyle B.; Didehbani, Nyaz; Lacritz, Laura H.; Rossetti, Heidi C.; Cullum, C. Munro

2016-01-01

Objective This study examined whether a history of traumatic brain injury (TBI) is associated with earlier onset of Alzheimer disease (AD), independent of apolipoprotein ε4 status (Apoe4) and gender. Method Participants with a clinical diagnosis of AD (n=7625) were obtained from the National Alzheimer’s Coordinating Center Uniform Data Set, and categorized based on self-reported lifetime TBI with loss of consciousness (LOC) (TBI+ vs TBI-) and presence of Apoe4. ANCOVAs, controlling for gender, race, and education were used to examine the association between history of TBI, presence of Apoe4, and an interaction of both risk factors on estimated age of AD onset. Results Estimated AD onset differed by TBI history and Apoe4 independently (p’s <.001). The TBI+ group had a mean age of onset 2.5 years earlier than the TBI- group. Likewise, Apoe4 carriers had a mean age of onset 2.3 years earlier than non-carriers. While the interaction was non-significant (p = .34), participants having both a history of TBI and Apoe4 had the earliest mean age of onset compared to those with a TBI history or Apoe4 alone (MDifference = 2.8 & 2.7 years, respectively). These results remained unchanged when stratified by gender. Conclusions History of self-reported TBI can be associated with an earlier onset of AD-related cognitive decline, regardless of Apoe4 status and gender. TBI may be related to an underlying neurodegenerative process in AD, but the implications of age at time of injury, severity, and repetitive injuries remain unclear. PMID:27855547

[Cardiovascular reactivity and cardiovascular risk factors in normotensive individuals of the Municipality of Rodas Cienfuegos].

PubMed

Benet Rodríguez, M; Apollinaire Pinnini, J J; González Leiva, J; Yanes Nuñez, A J; Fernández Urquizar, M

1999-01-01

A relationship exists between different cardiovascular risk factors and a significant rise in blood pressure in the presence of psychological or physical stress (cardiovascular reactivity). We studied this relationship in normotensive individuals who were subjected to stress caused by isometric exercise, which provided us with proof of the amount of weight withstood. A descriptive study was conducted in which 267 normotensive individuals were divided into two groups. One of these groups was a study group comprised of cardiovascular hyperreactive (CVHR) with a greater blood pressure response (BP)(n = 58), with BP levels > or = 90/140 mm/Hg, and the other group as a control group, with BP < 90/140 mm/Hg, n = 209. The relationship was found between the age, gender, sedentary life, smoking habit (SH), alcoholic beverage intake (ABI) and clinical history of blood pressure disorders (CH of BPD with the condition of cardiovascular hyperreactivity. 21.7% of the subjects were CVHR. The risk factors SH, ABI and gender were not related to the CVHR P > 0.05. The risk factor of CVHR is twice as high on the part of sedentary individuals, age becoming a factor as of age 40, and those individuals with a CH of BPD had twice the risk of having a cardiovascular hyperreactivity 3.85 (2: 7, 19) as those who had no CH of BPD). A significant relationship exists between being over age 40, CH of BPD and lack of exercise with a CVHR condition. This was not found to be the case for other risk factors such as SH, gender and ABI.

Equity of child and adolescent treatment, continuity of care and mortality, according to age and gender among enrollees in a large HIV programme in Tanzania.

PubMed

Chaudhury, Sumona; Hertzmark, Ellen; Muya, Aisa; Sando, David; Ulenga, Nzovu; Machumi, Lameck; Spiegelman, Donna; Fawzi, Wafaie W

2018-02-01

Global scale up of anti-retroviral therapy (ART) has led to expansion of HIV treatment and prevention across sub-Saharan Africa. However, age and gender-specific disparities persist leading to failures in fulfillment of Sustainability Development Goals, including SDG3 (achieving healthy lives and wellbeing for all, at all ages) and SDG5 (gender equality). We assessed ART initiation and adherence, loss to follow-up, all-cause death and early death, according to SDG3 and SDG5 indicators among a cohort of HIV-infected children and adolescents enrolled in care in Dar-es-Salaam, Tanzania METHODS: SDG3 indicators included young (<5 years) and older paediatric children (5 to <10 years), early adolescent (10 to <15 years) and late adolescent (15 to <20 years) age group divisions and the SDG5 indicator was gender. Associations of age group and gender with ART initiation, loss to follow-up and all-cause death, were analysed using Cox proportional hazards regression and with adherence, using generalized estimating equations (GEE) with the Poisson distribution. Associations of age group and gender with early death were analysed, using log-Poisson regression with empirical variance. A total of 18,315 enrollees with at least one clinic visit were included in this cohort study. Of these 7238 (40%) were young paediatric , 4169 (23%) older paediatric, 2922 (16%) early adolescent and 3986 (22%) late adolescent patients at enrolment. Just over half of paediatric and early adolescents and around four fifths of the late adolescents were female. Young paediatric patients were at greater risk of early death, being almost twice as likely to die within 90 days. Males were at greater risk of early death once initiated on ART (HR 1.35, 95% CI 1.09, 1.66)), while females in late adolescence were at greatest risk of late death (HR 2.44 [1.60, 3.74] <0.01). Late adolescents demonstrated greater non-engagement in care (RR 1.21 (95% CI 1.16, 1.26)). Among both males and females, early paediatric and late adolescent groups experienced significantly greater loss to follow-up. These findings highlight equity concerns critical to the fulfillment of SDG3 and SDG5 within services for children and adolescents living with HIV in sub-Saharan Africa. Young paediatric and late adolescent age groups were at increased risk of late diagnosis, early death, delayed treatment initiation and loss of continuity of care. Males were more likely to die earlier. Special attention to SDG3 and SDG5 disparities for children and adolescents living with HIV will be critical for fulfillment of the 2030 SDG agenda. © 2018 The Authors. Journal of the International AIDS Society published by John Wiley & sons Ltd on behalf of the International AIDS Society.

Moderating effect of gender on the prospective relation of physical activity with psychosocial outcomes and asthma control in adolescents: a longitudinal study.

PubMed

Tiggelman, Dana; van de Ven, Monique O M; van Schayck, Onno C P; Engels, Rutger C M E

2014-12-01

Adolescents with asthma experience more psychosocial and physiological problems compared to their healthy peers. Physical activity (PA) might decrease these problems. This study was the first observational longitudinal study to examine whether habitual PA could predict changes in psychosocial outcomes (i.e., symptoms of anxiety and depression, quality of life [QOL] and stress) and asthma control over time in adolescents with asthma and whether gender moderated these relationships. Adolescents with asthma (N = 253; aged 10-14 years at baseline) were visited at home in the spring/summer of 2012 and 2013. They completed questionnaires assessing their habitual PA, symptoms of anxiety and depression, QOL, perceived stress and asthma control. Path analyses using Mplus were conducted to examine longitudinal relationships among habitual PA, psychosocial outcomes and asthma control (controlled for body mass index, age and gender). Using multi-group analyses, we examined whether gender moderated these relationships. Path analyses in the total group showed that habitual PA did not predict changes in psychosocial outcomes or asthma control over time. Multi-group analyses showed that gender moderated the relation of habitual PA with anxiety and depression. Habitual PA only significantly predicted a decrease in anxiety and depression over time for girls but not for boys. Increasing habitual PA in girls with asthma might decrease their symptoms of anxiety and depression.

Sex, race, and age distributions of mean aortic wall thickness in a multiethnic population-based sample.

PubMed

Rosero, Eric B; Peshock, Ronald M; Khera, Amit; Clagett, Patrick; Lo, Hao; Timaran, Carlos H

2011-04-01

Reference values and age-related changes of the wall thickness of the abdominal aorta have not been described in the general population. We characterized age-, race-, and gender-specific distributions, and yearly rates of change of mean aortic wall thickness (MAWT), and associations between MAWT and cardiovascular risk factors in a multi-ethnic population-based probability sample. Magnetic resonance imaging measurements of MAWT were performed on 2466 free-living white, black, and Hispanic adult subjects. MAWT race/ethnicity- and gender-specific percentile values across age were estimated using regression analyses. MAWT was greater in men than in women and increased linearly with age in all the groups and across all the percentiles. Hispanic women had the thinnest and black men the thickest aortas. Black men had the highest and white women the lowest age-related MAWT increase. Age, gender, ethnicity, smoking status, systolic blood pressure, low-density lipoprotein-cholesterol levels, high-density lipoprotein-cholesterol levels, and fasting glucose levels were independent predictors of MAWT. Age, gender, and racial/ethnic differences in MAWT distributions exist in the general population. Such differences should be considered in future investigations assessing aortic atherosclerosis and the effects of anti-atherosclerotic therapies. Published by Mosby, Inc.

Excess costs of dementia disorders and the role of age and gender - an analysis of German health and long-term care insurance claims data

PubMed Central

2012-01-01

Background Demographic ageing is associated with an increasing number of dementia patients, who reportedly incur higher costs of care than individuals without dementia. Regarding Germany, evidence on these excess costs is scarce. Adopting a payer perspective, our study aimed to quantify the additional yearly expenditures per dementia patient for various health and long-term care services. Additionally, we sought to identify gender-specific cost patterns and to describe age-dependent cost profiles. Methods The analyses used 2006 claims data from the AOK Bavaria Statutory Health Insurance fund of 9,147 dementia patients and 29,741 age- and gender-matched control subjects. Cost predictions based on two-part regression models adjusted for age and gender and excess costs of dementia care refer to the difference in model-estimated means between both groups. Corresponding analyses were performed stratified for gender. Finally, a potentially non-linear association between age and costs was investigated within a generalized additive model. Results Yearly spending within the social security system was circa €12,300 per dementia patient and circa €4,000 per non-demented control subject. About two-thirds of the additional expenditure for dementia patients occurred in the long-term care sector. Within our study sample, male and female dementia patients incurred comparable total costs. However, women accounted for significantly lower health and significantly higher long-term care expenditures. Long-term care spending increased in older age, whereupon health care spending decreased. Thus, at more advanced ages, women incurred greater costs than men of the same age. Conclusions Dementia poses a substantial additional burden to the German social security system, with the long-term care sector being more seriously challenged than the health care sector. Our results suggest that female dementia patients need to be seen as a key target group for health services research in an ageing society. It seems clear that strategies enabling community-based care for this vulnerable population might contribute to lowering the financial burden caused by dementia. This would allow for the sustaining of comprehensive dementia care within the social security system. PMID:22713212

Maximum Bite Force Analysis in Different Age Groups

PubMed Central

Takaki, Patricia; Vieira, Marilena; Bommarito, Silvana

2014-01-01

Introduction Maximum bite force (MBF) is the maximum force performed by the subject on the fragmentation of food, directly related with the mastication and determined by many factors. Objective Analyze the MBF of subjects according to age groups. Methods One hundred individuals from the city of São Paulo were equally divided according to age groups and gender. Each individual submitted to a myotherapy evaluation composed of anthropometric measurements of height and weight to obtain body mass index (BMI), using a tape and a digital scale (Magna, G-life, São Paulo), and a dental condition and maximum bite force evaluation, using a digital dynamometer model DDK/M (Kratos, São Paulo, Brazil), on Newton scale. The dental and bite force evaluations were monitored by a professional from the area. Analysis of variance was used with MBF as a dependent variable, age group and gender as random factors, and BMI as a control variable. Results Till the end of adolescence, it was possible to observe a decrease in MBF in both sexes, with the male force greater than the female force. In young adults, the female force became greater the males, then decreased in adulthood. There was no correlation between MBF and BMI. Conclusion There are MBF variations that characterizes the human development stages, according to age groups. PMID:25992105

Variation of skin surface pH, sebum content and stratum corneum hydration with age and gender in a large Chinese population.

PubMed

Man, M Q; Xin, S J; Song, S P; Cho, S Y; Zhang, X J; Tu, C X; Feingold, K R; Elias, P M

2009-01-01

Evidence suggests the importance of skin biophysical properties in predicting diseases and in developing appropriate skin care. The results to date of studies on skin surface pH, stratum corneum (SC) hydration and sebum content in both genders and at various ages have been inconclusive, which was in part due to small sample size. Additionally, little is known about the skin physical properties of Asian, especially Chinese, subjects. In the present study, we assess the difference in skin surface pH, sebum content and SC hydration at various ages and in both genders in a large Chinese population without skin diseases. 713 subjects (328 males and 385 females) aged 0.5-94 years were enrolled in this study. The subjects were divided by age into 5 groups, i.e., 0-12, 13-35, 36-50, 51-70 and over 70 years old. A multifunctional skin physiology monitor was used to measure SC hydration, skin surface pH and sebum content on both the forehead and the forearms. In males, the highest sebum content was found on the forearm and the forehead in the age groups 36-50 (93.47 +/- 10.01 microg/cm(2)) and 51-70 years (9.16 +/- 1.95 microg/cm(2)), while in females, the highest sebum content was found on the forearm and the forehead in the age groups 13-35 (61.91 +/- 6.12 microg/cm(2)) and 51-70 years (7.54 +/- 2.55 microg/cm(2)). The forehead sebum content was higher in males aged 13-70 years than in age-matched females; the sebum content on the forehead in both males and females was higher than that on the forearm. Skin surface pH on the forehead of both males and females over the age of 70 years was higher than that in younger groups. SC hydration on the forehead in both males and females was lower above the age of 70, and the one in males aged 13-35 was higher than that in females (43.99 +/- 1.88 vs. 36.38 +/- 1.67 AU, p < 0.01). SC hydration on the forehead in both males and females did not significantly differ from that on the forearm. In a large Chinese cohort, the skin surface pH, sebum content and SC hydration vary with age, gender and body site. Copyright 2009 S. Karger AG, Basel.

Variation of Skin Surface pH, Sebum Content and Stratum Corneum Hydration with Age and Gender in a Large Chinese Population

PubMed Central

Man, M.Q.; Xin, S.J.; Song, S.P.; Cho, S.Y.; Zhang, X.J.; Tu, C.X.; Feingold, K.R.; Elias, P.M.

2009-01-01

Background and Objectives Evidence suggests the importance of skin biophysical properties in predicting diseases and in developing appropriate skin care. The results to date of studies on skin surface pH, stratum corneum (SC) hydration and sebum content in both genders and at various ages have been inconclusive, which was in part due to small sample size. Additionally, little is known about the skin physical properties of Asian, especially Chinese, subjects. In the present study, we assess the difference in skin surface pH, sebum content and SC hydration at various ages and in both genders in a large Chinese population without skin diseases. Methods 713 subjects (328 males and 385 females) aged 0.5–94 years were enrolled in this study. The subjects were divided by age into 5 groups, i.e., 0–12, 13–35, 36–50, 51–70 and over 70 years old. A multifunctional skin physiology monitor was used to measure SC hydration, skin surface pH and sebum content on both the forehead and the forearms. Results In males, the highest sebum content was found on the forearm and the forehead in the age groups 36–50 (93.47 ± 10.01 μg/cm2) and 51–70 years (9.16 ± 1.95 μg/cm2), while in females, the highest sebum content was found on the forearm and the forehead in the age groups 13–35 (61.91 ± 6.12 μg/cm2) and 51–70 years (7.54 ± 2.55 μg/cm2). The forehead sebum content was higher in males aged 13–70 years than in age-matched females; the sebum content on the forehead in both males and females was higher than that on the forearm. Skin surface pH on the forehead of both males and females over the age of 70 years was higher than that in younger groups. SC hydration on the forehead in both males and females was lower above the age of 70, and the one in males aged 13–35 was higher than that in females (43.99 ± 1.88 vs. 36.38 ± 1.67 AU, p < 0.01). SC hydration on the forehead in both males and females did not significantly differ from that on the forearm. Conclusions In a large Chinese cohort, the skin surface pH, sebum content and SC hydration vary with age, gender and body site. PMID:19648780

Pediatric Idiopathic Intracranial Hypertension: Age, Gender, and Anthropometric Features at Diagnosis in a Large, Retrospective, Multisite Cohort.

PubMed

Sheldon, Claire A; Paley, Grace L; Xiao, Rui; Kesler, Anat; Eyal, Ori; Ko, Melissa W; Boisvert, Chantal J; Avery, Robert A; Salpietro, Vincenzo; Phillips, Paul H; Heidary, Gena; McCormack, Shana E; Liu, Grant T

2016-11-01

To examine anthropometric and maturational characteristics at diagnosis in pediatric idiopathic intracranial hypertension (IIH). Retrospective, international, multisite study. Pediatric patients (2-18 years of age at diagnosis) with IIH. Body mass index (BMI), height, and weight Z-scores; sexual maturation. Cases of IIH were identified retrospectively based on diagnostic code, pediatric neuro-ophthalmologist databases, or both and updated diagnostic criteria (2013) were applied to confirm definite IIH. Anthropometric measurements were converted into age- and gender-specific height, weight, and BMI Z-scores CDC 2000 growth charts. When available, sexual maturation was noted. Two hundred thirty-three cases of definite IIH were identified across 8 sites. In boys, a moderate association between age and BMI Z-scores was noted (Pearson's correlation coefficient, 0.50; 95% confidence interval [CI], 0.30-0.66; P < 0.001; n = 72), and in girls, a weak association was noted (Pearson's correlation coefficient, 0.34; 95% CI, 0.20-0.47; P < 0.001; n = 161). The average patient was more likely to be overweight at diagnosis at age 6.7 years in girls and 8.7 years in boys, and obese at diagnosis at age 12.5 years in girls and 12.4 years in boys. Compared with age- and gender-matched reference values, early adolescent patients were taller for age (P = 0.002 in girls and P = 0.02 in boys). Data on Tanner staging, menarchal status, or both were available in 25% of cases (n = 57/233). Prepubertal participants (n = 12) had lower average BMI Z-scores (0.95±1.98) compared with pubertal participants (n = 45; 1.92±0.60), but this result did not reach statistical significance (P = 0.09). With updated diagnostic criteria and pediatric-specific assessments, the present study identifies 3 subgroups of pediatric IIH: a young group that is not overweight, an early adolescent group that is either overweight or obese, and a late adolescent group that is mostly obese. Data also suggest that the early adolescent group with IIH may be taller than age- and gender-matched reference values. Understanding these features of pediatric IIH may help to illuminate the complex pathogenesis of this condition. Copyright © 2016 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.

Gender differences in food preferences of school-aged children and adolescents.

PubMed

Caine-Bish, Natalie L; Scheule, Barbara

2009-11-01

Schools have the opportunity, through the National School Lunch Program and Local School Wellness Policies, to have a significant impact on healthy eating behaviors. An understanding of children's and adolescents' food preferences in relation to gender and age will facilitate the successful creation of both healthy and financially viable school menus. The purpose of this study was to identify food preferences with respect to gender of school-age children and adolescents in an Ohio school district. A survey was administered to 1818 3rd- to 12th-grade students in 1 rural northeast Ohio school district. Students filled out an anonymous questionnaire about their preferences for 80 different foods using a 5-point rating scale. The student data were grouped according to school level attended: elementary (3rd-6th), middle (7th-8th), and high school (9th-12th). An exploratory factor analysis identified entrée and side dish factors. Cronbach's alpha was used to measure each factor's internal reliability. Differences in mean scores by gender and grade for each of the entrée and side dish factors by gender and grade were identified using analysis of variance (ANOVA). Boys preferred the meat, fish, and poultry foods over girls; girls preferred fruits and vegetables over boys (p < .05). Furthermore, gender differences in preferences were also demonstrated with respect to school level. Food preferences differed between genders and these gender differences varied among elementary, middle, and high school students. Gender differences should be considered when providing food choices to boys and girls at all ages.

Body Potassium Content and Radiation Dose from 40K for the Urals Population (Russia)

PubMed Central

Tolstykh, Evgenia I.; Degteva, Marina O.; Bougrov, Nikolay G.; Napier, Bruce A.

2016-01-01

Long-term whole-body monitoring of radionuclides in residents of the Urals Region has been performed at the Urals Research Center for Radiation Medicine (URCRM, Chelyabinsk). Quantification of 40K was achieved by measuring the 40K photopeak with four phoswich detectors in whole body counter SICH-9.1M. The current study presents the results of 40K measurements in 3,651 women and 1,961 t-test; U-test men aged 11–90; measurements were performed in 2006–2014. The residents belonged to two ethnic groups, Turkic (Tatar, Bashkir) and Slavs (mainly Russian). The levels of 40K-body contents depend upon gender, age, and body mass. Significant ethnic-differences were not found in 40K-body contents and 40K concentrations in terms of Bq per kg of body weight (in groups homogenous by age and gender). Both 40K-body contents and concentrations were significantly higher in men than in women in all age-groups; the difference was about 25%. The measured 40K-body content in men of 20–50 years was about 4200 Bq (134 g of K) and about 3000 Bq (95 g of K) in women. By the age of 80 these values decreased to 3200 Bq (102 g of K) in men and 2500 Bq (80 g of K) in women. Annual dose rates were maximal in the age group of 20–30 years– 0.16 mGy/y for men and 0.13 mGy/y for women. Further, the dose-rates decreased with age and in the groups of 60–80 years were 0.13 mGy/y for men and 0.10 mGy/y for women. Within groups homogeneous by age and gender, individual dose rates are described by a normal statistical distribution. The coefficient of variation ranges from 9 to 14%, and on the average is 12.5%. Doses from naturally occurring 40K accumulated over 70 years were found to be 9.9 mGy for men and 8.3 mGy for women; over 90 years - 12.5 and 10.4 mGy. PMID:27111330

Gender differences in mental disorders and suicidality in Europe: results from a large cross-sectional population-based study.

PubMed

Boyd, Anders; Van de Velde, Sarah; Vilagut, Gemma; de Graaf, Ron; O'Neill, Siobhan; Florescu, Silvia; Alonso, Jordi; Kovess-Masfety, Vivane

2015-03-01

When evaluating gender differences in mental disorders and suicidality, specifically between European countries, studies are sparse and frequently hindered by methodological issues, such as the limited items evaluated and inconsistent sampling designs. In ten European countries participating in the World Mental Health Survey Initiative, lifetime internalizing and externalizing disorders and suicidality were assessed among 37,289 respondents. Disorders were classified using DMS-IV criteria. Odds ratios (OR) for gender differences were calculated using logistic regression, while trends across age-groups were tested via gender × age interaction. Within countries, prevalence of any lifetime internalizing disorder ranged from 10.8% to 44.5% among women and 5.9% to 26.5% among men, with women having consistently higher odds than men (OR range: 1.52-2.73). Prevalence of any lifetime externalizing disorders ranged from 0.2% to 6.6% among women and 2.2% to 22.4% among men, with women having consistently lower odds than men (OR range: 0.05-0.35). Any lifetime suicide attempt was found in 0.8-5.4% of women and 0.3-2.4% of men, showing inconsistent relative gender-differences across countries (OR range: 0.77-4.72). Significant effects in gender OR across age-groups were not observed for any internalizing disorder or suicide attempt, yet were present for any externalizing disorder in France (p = 0.01), the Netherlands (p = 0.05), and Spain (p = 0.02). Mental disorders were assessed with the CIDI 3.0 and not psychiatric evaluations. Suicidality does not fully represent more important clinical events, such as suicide mortality. Consistent across European countries, internalizing disorders are more common among women and externalizing disorders among men, whereas gender differences in suicidality varied. Copyright © 2014 Elsevier B.V. All rights reserved.

Gender differences in the effects of ADH1B and ALDH2 polymorphisms on alcoholism.

PubMed

Kimura, Mitsuru; Miyakawa, Tomohiro; Matsushita, Sachio; So, Mirai; Higuchi, Susumu

2011-11-01

Gender differences are known to exist in the prevalence, characteristics, and course of alcohol dependence. Elucidating gender differences in the characteristics of alcohol dependence is important in gender-based medicine and may improve treatment outcomes. Many studies have shown that genetic factors are associated with the risk of alcohol dependence in both genders. Polymorphisms of alcohol dehydrogenase-1B (ADH1B) and aldehyde dehydrogenase-2 (ALDH2) are strong genetic determinants of alcohol dependence. This study aimed to clarify gender differences in the effects of ADH1B and ALDH2 polymorphism on the development of alcohol dependence. Subjects were 200 female alcoholics and 415 male alcoholics hospitalized in Kurihama Alcoholism Center. Clinical information and background data were obtained by chart review. ALDH2 and ADH1B genotyping was performed by the polymerase chain reaction-restriction fragment length polymorphism method. The onset age of female alcoholics with inactive ALDH2 genotype was significantly lower than those with active ALDH2 genotype, but the onset age did not differ between the inactive and active ALDH2 group in male alcoholics. The difference in onset age between the ADH1B genotype groups did not reach significant levels. The prevalence of comorbid psychiatric disorders, including major depression, eating disorder, panic disorder, and borderline personality disorder, was significantly higher in female alcoholics with inactive ALDH2 or superactive ADH1B than in those with active ALDH2 or normal ADH1B. ALDH2 polymorphism appears to have contrasting effects on the development of alcoholism in women and men. One possible reason for this gender difference may be the high prevalence of psychiatric comorbidities in female alcoholics with inactive ALDH2. Copyright © 2011 by the Research Society on Alcoholism.

Factorial Validity and Invariance Assessment of a Short Version of the Recalled Childhood Gender Identity/Role Questionnaire.

PubMed

Veale, Jaimie F

2016-04-01

Recalled childhood gender role/identity is a construct that is related to sexual orientation, abuse, and psychological health. The purpose of this study was to assess the factorial validity of a short version of Zucker et al.'s (2006) "Recalled Childhood Gender Identity/Gender Role Questionnaire" using confirmatory factor analysis and to test the stability of the factor structure across groups (measurement invariance). Six items of the questionnaire were completed online by 1929 participants from a variety of gender identity and sexual orientation groups. Models of the six items loading onto one factor had poor fit for the data. Items were removed for having a large proportion of error variance. Among birth-assigned females, a five-item model had good fit for the data, but there was evidence for differences in scale's factor structure across gender identity, age, level of education, and country groups. Among birth-assigned males, the resulting four-item model did not account for all of the relationship between variables, and modeling for this resulted in a model that was almost saturated. This model also had evidence of measurement variance across gender identity and sexual orientation groups. The models had good reliability and factor score determinacy. These findings suggest that results of previous studies that have assessed recalled childhood gender role/identity may have been susceptible to construct bias due to measurement variance across these groups. Future studies should assess measurement invariance between groups they are comparing, and if it is not found the issue can be addressed by removing variant indicators and/or applying a partial invariance model.

Age and closeness of death as determinants of health and social care utilization: a case-control study.

PubMed

Forma, Leena; Rissanen, Pekka; Aaltonen, Mari; Raitanen, Jani; Jylhä, Marja

2009-06-01

We used case-control design to compare utilization of health and social services between older decedents and survivors, and to identify the respective impact of age and closeness of death on the utilization of services. Data were derived from multiple national registers. The sample consisted of 56,001 persons, who died during years 1998-2000 at the age of > or = 70, and their pairs matched on age, gender and municipality of residence, who were alive at least 2 years after their counterpart's death. Data include use of hospitals, long-term care and home care. Decedents' utilization within 2 years before death and survivors' utilization in the same period of time was assessed in three age groups (70-79, 80-89 and > or = 90 years) and by gender. Decedents used hospital and long-term care more than their surviving counterparts, but the time patterns were different. In hospital care the differences between decedents and survivors rose in the last months of the study period, whereas in long-term care there were clear differences during the whole 2-year period. The differences were smaller in the oldest age group than in younger age groups. Closeness of death is an important predictor of health and social service use in old age, but its influence varies between age groups. Not only the changing age structure, but also the higher average age at death affects the future need for services.

The characteristics and effects of motivational music in exercise settings: the possible influence of gender, age, frequency of attendance, and time of attendance.

PubMed

Priest, D L; Karageorghis, C I; Sharp, N C C

2004-03-01

The purpose of the present study was to investigate the characteristics and effects of motivational music in British gymnasia. The secondary purpose was to determine whether the characteristics and effects of motivational music were invariant in relation to gender, age, frequency of gymnasium attendance, and the time of day at which exercise participants attended gymnasia. Participants (n=532) from 29 David Lloyd Leisure exercise facilities across Britain responded to a questionnaire that was designed to assess music preferences during exercise via 2 open-ended questions and 1 scaled-response item. A content analysis of the questionnaire data yielded 45 analytic properties that were grouped into the following categories: specific music factors, general music factors, music programme factors, delivery factors, televisual factors, personal factors, contextual factors, and psychophysical response factors. The relative incidence of these analytic properties across gender groups (male/female), age groups (16-26 y, 27-34 y, 35-45 y, 46+ y), frequency of attendance groups (low, medium, high), and time of attendance groups (morning, afternoon, evening) was tested by use of chi(2) analyses. Of the personal variables tested, age exerted the greatest influence on musical preference during exercise; older participants expressed a preference for quieter, slower, and generally less overtly stimulative music. Music programmes that are prescribed to accompany exercise should be varied in terms of musical idiom and date of release. Such programmes will account for the preferences of different groups of exercise participants that attend gymnasia at different times of the day. Further, the music chosen should be characterised by a strong rhythmical component.

National record linkage study of mortality for a large cohort of opioid users ascertained by drug treatment or criminal justice sources in England, 2005–2009

PubMed Central

Pierce, Matthias; Bird, Sheila M.; Hickman, Matthew; Millar, Tim

2015-01-01

Background Globally, opioid drug use is an important cause of premature mortality. In many countries, opioid using populations are ageing. The current study investigates mortality in a large cohort of opioid users; with a focus on testing whether excess mortality changes with age. Methods 198,247 opioid users in England were identified from drug treatment and criminal justice sources (April, 2005 to March, 2009) and linked to mortality records. Mortality rates and standardised mortality ratios (SMRs) were calculated by age-group and gender. Results There were 3974 deaths from all causes (SMR 5.7, 95% Confidence Interval: 5.5 to 5.9). Drug-related poisonings (1715) accounted for 43% of deaths. Relative to gender-and-age-appropriate expectation, mortality was elevated for a range of major causes including: infectious, respiratory, circulatory, liver disease, suicide, and homicide. Drug-related poisoning mortality risk continued to increase beyond 45 years and there were age-related increases in SMRs for specific causes of death (infectious, cancer, liver cirrhosis, and homicide). A gender by age-group interaction revealed that whilst men have a greater drug-related poisoning mortality risk than women at younger ages, the difference narrows with increasing age. Conclusion Opioid users’ excess mortality persists into old age and for some causes is exacerbated. This study highlights the importance of managing the complex health needs of older opioid users. PMID:25454405

National record linkage study of mortality for a large cohort of opioid users ascertained by drug treatment or criminal justice sources in England, 2005-2009.

PubMed

Pierce, Matthias; Bird, Sheila M; Hickman, Matthew; Millar, Tim

2015-01-01

Globally, opioid drug use is an important cause of premature mortality. In many countries, opioid using populations are ageing. The current study investigates mortality in a large cohort of opioid users; with a focus on testing whether excess mortality changes with age. 198,247 opioid users in England were identified from drug treatment and criminal justice sources (April, 2005 to March, 2009) and linked to mortality records. Mortality rates and standardised mortality ratios (SMRs) were calculated by age-group and gender. There were 3974 deaths from all causes (SMR 5.7, 95% Confidence Interval: 5.5 to 5.9). Drug-related poisonings (1715) accounted for 43% of deaths. Relative to gender-and-age-appropriate expectation, mortality was elevated for a range of major causes including: infectious, respiratory, circulatory, liver disease, suicide, and homicide. Drug-related poisoning mortality risk continued to increase beyond 45 years and there were age-related increases in SMRs for specific causes of death (infectious, cancer, liver cirrhosis, and homicide). A gender by age-group interaction revealed that whilst men have a greater drug-related poisoning mortality risk than women at younger ages, the difference narrows with increasing age. Opioid users' excess mortality persists into old age and for some causes is exacerbated. This study highlights the importance of managing the complex health needs of older opioid users. Copyright © 2014 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

Fall with and without fracture in elderly: what's different?

PubMed

Kantayaporn, Choochat

2012-10-01

Falling fracture was one of the health problems in elderly. This presentation aimed to identify the factors of fall that caused fractures. The retrospective case-control study was designed. Samples were all who experienced fall within 1 year in Lamphun. Factors included age, gender underlying diseases, chronic drugs used, history of parent fragility fracture, age of menopause, steroid used, body mass index, visual acuity and time up and go test were studied. Multivariate regression analysis was used. 336 cases of fractures in 1,244 cases of fall were found. Significant factors of falling fracture group that were different from fall without fracture group included age, female gender, menopause before age of 45 and visual impairment. Visual impairment was the other key factor rather than osteoporosis that caused fall with fracture. The author suggested that falling fracture prevention programs should be included correction of visual impairment other than osteoporosis treatment.

Group-based differences in anti-aging bias among medical students.

PubMed

Ruiz, Jorge G; Andrade, Allen D; Anam, Ramanakumar; Taldone, Sabrina; Karanam, Chandana; Hogue, Christie; Mintzer, Michael J

2015-01-01

Medical students (MS) may develop ageist attitudes early in their training that may predict their future avoidance of caring for the elderly. This study sought to determine MS' patterns of explicit and implicit anti-aging bias, intent to practice with older people and using the quad model, the role of gender, race, and motivation-based differences. One hundred and three MS completed an online survey that included explicit and implicit measures. Explicit measures revealed a moderately positive perception of older people. Female medical students and those high in internal motivation showed lower anti-aging bias, and both were more likely to intend to practice with older people. Although the implicit measure revealed more negativity toward the elderly than the explicit measures, there were no group differences. However, using the quad model the authors identified gender, race, and motivation-based differences in controlled and automatic processes involved in anti-aging bias.

Radiological evaluation of the posterior pelvic ring in paediatric patients: Results of a retrospective study developing age- and gender-related non-osseous baseline characteristics in paediatric pelvic computed tomography - References for suspected sacroiliac joint injury.

PubMed

Bayer, Jörg; Neubauer, Jakob; Saueressig, Ulrich; Südkamp, Norbert Paul; Reising, Kilian

2016-04-01

The prevalence of paediatric pelvic injury is low, yet they are often indicative of accompanying injuries, and an instable pelvis at presentation is related to long-term poor outcome. Judging diastasis of the sacroiliac joint in paediatric pelvic computed tomography is challenging, as information on their normal appearance is scarce. We therefore sought to generate age- and gender-related standard width measurements of the sacroiliac joint in children for comparison. A total of 427 pelvic computed tomography scans in paediatric patients (<18 years old) were retrospectively evaluated. After applying exclusion criteria, 350 scans remained for measurements. Taking a standard approach we measured the sacroiliac joint width bilaterally in axial and coronal planes. We illustrate age- and gender-related measurements of the sacroiliac joint width as a designated continuous 3rd, 15th, 50th, 85th and 97th centile graph, respectively. Means and standard deviations in the joint width are reported for four age groups. There are distinct changes in the sacroiliac joint's appearance during growth. In general, male children exhibit broader sacroiliac joints than females at the same age, although this difference is significant only in the 11 to 15-year-old age group. The sacroiliac joint width in children as measured in coronal and axial CT scans differs in association with age and gender. When the sacroiliac joint width is broader than the 97th centile published in our study, we strongly encourage considering a sacroiliac joint injury. Copyright © 2016 Elsevier Ltd. All rights reserved.

Epigenetic hereditary transcription profiles III, evidence for an epigenetic network resulting in gender, tissue and age-specific variation in overall transcription

PubMed Central

Simons, Johannes WIM

2009-01-01

Background We have previously shown that deviations from the average transcription profile of a group of functionally related genes are not only heritable, but also demonstrate specific patterns associated with age, gender and differentiation, thereby implicating genome-wide nuclear programming as the cause. To determine whether these results could be reproduced, a different micro-array database (obtained from two types of muscle tissue, derived from 81 human donors aged between 16 to 89 years) was studied. Results This new database also revealed the existence of age, gender and tissue-specific features in a small group of functionally related genes. In order to further analyze this phenomenon, a method was developed for quantifying the contribution of different factors to the variability in gene expression, and for generating a database limited to residual values reflecting constitutional differences between individuals. These constitutional differences, presumably epigenetic in origin, contribute to about 50% of the observed residual variance which is connected with a network of interrelated changes in gene expression with some genes displaying a decrease or increase in residual variation with age. Conclusion Epigenetic variation in gene expression without a clear concomitant relation to gene function appears to be a widespread phenomenon. This variation is connected with interactions between genes, is gender and tissue specific and is related to cellular aging. This finding, together with the method developed for analysis, might contribute to the elucidation of the role of nuclear programming in differentiation, aging and carcinogenesis Reviewers This article was reviewed by Thiago M. Venancio (nominated by Aravind Iyer), Hua Li (nominated by Arcady Mushegian) and Arcady Mushegian and J.P.de Magelhaes (nominated by G. Church). PMID:19796384

Estimating the color of maxillary central incisors based on age and gender

PubMed Central

Gozalo-Diaz, David; Johnston, William M.; Wee, Alvin G.

2008-01-01

Statement of problem There is no scientific information regarding the selection of the color of teeth for edentulous patients. Purpose The purpose of this study was to evaluate linear regression models that may be used to predict color parameters for central incisors of edentulous patients based on some characteristics of dentate subjects. Material and methods A spectroradiometer and an external light source were set in a noncontacting 45/0 degree (45-degree illumination and 0-degree observer) optical configuration to measure the color of subjects’ vital craniofacial structures (maxillary central incisor, attached gingiva, and facial skin). The subjects (n=120) were stratified into 5 age groups with 4 racial groups and balanced for gender. Linear first-order regression was used to determine the significant factors (α=.05) in the prediction model for each color direction of the color of the maxillary central incisor. Age, gender, and color of the other craniofacial structures were studied as potential predictors. Final predictions in each color direction were based only on the statistically significant factors, and then the color differences between observed and predicted CIELAB values for the central incisors were calculated and summarized. Results The statistically significant predictors of age and gender accounted for 36% of the total variability in L*. The statistically significant predictor of age accounted for 16% of the total variability in a*. The statistically significant predictors of age and gender accounted for 21% of the variability in b*. The mean ΔE (SD) between predicted and observed CIELAB values for the central incisor was 5.8 (3.2). Conclusions Age and gender were found to be statistically significant determinants in predicting the natural color of central incisors. Although the precision of these predictions was less than the median color difference found for all pairs of teeth studied, and may be considered an acceptable precision, further study is needed to reduce this precision to the limit of detection. Clinical Implications Age is highly correlated with the natural color of the central incisors. When age increases, the central incisor becomes darker, more reddish, and more yellow. Also, the women subjects in this study had lighter and less yellow central incisors than the men. PMID:18672125

Gender differences in walking (for leisure, transport and in total) across adult life: a systematic review.

PubMed

Pollard, Tessa M; Wagnild, Janelle M

2017-04-20

The aim of this systematic review was to examine gender differences in walking for leisure, transport and in total in adults living in high-income countries, and to assess whether gender differences in walking practices change across the life-course. A systematic literature search was conducted of publications dated 1995 to 2015. Papers providing quantitative data on participation in walking of both men and women aged at least 18 years in a high-income country were screened for the quality of the data on gender differences in walking. Data were extracted and results were synthesised using forest plots and narrative summary. Thirty-six studies were included in the review: 18 reported on walking for leisure, 16 on walking for transport (in total, or for particular purposes), and 14 on total walking. Most (33) studies provided data comparing the proportion of men and women who walked (at all or for a minimum duration) over a defined period, usually one week. There was consistent evidence that more women than men walk for leisure, although effect sizes were small. However, this effect varies by age: more younger women than younger men walk for leisure, but the gender difference diminishes with age and appears to reverse in the oldest age groups. Taking all ages together, there was no consistent gender difference in walking for transport or in total walking, although the small number of studies reporting on walking to undertake errands suggested that more women than men walk for this purpose. While there is little evidence that levels of total walking consistently vary by gender, our findings suggest that there are consistent gender differences in participation in walking for some purposes, including for leisure, and that there are gender differences in the impact of age on walking. We conclude that more research is needed to improve our understanding of how walking fits into the lives of women and men across the life-course, especially in relation to gender differences in the impact of aging on walking. PROSPERO registration number: CRD42015025961 .

Ethnic differences in perceptions of body satisfaction and body appearance among U.S. Schoolchildren: a cross-sectional study

PubMed Central

2012-01-01

Background Perceived body appearance and body satisfaction are potentially related to weight problems and poor health. The purpose of this study was to examine how gender, and ethnic differences in body satisfaction, perceived body appearance and weight status change by age in a representative sample of U.S. adolescents 11–17 years old. Methods We used the US Health Behavior in School-Aged Children (HBSC) 2001 survey which assessed perceived body appearance, body satisfaction, self-reported body mass index (BMI) and socio-demographic indicators. The associations between age and perceived appearance, age and body satisfaction, and between z-transformed BMI and body satisfaction were analyzed using separate non-parametric regression models for both genders and the three ethnic groups. Results Body satisfaction did not vary significantly by age except for an increase with age in the proportion of Non-Hispanic White girls who perceived themselves as too fat. Although boys did not report being too fat unless their BMI was above the age- and gender-specific median, one third of Non-Hispanic White girls felt too fat at or below the age- and gender-specific median. Compared to other ethnicities, African-American students’ perceived appearance was significantly more positive and they were less likely to perceive themselves overweight at higher BMI scores. However, during adolescence, the positive self-reported perceived appearance of African-American boys dropped substantially while it remained relatively stable in African-American girls. Conclusions There were substantial differences in body satisfaction and perceived appearance across the three largest ethnic groups of school-age children in the U.S. Stability across age indicates that these perceptions are most likely established before the age of 10 and underline the importance of primary schools and parents in prevention. Special attention should be directed to the dramatic loss of positive perceived appearance among African-American boys. PMID:22691404

Gender similarities in somatic depression and in DSM depression secondary symptom profiles within the context of severity and bereavement.

PubMed

Thompson, Angus H; Bland, Roger C

2018-02-01

Most population studies report higher rates of depression among women than men, and some researchers have observed gender differences in depression symptoms overall, or in sub-groupings (e.g. somatic depression). However, gender symptom differences have been inconsistent, prompting this investigation of gender differences in secondary DSM symptom profiles in the context of bereavement status, age, and depression severity. Individuals with symptoms of core depression (flat affect or anhedonia) were selected from a large survey of adults in the Alberta, Canada workforce. Analyses involved the comparison of gender profiles across the seven DSM-IV secondary depressive symptoms plus a MANOVA of sex, bereavement, and age, with secondary symptoms comprising the dependent variable. Gender profiles were very similar, irrespective of depression severity or bereavement. Secondary symptoms were marginally more common among women and more frequent among bereaved young adults, but there was no evidence for a gender-related somatic factor. First, data were gathered only for persons in the workforce and thus may not be generalizable to, for example, stay-at-home parents or those with employment issues. Second, the focus here is restricted to DSM symptoms, leaving risk factors, social roles, and brain functioning for separate investigation. Third, inferences were drawn from associations between groups of persons, rather than between individuals, requiring caution when speculating about individual attributes. Gender differences in depression represent a difference in amount, not kind, suggesting that the range of depressive experiences is similar for men and women. There was no gender difference ascribable to somatic depression. Copyright © 2017 Elsevier B.V. All rights reserved.

Item Response Theory Analyses of the Cambridge Face Memory Test (CFMT)

PubMed Central

Cho, Sun-Joo; Wilmer, Jeremy; Herzmann, Grit; McGugin, Rankin; Fiset, Daniel; Van Gulick, Ana E.; Ryan, Katie; Gauthier, Isabel

2014-01-01

We evaluated the psychometric properties of the Cambridge face memory test (CFMT; Duchaine & Nakayama, 2006). First, we assessed the dimensionality of the test with a bi-factor exploratory factor analysis (EFA). This EFA analysis revealed a general factor and three specific factors clustered by targets of CFMT. However, the three specific factors appeared to be minor factors that can be ignored. Second, we fit a unidimensional item response model. This item response model showed that the CFMT items could discriminate individuals at different ability levels and covered a wide range of the ability continuum. We found the CFMT to be particularly precise for a wide range of ability levels. Third, we implemented item response theory (IRT) differential item functioning (DIF) analyses for each gender group and two age groups (Age ≤ 20 versus Age > 21). This DIF analysis suggested little evidence of consequential differential functioning on the CFMT for these groups, supporting the use of the test to compare older to younger, or male to female, individuals. Fourth, we tested for a gender difference on the latent facial recognition ability with an explanatory item response model. We found a significant but small gender difference on the latent ability for face recognition, which was higher for women than men by 0.184, at age mean 23.2, controlling for linear and quadratic age effects. Finally, we discuss the practical considerations of the use of total scores versus IRT scale scores in applications of the CFMT. PMID:25642930

Exploring Career Development in Emerging Adult Collegians

ERIC Educational Resources Information Center

Rosemond, Marie Michelle; Owens, Delila

2018-01-01

Emerging adulthood is defined as age-based (18-29 years of age). This age range is central to traditional age collegians who are a very diverse group (i.e., relative to race/ethnicity, gender, socioeconomic status, relationship status, and educational attainment). In an effort to explore the career development process of college students this…

Endorsement and Timing of Sexual Orientation Developmental Milestones Among Sexual Minority Young Adults in the Growing Up Today Study

PubMed Central

Katz-Wise, Sabra L.; Rosario, Margaret; Calzo, Jerel P.; Scherer, Emily A.; Sarda, Vishnudas; Austin, S. Bryn

2017-01-01

This research examined endorsement and timing of sexual orientation developmental milestones. Participants were 1235 females and 398 males from the Growing Up Today Study, ages 22 to 29 years, who endorsed a sexual minority orientation (lesbian/gay, bisexual, mostly heterosexual) or reported same-gender sexual behavior (heterosexual with same-gender sexual experience). An online survey measured current sexual orientation and endorsement and timing (age first experienced) of five sexual orientation developmental milestones: same-gender attractions, other-gender attractions, same-gender sexual experience, other-gender sexual experience, and sexual minority identification. Descriptive analyses and analyses to test for gender and sexual orientation group differences were conducted. Results indicated that females were more likely than males to endorse same-gender attraction, other-gender attraction, and other-gender sexual experience, with the most gender differences in endorsement among mostly heterosexuals and heterosexuals with same-gender sexual experience. In general, males reached milestones earlier than females, with the most gender differences in timing among lesbian and gay individuals and heterosexuals with same-gender sexual experience. Results suggest that the three sexual minority developmental milestones may best characterize the experiences of lesbians, gay males, and female and male bisexuals. More research is needed to understand sexual orientation development among mostly heterosexuals and heterosexuals with same-gender sexual experience. PMID:27148762

Endorsement and Timing of Sexual Orientation Developmental Milestones Among Sexual Minority Young Adults in the Growing Up Today Study.

PubMed

Katz-Wise, Sabra L; Rosario, Margaret; Calzo, Jerel P; Scherer, Emily A; Sarda, Vishnudas; Austin, S Bryn

2017-02-01

This research examined endorsement and timing of sexual orientation developmental milestones. Participants were 1,235 females and 398 males from the Growing Up Today Study, ages 22 to 29 years, who endorsed a sexual minority orientation (lesbian/gay, bisexual, mostly heterosexual) or reported same-gender sexual behavior (heterosexual with same-gender sexual experience). An online survey measured current sexual orientation and endorsement and timing (age first experienced) of five sexual orientation developmental milestones: same-gender attractions, other-gender attractions, same-gender sexual experience, other-gender sexual experience, and sexual minority identification. Descriptive analyses and analyses to test for gender and sexual orientation group differences were conducted. Results indicated that women were more likely than men to endorse same-gender attraction, other-gender attraction, and other-gender sexual experience, with the most gender differences in endorsement among mostly heterosexuals and heterosexuals with same-gender sexual experience. In general, men reached milestones earlier than women, with the most gender differences in timing among lesbian and gay individuals and heterosexuals with same-gender sexual experience. Results suggest that the three sexual minority developmental milestones may best characterize the experiences of lesbians, gay males, and female and male bisexuals. More research is needed to understand sexual orientation development among mostly heterosexuals and heterosexuals with same-gender sexual experience.

Masculine Traits and Depressive Symptoms in Older and Younger Men and Women

PubMed Central

Price, Elizabeth C.; Gregg, Jeffrey J.; Smith, Merideth D.; Fiske, Amy

2015-01-01

Evidence suggests that men who strongly endorse masculine traits display an atypical presentation of depression, including more externalizing symptoms (e.g., anger or substance use), but fewer typical, internalizing symptoms (e.g., depressed mood or crying). This phenomenon has not been adequately explored in older adults or women. The current study used the externalizing subscale of the Masculine Depression Scale in older and younger men and women to detect atypical symptoms. It was predicted that individuals who more strongly endorsed masculine traits would have higher scores on the measure of externalizing symptoms relative to a measure of typical depressive symptoms Center for Epidemiologic Studies–Depression Scale. It was anticipated that results would differ by age-group but not by gender. Multigroup path analysis was used to test the hypothesis. The hypothesized path model, in which endorsement of masculine traits was associated with lower scores on the Center for Epidemiologic Studies–Depression Scale and with scores on the externalizing, but not internalizing, factor of the Masculine Depression Scale, fit the data well. Results differed significantly by age-group and gender. Masculine individuals reported lower levels of typical depressive symptoms relative to externalizing symptoms, but further research is needed within age- and gender groups. Results are consistent with the gendered responding framework and suggest that current assessment tools, which tend to focus on internalizing symptoms of depression, may not detect depression in individuals who endorse masculine traits. PMID:26634856

Smoking Behaviors Among Adolescents in Foster Care: A Gender-Based Analysis.

PubMed

Shpiegel, Svetlana; Sussman, Steve; Sherman, Scott E; El Shahawy, Omar

2017-09-19

Adolescents in foster care are at high risk for cigarette smoking. However, it is not clear how their smoking behaviors vary by gender. The present study examined lifetime and current smoking among males and females, and explored gender-specific risk factors for engagement in smoking behaviors. Data from the Multi Site Evaluation of Foster Youth Programs was used to evaluate patterns of smoking among adolescents aged 12-18 years (N = 1121; 489 males, 632 females). Males and females did not differ significantly in rates of lifetime and current smoking, or in the age of smoking initiation and number of cigarettes smoked on a typical day. Gender-based analyses revealed that older age and placement in group homes or residential treatment facilities were associated with heightened risk of smoking among males. In contrast, sexual minority status (i.e., nonheterosexual orientation) and increased childhood victimization were associated with heightened risk of smoking among females. A history of running away was linked to smoking in both genders. Gender should be considered when designing intervention programs to address cigarette smoking among foster youth, as the stressors associated with smoking may differ for males and females.

Exploring comfort food preferences across age and gender.

PubMed

Wansink, Brian; Cheney, Matthew M; Chan, Nina

2003-09-01

Building on findings related to physiological and psychological motivations of food preference, this research develops a framework to examine preferences toward comfort foods. Study 1 used a North American survey of 411 people to determine favored comfort foods, and Study 2 quantified the preferences for these foods across gender and across age groups using a stratified sample of 1005 additional people. Consistent with hypotheses, the findings showed different comfort food preferences across gender and across age. Males preferred warm, hearty, meal-related comfort foods (such as steak, casseroles, and soup), while females instead preferred comfort foods that were more snack related (such as chocolate and ice cream). In addition, younger people preferred more snack-related comfort foods compared to those over 55 years of age. Associations with guilty feelings underscored how these different preferences between males and females may extend to areas of application.

A cross-sectional study of the influence of neighborhood environment on childhood overweight and obesity: Variation by age, gender, and environment characteristics.

PubMed

Yang, Yong; Jiang, Yu; Xu, Yanqing; Mzayek, Fawaz; Levy, Marian

2018-03-01

To examine the influence of neighborhood environment on childhood overweight and obesity in Shelby County Schools, Tennessee, and whether and to what extent that influence varies by age, gender, and the specific environment characteristics. 41,283 students were surveyed covering both individual-level covariates and several objective measures of neighborhood environment. Multilevel logistic regressions were used to examine the influence of neighborhood-level variables on overweight+obesity and obesity with adjustment of individual-level covariates. Further, a stratified analysis for each of the six groups by school level and gender. For both overweight+obesity and obesity, younger children were less sensitive to neighborhood characteristics than older children, and boys are less sensitive than girls. For girls in middle and high schools, the risk of overweight+obesity and obesity were positively associated with population density, and negatively associated with percent of poverty and percent of unhealthy food. Boys' risk of overweight+obesity and obesity were positively associated with distance to park. Neighborhood environment plays an important role in childhood overweight and obesity, and the effects vary by age, gender, and the specific neighborhood characteristic. Intervention programs tailored to specific groups may be more effective than ones targeted to children as a whole. Copyright © 2018 Elsevier Inc. All rights reserved.

Impact of Martial Arts (Judo, Karate, and Kung Fu) on Bone Mineral Density Gains in Adolescents of Both Genders: 9-Month Follow-Up.

PubMed

Ito, Igor H; Kemper, Han C G; Agostinete, Ricardo R; Lynch, Kyle R; Christofaro, Diego G D; Ronque, Enio R; Fernandes, Rômulo A

2017-11-01

To compare bone mineral density (BMD) gains in adolescents of both genders stratified according to different martial art styles in a 9-month follow-up study. The longitudinal study consisted of 29 adolescents of both genders and age between 11 and 17 years stratified into a control group (not engaged in any sport) and 50 fighters (kung fu/karate, n = 29; judo, n = 21). All 79 subjects underwent anthropometric measures (weight, height, leg length, and height set) and dual-energy X-ray absorptiometry (BMD, in g/cm 2 ) at 2 moments, baseline and 9 months later. Maturity offset (age at peak height velocity), lean soft tissue, chronological age, and resistance training were treated as covariates. Male judoists presented higher gains in BMD-spine [0.098 g/cm 2 (95% confidence interval, 0.068-0.128)] than control group [0.040 g/cm 2 (95% confidence interval, 0.011-0.069)] (post hoc test with P = .030). There was no effect of martial art on BMD gains among girls. Independently of gender, in all multivariate models, lean soft tissue constituted the most relevant covariate. Judo practice in adolescents affected the bone accrual significantly after 9-month follow-up compared with controls, mainly in boys.

Stigmatizing attitudes and beliefs about bulimia nervosa: gender, age, education and income variability in a community sample.

PubMed

McLean, Siân A; Paxton, Susan J; Massey, Robin; Hay, Phillipa J; Mond, Jonathan M; Rodgers, Bryan

2014-05-01

Stigmatizing attitudes towards eating disorders negatively impacts treatment seeking. To determine the effect of interventions to reduce stigma, a measure of stigma that is simple to implement is required. This study aimed to develop a measure of stigmatizing attitudes and beliefs towards bulimia nervosa (SAB-BN) and evaluate the distribution of beliefs across gender, age, education, and income groups. Participants were 1828 community adults (890 men; 938 women) aged 18-65 sampled from the Australian Electoral Roll responded to a mailed questionnaire. Participants provided demographic information and completed the SAB-BN questionnaire. Five components of stigmatizing attitudes and beliefs were identified; advantages of BN, minimization/low seriousness, unreliability, social distance, and personal responsibility. Stigma was low except on social distance and personal responsibility sub-scales, which indicated negative attitudes toward people with bulimia. Men compared with women and lower compared with higher education and income groups held significantly higher stigmatizing attitudes and beliefs. There were few differences between age groups in stigma. Differences between demographic groups provides evidence for known-groups validity. The SAB-BN questionnaire provides a potentially useful tool for evaluating stigma in relation to BN. Results provide insight into components of stigma and the demographic groups to whom interventions should be targeted. Copyright © 2013 Wiley Periodicals, Inc.

Gender Differences in Homicide of Neonates, Infants, and Children under 5 y in South Africa: Results from the Cross-Sectional 2009 National Child Homicide Study.

PubMed

Abrahams, Naeemah; Mathews, Shanaaz; Martin, Lorna J; Lombard, Carl; Nannan, Nadine; Jewkes, Rachel

2016-04-01

Homicide of children is a global problem. The under-5-y age group is the second largest homicide age group after 15-19 y olds, but has received little research attention. Understanding age and gender patterns is important for assisting with developing prevention interventions. Here we present an age and gender analysis of homicides among children under 5 y in South Africa from a national study that included a focus on neonaticide and infanticide. A retrospective national cross-sectional study was conducted using a random sample of 38 medico-legal laboratories operating in 2009 to identify homicides of children under 5 y. Child data were abstracted from the mortuary files and autopsy reports, and both child and perpetrator data data were collected from police interviews. We erred towards applying a conservative definition of homicide and excluded sudden infant death syndrome cases. We estimated that 454 (95% CI 366, 541) children under the age of 5 y were killed in South Africa in 2009. More than half (53.2%; 95% CI 46.7%, 59.5%) were neonates (0-28 d), and 74.4% (95% CI 69.3%, 78.9%) were infants (under 1 y), giving a neonaticide rate of 19.6 per 100,000 live births and an infanticide rate of 28.4 per 100,000 live births. The majority of the neonates died in the early neonatal period (0-6 d), and abandonment accounted for 84.9% (95% CI 81.5%, 87.8%) of all the neonates killed. Distinct age and gender patterns were found, with significantly fewer boy children killed in rural settings compared to urban settings (odds ratio 0.6; 95% CI 0.4, 0.9; p = 0.015). Abuse-related killings and evidence of sexual assault were more common among older girls than in all other age and gender groups. Mothers were identified as the perpetrators in all of the neonaticides and were the most common perpetrators overall (71.0%; 95% CI 63.9%, 77.2%). Abandoned neonates were mainly term babies, with a mean gestational age of 38 wk. We did not have information on abandonment motives for all newborns and did not know if babies were abandoned with the intention that they would die or with the hope that they would be found alive. We therefore considered all abandoned babies as homicides. Homicide of children is an extreme form or consequence of violence against children. This national study provides one of the first analyses of neonaticide and infanticide by age and gender and shows the failure of reproductive and mental health and social services to identify and help vulnerable mothers. Multi-sectoral prevention strategies are needed.

Social and gender determinants of risk of cryptosporidiosis, an emerging zoonosis, in Dagoretti, Nairobi, Kenya.

PubMed

Kimani, Violet N; Mitoko, Grace; McDermott, Brigid; Grace, Delia; Ambia, Julie; Kiragu, Monica W; Njehu, Alice N; Sinja, Judith; Monda, Joseph G; Kang'ethe, Erastus K

2012-09-01

The aim of the study was to investigate the social and gender determinants of the risk of exposure to Cryptosporidium from urban dairying in Dagoretti, Nairobi. Focus group discussions were held in six locations to obtain qualitative information on risk of exposure. A repeated cross-sectional descriptive study included participatory assessment and household questionnaires (300 randomly selected urban dairy farming households and 100 non-dairying neighbours). One-hundred dairy households randomly selected from the 300 dairy households participated in an additional economic survey along with 40 neighbouring non-dairy households. We found that exposure to Cryptosporidium was influenced by gender, age and role in the household. Farm workers and people aged 50 to 65 years had most contact with cattle, and women had greater contact with raw milk. However, children had relatively higher consumption of raw milk than other age groups. Adult women had more daily contact with cattle faeces than adult men, and older women had more contact than older men. Employees had greater contact with cattle than other groups and cattle faeces, and most (77 %) were male. Women took more care of sick people and were more at risk from exposure by this route. Poverty did not affect the level of exposure to cattle but did decrease consumption of milk. There was no significant difference between men and women as regards levels of knowledge on symptoms of cryptosporidiosis infections or other zoonotic diseases associated with dairy farming. Awareness of cryptosporidiosis and its transmission increased significantly with rising levels of education. Members of non-dairy households and children under the age of 12 years had significantly higher odds of reporting diarrhoea: gender, season and contact with cattle or cattle dung were not significantly linked with diarrhoea. In conclusion, social and gender factors are important determinants of exposure to zoonotic disease in Nairobi.

Motivations for play in online games.

PubMed

Yee, Nick

2006-12-01

An empirical model of player motivations in online games provides the foundation to understand and assess how players differ from one another and how motivations of play relate to age, gender, usage patterns, and in-game behaviors. In the current study, a factor analytic approach was used to create an empirical model of player motivations. The analysis revealed 10 motivation subcomponents that grouped into three overarching components (achievement, social, and immersion). Relationships between motivations and demographic variables (age, gender, and usage patterns) are also presented.

Gender classification in children based on speech characteristics: using fundamental and formant frequencies of Malay vowels.

PubMed

Zourmand, Alireza; Ting, Hua-Nong; Mirhassani, Seyed Mostafa

2013-03-01

Speech is one of the prevalent communication mediums for humans. Identifying the gender of a child speaker based on his/her speech is crucial in telecommunication and speech therapy. This article investigates the use of fundamental and formant frequencies from sustained vowel phonation to distinguish the gender of Malay children aged between 7 and 12 years. The Euclidean minimum distance and multilayer perceptron were used to classify the gender of 360 Malay children based on different combinations of fundamental and formant frequencies (F0, F1, F2, and F3). The Euclidean minimum distance with normalized frequency data achieved a classification accuracy of 79.44%, which was higher than that of the nonnormalized frequency data. Age-dependent modeling was used to improve the accuracy of gender classification. The Euclidean distance method obtained 84.17% based on the optimal classification accuracy for all age groups. The accuracy was further increased to 99.81% using multilayer perceptron based on mel-frequency cepstral coefficients. Copyright © 2013 The Voice Foundation. Published by Mosby, Inc. All rights reserved.

Gender Differences in Performance of Script Analysis by Older Adults

ERIC Educational Resources Information Center

Helmes, E.; Bush, J. D.; Pike, D. L.; Drake, D. G.

2006-01-01

Script analysis as a test of executive functions is presumed sensitive to cognitive changes seen with increasing age. Two studies evaluated if gender differences exist in performance on scripts for familiar and unfamiliar tasks in groups of cognitively intact older adults. In Study 1, 26 older adults completed male and female stereotypical…

Gender bias in beliefs on physical activity: Buffering effects of sport participation among girls

USDA-ARS?s Scientific Manuscript database

The purpose of this study was to determine effects of child gender on parental and child beliefs and evaluate competitive sport participation as a modifier of child beliefs. Two age-groups of children and parents completed measures on child athletic appearance, competence, importance of physical act...

QT dispersion increases with low glomerular filtration rate in patients with coronary artery disease

PubMed Central

Celik, Murat; Yuksel, UygarCagdas; Gokoglan, Yalcin; Bugan, Baris; Yalcinkaya, Emre; Unal, HilmiUmut; Celik, Turgay; Iyisoy, Atila; Kilic, Selim

2014-01-01

Objective: We aimed to evaluate the relationship between estimated glomerular filtration rate (eGFR) and QT dispersion (QTd) in patients with coronary artery disease (CAD). Methods: Sixty patients(mean age 62.72 ± 12.48 years) included 46 male, (mean age 60.89 ± 12.70 years)and 14 female (mean age 68.71± 9.86 years) were enrolled in this study. Patients were divided into 2 groups according to their eGFR using the 6 variable MDRD equation. Group 1 consisted of patients with estimated eGFR<60 ml/min/1.73m2 and Group 2 consisted of patients witheGFR ≥ 60 ml/min/1.73m2. Results: Baseline patient characteristics were homogeneous in both groups except for age, gender and smoking.Also, the extent of CAD was similar in both groups (p > 0.05) QTd values were found higher in group 1 than those of group 2 (57.23 ± 40.65 ms vs. 31.23 ± 14.47 ms, p = 0.002). After adjustment for age, gender and smoking using one-way ANCOVA test, statistically significant difference in QTd still existedbetween the groups (p=0.038). Conclusion:QTd tends to be higher in patients with poor renal function independent of severity of angiographical CAD. QTd may be a potentially useful non-invasive test in the management of patients with poor renal function, especially those with CAD. PMID:24772124

Olfactory Function is Associated with Cognitive Performance: Results of the Heinz Nixdorf Recall Study.

PubMed

Tebrügge, Sarah; Winkler, Angela; Gerards, Diana; Weimar, Christian; Moebus, Susanne; Jöckel, Karl-Heinz; Erbel, Raimund; Jokisch, Martha

2018-01-01

There is strong evidence for an association of olfactory dysfunction and neurodegenerative diseases. Studies on the association of olfaction and cognition in the general population are rare. To evaluate gender- and age-specific associations of olfactory function and cognitive performance in a well characterized population-based study sample. At the third examination of the Heinz Nixdorf Recall study (n = 3,087), 2,640 participants (48% men; 68.2±7.2 years) underwent Sniffin' Sticks Screening Test measuring olfactory function on a scale of 0-12 points. Olfactory function was rated as anosmic, hyposmic, or normosmic (≤6, 7-10 or ≥11 points, respectively). All participants performed eight validated cognitive subtests. Age- (55-64 years, 65-74 years, 75-86 years) and gender-stratified multivariate analysis of covariance was used to evaluate group differences in cognitive performance. Women showed better olfactory function than men (p < 0.001). For middle-aged participants, olfactory groups differed in almost all cognitive subtests. The analyses revealed no gender effects, although associations were slightly greater for women than for men. Anosmics showed the worst cognitive performance and normosmics showed the best cognitive performance. In the young- and old-aged groups, a quantitative association was found for anosmics in all subtests and for normosmics and hyposmics in almost all subtests. This is the first study reporting on age-specific associations of olfactory function and cognitive performance in the general population. The association found in middle-aged participants (65-74 years) may serve as a marker to improve identification of persons at high risk for cognitive decline and dementia.

Exploring patterns of response across the lifespan: the Cambridge Centre for Ageing and Neuroscience (Cam-CAN) study.

PubMed

Green, Emma; Bennett, Holly; Brayne, Carol; Matthews, Fiona E

2018-06-19

With declining rates of participation in epidemiological studies there is an important need to attempt to understand what factors might affect response. This study examines the pattern of response at different adult ages within a contemporary cross-sectional population-based cohort, the Cambridge Centre for Ageing and Neuroscience (Cam-CAN). Using logistic regression, we investigated associations between age, gender and Townsend deprivation level for both participants and non-participants. Weighted estimates of the odds ratios with confidence intervals for each demographic characteristic were calculated. Reasons given for refusal were grouped into three broad categories: 'active', 'passive' and illness preventing interview. An association of age and participation was found, with individuals in middle age groups more likely to participate (age group 48-57 OR: 1.8, 95% CI: 1.5-2.2 and age group 58-67 OR: 2.1, 95% CI: 1.7-2.4). Overall, there was no difference in participation between men and women. An association with deprivation was found, with those living in the most deprived areas being the least willing to participate (fifth quintile OR: 0.6, 95% CI: 0.5-0.7). An interaction between age and gender was found whereby younger women and older men were more likely to agree to participate (p = 0.01). Our findings highlight some of the factors affecting recruitment into epidemiological studies in the UK and suggest that targeted age-specific recruitment strategies might be needed to increase participation rates in future cohort investigations.

Specific cross-gender behaviour in boyhood and later homosexual orientation.

PubMed

Green, R; Roberts, C W; Williams, K; Goodman, M; Mixon, A

1987-07-01

Data from a group of males aged 13 to 23, who as children exhibited extensive cross-gender behaviour, was analysed. In boyhood they frequently played with dress-up dolls, role-played as females, dressed in girls' clothes, stated the wish to be girls, primarily had girls as friends, and avoided rough-and-tumble play. The majority of the group evolved a bisexual or homosexual orientation; two types of behaviour, boyhood doll play and female role-playing, were found to be associated with later homosexual orientation. The findings suggest developmental associations between specific types of boyhood cross-gender behaviour and the objects of later sexual arousal.

Gender and age effects on risk factor-based prediction of coronary artery calcium in symptomatic patients: A Euro-CCAD study.

PubMed

Nicoll, R; Wiklund, U; Zhao, Y; Diederichsen, A; Mickley, H; Ovrehus, K; Zamorano, J; Gueret, P; Schmermund, A; Maffei, E; Cademartiri, F; Budoff, M; Henein, M

2016-09-01

The influence of gender and age on risk factor prediction of coronary artery calcification (CAC) in symptomatic patients is unclear. From the European Calcific Coronary Artery Disease (EURO-CCAD) cohort, we retrospectively investigated 6309 symptomatic patients, 62% male, from Denmark, France, Germany, Italy, Spain and USA. All of them underwent risk factor assessment and CT scanning for CAC scoring. The prevalence of CAC among females was lower than among males in all age groups. Using multivariate logistic regression, age, dyslipidaemia, hypertension, diabetes and smoking were independently predictive of CAC presence in both genders. In addition to a progressive increase in CAC with age, the most important predictors of CAC presence were dyslipidaemia and diabetes (β = 0.64 and 0.63, respectively) in males and diabetes (β = 1.08) followed by smoking (β = 0.68) in females; these same risk factors were also important in predicting increasing CAC scores. There was no difference in the predictive ability of diabetes, hypertension and dyslipidaemia in either gender for CAC presence in patients aged <50 and 50-70 years. However, in patients aged >70, only dyslipidaemia predicted CAC presence in males and only smoking and diabetes were predictive in females. In symptomatic patients, there are significant differences in the ability of conventional risk factors to predict CAC presence between genders and between patients aged <70 and ≥70, indicating the important role of age in predicting CAC presence. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Bridging Multidimensional Models of Ethnic-Racial and Gender Identity Among Ethnically Diverse Emerging Adults.

PubMed

Wilson, Antoinette R; Leaper, Campbell

2016-08-01

The purpose of this study was to integrate and validate a multidimensional model of ethnic-racial identity and gender identity borrowing constructs and measures based on social identity and gender identity theories. Participants included 662 emerging adults (M age  = 19.86 years; 75 % female) who self-identified either as Asian American, Latino/a, or White European American. We assessed the following facets separately for ethnic-racial identity and gender identity: centrality, in-group affect, in-group ties, self-perceived typicality, and felt conformity pressure. Within each identity domain (gender or ethnicity/race), the five dimensions generally indicated small-to-moderate correlations with one another. Also, correlations between domains for each dimension (e.g., gender typicality and ethnic-racial typicality) were mostly moderate in magnitude. We also noted some group variations based on participants' ethnicity/race and gender in how strongly particular dimensions were associated with self-esteem. Finally, participants who scored positively on identity dimensions for both gender and ethnic-racial domains indicated higher self-esteem than those who scored high in only one domain or low in both domains. We recommend the application of multidimensional models to study social identities in multiple domains as they may relate to various outcomes during development.

Gender differences in psychotic disorders with concurrent substance use.

PubMed

Caton, Carol L M; Xie, Haiyi; Drake, Robert E; McHugo, Gregory

2014-01-01

We conducted a comparative analysis of gender differences in patients with primary psychotic disorders with concurrent substance use and in those with substance-induced psychoses. A total of 385 individuals admitted to psychiatric emergency departments with early-onset psychosis and recent substance use were interviewed at baseline and at six-month intervals for two years. Using a standardized research diagnostic assessment instrument, we classified patients at baseline into primary and substance-induced psychosis groups and analyzed the effects of gender on demographic, family, and clinical characteristics at baseline, the interaction of gender and diagnosis, and gender main effects on illness course, adjustment, and service use over the two-year follow-up period. Women had better premorbid adjustment, less misattribution of symptoms, and a later age at onset of regular drug use compared to men. Women, however, showed greater depression and histories of abuse compared to men. Men had greater arrest histories. No interactions between gender and diagnosis were significant. Both genders in the primary and substance-induced psychosis groups showed clinical and functional improvement over the follow-up period despite the overall minimal use of mental health and substance abuse treatment services. Women and men with psychosis and substance use differ on several dimensions. Our findings suggest the need for gender-specific treatment programming across both diagnostic groups.

Anthropometry of elderly residents in the city of São Paulo, Brazil.

PubMed

Barbosa, Aline R; Souza, José M P; Lebrão, Maria L; Laurenti, Ruy; Marucci, Maria de Fátima N

2005-01-01

The article presents gender and age-specific selected anthropometric data for a representative sample of elderly Brazilians in the city of São Paulo. This was a cross-sectional, population-based household survey. A total of 1,894 older adults (men and women, > 60 years) were examined from January to March 2001. Data were presented as means and percentiles for body mass (BM); height or stature (ST); body mass index (BMI); waist (WC), hip (HC), arm (AC), and calf (CC) circumferences; triceps skinfold thickness (TST); and arm muscle circumference (AMC), and differences were described according to age (all variables) and gender (BMI). Except for HC (men), all anthropometric variables were lower in the oldest than in the youngest individuals (p < 0.01) in both genders. BMI was significantly higher (p < 0.01) in women than men (all age groups). The observations suggest that there is loss of muscle mass and redistribution and reduction of fat mass with age (both genders). The data can be used in clinical practice and epidemiological studies based on interpretation of anthropometric measurements in the elderly in São Paulo.

The effect of gender and age structure on municipal waste generation in Poland.

PubMed

Talalaj, Izabela Anna; Walery, Maria

2015-06-01

In this study the effect of gender and age structure on municipal waste generation was investigated. The data from 10-year period, from 2001 to 2010 year, were taken into consideration. The following parameters of gender and age structure were analyzed: men and woman quantity, female to male ratio, number of working, pre-working and post-working age men/women, number of unemployed men/women. The results have showed a strong correlation of annual per capita waste generation rate with number of unemployed women (r=0.70) and female to male ratio (r=0.81). This indicates that waste generation rate is more depended on ratio of men and women that on quantitative size of each group. Using the regression analysis a model describing the dependence between female to male ratio, number of unemployed woman and waste quantity was determined. The model explains 70% of waste quantity variation. Obtained results can be used both to improve waste management and to a fuller understanding of gender behavior. Copyright © 2015 Elsevier Ltd. All rights reserved.

Interactive effects of age and gender on EEG power and coherence during a short-term memory task in middle-aged adults.

PubMed

Kober, Silvia Erika; Reichert, Johanna Louise; Neuper, Christa; Wood, Guilherme

2016-04-01

The effects of age and gender on electroencephalographic (EEG) activity during a short-term memory task were assessed in a group of 40 healthy participants aged 22-63 years. Multi-channel EEG was recorded in 20 younger (mean = 24.65-year-old, 10 male) and 20 middle-aged participants (mean = 46.40-year-old, 10 male) during performance of a Sternberg task. EEG power and coherence measures were analyzed in different frequency bands. Significant interactions emerged between age and gender in memory performance and concomitant EEG parameters, suggesting that the aging process differentially influences men and women. Middle-aged women showed a lower short-term memory performance compared to young women, which was accompanied by decreasing delta and theta power and increasing brain connectivity with age in women. In contrast, men showed no age-related decline in short-term memory performance and no changes in EEG parameters. These results provide first evidence of age-related alterations in EEG activity underlying memory processes, which were already evident in the middle years of life in women but not in men. Copyright © 2016 Elsevier Inc. All rights reserved.

Childhood gender-typed behavior and adolescent sexual orientation: A longitudinal population-based study.

PubMed

Li, Gu; Kung, Karson T F; Hines, Melissa

2017-04-01

Lesbian and gay individuals have been reported to show more interest in other-sex, and/or less interest in same-sex, toys, playmates, and activities in childhood than heterosexual counterparts. Yet, most of the relevant evidence comes from retrospective studies or from prospective studies of clinically referred, extremely gender nonconforming children. In addition, findings are mixed regarding the relation between childhood gender-typed behavior and the later sexual orientation spectrum from exclusively heterosexual to exclusively lesbian/gay. The current study drew a sample (2,428 girls and 2,169 boys) from a population-based longitudinal study, and found that the levels of gender-typed behavior at ages 3.5 and 4.75 years, although less so at age 2.5 years, significantly and consistently predicted adolescents' sexual orientation at age 15 years, both when sexual orientation was conceptualized as 2 groups or as a spectrum. In addition, within-individual change in gender-typed behavior during the preschool years significantly related to adolescent sexual orientation, especially in boys. These results suggest that the factors contributing to the link between childhood gender-typed behavior and sexual orientation emerge during early development. Some of those factors are likely to be nonsocial, because nonheterosexual individuals appear to diverge from gender norms regardless of social encouragement to conform to gender roles. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

Birth Order and Sibling Sex Ratio of Children and Adolescents Referred to a Gender Identity Service

PubMed Central

VanderLaan, Doug P.; Blanchard, Ray; Wood, Hayley; Zucker, Kenneth J.

2014-01-01

In adult male samples, homosexuality is associated with a preponderance of older brothers (i.e., the fraternal birth order effect). In several studies comparing gender dysphoric youth, who are likely to be homosexual in adulthood, to clinical or non-clinical control groups, the findings have been consistent with the fraternal birth order effect in males; however, less is known about unique sibship characteristics of gender dysphoric females. The current study investigated birth order and sibling sex ratio in a large sample of children and adolescents referred to the same Gender Identity Service (N = 768). Probands were classified as heterosexual males, homosexual males, or homosexual females based on clinical diagnostic information. Groups differed significantly in age and sibship size, and homosexual females were significantly more likely to be only children. Subsequent analyses controlled for age and for sibship size. Compared to heterosexual males, homosexual males had a significant preponderance of older brothers and homosexual females had a significant preponderance of older sisters. Similarly, the older sibling sex ratio of homosexual males showed a significant excess of brothers whereas that of homosexual females showed a significant excess of sisters. Like previous studies of gender dysphoric youth and adults, these findings were consistent with the fraternal birth order effect. In addition, the greater frequency of only children and elevated numbers of older sisters among the homosexual female group adds to a small literature on sibship characteristics of potential relevance to the development of gender identity and sexual orientation in females. PMID:24651045

Comparing perceived effectiveness of FDA-proposed cigarette packaging graphic health warnings between sexual and gender minorities and heterosexual adults.

PubMed

Tan, Andy S L; Bigman, Cabral A; Nagler, Rebekah H; Minsky, Sara; Viswanath, Kasisomayajula

2017-10-01

In 2012, the U.S. Food and Drug Administration proposed nine graphic health warnings (GHWs) on cigarette packaging that were rated equally effective across racial/ethnic, education, or income groups of adult smokers. However, data on GHW effectiveness among sexual and gender minority (SGM) adults, who have higher smoking prevalence, are currently lacking. This study analyzed whether perceived effectiveness of GHWs differed by gender and sexual orientation. Data came from a randomized experiment among 1,200 adults with an oversample from low socioeconomic status groups, conducted between 2013 and 2014 in three Massachusetts communities. Participants viewed and rated the effectiveness of nine GHWs. Mixed effects regression models predicted perceived effectiveness with gender and sexual orientation, adjusting for repeated measurements, GHWs viewed, age, race, ethnicity, smoking status, and health status. Female heterosexuals rated GHWs as more effective than male heterosexual, lesbian, and transgender and other gender respondents. There was no significant difference between female and male heterosexuals versus gay, male bisexual, or female bisexual respondents. Differences by gender and sexual orientation were consistent across all nine GHWs. Significant correlates of higher perceived effectiveness included certain GHWs, older age, being African-American (vs white), being Hispanic (vs non-Hispanic), having less than high school education (vs associate degree or higher), and being current smokers (vs non-smokers). Perceived effectiveness of GHWs was lower in certain SGM groups. We recommend further studies to understand the underlying mechanisms for these findings and investments in research and policy to communicate anti-smoking messages more effectively to SGM populations.

Differential effect of birthplace and length of residence on body mass index (BMI) by education, gender and race/ethnicity.

PubMed

Sanchez-Vaznaugh, Emma V; Kawachi, Ichiro; Subramanian, S V; Sánchez, Brisa N; Acevedo-Garcia, Dolores

2008-10-01

Although birthplace and length of residence have been found to be associated with Body Mass Index (BMI)/obesity in the USA, their effects may not be the same across groups defined by education, gender and race/ethnicity. Using cross-sectional population based data from the 2001 California Health Interview Survey, we investigated the associations of birthplace and US length of residence with BMI, and whether the influence of birthplace-US length of residence on BMI varied by education, gender and race/ethnicity. Our sample included 37,350 adults aged 25-64 years. Self-reported weight and height were used to calculate BMI. Birthplace and length of residence were combined into a single variable divided into five levels: US-born, foreign-born living in the United States for more than 15, 10-14, 5-9, and less than 5 years. Controlling for age, gender, marital status, race/ethnicity, education, income, fruit and vegetable consumption, current smoking and alcohol use, we found that: (1) foreign-born adults had lower BMI than US-born adults; (2) among foreign-born adults, longer residence in the United States was associated with higher BMI; and (3) the effect of birthplace-length of US residence on BMI differed by education level, gender and race/ethnicity. Specifically, longer residence in the United States was associated with the greatest percent increases in BMI among the lowest educated groups than higher educated groups, among women (vs. men) and among Hispanics (vs. other racial/ethnic groups). These findings suggest that a protective effect of foreign birthplace on BMI appears to attenuate with length of residence in the United States, and also reveal that BMI/obesity trajectories associated with length of US residence vary by education, gender and race/ethnicity. Immigrant status, independently and in combination with education, gender and race/ethnicity should be considered in future obesity prevention and reduction efforts.

Gender disparities in the associations of behavioral factors, serious psychological distress and chronic diseases with type 2 diabetes screening among US adults.

PubMed

Xie, Xin; Wang, Nianyang; Liu, Ying

2018-01-01

The increasing prevalence of undiagnosed and diagnosed type 2 diabetes (T2D) posed a major challenge for public health and thus screening for T2D becomes essentially important. The social-demographical factors associated with the use of T2D screening have been widely studied, however, little is known about the impact of behavioral factors, mental health and chronic diseases on prevalence of screening, especially by gender and age groups. We investigated the impact of behavioral factors, mental health and chronic diseases across gender and age groups on the usage rate of T2D screening. To analyze the likelihood of the use of T2D screening, we performed weighted binomial logistic regression analyses. Obesity, physical activity and smoking increased the use of T2D screening for females more than for males, and alcohol use increased screenings only for females. Serious psychological distress (SPD) was found to have a positive association with the use of T2D screening for females rather than for males; whereas hypertension and diabetes increased the use of T2D screening for males more than for females. Physical activity was an effective predictor of screening for T2D in the groups of 45-64 years and 65 years or older. Former drinking was positively associated with T2D screening for people aged 65 or older, and smoking was found to increase the odds of screening for T2D for people aged less than 65. Behavioral factors, mental health, and chronic diseases were significantly associated with the use of T2D screening and further demonstrated that gender differences exist in the role of above factors.

Two-year controlled effectiveness trial of a school-based intervention to prevent obesity in Chilean children.

PubMed

Kain, Juliana; Leyton, Barbara; Cerda, Ricardo; Vio, Fernando; Uauy, Ricardo

2009-09-01

Obesity prevalence among Chilean children is 19.4%. The present study aimed to assess the effectiveness of a school-based obesity prevention programme. Non-randomized controlled study. The intervention included activities in nutrition and physical activity, fully applied the first year and partially in the second one. Primary outcomes were BMI Z-score (BMIZ) and obesity prevalence; secondary outcomes were waist circumference and triceps skinfold thickness. Time effects were assessed by changes in BMI-related variables by gender and period (ANOVA and Tukey test), while intervention effects were determined by comparing changes in (i) obesity prevalence by gender and period (PROC GENMOD) and (ii) BMIZ according gender, age and period (PROC MIXED). Primary schools in the Chilean cities of Casablanca (intervention group) and Quillota (control group). One thousand seven hundred and fifty-nine children from three schools (intervention group) and 671 from one school (control group). Over the two years, obesity prevalence and BMIZ declined significantly in the intervention group; from 17.0% to 12.3% and 14.1% to 10.3% in boys and girls, respectively, and from 0.62 to 0.53 and 0.64 to 0.58, respectively. In the control group, obesity remained stable at about 21% and 15%, while BMIZ increased significantly in the second year. BMIZ declined in both genders and all age categories in the intervention group during the first year (significant only in younger boys). No changes occurred during the summer, while during the second year, BMIZ increased in boys and girls from both groups (significant only in the younger control boys). Obesity declined significantly only in boys during the first year. Effectiveness was greater in the first school year and more evident in younger boys.

Sex ratio in multiple sclerosis mortality over 65 years; an age-period-cohort analysis in Norway.

PubMed

Nakken, Ola; Lindstrøm, Jonas Christoffer; Holmøy, Trygve

2018-06-01

Increasing female: male ratio in multiple sclerosis (MS) has been assigned to cohort effects, with females in more recent birth cohorts possibly being more exposed or vulnerable to environmental risk factors than males. We collected MS mortality data in Norway from 1951 to 2015 from The Norwegian Cause of Death registry. Age-Period-Cohort analysis was conducted using log-linear Poisson models, including sex interaction terms. MS was registered as the underlying, contributing or direct cause in 6060 deaths. MS associated mortality remained stable with a slight preponderance among males until after 1980, and have since increased preferentially among females. Throughout the study period the mean annual increase was 1.25% for females and 0.3% for males (p < 0.0001). Age-period-cohort analysis revealed limited evidence of cohort effects for the gender differences; the best fitting model only included gender-age and gender-period interaction terms. The period effect evened out for males in the last three decades but increased for females, especially among the oldest age-groups. In conclusion, the increased female: male mortality ratio in MS associated mortality is driven mainly by increased mortality among females in the three last decades, particularly in the older age groups. It is best explained by disproportional period effects, providing evidence of time-varying external factors including improved access to diagnosis among females.

Sex-dependent age modulation of frontostriatal and temporo-parietal activation during cognitive control.

PubMed

Christakou, Anastasia; Halari, Rozmin; Smith, Anna B; Ifkovits, Eve; Brammer, Mick; Rubia, Katya

2009-10-15

Developmental functional imaging studies of cognitive control show progressive age-related increase in task-relevant fronto-striatal activation in male development from childhood to adulthood. Little is known, however, about how gender affects this functional development. In this study, we used event related functional magnetic resonance imaging to examine effects of sex, age, and their interaction on brain activation during attentional switching and interference inhibition, in 63 male and female adolescents and adults, aged 13 to 38. Linear age correlations were observed across all subjects in task-specific frontal, striatal and temporo-parietal activation. Gender analysis revealed increased activation in females relative to males in fronto-striatal areas during the Switch task, and laterality effects in the Simon task, with females showing increased left inferior prefrontal and temporal activation, and males showing increased right inferior prefrontal and parietal activation. Increased prefrontal activation clusters in females and increased parietal activation clusters in males furthermore overlapped with clusters that were age-correlated across the whole group, potentially reflecting more mature prefrontal brain activation patterns for females, and more mature parietal activation patterns for males. Gender by age interactions further supported this dissociation, revealing exclusive female-specific age correlations in inferior and medial prefrontal brain regions during both tasks, and exclusive male-specific age correlations in superior parietal (Switch task) and temporal regions (Simon task). These findings show increased recruitment of age-correlated prefrontal activation in females, and of age-correlated parietal activation in males, during tasks of cognitive control. Gender differences in frontal and parietal recruitment may thus be related to gender differences in the neurofunctional maturation of these brain regions.

Age, gender and normalization covariates for spinal cord gray matter and total cross-sectional areas at cervical and thoracic levels: A 2D phase sensitive inversion recovery imaging study.

PubMed

Papinutto, Nico; Schlaeger, Regina; Panara, Valentina; Zhu, Alyssa H; Caverzasi, Eduardo; Stern, William A; Hauser, Stephen L; Henry, Roland G

2015-01-01

The source of inter-subject variability and the influence of age and gender on morphometric characteristics of the spinal cord, such as the total cross-sectional area (TCA), the gray matter (GM) and white matter (WM) areas, currently remain under investigation. Understanding the effect of covariates such as age, gender, brain volumes, and skull- and vertebra-derived metrics on cervical and thoracic spinal cord TCA and GM areas in healthy subjects would be fundamental for exploring compartment specific changes in neurological diseases affecting the spinal cord. Using Magnetic Resonance Imaging at 3T we investigated 32 healthy subjects using a 2D phase sensitive inversion recovery sequence and we measured TCA, GM and WM areas at 4 cervical and thoracic levels of the spinal cord. We assessed age and gender relationships of cord measures and explored associations between cord measures and a) brain volumes and b) skull- and vertebra-derived metrics. Age and gender had a significant effect on TCA, WM and GM areas (with women and elderly having smaller values than men and younger people respectively), but not on the GM area/TCA ratio. The total intracranial volume and C3 vertebra dimensions showed the highest correlations with cord measures. When used in multi-regression models, they reduced cord areas group variability by approximately a third. Age and gender influences on cord measures and normalization strategies here presented might be of use in the study of compartment specific changes in various neurological diseases affecting the spinal cord.

Body mass index at age 25 and all-cause mortality in whites and African Americans: the Atherosclerosis Risk in Communities study.

PubMed

Stevens, June; Truesdale, Kimberly P; Wang, Chin-Hua; Cai, Jianwen; Erber, Eva

2012-03-01

Approximately 20% of young adults in the United States are obese, and most of them gain weight between young and middle adulthood. Few studies have examined the association between elevated body mass index (BMI) in early adulthood and mortality or have examined that such effects are independent of changes in weight. To our knowledge, no such study has been conducted in African-American samples. We used data from 13,941 African-American and white adults who self-reported their weight at the age of 25, and had weight and height measured when they were 45-64 years of age (1987-1989). Date of death was ascertained between 1987 and 2005. Hazard ratios and hazard differences for the effects of BMI at age 25 on all-cause mortality were determined using Cox proportional hazard and additive hazard models, respectively. In the combined ethnic-gender groups, the hazard ratio associated with a 5 kg/m(2) increase in BMI at age 25 was 1.28 (95% confidence interval [CI]: 1.22-1.35), and the hazard difference was 2.75 (2.01-3.50) deaths/1,000 person-years. Associations were observed in all four ethnic-gender groups. Models including weight change from age 25 to age in 1987-1989 resulted in null estimates for BMI in African-American men, whereas associations were maintained or only mildly attenuated in other ethnic-gender groups. Excess weight during young adulthood should be avoided because it contributes to increases in death rates that may be independent of changes in weight experienced in later life. Further study is needed to better understand these associations in African-American men. Copyright © 2012 Society for Adolescent Health and Medicine. Published by Elsevier Inc. All rights reserved.

Prevalence and Patterns of Multi-Morbidity in Serbian Adults: A Cross-Sectional Study

PubMed Central

Jovic, Dragana; Vukovic, Dejana; Marinkovic, Jelena

2016-01-01

Introduction Like many developing countries, Serbia is facing a growing burden of chronic diseases. Within such public health issue, multi-morbidity requires a special attention. Aims This study investigated the prevalence of multi-morbidity in the Serbia population and assessed the co-occurrence of chronic diseases by age and gender. Methods We analyzed data from the 2013 National Health Survey, which included 13,103 individuals ≥ 20 years old. Multi-morbidity patterns were identified by exploratory factor analysis of data on self-reported chronic diseases, as well as data on measured body weight and height. The analysis was stratified by age and gender. Results Multi-morbidity was present in nearly one-third of respondents (26.9%) and existed in all age groups, with the highest prevalence among individuals aged 65 years and older (47.2% of men and 65.0% of women). Six patterns of multi-morbidity were identified: non-communicable, cardio-metabolic, respiratory, cardiovascular, aggregate, and mechanical/mental/metabolic. The non-communicable pattern was observed in both genders but only in the 20–44 years age group, while the aggregate pattern occurred only in middle-aged men. Cardio-metabolic and respiratory patterns were present in all age groups. Cardiovascular and mechanical/mental/metabolic patterns showed similar presentation in both men and women. Conclusions Multi-morbidity is a common occurrence among adults in Serbia, especially in the elderly. While several patterns may be explained by underlying pathophysiologies, some require further investigation and follow-up. Recognizing the complexity of multi-morbidity in Serbia is of great importance from both clinical and preventive perspectives given that it affects one-third of the population and may require adjustment of the healthcare system to address the needs of affected individuals. PMID:26871936

Gender differences in both the pathology and surgical outcome of patients with esophageal achalasia.

PubMed

Tsuboi, Kazuto; Omura, Nobuo; Yano, Fumiaki; Hoshino, Masato; Yamamoto, Se-Ryung; Akimoto, Shusuke; Masuda, Takahiro; Kashiwagi, Hideyuki; Yanaga, Katsuhiko

2016-12-01

Esophageal achalasia is a relatively rare disease that occurs usually in middle-aged patients. The laparoscopic Heller-Dor (LHD) procedure is the gold-standard surgical treatment for esophageal achalasia. There are many studies on the pathology and surgical outcome of esophageal achalasia from various perspectives, but there are no studies on gender differences in both the pathology and surgical outcome. This study aimed to evaluate gender differences in the surgical outcome with the LHD procedure and in the pathology of esophageal achalasia patients. The study included 474 LHD-treated patients who were postoperatively followed up for 6 months or more. The patients were divided into 2 groups by gender, to compare the preoperative pathology, surgical outcome, symptom scores before and after LHD, symptom score improvement frequency, and patient satisfaction with the surgery. The study population consisted of 248 male and 226 female, having a mean age of 45.1 years. There were no gender differences in the preoperative pathology, but a significantly lower BMI (p < 0.0001) and a smaller esophageal dilation (p = 0.0061) were observed in the female group. The frequency and severity of chest pain before the surgery were significantly higher in the female group (p = 0.0117 and p = 0.0103, respectively), and the improvement in both the frequency and severity of chest pain was significantly higher in the female group (p = 0.0005 and p = 0.003, respectively). No differences were identified in the surgical outcomes and postoperative course. The patient satisfaction with the surgery was high in both groups and comparable (p = 0.6863). The female patients with esophageal achalasia were characterized by low BMI, less esophageal dilation, and increased frequency and severity of chest pain. LHD improved the chest pain in the female patients, whereas the surgical outcome and satisfaction with the surgery were excellent regardless of gender.

Effects on gender identity of prenatal androgens and genital appearance: evidence from girls with congenital adrenal hyperplasia.

PubMed

Berenbaum, Sheri A; Bailey, J Michael

2003-03-01

To address questions about sex assignment in children with ambiguous genitalia, we studied gender identity in girls with congenital adrenal hyperplasia (CAH) in relation to characteristics of the disease and treatment, particularly genital appearance and surgery. A 9-item gender identity interview was administered to 43 girls with classical CAH ranging in age from 3-18 yr, 7 tomboys, and 29 sister control girls. Groups were compared on total score and on individual items. Results showed that, on the total gender identity score, 88% of girls with CAH had scores overlapping those of control girls, but the average score was intermediate between control girls and tomboys. On individual items of gender identity (discomfort as a girl, wish to be a boy), girls with CAH were similar to control girls. Gender identity in girls with CAH was not related to degree of genital virilization or age at which genital reconstructive surgery was done. Thus, moderate androgen excess early in development appears to produce a small increase in the risk of atypical gender identity, but this risk cannot be predicted from genital virilization.

Investigation of gender role behaviors in boys with hypospadias: comparative study with unaffected boys and girls.

PubMed

Sung, Ji Yean; Han, Sang Won; Chung, Kyong-Mee; Lee, Hyeyoung; Cho, Sang Hee

2014-10-01

The purpose of the study was (1) to investigate gender role behaviors of boys with hypospadias compared with groups of unaffected boys and girls using parental reports and direct observations; and (2) to directly observe effects of socialization (mothers' presence) on children's gender role behaviors. Ages of 19 children with hypospadias ranged from 3 to 7 years, and each of them were matched to controls of unaffected boys and girls by age. All the children participated with their mothers. Children's gender role behaviors and their mothers' behaviors were evaluated using an observation coding system. Mothers also completed questionnaires regarding their children's gender role behaviors. Results indicated no atypical gender role behavior for the boys with hypospadias and no direct effects of socialization on their gender role behaviors. However, differences were found in negative communicative behaviors between boys with hypospadias and unaffected boys, suggesting a possible role of socialization. © The Author 2014. Published by Oxford University Press on behalf of the Society of Pediatric Psychology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Job satisfaction among health care workers: the role of gender and age.

PubMed

Carrillo-García, César; Solano-Ruíz, María del Carmen; Martínez-Roche, María Emilia; Gómez-García, Carmen Isabel

2013-01-01

to analyze the influence of gender and age on the quality of the professional lives of health care professionals at a university hospital. a total of 546 professionals completed a general questionnaire that measured sociodemographic variables and evaluated job satisfaction using a scale adopted from the NTP 394 Job Satisfaction scale and translated into Spanish. overall, 77.2% of the professionals surveyed were satisfied with the work they perform. With regards to gender, we found overwhelming evidence of the feminization of practically all health care professions included in the study, with higher levels of job satisfaction among women than men. Regarding age, 20-30-year-olds and professionals over 61 years old showed higher satisfaction levels than did middle-aged professionals. Higher levels of dissatisfaction were reported by professionals between 41 and 50 years old. we were able to detect the influence of gender and age on the level of job satisfaction, finding significant associations between job satisfaction and both of these variables. Generally, women expressed more satisfaction than men, and elderly professionals showed higher satisfaction compared to younger professionals. Management policies should focus on taking action to correct the conditions that produce dissatisfaction among certain groups of employees.

The Influence of Place of Residence, Gender and Age Influence on Food Group Choices in the Spanish Population: Findings from the ANIBES Study.

PubMed

Samaniego-Vaesken, María de Lourdes; Partearroyo, Teresa; Ruiz, Emma; Aranceta-Bartrina, Javier; Gil, Ángel; González-Gross, Marcela; Ortega, Rosa M; Serra-Majem, Lluis; Varela-Moreiras, Gregorio

2018-03-22

Socioeconomic factors (SEF) can exert a great impact on food choices. However, limited data are available from the Spanish population. Our aim was to describe the influence of place of residence and habitat size on food group intakes. Data were obtained from the ANIBES study. A 3-day dietary record provided information on food and beverage consumption. Data analysis compared gender, age, Nielsen geographic areas, and habitat population size (urban, semi-urban, and rural). Place of residence did not appear to be a determinant for specific food group consumption during childhood and adolescence, as only higher intakes of non-alcoholic beverages were observed among children aged 9 to 12 years living in the East, when compared to those from the Northwest of Spain ( p < 0.05). Food choices within adults (18 to 64 years) and seniors (65 to 75 years) were conditioned: sugar and sweets intake was significantly higher ( p < 0.05) for adult men living in the Northwest than those from the South, and senior males from North Central areas had significantly higher consumption of eggs ( p < 0.05) compared to the Northeast. Basic food group consumption was only affected during childhood and aging. Adults who inhabited rural areas consumed greater quantities of fats and oils than those from higher population densities ( p < 0.01). Our results indicate that place of residence and habitat size have a limited influence on food choices, regardless of age and gender in the ANIBES study population. It is fundamental to acknowledge that other SEF variables are important and further studies are needed to monitor and assess these influences are warranted.

AGE-RELATED EFFECT ON THE CONCENTRATION OF COLLAGEN CROSSLINKS IN HUMAN OSTEONAL AND INTERSTITIAL BONE TISSUE

PubMed Central

Nyman, Jeffry S.; Roy, Anuradha; Acuna, Rae L.; Gayle, Heather J.; Reyes, Michael J.; Tyler, Jerrod H.; Dean, David D.; Wang, Xiaodu

2007-01-01

Collagen crosslinks are important to the quality of bone and may be contributors to the age-related increase in bone fracture. This study was performed to investigate whether age and gender effects on collagen crosslinks are similar in osteonal and interstitial bone tissues. Forty human cadaveric femurs were collected and divided into two age groups: Middle aged (42–63 years of age) and Elderly (69–90 years of age) with ten males and ten females in each group (n = 10). Micro-cores of bone tissue from both secondary osteons (newly formed) and interstitial regions (biologically old) in the medial quadrant of the diaphysis were extracted using a custom-modified, computer numerical controlled machine. The bone specimens were then analyzed using high performance liquid chromatography to determine the effects of age and gender on the concentration of mature, enzymatic crosslinks (hydroxylysyl-pyridinoline – HP and lysylpyridinoline – LP) and a non-enzymatic crosslink (pentosidine – PE) at these two bony sites. The results indicate that age has a significant effect on the concentration of LP and PE, while gender has a significant effect on HP and LP. In addition, the concentration of the crosslinks in the secondary osteons is significantly different from that in the interstitial bone regions. These results suggest that the rate of non-enzymatic crosslinking may increase while the formation of maturate enzymatic crosslinks may decrease with age. Such changes could potentially reduce the inherent quality of the bone tissue in the elderly skeleton. PMID:16962838

A population-based cohort study of symptomatic gallstone disease in diabetic patients

PubMed Central

Liu, Chi-Ming; Hsu, Chung-Te; Li, Chung-Yi; Chen, Chu-Chieh; Liu, Meng-Lun; Liu, Jorn-Hon

2012-01-01

AIM: To investigate the prevalence of gallstone disease (GSD) and to evaluate the risk of symptomatic GSD among diabetic patients. METHODS: The study was conducted by analyzing the National Health Research Institutes (NHRI) dataset of ambulatory care patients, inpatient claims, and the updated registry of beneficiaries from 2000 to 2008. A total of 615 532 diabetic patients without a prior history of hospital treatment or ambulatory care visits for symptomatic GSD were identified in the year 2000. Age- and gender-matched control individuals free from both GSD and diabetes from 1997 to 1999 were randomly selected from the NHIR database (n = 614 871). The incidence densities of symptomatic GSD were estimated according to the subjects’ diabetic status. The distributions of age, gender, occupation, income, and residential area urbanization were compared between diabetic patients and control subjects using Cox proportion hazards models. Differences between the rates of selected comorbidities were also assessed in the two groups. RESULTS: Overall, 60 734 diabetic patients and 48 116 control patients developed symptomatic GSD and underwent operations, resulting in cumulative operation rates of 9.87% and 7.83%, respectively. The age and gender distributions of both groups were similar, with a mean age of 60 years and a predominance of females. The diabetic group had a significantly higher prevalence of all comorbidities of interest. A higher incidence of symptomatic GSD was observed in females than in males in both groups. In the control group, females under the age of 64 had a significantly higher incidence of GSD than the corresponding males, but this difference was reduced with increasing age. The cumulative incidences of operations for symptomatic GSD in the diabetic and control groups were 13.06 and 9.52 cases per 1000 person-years, respectively. Diabetic men exhibited a higher incidence of operations for symptomatic GSD than did their counterparts in the control group (12.35 vs 8.75 cases per 1000 person-years). CONCLUSION: The association of diabetes with increased symptomatic GSD may provide insight to the treatment or management of diabetes in clinical settings. PMID:22529695

[Epidemiologic aspects of bronchial asthma in the Mexican Republic].

PubMed

Martínez-Cairo Cueto, S; Salas-Ramírez, M; Segura-Méndez, N H

1995-01-01

This work was done to determine the mortality and morbidity rates secondary to asthma in Mexico, for age, gender, state of the country and time. Data were obtained from the Instituto Nacional de Estadística. Geografía e Informática. We calculated morbidity and mortality rates adjusting for age, by a direct method. In the results, there was a reduction in mortality rate in both genders, from 1960 to 1987. Age groups up to 4 years and older than 50 were the mainly affected. From 1960 to the present time, the state with highest mortality is Tlaxcala. The states with highest hospitalization rates were Morelos, Baja California Sur, Nuevo León, Durango and Tamaulipas. In conclusion, mortality rates secondary to asthma in Mexico show a decreasing trend, with a considerable rise in morbidity, especially in the adolescent group.

The role of age, gender, mood states and exercise frequency on exercise dependence.

PubMed

Costa, Sebastiano; Hausenblas, Heather A; Oliva, Patrizia; Cuzzocrea, Francesca; Larcan, Rosalba

2013-12-01

The purpose of our study was to explore the prevalence, and the role of mood, exercise frequency, age, and gender differences of exercise dependence. Regular exercisers (N = 409) completed a socio-demographic questionnaire, the Exercise Dependence Scale, and the Profile of Mood States. For data analyses, the participants were stratified for sex and age (age ranges = young adults: 18-24 years, adults: 25-44 years, and middle-aged adults: 45-64 years). We found that: (a) 4.4% of the participants were classified as at-risk for exercise dependence; (b) the men and the two younger groups (i.e., young adults and adults) had higher exercise dependence scores; and (c) age, gender, exercise frequency, and mood state were related to exercise dependence. Our results support previous research on the prevalence of exercise dependence and reveal that adulthood may be the critical age for developing exercise dependence. These findings have practical implication for identifying individuals at-risk for exercise dependence symptoms, and may aid in targeting and guiding the implementation of prevention program for adults.

Age and Gender Differences in the Social Patterning of Cardiovascular Risk Factors in Switzerland: The CoLaus Study

PubMed Central

Stringhini, Silvia; Spencer, Brenda; Marques-Vidal, Pedro; Waeber, Gerard; Vollenweider, Peter; Paccaud, Fred; Bovet, Pascal

2012-01-01

Objectives We examined the social distribution of a comprehensive range of cardiovascular risk factors (CVRF) in a Swiss population and assessed whether socioeconomic differences varied by age and gender. Methods Participants were 2960 men and 3343 women aged 35–75 years from a population-based survey conducted in Lausanne, Switzerland (CoLaus study). Educational level was the indicator of socioeconomic status used in this study. Analyses were stratified by gender and age group (35–54 years; 55–75 years). Results There were large educational differences in the prevalence of CVRF such as current smoking (Δ = absolute difference in prevalence between highest and lowest educational group:15.1%/12.6% in men/women aged 35–54 years), physical inactivity (Δ = 25.3%/22.7% in men/women aged 35–54 years), overweight and obesity (Δ = 14.6%/14.8% in men/women aged 55–75 years for obesity), hypertension (Δ = 16.7%/11.4% in men/women aged 55–75 years), dyslipidemia (Δ = 2.8%/6.2% in men/women aged 35–54 years for high LDL-cholesterol) and diabetes (Δ = 6.0%/2.6% in men/women aged 55–75 years). Educational inequalities in the distribution of CVRF were larger in women than in men for alcohol consumption, obesity, hypertension and dyslipidemia (p<0.05). Relative educational inequalities in CVRF tended to be greater among the younger (35–54 years) than among the older age group (55–75 years), particularly for behavioral CVRF and abdominal obesity among men and for physiological CVRF among women (p<0.05). Conclusion Large absolute differences in the prevalence of CVRF according to education categories were observed in this Swiss population. The socioeconomic gradient in CVRF tended to be larger in women and in younger persons. PMID:23152909

Gender differences in the association of perceived social support and social network with self-rated health status among older adults: a population-based study in Brazil

PubMed Central

2013-01-01

Background Older adults are more likely to live alone, because they may have been predeceased by their spouse and friends. Social interaction could also be reduced in this age group due by limited mobility caused by chronic conditions. Therefore, aging is frequently accompanied by reduced social support, which might affect health status. Little is known about the role of gender in the relationship between social support and health in older adults. Hence, the present study tests the hypothesis that gender differences exist in the relationship between perceived social support, social network, and self-rated health (SRH) among older adults. Methods A cross-sectional study using two-stage probabilistic sampling recruited 3,649 individuals aged 60 years and above. Data were collected during the national influenza vaccination campaign in Rio de Janeiro, Brazil, in 2006. Individual interviews collected information on SRH, perceived social support, social network, and other covariates. Multivariate logistic regression analyses using nested models were conducted separately for males and females. Independent variables were organised into six blocks: (1) perceived social support and social network, (2) age group, (3) socioeconomic characteristics, (4) health-related behaviours, (5) use of health care services, (6) functional status measures and somatic health problems. Results Older men who did not participate in group activities were more likely to report poor SRH compared to those who did, (OR = 1.63; 95% CI = 1.16–2.30). Low perceived social support predicted the probability of poor SRH in women (OR = 1.64; 95% CI = 1.16–2.34). Poor SRH was associated with low age, low income, not working, poor functional capacity, and depression in both men and women. More somatic health problems were associated with poor SRH in women. Conclusions The association between social interactions and SRH varies between genders. Low social network involvement is associated with poor SRH in older men, whereas low perceived social support is associated with poor SRH in older women. The hypothesis that the relationship of perceived social support and social networks to SRH differs according to gender has been confirmed. PMID:24229389

Gender differences in the association of perceived social support and social network with self-rated health status among older adults: a population-based study in Brazil.

PubMed

Caetano, Silvana C; Silva, Cosme M F P; Vettore, Mario V

2013-11-15

Older adults are more likely to live alone, because they may have been predeceased by their spouse and friends. Social interaction could also be reduced in this age group due by limited mobility caused by chronic conditions. Therefore, aging is frequently accompanied by reduced social support, which might affect health status. Little is known about the role of gender in the relationship between social support and health in older adults. Hence, the present study tests the hypothesis that gender differences exist in the relationship between perceived social support, social network, and self-rated health (SRH) among older adults. A cross-sectional study using two-stage probabilistic sampling recruited 3,649 individuals aged 60 years and above. Data were collected during the national influenza vaccination campaign in Rio de Janeiro, Brazil, in 2006. Individual interviews collected information on SRH, perceived social support, social network, and other covariates. Multivariate logistic regression analyses using nested models were conducted separately for males and females. Independent variables were organised into six blocks: (1) perceived social support and social network, (2) age group, (3) socioeconomic characteristics, (4) health-related behaviours, (5) use of health care services, (6) functional status measures and somatic health problems. Older men who did not participate in group activities were more likely to report poor SRH compared to those who did, (OR = 1.63; 95% CI = 1.16-2.30). Low perceived social support predicted the probability of poor SRH in women (OR = 1.64; 95% CI = 1.16-2.34). Poor SRH was associated with low age, low income, not working, poor functional capacity, and depression in both men and women. More somatic health problems were associated with poor SRH in women. The association between social interactions and SRH varies between genders. Low social network involvement is associated with poor SRH in older men, whereas low perceived social support is associated with poor SRH in older women. The hypothesis that the relationship of perceived social support and social networks to SRH differs according to gender has been confirmed.

Effects of Training Method and Gender on Learning 2D/3D Geometry

ERIC Educational Resources Information Center

Khairulanuar, Samsudin; Nazre, Abd Rashid; Jamilah, H.; Sairabanu, Omar Khan; Norasikin, Fabil

2010-01-01

This article reports the findings of an experimental study involving 36 primary school students (16 girls, 20 boys, Mean age = 9.5 years, age range: 8-10 years) in geometrical understanding of 2D and 3D objects. Students were assigned into two experimental groups and one control group based on a stratified random sampling procedure. The first…

The clinical syndromes of femmiphilic transvestism.

PubMed

Buhrich, N; McConaghy, N

1977-09-01

Thirty-four members of a club established for heterosexual transvestites were interviewed. They were categorized into two groups. Subjects in group I were satisfied with cross-dressing and did not desire additional feminization. Subjects in group II desired to alter their bodily appearance toward female by taking female hormones or by having surgical intervention. Group II transvestites cross-dressed more frequently and had a more intense feminine gender identity and stronger homosexual interests than did group I transvestites. A feminine gender identity appeared to be present from childhood in both groups but to be stronger in group II. Cross-dressing in subjects of both groups often occurred first during childhood and almost always prior to age 15. All subjects showed a period of fetishistic arousal to women's clothes during adolescence. With increasing age, fetishistic arousal diminished or disappeared and the frequency of cross-dressing increased. Terms in the literature used to describe the type of transvestism reported in this study are discussed. It was suggested that the term "femmiphilic transvestism" be used to describe the condition of the subjects of both groups. The term has fewer disadvantages than terms previously suggested.

Exploration of the telescoping effect among not-in-treatment, intensive heroin-using research volunteers.

PubMed

Stoltman, Jonathan J K; Woodcock, Eric A; Lister, Jamey J; Greenwald, Mark K; Lundahl, Leslie H

2015-03-01

Addiction research literature suggests some demographic groups exhibit a later age of substance use initiation, more rapid escalation to dependence, and worse substance use-related outcomes. This 'telescoping' effect has been observed more often in females but has not yet been examined in not-in-treatment heroin users or racial subgroups. Not-in-treatment, intensive heroin-using adults screened for laboratory-based research studies (N=554; range 18-55 yr; mean age: 42.5 yr; 60.5% African American [AA]; 70.2% male) were included in this secondary analysis. A comprehensive drug history questionnaire assessed heroin-use characteristics and lifetime adverse consequences. We examined telescoping effects by racial and gender groups: Caucasian males and females; AA males and females. Caucasian males initiated heroin use significantly later than AA males but this difference was not observed for age at intensive heroin use (≥3 times weekly). Caucasian males reported significantly more lifetime heroin use-related consequences, were more likely to inject heroin, and reported more-frequent past-month heroin use, but did not differ from AA males in lifetime heroin quit attempts or prior heroin treatment. Females, compared to males, reported later onset of initial and intensive use, but there was no gender-telescoping effect from initial to intensive heroin-use. In this not-in-treatment sample, Caucasian males exhibited more rapid heroin-use progression and adverse consequences than AA males, i.e., within-gender, racial-group telescoping. Despite later-onset heroin use among females, there was no evidence of gender-related telescoping. Given the resurgence of heroin use, differential heroin-use trajectories across demographic groups may be helpful in planning interventions. Copyright © 2015. Published by Elsevier Ireland Ltd.

Risk factors of carotid plaque and carotid common artery intima-media thickening in a high-stroke-risk population.

PubMed

Wang, ChunFang; Lv, GaoPeng; Zang, DaWei

2017-11-01

To analyze the risk factors of carotid plaque (CP) and carotid common artery intima-media thickening (CCAIMT) and the association between the risk factors and CP numbers and the side of the CCAIMT in a high-stroke-risk population. Carotid ultrasonography was conducted in 2025 participants with high stroke risk. Participants were divided into different groups according to the results of the ultrasound. The risk factors and blood biochemical indices were recorded. The presence of CP and CCAIMT were 38.9% and 24.8% respectively. Multivariate logistic regression indicated that the risk factors of CP were age, high LDL-C and FBG levels, male gender, stroke, diabetes, hypertension, and tobacco use. Compared with participants without CPs, the participants who were male, and older in age, with risk factors of tobacco use, diabetes, high LDL-C levels, and a family history of hypertension were likely to have a single CP, whereas the participants with risk factors of tobacco use, diabetes, hypertension, male gender, older age, high LDL-C levels, stroke and AF or valvulopathy were prone to have multiple CPs. The risk factors of CCAIMT were male gender, stroke, hypertension, diabetes, AF or valvulopathy, tobacco use and age. Compared with the N-CCAIMT subgroup, the risk factors of left CCAIMT were tobacco use, diabetes, male gender, and age. The risk factors of right CCAIMT were male gender, high FBG levels, age, AF or valvulopathy. The risk factors of dual CCAIMT were high frequency of drinking milk, tobacco use, male gender, age, stroke, and hypertension. These findings revealed the risk factors of CP and CCAIMT, and an association between the risk factors and the CP numbers and the side of the CCAIMT.

Asymptomatic population reference values for three knee patient-reported outcomes measures: evaluation of an electronic data collection system and implications for future international, multi-centre cohort studies.

PubMed

McLean, James M; Brumby-Rendell, Oscar; Lisle, Ryan; Brazier, Jacob; Dunn, Kieran; Gill, Tiffany; Hill, Catherine L; Mandziak, Daniel; Leith, Jordan

2018-05-01

The aim was to assess whether the Knee Society Score, Oxford Knee Score (OKS) and Knee Injury and Osteoarthritis Outcome Score (KOOS) were comparable in asymptomatic, healthy, individuals of different age, gender and ethnicity, across two remote continents. The purpose of this study was to establish normal population values for these scores using an electronic data collection system. There is no difference in clinical knee scores in an asymptomatic population when comparing age, gender and ethnicity, across two remote continents. 312 Australian and 314 Canadian citizens, aged 18-94 years, with no active knee pain, injury or pathology in the ipsilateral knee corresponding to their dominant arm, were evaluated. A knee examination was performed and participants completed an electronically administered questionnaire covering the subjective components of the knee scores. The cohorts were age- and gender-matched. Chi-square tests, Fisher's exact test and Poisson regression models were used where appropriate, to investigate the association between knee scores, age, gender, ethnicity and nationality. There was a significant inverse relationship between age and all assessment tools. OKS recorded a significant difference between gender with females scoring on average 1% lower score. There was no significant difference between international cohorts when comparing all assessment tools. An electronic, multi-centre data collection system can be effectively utilized to assess remote international cohorts. Differences in gender, age, ethnicity and nationality should be taken into consideration when using knee scores to compare to pathological patient scores. This study has established an electronic, normal control group for future studies using the Knee society, Oxford, and KOOS knee scores. Diagnostic Level II.

Gender Role Orientation with Health Literacy and Self-Efficacy for Healthy Eating among Japanese Workers in Early Adulthood.

PubMed

Hosokawa, Chizuru; Ishikawa, Hirono; Okada, Masafumi; Kato, Mio; Okuhara, Tsuyoshi; Kiuchi, Takahiro

2016-01-01

Gender role, independent of biological sex, affects health. However, research on healthy eating that considers the importance of gender norms is scarce. People who are androgynous and have high masculinity and femininity are reported to have better health practices than other people. The present study aimed to examine the differences in health literacy (HL) and self-efficacy for healthy eating by gender role in Japanese men and women. Participants were 629 men and women aged 25-34 years, recruited via a Japanese Internet research company database. Participants were categorized into four gender role groups using the Japanese Gender Role Index. HL and self-efficacy for healthy eating were assessed using the healthy eating literacy (HEL) scale and the healthy eating and weight self-efficacy (HEWSE) scale. Analysis of variance with Bonferroni-adjusted post hoc tests and hierarchical multiple regression were used to test the research hypotheses. We found that the Androgynous group had significantly higher HEL and HEWSE scores than the Feminine and Undifferentiated groups. The Masculine group scored significantly higher on both measures than the Undifferentiated group. Being Androgynous (HEL: β = 0.34, p < 0.001; HEWSE: β = 0.30, p < 0.001) was a strong predictor for higher scores even after considering other predictors. The results showed significant associations between gender role orientation and individual HL and self-efficacy for healthy eating. These findings may be relevant for promoting healthy eating from the perspective of gender norms.

[The assessment of the risk of large bowel cancer in patients operated on cholecystolithiasis].

PubMed

Grotowski, Maciej

2002-06-01

In the recent years reports have become available suggesting more frequent incidence of colorectal cancer in patients who earlier had cholecystectomy performed as well as in those with unoperated cholecystolithiasis. The divergent views of many authors became the cause of studying of the incidence of past cholecystectomy and cholecystolithiasis in patients operated on for colorectal cancer and comparing of this incidence with that in the control group selected on the basis of own material. The incidence of cholecystectomy and unoperated cholecystolithiasis was assessed in 90 patients treated for colorectal cancer of various location and was compared with the control group of 90 patients treated for other reasons than neoplastic disease. Both groups were selected with respect to gender, age and hospitalisation duration. In the analysis performed no significantly greater frequency of cholecystectomy and cholecystolithiasis was found in patients with colorectal cancer as compared to the control group. Such difference was neither observed considering cancer location and gender of the studied subjects (p < 0.05). Taking into account age over 60 years, more frequent cholecystectomy was found in the case of cancer of the right half of the colon in both genders in the group of patients with colorectal cancer as compared to the control group (p = 0.031). The relative risk for cancer development was in this case 4.5. In these patients cholecystectomy was performed 14.9 years on the average before cancer diagnosis. The patients in older age with cholecystolithiasis should be evaluated for the presence of coexistent colorectal cancer prior to laparoscopic cholecystectomy.

[The associations between adenosine triphosphate binding cassette subfamily G member-2 single nucleotide polymorphism and hyperuricemia in a Chinese tertiary hospital faculty cohort].

PubMed

Zhang, B Q; Fang, W G; Zhang, Y; Liu, S F; Zeng, X J

2017-11-01

Objective: To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia. Method: A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing. The enrollment criteria were faculty member of the hospital with signed consent. The exclusion criteria were tumor, previous renal diseases, renal function damage, pregnancy, currently taking medicines that could increase or decrease serum uric acid level, and those who had gout. Males with serum uric acid>416.4 μmol/L and females with serum uric acid> 359.6 μmol/L were enrolled as hyperuricemia group. Subjects with normal serum uric acid were randomly enrolled at 1∶2 ratio after matching for gender, age, renal function and body mass index. Rs2231142(C>A) was assayed by amplification refractory mutation system polymerase chain reaction, with common forward primer: 5' GGCTTTGCAGACATCTATGG 3', C specific reverse primer: 5'CGAAGAGCTGCTGAGAAATG 3', and A specific reverse primer: 5' CGAAGAGCTGCTGAGAAATT 3'.Association between rs2231142 and hyperuricemia was analyzed in the general study group, as well as different gender and age groups. Results: A total of 198 subjects with hyperuricemia and 370 controls were enrolled. The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P <0.001), with an OR for hyperuricemia of 2.89 (95% CI 1.91-4.37, P <0.001). After adjustment for hypertension, hyperglycemia and dyslipidemia, the OR was 2.99 (95% CI 1.94 - 4.62, P <0.001). Subgroup analysis showed that the ORs were 3.83 (95% CI 2.03-7.24, P <0.001) in male and 2.30 (95% CI 1.32-4.00, P =0.003) in female. In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95% CI 1.02-10.29, P =0.047) in male and 3.06 (95% CI 1.37-6.84, P =0.006) in female. While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95% CI 1.92-8.79, P <0.001) in males and 1.73 (95% CI 0.80-3.76, P =0.165) in females. Interaction study between gender and rs2231142 did not reach significant level in both the gender group and two age groups. Conclusion: Single nucleotide polymorphism rs2231142 A allele is an independent risk factor for hyperuricemia in this tertiary hospital faculty cohort. The ORs are higher in male than those in female, especially in those less than 55 years old.

Healthcare costs and resource utilization of asthma in Germany: a claims data analysis.

PubMed

Jacob, Christian; Bechtel, Benno; Engel, Susanne; Kardos, Peter; Linder, Roland; Braun, Sebastian; Greiner, Wolfgang

2016-03-01

Asthma is associated with a substantial economic burden on the German Statutory Health Insurance. To determine costs and resource utilization associated with asthma and to analyze the impact of disease severity on subgroups based on age and gender. A claims database analysis from the statutory health insurance perspective was conducted. Patients with an ICD-10-GM code of asthma were extracted from a 10% sample of a large German sickness fund. Five controls for each asthma patient matched by age and gender were randomly selected from the same database. Costs and resource utilization were calculated for each individual in the asthma and control group. Incremental asthma-related costs were calculated as the mean cost difference. Based on prescribed asthma medication, patients were classified as intermittent or persistent. In addition, age groups of ≤ 5, 6-18, and >18 years were analyzed separately and gender differences were investigated. Overall, 49,668 individuals were included in the asthma group. On average, total annual costs per patient were €753 higher (p = 0.000) compared to the control group (€2,168 vs. €1,415). Asthma patients had significantly higher (p = 0.000) outpatient (€217), inpatient (€176), and pharmacy costs (€259). Incremental asthma-related total costs were higher for patients with persistent asthma compared to patients with intermittent asthma (€1,091 vs. €408). Women aged >18 years with persistent asthma had the highest difference in costs compared to their controls (€1,207; p < 0.0001). Corresponding healthcare resource utilization was significantly higher in the asthma group (p = 0.000). The treatment of asthma is associated with an increased level of healthcare resource utilization and significantly higher healthcare costs. Asthma imposes a substantial economic burden on sickness funds.

Depression among Arabs and Jews in Israel: a population-based study.

PubMed

Kaplan, Giora; Glasser, Saralee; Murad, Havi; Atamna, Ahmed; Alpert, Gershon; Goldbourt, Uri; Kalter-Leibovici, Ofra

2010-10-01

Depression is the second most common chronic disorder seen by primary care physicians. Risk factors associated with depression include medical and psychosocial factors. While in Israel, the rate and risk factors for depression are considered similar to those in other Western countries, population-based data are limited. The present study aims to estimate the prevalence of depression among Jews and Muslim Arabs, and to consider possible associations with demographic, socioeconomic, and health factors. The study group (N = 872) was equally divided according to ethnicity, gender, and age group. Depression was measured by the Harvard Department of Psychiatry National Depression Screening Day Scale (HANDS). The rate of depression scores in the likely/very likely range was 2.5 times higher among Arabs than among Jews (24.9 vs. 10.6%; P < 0.001). Women were more likely to express symptoms of depressive episode than were men (22.0 vs. 13.6%; P = 0.001), and the depression rate increased with age, from 11.0% in the youngest group (26-35) to 25.0% in the oldest (P = 0.001). The rate of increase in depression by age was different for the genders, rising more steeply for women than for men. However, the age-gender differential was not identical for the two ethnic groups. The differences in depression prevalence between Arabs and Jews were maintained after controlling for confounding variables, except that when controlling for education, the difference between the ethnic groups was no longer significant. After adjusting for all variables in the analysis, no significant association remained between ethnicity and depression (OR = 0.80; 95% CI = 0.45-1.40).

The effect of gender and age on kidney cancer survival: younger age is an independent prognostic factor in women with renal cell carcinoma.

PubMed

Rampersaud, Edward N; Klatte, Tobias; Bass, Geoffrey; Patard, Jean-Jacques; Bensaleh, Karim; Böhm, Malte; Allhoff, Ernst P; Cindolo, Luca; De La Taille, Alexandre; Mejean, Arnaud; Soulie, Michel; Bellec, Laurent; Christophe Bernhard, Jean; Pfister, Christian; Colombel, Marc; Belldegrun, Arie S; Pantuck, Allan J; George, Daniel

2014-01-01

Gender-specific differences in incidence of renal cell carcinoma (RCC) and its outcome have previously been reported. We used age as a surrogate to test whether this might be hormone-related in a large international RCC cohort. This study included patients treated by nephrectomy at 10 international academic centers. Clinicopathologic features were assessed using chi-square and the Student t-tests. Kaplan-Meier survival estimates and Cox proportional hazards models addressed the effect of gender and age on disease-specific survival. Of the 5,654 patients, 3,777 (67%) were men and 1,877 (33%) were women. Generally, women presented at lower T stages (P<0.001), had fewer metastases (P<0.001), and had lower-grade tumors (P<0.001). Women more frequently had clear-cell (87% vs. 82%) and less frequently had papillary RCC (7% vs. 12%) than men (P<0.001). Women had a 19% reduced risk of death from RCC than men (hazard ratio 0.81, 95% confidence interval 0.73-0.90, P<0.001). The survival advantage for women was present to the greatest degree in the age group<42 years (P = 0.0136) and in women aged 42 to 58 years (P<0.001), but was not apparent in patients aged 59 years and older (P = 0.248). Age was an independent predictor of disease-specific survival in women (hazard ratio 1.011, 95% confidence interval 1.004-1.019, P = 0.004), but not in men. As a group, women present with less advanced tumors, leading to a 19% reduced risk of RCC-specific death compared with men. This survival difference is present only in patients aged<59 years. Because this gender-based survival difference is not related to pathologic features, the role of hormonal effects on the development and progression of RCC needs to be investigated. Copyright © 2014 Elsevier Inc. All rights reserved.

BMI curves for preterm infants.

PubMed

Olsen, Irene E; Lawson, M Louise; Ferguson, A Nicole; Cantrell, Rebecca; Grabich, Shannon C; Zemel, Babette S; Clark, Reese H

2015-03-01

Preterm infants experience disproportionate growth failure postnatally and may be large weight for length despite being small weight for age by hospital discharge. The objective of this study was to create and validate intrauterine weight-for-length growth curves using the contemporary, large, racially diverse US birth parameters sample used to create the Olsen weight-, length-, and head-circumference-for-age curves. Data from 391 681 US infants (Pediatrix Medical Group) born at 22 to 42 weeks' gestational age (born in 1998-2006) included birth weight, length, and head circumference, estimated gestational age, and gender. Separate subsamples were used to create and validate curves. Established methods were used to determine the weight-for-length ratio that was most highly correlated with weight and uncorrelated with length. Final smoothed percentile curves (3rd to 97th) were created by the Lambda Mu Sigma (LMS) method. The validation sample was used to confirm results. The final sample included 254 454 singleton infants (57.2% male) who survived to discharge. BMI was the best overall weight-for-length ratio for both genders and a majority of gestational ages. Gender-specific BMI-for-age curves were created (n = 127 446) and successfully validated (n = 126 988). Mean z scores for the validation sample were ∼0 (∼1 SD). BMI was different across gender and gestational age. We provide a set of validated reference curves (gender-specific) to track changes in BMI for prematurely born infants cared for in the NICU for use with weight-, length-, and head-circumference-for-age intrauterine growth curves. Copyright © 2015 by the American Academy of Pediatrics.

A study of the dynamics of sex differences in adulthood.

PubMed

Trofimova, Irina

2013-01-01

Studies of gender differences using primarily young individuals show that males, on average, perform better than females in physical activities but worse than females on tests of verbal abilities. There is however a controversy about the existence of these sex differences in adulthood. Our study used 1271 participants from four cultural backgrounds (Chinese, multi-generation Canadians, Indu-Canadians, and European-Canadians) divided in five age groups. We measured sex differences in the time required for participants to complete a lexical task experiment, and also assessed their verbal tempo and physical endurance using a validated temperament test (Structure of Temperament Questionnaire). We found a significant female advantage in time on the lexical task and on the temperament scale of social-verbal tempo, and a male advantage on the temperament scale of physical endurance. These sex differences, however, were more pronounced in young age groups (17-24), fading in older groups. This "middle age-middle sex" phenomenon suggests that sex differences in these two types of abilities observed in younger groups might be "a matter of age," and should not be attributed to gender in general. A one-dimensional approach to sex differences (common in meta-analytic studies) therefore overlooks a possible interaction of sex differences with age.

[Microcirculatory blood and lymph flow examination in eyelid skin by laser Doppler flowmetry].

PubMed

Safonova, T N; Kintyukhina, N P; Sidorov, V V; Gladkova, O V; Reyn, E S

to study normal blood and lymph microcirculation of the upper and lower eyelids in different age groups. The study included 108 volunteers (216 eyes) aged from 20 to 80 years with no signs of changes in anterior segment structures, who were grouped by age ranges (20-30 years, 31-40 years, 41-50 years, 51-60 years, 61-70 years, and 71-80 years) into 6 groups equal in gender and quantitative composition. In all volunteers, microcirculation of the upper and lower eyelids was examined by laser Doppler flowmetry (LDF) ('LASMA MC-1' peripheral blood and lymph flow analyzer and 'LASMA MC' laser diagnostic complex, LASMA LLC). The average perfusion changes in blood and lymph flow as well as blood and lymph flow oscillations were analyzed. Blood and lymph flow in the microvasculature of the upper and lower eyelids is variable and depends on neither the age, nor gender of the test subject. On LDF-gram, every increase in amplitude of blood flow corresponds to a decrease in that of lymph flow. The non-invasive method of LDF expands our diagnostic capabilities as it enables assessment of not only blood, but also lymph flow. The data obtained can serve as a starting point for exploring microcirculation in different age groups in the presence of different pathological processes.

Lateral comparisons using Fishman's skeletal maturation assessment.

PubMed

Safer, Abraham N; Homel, Peter; Chung, David D

2015-05-01

To assess lateral differences between ossification events and stages of bone development in the hands and wrists utilizing Fishman's skeletal maturation indicators (SMIs). The skeletal ages of 125 subjects, aged 8 to 20 years, were determined with left and right hand-wrist radiographs using Fishman's SMI assessment. Each subject was also given the Edinburgh Handedness Questionnaire to assess handedness. The skeletal ages of both hand-wrist radiographs were analyzed against each other, handedness, chronologic age, and gender. There were no significant differences overall in right and left SMI scores (P  =  .70); 79% of all patients showed no difference in right and left SMI scores, regardless of handedness, gender, or age. However, when patients were categorized based on clinical levels of SMI score for the right hand-wrist, there was a significant difference (P  =  .01) between the SMI 1-3 group and the SMI 11 group. Subjects in the SMI 1-3 group were more likely to show a left > right SMI score, while subjects in the SMI 11 group were likely to show a right > left SMI score. Although no significant overall lateral differences in SMI scores were noted, it may be advisable to obtain a left hand-wrist radiograph and/or additional diagnostic information to estimate completion of growth in young surgical patients.

The Relationship Between Mindfulness, Depressive Symptoms, and Non-Suicidal Self-Injury Amongst Adolescents.

PubMed

Heath, Nancy L; Carsley, Dana; De Riggi, Melissa E; Mills, Devin; Mettler, Jessica

2016-01-01

Mindfulness is often part of treatment for non-suicidal self-injury (NSSI); however, there has been limited research examining the role of mindfulness in NSSI. Thus, the current study sought to investigate the relationship among mindfulness, depressive symptoms, and NSSI (past year) in adolescents (N = 764; 56.8% female, M age = 14.42, SD = 0.64) with consideration of gender. Adolescents with recent NSSI (n = 74; 83.8% female, M age = 14.36, SD = 0.56) and a matched for age and gender no-NSSI group completed measures of mindfulness and depression. Findings revealed that mindfulness and depressive symptoms were negatively correlated, although significantly less so for the NSSI group. Second, the NSSI group reported greater depressive symptoms and less mindfulness. Finally, mindfulness was found to partially mediate the effect of depressive symptoms on NSSI. The present study is the first to provide empirical support for the protective role of mindfulness in NSSI.

Cytomegalovirus prevalence and transmission after islet allograft transplant in patients with type 1 diabetes mellitus.

PubMed

Hafiz, Muhammad M; Poggioli, Raffaella; Caulfield, Aileen; Messinger, Shari; Geiger, Milene C; Baidal, David A; Froud, Tatiana; Ferreira, Jacqueline V; Tzakis, Andreas G; Ricordi, Camillo; Alejandro, Rodolfo

2004-10-01

Cytomegalovirus (CMV) serological status of transplant donors and recipients has important implications on antiviral prophylaxis, morbidity/mortality, donor selection and hospital stay. We evaluated CMV prevalence in our islet transplant candidates (ITC) in comparison with organ donors. We correlated the CMV serological status of our ITC with serology for Epstein-Barr virus and Parvovirus B19, auto-antibodies, patient's age, age at DM onset, duration of DM, gender, race, ABO group, HLA haplotype and C-peptide levels. Cytomegalovirus transmission after islet transplant using the Edmonton regimen was also evaluated. Cytomegalovirus seropositivity varied according to patient group, age, gender and race. Type 1 DM patients had reduced odds of CMV seropositivity when compared with organ donors. In all groups studied, older patients, females, and non-Caucasians were more likely to be CMV seropositive. In addition, no CMV reactivation, infection or disease was observed among our transplanted patients using this steroid-free regimen even after donor/recipient CMV mismatch.

Screening preschool children for fine motor skills: environmental influence.

PubMed

Comuk-Balci, Nilay; Bayoglu, Birgul; Tekindal, Agah; Kerem-Gunel, Mintaze; Anlar, Banu

2016-03-01

[Purpose] The aim of this study was to investigate the influence of gender and family factors on performance in the fine motor domain of the Denver II developmental screening test. [Subjects and Methods] Data were obtained from 2038 healthy children, 999 boys (49%) and 1039 girls (51%) in four age groups: 0-24 months (57%), 25-40 months (21.1%), 41-56 months (10.4%), and 57-82 months (11.5%). [Results] Female gender, higher maternal age, especially in children older than 24 months, and higher maternal education were associated with earlier accomplishment of fine motor items. Higher socioeconomic status was correlated with fine motor skills more noticeably at young ages. [Conclusion] The results of this study support the role of environmental factors in the interpretation of fine motor test results and point to target groups for intervention, such as infants in the low socioeconomic group and preschool children of less educated mothers. Studies in different populations may reveal particular patterns that affect child development.

A Mixed-Method Approach on Digital Educational Games for K12: Gender, Attitudes and Performance

NASA Astrophysics Data System (ADS)

Law, Effie Lai-Chong; Gamble, Tim; Schwarz, Daniel; Kickmeier-Rust, Michael D.; Holzinger, Andreas

Research on the influence of gender on attitudes towards and performance in digital educational games (DEGs) has quite a long history. Generally, males tend to play such games more engagingly than females, consequently attitude and performance of males using DEGs should be presumably higher than that of females. This paper reports an investigation of a DEG, which was developed to enhance the acquisition of geographical knowledge, carried out on British, German and Austrian K12 students aged between 11 and 14. Methods include a survey on initial design concepts, user tests on the system and two single-gender focus groups. Gender and cultural differences in gameplay habit, game type preferences and game character perceptions were observed. The results showed that both genders similarly improved their geographical knowledge, although boys tended to have a higher level of positive user experience than the girls. The qualitative data from the focus groups illustrated some interesting gender differences in perceiving various aspects of the game.

Gender influences on preschool children's social problem-solving strategies.

PubMed

Walker, Sue; Irving, Kym; Berthelsen, Donna

2002-06-01

The authors investigated gender influences on the nature and competency of preschool children's social problem-solving strategies. Preschool-age children (N = 179; 91 boys, 88 girls) responded to hypothetical social situations designed to assess their social problem-solving skills in the areas of provocation, peer group entry, and sharing or taking turns. Results indicated that, overall, girls' responses were more competent (i.e., reflective of successful functioning with peers) than those of boys, and girls' strategies were less likely to involve retaliation or verbal or physical aggression. The competency of the children's responses also varied with the gender of the target child. Findings are discussed in terms of the influence of gender-related social experiences on the types of strategies and behaviors that may be viewed as competent for boys and girls of preschool age.

Impact of Air Pollution on Age and Gender Related Increase in Cough Reflex Sensitivity of Healthy Children in Slovakia

PubMed Central

Demoulin-Alexikova, Silvia; Plevkova, Jana; Mazurova, Lenka; Zatko, Tomas; Alexik, Mikulas; Hanacek, Jan; Tatar, Milos

2016-01-01

Background: Numerous studies show higher cough reflex sensitivity (CRS) and cough outcomes in children compared to adults and in females compared to males. Despite close link that exists between cough and environment the potential influence of environmental air pollution on age- and gender -related differences in cough has not been studied yet. Purpose: The purpose of our study was to analyse whether the effects of exposure to environmental tobacco smoke (ETS) from parental smoking and PM10 from living in urban area are implied in age- and gender-related differences in cough outcomes of healthy, non-asthmatic children. Assessment of CRS using capsaicin and incidence of dry and wet cough was performed in 290 children (mean age 13.3 ± 2.6 years (138 females/152 males). Results: CRS was significantly higher in girls exposed to ETS [22.3 μmol/l (9.8–50.2 μmol/l)] compared to not exposed girls [79.9 μmol/l (56.4–112.2 μmol/l), p = 0.02] as well as compared to exposed boys [121.4 μmol/l (58.2–253.1 μmol/l), p = 0.01]. Incidence of dry cough lasting more than 3 weeks was significantly higher in exposed compared to not exposed girls. CRS was significantly higher in school-aged girls living in urban area [22.0 μmol/l (10.6–45.6 μmol/l)] compared to school-aged girls living in rural area [215.9 μmol/l (87.3–533.4 μmol/l); p = 0.003], as well as compared to teenage girls living in urban area [108.8 μmol/l (68.7–172.9 μmol/l); p = 0.007]. No CRS differences were found between urban and rural boys when controlled for age group. No CRS differences were found between school-aged and teenage boys when controlled for living area. Conclusions: Our results have shown that the effect of ETS on CRS was gender specific, linked to female gender and the effect of PM10 on CRS was both gender and age specific, related to female gender and school-age. We suggest that age and gender related differences in incidence of cough and CRS might be, at least partially, ascribed to the effect of environmental pollutants. The role of age and gender in the effect of air pollution on cough strongly suggest some interplay of development with biological and behavioral factors. PMID:26941651

Impact of Air Pollution on Age and Gender Related Increase in Cough Reflex Sensitivity of Healthy Children in Slovakia.

PubMed

Demoulin-Alexikova, Silvia; Plevkova, Jana; Mazurova, Lenka; Zatko, Tomas; Alexik, Mikulas; Hanacek, Jan; Tatar, Milos

2016-01-01

Numerous studies show higher cough reflex sensitivity (CRS) and cough outcomes in children compared to adults and in females compared to males. Despite close link that exists between cough and environment the potential influence of environmental air pollution on age- and gender -related differences in cough has not been studied yet. The purpose of our study was to analyse whether the effects of exposure to environmental tobacco smoke (ETS) from parental smoking and PM10 from living in urban area are implied in age- and gender-related differences in cough outcomes of healthy, non-asthmatic children. Assessment of CRS using capsaicin and incidence of dry and wet cough was performed in 290 children (mean age 13.3 ± 2.6 years (138 females/152 males). CRS was significantly higher in girls exposed to ETS [22.3 μmol/l (9.8-50.2 μmol/l)] compared to not exposed girls [79.9 μmol/l (56.4-112.2 μmol/l), p = 0.02] as well as compared to exposed boys [121.4 μmol/l (58.2-253.1 μmol/l), p = 0.01]. Incidence of dry cough lasting more than 3 weeks was significantly higher in exposed compared to not exposed girls. CRS was significantly higher in school-aged girls living in urban area [22.0 μmol/l (10.6-45.6 μmol/l)] compared to school-aged girls living in rural area [215.9 μmol/l (87.3-533.4 μmol/l); p = 0.003], as well as compared to teenage girls living in urban area [108.8 μmol/l (68.7-172.9 μmol/l); p = 0.007]. No CRS differences were found between urban and rural boys when controlled for age group. No CRS differences were found between school-aged and teenage boys when controlled for living area. Our results have shown that the effect of ETS on CRS was gender specific, linked to female gender and the effect of PM10 on CRS was both gender and age specific, related to female gender and school-age. We suggest that age and gender related differences in incidence of cough and CRS might be, at least partially, ascribed to the effect of environmental pollutants. The role of age and gender in the effect of air pollution on cough strongly suggest some interplay of development with biological and behavioral factors.

From Dichotomy to Divergence: Number/Gender Marking on Hebrew Nouns and Adjectives across School Ages

ERIC Educational Resources Information Center

Ravid, Dorit; Schiff, Rachel

2012-01-01

This study investigates the development of plural adjective agreement in Hebrew, focusing on the consolidation of Hebrew number/gender morphology in children and adolescents across the school years in comparison with adults. A total of 240 Hebrew-speaking participants in seven consecutive grade levels (kindergarten to sixth grade) plus a group of…

Gender, Ethnicity, Ethnic Identity, and Language Choices of Malaysian Youths: The Case of the Family Domain

ERIC Educational Resources Information Center

Granhemat, Mehdi; Abdullah, Ain Nadzimah

2017-01-01

This study examined the relationships between gender, ethnicity, ethnic identity, and language choices of Malaysian multilingual youths in the family domain of language use. Five hundred undergraduate students who belonged to different Malaysian ethnic groups were selected as participants of the study. The participant aged between 17 to 25 years…

Short-Term Persistence of "DSM-IV" ADHD Diagnoses: Influence of Context, Age, and Gender

ERIC Educational Resources Information Center

Bauermeister, Jose J.; Bird, Hector R.; Shrout, Patrick E.; Chavez, Ligia; Ramirez, Rafael; Canino, Glorisa

2011-01-01

Objective: Little is known about the effect of social context and gender on persistence of "attention-deficit/hyperactivity disorder" (ADHD) in children of early and middle school years. The study compared persistence of "DSM-IV" ADHD and ADHD not otherwise specified (NOS) over 2 years in two groups of Puerto Rican children.…

Gender Differences in Psychopathic Traits, Types, and Correlates of Aggression among Adjudicated Youth

ERIC Educational Resources Information Center

Stickle, Timothy R.; Marini, Victoria A.; Thomas, Jamila N.

2012-01-01

The current study investigated gender differences in types and correlates of aggression among 150 adjudicated youth (M age = 15.2, SD = 1.4). In cluster analysis, consistent with past studies, one aggressive group characterized by moderate levels of reactive aggression and one characterized by high levels of proactive and reactive aggression…

Burnout among Volunteers in the Social Services: The Impact of Gender and Employment Status

ERIC Educational Resources Information Center

Kulik, Liat

2006-01-01

This study examines whether gender and employment status affect burnout, motives for volunteering, and difficulties associated with volunteer activity in social and community services in Israel. The sample included 375 men and women aged 16 through 80. Participants were divided into four groups by employment status: high school students, employed…

Estimation of salivary flow rate, pH, buffer capacity, calcium, total protein content and total antioxidant capacity in relation to dental caries severity, age and gender.

PubMed

Pandey, Pallavi; Reddy, N Venugopal; Rao, V Arun Prasad; Saxena, Aditya; Chaudhary, C P

2015-03-01

The aim of the study was to evaluate salivary flow rate, pH, buffering capacity, calcium, total protein content and total antioxidant capacity in relation to dental caries, age and gender. The study population consisted of 120 healthy children aged 7-15 years that was further divided into two groups: 7-10 years and 11-15 years. In this 60 children with DMFS/dfs = 0 and 60 children with DMFS/dfs ≥5 were included. The subjects were divided into two groups; Group A: Children with DMFS/dfs = 0 (caries-free) Group B: Children with DMFS/dfs ≥5 (caries active). Unstimulated saliva samples were collected from all groups. Flow rates were determined, and samples analyzed for pH, buffer capacity, calcium, total protein and total antioxidant status. Salivary antioxidant activity is measured with spectrophotometer by an adaptation of 2,2'-azino-di-(3-ethylbenzthiazoline-6-sulphonate) assays. The mean difference of the two groups; caries-free and caries active were proved to be statistically significant (P < 0.05) for salivary calcium, total protein and total antioxidant level for both the sexes in the age group 7-10 years and for the age 11-15 years the mean difference of the two groups were proved to be statistically significant (P < 0.05) for salivary calcium level for both the sexes. Salivary total protein and total antioxidant level were proved to be statistically significant for male children only. In general, total protein and total antioxidants in saliva were increased with caries activity. Calcium content of saliva was found to be more in caries-free group and increased with age.

The effect of gender and age structure on municipal waste generation in Poland

DOE Office of Scientific and Technical Information (OSTI.GOV)

Talalaj, Izabela Anna, E-mail: izabela.tj@gmail.com; Walery, Maria, E-mail: m.walery@pb.edu.pl

Highlights: • An effect of gender and age structure on municipal waste generation was presented. • The waste accumulation index is influenced by a number of unemployed women. • Greater share of women in society contributes to greater waste production. • A model describing the analyzed dependences was determined. - Abstract: In this study the effect of gender and age structure on municipal waste generation was investigated. The data from 10-year period, from 2001 to 2010 year, were taken into consideration. The following parameters of gender and age structure were analyzed: men and woman quantity, female to male ratio, numbermore » of working, pre-working and post-working age men/women, number of unemployed men/women. The results have showed a strong correlation of annual per capita waste generation rate with number of unemployed women (r = 0.70) and female to male ratio (r = 0.81). This indicates that waste generation rate is more depended on ratio of men and women that on quantitative size of each group. Using the regression analysis a model describing the dependence between female to male ratio, number of unemployed woman and waste quantity was determined. The model explains 70% of waste quantity variation. Obtained results can be used both to improve waste management and to a fuller understanding of gender behavior.« less

The Mortality Divide in India: The Differential Contributions of Gender, Caste, and Standard of Living Across the Life Course

PubMed Central

Subramanian, S.V.; Nandy, Shailen; Irving, Michelle; Gordon, Dave; Lambert, Helen; Davey Smith, George

2006-01-01

Objectives. We investigated the contributions of gender, caste, and standard of living to inequalities in mortality across the life course in India. Methods. We conducted a multilevel cross-sectional analysis of individual mortality, using the 1998–1999 Indian National Family Health Survey data for 529321 individuals from 26 states. Results. Substantial mortality differentials were observed between the lowest and highest standard-of-living quintiles across all age groups, ranging from an odds ratio (OR) of 4.61 (95% confidence interval [CI]=2.98, 7.13) in the age group 2 to 5 years to an OR of 1.97 (95% CI=1.68, 2.32) in the age group 45 to 64 years. Excess mortality for girls was evident only for the age group 2 to 5 years (OR=1.33, 95% CI=1.13, 1.58). Substantial caste differentials were observed at the beginning and end stages of life. Area variation in mortality is partially a result of the compositional effects of household standard of living and caste. Conclusions. The mortality burden, across the life course in India, falls disproportionately on economically disadvantaged and lower-caste groups. Residual state-level variation in mortality suggests an underlying ecology to the mortality divide in India. PMID:16571702

The natural history of the anterior knee instability by stress radiography

PubMed Central

de Rezende, Márcia Uchôa; Hernandez, Arnaldo José; Camanho, Gilberto Luis

2014-01-01

OBJECTIVE: To analyze the anteroposterior displacement of the knee by means of stress radiography in individuals with unilateral anterior knee instability and relate to time of instability. METHODS: Sixty individuals with intact knees (control group) and 125 patients with unilateral anterior instability (AI group) agreed to participate in the study. Gender, age, weight, height, age at injury, time between injury and testing, and surgical findings are studied. Both groups are submitted to anterior and posterior stress radiographies of both knees. Anterior (ADD) and posterior displacement difference (PDD) were calculated between sides. RESULTS: In the control group ADD and PDD are in average, zero, whereas in the AI group ADD averaged 9.8mm and PDD, 1.92mm. Gender, age, weight, height, age at trauma and presence of menisci's lesions do not intervene in the values of ADD and PDD. Meniscal injuries increase with time. ADD and PDD do not relate with the presence or absence of associated menisci's lesions. The ADD and the PDD are related to each other and increase with time. CONCLUSION: There is a permanent anterior subluxation of the injured knee that is related to the amount of anterior displacement that increases with time. Level of Evidence III, Study Types Case-control study. PMID:25246846

The mortality divide in India: the differential contributions of gender, caste, and standard of living across the life course.

PubMed

Subramanian, S V; Nandy, Shailen; Irving, Michelle; Gordon, Dave; Lambert, Helen; Davey Smith, George

2006-05-01

We investigated the contributions of gender, caste, and standard of living to inequalities in mortality across the life course in India. We conducted a multilevel cross-sectional analysis of individual mortality, using the 1998-1999 Indian National Family Health Survey data for 529321 individuals from 26 states. Substantial mortality differentials were observed between the lowest and highest standard-of-living quintiles across all age groups, ranging from an odds ratio (OR) of 4.61 (95% confidence interval [CI]=2.98, 7.13) in the age group 2 to 5 years to an OR of 1.97 (95% CI=1.68, 2.32) in the age group 45 to 64 years. Excess mortality for girls was evident only for the age group 2 to 5 years (OR=1.33, 95% CI=1.13, 1.58). Substantial caste differentials were observed at the beginning and end stages of life. Area variation in mortality is partially a result of the compositional effects of household standard of living and caste. The mortality burden, across the life course in India, falls disproportionately on economically disadvantaged and lower-caste groups. Residual state-level variation in mortality suggests an underlying ecology to the mortality divide in India.

A comparison of donor and control group quality of life.

PubMed

Tumin, Makmor; Abdul Talib Abdul Mutalib, Muzalwana; Mohd Satar, Nurulhuda; Abdullah, Nawi; Chong, Chin-Sieng; Ng, Kok-Peng; Lim, Soo-Kun

2014-03-03

Informed consent of prospective donors should include information about the quality of life (QoL) of existing donors, especially those within the relevant country. This study aimed to provide information on Malaysian organ donors' QoL relative to a control group. Using a shorter version of the SF-36, QoL of 80 donors from the University of Malaya Medical Center (UMMC), Malaysia was surveyed and compared to QoL of 80 selected healthy individuals. ANOVA and General Linear Model (GLM) procedure were each applied for the QoL comparison, which was based on gender and age. Donors recorded a better QoL relative to the control group. Comparison across gender revealed that differences are more obvious for males than females. Donor/control comparison across age groups reveals that donors aged 56 and above reported significantly better QoL in most domains relative to other age groups. Information on donor QoL should be made available to the public to present a comprehensive picture of the consequences of organ donation. Nonetheless, we also argue that, despite the merits of organ donation, caution is required before concluding that donors have better QoL because the present research outcomes may reflect a self-selection bias in which respondents only included donors engaging in regular follow-ups.

Gender role conflict and emotional approach coping in men with cancer.

PubMed

Hoyt, Michael A

2009-10-01

The utility of emotional approach coping (EAC), or expressing and processing emotions, has been equivocal for men. Gender role conflict, or the negative cognitive, emotional and behavioural consequences associated with male gender role socialisation, likely shape coping responses and may negatively affect the efficacy of men's emotion-directed coping efforts and adjustment to cancer. Perceptions of receptiveness of one's interpersonal environment may be particularly important to the effectiveness of EAC. This study examined the relationships among EAC, gender role conflict, and distress in a group of 183 men with cancer. Structural equation modelling revealed that higher gender role conflict was associated with lower emotional expression, which in turn was associated with greater distress. Gender role conflict was not related to emotional processing. Higher gender role conflict also was associated directly with more distress. In subsequent analyses, social constraints and age were examined as possible moderators of EAC. Emotional expression was related to more psychological distress for those in highly constrained environments; and emotional processing was associated with more distress with younger age. Emotional expression may be particularly affected by social influences related to gender and social receptivity. More research is needed to better distinguish constructive and unconstructive emotional processing.

Variation of Biophysical Parameters of the Skin with Age, Gender, and Body Region

PubMed Central

Firooz, Alireza; Sadr, Bardia; Babakoohi, Shahab; Sarraf-Yazdy, Maryam; Fanian, Ferial; Kazerouni-Timsar, Ali; Nassiri-Kashani, Mansour; Naghizadeh, Mohammad Mehdi; Dowlati, Yahya

2012-01-01

Background. Understanding the physiological, chemical, and biophysical characteristics of the skin helps us to arrange a proper approach to the management of skin diseases. Objective. The aim of this study was to measure 6 biophysical characteristics of normal skin (sebum content, hydration, transepidermal water loss (TEWL), erythema index, melanin index, and elasticity) in a normal population and assess the effect of sex, age, and body location on them. Methods. Fifty healthy volunteers in 5 age groups (5 males and females in each) were enrolled in this study. A multifunctional skin physiology monitor (Courage & Khazaka electronic GmbH, Germany) was used to measure skin sebum content, hydration, TEWL, erythema index, melanin index, and elasticity in 8 different locations of the body. Results. There were significant differences between the hydration, melanin index, and elasticity of different age groups. Regarding the locations, forehead had the highest melanin index, where as palm had the lowest value. The mean values of erythema index and melanin index and TEWL were significantly higher in males and anatomic location was a significant independent factor for all of 6 measured parameters. Conclusion. Several biophysical properties of the skin vary among different gender, age groups, and body locations. PMID:22536139

Gender and racial differences for suicide attempters and ideators in a high-risk community corrections population.

PubMed

McCullumsmith, Cheryl B; Clark, C Brendan; Perkins, Adam; Fife, Jessaka; Cropsey, Karen L

2013-01-01

Community corrections populations are a high-risk group who carry multiple suicide risk factors. To identify factors correlated with historical suicide attempts and ideation among African-American men, African-American women, White men, and White women in a community corrections population. Self-report data from 18,753 enrollees in community corrections were analyzed. Multinomial logistic regression analyses were conducted to determine associations between historical suicidal ideation and attempts among the four demographic groups. Participants with historical suicide attempts tended to be younger, White, female, be taking psychotropic medication, have a history of physical or sexual abuse, and meet criteria for dependence on alcohol, amphetamines, cocaine, opioids, or sedatives. Five variables were commonly associated with suicide attempts for all four race/gender groups: younger age, being on disability or retirement, taking psychotropic medication, history of sexual or physical abuse, and cocaine dependence. Other demographic variables had race or gender specificities as risk factors for suicide attempts. Participants had high rates of historical suicide attempts with unique correlates differentiating attempters from ideators among different racial and gender groups. Cocaine dependence was universal predictor of suicide attempts, while other substance dependencies show specific racial and gender profiles associated with suicide attempts.

Normative and self-perceived orthodontic treatment need in Nigerian school children.

PubMed

Ajayi, Emmanuel Olubusayo

2015-07-01

The aim of this study was to assess the normative and self-perceived need for orthodontic treatment in Nigerian children, and to evaluate distribution of orthodontic treatment need according to gender and age. The sample consisted of 441 randomly selected school children, aged 11-18 years in Benin City, Nigeria. The subjects were further sub-grouped according to gender (229 males and 212 females) and age (246 11-13 years old and 195 14-18 years old). The Dental health Component (DHC) and Aesthetic Component (AC) of Index of Orthodontic Treatment Need (IOTN) were used to assess orthodontic treatment need normatively. Self-perceived need was evaluated by asking the subjects to rate their dental aesthetics on the Aesthetic Component scale of IOTN. Chi-square tests were used to evaluate gender and age differences in distribution of treatment need. A definite need for orthodontic treatment was found among 21.5% (grades 4-5 of DHC) and 6.3% (grades 8-10 of AC) of the subjects; 3.9% of the subjects perceived a definite need for orthodontic treatment (grades 8-10 of AC). There were no statistically significant gender and age differences in distribution of orthodontic treatment need among the subjects (p > 0.05). The study revealed a need for orthodontic treatment in slightly more than one fifth (21.5%) of this sample of Nigerian children. The sample population has a lower need on aesthetic grounds and their normative and self-perceived orthodontic treatment needs were not influenced by gender and age.

Brazilian Normative Data on Letter and Category Fluency Tasks: Effects of Gender, Age, and Geopolitical Region

PubMed Central

Hazin, Izabel; Leite, Gilmara; Oliveira, Rosinda M.; Alencar, João C.; Fichman, Helenice C.; Marques, Priscila d. N.; de Mello, Claudia Berlim

2016-01-01

Verbal fluency is a basic function of language that refers to the ability to produce fluent speech. Despite being an essentially linguistic function, its measurements are also used to evaluate executive aspects of verbal behavior. Performance in verbal fluency (VF) tasks varies according to age, education, and cognitive development. Neurodevelopmental disorders that affect the functioning of frontal areas tend to cause lower performance in VF tasks. Despite the relative consensus that has been reached in terms of the use of VF tasks for the diagnosis of dyslexia and attention-deficit/hyperactivity disorder, few studies have considered regional variations in Brazil. The present study sought to provide normative data on VF tasks in children by considering gender, age, education, and geopolitical region of origin with auxiliary purposes in neuropsychological diagnosis of disorders that occur with executive changes The study included 298 participants, 7–10 years of age of both genders, who performed three letter fluency tasks and three category fluency tasks. The data were subjected to correlational and variance analyses, with age and gender as factors. No effect of gender on the children's performance was found. However, significant differences between age groups were observed, with better performance in letter tasks in older children and better performance in letter tasks compared with category tasks. Significant regional differences in performance on the letter VF task were observed. These results reinforce the importance of regional normative data in countries with high regional cultural variations, such as Brazil. PMID:27242598

HIV prevention in favour of the choice-disabled in southern Africa: study protocol for a randomised controlled trial.

PubMed

Andersson, Neil; Cockcroft, Anne; Thabane, Lehana; Marokoane, Nobantu; Laetsang, Ditiro; Masisi, Mokgweetsi

2013-08-29

Most HIV prevention strategies assume beneficiaries can act on their prevention decisions. But some people are unable to do so. They are 'choice-disabled'. Economic and educational interventions can reduce sexual violence, but there is less evidence that they can reduce HIV. There is little research on complex interventions in HIV prevention, yet all countries in southern Africa implement combination prevention programmes. The primary objective is to reduce HIV infections among women aged 15 to 29 years. Secondary objectives are reduction in gender violence and improvement in HIV-related knowledge, attitudes and practices among youth aged 15 to 29 years.A random sample of 77 census enumeration areas in three countries (Botswana, Namibia and Swaziland) was allocated randomly to three interventions, alone or in combination, in a factorial design stratified by country, HIV rates (above or below average for country), and urban/rural location. A baseline survey of youth aged 15 to 29 years provided cluster specific rates of HIV. All clusters continue existing prevention efforts and have a baseline and follow-up survey. Cluster is the unit of allocation, intervention and analysis, using generalised estimating equations, on an intention-to-treat basis.One intervention discusses evidence about choice disability with local HIV prevention services, to help them to serve the choice-disabled. Another discusses an eight-episode audio-docudrama with community groups, of all ages and both sexes, to generate endogenous strategies to reduce gender violence and develop an enabling environment. A third supports groups of women aged 18 to 25 years to build self-esteem and life skills and to set up small enterprises to generate income.A survey in all clusters after 3 years will measure outcomes, with interviewers unaware of group assignment of the clusters. The primary outcome is HIV infection in women aged 15 to 29 years. Secondary outcomes in youth aged 15 to 29 years are gender violence and protective knowledge, attitudes, subjective norms, intention to change, agency, discussion of prevention and practices related to HIV and gender violence. ISRCTN28557578.

Psychometric Properties and Normative values of Early Maladaptive Schema Questionnaires Set for Children and Adolescents (SQS).

PubMed

Güner, Olcay

2017-03-01

The Early Maladaptive Schema Questionnaires Set for Children and Adolescents (SQS) was developed to assess early maladaptive schemas in children between the ages of 10 and 16 in Turkey. The SQS consists of five questionnaires that represent five schema domains in Young's schema theory. Psychometric properties (n = 983) and normative values (n = 2250) of SQS were investigated in children and adolescents between the ages of 10 and 16. Both exploratory and confirmatory factor analyses were performed. Results revealed 15 schema factors under five schema domains, with good fit indexes. A total of 14 schema factors were in line with Young's early maladaptive schemas. In addition to these factors, one new schema emerged: self-disapproval. Reliability analyses showed that SQS has high internal consistency and consistency over a 1-month interval. Correlations of SQS with the Adjective Check List (ACL), the Inventory of Parent and Peer Attachment (IPPA), the Symptom Assessment (SA-45) and the Young Schema Questionnaire (YSQ) were investigated to assess criterion validity, and the correlations revealed encouraging results. SQS significantly differentiated between children who have clinical diagnoses (n = 78) and children who have no diagnosis (n = 100). Finally, general normative values (n = 2,250) were determined for age groups, gender and age/gender groups. In conclusion, the early maladaptive schema questionnaires set for children and adolescents turned out to be a reliable and valid questionnaire with standard scores.Copyright © 2016 John Wiley & Sons, Ltd. The early maladaptive schema questionnaires set for children and adolescents (SQS) is a psychometrically reliable and valid measure of early maladaptive schemas for children between the ages of 10 and 16. SQS consists of five schema domains that represent Young's schema domains including 15 early maladaptive schemas and 97 items. Normative values for each schema were determined for age, gender and age/gender groups. Clinically, SQS presents valuable information about early maladaptive schemas during childhood and adolescence, before such schemas become more pervasive and persistent. Copyright © 2016 John Wiley & Sons, Ltd.

Who wants to work with older people? Swedish student nurses' willingness to work in elderly care--a questionnaire study.

PubMed

Carlson, Elisabeth; Idvall, Ewa

2015-07-01

The aging population is a globally recognized challenge for the health care service. The growing number of older people will probably lead to increased demands for nurses working in elderly care. Clinical practice has been shown to have an impact on how student nurses perceive a particular field of nursing. To compare perceptions of the clinical learning environment in nursing homes among students considering a career in aged care or not, and to examine the difference in age, gender and previous working experience as health care assistants in elderly care between the two groups. This was a cross-sectional study using the Swedish version of the Clinical Learning Environment and Nurse Teacher evaluation scale. Consecutive sampling was performed over three semesters from September 2011 to December 2012. The survey was conducted with 183 student nurses. Mann-Whitney U-test was used to examine differences in relation to two groups namely student nurses who did or did not consider to work in elderly care. A chi-square test of independence was performed to examine the difference in age, gender and previous working experience between the two groups. The analysis leaned towards an overall positive evaluation of the clinical learning environment with more positive values for students considering a career. There were no significant differences between younger students (18-23) and older students (24-50) regarding willingness to work in elderly care or not. Neither was any significant difference displayed between students, based on gender nor for previous work experience. Age, gender and previous work experiences as health care assistants did not impact on students' willingness to work in elderly care. Future studies need to acknowledge the complexity of why student nurses choose a particular pathway in nursing by longitudinal studies following cohorts of students during the course of the nursing programme. Copyright © 2015 Elsevier Ltd. All rights reserved.

Assessment of Carotid Intima-Media Thickness as an Early Marker Of Vascular Damage In Hypertensive Children.

PubMed

Baroncini, Liz Andréa Villela; Sylvestre, Lucimary de Castro; Baroncini, Camila Varotto; Pecoits, Roberto

2017-05-01

The increased carotid intima-media thickness (CIMT) correlates with the presence of atherosclerosis in adults and describes vascular abnormalities in both hypertensive children and adolescents. To assess CIMT as an early marker of atherosclerosis and vascular damage in hypertensive children and adolescents compared with non-hypertensive controls and to evaluate the influence of gender, age, and body mass index (BMI) on CIMT on each group. Observational cohort study. A total of 133 hypertensive subjects (male, n = 69; mean age, 10.5 ± 4 years) underwent carotid ultrasound exam for assessment of CIMT. One hundred and twenty-one non-hypertensive subjects (male, n = 64; mean age, 9.8 ± 4.1 years) were selected as controls for gender, age (± 1 year), and BMI (± 10%). There were no significant difference regarding gender (p = 0.954) and age (p = 0.067) between groups. Hypertensive subjects had higher BMI when compared to control group (p = 0.004), although within the established range of 10%. Subjects in the hypertensive group had higher CIMT values when compared to control group (0.46 ± 0.05 versus 0.42 ± 0.05 mm, respectively, p < 0.001; one-way ANOVA). Carotid IMT values were not significantly influenced by gender, age, and BMI when analyzed in both groups separately (Student's t-test for independent samples). According to the adjusted determination coefficient (R²) only 11.7% of CIMT variations were accounted for by group variations, including age, gender, and BMI. Carotid intima-media thickness was higher in hypertensive children and adolescents when compared to the control group. The presence of hypertension increased CIMT regardless of age, gender, and BMI. O aumento da espessura médio-intimal carotídea (EMIC) correlaciona-se com a presença de aterosclerose em adultos e descreve anormalidades vasculares em crianças e adolescentes hipertensos. Avaliar a EMIC como marcador precoce de aterosclerose e dano vascular em crianças e adolescentes hipertensos em comparação com um grupo controle e avaliar a influência do sexo, idade e índice de massa corporal (IMC) sobre a EMIC em cada grupo. Estudo observacional de coorte. Um total de 133 indivíduos hipertensos (sexo masculino, n = 69; idade média 10.5 ± 4 anos) foi submetido à ultrassonografia das artérias carótidas para avaliação da EMIC. Cento e vinte e um indivíduos saudáveis (sexo masculino, n = 64; idade média, 9.8 ± 4.1 anos) foram selecionados como controles para as seguintes características: sexo, idade (± 1ano) e IMC (±10%). Não houve diferenças significativas entre os grupos com relação ao sexo (p = 0,954) e idade (p = 0,067). Os indivíduos hipertensos apresentaram maior IMC (p = 0,004), porém dentro da faixa estabelecida de até 10%. Os indivíduos hipertensos apresentaram maiores valores de EMIC quando comparados ao grupo-controle (0,46 ± 0,05 versus 0,42 ± 0,05 mm, respectivamente, p < 0.001; ANOVA com um parâmetro). Os valores da EMIC não foram influenciados por sexo, idade e IMC quando analisados em ambos os grupos separadamente (Teste t de Student para amostras independentes). De acordo com o coeficiente de determinação (R²) ajustado, apenas 11.7% das variações da EMIC são devidas às variações em cada grupo, incluindo idade, sexo e IMC. A espessura médio-intimal das carótidas apresentou-se aumentada em crianças e adolescentes hipertensos quando comparados ao grupo controle. A presença de hipertensão aumentou a EMIC independentemente de idade, sexo e IMC.

Epidemiologic Characteristics of Injured School-age Patients Transported via Emergency Medical Services in Korea.

PubMed

Park, Hang A; Ahn, Ki Ok; Park, Ju Ok; Kim, Jungeun; Jeong, Seungmin; Kim, Meesook

2018-03-05

The purpose of this study was to identify the characteristics of injuries of school-aged children transported via emergency medical services (EMS) that occurred in schools by comparing with injuries that occurred outside of school. Data from the 119 EMS from 2012 to 2014 were analyzed. School and non-school injuries were analyzed in children 6 to 17 years of age. The epidemiologic characteristics were assessed according to school-age groups; low-grade primary (6-8 years), high-grade primary (9-13 years), middle (13-15 years) and high (15-17 years) school. Gender-stratified multivariable logistic regression analysis was conducted to estimate the risks of school injury in each age group. During the study period, a total of 167,104 children with injury were transported via 119 ambulances. Of these injuries, 13.3% occurred at schools. Boys accounted for 76.9% of school injuries and middle school children accounted for a significantly greater proportion (39.6%) of school injuries (P < 0.001). The most frequent mechanisms of injury at school were falls (43.8%). The peak times for school injury occurrence were lunch time (13:00-13:59) in all age groups. Multivariate regression identified the risky age groups as high-grade primary (odds ratio [OR], 1.14; 95% confidence interval [CI], 1.09-1.20) and middle school-aged boys (OR, 1.82; 95% CI, 1.74-1.90) and middle school-aged girls (OR, 1.30; 95% CI, 1.21-1.40). Notable epidemiologic differences exist between in- and out-of-school injuries. The age groups at risk for school injuries differ by gender. © 2018 The Korean Academy of Medical Sciences.

Epidemiologic Characteristics of Injured School-age Patients Transported via Emergency Medical Services in Korea

PubMed Central

2018-01-01

Background The purpose of this study was to identify the characteristics of injuries of school-aged children transported via emergency medical services (EMS) that occurred in schools by comparing with injuries that occurred outside of school. Methods Data from the 119 EMS from 2012 to 2014 were analyzed. School and non-school injuries were analyzed in children 6 to 17 years of age. The epidemiologic characteristics were assessed according to school-age groups; low-grade primary (6–8 years), high-grade primary (9–13 years), middle (13–15 years) and high (15–17 years) school. Gender-stratified multivariable logistic regression analysis was conducted to estimate the risks of school injury in each age group. Results During the study period, a total of 167,104 children with injury were transported via 119 ambulances. Of these injuries, 13.3% occurred at schools. Boys accounted for 76.9% of school injuries and middle school children accounted for a significantly greater proportion (39.6%) of school injuries (P < 0.001). The most frequent mechanisms of injury at school were falls (43.8%). The peak times for school injury occurrence were lunch time (13:00–13:59) in all age groups. Multivariate regression identified the risky age groups as high-grade primary (odds ratio [OR], 1.14; 95% confidence interval [CI], 1.09–1.20) and middle school-aged boys (OR, 1.82; 95% CI, 1.74–1.90) and middle school-aged girls (OR, 1.30; 95% CI, 1.21–1.40). Conclusion Notable epidemiologic differences exist between in- and out-of-school injuries. The age groups at risk for school injuries differ by gender. PMID:29495140

A unique gender difference in early onset melanoma implies that in addition to ultraviolet light exposure other causative factors are important

PubMed Central

Liu, Feng; Bessonova, Leona; Taylor, Thomas H.; Ziogas, Argyrios; Meyskens, Frank L.; Anton-Culver, Hoda

2014-01-01

Summary Using US SEER17 Registry data, age-specific melanoma incidence rates were calculated and comparisons were made between males and females. Relative Risk (RR) for males and females in each age group was computed and compared with that from Nordic Cancer Registry data set and to that for non-melanoma skin cancer (NMSC). For age groups 44 and younger, females showed higher incidence rates, with a peak difference at age 20–24 (RR = 2.01, 95% CI = 1.21–3.33). Males exhibited higher incidence rates after age 44. The same bimodal gender difference was confirmed by the Nordic Cancer Registry data set, but it was not observed for NMSC, which is known to be strongly associated with cumulative exposure to solar UV radiation. We conclude that exposure to solar ultraviolet (UV) radiation is the major causative factor for melanoma at older age (>44 yr), but that other factors may play a role in early onset melanomas, particularly in females. PMID:23095171

Gender and age differences in suicide mortality in the context of violent death: findings from a multi-state population-based surveillance system.

PubMed

Bozzay, Melanie L; Liu, Richard T; Kleiman, Evan M

2014-07-01

Males are more likely than females to die by all forms of violent death, including suicide. The primary purpose of the present study was to explore whether the gender difference in suicide rates is largely accounted for by males' general greater tendency to experience violent deaths. The current study examined gender and age differences in suicides and other violent deaths, using data from a population-based surveillance system. Pearson's chi-square tests and logistic regression analyses were conducted with data for 32,107 decedents in the 2003-2005 National Violent Death Reporting System (NVDRS). Decedents were categorized by gender, age, and death by suicide versus other violent means. When suicides were examined in the greater context of violent death, the total proportion of violent deaths due to suicide did not differ across gender. When deaths were examined by age group, after controlling for ethnicity, marital status, and U.S. location in which the death occurred, males in early to mid childhood were significantly more likely than same-aged females to die by suicide relative to all other violent deaths. The portion of deaths due to suicide was for the most part equal across both genders in late childhood, young adulthood, and mid-adulthood. Older males were more likely than older females to die by suicide relative to other violent deaths. Our findings suggest that that the risk of dying by suicide relative to other violent deaths may be more pronounced at certain developmental stages for each gender. This knowledge may be valuable in tailoring prevention strategies. Copyright © 2014 Elsevier Inc. All rights reserved.

Stability and Change of Adolescents' Aggressive Behavior in Residential Youth Care.

PubMed

Eltink, E M A; Ten Hoeve, J; De Jongh, T; Van der Helm, G H P; Wissink, I B; Stams, G J J M

2018-01-01

Aggression in residential youth care institutions is a frequent problem. The present short-term longitudinal study examined individual and institutional predictors of aggression in a group of 198 adolescents placed in open, semi-secure and secure residential institutions from the perspective of the importation and deprivation model. A total of 198 adolescents in residential youth care filled in questionnaires regarding group climate and aggression with a 3 month interval. Hierarchical multiple regression analyses were performed to test the degree to which individual and contextual factors predict aggression. Very limited support was found for the effect of contextual factors; only repression showed a trend, predicting direct aggression, while gender composition of the living groups yielded a small effect. Girls placed in same-gender groups showed lower levels of indirect (relational) aggression compared to adolescents placed in mixed-gender or boys-only groups, even when controlled for gender and initial levels of aggression. Type of institution (i.e., level of security) did not predict differences in aggression. In particular individual characteristics of the adolescents were associated with later aggression, including initial levels of aggression, showing substantial 3 months stability, age and gender of the adolescents. These findings are in line with research showing that aggression is relatively stable. Very limited support for environmental effects was found.

Minority Rights and Majority Rule: Ethnic Tolerance in Romania and Bulgaria.

ERIC Educational Resources Information Center

McIntosh, Mary E.; And Others

1995-01-01

Analysis of data from national surveys of majority ethnic groups in Romania and Bulgaria examined the effects on tolerance toward minority groups of education, community ethnic composition, urbanism, age, gender, perceived threat to national security from the minority group's homeland, democratic values, and prevailing political ideology. Contains…

Osteoporosis in Groups with Intellectual Disability.

ERIC Educational Resources Information Center

Center, J. R.; And Others

1994-01-01

Fifty-three adults with intellectual impairment referred to an endocrinology clinic in New South Wales (Australia) were measured for lumbar bone mineral density. Bone mineral density was significantly lower in this group than in an age and sex matched control group. Risk factors included male gender, physical inactivity, small body size,…

[Gender and age differences in waiting time on hospital waiting list.].

PubMed

Thornórðardóttir, Steinunn; Halldórsson, Matthías; Guðmundsson, Sigurður

2002-09-01

The size of waiting lists has traditionally been viewed as a fairly good measure of the quality of health care services. No statistical analysis exists in Iceland of the length of waiting times and the potential variation between groups of patients. This study was conducted within the office of the Directorate of Health in Iceland. This location was convenient since standardized information on waiting lists is collected by the office three times a year. Variations in waiting times were studied based on gender on the one hand and on age on the other. Data from the largest waiting lists, those amounting to 400 or more patients, were included in the study. The most frequently awaited operations were identified and the groups of people waiting for them analyzed. The departments and prospective operations included in the study were: Dept. of General Surgery at the University Hospital (UH) (laparoscopic gastro-oesophageal antireflux operation), Opthalmology at UH (phakoemulsification with implantation of artificial lens in posterior chamber), Orthopedic Surgery at UH (primary total prosthetic replacement of hip joint using sement), The Rehabilitation Center at Reykjalundur (rehabilitation, not specified), Ear, Nose and Throat (ENT) at UH (tonsillectomy), and Reconstructive Surgery at UH (reduction mammoplasty with transposition of areola). The lists were sorted by gender and age, with the latter consisting of two categories, older and younger patients. Every attempt was made as to ensure similar sample sizes for both age groups within each department. Finally, the median waiting time was determined and a Mann-Whitney test conducted in order to test for significance. The median waiting time for males at the General Surgery Dept. was 73 weeks as compared to 60 weeks for females. This was the only department where the median waiting time was significantly longer for males than for females (p<0.05). At three of the departments the older group had a longer median waiting time than the younger group, 18 weeks compared to 14 at Opthalmology (p<0.001), 26 versus 17 weeks at Reykjalundur (p<0.025) and 33 versus 21 weeks at ENT (p<0.01). Waiting times for females was significantly longer than for males at two departments, Reykjalundur (21 vs. 17 weeks, p<0.05) and ENT (33 vs. 29 weeks, p<0.05). This study revealed age and gender differences in median waiting times at Icelandic hospitals. These differences were in many cases marked and statistically significant. Various explanations have been put forward, however, further research is needed in order to determine if it these differences are due to actual clinical needs assessments or to age or gender discrimination.

Body weight has no impact on self-esteem of minority children living in inner city, low-income neighborhoods: a cross-sectional study.

PubMed

Wong, William W; Mikhail, Carmen; Ortiz, Christina L; Lathan, Debra; Moore, Louis A; Konzelmann, Karen L; Smith, E O'Brian

2014-01-24

The relationship between body weight and self-esteem among underserved minority children is not well documented. We measured the self-esteem profile using the Self-Perception Profile for Children among 910 minority children at 17 Houston community centers. Weight status had no effect on any of the self-esteem scores among the minority children (P ≥ 0.21). Black children had higher scholastic competence than Hispanic children (P = 0.05). Social acceptance was not affected by age, gender, and race/ethnicity (P ≥ 0.13). Significant age x gender (P = 0.006) and race x gender (P = 0.005) interactions were detected on athletic competence. The younger boys had higher athletic competence than the younger and older girls (P ≤ 0.01). The older boys had higher athletic competence than the older girls (P = 0.008) but their scores were not different from those of the younger girls (P = 0.07). Within each race/ethnicity group, boys had higher athletic competence than girls (P ≤ 0.03). Black boys had higher athletic competence than Hispanic girls (P = 0.007) but their scores were not different from those of the Hispanic boys (P = 0.08). Age and gender had no effect on physical appearance but black children had higher scores than Hispanic children (P = 0.05). Behavioral conduct was not affected by age, gender, or race/ethnicity (P ≥ 0.11). There was an age x gender interaction on global self-worth (P = 0.02) with boys having similar scores regardless of ages (P = 0.40) or ethnicity (P = 0.98). However, boys from both age groups had higher global self-worth than the older girls (P ≤ 0.04) but their scores were not different from those of the younger girls (P ≥ 0.07). For the first time, we documented that being normal weight did not necessarily guarantee positive self-esteem among minority children. Their self-esteem scores were similar to those found among children who were diagnosed with obesity and obesity-related co-morbidities and lower than those reported among normal-weight white children. Therefore, activities to promote self-esteem are important when working with underserved minority children in order to promote a healthy lifestyle.

Understanding environmental health inequalities through comparative intracategorical analysis: racial/ethnic disparities in cancer risks from air toxics in El Paso County, Texas.

PubMed

Collins, Timothy W; Grineski, Sara E; Chakraborty, Jayajit; McDonald, Yolanda J

2011-01-01

This paper contributes to the environmental justice literature by analyzing contextually relevant and racial/ethnic group-specific variables in relation to air toxics cancer risks in a US-Mexico border metropolis at the census block group-level. Results indicate that Hispanics' ethnic status interacts with class, gender and age status to amplify disproportionate risk. In contrast, results indicate that non-Hispanic whiteness attenuates cancer risk disparities associated with class, gender and age status. Findings suggest that a system of white-Anglo privilege shapes the way in which race/ethnicity articulates with other dimensions of inequality to create unequal cancer risks from air toxics. Copyright © 2010 Elsevier Ltd. All rights reserved.

Incidence and outcomes of emergency self-harm among adolescents: a descriptive epidemiological study in Osaka City, Japan

PubMed Central

Matsuyama, Tasuku; Kitamura, Tetsuhisa; Kiyohara, Kosuke; Hayashida, Sumito; Nitta, Masahiko; Kawamura, Takashi; Iwami, Taku; Ohta, Bon

2016-01-01

Objectives To evaluate the incidence and outcomes of self-harm from ambulance records. Design A retrospective, observational study. Setting Osaka City, Japan. Participants A total of 365 adolescents aged 10–19 years with emergency self-harm such as poisoning by drugs or gas, cutting skin, jumping from heights, hanging and drowning and treated by emergency medical service personnel from January 2010 through December 2012. Primary outcome measurements Incidence per 100 000 persons and outcome at the scene or hospital arrival by age and gender. Poisson regression models for incidence evaluation were used; reporting relative risks (RRs) and their 95% CIs. Results During the study period, a total of 425 self-harm events were documented in 365 adolescents. The incidence of self-harm increased significantly between the ages of 11 and 19 years, from 6.3 to 81.0 among boys and the ages of 12 and 19 years from 6.3 to 228.3 among girls, respectively (both p<0.001). Although there was no incidence difference between girls and boys in the group aged 11–14 years (RR 1.20; 95% CI 0.59 to 2.47), the incidence was significantly higher among girls than boys in the group aged 15–19 years (RR 4.18; 95% CI 3.20 to 5.45). The overall proportion of death by self-harm was 4.9%. The proportion of hospital admission and death by self-harm was higher among boys than among girls (38.6% vs 25.2%, p=0.016 and 14.8% vs 2.4%, p<0.001). Conclusions The incidence of emergency treatment for self-harm by adolescents increased with age and our findings also demonstrated the gender paradox. It would be necessary to establish active, gender-specific and comprehensive prevention strategies for adolescent self-harm, based on our findings showing the age and gender differences of self-harm among adolescents. PMID:27381208

Mood disturbance and depression in Arab women following hospitalisation from acute cardiac conditions: a cross-sectional study from Qatar

PubMed Central

Donnelly, Tam Truong; Al Suwaidi, Jassim Mohd; Al-Qahtani, Awad; Asaad, Nidal; Fung, Tak; Singh, Rajvir; Qader, Najlaa Abdul

2016-01-01

Objectives Depression is associated with increased morbidity and mortality rates among cardiovascular patients. Depressed patients have three times higher risk of death than those who are not. We sought to determine the presence of depressive symptoms, and whether gender and age are associated with depression among Arab patients hospitalised with cardiac conditions in a Middle Eastern country. Setting Using a non-probability convenient sampling technique, a cross-sectional survey was conducted with 1000 Arab patients ≥20 years who were admitted to cardiology units between 2013 and 2014 at the Heart Hospital in Qatar. Patients were interviewed 3 days after admission following the cardiac event. Surveys included demographic and clinical characteristics, and the Arabic version of the Beck Depression Inventory Second Edition (BDI-II). Depression was assessed by BDI-II clinical classification scale. Results 15% of the patients had mild mood disturbance and 5% had symptoms of clinical depression. Twice as many females than males suffered from mild mood disturbance and clinical depression symptoms, the majority of females were in the age group 50 years and above, whereas males were in the age group 40–49 years. χ2 Tests and multivariate logistic regression analyses indicated that gender and age were statistically significantly related to depression (p<0.001 for all). Conclusions Older Arab women are more likely to develop mood disturbance and depression after being hospitalised with acute cardiac condition. Gender and age differences approach, and routine screening for depression should be conducted with all cardiovascular patients, especially for females in the older age groups. Mental health counselling should be available for all cardiovascular patients who exhibit depressive symptoms. PMID:27388362

Heider balance, asymmetric ties, and gender segregation

NASA Astrophysics Data System (ADS)

Krawczyk, Małgorzata J.; del Castillo-Mussot, Marcelo; Hernández-Ramírez, Eric; Naumis, Gerardo G.; Kułakowski, Krzysztof

2015-12-01

To remove a cognitive dissonance in interpersonal relations, people tend to divide their acquaintances into friendly and hostile parts, both groups internally friendly and mutually hostile. This process is modeled as an evolution toward the Heider balance. A set of differential equations have been proposed and validated (Kułakowski et al., 2005) to model the Heider dynamics of this social and psychological process. Here we generalize the model by including the initial asymmetry of the interpersonal relations and the direct reciprocity effect which removes this asymmetry. Our model is applied to the data on enmity and friendship in 37 school classes and 4 groups of teachers in México. For each class, a stable balanced partition is obtained into two groups. The gender structure of the groups reveals stronger gender segregation in younger classes, i.e. of age below 12 years, a fact consistent with other general empirical results.

Gender is a risk factor in patients with gastroesophageal reflux disease.

PubMed

Fakhre Yaseri, Hashem

2017-01-01

Background: Prevalence of gastroesophageal reflux disease (GERD) has increased in the last decades, and it is now one of the most common chronic and recurrent diseases. The present study aimed at determining the frequency of gender (sex) and age in Iranian patients with GERD symptoms. Methods: In this study, 803 patients aged 11 to 84 years, with erosive and nonerosive gastroesophageal reflux diseases, based on the questionnaire and esophagogastroduodenoscopy findings, participated. The female group was compared with the male group with respect to age, symptoms, esophageal injury, and hiatus hernia. Results: Of the 803 participants, 60.5% (n= 486) were female, and 69.2% (n= 555) were younger than 50 years. Of those patients older than 50 years, 32.8% (n= 81) were female. Moreover, 31.0% (n= 249) of the patients had erosive esophagitis (ERD), and 69.0% (n= 254) had normal esophageal mucosa (NERD).The female to male ratio was 1/1.06 and 1.94/1 in ERD and NERD patients, respectively. Hiatal hernia was more prevalent in females than in males. Conclusion: Nonerosive reflux disease, as a gastroesophageal reflux disease (GERD), was more common in females than in males. GERD became more prevalent with increase in age. Gender and hiatal hernias were 2 potential risk factors of GERD.

[Effect of sociodemographic factors, cancer, psychiatric disorder on suicide: gender and age-specific patterns].

PubMed

Park, Jae Young; Moon, Ki Tae; Chae, Yoo Mi; Jung, Sang Hyuk

2008-01-01

We examined the effect of sociodemographic factors, cancer, and psychiatric disorders on suicide by gender and age-specific patterns in South Korea. The study is a case-control study. Claim data was obtained from the national health insurance database and national death registration database. The number of people who committed suicide was 11,523, which was matched with a control group consisting of ten times as many people at 115,230 selected from the national health insurance and medical aids beneficiaries. The medical utilization of the case group was one year before death and that of the control group was from July 1,2003 to June 30, 2004. Four variables-address, economic status, presence of a psychiatric disease, and cancer-were used in multiple logistic regression analyses. Living in cities or in rural areas showed a greater risk for suicide than living in a metropolitan city. Low economic status, the presence of a psychiatric disorder, and cancer were also statistically meaningful risk factors for suicide. The three major psychiatric diseases, schizophrenia, alcohol abuse, and bipolar disorder, were meaningful in all age groups, but the scale of the odds ratio differed by the age group. Only the psychiatric disorder variable was meaningful in the adolescent group, whereas a psychiatric disorder and economic status were meaningful for the young adult group, and all variables were meaningful for the middle-aged group. A psychiatric disorder and cancer were meaningful in the elderly group, economic status was meaningful for male subjects, and address was meaningful for female subjects. Factors such as living in city or rural areas, low economic status, the presence of a psychiatric disorder, and cancer were statistically meaningful risk factors in suicide. These factors also differed by age group. Therefore, policymakers should establish policies for suicide prevention that are relevant for each age group.

[Study on the difference of corresponding age at cervical vertebral maturation stages among different skeletal malocclusions].

PubMed

Zuo, Changyan; Cong, Chao; Wang, Shihui; Gu, Yan

2015-10-01

To compare the difference of corresponding age at cervical vertebral maturation (CVM) stages among different skeletal malocclusions and provide clinic guideline on optimal treatment timing for skeletal malocclusion. Based on ANB angle, 2 575 cephalograms collected from Department of Orthodontics, Peking University School and Hospital of Stomatology from May, 2006 to November, 2014 were classified into skeletal Class I (ANB 0°~5°, 1 317 subjects), Class II (ANB > 5°, 685 subjects) and Class III (ANB < 0°, 573 subjects) groups. CVM stages were evaluated with the modified version of CVM method. Independent sample t test was performed to analyze the difference of age at different CVM stages among various skeletal groups. Significant gender difference of age was found at CS3 to CS6 for skeletal Class I group (P < 0.05), at CS5 and CS6 for skeletal Class II group (P < 0.05), and at CS3 and CS5 for skeletal Class III group (P < 0.05). At CS3 stage, the average age of male in skeletal Class II and skeletal Class III groups was (11.6 ± 1.5) years old and (10.3 ± 1.9) years old, respectively; the average age of females in those two groups was (11.7 ± 1.3) years old and (9.3 ± 1.5) years old, respectively, and significant difference was found in both comparisons (P < 0.05). Compared average age at CS5 and CS6 between skeletal Class II and skeletal Class III groups [the ages of male was (15.1 ± 1.7) and (16.8 ± 1.6) years old, the ages of male was (14.6 ± 1.2) and (15.7 ± 2.5) years old], significant difference was also found (P < 0.05). Significant gender differences were found when evaluated CVM stage and age in skeletal Class I, II and III groups. Significant differences of age at different CVM stage was noted when skeletal Class II was compared with skeletal Class III groups.

Children's acceptance of a peer who is overweight: relations among gender, age and blame for weight status.

PubMed

Iobst, E A; Ritchey, P N; Nabors, L A; Stutz, R; Ghee, K; Smith, D T

2009-07-01

To examine the role of blame as a mediator of the relationships between perceiver age and gender and children's acceptance of an overweight peer. Cross-sectional study of children's perceptions of their overweight peers using structural equation modeling. Two hundred and ninety-one children between the ages of 3 and 11 years. Children viewed a videotape of a same-sex peer, dressed to appear overweight, interacting with an adult. After viewing the videotape, children responded to items assessing their perceptions of the child's social and emotional traits and how much the child was to blame for being overweight.Results:Confirmatory factor analysis indicated that the traits loaded on a single factor, acceptance. of analyses for our structural equation model indicated that as blame increased, acceptance of the peer decreased. The relationships between gender and blame and gender and acceptance were not significant. Children were categorized into three age groups (3-4, 5-8 and 9-11 years) to examine the influence of age. Children between 5 and 8 years of age were less likely to blame the model compared with younger and older children. Preschoolers reported the lowest acceptance, indicating a need for intervention for children in this age range. Furthermore, it will be important to conduct longitudinal studies to determine the influence of interventions as the child passes through different developmental stages.

Obesity and Overweight Among Brazilian Early Adolescents: Variability Across Region, Socioeconomic Status, and Gender.

PubMed

Fradkin, Chris; Valentini, Nadia C; Nobre, Glauber C; Dos Santos, João O L

2018-01-01

As with most emerging nations, Brazil lacks up-to-date data on the prevalence of obesity and overweight among its children. Of particular concern is the lack of data on children in early adolescence, considered by many to be the crucial stage for weight-related healthcare. To assess regional, socioeconomic, and gender differences in the prevalence of obesity and overweight among Brazilian early adolescents. A cross-sectional study was conducted on a racially diverse sample of students aged 10-13 years, from schools in three geographic regions (north, northeast, south) ( N  = 1,738). Data on gender, age, race, socioeconomic status (SES), weight, and height were obtained. Weight class was calculated from age- and gender-adjusted body mass index, based on children's weight and height. Bivariate and multivariable analyses, with post hoc tests, were conducted to estimate differences between groups and were corrected for multiple comparisons. Procedures were approved by institutional review boards at study sites. Analyses revealed a higher prevalence of obesity and/or overweight among: (1) children of higher SES; (2) children in southern Brazil; (3) males; and (4) Black females. The most salient predictor of weight risk among Brazilian early adolescents is higher SES. This finding is consistent with previous findings of an inverse social gradient, in weight risk, among emerging-nation population groups.

Movement Skills of Younger versus Older Adults with and without Down Syndrome

ERIC Educational Resources Information Center

Carmeli, Eli; Ariav, Claudette; Bar-Yossef, Tamar; Levy, Ran; Imam, Bita

2012-01-01

Adults with Down syndrome (DS) are often physically inactive, which may accelerate the onset of disease and aging symptoms. Eight older persons with DS (aged 54-61), and 10 younger persons with DS (aged 26-35) living in a residential care center were examined. Eighteen age- and gender-matched individuals without DS served as control groups.…

A human immunodeficiency virus risk reduction intervention for incarcerated youth: a randomized controlled trial.

PubMed

Goldberg, Eudice; Millson, Peggy; Rivers, Stephen; Manning, Stephanie Jeanneret; Leslie, Karen; Read, Stanley; Shipley, Caitlin; Victor, J Charles

2009-02-01

To evaluate, by gender, the impact of a structured, comprehensive risk reduction intervention with and without boosters on human immunodeficiency virus (HIV) knowledge, attitudes and behaviors in incarcerated youth; and to determine predictors of increasing HIV knowledge and reducing high-risk attitudes and behaviors. This randomized controlled trial involved participants completing structured interviews at 1, 3, and 6 months. Repeated measures analysis of variance was used to analyze changes over time. The study was conducted in secure custody facilities and in the community. The study sample comprising 391 incarcerated youth, 102 female and 289 male aged 12-18, formed the voluntary sample. Participants were randomly assigned to one of three conditions: education intervention; education intervention with booster; or no systematic intervention. The outcome and predictor measures included the Rosenberg Self-Esteem Scale, Youth Self Report, Drug Use Inventory, and HIV Knowledge, Attitudes and Behavior Scale. The 6-month retention rate was 59.6%. At 6 months, males in the education and booster groups sustained increases in knowledge scores (p < 0.001). Females in these groups sustained increased condom attitude scores (p = 0.004). Males in the booster group sustained increased prevention attitude scores (p = 0.017). Females in the booster group reported more consistent condom use (odds ratio [OR] = 4.20; 95% confidence interval [CI] = 1.81, 9.77). Age, gender, drug use, and psychological profiles were predictive of outcome. The intervention and boosters led to gender-specific improvements in knowledge, attitudes, and condom use. Result variations by gender underline the importance of gender issues in prevention interventions. Predictors of success were identified to inform future HIV education interventions.

Survival of gastrointestinal stromal tumor patients in the imatinib era: life raft group observational registry

PubMed Central

2012-01-01

Background Gastrointestinal stromal tumors (GIST), one of the most common mesenchymal tumors of the gastrointestinal tract, prior to routine immunohistochemical staining and the introduction of tyrosine kinase inhibitors, were often mistaken for neoplasms of smooth muscle origin such as leiomyomas, leiomyosarcomas or leiomyoblastomas. Since the advent of imatinib, GIST has been further delineated into adult- (KIT or PDGFRα mutations) and pediatric- (typified by wild-type GIST/succinate dehydrogenase deficiencies) types. Using varying gender ratios at age of diagnosis we sought to elucidate prognostic factors for each sub-type and their impact on overall survival. Methods This is a long-term retrospective analysis of a large observational study of an international open cohort of patients from a GIST research and patient advocacy's lifetime registry. Demographic and disease-specific data were voluntarily supplied by its members from May 2000-October 2010; the primary outcome was overall survival. Associations between survival and prognostic factors were evaluated by univariate Cox proportional hazard analyses, with backward selection at P < 0.05 used to identify independent factors. Results Inflections in gender ratios by age at diagnosis in years delineated two distinct groups: above and below age 35 at diagnosis. Closer analysis confirmed the above 35 age group as previously reported for adult-type GIST, typified by mixed primary tumor sites and gender, KIT or PDGFRα mutations, and shorter survival times. The pediatric group (< age 18 at diagnosis) was also as previously reported with predominantly stomach tumors, females, wild-type GIST or SDH mutations, and extended survival. "Young adults" however formed a third group aged 18-35 at diagnosis, and were a clear mix of these two previously reported distinct sub-types. Conclusions Pediatric- and adult-type GIST have been previously characterized in clinical settings and these observations confirm significant prognostic factors for each from a diverse real-world cohort. Additionally, these findings suggest that extra diligence be taken with "young adults" (aged 18-35 at diagnosis) as pediatric-type GIST may present well beyond adolescence, particularly as these distinct sub-types have different causes, and consequently respond differently to treatments. PMID:22429770

Survival of gastrointestinal stromal tumor patients in the imatinib era: life raft group observational registry.

PubMed

Call, Jerry; Walentas, Christopher D; Eickhoff, Jens C; Scherzer, Norman

2012-03-19

Gastrointestinal stromal tumors (GIST), one of the most common mesenchymal tumors of the gastrointestinal tract, prior to routine immunohistochemical staining and the introduction of tyrosine kinase inhibitors, were often mistaken for neoplasms of smooth muscle origin such as leiomyomas, leiomyosarcomas or leiomyoblastomas. Since the advent of imatinib, GIST has been further delineated into adult- (KIT or PDGFRα mutations) and pediatric- (typified by wild-type GIST/succinate dehydrogenase deficiencies) types. Using varying gender ratios at age of diagnosis we sought to elucidate prognostic factors for each sub-type and their impact on overall survival. This is a long-term retrospective analysis of a large observational study of an international open cohort of patients from a GIST research and patient advocacy's lifetime registry. Demographic and disease-specific data were voluntarily supplied by its members from May 2000-October 2010; the primary outcome was overall survival. Associations between survival and prognostic factors were evaluated by univariate Cox proportional hazard analyses, with backward selection at P < 0.05 used to identify independent factors. Inflections in gender ratios by age at diagnosis in years delineated two distinct groups: above and below age 35 at diagnosis. Closer analysis confirmed the above 35 age group as previously reported for adult-type GIST, typified by mixed primary tumor sites and gender, KIT or PDGFRα mutations, and shorter survival times. The pediatric group (< age 18 at diagnosis) was also as previously reported with predominantly stomach tumors, females, wild-type GIST or SDH mutations, and extended survival. "Young adults" however formed a third group aged 18-35 at diagnosis, and were a clear mix of these two previously reported distinct sub-types. Pediatric- and adult-type GIST have been previously characterized in clinical settings and these observations confirm significant prognostic factors for each from a diverse real-world cohort. Additionally, these findings suggest that extra diligence be taken with "young adults" (aged 18-35 at diagnosis) as pediatric-type GIST may present well beyond adolescence, particularly as these distinct sub-types have different causes, and consequently respond differently to treatments.

Dissecting the voice: Health professions students' perceptions of instructor age and gender in an online environment and the impact on evaluations for faculty.

PubMed

Doubleday, Alison F; Lee, Lisa M J

2016-11-01

Gender and age bias is well-documented in academia with many studies demonstrating bias in students' evaluations of instructors. Failure of an instructor to meet gender or age-based expectations can translate to lower scores or negative comments on evaluations. While there is some evidence of bias in students' evaluations of online instructors, current studies have not fully examined the relationship between bias and instructor vocal characteristics. First-year dental students at two institutions were randomly assigned one of four videos on spinal cord anatomy to view. Videos contained identical content but were narrated by individuals of different gender and age (younger man, younger woman, older man, older woman). Students completed a content-based prequiz, watched the video, completed a postquiz, and answered a questionnaire evaluating the video and instructor. Students at Institution A rated the younger man and younger woman highest for nearly every evaluation category. At Institution B students rated the older man and younger woman highest. Results reveal that the older woman's voice received the lowest rankings for nearly every question in both samples. This report confirms the presence of gender and age bias in student evaluations of instructors in an online environment and demonstrates that bias may surface in response to vocal characteristics. Bias may impact older women more significantly than other groups. Differences in results from Institution A and Institution B suggest that factors affecting student perceptions of instructors, and the roles that gender and age bias may play in student evaluations, are complex and may be contextual. Anat Sci Educ 9: 537-544. © 2016 American Association of Anatomists. © 2016 American Association of Anatomists.

Gender Differences in Psychotic Disorders with Concurrent Substance Use

PubMed Central

Caton, Carol L.M.; Xie, Haiyi; Drake, Robert E.; McHugo, Gregory

2015-01-01

Objective We conducted a comparative analysis of gender differences in patients with primary psychotic disorders with concurrent substance use and in those with substance-induced psychoses. Methods A total of 385 individuals admitted to psychiatric emergency departments with early onset psychosis and recent substance use were interviewed at baseline and at 6-month intervals for two years. Using a standardized research diagnostic assessment instrument, we classified patients at baseline into primary and substance-induced psychosis groups and analyzed the effects of gender on demographic, family, and clinical characteristics at baseline, the interaction of gender and diagnosis, and gender main effects on illness course, adjustment, and service use over the two-year follow-up period. Results Women had better premorbid adjustment, less misattribution of symptoms, and a later age of onset of regular drug use compared to men. Women, however, showed greater depression and histories of abuse compared to men. Men had greater arrest histories. No interactions between gender and diagnosis were significant. Both genders in the primary and substance-induced psychosis groups showed clinical and functional improvement over the follow-up period despite the overall minimal use of mental health and substance abuse treatment services. Conclusions Women and men with psychosis and substance use differ on several dimensions. Our findings suggest the need for gender-specific treatment programming across both diagnostic groups. PMID:25391275

Suicide rate differences by sex, age, and urbanicity, and related regional factors in Korea.

PubMed

Cheong, Kyu-Seok; Choi, Min-Hyeok; Cho, Byung-Mann; Yoon, Tae-Ho; Kim, Chang-Hun; Kim, Yu-Mi; Hwang, In-Kyung

2012-03-01

Identify the characteristics related to the suicide rates in rural and urban areas of Korea and discover the factors that influence the suicide rate of the rural and urban areas. Using the data on causes of death from 2006 to 2008, the suicide rates were calculated and compared after age-standardization based on gender, age group and urbanicity. And, in order to understand the factors that influence suicide rate, total 10 local characteristics in four domains--public service, social integration, residential environment, and economic status--were selected for multiple regression analysis. The suicide rates were higher in men than women, in rural areas than urban, and in older people than the younger. Generally, although there were variations according to age group and urbanicity, suicide rates were significantly related to residential environment and regional economic status but not related to regional welfare spending and social integration. In addition, the population over the age of 65 years, only regional economic status has significantly influence on their suicide rates. The influence of characteristics of regions on suicide rate is various by age-group, gender, and urbanicity. Therefore, in order to lower suicide rate and reduce the gap between regions, various approaches must be adopted by taking into account the socioeconomic characteristics of the regions.

Suicide Rate Differences by Sex, Age, and Urbanicity, and Related Regional Factors in Korea

PubMed Central

Cheong, Kyu-Seok; Choi, Min-Hyeok; Cho, Byung-Mann; Yoon, Tae-Ho; Kim, Chang-Hun; Kim, Yu-Mi

2012-01-01

Objectives Identify the characteristics related to the suicide rates in rural and urban areas of Korea and discover the factors that influence the suicide rate of the rural and urban areas. Methods Using the data on causes of death from 2006 to 2008, the suicide rates were calculated and compared after age-standardization based on gender, age group and urbanicity. And, in order to understand the factors that influence suicide rate, total 10 local characteristics in four domains - public service, social integration, residential environment, and economic status - were selected for multiple regression analysis. Results The suicide rates were higher in men than women, in rural areas than urban, and in older people than the younger. Generally, although there were variations according to age group and urbanicity, suicide rates were significantly related to residential environment and regional economic status but not related to regional welfare spending and social integration. In addition, the population over the age of 65 years, only regional economic status has significantly influence on their suicide rates. Conclusions The influence of characteristics of regions on suicide rate is various by age-group, gender, and urbanicity. Therefore, in order to lower suicide rate and reduce the gap between regions, various approaches must be adopted by taking into account the socioeconomic characteristics of the regions. PMID:22509447

Labour Market Segregation and Gender Differences in Sickness Absence: Trends in 2005-2013 in Finland.

PubMed

Leinonen, Taina; Viikari-Juntura, Eira; Husgafvel-Pursiainen, Kirsti; Virta, Lauri J; Laaksonen, Mikko; Autti-Rämö, Ilona; Solovieva, Svetlana

2018-04-18

Women have higher sickness absence rate than men, but less is known of changes in this difference over time. We examined gender differences in sickness absence trends focusing on gender segregation in the labour market. We used large nationwide register data on Finnish wage earners aged 25-59 and generalized estimation equations based on repeated logistic regression to estimate the annual risk of sickness absence lasting at least 2 weeks. Between 2005 and 2013, the age-adjusted proportion (%) of employees with all-cause sickness absence decreased from the initial levels of 10.6 among men and 15.1 among women by 16.7 and 13.6%, respectively. Among both genders, the largest decrease in sickness absence coincided with the peak of the economic recession in 2009. In sickness absence due to all causes and musculoskeletal diseases, also the excess decrease among men mainly occurred in 2009, and in sickness absence due to mental disorders 2 years later. In sickness absence due to all causes and musculoskeletal diseases, the increasing gender difference was mainly attributable to a larger decrease in sickness absence at the time of the recession in male-dominated groups, such as in manual and manufacturing work, than in other sectors and occupational classes. In mental disorders, the increasing gender difference was partly attributable to a later smaller decrease in sickness absence among female-dominated lower non-manual and lower income employment groups. The increasing gender differences did not result from differential distributional changes in employment or sociodemographic factors among the employed male and female populations. In fact, widening of the gender gap in sickness absence due to all causes and musculoskeletal diseases would have been even larger without faster increase among women in the educational level and in non-manual employment. Sickness absence decreased especially in male-dominated employment groups, resulting in a larger decrease in absences among men compared with women. More research is needed to ascertain whether these differential changes are attributable, for example, to reduced willingness to seek medical advice or increased presenteeism in male-dominated groups, or to increased work pressures in female-dominated groups. Selection mechanisms, i.e. men's increased ill-health-related exit from work through other routes than sickness absence, also cannot be ruled out.