Sample records for agonist cpg critically

  1. HIV Gag protein conjugated to a Toll-like receptor 7/8 agonist improves the magnitude and quality of Th1 and CD8+ T cell responses in nonhuman primates

    NASA Astrophysics Data System (ADS)

    Wille-Reece, Ulrike; Flynn, Barbara J.; Loré, Karin; Koup, Richard A.; Kedl, Ross M.; Mattapallil, Joseph J.; Weiss, Walter R.; Roederer, Mario; Seder, Robert A.

    2005-10-01

    Induction and maintenance of antibody and T cell responses will be critical for developing a successful vaccine against HIV. A rational approach for generating such responses is to design vaccines or adjuvants that have the capacity to activate specific antigen-presenting cells. In this regard, dendritic cells (DCs) are the most potent antigen-presenting cells for generating primary T cell responses. Here, we report that Toll-like receptor (TLR) agonists and ligands that activate DCs in vitro influence the magnitude and quality of the cellular immune response in nonhuman primates (NHPs) when administered with HIV Gag protein. NHPs immunized with HIV Gag protein and a TLR7/8 agonist or a TLR9 ligand [CpG oligodeoxynucleotides (CpG ODN)] had significantly increased Gag-specific T helper 1 and antibody responses, compared with animals immunized with HIV Gag protein alone. Importantly, conjugating the HIV Gag protein to the TLR7/8 agonist (Gag-TLR7/8 conjugate) dramatically enhanced the magnitude and altered the quality of the T helper 1 response, compared with animals immunized with HIV Gag protein and the TLR7/8 agonist or CpG ODN. Furthermore, immunization with the Gag-TLR7/8 conjugate vaccine elicited Gag-specific CD8+ T responses. Collectively, our results show that conjugating HIV Gag protein to a TLR7/8 agonist is an effective way to elicit broad-based adaptive immunity in NHPs. This type of vaccine formulation should have utility in preventive or therapeutic vaccines in which humoral and cellular immunity is required. vaccine | dendritic cell | cross-presentation | cellular immunity

  2. Co-delivery of Dual Toll-Like Receptor Agonists and Antigen in Poly(Lactic-Co-Glycolic) Acid/Polyethylenimine Cationic Hybrid Nanoparticles Promote Efficient In Vivo Immune Responses.

    PubMed

    Ebrahimian, Mahboubeh; Hashemi, Maryam; Maleki, Mohsen; Hashemitabar, Gholamreza; Abnous, Khalil; Ramezani, Mohammad; Haghparast, Alireza

    2017-01-01

    Strategies to design delivery vehicles are critical in modern vaccine-adjuvant development. Nanoparticles (NPs) encapsulating antigen(s) and adjuvant(s) are promising vehicles to deliver antigen(s) and adjuvant(s) to antigen-presenting cells (APCs), allowing optimal immune responses against a specific pathogen. In this study, we developed a novel adjuvant delivery approach for induction of efficient in vivo immune responses. Polyethylenimine (PEI) was physically conjugated to poly(lactic-co-glycolic) acid (PLGA) to form PLGA/PEI NPs. This complex was encapsulated with resiquimod (R848) as toll-like receptor (TLR) 7/8 agonist, or monophosphoryl lipid A (MPLA) as TLR4 agonist and co-assembled with cytosine-phosphorothioate-guanine oligodeoxynucleotide (CpG ODN) as TLR9 agonist to form a tripartite formulation [two TLR agonists (inside and outside NPs) and PLGA/PEI NPs as delivery system]. The physicochemical characteristics, cytotoxicity and cellular uptake of these synthesized delivery vehicles were investigated. Cellular viability test revealed no pronounced cytotoxicity as well as increased cellular uptake compared to control groups in murine macrophage cells (J774 cell line). In the next step, PLGA (MPLA or R848)/PEI (CpG ODN) were co-delivered with ovalbumin (OVA) encapsulated into PLGA NPs to enhance the induction of immune responses. The immunogenicity properties of these co-delivery formulations were examined in vivo by evaluating the cytokine (IFN-γ, IL-4, and IL-1β) secretion and antibody (IgG1, IgG2a) production. Robust and efficient immune responses were achieved after in vivo administration of PLGA (MPLA or R848)/PEI (CpG ODN) co-delivered with OVA encapsulated in PLGA NPs in BALB/c mice. Our results demonstrate a rational design of using dual TLR agonists in a context-dependent manner for efficient nanoparticulate adjuvant-vaccine development.

  3. CpG in Combination with an Inhibitor of Notch Signaling Suppresses Formalin-Inactivated Respiratory Syncytial Virus-Enhanced Airway Hyperresponsiveness and Inflammation by Inhibiting Th17 Memory Responses and Promoting Tissue-Resident Memory Cells in Lungs.

    PubMed

    Zhang, Lei; Li, Hongyong; Hai, Yan; Yin, Wei; Li, Wenjian; Zheng, Boyang; Du, Xiaomin; Li, Na; Zhang, Zhengzheng; Deng, Yuqing; Zeng, Ruihong; Wei, Lin

    2017-05-15

    Respiratory syncytial virus (RSV) is the leading cause of childhood hospitalizations. The formalin-inactivated RSV (FI-RSV) vaccine-enhanced respiratory disease (ERD) has been an obstacle to the development of a safe and effective killed RSV vaccine. Agonists of Toll-like receptor (TLR) have been shown to regulate immune responses induced by FI-RSV. Notch signaling plays critical roles during the differentiation and effector function phases of innate and adaptive immune responses. Cross talk between TLR and Notch signaling pathways results in fine-tuning of TLR-triggered innate inflammatory responses. We evaluated the impact of TLR and Notch signaling on ERD in a murine model by administering CpG, an agonist of TLR9, in combination with L685,458, an inhibitor of Notch signaling during FI-RSV immunization. Activation with CpG or deficiency of MyD88-dependent TLR signaling did not alleviate airway inflammation in FI-RSV-immunized mice. Activation or inhibition of Notch signaling with Dll4, one of the Notch ligands, or L685,458 did not suppress FI-RSV-enhanced airway inflammation either. However, the CpG together with L685,458 markedly inhibited FI-RSV-enhanced airway hyperresponsiveness, weight loss, and lung inflammation. Interestingly, CpG plus L685,458 completely inhibited FI-RSV-associated Th17 and Th17-associated proinflammatory chemokine responses in lungs following RSV challenge but not Th1 or Th2, memory responses. In addition, FI-RSV plus CpG plus L685,458 promoted protective CD8 + lung tissue-resident memory (TRM) cells. These results indicate that activation of TLR signaling combined with inhibition of Notch signaling prevent FI-RSV ERD, and the mechanism appears to involve suppressing proinflammatory Th17 memory responses and promoting protective TRM in lungs. IMPORTANCE RSV is the most important cause of lower respiratory tract infections in infants. The FI-RSV-enhanced respiratory disease (ERD) is a major impediment to the development of a safe and effective killed RSV vaccine. Using adjuvants to regulate innate and adaptive immune responses could be an effective method to prevent ERD. We evaluated the impact of TLR and Notch signaling on ERD by administering CpG, an agonist of TLR9, in combination with L685,458, an inhibitor of Notch signaling, during FI-RSV immunization. The data showed that treatment of TLR or Notch signaling alone did not suppress FI-RSV-enhanced airway inflammation, while CpG plus L685,458 markedly inhibited ERD. The mechanism appears to involve suppressing Th17 memory responses and promoting tissue-resident memory cells. Moreover, these results suggest that regulation of lung immune memory with adjuvant compounds containing more than one immune-stimulatory molecule may be a good strategy to prevent FI-RSV ERD. Copyright © 2017 American Society for Microbiology.

  4. CpG in Combination with an Inhibitor of Notch Signaling Suppresses Formalin-Inactivated Respiratory Syncytial Virus-Enhanced Airway Hyperresponsiveness and Inflammation by Inhibiting Th17 Memory Responses and Promoting Tissue-Resident Memory Cells in Lungs

    PubMed Central

    Zhang, Lei; Li, Hongyong; Hai, Yan; Yin, Wei; Li, Wenjian; Zheng, Boyang; Du, Xiaomin; Li, Na; Zhang, Zhengzheng; Deng, Yuqing

    2017-01-01

    ABSTRACT Respiratory syncytial virus (RSV) is the leading cause of childhood hospitalizations. The formalin-inactivated RSV (FI-RSV) vaccine-enhanced respiratory disease (ERD) has been an obstacle to the development of a safe and effective killed RSV vaccine. Agonists of Toll-like receptor (TLR) have been shown to regulate immune responses induced by FI-RSV. Notch signaling plays critical roles during the differentiation and effector function phases of innate and adaptive immune responses. Cross talk between TLR and Notch signaling pathways results in fine-tuning of TLR-triggered innate inflammatory responses. We evaluated the impact of TLR and Notch signaling on ERD in a murine model by administering CpG, an agonist of TLR9, in combination with L685,458, an inhibitor of Notch signaling during FI-RSV immunization. Activation with CpG or deficiency of MyD88-dependent TLR signaling did not alleviate airway inflammation in FI-RSV-immunized mice. Activation or inhibition of Notch signaling with Dll4, one of the Notch ligands, or L685,458 did not suppress FI-RSV-enhanced airway inflammation either. However, the CpG together with L685,458 markedly inhibited FI-RSV-enhanced airway hyperresponsiveness, weight loss, and lung inflammation. Interestingly, CpG plus L685,458 completely inhibited FI-RSV-associated Th17 and Th17-associated proinflammatory chemokine responses in lungs following RSV challenge but not Th1 or Th2, memory responses. In addition, FI-RSV plus CpG plus L685,458 promoted protective CD8+ lung tissue-resident memory (TRM) cells. These results indicate that activation of TLR signaling combined with inhibition of Notch signaling prevent FI-RSV ERD, and the mechanism appears to involve suppressing proinflammatory Th17 memory responses and promoting protective TRM in lungs. IMPORTANCE RSV is the most important cause of lower respiratory tract infections in infants. The FI-RSV-enhanced respiratory disease (ERD) is a major impediment to the development of a safe and effective killed RSV vaccine. Using adjuvants to regulate innate and adaptive immune responses could be an effective method to prevent ERD. We evaluated the impact of TLR and Notch signaling on ERD by administering CpG, an agonist of TLR9, in combination with L685,458, an inhibitor of Notch signaling, during FI-RSV immunization. The data showed that treatment of TLR or Notch signaling alone did not suppress FI-RSV-enhanced airway inflammation, while CpG plus L685,458 markedly inhibited ERD. The mechanism appears to involve suppressing Th17 memory responses and promoting tissue-resident memory cells. Moreover, these results suggest that regulation of lung immune memory with adjuvant compounds containing more than one immune-stimulatory molecule may be a good strategy to prevent FI-RSV ERD. PMID:28275186

  5. Toll-like receptor 9 agonist enhances anti-tumor immunity and inhibits tumor-associated immunosuppressive cells numbers in a mouse cervical cancer model following recombinant lipoprotein therapy.

    PubMed

    Chang, Li-Sheng; Leng, Chih-Hsiang; Yeh, Yi-Chen; Wu, Chiao-Chieh; Chen, Hsin-Wei; Huang, Hai-Mei; Liu, Shih-Jen

    2014-03-19

    Although cytotoxic T lymphocytes (CTLs) play a major role in eradicating cancer cells during immunotherapy, the cancer-associated immunosuppressive microenvironment often limits the success of such therapies. Therefore, the simultaneous induction of cancer-specific CTLs and reversal of the immunosuppressive tumor microenvironment may be more effectively achieved through a single therapeutic vaccine. A recombinant lipoprotein with intrinsic Toll-like receptor 2 (TLR2) agonist activity containing a mutant form of E7 (E7m) and a bacterial lipid moiety (rlipo-E7m) has been demonstrated to induce robust CTL responses against small tumors. This treatment in combination with other TLR agonists is able to eliminate large tumors. Mouse bone marrow-derived dendritic cells (DCs) were employed to determine the synergistic production of pro-inflammatory cytokines upon combination of rlipo-E7m and other TLR agonists. Antigen-specific CTL responses were investigated using immunospots or in vivo cytolytic assays after immunization in mice. Mice bearing various tumor sizes were used to evaluate the anti-tumor effects of the formulation. Specific subpopulations of immunosuppressive cells in the tumor infiltrate were quantitatively determined by flow cytometry. We demonstrate that a TLR9 agonist (unmethylated CpG oligodeoxynucleotide, CpG ODN) enhances CTL responses and eradicates large tumors when combined with rlipo-E7m. Moreover, combined treatment with rlipo-E7m and CpG ODN effectively increases tumor infiltration by CTLs and reduces the numbers of myeloid-derived suppressor cells (MDSCs), tumor-associated macrophages (TAMs) and regulatory T cells (Tregs) in the tumor microenvironment. These findings suggest that the dramatic anti-tumor effects of the recombinant lipoprotein together with CpG ODN may reflect the amplification of CTL responses and the repression of the immunosuppressive environment. This promising approach could be applied for the development of additional therapeutic cancer vaccines.

  6. Dual activation of Toll-like receptors 7 and 9 impairs the efficacy of antitumor vaccines in murine models of metastatic breast cancer.

    PubMed

    Moreno Ayala, Mariela A; Gottardo, María Florencia; Gori, María Soledad; Nicola Candia, Alejandro Javier; Caruso, Carla; De Laurentiis, Andrea; Imsen, Mercedes; Klein, Slobodanka; Bal de Kier Joffé, Elisa; Salamone, Gabriela; Castro, Maria G; Seilicovich, Adriana; Candolfi, Marianela

    2017-09-01

    Since combination of Toll-like receptor (TLR) ligands could boost antitumor immunity, we evaluated the efficacy of dendritic cell (DC) vaccines upon dual activation of TLR9 and TLR7 in breast cancer models. DCs were generated from mouse bone marrow or peripheral blood from healthy human donors and stimulated with CpG1826 (mouse TLR9 agonist), CpG2006 or IMT504 (human TLR9 agonists) and R848 (TLR7 agonist). Efficacy of antitumor vaccines was evaluated in BALB/c mice bearing metastatic mammary adenocarcinomas. CpG-DCs improved the survival of tumor-bearing mice, reduced the development of lung metastases and generated immunological memory. However, dual activation of TLRs impaired the efficacy of DC vaccines. In vitro, we found that R848 inhibited CpG-mediated maturation of murine DCs. A positive feedback loop in TLR9 mRNA expression was observed upon CpG stimulation that was inhibited in the presence of R848. Impaired activation of NF-κB was detected when TLR9 and TLR7 were simultaneously activated. Blockade of nitric oxide synthase (NOS) and indoleamine-pyrrole-2,3-dioxygenase (IDO) improved the activation of CpG-DCs. When we evaluated the effect of combined activation of TLR9 and TLR7 in human DCs, we found that R848 induced robust DC activation that was inhibited by TLR9 agonists. These observations provide insight in the biology of TLR9 and TLR7 crosstalk and suggest caution in the selection of agonists for multiple TLR stimulation. Blockade of NOS and IDO could improve the maturation of antitumor DC vaccines. R848 could prove a useful adjuvant for DC vaccines in human patients.

  7. CpG DNA in the prevention and treatment of infections.

    PubMed

    Dalpke, Alexander; Zimmermann, Stefan; Heeg, Klaus

    2002-01-01

    Microbial infection is sensed by Toll-like receptors (TLRs) on innate immune cells. Among the ten so far defined TLRs, TLR9 and its ligand are peculiar. TLR9 recognises bacterial DNA characterised by the abundance of unmethylated CpG dinucleotides, which distinguish bacterial DNA (CpG DNA) from mammalian DNA. Moreover, TLR9 shows a restricted cellular and subcellular pattern of expression. In contrast to other TLR agonists, CpG DNA is superior in activation of dendritic dells and induction of costimulatory cytokines such as interleukin (IL)-12 and IL-18. This qualifies CpG DNA as a Th1-promoting adjuvant. During infection, recognition of CpG DNA of intracellular pathogens skews and fine-tunes the ongoing immune response and induces long-lasting Th1 milieus. Thus, CpG DNA might play an important role in driving the immune system to a Th1 profile, preventing undesired Th2 milieus that might favour induction of allergic responses. Since CpG DNA can be synthesised with high purity and sequence fidelity, synthetic CpG DNA will become an important agent for Th1 instruction and be an effective adjuvant during vaccination.

  8. CpG oligodeoxynucleotide nanomedicines for the prophylaxis or treatment of cancers, infectious diseases, and allergies.

    PubMed

    Hanagata, Nobutaka

    2017-01-01

    Unmethylated cytosine-guanine dinucleotide-containing oligodeoxynucleotides (CpG ODNs), which are synthetic agonists of Toll-like receptor 9 (TLR9), activate humoral and cellular immunity and are being developed as vaccine adjuvants to prevent or treat cancers, infectious diseases, and allergies. Free CpG ODNs have been used in many clinical trials implemented to verify their effects. However, recent research has reported that self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes demonstrate higher adjuvant effects than free CpG ODNs, owing to their improved uptake efficiency into cells expressing TLR9. Moreover, protein/peptide-CpG ODN conjugates and nanomaterial-CpG ODN complexes are able to deliver CpG ODNs and antigens (or allergens) to the same types of cells, which enables a higher degree of prophylaxis or therapeutic effect. In this review, the author describes recent trends in the research and development of CpG ODN nanomedicines containing self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes, focusing mainly on the results of preclinical and clinical studies.

  9. The type of adjuvant strongly influences the T-cell response during nanoparticle-based immunization

    PubMed Central

    Knuschke, Torben; Epple, Matthias; Westendorf, Astrid M

    2014-01-01

    Potent vaccines require the ability to effectively induce immune responses. Especially for the control of infectious diseases with intracellular pathogens, like viruses or bacteria, potent T-cell responses are indispensable. Several delivery systems such as nanoparticles have been considered to boost the immunogenicity of pathogen derived peptides or subunits for the induction of potent T-cell responses. Since they can be further functionalized with immunostimulants, like Toll-like receptor (TLR) agonists, they improve the response by enhanced activation of the innate immune system. Currently, TLR agonists like unmethylated CpG oligonucleotides and the synthetic dsRNA derivate polyriboinosinic acid-polyribocytidylic acid (poly[I:C]) are widely used as vaccine adjuvants. CpG and poly(I:C) trigger different TLRs and therefore show differential signal transduction. Recently, we established biodegradable calcium phosphate (CaP) nanoparticles as potent T cell inducing vaccination vehicles. In this commentary we discuss the role of CpG and poly(I:C) for the effective induction of virus-specific T cells during immunization with CaP nanoparticles. The presented results underline the importance of the right formulation of vaccines for specific immunization purpose. PMID:23982325

  10. Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination.

    PubMed

    Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye; Kang, Sang-Moo

    2017-10-01

    Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination.

  11. The effect of TLR9 agonist CpG oligodeoxynucleotides on the intestinal immune response of cobia (Rachycentron canadum).

    PubMed

    Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

    2014-01-01

    Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1 β . Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1 β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia.

  12. The Effect of TLR9 Agonist CpG Oligodeoxynucleotides on the Intestinal Immune Response of Cobia (Rachycentron canadum)

    PubMed Central

    Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

    2014-01-01

    Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1β. Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia. PMID:24991578

  13. A crucial role for plasmacytoid dendritic cells in antiviral protection by CpG ODN–based vaginal microbicide

    PubMed Central

    Shen, Hong; Iwasaki, Akiko

    2006-01-01

    Topical microbicides represent a promising new approach to preventing HIV and other sexually transmitted infections. TLR agonists are ideal candidates for microbicides, as they trigger a multitude of antiviral genes effective against a broad range of viruses. Although vaginal application of CpG oligodeoxynucleotides (ODNs) and poly I:C has been shown to protect mice from genital herpes infection, the mechanism by which these agents provide protection remains unclear. Here, we show that plasmacytoid DCs (pDCs) are required for CpG ODN–mediated protection against lethal vaginal challenge with herpes simplex virus type 2 (HSV-2). Moreover, we demonstrate that cells of both the hematopoietic and stromal compartments must respond to CpG ODN via TLR9 and to type I IFNs through IFN-αβ receptor (IFN-αβR) for protection. Thus, crosstalk between pDCs and vaginal stromal cells provides for optimal microbicide efficacy. Our results imply that temporally and spatially controlled targeting of CpG ODN to pDCs and epithelial cells can potentially maximize their effectiveness as microbicides while minimizing the associated inflammatory responses. PMID:16878177

  14. Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination

    PubMed Central

    Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye

    2017-01-01

    Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination. PMID:29093654

  15. Poly(U) and CpG ameliorate the unbalanced T cell immunity and pneumonia of mice with RSV vaccine-enhanced disease.

    PubMed

    Jia, Ran; Lu, Lu; Liang, Xiaozhen; Sun, Zhiwu; Tan, Lingbing; Xu, Menghua; Su, Liyun; Xu, Jin

    2017-09-12

    Respiratory Syncycial Virus (RSV) is the most important pathogen responsible for children's severe lower respiratory tract infection. So far no RSV vaccine has yet been authorized for clinical use. The main impediment that blocked development of RSV vaccine is that inactivated RSV vaccine could cause RSV vaccine-enhanced disease (RVED). The mechanism of RVED remains unclear. Recently some researchers found that insufficient activation of innate immunity, including Toll-like receptors (TLRs), might be associated with the onset of RVED. Based on the above findings, this research was conducted to further study the mechanism of RVED. We first vaccinated mice with formalin-inactivated RSV vaccine (FIRSV) and then exposed them to RSV to establish a RVED mouse model. Consequently, we found that mice previously inoculated with FIRSV showed obvious weight loss and extensive pneumonia, as well as T helper 2 cells (Th2)-biased immunity and suppressed CD8 + T cell immunity after viral exposure, suggesting that we have successfully established a RVED mouse model. Then based on this model, we further added Poly(U) (TLR7/8 agonist) and CpG (TLR9 agonist) in FIRSV to see if RVED could be ameliorated. As a result, mice inoculated with FIRSV supplemented with Poly(U) and CpG had a much relieved weight loss and pneumonia, as well as suppressed Th2-biased immunity and strengthened CD8 + T cell function. Thus, the insufficient stimulation of TLR7/8 and (or) TLR9 might play a role in the development of RVED, which could provide evidence for using TLR agonists as vaccine adjuvants to confer a protective immune response against RSV.

  16. The Composite of Bone Marrow Concentrate and PRP as an Alternative to Autologous Bone Grafting

    PubMed Central

    Hakimi, Mohssen; Grassmann, Jan-Peter; Betsch, Marcel; Schneppendahl, Johannes; Gehrmann, Sebastian; Hakimi, Ahmad-Reza; Kröpil, Patric; Sager, Martin; Herten, Monika; Wild, Michael; Windolf, Joachim; Jungbluth, Pascal

    2014-01-01

    One possible alternative to the application of autologous bone grafts represents the use of autologous bone marrow concentrate (BMC). The purpose of our study was to evaluate the potency of autologous platelet-rich plasma (PRP) in combination with BMC. In 32 mini-pigs a metaphyseal critical-size defect was surgically created at the proximal tibia. The animals were allocated to four treatment groups of eight animals each (1. BMC+CPG group, 2. BMC+CPG+PRP group, 3. autograft group, 4. CPG group). In the BMC+CPG group the defect was filled with autologous BMC in combination with calcium phosphate granules (CPG), whereas in the BMC+CPG+PRP group the defect was filled with the composite of autologous BMC, CPG and autologous PRP. In the autograft group the defect was filled with autologous cancellous graft, whereas in the CPG group the defect was filled with CPG solely. After 6 weeks radiological and histomorphometrical analysis showed significantly more new bone formation in the BMC+CPG+PRP group compared to the BMC+CPG group and the CPG group. There were no significant differences between the BMC+CPG+PRP group and the autograft group. In the PRP platelets were enriched significantly about 4.7-fold compared to native blood. In BMC the count of mononuclear cells increased significantly (3.5-fold) compared to the bone marrow aspirate. This study demonstrates that the composite of BMC+CPG+PRP leads to a significantly higher bone regeneration of critical-size defects at the proximal tibia in mini-pigs than the use of BMC+CPG without PRP. Furthermore, within the limits of the present study the composite BMC+CPG+PRP represents a comparable alternative to autologous bone grafting. PMID:24950251

  17. Reinforcement learning for a biped robot based on a CPG-actor-critic method.

    PubMed

    Nakamura, Yutaka; Mori, Takeshi; Sato, Masa-aki; Ishii, Shin

    2007-08-01

    Animals' rhythmic movements, such as locomotion, are considered to be controlled by neural circuits called central pattern generators (CPGs), which generate oscillatory signals. Motivated by this biological mechanism, studies have been conducted on the rhythmic movements controlled by CPG. As an autonomous learning framework for a CPG controller, we propose in this article a reinforcement learning method we call the "CPG-actor-critic" method. This method introduces a new architecture to the actor, and its training is roughly based on a stochastic policy gradient algorithm presented recently. We apply this method to an automatic acquisition problem of control for a biped robot. Computer simulations show that training of the CPG can be successfully performed by our method, thus allowing the biped robot to not only walk stably but also adapt to environmental changes.

  18. Topical CpG Adjuvantation of a Protein-Based Vaccine Induces Protective Immunity to Listeria monocytogenes

    PubMed Central

    Cheng, Wing Ki; Wee, Kathleen; Kollmann, Tobias R.

    2014-01-01

    Robust CD8+ T cell responses are essential for immune protection against intracellular pathogens. Using parenteral administration of ovalbumin (OVA) protein as a model antigen, the effect of the Toll-like receptor 9 (TLR9) agonist, CpG oligodeoxynucleotide (ODN) 1826, as an adjuvant delivered either topically, subcutaneously, or intramuscularly on antigen-specific CD8+ T cell responses in a mouse model was evaluated. Topical CpG adjuvant increased the frequency of OVA-specific CD8+ T cells in the peripheral blood and in the spleen. The more effective strategy to administer topical CpG adjuvant to enhance CD8+ T cell responses was single-dose administration at the time of antigen injection with a prime-boost regimen. Topical CpG adjuvant conferred both rapid and long-lasting protection against systemic challenge with recombinant Listeria monocytogenes expressing the cytotoxic T lymphocyte (CTL) epitope of OVA257–264 (strain Lm-OVA) in a TLR9-dependent manner. Topical CpG adjuvant induced a higher proportion of CD8+ effector memory T cells than parenteral administration of the adjuvant. Although traditional vaccination strategies involve coformulation of antigen and adjuvant, split administration using topical adjuvant is effective and has advantages of safety and flexibility. Split administration of topical CpG ODN 1826 with parenteral protein antigen is superior to other administration strategies in enhancing both acute and memory protective CD8+ T cell immune responses to subcutaneous protein vaccines. This vaccination strategy induces rapid and persistent protective immune responses against the intracellular organism L. monocytogenes. PMID:24391136

  19. Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages

    PubMed Central

    Shi, Yongyu; Felder, Mildred A.R.; Sondel, Paul M.; Rakhmilevich, Alexander L.

    2015-01-01

    Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy. PMID:25829245

  20. Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages.

    PubMed

    Shi, Yongyu; Felder, Mildred A R; Sondel, Paul M; Rakhmilevich, Alexander L

    2015-08-01

    Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. A physical model of sensorimotor interactions during locomotion

    NASA Astrophysics Data System (ADS)

    Klein, Theresa J.; Lewis, M. Anthony

    2012-08-01

    In this paper, we describe the development of a bipedal robot that models the neuromuscular architecture of human walking. The body is based on principles derived from human muscular architecture, using muscles on straps to mimic agonist/antagonist muscle action as well as bifunctional muscles. Load sensors in the straps model Golgi tendon organs. The neural architecture is a central pattern generator (CPG) composed of a half-center oscillator combined with phase-modulated reflexes that is simulated using a spiking neural network. We show that the interaction between the reflex system, body dynamics and CPG results in a walking cycle that is entrained to the dynamics of the system. We also show that the CPG helped stabilize the gait against perturbations relative to a purely reflexive system, and compared the joint trajectories to human walking data. This robot represents a complete physical, or ‘neurorobotic’, model of the system, demonstrating the usefulness of this type of robotics research for investigating the neurophysiological processes underlying walking in humans and animals.

  2. Marked enhancement of the immune response to BioThrax® (Anthrax Vaccine Adsorbed) by the TLR9 agonist CPG 7909 in healthy volunteers.

    PubMed

    Rynkiewicz, Dianna; Rathkopf, Melinda; Sim, Iain; Waytes, A Thomas; Hopkins, Robert J; Giri, Lallan; DeMuria, Deborah; Ransom, Janet; Quinn, James; Nabors, Gary S; Nielsen, Carl J

    2011-08-26

    Immunization with BioThrax(®) (Anthrax Vaccine Adsorbed) is a safe and effective means of preventing anthrax. Animal studies have demonstrated that the addition of CpG DNA adjuvants to BioThrax can markedly increase the immunogenicity of the vaccine, increasing both serum anti-protective antigen (PA) antibody and anthrax toxin-neutralizing antibody (TNA) concentrations. The immune response to CpG-adjuvanted BioThrax in animals was not only stronger, but was also more rapid and led to higher levels of protection in spore challenge models. The B-class CpG DNA adjuvant CPG 7909, a 24-base synthetic, single-strand oligodeoxynucleotide, was evaluated for its safety profile and adjuvant properties in a Phase 1 clinical trial. A double-blind study was performed in which 69 healthy subjects, age 18-45 years, were randomized to receive three doses of either: (1) BioThrax alone, (2) 1 mg of CPG 7909 alone or (3) BioThrax plus 1 mg of CPG 7909, all given intramuscularly on study days 0, 14 and 28. Subjects were monitored for IgG to PA by ELISA and for TNA titers through study day 56 and for safety through month 6. CPG 7909 increased the antibody response by 6-8-fold at peak, and accelerated the response by 3 weeks compared to the response seen in subjects vaccinated with BioThrax alone. No serious adverse events related to study agents were reported, and the combination was considered to be reasonably well tolerated. The marked acceleration and enhancement of the immune response seen by combining BioThrax and CPG 7909 offers the potential to shorten the course of immunization and reduce the time to protection, and may be particularly useful in the setting of post-exposure prophylaxis. Copyright © 2011 Elsevier Ltd. All rights reserved.

  3. Forging a potent vaccine adjuvant: CpG ODN/cationic peptide nanorings.

    PubMed

    Gungor, Bilgi; Yagci, Fuat Cem; Gursel, Ihsan; Gursel, Mayda

    Type I interferon inducers may potentially be engineered to function as antiviral and anticancer agents, or alternatively, vaccine adjuvants, all of which may have clinical applications. We recently described a simple strategy to convert a Toll-like receptor 9 (TLR9) agonist devoid of interferon α (IFNα) stimulating activity into a robust Type I interferon inducer with potent vaccine adjuvant activity.

  4. Beta-Glucan Activated Human B-Lymphocytes Participate in Innate Immune Responses by Releasing Pro-inflammatory Cytokines and Stimulating Neutrophil Chemotaxis

    PubMed Central

    Ali, Mohamed F.; Driscoll, Christopher B.; Walters, Paula R.; Limper, Andrew H.; Carmona, Eva M.

    2015-01-01

    B-lymphocytes play an essential regulatory role in the adaptive immune response through antibody production during infection. A less known function of B-lymphocytes is their ability to respond directly to infectious antigens through stimulation of pattern recognition receptors expressed on their surfaces. β-glucans are carbohydrates present in the cell wall of many pathogenic fungi that can be detected in the peripheral blood of patients during infection. They have been shown to participate in the innate inflammatory response as they can directly activate peripheral macrophages and dendritic cells. However, their effect as direct stimulators of B-lymphocytes has not been yet fully elucidated. The aim of this study was to examine the molecular mechanisms and cytokine profiles generated following β-glucan stimulation of B-lymphocytes, compared with the well-established TLR-9 agonist CpG-oligodeoxynucleotide (CpG) and study the participation of β-glucan stimulated B-cells in the innate immune response. Herein, we demonstrate that β-glucan activated B-lymphocytes upregulate pro-inflammatory cytokines (TNFα, IL-6 and IL-8). Interestingly, β-glucan, unlike CpG, had no effect on B-lymphocyte proliferation or IgM production. When compared with CpG (TLR9 agonist), β-glucan-activated cells secreted significantly higher levels of IL-8. Furthermore, IL-8 secretion was partially mediated by Dectin-1 and required SYK, MAPKs and the transcription factors NF-κB and AP-1. Moreover, we observed that conditioned media from β-glucan stimulated B-lymphocytes elicited neutrophil chemotaxis. These studies suggest that β-glucan activated B-lymphocytes have an important and novel role in fungal innate immune responses. PMID:26519534

  5. Humanoids Learning to Walk: A Natural CPG-Actor-Critic Architecture.

    PubMed

    Li, Cai; Lowe, Robert; Ziemke, Tom

    2013-01-01

    The identification of learning mechanisms for locomotion has been the subject of much research for some time but many challenges remain. Dynamic systems theory (DST) offers a novel approach to humanoid learning through environmental interaction. Reinforcement learning (RL) has offered a promising method to adaptively link the dynamic system to the environment it interacts with via a reward-based value system. In this paper, we propose a model that integrates the above perspectives and applies it to the case of a humanoid (NAO) robot learning to walk the ability of which emerges from its value-based interaction with the environment. In the model, a simplified central pattern generator (CPG) architecture inspired by neuroscientific research and DST is integrated with an actor-critic approach to RL (cpg-actor-critic). In the cpg-actor-critic architecture, least-square-temporal-difference based learning converges to the optimal solution quickly by using natural gradient learning and balancing exploration and exploitation. Futhermore, rather than using a traditional (designer-specified) reward it uses a dynamic value function as a stability indicator that adapts to the environment. The results obtained are analyzed using a novel DST-based embodied cognition approach. Learning to walk, from this perspective, is a process of integrating levels of sensorimotor activity and value.

  6. Humanoids Learning to Walk: A Natural CPG-Actor-Critic Architecture

    PubMed Central

    Li, Cai; Lowe, Robert; Ziemke, Tom

    2013-01-01

    The identification of learning mechanisms for locomotion has been the subject of much research for some time but many challenges remain. Dynamic systems theory (DST) offers a novel approach to humanoid learning through environmental interaction. Reinforcement learning (RL) has offered a promising method to adaptively link the dynamic system to the environment it interacts with via a reward-based value system. In this paper, we propose a model that integrates the above perspectives and applies it to the case of a humanoid (NAO) robot learning to walk the ability of which emerges from its value-based interaction with the environment. In the model, a simplified central pattern generator (CPG) architecture inspired by neuroscientific research and DST is integrated with an actor-critic approach to RL (cpg-actor-critic). In the cpg-actor-critic architecture, least-square-temporal-difference based learning converges to the optimal solution quickly by using natural gradient learning and balancing exploration and exploitation. Futhermore, rather than using a traditional (designer-specified) reward it uses a dynamic value function as a stability indicator that adapts to the environment. The results obtained are analyzed using a novel DST-based embodied cognition approach. Learning to walk, from this perspective, is a process of integrating levels of sensorimotor activity and value. PMID:23675345

  7. Extended Plasticity of Visual Cortex in Dark-Reared Animals May Result from Prolonged Expression of cpg15-Like Genes

    PubMed Central

    Lee, Wei-Chung Allen; Nedivi, Elly

    2011-01-01

    cpg15 is an activity-regulated gene that encodes a membrane-bound ligand that coordinately regulates growth of apposing dendritic and axonal arbors and the maturation of their synapses. These properties make it an attractive candidate for participating in plasticity of the mammalian visual system. Here we compare cpg15 expression during normal development of the rat visual system with that seen in response to dark rearing, monocular blockade of retinal action potentials, or monocular deprivation. Our results show that the onset of cpg15 expression in the visual cortex is coincident with eye opening, and it increases until the peak of the critical period at postnatal day 28 (P28). This early expression is independent of both retinal activity and visual experience. After P28, a component of cpg15 expression in the visual cortex, lateral geniculate nucleus (LGN), and superior colliculus (SC) develops a progressively stronger dependence on retinally driven action potentials. Dark rearing does not affect cpg15 mRNA expression in the LGN and SC at any age, but it does significantly affect its expression in the visual cortex from the peak of the critical period and into adulthood. In dark-reared rats, the peak level of cpg15 expression in the visual cortex at P28 is lower than in controls. Rather than showing the normal decline with maturation, these levels are maintained in dark-reared animals. We suggest that the prolonged plasticity in the visual cortex that is seen in dark-reared animals may result from failure to downregulate genes such as cpg15 that could promote structural remodeling and synaptic maturation. PMID:11880509

  8. TLR9-ERK-mTOR signaling is critical for autophagic cell death induced by CpG oligodeoxynucleotide 107 combined with irradiation in glioma cells

    PubMed Central

    Li, Xiaoli; Cen, Yanyan; Cai, Yongqing; Liu, Tao; Liu, Huan; Cao, Guanqun; Liu, Dan; Li, Bin; Peng, Wei; Zou, Jintao; Pang, Xueli; Zheng, Jiang; Zhou, Hong

    2016-01-01

    Synthetic oligodeoxynucleotides containing unmethylated CpG dinucleotides (CpG ODN) function as potential radiosensitizers for glioma treatment, although the underlying mechanism is unclear. It was observed that CpG ODN107, when combined with irradiation, did not induce apoptosis. Herein, the effect of CpG ODN107 + irradiation on autophagy and the related signaling pathways was investigated. In vitro, CpG ODN107 + irradiation induced autophagosome formation, increased the ratio of LC3 II/LC3 I, beclin 1 and decreased p62 expression in U87 cells. Meanwhile, CpG ODN107 also increased LC3 II/LC3 I expression in U251 and CHG-5 cells. In vivo, CpG ODN107 combined with local radiotherapy induced autophagosome formation in orthotopic transplantation tumor. Investigation of the molecular mechanisms demonstrated that CpG ODN107 + irradiation increased the levels of TLR9 and p-ERK, and decreased the level of p-mTOR in glioma cells. Further, TLR9-specific siRNA could affect the expressions of p-ERK and autophagy-related proteins in glioma cells. Taken together, CpG ODN107 combined with irradiation could induce autophagic cell death, and this effect was closely related to the TLR9-ERK-mTOR signaling pathway in glioma cells, providing new insights into the investigation mechanism of CpG ODN. PMID:27251306

  9. Critical Points and Traveling Wave in Locomotion: Experimental Evidence and Some Theoretical Considerations.

    PubMed

    Saltiel, Philippe; d'Avella, Andrea; Tresch, Matthew C; Wyler, Kuno; Bizzi, Emilio

    2017-01-01

    The central pattern generator (CPG) architecture for rhythm generation remains partly elusive. We compare cat and frog locomotion results, where the component unrelated to pattern formation appears as a temporal grid, and traveling wave respectively. Frog spinal cord microstimulation with N-methyl-D-Aspartate (NMDA), a CPG activator, produced a limited set of force directions, sometimes tonic, but more often alternating between directions similar to the tonic forces. The tonic forces were topographically organized, and sites evoking rhythms with different force subsets were located close to the constituent tonic force regions. Thus CPGs consist of topographically organized modules. Modularity was also identified as a limited set of muscle synergies whose combinations reconstructed the EMGs. The cat CPG was investigated using proprioceptive inputs during fictive locomotion. Critical points identified both as abrupt transitions in the effect of phasic perturbations, and burst shape transitions, had biomechanical correlates in intact locomotion. During tonic proprioceptive perturbations, discrete shifts between these critical points explained the burst durations changes, and amplitude changes occurred at one of these points. Besides confirming CPG modularity, these results suggest a fixed temporal grid of anchoring points, to shift modules onsets and offsets. Frog locomotion, reconstructed with the NMDA synergies, showed a partially overlapping synergy activation sequence. Using the early synergy output evoked by NMDA at different spinal sites, revealed a rostrocaudal topographic organization, where each synergy is preferentially evoked from a few, albeit overlapping, cord regions. Comparing the locomotor synergy sequence with this topography suggests that a rostrocaudal traveling wave would activate the synergies in the proper sequence for locomotion. This output was reproduced in a two-layer model using this topography and a traveling wave. Together our results suggest two CPG components: modules, i.e., synergies; and temporal patterning, seen as a temporal grid in the cat, and a traveling wave in the frog. Animal and limb navigation have similarities. Research relating grid cells to the theta rhythm and on segmentation during navigation may relate to our temporal grid and traveling wave results. Winfree's mathematical work, combining critical phases and a traveling wave, also appears important. We conclude suggesting tracing, and imaging experiments to investigate our CPG model.

  10. A terahertz EO detector with large dynamical range, high modulation depth and signal-noise ratio

    NASA Astrophysics Data System (ADS)

    Pan, Xinjian; Cai, Yi; Zeng, Xuanke; Zheng, Shuiqin; Li, Jingzhen; Xu, Shixiang

    2017-05-01

    The paper presents a novel design for terahertz (THz) free-space time domain electro-optic (EO) detection where the static birefringent phases of the two balanced arms are set close to zero but opposite to each other. Our theoretical and numerical analyses show this design has much stronger ability to cancel the optical background noise than both THz ellipsometer and traditional crossed polarizer geometry (CPG). Its optical modulation depth is about twice as high as that of traditional CPG, but about ten times as high as that of THz ellipsometer. As for the dynamical range, our improved design is comparable to the THz ellipsometer but obviously larger than the traditional CPG. Some experiments for comparing our improved CPG with traditional CPG agree well with the corresponding theoretical predictions. Our experiments also show that the splitting ratio of the used non-polarization beam splitter is critical for the performance of our design.

  11. Response of immune response genes to adjuvants poly [di(sodium carboxylatoethylphenoxy)phosphazene] (PCEP), CpG oligodeoxynucleotide and emulsigen at intradermal injection site in pigs.

    PubMed

    Magiri, R B; Lai, K; Chaffey, A M; Wilson, H L; Berry, W E; Szafron, M L; Mutwiri, G K

    2016-07-01

    Understanding the mechanisms by which adjuvants mediate their effects provide critical information on how innate immunity influences the development of adaptive immunity. Despite being a critical vaccine component, the mechanisms by which adjuvants mediate their effects are not fully understood and this is especially true when they are used in large animals. This lack of understanding limits our ability to design effective vaccines. In the present study, we administered polyphosphazene (PCEP), CpG oligodeoxynucleotides (CpG), emulsigen or saline via an intradermal injection into pigs and assessed the impact on the expression of reported 'adjuvant response genes' over time. CpG induced a strong upregulation of the chemokine CXL10 several 'Interferon Response Genes', as well as TNFα, and IL-10, and a down-regulation of IL-17 genes. Emulsigen upregulated expression of chemokines CCL2 and CCL5, proinflammatory cytokines IL-6 and TNFα, as well as TLR9, and several IFN response genes. PCEP induced the expression of chemokine CCL2 and proinflammatory cytokine IL-6. These results suggest that emulsigen and CpG may promote recruitment of innate immune cells and Th1 type cytokine production but that PCEP may promote a Th-2 type immune response through the induction of IL-6, an inducer of B cell activity and differentiation. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Treatment of Tobacco Dependence, a Critical Gap in Czech Clinical Practice Guidelines.

    PubMed

    Zvolská, Kamila; Fraser, Keely; Zvolský, Miroslav; Králíková, Eva

    2017-06-01

    Tobacco related comorbidities and treatment of dependence are relevant to clinicians of all disciplines. Clinicians should provide a brief intervention about tobacco use with smokers at each clinical contact (success rate of 5-10 %). Intensive treatment (success rate >30%) should be available to those who need it. Brief intervention is not yet standard clinical practice. Our aim was to assess clinical practice guidelines (CPG) of selected medical professional societies to determine whether or not tobacco dependence treatment recommendations were included. Between October and December 2013, we conducted a keyword search of CPG for 20 medical professional societies in the Czech Republic. We searched for the keywords "smoking", "tobacco" and "nicotine addiction" in 91 CPG documents, which were freely available on the websites of selected professional societies. We focused specifically on CPG relating to cardiovascular and respiratory diseases as well as cancer. We excluded any CPG focused on acute conditions, diagnostics only, laboratory methods, or administration. There was no mention of smoking in 27.7% (26/94) of CPG documents. Only 16% (15/94) of CPG documents listed smoking as a risk factor. 42.5% (40/94) mentioned smoking related phrases (e.g. "smoking ban"). Only 13.8% (13/94) of CPG included a section on tobacco dependence, referenced tobacco dependence treatment guidelines or mentioned specialized treatment centres where smokers can be referred. Nearly one third of CPG related to cardiovascular and respiratory diseases as well as cancer made no mention of smoking. Despite the clinical significance of smoking, the majority of CPG did not adequately address tobacco dependence and its treatment. Copyright© by the National Institute of Public Health, Prague 2017

  13. Phase 1 testing of detoxified LPS/group B meningococcal outer membrane protein vaccine with and without synthetic CPG 7909 adjuvant for the prevention and treatment of sepsis.

    PubMed

    Cross, Alan S; Greenberg, Nancy; Billington, Melissa; Zhang, Lei; DeFilippi, Christopher; May, Ryan C; Bajwa, Kanwaldeep K

    2015-11-27

    Gram-negative bacteria (GNB) are a leading cause of nosocomial infection and sepsis. Increasing multi-antibiotic resistance has left clinicians with fewer therapeutic options. Antibodies to GNB lipopolysaccharide (LPS, or endotoxin) have reduced morbidity and mortality as a result of infection and are not subject to the resistance mechanisms deployed by bacteria against antibiotics. In this phase 1 study, we administered a vaccine that elicits antibodies against a highly conserved portion of LPS with and without a CpG oligodeoxynucleotide (ODN) TLR9 agonist as adjuvant. A vaccine composed of the detoxified LPS (dLPS) from E. coli O111:B4 (J5 mutant) non-covalently complexed to group B meningococcal outer membrane protein (OMP). Twenty healthy adult subjects received three doses at 0, 29 and 59 days of antigen (10 μg dLPS) with or without CPG 7909 (250 or 500 μg). Subjects were evaluated for local and systemic adverse effects and laboratory findings. Anti-J5 LPS IgG and IgM antibody levels were measured by electrochemiluminesence. Due to premature study termination, not all subjects received all three doses. All vaccine formulations were well-tolerated with no local or systemic events of greater than moderate severity. The vaccine alone group achieved a ≥ 4-fold "responder" response in IgG and IgM antibody in only one of 6 subjects. In contrast, the vaccine plus CPG 7909 groups appeared to have earlier and more sustained (to 180 days) responses, greater mean-fold increases, and a higher proportion of "responders" achieving ≥ 4-fold increases over baseline. Although the study was halted before all enrolled subjects received all three doses, the J5dLPS/OMP vaccine, with or without CpG adjuvant, was safe and well-tolerated. The inclusion of CpG increased the number of subjects with a ≥ 4-fold antibody response, evident even after the second of three planned doses. A vaccine comprising J5dLPS/OMP antigen with CpG adjuvant merits further investigation. ClinicalTrials.gov Identifier: NCT01164514. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Immunotherapeutic potential of CpG oligodeoxynucleotides in veterinary species.

    PubMed

    Manuja, Anju; Manuja, Balvinder K; Kaushik, Jyoti; Singha, Harisankar; Singh, Raj Kumar

    2013-10-01

    Innate immunity plays a critical role in host defense against infectious diseases by discriminating between self and infectious non-self. The recognition of infectious non-self involves germ-line encoded pattern recognition receptors (PRRs) that recognize pathogen-associated molecular patterns (PAMPs). The PAMPs are the components of pathogenic microbes which include not only the cell wall constituents but also the unmethylated 2'-deoxy-ribo-cytosine-phosphate-guanosine (CpG) motifs. These CpG motifs present within bacterial and viral DNA are recognized by toll-like receptor 9 (TLR9), and signaling by this receptor triggers a proinflammatory cytokine response which, in turn, influences both innate and adaptive immune responses. The activation of TLR9 with synthetic CpG oligodeoxynucleotides (ODNs) induces powerful Th1-like immune responses. It has been shown to provide protection against infectious diseases, allergy and cancer in laboratory animal models and some domestic animal species. With better understanding of the basic biology and immune mechanisms, it would be possible to exploit the potential of CpG motifs for animal welfare. The research developments in the area of CpG and TLR9 and the potential applications in animal health have been reviewed in this article.

  15. Regulation of glutamate receptor internalization by the spine cytoskeleton is mediated by its PKA-dependent association with CPG2

    PubMed Central

    Loebrich, Sven; Djukic, Biljana; Tong, Zachary J.; Cottrell, Jeffrey R.; Turrigiano, Gina G.; Nedivi, Elly

    2013-01-01

    A key neuronal mechanism for adjusting excitatory synaptic strength is clathrin-mediated endocytosis of postsynaptic glutamate receptors (GluRs). The actin cytoskeleton is critical for clathrin-mediated endocytosis, yet we lack a mechanistic understanding of its interaction with the endocytic process and how it may be regulated. Here we show that F-actin in dendritic spines physically binds the synaptic nuclear envelope 1 gene product candidate plasticity gene 2 (CPG2) in a PKA-dependent manner, and that this association is required for synaptic GluR internalization. Mutating two PKA sites on CPG2 disrupts its cytoskeletal association, attenuating GluR endocytosis and affecting the efficacy of synaptic transmission in vivo. These results identify CPG2 as an F-actin binding partner that functionally mediates interaction of the spine cytoskeleton with postsynaptic endocytosis. Further, the regulation of CPG2/F-actin association by PKA provides a gateway for cellular control of synaptic receptor internalization through second messenger signaling pathways. Recent identification of human synaptic nuclear envelope 1 as a risk locus for bipolar disorder suggests that CPG2 could play a role in synaptic dysfunction underlying neuropsychiatric disease. PMID:24191017

  16. Lack of chart reminder effectiveness on family medicine resident JNC-VI and NCEP III guideline knowledge and attitudes.

    PubMed

    Echlin, Paul S; Upshur, Ross E G; Markova, Tsveti P

    2004-07-05

    The literature demonstrates that medical residents and practicing physicians have an attitudinal-behavioral discordance concerning their positive attitudes towards clinical practice guidelines (CPG), and the implementation of these guidelines into clinical practice patterns. A pilot study was performed to determine if change in a previously identified CPG compliance factor (accessibility) would produce a significant increase in family medicine resident knowledge and attitude toward the guidelines. The primary study intervention involved placing a summary of the Sixth Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure (JNC VI) and the National Cholesterol Education Program Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (NCEP III) CPGs in all patient (>18 yr.) charts for a period of three months. The JNC VI and NCEP III CPGs were also distributed to each Wayne State family medicine resident, and a copy of each CPG was placed in the preceptor's area of the involved clinics. Identical pre- and post- intervention questionnaires were administered to all residents concerning CPG knowledge and attitude. Post-intervention analysis failed to demonstrate a significant difference in CPG knowledge. A statistically significant post-intervention difference was found in only on attitude question. The barriers to CPG compliance were identified as 1) lack of CPG instruction; 2) lack of critical appraisal ability; 3) insufficient time; 4) lack of CPG accessibility; and 5) lack of faculty modeling. This study demonstrated no significant post intervention changes in CPG knowledge, and only one question that reflected attitude change. Wider resident access to dedicated clinic time, increased faculty modeling, and the implementation of an electronic record/reminder system that uses a team-based approach are compliance factors that should be considered for further investigation. The interpretation of CPG non-compliance will benefit from a causal matrix focused on physician knowledge, attitudes, and behavior. Recent findings in resident knowledge-behavior discordance may direct the future investigation of physician CPG non-compliance away from generalized barrier research, and toward the development of information that maximizes the sense of individual practitioner urgency and certainty.

  17. CPG2 Recruits Endophilin B2 to the Cytoskeleton for Activity-Dependent Endocytosis of Synaptic Glutamate Receptors.

    PubMed

    Loebrich, Sven; Benoit, Marc Robert; Konopka, Jaclyn Aleksandra; Cottrell, Jeffrey Richard; Gibson, Joanne; Nedivi, Elly

    2016-02-08

    Internalization of glutamate receptors at the postsynaptic membrane via clathrin-mediated endocytosis (CME) is a key mechanism for regulating synaptic strength. A role for the F-actin cytoskeleton in CME is well established, and recently, PKA-dependent association of candidate plasticity gene 2 (CPG2) with the spine-cytoskeleton has been shown to mediate synaptic glutamate receptor internalization. Yet, how the endocytic machinery is physically coupled to the actin cytoskeleton to facilitate glutamate receptor internalization has not been demonstrated. Moreover, there has been no distinction of endocytic-machinery components that are specific to activity-dependent versus constitutive glutamate receptor internalization. Here, we show that CPG2, through a direct physical interaction, recruits endophilin B2 (EndoB2) to F-actin, thus anchoring the endocytic machinery to the spine cytoskeleton and facilitating glutamate receptor internalization. Regulation of CPG2 binding to the actin cytoskeleton by protein kinase A directly impacts recruitment of EndoB2 and clathrin. Specific disruption of EndoB2 or the CPG2-EndoB2 interaction impairs activity-dependent, but not constitutive, internalization of both NMDA- and AMPA-type glutamate receptors. These results demonstrate that, through direct interactions with F-actin and EndoB2, CPG2 physically bridges the spine cytoskeleton and the endocytic machinery, and this tripartite association is critical specifically for activity-dependent CME of synaptic glutamate receptors. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. TLR3 and TLR9 agonists improve postexposure vaccination efficacy of live smallpox vaccines.

    PubMed

    Israely, Tomer; Melamed, Sharon; Achdout, Hagit; Erez, Noam; Politi, Boaz; Waner, Trevor; Lustig, Shlomo; Paran, Nir

    2014-01-01

    Eradication of smallpox and discontinuation of the vaccination campaign resulted in an increase in the percentage of unvaccinated individuals, highlighting the need for postexposure efficient countermeasures in case of accidental or deliberate viral release. Intranasal infection of mice with ectromelia virus (ECTV), a model for human smallpox, is curable by vaccination with a high vaccine dose given up to 3 days postexposure. To further extend this protective window and to reduce morbidity, mice were vaccinated postexposure with Vaccinia-Lister, the conventional smallpox vaccine or Modified Vaccinia Ankara, a highly attenuated vaccine in conjunction with TLR3 or TLR9 agonists. We show that co-administration of the TLR3 agonist poly(I:C) even 5 days postexposure conferred protection, avoiding the need to increase the vaccination dose. Efficacious treatments prevented death, ameliorated disease symptoms, reduced viral load and maintained tissue integrity of target organs. Protection was associated with significant elevation of serum IFNα and anti-vaccinia IgM antibodies, modulation of IFNγ response, and balanced activation of NK and T cells. TLR9 agonists (CpG ODNs) were less protective than the TLR3 agonist poly(I:C). We show that activation of type 1 IFN by poly(I:C) and protection is achievable even without co-vaccination, requiring sufficient amount of the viral antigens of the infective agent or the vaccine. This study demonstrated the therapeutic potential of postexposure immune modulation by TLR activation, allowing to alleviate the disease symptoms and to further extend the protective window of postexposure vaccination.

  19. TLR3 and TLR9 Agonists Improve Postexposure Vaccination Efficacy of Live Smallpox Vaccines

    PubMed Central

    Israely, Tomer; Erez, Noam; Politi, Boaz; Waner, Trevor; Lustig, Shlomo; Paran, Nir

    2014-01-01

    Eradication of smallpox and discontinuation of the vaccination campaign resulted in an increase in the percentage of unvaccinated individuals, highlighting the need for postexposure efficient countermeasures in case of accidental or deliberate viral release. Intranasal infection of mice with ectromelia virus (ECTV), a model for human smallpox, is curable by vaccination with a high vaccine dose given up to 3 days postexposure. To further extend this protective window and to reduce morbidity, mice were vaccinated postexposure with Vaccinia-Lister, the conventional smallpox vaccine or Modified Vaccinia Ankara, a highly attenuated vaccine in conjunction with TLR3 or TLR9 agonists. We show that co-administration of the TLR3 agonist poly(I:C) even 5 days postexposure conferred protection, avoiding the need to increase the vaccination dose. Efficacious treatments prevented death, ameliorated disease symptoms, reduced viral load and maintained tissue integrity of target organs. Protection was associated with significant elevation of serum IFNα and anti-vaccinia IgM antibodies, modulation of IFNγ response, and balanced activation of NK and T cells. TLR9 agonists (CpG ODNs) were less protective than the TLR3 agonist poly(I:C). We show that activation of type 1 IFN by poly(I:C) and protection is achievable even without co-vaccination, requiring sufficient amount of the viral antigens of the infective agent or the vaccine. This study demonstrated the therapeutic potential of postexposure immune modulation by TLR activation, allowing to alleviate the disease symptoms and to further extend the protective window of postexposure vaccination. PMID:25350003

  20. Activation of plasmacytoid dendritic cells with TLR9 agonists initiates invariant NKT cell-mediated cross-talk with myeloid dendritic cells.

    PubMed

    Montoya, Carlos J; Jie, Hyun-Bae; Al-Harthi, Lena; Mulder, Candice; Patiño, Pablo J; Rugeles, María T; Krieg, Arthur M; Landay, Alan L; Wilson, S Brian

    2006-07-15

    CD1d-restricted invariant NK T (iNKT) cells and dendritic cells (DCs) have been shown to play crucial roles in various types of immune responses, including TLR9-dependent antiviral responses initiated by plasmacytoid DCs (pDCs). However, the mechanism by which this occurs is enigmatic because TLRs are absent in iNKT cells and human pDCs do not express CD1d. To explore this process, pDCs were activated with CpG oligodeoxyribonucleotides, which stimulated the secretion of several cytokines such as type I and TNF-alpha. These cytokines and other soluble factors potently induced the expression of activation markers on iNKT cells, selectively enhanced double-negative iNKT cell survival, but did not induce their expansion or production of cytokines. Notably, pDC-derived factors licensed iNKT cells to respond to myeloid DCs: an important downstream cellular target of iNKT cell effector function and a critical contributor to the initiation of adaptive immune responses. This interaction supports the notion that iNKT cells can mediate cross-talk between DC subsets known to express mutually exclusive TLR and cytokine profiles.

  1. Epicutaneous immunization with ovalbumin and CpG induces TH1/TH17 cytokines, which regulate IgE and IgG2a production

    PubMed Central

    Majewska-Szczepanik, Monika; Askenase, Philip W.; Lobo, Francis M.; Marcińska, Katarzyna; Wen, Li; Szczepanik, Marian

    2017-01-01

    Background Subcutaneous allergen-specific immunotherapy is a standard route for the immunotherapy of allergic diseases. It modulates the course of allergy and can generate long-term remission. However, subcutaneous allergen-specific immunotherapy can also induce anaphylaxis in some patients, and therefore additional routes of administration should be investigated to improve the safety and tolerability of immunotherapy. Objective We sought to determine whether epicutaneous treatment with antigen in the presence of a Toll-like receptor 9 agonist can suppress TH2-mediated responses in an antigen-specific manner. Methods Epicutaneous immunization was performed by applying a skin patch soaked with ovalbumin (OVA) plus CpG, and its suppressor activity was determined by using the mouse model of atopic dermatitis. Finally, adoptive cell transfers were implemented to characterize the regulatory cells that are induced by epicutaneous immunization. Results Epicutaneous immunization with OVA and CpG reduces the production of OVA-specific IgE and increases the synthesis of OVA-specific IgG2a antibodies in an antigen-specific manner. Moreover, eosinophil peroxidase activity in the skin and production of IL-4, IL-5, IL-10, and IL-13 are suppressed. The observed reduction of IgE synthesis is transferable with T-cell receptor (TCR) αβ+CD4+CD25− cells, whereas IgG2a production is dependent on both TCRαβ+ and TCRγδ+ T cells. Further experiments show that the described phenomenon is myeloid differentiation primary response 88, IFN-γ, and IL-17A dependent. Finally, the results suggest that epicutaneous immunization with OVA and CpG decreases the synthesis of OVA-specific IgE and skin eosinophil peroxidase activity in mice with ongoing skin allergy. Conclusion Epicutaneous application of protein antigen in the presence of adjuvant could be an attractive needle-free and self-administered immunotherapy for allergic diseases. PMID:26810716

  2. Macrophage ABCA1 reduces MyD88-dependent Toll-like receptor trafficking to lipid rafts by reduction of lipid raft cholesterol[S

    PubMed Central

    Zhu, Xuewei; Owen, John S.; Wilson, Martha D.; Li, Haitao; Griffiths, Gary L.; Thomas, Michael J.; Hiltbold, Elizabeth M.; Fessler, Michael B.; Parks, John S.

    2010-01-01

    We previously showed that macrophages from macrophage-specific ATP-binding cassette transporter A1 (ABCA1) knockout (Abca1-M/-M) mice had an enhanced proinflammatory response to the Toll-like receptor (TLR) 4 agonist, lipopolysaccharide (LPS), compared with wild-type (WT) mice. In the present study, we demonstrate a direct association between free cholesterol (FC), lipid raft content, and hyper-responsiveness of macrophages to LPS in WT mice. Abca1-M/-M macrophages were also hyper-responsive to specific agonists to TLR2, TLR7, and TLR9, but not TLR3, compared with WT macrophages. We hypothesized that ABCA1 regulates macrophage responsiveness to TLR agonists by modulation of lipid raft cholesterol and TLR mobilization to lipid rafts. We demonstrated that Abca1-M/-M vs. WT macrophages contained 23% more FC in isolated lipid rafts. Further, mass spectrometric analysis suggested raft phospholipid composition was unchanged. Although cell surface expression of TLR4 was similar between Abca1-M/-M and WT macrophages, significantly more TLR4 was distributed in membrane lipid rafts in Abca1-M/-M macrophages. Abca1-M/-M macrophages also exhibited increased trafficking of the predominantly intracellular TLR9 into lipid rafts in response to TLR9-specific agonist (CpG). Collectively, our data suggest that macrophage ABCA1 dampens inflammation by reducing MyD88-dependent TLRs trafficking to lipid rafts by selective reduction of FC content in lipid rafts. PMID:20650929

  3. New malaria vaccine candidates based on the Plasmodium vivax Merozoite Surface Protein-1 and the TLR-5 agonist Salmonella Typhimurium FliC flagellin.

    PubMed

    Bargieri, Daniel Y; Rosa, Daniela S; Braga, Catarina J M; Carvalho, Bruna O; Costa, Fabio T M; Espíndola, Noeli Maria; Vaz, Adelaide José; Soares, Irene S; Ferreira, Luis C S; Rodrigues, Mauricio M

    2008-11-11

    The present study evaluated the immunogenicity of new malaria vaccine formulations based on the 19kDa C-terminal fragment of Plasmodium vivax Merozoite Surface Protein-1 (MSP1(19)) and the Salmonella enterica serovar Typhimurium flagellin (FliC), a Toll-like receptor 5 (TLR5) agonist. FliC was used as an adjuvant either admixed or genetically linked to the P. vivax MSP1(19) and administered to C57BL/6 mice via parenteral (s.c.) or mucosal (i.n.) routes. The recombinant fusion protein preserved MSP1(19) epitopes recognized by sera collected from P. vivax infected humans and TLR5 agonist activity. Mice parenterally immunized with recombinant P. vivax MSP1(19) in the presence of FliC, either admixed or genetically linked, elicited strong and long-lasting MSP1(19)-specific systemic antibody responses with a prevailing IgG1 subclass response. Incorporation of another TLR agonist, CpG ODN 1826, resulted in a more balanced response, as evaluated by the IgG1/IgG2c ratio, and higher cell-mediated immune response measured by interferon-gamma secretion. Finally, we show that MSP1(19)-specific antibodies recognized the native protein expressed on the surface of P. vivax parasites harvested from infected humans. The present report proposes a new class of malaria vaccine formulation based on the use of malarial antigens and the innate immunity agonist FliC. It contains intrinsic adjuvant properties and enhanced ability to induce specific humoral and cellular immune responses when administered alone or in combination with other adjuvants.

  4. Dual Roles for CXCL4 Chemokines and CXCR3 in Angiogenesis and Invasion of Pancreatic Cancer.

    PubMed

    Quemener, Cathy; Baud, Jessica; Boyé, Kevin; Dubrac, Alexandre; Billottet, Clotilde; Soulet, Fabienne; Darlot, Florence; Dumartin, Laurent; Sire, Marie; Grepin, Renaud; Daubon, Thomas; Rayne, Fabienne; Wodrich, Harald; Couvelard, Anne; Pineau, Raphael; Schilling, Martin; Castronovo, Vincent; Sue, Shih-Che; Clarke, Kim; Lomri, Abderrahim; Khatib, Abdel-Majid; Hagedorn, Martin; Prats, Hervé; Bikfalvi, Andreas

    2016-11-15

    The CXCL4 paralog CXCL4L1 is a less studied chemokine that has been suggested to exert an antiangiogenic function. However, CXCL4L1 is also expressed in patient tumors, tumor cell lines, and murine xenografts, prompting a more detailed analysis of its role in cancer pathogenesis. We used genetic and antibody-based approaches to attenuate CXCL4L1 in models of pancreatic ductal adenocarcinoma (PDAC). Mechanisms of expression were assessed in cell coculture experiments, murine, and avian xenotransplants, including through an evaluation of CpG methylation and mutation of critical CpG residues. CXCL4L1 gene expression was increased greatly in primary and metastatic PDAC. We found that myofibroblasts triggered cues in the tumor microenvironment, which led to induction of CXCL4L1 in tumor cells. CXCL4L1 expression was also controlled by epigenetic modifications at critical CpG islands, which were mapped. CXCL4L1 inhibited angiogenesis but also affected tumor development more directly, depending on the tumor cell type. In vivo administration of an mAb against CXCL4L1 demonstrated a blockade in the growth of tumors positive for CXCR3, a critical receptor for CXCL4 ligands. Our findings define a protumorigenic role in PDAC development for endogenous CXCL4L1, which is independent of its antiangiogenic function. Cancer Res; 76(22); 6507-19. ©2016 AACR. ©2016 American Association for Cancer Research.

  5. Production and quality of clinical practice guidelines in Argentina (1994–2004): a cross-sectional study

    PubMed Central

    Esandi, María Eugenia; Ortiz, Zulma; Chapman, Evelina; Dieguez, Marcelo García; Mejía, Raúl; Bernztein, Ricardo

    2008-01-01

    Background In the last decades, a sustained increment of Clinical Practice Guidelines (CPG) production in the world has been accompanied by a growing concern about their quality. Many studies related to quality assessment of guidelines produced in High Income Countries were published; however, evidence on this topic is scarce in Low and Middle Income Countries (LMIC). The objectives of this research were: a) to describe guideline production in Argentina at different levels of the health system (macro, meso and micro) from 1994 to 2004; and b) to assess their quality by using the AGREE instrument. Methods A cross-sectional study was undertaken to describe guidelines production in Argentina between 1994 and 2004. CPG were identified through Internet and electronic databases (MEDLINE and LILACS). Explicit inclusion and exclusion criteria were used to select guidelines. Each CPG was independently assessed by two reviewers using the AGREE instrument. Domain scores were calculated as recommended by the AGREE Collaboration. The internal consistency of each domain was evaluated using Cronbach's alpha and inter-observer agreement by the Intraclass Correlation Coefficient (ICC). Results A total amount of 431 potential CPG were identified, but only 144 were considered CPG. At the end, 101 CPG were included for further assessment. Median standardized score for each domain were: scope = 39%; stakeholder involvement = 13%; rigour of development = 10%; clarity = 42%; applicability = 6%; editorial independence = 0%. Only 22 CPG were recommended with modifications by both appraisers. ICC and Cronbach's alpha for each domain were in all cases moderate or high (greater than 0.40), except for editorial independence. Conclusion This study has systematically employed the AGREE instrument for the critical assessment of guidelines produced in a LMIC. Guideline development and diffusion in Argentina from 1994 to 2004 shows a constant increment, although quality of reporting did not improve; moreover, in some aspects it seemed to decline. Much room for improvement of the guideline development process was found at all levels of the health system. PMID:18851739

  6. Silencing of GSTP1 gene by CpG island DNA hypermethylation in HBV-associated hepatocellular carcinomas.

    PubMed

    Zhong, Sheng; Tang, Mandy W; Yeo, Winnie; Liu, Cuiling; Lo, Y M Dennis; Johnson, Philip J

    2002-04-01

    Glutathione S-transferases, enzymes that defend cells against damage mediated by oxidant and electrophilic carcinogens, may be critical determinants of cancer pathogenesis. In this report, we assess the role of epigenetic silencing of the GSTP1 gene, a gene encoding the pi-class glutathione S-transferase, in the pathogenesis of hepatitis B virus (HBV)-associated hepatocellular carcinomas (HCC). The cell lines Hep3B, HepG2, and a cohort of 43 HBV-associated HCC tissue specimens and corresponding nontumor tissues were subjected to analysis for GSTP1 epigenetic alteration and expression. GSTP1 "CpG" island DNA hypermethylation in the liver cell lines, and the tissue specimens were determined by methylation-specific PCR and correlated with expression of the gene using reverse-transcription PCR, immunoblotting, and immunohistochemistry. GSTP1 CpG island DNA hypermethylation was detected in 28 of 43 (65.1%) HCC tissues and 4 of 40 (10%) corresponding nontumor tissues. GSTP1 protein was absent in those cases showing hypermethylation of the gene. Similarly, DNA from Hep3B and HepG2 cell lines displayed complete GSTP1 hypermethylation in the CpG island, and they failed to express GSTP1 mRNA and the corresponding protein product. Treatment of the cell lines with the DNA methyltransferase inhibitor 5-aza-deoxycytidine reversed the hypermethylation, and restored GSTP1 mRNA and polypeptide expression. These data indicate that epigenetic silencing of GSTP1 gene expression by CpG island DNA hypermethylation is common in human HBV-associated HCC. In addition, somatic GSTP1 inactivation via CpG island hypermethylation may contribute to the pathogenesis of this malignancy.

  7. Induction of multispecific Th-1 type immune response against HCV in mice by protein immunization using CpG and Montanide ISA 720 as adjuvants

    PubMed Central

    Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J.; Shih, J. Wai-Kuo

    2017-01-01

    Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-γ-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biasedpathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-γ demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins. PMID:18675871

  8. Induction of multispecific Th-1 type immune response against HCV in mice by protein immunization using CpG and Montanide ISA 720 as adjuvants.

    PubMed

    Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J; Shih, J Wai-Kuo

    2008-10-09

    Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-gamma-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biased pathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-gamma demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins.

  9. Asymmetric DNA methylation of CpG dyads is a feature of secondary DMRs associated with the Dlk1/Gtl2 imprinting cluster in mouse.

    PubMed

    Guntrum, Megan; Vlasova, Ekaterina; Davis, Tamara L

    2017-01-01

    Differential DNA methylation plays a critical role in the regulation of imprinted genes. The differentially methylated state of the imprinting control region is inherited via the gametes at fertilization, and is stably maintained in somatic cells throughout development, influencing the expression of genes across the imprinting cluster. In contrast, DNA methylation patterns are more labile at secondary differentially methylated regions which are established at imprinted loci during post-implantation development. To investigate the nature of these more variably methylated secondary differentially methylated regions, we adopted a hairpin linker bisulfite mutagenesis approach to examine CpG dyad methylation at differentially methylated regions associated with the murine Dlk1/Gtl2 imprinting cluster on both complementary strands. We observed homomethylation at greater than 90% of the methylated CpG dyads at the IG-DMR, which serves as the imprinting control element. In contrast, homomethylation was only observed at 67-78% of the methylated CpG dyads at the secondary differentially methylated regions; the remaining 22-33% of methylated CpG dyads exhibited hemimethylation. We propose that this high degree of hemimethylation could explain the variability in DNA methylation patterns at secondary differentially methylated regions associated with imprinted loci. We further suggest that the presence of 5-hydroxymethylation at secondary differentially methylated regions may result in hemimethylation and methylation variability as a result of passive and/or active demethylation mechanisms.

  10. Grafting of fetal brainstem 5-HT neurons into the sublesional spinal cord of paraplegic rats restores coordinated hindlimb locomotion.

    PubMed

    Sławińska, Urszula; Miazga, Krzysztof; Cabaj, Anna M; Leszczyńska, Anna N; Majczyński, Henryk; Nagy, James I; Jordan, Larry M

    2013-09-01

    In rodent models of spinal cord injury, there is increasing evidence that activation of the locomotor central pattern generator (CPG) below the site of injury with 5-hydroxytryptamine (5-HT) agonists improves locomotor recovery and restores coordination. A promising means of replacing 5-HT control of locomotion is to graft brainstem 5-HT neurons into the spinal cord below the level of the spinal cord injury. However, it is not known whether this approach improves limb coordination because recovery of coordinated stepping has not been documented in detail in previous studies employing this transplantation strategy. Here, adult rats with complete spinal cord transections at the T9/10 level were grafted with E14 fetal neurons from the medulla at the T10/11 vertebra level one month after injury. The B1, B2 and B3 fetal anlagen of brainstem 5-HT neurons, a grouping that included the presumed precursors of recently described 5-HT locomotor command neurons, were used in these grafts. EMG and video recordings of treadmill locomotion evoked by tail stimulation showed full recovery of inter- and intralimb coordination in the grafted rats. We showed, using systemically applied antagonists, that 5-HT₂ and 5-HT₇ receptors mediate the improved locomotion after grafting, but through actions on different populations of spinal locomotor neurons. Specifically, 5-HT₂ receptors control CPG activation as well as motoneuron output, while 5-HT₇ receptors contribute primarily to activity of the locomotor CPG. These results are consistent with the roles for these receptors during locomotion in intact rodents and in rodent brainstem-spinal cord in vitro preparations. Copyright © 2013 Elsevier Inc. All rights reserved.

  11. Intra- and intersegmental influences among central pattern generating networks in the walking system of the stick insect.

    PubMed

    Mantziaris, Charalampos; Bockemühl, Till; Holmes, Philip; Borgmann, Anke; Daun, Silvia; Büschges, Ansgar

    2017-10-01

    To efficiently move around, animals need to coordinate their limbs. Proper, context-dependent coupling among the neural networks underlying leg movement is necessary for generating intersegmental coordination. In the slow-walking stick insect, local sensory information is very important for shaping coordination. However, central coupling mechanisms among segmental central pattern generators (CPGs) may also contribute to this. Here, we analyzed the interactions between contralateral networks that drive the depressor trochanteris muscle of the legs in both isolated and interconnected deafferented thoracic ganglia of the stick insect on application of pilocarpine, a muscarinic acetylcholine receptor agonist. Our results show that depressor CPG activity is only weakly coupled between all segments. Intrasegmental phase relationships differ between the three isolated ganglia, and they are modified and stabilized when ganglia are interconnected. However, the coordination patterns that emerge do not resemble those observed during walking. Our findings are in line with recent studies and highlight the influence of sensory input on coordination in slowly walking insects. Finally, as a direct interaction between depressor CPG networks and contralateral motoneurons could not be observed, we hypothesize that coupling is based on interactions at the level of CPG interneurons. NEW & NOTEWORTHY Maintaining functional interleg coordination is vitally important as animals locomote through changing environments. The relative importance of central mechanisms vs. sensory feedback in this process is not well understood. We analyzed coordination among the neural networks generating leg movements in stick insect preparations lacking phasic sensory feedback. Under these conditions, the networks governing different legs were only weakly coupled. In stick insect, central connections alone are thus insufficient to produce the leg coordination observed behaviorally. Copyright © 2017 the American Physiological Society.

  12. Epigenome-wide DNA methylation study of IgE concentration in relation to self-reported allergies.

    PubMed

    Ek, Weronica E; Ahsan, Muhammad; Rask-Andersen, Mathias; Liang, Liming; Moffatt, Miriam F; Gyllensten, Ulf; Johansson, Åsa

    2017-04-01

    Epigenetic mechanisms are critical for normal immune development and epigenetic alterations might therefore be possible contributors to immune diseases. To investigate if DNA methylation in whole blood is associated with total and allergen-specific IgE levels. We performed an epigenome-wide association study to investigate the association between DNA methylation and IgE level, allergen-specific IgE and self-reported immune diseases and allergies in 728 individuals. We identified and replicated 15 CpG sites associated with IgE, mapping to biologically relevant genes, including ACOT7, ILR5A, KCNH2, PRG2 and EPX. A total of 331 loci were associated with allergen-specific IgE, but none of these CpG sites were associated with self-reported allergies and immune diseases. This study shows that IgE levels are associated with DNA methylation levels at numerous CpG sites, which might provide new leads for investigating the links between IgE and allergic inflammation.

  13. Promoter DNA methylation regulates progranulin expression and is altered in FTLD

    PubMed Central

    2013-01-01

    Background Frontotemporal lobar degeneration (FTLD) is a heterogeneous group of neurodegenerative diseases associated with personality changes and progressive dementia. Loss-of-function mutations in the growth factor progranulin (GRN) cause autosomal dominant FTLD, but so far the pathomechanism of sporadic FTLD is unclear. Results We analyzed whether DNA methylation in the GRN core promoter restricts GRN expression and, thus, might promote FTLD in the absence of GRN mutations. GRN expression in human lymphoblast cell lines is negatively correlated with methylation at several CpG units within the GRN promoter. Chronic treatment with the DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (DAC) strongly induces GRN mRNA and protein levels. In a reporter assay, CpG methylation blocks transcriptional activity of the GRN core promoter. In brains of FTLD patients several CpG units in the GRN promoter are significantly hypermethylated compared to age-matched healthy controls, Alzheimer and Parkinson patients. These CpG motifs are critical for GRN promoter activity in reporter assays. Furthermore, DNA methyltransferase 3a (DNMT3a) is upregulated in FTLD patients and overexpression of DNMT3a reduces GRN promoter activity and expression. Conclusion These data suggest that altered DNA methylation is a novel pathomechanism for FTLD that is potentially amenable to targeted pharmacotherapy. PMID:24252647

  14. CpG ODN 1668 induce innate and adaptive immune responses in rock bream (Oplegnathus fasciatus) against rock bream iridovirus (RBIV) infection.

    PubMed

    Jung, Myung-Hwa; Jung, Sung-Ju

    2017-10-01

    Rock bream iridovirus (RBIV) causes severe mass mortalities in rock bream in Korea. CpG ODN 1668 showed promise as immunoprotective agents against RBIV infection in rock bream. In this study, we assessed innate/adaptive-related gene expression patterns in RBIV-infected rock bream with and without CpG ODN 1668 administration to determine important immune defense related factors that may affect fish survival. In the CpG ODN 1668+virus-injected group, virus copies were more than 7.4- to 790591-fold lower than in the virus-injected group at 4 d (8.79 × 10 4 and 6.58 × 10 5 /μl, respectively), 7 d (5.30 × 10 2 and 2.29 × 10 7 /μl, respectively) and 10 dpi (7.79 × 10 1 and 6.16 × 10 7 /μl, respectively). Furthermore, in the CpG ODN 1668+virus-injected group, significantly higher levels of MyD88 (6 h, 1 d, 4 d and 7 dpi), IL1β (1 d, 2 d and 7 dpi) and perforin/granzyme (1 dpi) expression were observed, whereas these genes were not significantly expressed in the virus-injected group at that time points. Mx, ISG15 and PKR were significantly highly expressed at 4 d and 7 dpi and reduced when low viral loads at 10 dpi in the CpG ODN 1668+virus-injected group. Conversely, in the virus-injected group, Mx, ISG15 and PKR expression were significantly higher than the control group until 10 dpi. However, MHC class I, CD8, Fas, Fas ligand and caspases (3, 8 and 9) expression levels showed no statistically significant differences between virus- and CpG ODN 1668+virus-injected group. In summary, CpG ODN 1668 administration in fish induces innate immune response or cell death pathway, which could be a major contributing factor to effective fish control over viral transcription on 4 d to 10 dpi. Expression of MyD88, IL1β, perforin and granzyme-related immune gene response is critical factor for inhibition of RBIV replication. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Targeting Stat3 in the myeloid compartment drastically improves the in vivo antitumor functions of adoptively transferred T cells

    PubMed Central

    Herrmann, Andreas; Kortylewski, Marcin; Kujawski, Maciej; Zhang, Chunyan; Reckamp, Karen; Armstrong, Brian; Wang, Lin; Kowolik, Claudia; Deng, Jiehui; Robert, Figlin; Yu, Hua

    2010-01-01

    Improving effector T cell functions is highly desirable for preventive or therapeutic interventions of diverse diseases. Stat3 in the myeloid compartment constrains Th-1 type immunity, dampening natural and induced antitumor immune responses. We have recently developed an in vivo siRNA delivery platform by conjugating a TLR9 agonist with siRNA that efficiently targets myeloid and B cells. Here we show that either ablating the Stat3 alleles in the myeloid compartment and B cells combined with CpG triggering or administrating the CpG-Stat3siRNA conjugates drastically augments effector functions of adoptively transferred CD8+ T cells. Specifically, we demonstrate that both approaches are capable of increasing dendritic cell and CD8+ T cell engagement in tumor draining lymph nodes. Furthermore, both approaches can significantly activate the transferred CD8+ T cells in vivo, upregulating effector molecules such as perforin, granzyme B and IFN-γ. Intravital multiphoton microscopy reveals that Stat3 silencing combined with CpG triggering greatly increases killing activity and tumor infiltration of transferred T cells. These results suggest the use of CpG-Stat3siRNA, and possibly other Stat3 inhibitors, as a potent adjuvant to improve T cell therapies. PMID:20841481

  16. Computational Modeling Approach in Probing the Effects of Cytosine Methylation on the Transcription Factor Binding to DNA.

    PubMed

    Tenayuca, John; Cousins, Kimberley; Yang, Shumei; Zhang, Lubo

    2017-01-01

    Cytosine methylation at CpG dinucleotides is a chief mechanism in epigenetic modification of gene expression patterns. Previous studies demonstrated that increased CpG methylation of Sp1 sites at -268 and -346 of protein kinase C ε promoter repressed the gene expression. The present study investigated the impact of CpG methylation on the Sp1 binding via molecular modeling and electrophoretic mobility shift assay. Each of the Sp1 sites contain two CpGs. Methylation of either CpG lowered the binding affinity of Sp1, whereas methylation of both CpGs produced a greater decrease in the binding affinity. Computation of van der Waals (VDW) energy of Sp1 in complex with the Sp1 sites demonstrated increased VDW values from one to two sites of CpG methylation. Molecular modeling indicated that single CpG methylation caused underwinding of the DNA fragment, with the phosphate groups at C1, C4 and C5 reoriented from their original positions. Methylation of both CpGs pinched the minor groove and increased the helical twist concomitant with a shallow, hydrophobic major groove. Additionally, double methylation eliminated hydrogen bonds on recognition helix residues located at positions -1 and 1, which were essential for interaction with O6/N7 of G-bases. Bonding from linker residues Arg565, Lys595 and Lys596 were also reduced. Methylation of single or both CpGs significantly affected hydrogen bonding from all three Sp1 DNA binding domains, demonstrating that the consequences of cytosine modification extend beyond the neighboring nucleotides. The results indicate that cytosine methylation causes subtle structural alterations in Sp1 binding sites consequently resulting in inhibition of side chain interactions critical for specific base recognition and reduction of the binding affinity of Sp1. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  17. Decreased IL-10 production mediated by Toll-like receptor 9 in B cells in multiple sclerosis.

    PubMed

    Hirotani, Makoto; Niino, Masaaki; Fukazawa, Toshiyuki; Kikuchi, Seiji; Yabe, Ichiro; Hamada, Shinsuke; Tajima, Yasutaka; Sasaki, Hidenao

    2010-04-15

    The complexity of the roles of Toll-like receptors (TLRs) is attributable to their ability to promote or suppress autoimmune diseases. Recent studies have demonstrated that B cells regulate autoimmune diseases, including multiple sclerosis (MS), by producing interleukin (IL)-10. By using CpG DNA as a TLR9 agonist, we investigated the immunoregulatory functions of B cell via TLR9 in MS. Our results indicate that TLR9-mediated IL-10 production by B cells was significantly decreased in MS, and this decrease is likely due to decreased TLR9 expression in memory B cells, suggesting a role of TLR9 in immunoregulation in MS. Copyright 2010 Elsevier B.V. All rights reserved.

  18. Adjuvant-carrying synthetic vaccine particles augment the immune response to encapsulated antigen and exhibit strong local immune activation without inducing systemic cytokine release

    PubMed Central

    Ilyinskii, Petr O.; Roy, Christopher J.; O’Neil, Conlin P.; Browning, Erica A.; Pittet, Lynnelle A.; Altreuter, David H.; Alexis, Frank; Tonti, Elena; Shi, Jinjun; Basto, Pamela A.; Iannacone, Matteo; Radovic-Moreno, Aleksandar F.; Langer, Robert S.; Farokhzad, Omid C.; von Andrian, Ulrich H.; Johnston, Lloyd P.M.; Kishimoto, Takashi Kei

    2014-01-01

    Augmentation of immunogenicity can be achieved by particulate delivery of an antigen and by its co-administration with an adjuvant. However, many adjuvants initiate strong systemic inflammatory reactions in vivo, leading to potential adverse events and safety concerns. We have developed a synthetic vaccine particle (SVP) technology that enables co-encapsulation of antigen with potent adjuvants. We demonstrate that co-delivery of an antigen with a TLR7/8 or TLR9 agonist in synthetic polymer nanoparticles results in a strong augmentation of humoral and cellular immune responses with minimal systemic production of inflammatory cytokines. In contrast, antigen encapsulated into nanoparticles and admixed with free TLR7/8 agonist leads to lower immunogenicity and rapid induction of high levels of inflammatory cytokines in the serum (e.g., TNF-α and IL-6 levels are 50- to 200-fold higher upon injection of free resiquimod (R848) than of nanoparticle-encapsulated R848). Conversely, local immune stimulation as evidenced by cellular infiltration of draining lymph nodes and by intranodal cytokine production was more pronounced and persisted longer when SVP-encapsulated TLR agonists were used. The strong local immune activation achieved using a modular self-assembling nanoparticle platform markedly enhanced immunogenicity and was equally effective whether antigen and adjuvant were co-encapsulated in a single nanoparticle formulation or co-delivered in two separate nanoparticles. Moreover, particle encapsulation enabled the utilization of CpG oligonucleotides with the natural phosphodiester backbone, which are otherwise rapidly hydrolyzed by nucleases in vivo. The use of SVP may enable clinical use of potent TLR agonists as vaccine adjuvants for indications where cellular immunity or robust humoral responses are required. PMID:24593999

  19. Formulation of vaccines containing CpG oligonucleotides and alum

    PubMed Central

    Aebig, Joan A.; Mullen, Gregory E. D.; Dobrescu, Gelu; Rausch, Kelly; Lambert, Lynn; Ajose-Popoola, Olubunmi; Long, Carole A.; Saul, Allan; Miles, Aaron P.

    2007-01-01

    CpG oligodeoxynucleotides are potent immunostimulants. For parenterally delivered alum based vaccines, the immunostimulatory effect of CpG depends on the association of the CpG and antigen to the alum. We describe effects of buffer components on the binding of CPG 7909 to aluminum hydroxide (Alhydrogel), assays for measuring binding of CPG 7909 to alum and CPG 7909 induced dissociation of antigen from the alum. Free CPG 7909 is a potent inducer of IP-10 in mice. However the lack of IP-10 production from formulations containing bound CPG 7909 suggested that CPG 7909 does not rapidly dissociate from the alum after injection. It also suggests that IP-10 assays are not a good basis for potency assays for alum based vaccines containing CPG 7909. PMID:17512533

  20. Interactions between Dorsal and Ventral Root Stimulation on the Generation of Locomotor-Like Activity in the Neonatal Mouse Spinal Cord

    PubMed Central

    2016-01-01

    Abstract We investigated whether dorsal (DR) and ventral root (VR) stimulus trains engage common postsynaptic components to activate the central pattern generator (CPG) for locomotion in the neonatal mouse spinal cord. VR stimulation did not activate the first order interneurons mediating the activation of the locomotor CPG by sacrocaudal afferent stimulation. Simultaneous stimulation of adjacent dorsal or ventral root pairs, subthreshold for evoking locomotor-like activity, did not summate to activate the CPG. This suggests that locomotor-like activity is triggered when a critical class of efferent or afferent axons is stimulated and does not depend on the number of stimulated axons or activated postsynaptic neurons. DR- and VR-evoked episodes exhibited differences in the coupling between VR pairs. In DR-evoked episodes, the coupling between the ipsilateral and contralateral flexor/extensor roots was similar and stronger than the bilateral extensor roots. In VR-evoked episodes, ipsilateral flexor/extensor coupling was stronger than both the contralateral flexor/extensor and the bilateral extensor coupling. For both types of stimulation, the coupling was greatest between the bilateral L1/L2 flexor-dominated roots. This indicates that the recruitment and/or the firing pattern of motoneurons differed in DR and VR-evoked episodes. However, the DR and VR trains do not appear to activate distinct CPGs because trains of DR and VR stimuli at frequencies too low to evoke locomotor-like activity did so when they were interleaved. These results indicate that the excitatory actions of VR stimulation converge onto the CPG through an unknown pathway that is not captured by current models of the locomotor CPG. PMID:27419215

  1. Prenatal antidepressant exposure associated with CYP2E1 DNA methylation change in neonates

    PubMed Central

    Gurnot, Cécile; Martin-Subero, Ignacio; Mah, Sarah M; Weikum, Whitney; Goodman, Sarah J; Brain, Ursula; Werker, Janet F; Kobor, Michael S; Esteller, Manel; Oberlander, Tim F; Hensch, Takao K

    2015-01-01

    Some but not all neonates are affected by prenatal exposure to serotonin reuptake inhibitor antidepressants (SRI) and maternal mood disturbances. Distinguishing the impact of these 2 exposures is challenging and raises critical questions about whether pharmacological, genetic, or epigenetic factors can explain the spectrum of reported outcomes. Using unbiased DNA methylation array measurements followed by a detailed candidate gene approach, we examined whether prenatal SRI exposure was associated with neonatal DNA methylation changes and whether such changes were associated with differences in birth outcomes. Prenatal SRI exposure was first associated with increased DNA methylation status primarily at CYP2E1(βNon-exposed = 0.06, βSRI-exposed = 0.30, FDR = 0); however, this finding could not be distinguished from the potential impact of prenatal maternal depressed mood. Then, using pyrosequencing of CYP2E1 regulatory regions in an expanded cohort, higher DNA methylation status—both the mean across 16 CpG sites (P < 0.01) and at each specific CpG site (P < 0.05)—was associated with exposure to lower 3rd trimester maternal depressed mood symptoms only in the SRI-exposed neonates, indicating a maternal mood x SRI exposure interaction. In addition, higher DNA methylation levels at CpG2 (P = 0.04), CpG9 (P = 0.04) and CpG10 (P = 0.02), in the interrogated CYP2E1 region, were associated with increased birth weight independently of prenatal maternal mood, SRI drug exposure, or gestational age at birth. Prenatal SRI antidepressant exposure and maternal depressed mood were associated with altered neonatal CYP2E1 DNA methylation status, which, in turn, appeared to be associated with birth weight. PMID:25891251

  2. Dendritic Cell-Based Immunotherapy of Breast Cancer: Modulation by CpG DNA

    DTIC Science & Technology

    2005-09-01

    tumor-associated antigens and bacterial DNA oligodeoxynucleotides containing unmethylated CpG sequences (CpG DNA) further augment the immune priming...associated antigens by cytotoxic T lymphocytes, and bacterial DNA oligodeoxy- nucleotides containing unmethylated CpG sequences (CpG DNA) can further...further amplify their immunostimulatory capacity and bacterial DNA oligodeoxynucleotides (ODN) containing unmethylated CpG sequences (CpG DNA) provide such

  3. Cancer immunotherapy: activating innate and adaptive immunity through CD40 agonists

    PubMed Central

    Beatty, Gregory L.; Li, Yan; Long, Kristen B.

    2017-01-01

    INTRODUCTION CD40 is a promising therapeutic target for cancer immunotherapy. In patients with advanced solid malignancies, CD40 agonists have demonstrated some anti-tumor activity and a manageable toxicity profile. A 2nd generation of CD40 agonists has now been designed with optimized Fc receptor (FcR) binding based on preclinical evidence suggesting a critical role for FcR engagement in defining the potency of CD40 agonists in vivo. AREAS COVERED We provide a comprehensive review using PubMed and Google Patent databases on the current clinical status of CD40 agonists, strategies for applying CD40 agonists in cancer therapy, and the preclinical data that supports and is guiding the future development of CD40 agonists. EXPERT COMMENTARY There is a wealth of preclinical data that provide rationale on several distinct approaches for using CD40 agonists in cancer immunotherapy. This data illustrates the need to strategically combine CD40 agonists with other clinically active treatment regimens in order to realize the full potential of activating CD40 in vivo. Thus, critical to the success of this class of immune-oncology drugs, which have the potential to restore both innate and adaptive immunosurveillance, will be the identification of biomarkers for monitoring and predicting responses as well as informing mechanisms of treatment resistance. PMID:27927088

  4. Liposomal SLA co-incorporated with PO CpG ODNs or PS CpG ODNs induce the same protection against the murine model of leishmaniasis.

    PubMed

    Shargh, Vahid Heravi; Jaafari, Mahmoud Reza; Khamesipour, Ali; Jaafari, Iman; Jalali, Seyed Amir; Abbasi, Azam; Badiee, Ali

    2012-06-06

    First generation Leishmania vaccines consisting of whole killed parasites with or without adjuvants have reached phase 3 trial and failed to show enough efficacy mainly due to the lack of an appropriate adjuvant. In this study, the nuclease-resistant phosphorothioate CpG oligodeoxynucleotides (PS CpG) or nuclease-sensitive phosphodiester CpG ODNs (PO CpG) were used as adjuvants to enhance immunogenicity and rate of protection against leishmaniasis. Due to the susceptibility of PO CpG to nuclease degradation, an efficient liposomal delivery system was developed to protect them from degradation. 1, 2-dioleoyl-3-trimethylammonium-propane (DOTAP) as a cationic lipid was used because of its unique adjuvanticity and electrostatic interaction with negatively charged CpG ODNs. To evaluate the role of liposomal formulation in protection rate and enhanced immune response, BALB/c mice were immunized subcutaneously with liposomal soluble Leishmania antigens (SLA) co-incorporated with PO CpG (Lip-SLA-PO CpG), Lip-SLA-PS CpG, SLA+PO CpG, SLA+PS CpG, SLA or buffer. As criteria for protection, footpad swelling at the site of challenge, parasite loads, the levels of IFN-γ and IL-4, and the IgG subtypes were evaluated. The groups of mice receiving Lip-SLA-PO CpG or Lip-SLA-PS CpG showed a high protection rate compared with the control groups. In addition, there was no significant difference in immune response generation between mice immunized with PS CpG and the group receiving PO CpG when incorporated into the liposomes. The results suggested that liposomal form of PO CpG might be used instead of PS CpG in future vaccine formulations as an efficient adjuvant. Copyright © 2012 Elsevier Ltd. All rights reserved.

  5. Fundamental differences in promoter CpG island DNA hypermethylation between human cancer and genetically engineered mouse models of cancer.

    PubMed

    Diede, Scott J; Yao, Zizhen; Keyes, C Chip; Tyler, Ashlee E; Dey, Joyoti; Hackett, Christopher S; Elsaesser, Katrina; Kemp, Christopher J; Neiman, Paul E; Weiss, William A; Olson, James M; Tapscott, Stephen J

    2013-12-01

    Genetic and epigenetic alterations are essential for the initiation and progression of human cancer. We previously reported that primary human medulloblastomas showed extensive cancer-specific CpG island DNA hypermethylation in critical developmental pathways. To determine whether genetically engineered mouse models (GEMMs) of medulloblastoma have comparable epigenetic changes, we assessed genome-wide DNA methylation in three mouse models of medulloblastoma. In contrast to human samples, very few loci with cancer-specific DNA hypermethylation were detected, and in almost all cases the degree of methylation was relatively modest compared with the dense hypermethylation in the human cancers. To determine if this finding was common to other GEMMs, we examined a Burkitt lymphoma and breast cancer model and did not detect promoter CpG island DNA hypermethylation, suggesting that human cancers and at least some GEMMs are fundamentally different with respect to this epigenetic modification. These findings provide an opportunity to both better understand the mechanism of aberrant DNA methylation in human cancer and construct better GEMMs to serve as preclinical platforms for therapy development.

  6. Effect of amino groups of mesoporous silica nanoparticles on CpG oligodexynucleotide delivery

    NASA Astrophysics Data System (ADS)

    Xu, Yi; Claiden, Peter; Zhu, Yufang; Morita, Hiromi; Hanagata, Nobutaka

    2015-08-01

    In this study, we proposed to modify mesoporous silica nanoparticles (MSNs) with 3-aminopropyltriethoxysilane (NH2-TES), aminoethylaminopropyltriethoxysilane (2NH2-TES) and 3-[2-(2-aminoethylamino)ethylamino] propyl-trimethoxysilane (3NH2-TES) for binding of cytosine-phosphate-guanosine oligodexynucleotides (CpG ODN), and investigated the effect of different amino groups of MSNs on the CpG ODN delivery. Serum stability, in vitro cytotoxicity, and cytokine interleukin-6 (IL-6) induction by MSN-NH2/CpG, MSN-2NH2/CpG and MSN-3NH2/CpG complexes were investigated in detail. The results showed that three kinds of aminated-MSN-based CpG ODN delivery systems had no cytotoxicity to RAW264.7 cells, and binding of CpG ODN to MSN-NH2, MSN-2NH2 and MSN-3NH2 nanoparticles enhanced the serum stability of CpG ODN due to protection by the nanoparticles. However, three aminated MSN-based CpG ODN delivery systems exhibited different CpG ODN delivery efficiency, and MSN-NH2/CpG complexes had the highest ability to induce IL-6 secretion.

  7. The CpG island searcher: a new WWW resource.

    PubMed

    Takai, Daiya; Jones, Peter A

    2003-01-01

    Clusters of CpG dinucleotides in GC rich regions of the genome called "CpG islands" frequently occur in the 5' ends of genes. Methylation of CpG islands plays a role in transcriptional silencing in higher organisms in certain situations. We have established a CpG-island-extraction algorithm, which we previously developed [Takai and Jones, 2002], on a web site which has a simple user interface to identify CpG islands from submitted sequences of up to 50kb. The web site determines the locations of CpG islands using parameters (lower limit of %GC, ObsCpG/ExpCpG, length) set by the user, to display the value of parameters on each CpG island, and provides a graphical map of CpG dinucleotide distribution and borders of CpG islands. A command-line version of the CpG islands searcher has also been developed for larger sequences. The CpG Island Searcher was applied to the latest sequence and mapping information of human chromosomes 20, 21 and 22, and a total of 2345 CpG islands were extracted and 534 (23%) of them contained first coding exons and 650 (28%) contained other exons. The CpG Island Searcher is available on the World Wide Web at http://www.cpgislands.com or http://www.uscnorris.com/cpgislands/cpg.cgi.

  8. Exploiting Semantic Web Technologies to Develop OWL-Based Clinical Practice Guideline Execution Engines.

    PubMed

    Jafarpour, Borna; Abidi, Samina Raza; Abidi, Syed Sibte Raza

    2016-01-01

    Computerizing paper-based CPG and then executing them can provide evidence-informed decision support to physicians at the point of care. Semantic web technologies especially web ontology language (OWL) ontologies have been profusely used to represent computerized CPG. Using semantic web reasoning capabilities to execute OWL-based computerized CPG unties them from a specific custom-built CPG execution engine and increases their shareability as any OWL reasoner and triple store can be utilized for CPG execution. However, existing semantic web reasoning-based CPG execution engines suffer from lack of ability to execute CPG with high levels of expressivity, high cognitive load of computerization of paper-based CPG and updating their computerized versions. In order to address these limitations, we have developed three CPG execution engines based on OWL 1 DL, OWL 2 DL and OWL 2 DL + semantic web rule language (SWRL). OWL 1 DL serves as the base execution engine capable of executing a wide range of CPG constructs, however for executing highly complex CPG the OWL 2 DL and OWL 2 DL + SWRL offer additional executional capabilities. We evaluated the technical performance and medical correctness of our execution engines using a range of CPG. Technical evaluations show the efficiency of our CPG execution engines in terms of CPU time and validity of the generated recommendation in comparison to existing CPG execution engines. Medical evaluations by domain experts show the validity of the CPG-mediated therapy plans in terms of relevance, safety, and ordering for a wide range of patient scenarios.

  9. Impact of the implementation of an evidence-based guideline on diagnostic testing, management, and clinical outcomes for infants with bronchiolitis

    PubMed Central

    Henao-Villada, Ricardo; Sossa-Briceño, Monica P.; Rodríguez-Martínez, Carlos E.

    2016-01-01

    Background: Although bronchiolitis poses a significant health problem in low- and middle-income countries (LMICs), to the best of our knowledge, to date it has not been determined whether evidence-based bronchiolitis clinical practice guidelines (CPGs) complemented by standardized educational strategies reduce the use of unnecessary diagnostic tests and medications and improve clinically important outcomes in LMICs. Methods: In an uncontrolled before and after study, we assessed the impact of the implementation of an evidence-based bronchiolitis CPG on physician behavior and the care of infants with bronchiolitis by comparing pre-guideline (March to August 2014) and post-guideline (March to August 2015) use of diagnostic tests and medications through an electronic medical record review in a children’s hospital in Bogota, Colombia. We also sought to assess the impact of the implementation of the CPG on clinically important outcomes such as lengths of stay, hospital admissions, intensive care admissions, and hospital readmissions. Results: Data from 662 cases of bronchiolitis (pre-guideline period) were compared with the data from 703 cases (post-guideline period). On comparing the pre- and post-guideline periods, it was seen that there was a significant increase in the proportion of patients with an appropriate diagnosis and treatment of bronchiolitis (36.4% versus 44.5%, p = 0.003), and there were statistically significant decreases in the use of a hemogram (33.2% versus 26.6%, p=0.010), procalcitonin (3.9% versus 1.6%, p=0.018), nebulized beta-2 agonists (45.6% versus 3.4%, p < 0.001), nebulized anticholinergics (3.3% versus 1.4%, p= 0.029), and nebulized epinephrine (16.2% versus 7.8%, p < 0.001). Likewise, a significant increase in the use of nebulized hypertonic saline was seen (79.6% versus 91.7%, p < 0.001). However, implementation of the CPG for bronchiolitis was not associated with significant changes in clinically important outcomes. Conclusions: The development and implementation of a good quality bronchiolitis CPG is associated with a significant increase in the proportion of cases with an appropriate diagnosis and treatment of the disease in the context of a university-based hospital located in the capital of an LMIC. However, we could not demonstrate an improvement in clinically important outcomes such as any of the bronchiolitis severity parameters. PMID:27492738

  10. Promoter methylation assay of SASH1 gene in hepatocellular carcinoma.

    PubMed

    Peng, Liu; Wei, He; Liren, Li

    2014-01-01

    To analyse the relationship between the expression of SASH1 and its methylation level in human hepatocellular carcinoma. Expression levels of SASH1 were examined with real-time PCR (RT-PCR) in tissues and cells, and methylation analysis was performed with MassArray. The expression levels of SASH1 were strongly reduced in liver cancer tissues compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed different CpG sites in SASH1 promoter shared similar methylation pattern between liver cancer tissues and adjacent normal tissues and the CpG sites of significant difference in methylation level were found as follows: CpG_3, CpG_17, CpG_21.22, CpG_25, CpG_26.27, CpG_28, CpG_34.35.36 and CpG_51.52. Moreover, 5-aza-2'-deoxycytidine treatment of Hep-G2 cell line caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation degree in the promoter region of SASH1 gene, particularly CpG_26.27 sites, possibly repressed SASH1 expression in liver cancer.

  11. Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.

    PubMed

    Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won

    2018-05-01

    DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. Identification of a boron nitride nanosphere-binding peptide for the intracellular delivery of CpG oligodeoxynucleotides

    NASA Astrophysics Data System (ADS)

    Zhang, Huijie; Yamazaki, Tomohiko; Zhi, Chunyi; Hanagata, Nobutaka

    2012-09-01

    CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications.CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications. Electronic supplementary information (ESI) available. See DOI: 10.1039/c2nr31189e

  13. Tim-3 is a Marker of Plasmacytoid Dendritic Cell Dysfunction during HIV Infection and Is Associated with the Recruitment of IRF7 and p85 into Lysosomes and with the Submembrane Displacement of TLR9.

    PubMed

    Schwartz, Jordan Ari; Clayton, Kiera L; Mujib, Shariq; Zhang, Hongliang; Rahman, A K M Nur-Ur; Liu, Jun; Yue, Feng Yun; Benko, Erika; Kovacs, Colin; Ostrowski, Mario A

    2017-04-15

    In chronic diseases, such as HIV infection, plasmacytoid dendritic cells (pDCs) are rendered dysfunctional, as measured by their decreased capacity to produce IFN-α. In this study, we identified elevated levels of T cell Ig and mucin-domain containing molecule-3 (Tim-3)-expressing pDCs in the blood of HIV-infected donors. The frequency of Tim-3-expressing pDCs correlated inversely with CD4 T cell counts and positively with HIV viral loads. A lower frequency of pDCs expressing Tim-3 produced IFN-α or TNF-α in response to the TLR7 agonists imiquimod and Sendai virus and to the TLR9 agonist CpG. Thus, Tim-3 may serve as a biomarker of pDC dysfunction in HIV infection. The source and function of Tim-3 was investigated on enriched pDC populations from donors not infected with HIV. Tim-3 induction was achieved in response to viral and artificial stimuli, as well as exogenous IFN-α, and was PI3K dependent. Potent pDC-activating stimuli, such as CpG, imiquimod, and Sendai virus, induced the most Tim-3 expression and subsequent dysfunction. Small interfering RNA knockdown of Tim-3 increased IFN-α secretion in response to activation. Intracellular Tim-3, as measured by confocal microscopy, was dispersed throughout the cytoplasm prior to activation. Postactivation, Tim-3 accumulated at the plasma membrane and associated with disrupted TLR9 at the submembrane. Tim-3-expressing pDCs had reduced IRF7 levels. Furthermore, intracellular Tim-3 colocalized with p85 and IRF7 within LAMP1 + lysosomes, suggestive of a role in degradation. We conclude that Tim-3 is a biomarker of dysfunctional pDCs and may negatively regulate IFN-α, possibly through interference with TLR signaling and recruitment of IRF7 and p85 into lysosomes, enhancing their degradation. Copyright © 2017 by The American Association of Immunologists, Inc.

  14. Herpes simplex virus 2-induced activation in vaginal cells involves Toll-like receptors 2 and 9 and DNA sensors DAI and IFI16.

    PubMed

    Triantafilou, Kathy; Eryilmazlar, Dilan; Triantafilou, Martha

    2014-02-01

    The pathway by which herpes simplex virus 2 (HSV2) triggers the innate immune system in the urogenital system has not as yet been fully elucidated. In this study, we aimed to determine which pattern recognition receptors (PRRs) recognize HSV2 in primary vaginal epithelial cells. Once we deciphered the receptors involved, we aimed to target them to immunomodulate innate responses as a prophylactic or therapeutic intervention for early HSV2 infection. To determine which PRRs are involved, receptor silencing as well as confocal microscopy was utilized. For immunomodulation, PRR agonists were utilized to induce a strong, local response to limit the infection, and we used 2 quantitative methods, flow cytometry and plaque assays, to determine their effect on HSV2 replication. Our results show that HSV2 is detected by a plethora of PRRs: Toll-like receptors (TLR) 2 as well as deoxyribonucleic acid (DNA) sensors TLR9, DNA-dependent activator of interferon regulatory factors, and to a lesser extent interferon-inducible 16, which trigger cytokine secretion to protect the host. Using PRR agonists, such as lipoproteins, CpG DNA, and cyclic dinucleotides, we could significantly limit HSV2 replication. Different PRRs are strategically placed in different cell locations to detect virus invasion. Use of agonists that target and activate these PRRs appeared to be effective in preventing primary HSV2 infection in vaginal cells and could provide new insights in defense against HSV2 urogenital infections. Copyright © 2014 Mosby, Inc. All rights reserved.

  15. Healthcare professionals' and policy makers' views on implementing a clinical practice guideline of hypertension management: a qualitative study.

    PubMed

    Lee, Ping Yein; Liew, Su May; Abdullah, Adina; Abdullah, Nurdiana; Ng, Chirk Jenn; Hanafi, Nik Sherina; Chia, Yook Chin; Lai, Pauline S M; Wong, Stalia S L; Khoo, Ee Ming

    2015-01-01

    Most studies have reported barriers to guideline usage mainly from doctors' perspective; few have reported the perspective of other stakeholders. This study aimed to determine the views and barriers to adherence of a national clinical practice guideline (CPG) on management of hypertension from the perspectives of policymakers, doctors and allied healthcare professionals. This study used a qualitative approach with purposive sampling. Seven in depth interviews and six focus group discussions were conducted with 35 healthcare professionals (policy makers, doctors, pharmacists and nurses) at a teaching hospital in Kuala Lumpur, Malaysia, between February and June 2013. All interviews were audio-recorded, transcribed verbatim and checked. Thematic approach was used to analyse the data. Two main themes and three sub-themes emerged from this study. The main themes were (1) variation in the use of CPG and (2) barriers to adherence to CPG. The three sub-themes for barriers were issues inherent to the CPG, systems and policy that is not supportive of CPG use, and attitudes and behaviour of stakeholders. The main users of the CPG were the primary care doctors. Pharmacists only partially use the guidelines, while nurses and policy makers were not using the CPG at all. Participants had suggested few strategies to improve usage and adherence to CPG. First, update the CPG regularly and keep its content simple with specific sections for allied health workers. Second, use technology to facilitate CPG accessibility and provide protected time for implementation of CPG recommendations. Third, incorporate local CPG in professional training, link CPG adherence to key performance indicators and provide incentives for its use. Barriers to the use of CPG hypertension management span across all stakeholders. The development and implementation of CPG focused mainly on doctors with lack of involvement of other healthcare stakeholders. Guidelines should be made simple, current, reliable, accessible, inclusive of all stakeholders and with good policy support.

  16. A Knowledge-Modeling Approach to Integrate Multiple Clinical Practice Guidelines to Provide Evidence-Based Clinical Decision Support for Managing Comorbid Conditions.

    PubMed

    Abidi, Samina

    2017-10-26

    Clinical management of comorbidities is a challenge, especially in a clinical decision support setting, as it requires the safe and efficient reconciliation of multiple disease-specific clinical procedures to formulate a comorbid therapeutic plan that is both effective and safe for the patient. In this paper we pursue the integration of multiple disease-specific Clinical Practice Guidelines (CPG) in order to manage co-morbidities within a computerized Clinical Decision Support System (CDSS). We present a CPG integration framework-termed as COMET (Comorbidity Ontological Modeling & ExecuTion) that manifests a knowledge management approach to model, computerize and integrate multiple CPG to yield a comorbid CPG knowledge model that upon execution can provide evidence-based recommendations for handling comorbid patients. COMET exploits semantic web technologies to achieve (a) CPG knowledge synthesis to translate a paper-based CPG to disease-specific clinical pathways (CP) that include specialized co-morbidity management procedures based on input from domain experts; (b) CPG knowledge modeling to computerize the disease-specific CP using a Comorbidity CPG ontology; (c) CPG knowledge integration by aligning multiple ontologically-modeled CP to develop a unified comorbid CPG knowledge model; and (e) CPG knowledge execution using reasoning engines to derive CPG-mediated recommendations for managing patients with comorbidities. We present a web-accessible COMET CDSS that provides family physicians with CPG-mediated comorbidity decision support to manage Atrial Fibrillation and Chronic Heart Failure. We present our qualitative and quantitative analysis of the knowledge content and usability of COMET CDSS.

  17. Immunostimulatory Properties of Lipid Modified CpG Oligonucleotides.

    PubMed

    Yu, Chunsong; An, Myunggi; Li, Meng; Liu, Haipeng

    2017-08-07

    Innate immune responses recognizing pathogen associated molecular patterns play important roles in adaptive immunity. As such, ligands which mimic the conserved products of microbial and activate innate immunity are widely used as adjuvants for vaccines. Synthetic single strand oligodeoxynucleotides (ODNs) containing unmethylated cytosine-guanine (CpG) motifs which bind Toll-like receptor 9 (TLR9) are powerful molecular adjuvants, potentiating both humoral and cellular responses. However, CpG ODN's in vitro potency has not been translated to in vivo settings primarily due to issues associated with delivery and toxicity. A major challenge in clinical application of CpG ODN is the efficient delivery to lymph nodes, the anatomic sites where all the immune responses are initiated. Targeting CpG to the key antigen presenting cells (APC) is essential for its application as a vaccine adjuvant, as it not only enhances CpG's efficacy, but also greatly reduces the systemic toxicity. We recently discovered an "albumin-hitchhiking" approach by which CpG ODNs were conjugated to a lipophilic lipid tail and follow subcutaneous injection, accumulated in lymph nodes by binding and transporting with endogenous albumin. This molecular approach targets CpG to antigen presenting cells in the draining lymph nodes via an endogenous albumin-mediated mechanism and simultaneously improves both the efficacy and safety of CpG as a vaccine adjuvant. Since CpG ODNs can be divided into structurally distinct classes, and each class of CpG ODN activates different types of immune cells and triggers different types of immunostimulatory activities, it is important to thoroughly evaluate the efficacy of this "albumin-hitchhiking" strategy in each class of CpG. Here we compare the immunostimulatory activities of three classes of lipid conjugated CpG ODNs in vitro and in vivo. Three representative sequences of lipid modified CpG ODNs were synthesized and their stimulatory effects as a vaccine adjuvant were evaluated. Our results showed that in vitro, lipid modified class A CpG exhibited enhanced stimulatory activities toward TLR transfected reporter cells or bone-marrow derived dendritic cells, whereas lipid-modification of class B or C CpG reduces the activation of TLR9 by 2-3 fold, as compared with unmodified class B and class C CpG, respectively. However, in vivo coadministration of ovalbumin (OVA) protein antigen mixed with lipid-conjugated class B or C CpG ODNs, but not class A CpGs induced dramatically increased OVA-specific humoral and cytotoxic CD8 + T cells responses compared with OVA mixed with unmodified CpGs. Further, lipid-modification greatly reduces the toxicity associated with CpG by minimizing the systemic dissemination. Taken together, these results demonstrated that amphiphilic modification of three classes of CpG motifs differentially affected and modulated the immunostimulatory activities in vitro and in vivo. Our study highlights the importance of in vivo lymph node targeting of CpG ODNs in fulfilling their use as vaccine adjuvants, providing implications for the rational design of molecular adjuvant for subunit vaccines.

  18. CpG island mapping by epigenome prediction.

    PubMed

    Bock, Christoph; Walter, Jörn; Paulsen, Martina; Lengauer, Thomas

    2007-06-01

    CpG islands were originally identified by epigenetic and functional properties, namely, absence of DNA methylation and frequent promoter association. However, this concept was quickly replaced by simple DNA sequence criteria, which allowed for genome-wide annotation of CpG islands in the absence of large-scale epigenetic datasets. Although widely used, the current CpG island criteria incur significant disadvantages: (1) reliance on arbitrary threshold parameters that bear little biological justification, (2) failure to account for widespread heterogeneity among CpG islands, and (3) apparent lack of specificity when applied to the human genome. This study is driven by the idea that a quantitative score of "CpG island strength" that incorporates epigenetic and functional aspects can help resolve these issues. We construct an epigenome prediction pipeline that links the DNA sequence of CpG islands to their epigenetic states, including DNA methylation, histone modifications, and chromatin accessibility. By training support vector machines on epigenetic data for CpG islands on human Chromosomes 21 and 22, we identify informative DNA attributes that correlate with open versus compact chromatin structures. These DNA attributes are used to predict the epigenetic states of all CpG islands genome-wide. Combining predictions for multiple epigenetic features, we estimate the inherent CpG island strength for each CpG island in the human genome, i.e., its inherent tendency to exhibit an open and transcriptionally competent chromatin structure. We extensively validate our results on independent datasets, showing that the CpG island strength predictions are applicable and informative across different tissues and cell types, and we derive improved maps of predicted "bona fide" CpG islands. The mapping of CpG islands by epigenome prediction is conceptually superior to identifying CpG islands by widely used sequence criteria since it links CpG island detection to their characteristic epigenetic and functional states. And it is superior to purely experimental epigenome mapping for CpG island detection since it abstracts from specific properties that are limited to a single cell type or tissue. In addition, using computational epigenetics methods we could identify high correlation between the epigenome and characteristics of the DNA sequence, a finding which emphasizes the need for a better understanding of the mechanistic links between genome and epigenome.

  19. Maternal BMI as a predictor of methylation of obesity-related genes in saliva samples from preschool-age Hispanic children at-risk for obesity.

    PubMed

    Oelsner, Kathryn Tully; Guo, Yan; To, Sophie Bao-Chieu; Non, Amy L; Barkin, Shari L

    2017-01-09

    The study of epigenetic processes and mechanisms present a dynamic approach to assess complex individual variation in obesity susceptibility. However, few studies have examined epigenetic patterns in preschool-age children at-risk for obesity despite the relevance of this developmental stage to trajectories of weight gain. We hypothesized that salivary DNA methylation patterns of key obesogenic genes in Hispanic children would 1) correlate with maternal BMI and 2) allow for identification of pathways associated with children at-risk for obesity. Genome-wide DNA methylation was conducted on 92 saliva samples collected from Hispanic preschool children using the Infinium Illumina HumanMethylation 450 K BeadChip (Illumina, San Diego, CA, USA), which interrogates >484,000 CpG sites associated with ~24,000 genes. The analysis was limited to 936 genes that have been associated with obesity in a prior GWAS Study. Child DNA methylation at 17 CpG sites was found to be significantly associated with maternal BMI, with increased methylation at 12 CpG sites and decreased methylation at 5 CpG sites. Pathway analysis revealed methylation at these sites related to homocysteine and methionine degradation as well as cysteine biosynthesis and circadian rhythm. Furthermore, eight of the 17 CpG sites reside in genes (FSTL1, SORCS2, NRF1, DLC1, PPARGC1B, CHN2, NXPH1) that have prior known associations with obesity, diabetes, and the insulin pathway. Our study confirms that saliva is a practical human tissue to obtain in community settings and in pediatric populations. These salivary findings indicate potential epigenetic differences in Hispanic preschool children at risk for pediatric obesity. Identifying early biomarkers and understanding pathways that are epigenetically regulated during this critical stage of child development may present an opportunity for prevention or early intervention for addressing childhood obesity. The clinical trial protocol is available at ClinicalTrials.gov ( NCT01316653 ). Registered 3 March 2011.

  20. CpG- and LPS-activated MAPK signaling in in vitro cultured salmon (Salmo salar) mononuclear phagocytes.

    PubMed

    Iliev, Dimitar B; Hansen, Tom; Jørgensen, Sven Martin; Krasnov, Aleksei; Jørgensen, Jorunn B

    2013-10-01

    The Mitogen-activated protein kinases (MAPK) are involved in transmitting intracellular signals downstream of diverse cell surface receptors and mediate the response to ligands such as growth factors, hormones and cytokines. In addition, MAPK are critically involved in the innate immune response to pathogen-derived substances, commonly referred to as pathogen-associated molecular patterns (PAMPs), such as bacterial lipopolysaccharide (LPS) and bacterial DNA rich in CpG dinucleotides. Currently, a great deal of knowledge is available about the involvement of MAPK in the innate immune response to PAMPs in mammals; however, little is known about the role of the different MAPK classes in the immune response to PAMPs in lower vertebrates. In the current study, p38 phosphorylation was induced by CpG oligonucleotides (ODNs) and LPS in primary salmon mononuclear phagocytes. Pre-treatment of the cells with a p38 inhibitor (SB203580) blocked the PAMP-induced p38 activity and suppressed the upregulation of most of the CpG- and LPS-induced transcripts highlighting the role of this kinase in the salmon innate immune response to PAMPs. In contrast to p38, the phosphorylation of extracellular signal-regulated kinase (ERK), a MAPK involved primarily in response to mitogens, was high in resting cells and, surprisingly, incubation with both CpG and control ODNs downregulated the phospho-ERK levels independently of p38 activation. The basal phospho-ERK level and the CpG-inducible p38 phosphorylation were greatly influenced by the length of in vitro incubation. The basal phospho-ERK level increased gradually throughout a 5-day culture period and was PI3K-dependent as demonstrated by its sensitivity to Wortmannin suggesting it is influenced by growth factors. Overall these data indicate that both basal and PAMP-induced activity of MAPKs might be greatly influenced by the differentiation status of salmon mononuclear phagocytes. Copyright © 2013. Published by Elsevier Ltd.

  1. Unraveling Molecular Signatures of Immunostimulatory Adjuvants in the Female Genital Tract through Systems Biology

    PubMed Central

    Brinkenberg, Ingrid; Samuelson, Emma; Thörn, Karolina; Nielsen, Jens; Harandi, Ali M.

    2011-01-01

    Sexually transmitted infections (STIs) unequivocally represent a major public health concern in both industrialized and developing countries. Previous efforts to develop vaccines for systemic immunization against a large number of STIs in humans have been unsuccessful. There is currently a drive to develop mucosal vaccines and adjuvants for delivery through the genital tract to confer protective immunity against STIs. Identification of molecular signatures that can be used as biomarkers for adjuvant potency can inform rational development of potent mucosal adjuvants. Here, we used systems biology to study global gene expression and signature molecules and pathways in the mouse vagina after treatment with two classes of experimental adjuvants. The Toll-like receptor 9 agonist CpG ODN and the invariant natural killer T cell agonist alpha-galactosylceramide, which we previously identified as equally potent vaginal adjuvants, were selected for this study. Our integrated analysis of genome-wide transcriptome data determined which signature pathways, processes and networks are shared by or otherwise exclusive to these 2 classes of experimental vaginal adjuvants in the mouse vagina. To our knowledge, this is the first integrated genome-wide transcriptome analysis of the effects of immunomodulatory adjuvants on the female genital tract of a mammal. These results could inform rational development of effective mucosal adjuvants for vaccination against STIs. PMID:21666746

  2. Methylation levels of the "long interspersed nucleotide element-1" repetitive sequences predict survival of melanoma patients.

    PubMed

    Sigalotti, Luca; Fratta, Elisabetta; Bidoli, Ettore; Covre, Alessia; Parisi, Giulia; Colizzi, Francesca; Coral, Sandra; Massarut, Samuele; Kirkwood, John M; Maio, Michele

    2011-05-26

    The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients.

  3. A DNA methylation fingerprint of 1628 human samples

    PubMed Central

    Fernandez, Agustin F.; Assenov, Yassen; Martin-Subero, Jose Ignacio; Balint, Balazs; Siebert, Reiner; Taniguchi, Hiroaki; Yamamoto, Hiroyuki; Hidalgo, Manuel; Tan, Aik-Choon; Galm, Oliver; Ferrer, Isidre; Sanchez-Cespedes, Montse; Villanueva, Alberto; Carmona, Javier; Sanchez-Mut, Jose V.; Berdasco, Maria; Moreno, Victor; Capella, Gabriel; Monk, David; Ballestar, Esteban; Ropero, Santiago; Martinez, Ramon; Sanchez-Carbayo, Marta; Prosper, Felipe; Agirre, Xabier; Fraga, Mario F.; Graña, Osvaldo; Perez-Jurado, Luis; Mora, Jaume; Puig, Susana; Prat, Jaime; Badimon, Lina; Puca, Annibale A.; Meltzer, Stephen J.; Lengauer, Thomas; Bridgewater, John; Bock, Christoph; Esteller, Manel

    2012-01-01

    Most of the studies characterizing DNA methylation patterns have been restricted to particular genomic loci in a limited number of human samples and pathological conditions. Herein, we present a compromise between an extremely comprehensive study of a human sample population with an intermediate level of resolution of CpGs at the genomic level. We obtained a DNA methylation fingerprint of 1628 human samples in which we interrogated 1505 CpG sites. The DNA methylation patterns revealed show this epigenetic mark to be critical in tissue-type definition and stemness, particularly around transcription start sites that are not within a CpG island. For disease, the generated DNA methylation fingerprints show that, during tumorigenesis, human cancer cells underwent a progressive gain of promoter CpG-island hypermethylation and a loss of CpG methylation in non-CpG-island promoters. Although transformed cells are those in which DNA methylation disruption is more obvious, we observed that other common human diseases, such as neurological and autoimmune disorders, had their own distinct DNA methylation profiles. Most importantly, we provide proof of principle that the DNA methylation fingerprints obtained might be useful for translational purposes by showing that we are able to identify the tumor type origin of cancers of unknown primary origin (CUPs). Thus, the DNA methylation patterns identified across the largest spectrum of samples, tissues, and diseases reported to date constitute a baseline for developing higher-resolution DNA methylation maps and provide important clues concerning the contribution of CpG methylation to tissue identity and its changes in the most prevalent human diseases. PMID:21613409

  4. Modeling non-syndromic autism and the impact of TRPC6 disruption in human neurons.

    PubMed

    Griesi-Oliveira, K; Acab, A; Gupta, A R; Sunaga, D Y; Chailangkarn, T; Nicol, X; Nunez, Y; Walker, M F; Murdoch, J D; Sanders, S J; Fernandez, T V; Ji, W; Lifton, R P; Vadasz, E; Dietrich, A; Pradhan, D; Song, H; Ming, G-L; Gu, X; Haddad, G; Marchetto, M C N; Spitzer, N; Passos-Bueno, M R; State, M W; Muotri, A R

    2015-11-01

    An increasing number of genetic variants have been implicated in autism spectrum disorders (ASDs), and the functional study of such variants will be critical for the elucidation of autism pathophysiology. Here, we report a de novo balanced translocation disruption of TRPC6, a cation channel, in a non-syndromic autistic individual. Using multiple models, such as dental pulp cells, induced pluripotent stem cell (iPSC)-derived neuronal cells and mouse models, we demonstrate that TRPC6 reduction or haploinsufficiency leads to altered neuronal development, morphology and function. The observed neuronal phenotypes could then be rescued by TRPC6 complementation and by treatment with insulin-like growth factor-1 or hyperforin, a TRPC6-specific agonist, suggesting that ASD individuals with alterations in this pathway may benefit from these drugs. We also demonstrate that methyl CpG binding protein-2 (MeCP2) levels affect TRPC6 expression. Mutations in MeCP2 cause Rett syndrome, revealing common pathways among ASDs. Genetic sequencing of TRPC6 in 1041 ASD individuals and 2872 controls revealed significantly more nonsynonymous mutations in the ASD population, and identified loss-of-function mutations with incomplete penetrance in two patients. Taken together, these findings suggest that TRPC6 is a novel predisposing gene for ASD that may act in a multiple-hit model. This is the first study to use iPSC-derived human neurons to model non-syndromic ASD and illustrate the potential of modeling genetically complex sporadic diseases using such cells.

  5. Predicting aberrant CpG island methylation

    PubMed Central

    Feltus, F. A.; Lee, E. K.; Costello, J. F.; Plass, C.; Vertino, P. M.

    2003-01-01

    Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context. PMID:14519846

  6. Predicting aberrant CpG island methylation.

    PubMed

    Feltus, F A; Lee, E K; Costello, J F; Plass, C; Vertino, P M

    2003-10-14

    Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context.

  7. Implementation of antibiotic use guidelines for fresh traumatic wound at Siriraj Hospital.

    PubMed

    Sirijatuphat, Rujipas; Choochan, Tanatchon; Siritongtaworn, Preecha; Sripojtham, Vipaporn; Thamlikitkul, Visanu

    2015-03-01

    To determine the effectiveness of implementing a clinical practice guideline (CPG) on antibiotic use for adults with fresh traumatic wounds who attended the trauma center at Siriraj Hospital, Bangkok. A prospective study of 600 adult patients who had fresh traumatic wounds (≤ 6 hours) was conducted at Siriraj Trauma Center from March 2013 to March 2014. The CPG was introduced to physicians, nurses and medical students by posting the CPG at the patient care areas of the trauma center. The outcomes were an appropriate classification of wounds according to the CPG recommendations, prevalence of antibiotic prescribing, incidence of wound infection and compliance with the CPG. Clean-contaminated wounds that did not need antibiotic treatment and clean-contaminated and contaminated wounds that required antibiotics were observed in 63.2, 6.7, and 30.1% ofthe patients, respectively. Antibiotics were given to 512 patients (85.3%). Infections occurred in six patients (1.0%). Antibiotic prescription according to CPG recommendations was observed for 243 patients (40.5%). The prevalence of antibiotic use in the CPG-compliant group (65.8%) was significantly less than that in the CPG-noncompliant group (98.6%) (p < 0.001). The patients in the CPG-compliant group had more contaminated wounds than those in the CPG-noncompliant group (51.4 vs. 15.7%, p < 0.001). The incidences of wound infection were very low in both groups and not significantly different (1.2 vs. 0.8%, p = 0.690). Antibiotic prophylaxis was necessary in less than 36.8% of adults with fresh traumatic wounds who attended Siriraj Trauma Center Compliance to CPG implementation using simple intervention seemed to be low. Adhering to CPG recommendations for antibiotic prophylaxis in adults with fresh traumatic wounds can reduce the unnecessary prescribing of antibiotics without increasing the rate of wound infection.

  8. Depletion of CpG Dinucleotides in Papillomaviruses and Polyomaviruses: A Role for Divergent Evolutionary Pressures.

    PubMed

    Upadhyay, Mohita; Vivekanandan, Perumal

    2015-01-01

    Papillomaviruses and polyomaviruses are small ds-DNA viruses infecting a wide-range of vertebrate hosts. Evidence supporting co-evolution of the virus with the host does not fully explain the evolutionary path of papillomaviruses and polyomaviruses. Studies analyzing CpG dinucleotide frequencies in virus genomes have provided interesting insights on virus evolution. CpG dinucleotide depletion has not been extensively studied among papillomaviruses and polyomaviruses. We sought to analyze the relative abundance of dinucleotides and the relative roles of evolutionary pressures in papillomaviruses and polyomaviruses. We studied 127 full-length sequences from papillomaviruses and 56 full-length sequences from polyomaviruses. We analyzed the relative abundance of dinucleotides, effective codon number (ENC), differences in synonymous codon usage. We examined the association, if any, between the extent of CpG dinucleotide depletion and the evolutionary lineage of the infected host. We also investigated the contribution of mutational pressure and translational selection to the evolution of papillomaviruses and polyomaviruses. All papillomaviruses and polyomaviruses are CpG depleted. Interestingly, the evolutionary lineage of the infected host determines the extent of CpG depletion among papillomaviruses and polyomaviruses. CpG dinucleotide depletion was more pronounced among papillomaviruses and polyomaviruses infecting human and other mammals as compared to those infecting birds. Our findings demonstrate that CpG depletion among papillomaviruses is linked to mutational pressure; while CpG depletion among polyomaviruses is linked to translational selection. We also present evidence that suggests methylation of CpG dinucleotides may explain, at least in part, the depletion of CpG dinucleotides among papillomaviruses but not polyomaviruses. The extent of CpG depletion among papillomaviruses and polyomaviruses is linked to the evolutionary lineage of the infected host. Our results highlight the existence of divergent evolutionary pressures leading to CpG dinucleotide depletion among small ds-DNA viruses infecting vertebrate hosts.

  9. Methylation levels of the "long interspersed nucleotide element-1" repetitive sequences predict survival of melanoma patients

    PubMed Central

    2011-01-01

    Background The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Methods Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Results Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). Conclusion LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients. PMID:21615918

  10. Chitosan-coated boron nitride nanospheres enhance delivery of CpG oligodeoxynucleotides and induction of cytokines

    PubMed Central

    Zhang, Huijie; Chen, Song; Zhi, Chunyi; Yamazaki, Tomohiko; Hanagata, Nobutaka

    2013-01-01

    Background Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides activate Toll-like receptor 9, leading to induction of proinflammatory cytokines, which play an important role in induction and maintenance of innate and adaptive immune responses. Previously, we have used boron nitride nanospheres (BNNS) as a carrier for delivery of unmodified CpG oligodeoxynucleotides to activate Toll-like receptor 9. However, because CpG oligodeoxynucleotides and BNNS are both negatively charged, electrostatic repulsion between them is likely to reduce the loading of CpG oligodeoxynucleotides onto BNNS. Therefore, the efficiency of uptake of CpG oligodeoxynucleotides is also limited and does not result in induction of a robust cytokine response. To ameliorate these problems, we developed a CpG oligodeoxynucleotide delivery system using chitosan-coated BNNS as a carrier. Methods To facilitate attachment of CpG oligodeoxynucleotides onto the BNNS and improve their loading capacity, we prepared positively charged BNNS by coating them with chitosan preparations of three different molecular weights and used them as carriers for delivery of CpG oligodeoxynucleotides. Results The zeta potentials of the BNNS-CS complexes were positive, and chitosan coating improved their dispersity and stability in aqueous solution compared with BNNS. The positive charge of the BNNS-CS complexes greatly improved the loading capacity and cellular uptake efficiency of CpG oligodeoxynucleotides. The loading capacity of the CpG oligodeoxynucleotides depended on the molecular weight of chitosan, which affected the positive charge density on the surface of the BNNS. CpG oligodeoxynucleotides loaded onto BNNS-CS complexes significantly enhanced production of interleukin-6 and tumor necrosis factor-α by peripheral blood mononuclear cells compared with CpG oligodeoxynucleotides directly loaded onto BNNS, or when Lipofectamine™ 2000 was used as the carrier. The molecular weight of the chitosan used to coat the BNNS affected the magnitude of cytokine induction by varying the strength of condensation of the CpG oligodeoxynucleotides. Conclusion Although the loading capacity of BNNS coated with low molecular weight chitosan preparations was the lowest of all the preparations, they induced the highest levels of cytokines. PMID:23674892

  11. Emergent central pattern generator behavior in chemical coupled two-compartment models with time delay

    NASA Astrophysics Data System (ADS)

    Li, Shanshan; Zhang, Guoshan; Wang, Jiang; Chen, Yingyuan; Deng, Bin

    2018-02-01

    This paper proposes that modified two-compartment Pinsky-Rinzel (PR) neural model can be used to develop the simple form of central pattern generator (CPG). The CPG is called as 'half-central oscillator', which constructed by two inhibitory chemical coupled PR neurons with time delay. Some key properties of PR neural model related to CPG are studied and proved to meet the requirements of CPG. Using the simple CPG network, we first study the relationship between rhythmical output and key factors, including ambient noise, sensory feedback signals, morphological character of single neuron as well as the coupling delay time. We demonstrate that, appropriate intensity noise can enhance synchronization between two coupled neurons. Different output rhythm of CPG network can be entrained by sensory feedback signals. We also show that the morphology of single neuron has strong effect on the output rhythm. The phase synchronization indexes decrease with the increase of morphology parameter's difference. Through adjusting coupled delay time, we can get absolutely phase synchronization and antiphase state of CPG. Those results of simulation show the feasibility of PR neural model as a valid CPG as well as the emergent behaviors of the particularly CPG.

  12. Combinations of various CpG motifs cloned into plasmid backbone modulate and enhance protective immunity of viral replicon DNA anthrax vaccines.

    PubMed

    Yu, Yun-Zhou; Ma, Yao; Xu, Wen-Hui; Wang, Shuang; Sun, Zhi-Wei

    2015-08-01

    DNA vaccines are generally weak stimulators of the immune system. Fortunately, their efficacy can be improved using a viral replicon vector or by the addition of immunostimulatory CpG motifs, although the design of these engineered DNA vectors requires optimization. Our results clearly suggest that multiple copies of three types of CpG motifs or combinations of various types of CpG motifs cloned into a viral replicon vector backbone with strong immunostimulatory activities on human PBMC are efficient adjuvants for these DNA vaccines to modulate and enhance protective immunity against anthrax, although modifications with these different CpG forms in vivo elicited inconsistent immune response profiles. Modification with more copies of CpG motifs elicited more potent adjuvant effects leading to the generation of enhanced immunity, which indicated a CpG motif dose-dependent enhancement of antigen-specific immune responses. Notably, the enhanced and/or synchronous adjuvant effects were observed in modification with combinations of two different types of CpG motifs, which provides not only a contribution to the knowledge base on the adjuvant activities of CpG motifs combinations but also implications for the rational design of optimal DNA vaccines with combinations of CpG motifs as "built-in" adjuvants. We describe an efficient strategy to design and optimize DNA vaccines by the addition of combined immunostimulatory CpG motifs in a viral replicon DNA plasmid to produce strong immune responses, which indicates that the CpG-modified viral replicon DNA plasmid may be desirable for use as vector of DNA vaccines.

  13. Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides

    PubMed Central

    Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

    2015-01-01

    CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS–PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS–PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS–PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS–PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS–PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS–PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α. PMID:26346655

  14. Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides.

    PubMed

    Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

    2015-01-01

    CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS-PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS-PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS-PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS-PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS-PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS-PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α.

  15. Toll-like receptor prestimulation increases phagocytosis of Escherichia coli DH5alpha and Escherichia coli K1 strains by murine microglial cells.

    PubMed

    Ribes, Sandra; Ebert, Sandra; Czesnik, Dirk; Regen, Tommy; Zeug, Andre; Bukowski, Stephanie; Mildner, Alexander; Eiffert, Helmut; Hanisch, Uwe-Karsten; Hammerschmidt, Sven; Nau, Roland

    2009-01-01

    Meningitis and meningoencephalitis caused by Escherichia coli are associated with high rates of mortality. When an infection occurs, Toll-like receptors (TLRs) expressed by microglial cells can recognize pathogen-associated molecular patterns and activate multiple steps in the inflammatory response that coordinate the brain's local defense, such as phagocytosis of invading pathogens. An upregulation of the phagocytic ability of reactive microglia could improve the host defense in immunocompromised patients against pathogens such as E. coli. Here, murine microglial cultures were stimulated with the TLR agonists Pam(3)CSK(4) (TLR1/TLR2), lipopolysaccharide (TLR4), and CpG oligodeoxynucleotide (TLR9) for 24 h. Upon stimulation, levels of tumor necrosis factor alpha and the neutrophil chemoattractant CXCL1 were increased, indicating microglial activation. Phagocytic activity was studied after adding either E. coli DH5alpha or E. coli K1 strains. After 60 and 90 min of bacterial exposure, the number of ingested bacteria was significantly higher in cells prestimulated with TLR agonists than in unstimulated controls (P < 0.01). Addition of cytochalasin D, an inhibitor of actin polymerization, blocked >90% of phagocytosis. We also analyzed the ability of microglia to kill the ingested E. coli strains. Intracellularly surviving bacteria were quantified at different time points (90, 150, 240, and 360 min) after 90 min of phagocytosis. The number of bacteria killed intracellularly after 6 h was higher in cells primed with the different TLR agonists than in unstimulated microglia. Our data suggest that microglial stimulation by the TLR system can increase bacterial phagocytosis and killing. This approach could improve central nervous system resistance to infections in immunocompromised patients.

  16. Toll-like receptors 9 and 3 as essential components of innate immune defense against mouse cytomegalovirus infection.

    PubMed

    Tabeta, Koichi; Georgel, Philippe; Janssen, Edith; Du, Xin; Hoebe, Kasper; Crozat, Karine; Mudd, Suzanne; Shamel, Louis; Sovath, Sosathya; Goode, Jason; Alexopoulou, Lena; Flavell, Richard A; Beutler, Bruce

    2004-03-09

    Several subsets of dendritic cells have been shown to produce type I IFN in response to viral infections, thereby assisting the natural killer cell-dependent response that eliminates the pathogen. Type I IFN production can be induced both by unmethylated CpG-oligodeoxynucleotide and by double-stranded RNA. Here, we describe a codominant CpG-ODN unresponsive phenotype that results from an N-ethyl-N-nitrosourea-induced missense mutation in the Tlr9 gene (Tlr9(CpG1)). Mice homozygous for the Tlr9(CpG1) allele are highly susceptible to mouse cytomegalovirus infection and show impaired infection-induced secretion of IFN-alpha/beta and natural killer cell activation. We also demonstrate that both the Toll-like receptor (TLR) 9 --> MyD88 and TLR3 --> Trif signaling pathways are activated in vivo on viral inoculation, and that each pathway contributes to innate defense against systemic viral infection. Whereas both pathways lead to type I IFN production, neither pathway offers full protection against mouse cytomegalovirus infection in the absence of the other. The Tlr9(CpG1) mutation alters a leucine-rich repeat motif and lies within a receptor domain that is conserved within the evolutionary cluster encompassing TLRs 7, 8, and 9. In other TLRs, including three mouse-specific TLRs described in this paper, the affected region is not represented. The phenotypic effect of the Tlr9(CpG1) allele thus points to a critical role for TLR9 in viral sensing and identifies a vulnerable amino acid within the ectodomain of three TLR proteins, essential for a ligand response.

  17. Biomimetically Engineered Demi-Bacteria Potentiate Vaccination against Cancer.

    PubMed

    Ni, Dezhi; Qing, Shuang; Ding, Hui; Yue, Hua; Yu, Di; Wang, Shuang; Luo, Nana; Su, Zhiguo; Wei, Wei; Ma, Guanghui

    2017-10-01

    Failure in enhancing antigen immunogenicity has limited the development of cancer vaccine. Inspired by effective immune responses toward microorganisms, demi-bacteria (DB) from Bacillus are engineered as carriers for cancer vaccines. The explored hydrothermal treatment enables the Bacillus to preserve optimal pathogen morphology with intrinsic mannose receptor agonist. Meanwhile, the treated Bacillus can be further endowed with ideal hollow/porous structure for efficient accommodation of antigen and adjuvant, such as CpG. Therefore, this optimal engineered nanoarchitecture allows multiple immunostimulatory elements integrate in a pattern closely resembling that of bacterial pathogens. Such pathogen mimicry greatly enhances antigen uptake and cross-presentation, resulting in stronger immune activation suitable for cancer vaccines. Indeed, DB-based biomimetic vaccination in mice induces synergistic cellular and humoral immune responses, achieving potent therapeutic and preventive effects against cancer. Application of microorganism-sourced materials thus presents new opportunities for potent cancer therapy.

  18. Biomimetically Engineered Demi‐Bacteria Potentiate Vaccination against Cancer

    PubMed Central

    Ni, Dezhi; Qing, Shuang; Ding, Hui; Yue, Hua; Yu, Di; Wang, Shuang; Luo, Nana; Su, Zhiguo

    2017-01-01

    Abstract Failure in enhancing antigen immunogenicity has limited the development of cancer vaccine. Inspired by effective immune responses toward microorganisms, demi‐bacteria (DB) from Bacillus are engineered as carriers for cancer vaccines. The explored hydrothermal treatment enables the Bacillus to preserve optimal pathogen morphology with intrinsic mannose receptor agonist. Meanwhile, the treated Bacillus can be further endowed with ideal hollow/porous structure for efficient accommodation of antigen and adjuvant, such as CpG. Therefore, this optimal engineered nanoarchitecture allows multiple immunostimulatory elements integrate in a pattern closely resembling that of bacterial pathogens. Such pathogen mimicry greatly enhances antigen uptake and cross‐presentation, resulting in stronger immune activation suitable for cancer vaccines. Indeed, DB‐based biomimetic vaccination in mice induces synergistic cellular and humoral immune responses, achieving potent therapeutic and preventive effects against cancer. Application of microorganism‐sourced materials thus presents new opportunities for potent cancer therapy. PMID:29051851

  19. Neuromodulation intrinsic to the central pattern generator for escape swimming in Tritonia.

    PubMed

    Katz, P S

    1998-11-16

    Extrinsic neuromodulatory inputs to central pattern generators (CPGs) can alter the properties and synaptic interactions of neurons in those circuits and thereby modify the output of the CPG. Recent work in a number of systems has now demonstrated that neurons intrinsic to CPG can also evoke neuromodulatory actions on other members of the CPG. Such "intrinsic neuromodulation" plays a role in controlling the CPG underlying the escape swim response of the nudibrach mollusc, Tritonia diomedea. The dorsal swim interneurons (DSIs) are a bilaterally represented set of three serotonergic neurons that participate in the generation of the rhythmic swim motor program. Serotonin released from these CPG neurons functions both as a fast neurotransmitter and as a slower neuromodulator. In its modulatory role, serotonin enhances the release of neurotransmitter from another CPG neuron, C2, and also increases C2 excitability by decreasing spike frequency adaptation. These neuromodulatory actions intrinsic to the CPG may be important for the initial self-configuration of the system into a function CPG and for experience-dependent changes in the output such as behavioral sensitization and habituation.

  20. A UML approach to process modelling of clinical practice guidelines for enactment.

    PubMed

    Knape, T; Hederman, L; Wade, V P; Gargan, M; Harris, C; Rahman, Y

    2003-01-01

    Although clinical practice guidelines (CPGs) have been suggested as a means of encapsulating best practice in evidence-based medical treatment, their usage in clinical environments has been disappointing. Criticisms of guideline representations have been that they are predominantly narrative and are difficult to incorporate into clinical information systems. This paper analyses the use of UML process modelling techniques for guideline representation and proposes the automated generation of executable guidelines using XMI. This hybrid UML-XMI approach provides flexible authoring of guideline decision and control structures whilst integrating appropriate data flow. It also uses an open XMI standard interface to allow the use of authoring tools and process control systems from multiple vendors. The paper first surveys CPG modelling formalisms followed by a brief introduction to process modelling in UMI. Furthermore, the modelling of CPGs in UML is presented leading to a case study of encoding a diabetes mellitus CPG using UML.

  1. Conserved nonsense-prone CpG sites in apoptosis-regulatory genes: conditional stop signs on the road to cell death.

    PubMed

    Zhao, Yongzhong; Epstein, Richard J

    2013-01-01

    Methylation-prone CpG dinucleotides are strongly conserved in the germline, yet are also predisposed to somatic mutation. Here we quantify the relationship between germline codon mutability and somatic carcinogenesis by comparing usage of the nonsense-prone CGA (→TGA) codons in gene groups that differ in apoptotic function; to this end, suppressor genes were subclassified as either apoptotic (gatekeepers) or repair (caretakers). Mutations affecting CGA codons in sporadic tumors proved to be highly asymmetric. Moreover, nonsense mutations were 3-fold more likely to affect gatekeepers than caretakers. In addition, intragenic CGA clustering nonrandomly affected functionally critical regions of gatekeepers. We conclude that human gatekeeper suppressor genes are enriched for nonsense-prone codons, and submit that this germline vulnerability to tumors could reflect in utero selection for a methylation-dependent capability to short-circuit environmental insults that otherwise trigger apoptosis and fetal loss.

  2. DNA methylation markers in combination with skeletal and dental ages to improve age estimation in children.

    PubMed

    Shi, Lei; Jiang, Fan; Ouyang, Fengxiu; Zhang, Jun; Wang, Zhimin; Shen, Xiaoming

    2018-03-01

    Age estimation is critical in forensic science, in competitive sports and games and in other age-related fields, but the current methods are suboptimal. The combination of age-associated DNA methylation markers with skeletal age (SA) and dental age (DA) may improve the accuracy and precision of age estimation, but no study has examined this topic. In the current study, we measured SA (GP, TW3-RUS, and TW3-Carpal methods) and DA (Demirjian and Willems methods) by X-ray examination in 124 Chinese children (78 boys and 46 girls) aged 6-15 years. To identify age-associated CpG sites, we analyzed methylome-wide DNA methylation profiling by using the Illumina HumanMethylation450 BeadChip system in 48 randomly selected children. Five CpG sites were identified as associated with chronologic age (CA), with an absolute value of Pearson's correlation coefficient (r)>0.5 (p<0.01) and a false discovery rate<0.01. The validation of age-associated CpG sites was performed using droplet digital PCR techniques in all 124 children. After validation, four CpG sites for boys and five CpG sites for girls were further adopted to build the age estimation model with SA and DA using multivariate linear stepwise regressions. These CpG sites were located at 4 known genes: DDO, PRPH2, DHX8, and ITGA2B and at one unknown gene with the Illumina ID number of 22398226. The accuracy of age estimation methods was compared according to the mean absolute error (MAE) and root mean square error (RMSE). The best single measure for SA was the TW3-RUS method (MAE=0.69years, RMSE=0.95years) in boys, and the GP method (MAE=0.74years, RMSE=0.94years) in girls. For DA, the Willems method was the best single measure for both boys (MAE=0.63years, RMSE=0.78years) and girls (MAE=0.54years, RMSE=0.68years). The models that incorporated SA and DA with the methylation levels of age-associated CpG sites provided the highest accuracy of age estimation in both boys (MAE=0.47years, R 2 =0.886) and girls (MAE=0.33years, R 2 =0.941). Cross validation of the results confirmed the reliability and validity of the models. In conclusion, age-associated DNA methylation markers in combination with SA and DA greatly improve the accuracy of age estimation in Chinese children. This method may be applied in forensic science, in competitive sports and games and in other age-related fields. Copyright © 2017. Published by Elsevier B.V.

  3. Effect of CpG dinucleotides within IgH switch region repeats on immunoglobulin class switch recombination.

    PubMed

    Zhang, Zheng Z; Hsieh, Chih-Lin; Okitsu, Cindy Yen; Han, Li; Yu, Kefei; Lieber, Michael R

    2015-08-01

    Immunoglobulin (Ig) heavy chains undergo class switch recombination (CSR) to change the heavy chain isotype from IgM to IgG, A or E. The switch regions are several kilobases long, repetitive, and G-rich on the nontemplate strand. They are also relatively depleted of CpG (also called CG) sites for unknown reasons. Here we use synthetic switch regions at the IgH switch alpha (Sα) locus to test the effect of CpG sites and to try to understand why the IgH switch sequences evolved to be relatively depleted of CpG. We find that even just two CpG sites within an 80 bp synthetic switch repeat iterated 15 times (total switch region length of 1200 bp containing 30 CpG sites) are sufficient to dramatically reduce both Ig CSR and transcription through the switch region from the upstream Iα sterile transcript promoter, which is the promoter that directs transcripts through the Sα region. De novo DNA methylation occurs at the four CpG sites in and around the Iα promoter when each 80 bp Iα switch repeat contains the two CpG sites. Thus, a relatively low density of CpG sites within the switch repeats can induce upstream CpG methylation at the IgH alpha locus, and cause a substantial decrease in transcription from the sterile transcript promoter. This effect is likely the reason that switch regions evolved to contain very few CpG sites. We discuss these findings as they relate to DNA methylation and to Ig CSR. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Targeted-bisulfite sequence analysis of the methylation of CpG islands in genes encoding PNPLA3, SAMM50, and PARVB of patients with non-alcoholic fatty liver disease.

    PubMed

    Kitamoto, Takuya; Kitamoto, Aya; Ogawa, Yuji; Honda, Yasushi; Imajo, Kento; Saito, Satoru; Yoneda, Masato; Nakamura, Takahiro; Nakajima, Atsushi; Hotta, Kikuko

    2015-08-01

    The pathogenesis of non-alcoholic fatty liver disease (NAFLD) is affected by epigenetic factors as well as by genetic variation. We performed targeted-bisulfite sequencing to determine the levels of DNA methylation of 4 CpG islands (CpG99, CpG71, CpG26, and CpG101) in the regulatory regions of PNPLA3, SAMM50, PARVB variant 1, and PARVB variant 2, respectively. We compared the levels of methylation of DNA in the livers of the first and second sets of patients with mild (fibrosis stages 0 and 1) or advanced (fibrosis stages 2 to 4) NAFLD and in those of patients with mild (F0 to F2) or advanced (F3 and F4) chronic hepatitis C infection. The hepatic mRNA levels of PNPLA3, SAMM50, and PARVB were measured using qPCR. CpG26, which resides in the regulatory region of PARVB variant 1, was markedly hypomethylated in the livers of patients with advanced NAFLD. Conversely, CpG99 in the regulatory region of PNPLA3 was substantially hypermethylated in these patients. These differences in DNA methylation were replicated in a second set of patients with NAFLD or chronic hepatitis C. PNPLA3 mRNA levels in the liver of the same section of a biopsy specimen used for genomic DNA preparation were lower in patients with advanced NAFLD compared with those with mild NAFLD and correlated inversely with CpG99 methylation in liver DNA. Moreover, the levels of CpG99 methylation and PNPLA3 mRNA were affected by the rs738409 genotype. Hypomethylation of CpG26 and hypermethylation of CpG99 may contribute to the severity of fibrosis in patients with NAFLD or chronic hepatitis C infection. Copyright © 2015 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

  5. Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

    PubMed Central

    Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

    2001-01-01

    Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

  6. GaussianCpG: a Gaussian model for detection of CpG island in human genome sequences.

    PubMed

    Yu, Ning; Guo, Xuan; Zelikovsky, Alexander; Pan, Yi

    2017-05-24

    As crucial markers in identifying biological elements and processes in mammalian genomes, CpG islands (CGI) play important roles in DNA methylation, gene regulation, epigenetic inheritance, gene mutation, chromosome inactivation and nuclesome retention. The generally accepted criteria of CGI rely on: (a) %G+C content is ≥ 50%, (b) the ratio of the observed CpG content and the expected CpG content is ≥ 0.6, and (c) the general length of CGI is greater than 200 nucleotides. Most existing computational methods for the prediction of CpG island are programmed on these rules. However, many experimentally verified CpG islands deviate from these artificial criteria. Experiments indicate that in many cases %G+C is < 50%, CpG obs /CpG exp varies, and the length of CGI ranges from eight nucleotides to a few thousand of nucleotides. It implies that CGI detection is not just a straightly statistical task and some unrevealed rules probably are hidden. A novel Gaussian model, GaussianCpG, is developed for detection of CpG islands on human genome. We analyze the energy distribution over genomic primary structure for each CpG site and adopt the parameters from statistics of Human genome. The evaluation results show that the new model can predict CpG islands efficiently by balancing both sensitivity and specificity over known human CGI data sets. Compared with other models, GaussianCpG can achieve better performance in CGI detection. Our Gaussian model aims to simplify the complex interaction between nucleotides. The model is computed not by the linear statistical method but by the Gaussian energy distribution and accumulation. The parameters of Gaussian function are not arbitrarily designated but deliberately chosen by optimizing the biological statistics. By using the pseudopotential analysis on CpG islands, the novel model is validated on both the real and artificial data sets.

  7. Critical Advances in Wound Care

    DTIC Science & Technology

    2011-01-24

    Wound Limb Salvage Program WRAMC/NNMC Inpatient Care Wound and Ostomy NNMC and WRAMC Outpatient Care 2 Clinics over 400 complex encounters NNMC and... Ostomy Wound care Skin Care Cleansers Research / EBP Pressure ulcer protocol CPG development Wound education research grant WRNMMC wound care formulary...Algorithm Sibbald, Orstead, Schultz, Coutts, Keast. Preparing the Wound Bed – Focus on Infection and Inflammation. Ostomy Wound Manag 49:24-51

  8. DNA methylome profiling identifies novel methylated genes in African American patients with colorectal neoplasia.

    PubMed

    Ashktorab, Hassan; Daremipouran, M; Goel, Ajay; Varma, Sudhir; Leavitt, R; Sun, Xueguang; Brim, Hassan

    2014-04-01

    The identification of genes that are differentially methylated in colorectal cancer (CRC) has potential value for both diagnostic and therapeutic interventions specifically in high-risk populations such as African Americans (AAs). However, DNA methylation patterns in CRC, especially in AAs, have not been systematically explored and remain poorly understood. Here, we performed DNA methylome profiling to identify the methylation status of CpG islands within candidate genes involved in critical pathways important in the initiation and development of CRC. We used reduced representation bisulfite sequencing (RRBS) in colorectal cancer and adenoma tissues that were compared with DNA methylome from a healthy AA subject's colon tissue and peripheral blood DNA. The identified methylation markers were validated in fresh frozen CRC tissues and corresponding normal tissues from AA patients diagnosed with CRC at Howard University Hospital. We identified and validated the methylation status of 355 CpG sites located within 16 gene promoter regions associated with CpG islands. Fifty CpG sites located within CpG islands-in genes ATXN7L1 (2), BMP3 (7), EID3 (15), GAS7 (1), GPR75 (24), and TNFAIP2 (1)-were significantly hypermethylated in tumor vs. normal tissues (P<0.05). The methylation status of BMP3, EID3, GAS7, and GPR75 was confirmed in an independent, validation cohort. Ingenuity pathway analysis mapped three of these markers (GAS7, BMP3 and GPR) in the insulin and TGF-β1 network-the two key pathways in CRC. In addition to hypermethylated genes, our analysis also revealed that LINE-1 repeat elements were progressively hypomethylated in the normal-adenoma-cancer sequence. We conclude that DNA methylome profiling based on RRBS is an effective method for screening aberrantly methylated genes in CRC. While previous studies focused on the limited identification of hypermethylated genes, ours is the first study to systematically and comprehensively identify novel hypermethylated genes, as well as hypomethylated LINE-1 sequences, which may serve as potential biomarkers for CRC in African Americans. Our discovered biomarkers were intimately linked to the insulin/TGF-B1 pathway, further strengthening the association of diabetic disorders with colon oncogenic transformation.

  9. Carbon nanotubes enhance CpG uptake and potentiate antiglioma immunity.

    PubMed

    Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J; Badie, Behnam

    2011-02-15

    Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Because TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNT) as a CpG delivery vehicle in brain tumor models. Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and antiglioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated proinflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (>3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term antitumor immunity. These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. ©2010 AACR.

  10. CpG Dinucleotide Frequencies Reveal the Role of Host Methylation Capabilities in Parvovirus Evolution

    PubMed Central

    Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James

    2013-01-01

    Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to “fractional” methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses. PMID:24109231

  11. Nanoparticle conjugation enhances the immunomodulatory effects of intranasally delivered CpG in house dust mite-allergic mice

    DOE PAGES

    Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre; ...

    2015-09-21

    An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatorymore » therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.« less

  12. Carbon Nanotubes Enhance CpG Uptake and Potentiate Anti-Glioma Immunity

    PubMed Central

    Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J.; Badie, Behnam

    2010-01-01

    Purpose Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Since TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNTs) as a CpG delivery vehicle in brain tumor models. Experimental Design Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and anti-glioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. Results CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated pro-inflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (> 3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term anti-tumor immunity. Conclusions These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. PMID:21088258

  13. CpG dinucleotide frequencies reveal the role of host methylation capabilities in parvovirus evolution.

    PubMed

    Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James; Vivekanandan, Perumal

    2013-12-01

    Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to "fractional" methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses.

  14. Immunostimulatory Oligodeoxynucleotides Containing the CpG Motif are Effective as Immune Adjuvants in Tumor Antigen Immunization

    NASA Astrophysics Data System (ADS)

    Weiner, George J.; Liu, Hsin-Ming; Wooldridge, James E.; Dahle, Christopher E.; Krieg, Arthur M.

    1997-09-01

    Recent advances in our understanding of the immune response are allowing for the logical design of new approaches to cancer immunization. One area of interest is the development of new immune adjuvants. Immunostimulatory oligodeoxynucleotides containing the CpG motif (CpG ODN) can induce production of a wide variety of cytokines and activate B cells, monocytes, dendritic cells, and NK cells. Using the 38C13 B cell lymphoma model, we assessed whether CpG ODN can function as immune adjuvants in tumor antigen immunization. The idiotype served as the tumor antigen. Select CpG ODN were as effective as complete Freund's adjuvant at inducing an antigen-specific antibody response but were associated with less toxicity. These CpG ODN induced a higher titer of antigen-specific IgG2a than did complete Freund's adjuvant, suggesting an enhanced TH1 response. Mice immunized with CpG ODN as an adjuvant were protected from tumor challenge to a degree similar to that seen in mice immunized with complete Freund's adjuvant. We conclude that CpG ODN are effective as immune adjuvants and are attractive as part of a tumor immunization strategy.

  15. DNA containing CpG motifs induces angiogenesis

    NASA Astrophysics Data System (ADS)

    Zheng, Mei; Klinman, Dennis M.; Gierynska, Malgorzata; Rouse, Barry T.

    2002-06-01

    New blood vessel formation in the cornea is an essential step in the pathogenesis of a blinding immunoinflammatory reaction caused by ocular infection with herpes simplex virus (HSV). By using a murine corneal micropocket assay, we found that HSV DNA (which contains a significant excess of potentially bioactive "CpG" motifs when compared with mammalian DNA) induces angiogenesis. Moreover, synthetic oligodeoxynucleotides containing CpG motifs attract inflammatory cells and stimulate the release of vascular endothelial growth factor (VEGF), which in turn triggers new blood vessel formation. In vitro, CpG DNA induces the J774A.1 murine macrophage cell line to produce VEGF. In vivo CpG-induced angiogenesis was blocked by the administration of anti-mVEGF Ab or the inclusion of "neutralizing" oligodeoxynucleotides that specifically oppose the stimulatory activity of CpG DNA. These findings establish that DNA containing bioactive CpG motifs induces angiogenesis, and suggest that CpG motifs in HSV DNA may contribute to the blinding lesions of stromal keratitis.

  16. [Quality and compliance with Clinical Practice Guidelines of Chronic Noncommunicable Diseases in primary care].

    PubMed

    Poblano-Verástegui, Ofelia; Vieyra-Romero, Waldo I; Galván-García, Ángel F; Fernández-Elorriaga, María; Rodríguez-Martínez, Antonia I; Saturno-Hernández, Pedro J

    2017-01-01

    To assess the quality and compliance of clinical practice guidelines (CPG) applicable to chronic non-communicable diseases (CNCD) in primary healthcare (CS), and views of staff on the barriers, facilitators and their use. 18 valued CPG with AGREEII, 3 are selected to develop indicators and assess compliance using lot quality acceptance sample (LQAS, standard 75 / 95% threshold 40 / 75% respectively, α:0. 05, β:0. 10) on 5 CS. 70 professionals surveyed about knowledge and use of CPG. Average quality of the CPG was 57.2%; low rating in domains: "Applicability" (<25%), "Stakeholder involvement" (43.5%) and "Rigour of development" (55.0%). Compliance in CS ranges from 39 to 53.4%. Professionals show uneven knowledge of CPG; 44 to 45% (according to CPG), they declare that they are not used, they identify as main barriers the lack of training, and their difficult accessibility and management. The quality and implementation of evaluated CPG is deficient constituting an opportunity of improvement in health services.

  17. DNA-inorganic hybrid nanovaccine for cancer immunotherapy

    NASA Astrophysics Data System (ADS)

    Zhu, Guizhi; Liu, Yijing; Yang, Xiangyu; Kim, Young-Hwa; Zhang, Huimin; Jia, Rui; Liao, Hsien-Shun; Jin, Albert; Lin, Jing; Aronova, Maria; Leapman, Richard; Nie, Zhihong; Niu, Gang; Chen, Xiaoyuan

    2016-03-01

    Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy.Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy. Electronic supplementary information (ESI) available: ESI materials and methods, characterization of hNVs. See DOI: 10.1039/c5nr08821f

  18. An Animal Model of Abacavir-Induced HLA-Mediated Liver Injury.

    PubMed

    Song, Binbin; Aoki, Shigeki; Liu, Cong; Susukida, Takeshi; Ito, Kousei

    2018-04-01

    Genome-wide association studies indicate that several idiosyncratic adverse drug reactions are highly associated with specific human leukocyte antigen (HLA) alleles. For instance, abacavir, a human immunodeficiency virus reverse transcriptase inhibitor, induces multiorgan toxicity exclusively in patients carrying the HLA-B*57:01 allele. However, the underlying mechanism is unclear due to a lack of appropriate animal models. Previously, we developed HLA-B*57:01 transgenic mice and found that topical application of abacavir to the ears induced proliferation of CD8+ lymphocytes in local lymph nodes. Here, we attempted to reproduce abacavir-induced liver injury in these mice. However, oral administration of abacavir alone to HLA-B*57:01 transgenic mice did not increase levels of the liver injury marker alanine aminotransferase. Considering the importance of innate immune activation in mouse liver, we treated mice with CpG oligodeoxynucleotide, a toll-like receptor 9 agonist, plus abacavir. This resulted in a marked increase in alanine aminotransferase, pathological changes in liver, increased numbers of activated CD8+ T cells, and tissue infiltration by immune cells exclusively in HLA-B*57:01 transgenic mice. These results indicate that CpG oligodeoxynucleotide-induced inflammatory reactions and/or innate immune activation are necessary for abacavir-induced HLA-mediated liver injury characterized by infiltration of CD8+ T cells. Thus, we developed the first mouse model of HLA-mediated abacavir-induced idiosyncratic liver injury. Further investigation will show that the proposed HLA-mediated liver injury model can be applied to other combinations of drugs and HLA types, thereby improving drug development and contributing to the development of personalized medicine.

  19. Activation of the Alternative NFκB Pathway Improves Disease Symptoms in a Model of Sjogren's Syndrome

    PubMed Central

    Gilboa-Geffen, Adi; Wolf, Yochai; Hanin, Geula; Melamed-Book, Naomi; Pick, Marjorie; Bennett, Estelle R.; Greenberg, David S.; Lester, Susan; Rischmueller, Maureen; Soreq, Hermona

    2011-01-01

    The purpose of our study was to understand if Toll-like receptor 9 (TLR9) activation could contribute to the control of inflammation in Sjogren's syndrome. To this end, we manipulated TLR9 signaling in non-obese diabetic (NOD) and TLR9−/− mice using agonistic CpG oligonucleotide aptamers, TLR9 inhibitors, and the in-house oligonucleotide BL-7040. We then measured salivation, inflammatory response markers, and expression of proteins downstream to NF-κB activation pathways. Finally, we labeled proteins of interest in salivary gland biopsies from Sjogren's syndrome patients, compared to Sicca syndrome controls. We show that in NOD mice BL-7040 activates TLR9 to induce an alternative NF-κB activation mode resulting in increased salivation, elevated anti-inflammatory response in salivary glands, and reduced peripheral AChE activity. These effects were more prominent and also suppressible by TLR9 inhibitors in NOD mice, but TLR9−/− mice were resistant to the salivation-promoting effects of CpG oligonucleotides and BL-7040. Last, salivary glands from Sjogren's disease patients showed increased inflammatory and decreased anti-inflammatory biomarkers, in addition to decreased levels of alternative NF-κB pathway proteins. In summary, we have demonstrated that activation of TLR9 by BL-7040 leads to non-canonical activation of NF-κB, promoting salivary functioning and down-regulating inflammation. We propose that BL-7040 could be beneficial in treating Sjogren's syndrome and may be applicable to additional autoimmune syndromes. PMID:22174879

  20. Exposure to welding fumes is associated with hypomethylation of the F2RL3 gene: a cardiovascular disease marker

    PubMed Central

    Hossain, Mohammad B; Li, Huiqi; Hedmer, Maria; Tinnerberg, Håkan; Albin, Maria; Broberg, Karin

    2015-01-01

    Background Welders are at risk for cardiovascular disease. Recent studies linked tobacco smoke exposure to hypomethylation of the F2RL3 (coagulation factor II (thrombin) receptor-like 3) gene, a marker for cardiovascular disease prognosis and mortality. However, whether welding fumes cause hypomethylation of F2RL3 remains unknown. Methods We investigated 101 welders (median span of working as a welder: 7 years) and 127 unexposed controls (non-welders with no obvious exposure to respirable dust at work), age range 23–60 years, all currently non-smoking, in Sweden. The participants were interviewed about their work history, lifestyle factors and diseases. Personal sampling of respirable dust was performed for the welders. DNA methylation of F2RL3 in blood was assessed by pyrosequencing of four CpG sites, CpG_2 (corresponds to cg03636183) to CpG_5, in F2RL3. Multivariable linear regression analysis was used to assess the association between exposure to welding fumes and F2RL3 methylation. Results Welders had 2.6% lower methylation of CpG_5 than controls (p<0.001). Higher concentrations of measured respirable dust among the welders were associated with hypomethylation of CpG_2, CpG_4 and CpG_5 (β=−0.49 to −1.4, p<0.012); p<0.029 adjusted for age, previous smoking, passive smoking, education, current residence and respirator use. Increasing the number of years working as a welder was associated with hypomethylation of CpG_4 (linear regression analysis, β=−0.11, p=0.039, adjusted for previous smoking). Previous tobacco smokers had 1.5–4.7% (p<0.014) lower methylation of 3 of the 4 CpG sites in F2RL3 (CpG_2, CpG_4 and CpG_5) compared to never-smokers. A non-significant lower risk of cardiovascular disease with more methylation was observed for all CpG sites. Conclusions Welding fumes exposure and previous smoking were associated with F2RL3 hypomethylation. This finding links low-to-moderate exposure to welding fumes to adverse effects on the cardiovascular system, and suggests a potential mechanistic pathway for this link, via epigenetic effects on F2RL3 expression. PMID:26395445

  1. Association of the CpG Methylation Pattern of the Proximal Insulin Gene Promoter with Type 1 Diabetes

    PubMed Central

    Fradin, Delphine; Le Fur, Sophie; Mille, Clémence; Naoui, Nadia; Groves, Chris; Zelenika, Diana; McCarthy, Mark I.; Lathrop, Mark; Bougnères, Pierre

    2012-01-01

    The insulin (INS) region is the second most important locus associated with Type 1 Diabetes (T1D). The study of the DNA methylation pattern of the 7 CpGs proximal to the TSS in the INS gene promoter revealed that T1D patients have a lower level of methylation of CpG -19, -135 and -234 (p = 2.10−16) and a higher methylation of CpG -180 than controls, while methylation was comparable for CpG -69, -102, -206. The magnitude of the hypomethylation relative to a control population was 8–15% of the corresponding levels in controls and was correlated in CpGs -19 and -135 (r = 0.77) and CpG -135 and -234 (r = 0.65). 70/485 (14%) of T1D patients had a simultaneous decrease in methylation of CpG -19, -135, -234 versus none in 317 controls. CpG methylation did not correlate with glycated hemoglobin or with T1D duration. The methylation of CpG -69, -102, -180, -206, but not CpG -19, -135, -234 was strongly influenced by the cis-genotype at rs689, a SNP known to show a strong association with T1D. We hypothesize that part of this genetic association could in fact be mediated at the statistical and functional level by the underlying changes in neighboring CpG methylation. Our observation of a CpG-specific, locus-specific methylation pattern, although it can provide an epigenetic biomarker of a multifactorial disease, does not indicate whether the reported epigenetic pattern preexists or follows the establishment of T1D. To explore the effect of chronic hyperglycemia on CpG methylation, we studied non obese patients with type 2 diabetes (T2D) who were found to have decreased CpG-19 methylation versus age-matched controls, similar to T1D (p = 2.10−6) but increased CpG-234 methylation (p = 5.10−8), the opposite of T1D. The causality and natural history of the different epigenetic changes associated with T1D or T2D remain to be determined. PMID:22567146

  2. CpG PatternFinder: a Windows-based utility program for easy and rapid identification of the CpG methylation status of DNA.

    PubMed

    Xu, Yi-Hua; Manoharan, Herbert T; Pitot, Henry C

    2007-09-01

    The bisulfite genomic sequencing technique is one of the most widely used techniques to study sequence-specific DNA methylation because of its unambiguous ability to reveal DNA methylation status to the order of a single nucleotide. One characteristic feature of the bisulfite genomic sequencing technique is that a number of sample sequence files will be produced from a single DNA sample. The PCR products of bisulfite-treated DNA samples cannot be sequenced directly because they are heterogeneous in nature; therefore they should be cloned into suitable plasmids and then sequenced. This procedure generates an enormous number of sample DNA sequence files as well as adding extra bases belonging to the plasmids to the sequence, which will cause problems in the final sequence comparison. Finding the methylation status for each CpG in each sample sequence is not an easy job. As a result CpG PatternFinder was developed for this purpose. The main functions of the CpG PatternFinder are: (i) to analyze the reference sequence to obtain CpG and non-CpG-C residue position information. (ii) To tailor sample sequence files (delete insertions and mark deletions from the sample sequence files) based on a configuration of ClustalW multiple alignment. (iii) To align sample sequence files with a reference file to obtain bisulfite conversion efficiency and CpG methylation status. And, (iv) to produce graphics, highlighted aligned sequence text and a summary report which can be easily exported to Microsoft Office suite. CpG PatternFinder is designed to operate cooperatively with BioEdit, a freeware on the internet. It can handle up to 100 files of sample DNA sequences simultaneously, and the total CpG pattern analysis process can be finished in minutes. CpG PatternFinder is an ideal software tool for DNA methylation studies to determine the differential methylation pattern in a large number of individuals in a population. Previously we developed the CpG Analyzer program; CpG PatternFinder is our further effort to create software tools for DNA methylation studies.

  3. [Comparative evaluation of clinical practice guidelines for the treatment of schizophrenia].

    PubMed

    Delessert, D; Pomini, V; Grasset, F; Baumann, P

    2008-01-01

    Many clinical practice guidelines (CPG) have been published in reply to the development of the concept of "evidence-based medicine" (EBM) and as a solution to the difficulty of synthesizing and selecting relevant medical literature. Taking into account the expansion of new CPG, the question of choice arises: which CPG to consider in a given clinical situation? It is of primary importance to evaluate the quality of the CPG, but until recently, there has been no standardized tool of evaluation or comparison of the quality of the CPG. An instrument of evaluation of the quality of the CPG, called "AGREE" for appraisal of guidelines for research and evaluation was validated in 2002. The six principal CPG concerning the treatment of schizophrenia are compared with the help of the "AGREE" instrument: (1) "the Agence nationale pour le développement de l'évaluation médicale (ANDEM) recommendations"; (2) "The American Psychiatric Association (APA) practice guideline for the treatment of patients with schizophrenia"; (3) "The quick reference guide of APA practice guideline for the treatment of patients with schizophrenia"; (4) "The schizophrenia patient outcomes research team (PORT) treatment recommendations"; (5) "The Texas medication algorithm project (T-MAP)" and (6) "The expert consensus guideline for the treatment of schizophrenia". The results of our study were then compared with those of a similar investigation published in 2005, structured on 24 CPG tackling the treatment of schizophrenia. The "AGREE" tool was also used by two investigators in their study. In general, the scores of the two studies differed little and the two global evaluations of the CPG converged; however, each of the six CPG is perfectible. The rigour of elaboration of the six CPG was in general average. The consideration of the opinion of potential users was incomplete, and an effort made in the presentation of the recommendations would facilitate their clinical use. Moreover, there was little consideration by the authors regarding the applicability of the recommendations. Globally, two CPG are considered as strongly recommended: "the quick reference guide of the APA practice guideline for the treatment of patients with schizophrenia" and "the T-MAP".

  4. Clinical practice guidelines (CPGs) reduce costs in the management of isolated splenic injuries at pediatric trauma centers.

    PubMed

    Gutierrez, Ivan M; Zurakowski, David; Chen, Qiaoli; Mooney, David P

    2013-02-01

    The American Pediatric Surgical Association Trauma Committee proposed the use of a clinical practice guideline (CPG) for the non-operative management of isolated splenic injuries in 1998. An analysis was conducted to determine the financial impact of CPGs on the management of these injuries. The Pediatric Health Information System database, which contains data from 44 children's hospitals, was used to identify children who sustained a graded isolated splenic injury between June 2005 and June 2010. Demographics, length of stay (LOS), readmission rates, and laboratory, imaging, procedural, and total cost data were determined for all hospitals verified as a pediatric trauma center by the American College of Surgeons and/or designated by their local authority. Comparisons were made between facilities self-identifying as having a splenic injury management CPG and those without a CPG. Children (1,154) with isolated splenic injuries (grades 1-4) were cared for in 26 pediatric trauma centers: 20 with a CPG and 6 without (non-CPG). Median costs were significantly lower at CPG than non-CPG centers for imaging (US $163 vs. US $641, P < .001), laboratory (US $629 vs. US $1,044, P < .001), and total hospital stay (US $9,868 vs. US $10,830, P < .001). The median LOS for CPG and non-CPG centers were similar (3 vs. 2 days, P = .38), as were readmission rates within 90 days (3.1 vs. 5.1 %, P = .21). Multiple linear regression indicated that LOS (P < .001) and utilization of a CPG (P = .007) are significant independent predictors of total cost. Utilization of a CPG to manage children with isolated splenic injuries at a pediatric trauma center results in significantly reduced imaging, laboratory, and total hospital costs independent of patient age, gender, grade, and LOS.

  5. Performance of Different Analytical Software Packages in Quantification of DNA Methylation by Pyrosequencing.

    PubMed

    Grasso, Chiara; Trevisan, Morena; Fiano, Valentina; Tarallo, Valentina; De Marco, Laura; Sacerdote, Carlotta; Richiardi, Lorenzo; Merletti, Franco; Gillio-Tos, Anna

    2016-01-01

    Pyrosequencing has emerged as an alternative method of nucleic acid sequencing, well suited for many applications which aim to characterize single nucleotide polymorphisms, mutations, microbial types and CpG methylation in the target DNA. The commercially available pyrosequencing systems can harbor two different types of software which allow analysis in AQ or CpG mode, respectively, both widely employed for DNA methylation analysis. Aim of the study was to assess the performance for DNA methylation analysis at CpG sites of the two pyrosequencing software which allow analysis in AQ or CpG mode, respectively. Despite CpG mode having been specifically generated for CpG methylation quantification, many investigations on this topic have been carried out with AQ mode. As proof of equivalent performance of the two software for this type of analysis is not available, the focus of this paper was to evaluate if the two modes currently used for CpG methylation assessment by pyrosequencing may give overlapping results. We compared the performance of the two software in quantifying DNA methylation in the promoter of selected genes (GSTP1, MGMT, LINE-1) by testing two case series which include DNA from paraffin embedded prostate cancer tissues (PC study, N = 36) and DNA from blood fractions of healthy people (DD study, N = 28), respectively. We found discrepancy in the two pyrosequencing software-based quality assignment of DNA methylation assays. Compared to the software for analysis in the AQ mode, less permissive criteria are supported by the Pyro Q-CpG software, which enables analysis in CpG mode. CpG mode warns the operators about potential unsatisfactory performance of the assay and ensures a more accurate quantitative evaluation of DNA methylation at CpG sites. The implementation of CpG mode is strongly advisable in order to improve the reliability of the methylation analysis results achievable by pyrosequencing.

  6. Comprehensive analysis of CpG islands in human chromosomes 21 and 22

    NASA Astrophysics Data System (ADS)

    Takai, Daiya; Jones, Peter A.

    2002-03-01

    CpG islands are useful markers for genes in organisms containing 5-methylcytosine in their genomes. In addition, CpG islands located in the promoter regions of genes can play important roles in gene silencing during processes such as X-chromosome inactivation, imprinting, and silencing of intragenomic parasites. The generally accepted definition of what constitutes a CpG island was proposed in 1987 by Gardiner-Garden and Frommer [Gardiner-Garden, M. & Frommer, M. (1987) J. Mol. Biol. 196, 261-282] as being a 200-bp stretch of DNA with a C+G content of 50% and an observed CpG/expected CpG in excess of 0.6. Any definition of a CpG island is somewhat arbitrary, and this one, which was derived before the sequencing of mammalian genomes, will include many sequences that are not necessarily associated with controlling regions of genes but rather are associated with intragenomic parasites. We have therefore used the complete genomic sequences of human chromosomes 21 and 22 to examine the properties of CpG islands in different sequence classes by using a search algorithm that we have developed. Regions of DNA of greater than 500 bp with a G+C equal to or greater than 55% and observed CpG/expected CpG of 0.65 were more likely to be associated with the 5' regions of genes and this definition excluded most Alu-repetitive elements. We also used genome sequences to show strong CpG suppression in the human genome and slight suppression in Drosophila melanogaster and Saccharomyces cerevisiae. This finding is compatible with the recent detection of 5-methylcytosine in Drosophila, and might suggest that S. cerevisiae has, or once had, CpG methylation.

  7. DNA-inorganic hybrid nanovaccine for cancer immunotherapy.

    PubMed

    Zhu, Guizhi; Liu, Yijing; Yang, Xiangyu; Kim, Young-Hwa; Zhang, Huimin; Jia, Rui; Liao, Hsien-Shun; Jin, Albert; Lin, Jing; Aronova, Maria; Leapman, Richard; Nie, Zhihong; Niu, Gang; Chen, Xiaoyuan

    2016-03-28

    Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy.

  8. A Hybrid Approach for CpG Island Detection in the Human Genome.

    PubMed

    Yang, Cheng-Hong; Lin, Yu-Da; Chiang, Yi-Cheng; Chuang, Li-Yeh

    2016-01-01

    CpG islands have been demonstrated to influence local chromatin structures and simplify the regulation of gene activity. However, the accurate and rapid determination of CpG islands for whole DNA sequences remains experimentally and computationally challenging. A novel procedure is proposed to detect CpG islands by combining clustering technology with the sliding-window method (PSO-based). Clustering technology is used to detect the locations of all possible CpG islands and process the data, thus effectively obviating the need for the extensive and unnecessary processing of DNA fragments, and thus improving the efficiency of sliding-window based particle swarm optimization (PSO) search. This proposed approach, named ClusterPSO, provides versatile and highly-sensitive detection of CpG islands in the human genome. In addition, the detection efficiency of ClusterPSO is compared with eight CpG island detection methods in the human genome. Comparison of the detection efficiency for the CpG islands in human genome, including sensitivity, specificity, accuracy, performance coefficient (PC), and correlation coefficient (CC), ClusterPSO revealed superior detection ability among all of the test methods. Moreover, the combination of clustering technology and PSO method can successfully overcome their respective drawbacks while maintaining their advantages. Thus, clustering technology could be hybridized with the optimization algorithm method to optimize CpG island detection. The prediction accuracy of ClusterPSO was quite high, indicating the combination of CpGcluster and PSO has several advantages over CpGcluster and PSO alone. In addition, ClusterPSO significantly reduced implementation time.

  9. Extending antigen release from particulate vaccines results in enhanced antitumor immune response.

    PubMed

    Kapadia, Chintan H; Tian, Shaomin; Perry, Jillian L; Sailer, David; Christopher Luft, J; DeSimone, Joseph M

    2018-01-10

    Tumor-specific CD8 + cytotoxic T lymphocytes (CTLs) play a critical role in an anti-tumor immune response. However, vaccination intended to elicit a potent CD8 + T cell responses employing tumor-associated peptide antigens, are typically ineffective due to poor immunogenicity. Previously, we engineered a polyethylene glycol (PEG) hydrogel-based subunit vaccine for the delivery of an antigenic peptide and CpG (adjuvant) to elicit potent CTLs. In this study, we further examined the effect of antigen release kinetics on their induced immune responses. A CD8 + T cell epitope peptide from OVA (CSIINFEKL) and CpG were co-conjugated to nanoparticles utilizing either a disulfide or a thioether linkage. Subsequent studies comparing peptide release rates as a function of linker, determined that the thioether linkage provided sustained release of peptide over 72h. Ability to control the release of peptide resulted in both higher and prolonged antigen presentation when compared to disulfide-linked peptide. Both NP vaccine formulations resulted in activation and maturation of bone marrow derived dendritic cells (BMDCs) and induced potent CD8 + T cell responses when compared to soluble antigen and soluble CpG. Immunization with either disulfide or thioether linked vaccine constructs effectively inhibited EG7-OVA tumor growth in mice, however only treatment with the thioether linked vaccine construct resulted in enhanced survival. Copyright © 2017. Published by Elsevier B.V.

  10. Clinical practice guidelines for the management of patients with endometrial cancer in France: recommendations of the Institut National du Cancer and the Société Française d'Oncologie Gynécologique.

    PubMed

    Querleu, Denis; Planchamp, François; Narducci, Fabrice; Morice, Philippe; Joly, Florence; Genestie, Catherine; Haie-Meder, Christine; Thomas, Laurence; Quénel-Tueux, Nathalie; Daraï, Emile; Dorangeon, Pierre-Hervé; Marret, Henri; Taïeb, Sophie; Mazeau-Woynar, Valérie

    2011-07-01

    Endometrial cancer is the most common gynecological malignancy in France, with more than 6500 new cases in 2010. The French National Cancer Institute has been leading a clinical practice guidelines (CPG) project since 2008. This project involves the development and updating of evidence-based CPG in oncology. To develop CPG for diagnosis, treatment, and follow-up for patients with endometrial cancer. The guideline development process is based on systematic literature review and critical appraisal by experts, with feedback from specialists in cancer care delivery. The recommendations are thus based on the best available evidence and expert agreement. Main recommendations include a routine pelvic magnetic resonance imaging in association with magnetic resonance imaging exploration of the para-aortic lymph nodes for locoregional staging, surgical treatment based on total hysterectomy with bilateral salpingo-oophorectomy with or without lymphadenectomy, and clinical examination for the follow-up. The initial laparoscopic surgical approach is recommended for stage I tumors. Lymphadenectomy and postoperative external radiotherapy are recommended for patients with high risk of recurrence but are restricted for patients with low or intermediate risk. If brachytherapy is indicated, it should be given at a high-dose rate rather than a low-dose rate. Routine imaging, biologic tests, and vaginal smears are not indicated for follow-up.

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre

    An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatorymore » therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.« less

  12. Ten-Year Analysis of Transfusion in Operation Iraqi Freedom and Operation Enduring Freedom: Increased Plasma and Platelet Use Correlates with Improved Survival

    DTIC Science & Technology

    2012-01-01

    included the publication of the CRASH-2 trial in 2010, followed by the institution of a CPG regarding tranexamic acid (TXA) use in August 2011. 7,11 This...critically ill patients? Trans- fusion. 2011;51:1644 1650. 11. Shakur H, Roberts I, Bautista R, et al. Effects of tranexamic acid on death, vascular occlusive

  13. Pattern generating and reflex-like processes controlling aiming movements in the presence of inertia, damping and gravity. A theoretical note.

    PubMed

    Kalveram, K T

    1991-01-01

    A model is proposed, in which goal-directed movements of the forearm are controlled by a central pattern generator (CPG) initiated for exactly one period, and by reflex-analogous processes. Movement width is proportional to the amplitude factor of the CPG's output, and to the square of the CPG's period length. The period duration can be freely selected, thus enabling the CPG to accommodate its time scale to the period of others CPG's. Parameters which influence movement accuracy can be adjusted by means of closed control loop, which are discrete with respect to time: The time unit corresponds to the period of the CPG. For instance, momentum adjustment balances the CPG in such a manner that the velocity of the arm becomes zero on termination of the period, while gain adjustment serves to attain a correct movement length in the presence of an inertial load. Friction, stiffness and gravitational force are neutralized by additional reflex-type processes, interpretable as positive feedback loops with adjustable gain factors, using position and velocity signals.

  14. Nucleosome dynamics and maintenance of epigenetic states of CpG islands

    NASA Astrophysics Data System (ADS)

    Sneppen, Kim; Dodd, Ian B.

    2016-06-01

    Methylation of mammalian DNA occurs primarily at CG dinucleotides. These CpG sites are located nonrandomly in the genome, tending to occur within high density clusters of CpGs (islands) or within large regions of low CpG density. Cluster methylation tends to be bimodal, being dominantly unmethylated or mostly methylated. For CpG clusters near promoters, low methylation is associated with transcriptional activity, while high methylation is associated with gene silencing. Alternative CpG methylation states are thought to be stable and heritable, conferring localized epigenetic memory that allows transient signals to create long-lived gene expression states. Positive feedback where methylated CpG sites recruit enzymes that methylate nearby CpGs, can produce heritable bistability but does not easily explain that as clusters increase in size or density they change from being primarily methylated to primarily unmethylated. Here, we show that an interaction between the methylation state of a cluster and its occupancy by nucleosomes provides a mechanism to generate these features and explain genome wide systematics of CpG islands.

  15. FBXL19 recruits CDK-Mediator to CpG islands of developmental genes priming them for activation during lineage commitment

    PubMed Central

    Dimitrova, Emilia; Nakayama, Manabu; Koseki, Yoko; Konietzny, Rebecca; Kessler, Benedikt M; Koseki, Haruhiko

    2018-01-01

    CpG islands are gene regulatory elements associated with the majority of mammalian promoters, yet how they regulate gene expression remains poorly understood. Here, we identify FBXL19 as a CpG island-binding protein in mouse embryonic stem (ES) cells and show that it associates with the CDK-Mediator complex. We discover that FBXL19 recruits CDK-Mediator to CpG island-associated promoters of non-transcribed developmental genes to prime these genes for activation during cell lineage commitment. We further show that recognition of CpG islands by FBXL19 is essential for mouse development. Together this reveals a new CpG island-centric mechanism for CDK-Mediator recruitment to developmental gene promoters in ES cells and a requirement for CDK-Mediator in priming these developmental genes for activation during cell lineage commitment. PMID:29809150

  16. Prophylactic Herpes Simplex Virus 2 (HSV-2) Vaccines Adjuvanted with Stable Emulsion and Toll-Like Receptor 9 Agonist Induce a Robust HSV-2-Specific Cell-Mediated Immune Response, Protect against Symptomatic Disease, and Reduce the Latent Viral Reservoir

    PubMed Central

    Marshall, Jason D.; Dorwart, Michael R.; Heeke, Darren S.; Rao, Eileen; Tummala, Padmaja; Yu, Li; Cohen, Gary H.; Eisenberg, Roselyn J.

    2017-01-01

    ABSTRACT Several prophylactic vaccines targeting herpes simplex virus 2 (HSV-2) have failed in the clinic to demonstrate sustained depression of viral shedding or protection from recurrences. Although these vaccines have generated high titers of neutralizing antibodies (NAbs), their induction of robust CD8 T cells has largely been unreported, even though evidence for the importance of HSV-2 antigen-specific CD8 T cells is mounting in animal models and in translational studies involving subjects with active HSV-2-specific immune responses. We developed a subunit vaccine composed of the NAb targets gD and gB and the novel T cell antigen and tegument protein UL40, and we compared this vaccine to a whole-inactivated-virus vaccine (formaldehyde-inactivated HSV-2 [FI-HSV-2]). We evaluated different formulations in combination with several Th1-inducing Toll-like receptor (TLR) agonists in vivo. In mice, the TLR9 agonist cytosine-phosphate-guanine (CpG) oligodeoxynucleotide formulated in a squalene-based oil-in-water emulsion promoted most robust, functional HSV-2 antigen-specific CD8 T cell responses and high titers of neutralizing antibodies, demonstrating its superiority to vaccines adjuvanted by monophosphoryl lipid A (MPL)-alum. We further established that FI-HSV-2 alone or in combination with adjuvants as well as adjuvanted subunit vaccines were successful in the induction of NAbs and T cell responses in guinea pigs. These immunological responses were coincident with a suppression of vaginal HSV-2 shedding, low lesion scores, and a reduction in latent HSV-2 DNA in dorsal root ganglia to undetectable levels. These data support the further preclinical and clinical development of prophylactic HSV-2 vaccines that contain appropriate antigen and adjuvant components responsible for programming elevated CD8 T cell responses. IMPORTANCE Millions of people worldwide are infected with herpes simplex virus 2 (HSV-2), and to date, an efficacious prophylactic vaccine has not met the rigors of clinical trials. Attempts to develop a vaccine have focused primarily on glycoproteins necessary for HSV-2 entry as target antigens and to which the dominant neutralizing antibody response is directed during natural infection. Individuals with asymptomatic infection have exhibited T cell responses against specific HSV-2 antigens not observed in symptomatic individuals. We describe for the first time the immunogenicity profile in animal models of UL40, a novel HSV-2 T cell antigen that has been correlated with asymptomatic HSV-2 disease. Additionally, vaccine candidates adjuvanted by a robust formulation of the CpG oligonucleotide delivered in emulsion were superior to unadjuvanted or MPL-alum-adjuvanted formulations at eliciting a robust cell-mediated immune response and blocking the establishment of a latent viral reservoir in the guinea pig challenge model of HSV-2 infection. PMID:28228587

  17. Prophylactic Herpes Simplex Virus 2 (HSV-2) Vaccines Adjuvanted with Stable Emulsion and Toll-Like Receptor 9 Agonist Induce a Robust HSV-2-Specific Cell-Mediated Immune Response, Protect against Symptomatic Disease, and Reduce the Latent Viral Reservoir.

    PubMed

    Hensel, Michael T; Marshall, Jason D; Dorwart, Michael R; Heeke, Darren S; Rao, Eileen; Tummala, Padmaja; Yu, Li; Cohen, Gary H; Eisenberg, Roselyn J; Sloan, Derek D

    2017-05-01

    Several prophylactic vaccines targeting herpes simplex virus 2 (HSV-2) have failed in the clinic to demonstrate sustained depression of viral shedding or protection from recurrences. Although these vaccines have generated high titers of neutralizing antibodies (NAbs), their induction of robust CD8 T cells has largely been unreported, even though evidence for the importance of HSV-2 antigen-specific CD8 T cells is mounting in animal models and in translational studies involving subjects with active HSV-2-specific immune responses. We developed a subunit vaccine composed of the NAb targets gD and gB and the novel T cell antigen and tegument protein UL40, and we compared this vaccine to a whole-inactivated-virus vaccine (formaldehyde-inactivated HSV-2 [FI-HSV-2]). We evaluated different formulations in combination with several Th1-inducing Toll-like receptor (TLR) agonists in vivo In mice, the TLR9 agonist cytosine-phosphate-guanine (CpG) oligodeoxynucleotide formulated in a squalene-based oil-in-water emulsion promoted most robust, functional HSV-2 antigen-specific CD8 T cell responses and high titers of neutralizing antibodies, demonstrating its superiority to vaccines adjuvanted by monophosphoryl lipid A (MPL)-alum. We further established that FI-HSV-2 alone or in combination with adjuvants as well as adjuvanted subunit vaccines were successful in the induction of NAbs and T cell responses in guinea pigs. These immunological responses were coincident with a suppression of vaginal HSV-2 shedding, low lesion scores, and a reduction in latent HSV-2 DNA in dorsal root ganglia to undetectable levels. These data support the further preclinical and clinical development of prophylactic HSV-2 vaccines that contain appropriate antigen and adjuvant components responsible for programming elevated CD8 T cell responses. IMPORTANCE Millions of people worldwide are infected with herpes simplex virus 2 (HSV-2), and to date, an efficacious prophylactic vaccine has not met the rigors of clinical trials. Attempts to develop a vaccine have focused primarily on glycoproteins necessary for HSV-2 entry as target antigens and to which the dominant neutralizing antibody response is directed during natural infection. Individuals with asymptomatic infection have exhibited T cell responses against specific HSV-2 antigens not observed in symptomatic individuals. We describe for the first time the immunogenicity profile in animal models of UL40, a novel HSV-2 T cell antigen that has been correlated with asymptomatic HSV-2 disease. Additionally, vaccine candidates adjuvanted by a robust formulation of the CpG oligonucleotide delivered in emulsion were superior to unadjuvanted or MPL-alum-adjuvanted formulations at eliciting a robust cell-mediated immune response and blocking the establishment of a latent viral reservoir in the guinea pig challenge model of HSV-2 infection. Copyright © 2017 American Society for Microbiology.

  18. Exposure to welding fumes is associated with hypomethylation of the F2RL3 gene: a cardiovascular disease marker.

    PubMed

    Hossain, Mohammad B; Li, Huiqi; Hedmer, Maria; Tinnerberg, Håkan; Albin, Maria; Broberg, Karin

    2015-12-01

    Welders are at risk for cardiovascular disease. Recent studies linked tobacco smoke exposure to hypomethylation of the F2RL3 (coagulation factor II (thrombin) receptor-like 3) gene, a marker for cardiovascular disease prognosis and mortality. However, whether welding fumes cause hypomethylation of F2RL3 remains unknown. We investigated 101 welders (median span of working as a welder: 7 years) and 127 unexposed controls (non-welders with no obvious exposure to respirable dust at work), age range 23-60 years, all currently non-smoking, in Sweden. The participants were interviewed about their work history, lifestyle factors and diseases. Personal sampling of respirable dust was performed for the welders. DNA methylation of F2RL3 in blood was assessed by pyrosequencing of four CpG sites, CpG_2 (corresponds to cg03636183) to CpG_5, in F2RL3. Multivariable linear regression analysis was used to assess the association between exposure to welding fumes and F2RL3 methylation. Welders had 2.6% lower methylation of CpG_5 than controls (p<0.001). Higher concentrations of measured respirable dust among the welders were associated with hypomethylation of CpG_2, CpG_4 and CpG_5 (β=-0.49 to -1.4, p<0.012); p<0.029 adjusted for age, previous smoking, passive smoking, education, current residence and respirator use. Increasing the number of years working as a welder was associated with hypomethylation of CpG_4 (linear regression analysis, β=-0.11, p=0.039, adjusted for previous smoking). Previous tobacco smokers had 1.5-4.7% (p<0.014) lower methylation of 3 of the 4 CpG sites in F2RL3 (CpG_2, CpG_4 and CpG_5) compared to never-smokers. A non-significant lower risk of cardiovascular disease with more methylation was observed for all CpG sites. Welding fumes exposure and previous smoking were associated with F2RL3 hypomethylation. This finding links low-to-moderate exposure to welding fumes to adverse effects on the cardiovascular system, and suggests a potential mechanistic pathway for this link, via epigenetic effects on F2RL3 expression. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  19. A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei

    PubMed Central

    Waag, David M.; McCluskie, Michael J.; Zhang, Ningli; Krieg, Arthur M.

    2006-01-01

    Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-γ)-inducible protein 10, interleukin-12 (IL-12), IFN-γ, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders. PMID:16495571

  20. A CpG oligonucleotide can protect mice from a low aerosol challenge dose of Burkholderia mallei.

    PubMed

    Waag, David M; McCluskie, Michael J; Zhang, Ningli; Krieg, Arthur M

    2006-03-01

    Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-gamma)-inducible protein 10, interleukin-12 (IL-12), IFN-gamma, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders.

  1. Methylation analysis of p16, SLIT2, SCARA5, and Runx3 genes in hepatocellular carcinoma

    PubMed Central

    Sun, Gaofeng; Zhang, Chen; Feng, Min; Liu, Wensheng; Xie, Huifang; Qin, Qin; Zhao, E.; Wan, Li

    2017-01-01

    Abstract This study is to investigate the methylation status of multiple tumor suppressor 1 (p16), secreted glycoprotein 2 (SLIT2), scavenger receptor class A, member 5 putative (SCARA5), and human runt-related transcription factor 3 (Runx3) genes in the peripheral blood of hepatocellular carcinoma (HCC). This is a case–control study. The peripheral blood samples were collected from 25 HCC patients, 25 patients with high risk of HCC (defined as “internal control group”), and 25 healthy individuals (defined as “external control group”), respectively. Then the methylation status of p16, SLIT2, SCARA5, and Runx3 genes in the blood samples were analyzed by pyrosequencing. The relationship between the methylation and the clinical features of HCC patients were evaluated. The methylation levels in the 7 CpG loci of p16 gene in HCC patients were low and without statistically significant difference (P > .05) compared to the control groups. Although the methylation levels of CpG3 and CpG4 in SLIT2 gene loci were higher than those of the control groups, there was no statistically significant difference (P > .05). However, the methylation rate of CpG2 locus in SCARA5 gene in HCC patients was significantly higher (P < .05). And the methylation rates of CpG1, CpG2, CpG3, CpG4, CpG5, and CpG8 in Runx3 gene in HCC patients were significantly different to that of control groups (P < .05). We also have analyzed the correlations between the CpG islands methylation of Runx3 or SCARA5 genes and the age, gender, hepatitis B, liver cirrhosis, alpha fetal protein, or hepatitis B surface antigen (HBsAg) of the HCC patients, which all showed no significant correlations (P > .05). The methylation status of SCARA5 and Runx3 genes are abnormal in HCC patients, which may further be used as molecular markers for early auxiliary diagnosis of liver cancer. PMID:29019900

  2. F104S c-Mpl responds to a transmembrane domain-binding thrombopoietin receptor agonist: proof of concept that selected receptor mutations in congenital amegakaryocytic thrombocytopenia can be stimulated with alternative thrombopoietic agents.

    PubMed

    Fox, Norma E; Lim, Jihyang; Chen, Rose; Geddis, Amy E

    2010-05-01

    To determine whether specific c-Mpl mutations might respond to thrombopoietin receptor agonists. We created cell line models of type II c-Mpl mutations identified in congenital amegakaryocytic thrombocytopenia. We selected F104S c-Mpl for further study because it exhibited surface expression of the receptor. We measured proliferation of cell lines expressing wild-type or F104S c-Mpl in response to thrombopoietin receptor agonists targeting the extracellular (m-AMP4) or transmembrane (LGD-4665) domains of the receptor by 1-methyltetrazole-5-thiol assay. We measured thrombopoietin binding to the mutant receptor using an in vitro thrombopoietin uptake assay and identified F104 as a potentially critical residue for the interaction between the receptor and its ligand by aligning thrombopoietin and erythropoietin receptors from multiple species. Cells expressing F104S c-Mpl proliferated in response to LGD-4665, but not thrombopoietin or m-AMP4. Compared to thrombopoietin, LGD-4665 stimulates signaling with delayed kinetics in both wild-type and F104S c-Mpl-expressing cells. Although F104S c-Mpl is expressed on the cell surface in our BaF3 cell line model, the mutant receptor does not bind thrombopoietin. Comparison to the erythropoietin receptor suggests that F104 engages in hydrogen-bonding interactions that are critical for binding to thrombopoietin. These findings suggest that a small subset of patients with congenital amegakaryocytic thrombocytopenia might respond to treatment with thrombopoietin receptor agonists, but that responsiveness will depend on the type of mutation and agonist used. We postulate that F104 is critical for thrombopoietin binding. The kinetics of signaling in response to a transmembrane domain-binding agonist are delayed in comparison to thrombopoietin. 2010 ISEH Society for Hematology and Stem Cells. Published by Elsevier Inc. All rights reserved.

  3. Links between DNA methylation and nucleosome occupancy in the human genome.

    PubMed

    Collings, Clayton K; Anderson, John N

    2017-01-01

    DNA methylation is an epigenetic modification that is enriched in heterochromatin but depleted at active promoters and enhancers. However, the debate on whether or not DNA methylation is a reliable indicator of high nucleosome occupancy has not been settled. For example, the methylation levels of DNA flanking CTCF sites are higher in linker DNA than in nucleosomal DNA, while other studies have shown that the nucleosome core is the preferred site of methylation. In this study, we make progress toward understanding these conflicting phenomena by implementing a bioinformatics approach that combines MNase-seq and NOMe-seq data and by comprehensively profiling DNA methylation and nucleosome occupancy throughout the human genome. The results demonstrated that increasing methylated CpG density is correlated with nucleosome occupancy in the total genome and within nearly all subgenomic regions. Features with elevated methylated CpG density such as exons, SINE-Alu sequences, H3K36-trimethylated peaks, and methylated CpG islands are among the highest nucleosome occupied elements in the genome, while some of the lowest occupancies are displayed by unmethylated CpG islands and unmethylated transcription factor binding sites. Additionally, outside of CpG islands, the density of CpGs within nucleosomes was shown to be important for the nucleosomal location of DNA methylation with low CpG frequencies favoring linker methylation and high CpG frequencies favoring core particle methylation. Prominent exceptions to the correlations between methylated CpG density and nucleosome occupancy include CpG islands marked by H3K27me3 and CpG-poor heterochromatin marked by H3K9me3, and these modifications, along with DNA methylation, distinguish the major silencing mechanisms of the human epigenome. Thus, the relationship between DNA methylation and nucleosome occupancy is influenced by the density of methylated CpG dinucleotides and by other epigenomic components in chromatin.

  4. Clinical practice guideline for Sjögren's syndrome 2017.

    PubMed

    Sumida, Takayuki; Azuma, Naoto; Moriyama, Masafumi; Takahashi, Hiroyuki; Asashima, Hiromitsu; Honda, Fumika; Abe, Saori; Ono, Yuko; Hirota, Tomoya; Hirata, Shintaro; Tanaka, Yoshiya; Shimizu, Toshimasa; Nakamura, Hideki; Kawakami, Atsushi; Sano, Hajime; Ogawa, Yoko; Tsubota, Kazuo; Ryo, Koufuchi; Saito, Ichiro; Tanaka, Akihiko; Nakamura, Seiji; Takamura, Etsuko; Tanaka, Masao; Suzuki, Katsuya; Takeuchi, Tsutomu; Yamakawa, Noriyuki; Mimori, Tsuneyo; Ohta, Akiko; Nishiyama, Susumu; Yoshihara, Toshio; Suzuki, Yasunori; Kawano, Mitsuhiro; Tomiita, Minako; Tsuboi, Hiroto

    2018-05-01

    The objective of this study is to develop clinical practice guideline (CPG) for Sjögren's syndrome (SS) based on recently available clinical and therapeutic evidences. The CPG committee for SS was organized by the Research Team for Autoimmune Diseases, Research Program for Intractable Disease of the Ministry of Health, Labor and Welfare (MHLW), Japan. The committee completed a systematic review of evidences for several clinical questions and developed CPG for SS 2017 according to the procedure proposed by the Medical Information Network Distribution Service (Minds). The recommendations and their strength were checked by the modified Delphi method. The CPG for SS 2017 has been officially approved by both Japan College of Rheumatology and the Japanese Society for SS. The CPG committee set 38 clinical questions for clinical symptoms, signs, treatment, and management of SS in pediatric, adult and pregnant patients, using the PICO (P: patients, problem, population, I: interventions, C: comparisons, controls, comparators, O: outcomes) format. A summary of evidence, development of recommendation, recommendation, and strength for these 38 clinical questions are presented in the CPG. The CPG for SS 2017 should contribute to improvement and standardization of diagnosis and treatment of SS.

  5. Substantial reduction in hospital stay of children and adolescents with diabetic ketoacidosis after implementation of Clinical Practice Guidelines in a university hospital in Saudi Arabia.

    PubMed

    Al Nemri, Abdulrahman; Amer, Yasser Sami; Gasim, Hala; Osman, Mohamed Elfaki; Aleyadhy, Ayman; Al Otaibi, Hessah; Iqbal, Shaikh Mohammed; Aljurayyan, Nasir Abdullah; Assiri, Asaad M; Babiker, Amir; Mohamed, Sarar

    2017-02-01

    We aimed to determine the effect of Clinical Practice Guideline (CPG) implementation on length of hospital stay of children and adolescents with diabetic ketoacidosis (DKA). This was a 6-year (2008-2014) case-control retrospective study conducted at King Khalid University Hospital, Riyadh, that compared patients with DKA managed using CPG with those treated before CPG implementation. There were 63 episodes of DKA in 41 patients managed using CPG compared with 40 episodes in 33 patients treated before implementation of CPG. Baseline characteristics of the 2 groups were similar (age, sex, newly diagnosed patients, recurrent DKA, DKA severity, and mean glycosylated hemoglobin). The mean length of hospital stay (±SD) was 68.6 ± 53.1 hours after implementation of CPG compared with 107.4 ± 65.6 hours before implementation (P < .001). The reduction in length of hospital stay equals to 1700 bed days saved per year per 1000 patients. Implementation of CPG for DKA decreased the length of hospital stay. © 2016 John Wiley & Sons, Ltd.

  6. Newly identified CpG ODNs, M5-30 and M6-395, stimulate mouse immune cells to secrete TNF-alpha and enhance Th1-mediated immunity.

    PubMed

    Choi, Sun-Shim; Chung, Eunkyung; Jung, Yu-Jin

    2010-08-01

    Bacterial CpG motifs are known to induce both innate and adaptive immunity in infected hosts via toll-like receptor 9 (TLR9). Because small oligonucleotides (ODNs) mimicking bacterial CpG motifs are easily synthesized, they have found use as immunomodulatory agents in a number of disease models. We have developed a novel bioinformatics approach to identify effective CpG ODN sequences and evaluate their function as TLR9 ligands in a murine system. Among the CpG ODNs we identified, M5-30 and M6-395 showed significant ability to stimulate TNF-alpha and IFN-gamma production in a mouse macrophage cell line and mouse splenocytes, respectively. We also found that these CpG ODNs activated cells through the canonical NF-kappa B signaling pathway. Moreover, both CpG ODNs were able to induce Th1-mediated immunity in Mycobacterium tuberculosis (Mtb)-infected mice. Our results demonstrate that M5-30 and M6-395 function as TLR9-specific ligands, making them useful in the study of TLR9 functionality and signaling in mice.

  7. Distinct Orai-coupling domains in STIM1 and STIM2 define the Orai-activating site

    NASA Astrophysics Data System (ADS)

    Wang, Xizhuo; Wang, Youjun; Zhou, Yandong; Hendron, Eunan; Mancarella, Salvatore; Andrake, Mark D.; Rothberg, Brad S.; Soboloff, Jonathan; Gill, Donald L.

    2014-02-01

    STIM1 and STIM2 are widely expressed endoplasmic reticulum (ER) Ca2+ sensor proteins able to translocate within the ER membrane to physically couple with and gate plasma membrane Orai Ca2+ channels. Although they are structurally similar, we reveal critical differences in the function of the short STIM-Orai-activating regions (SOAR) of STIM1 and STIM2. We narrow these differences in Orai1 gating to a strategically exposed phenylalanine residue (Phe-394) in SOAR1, which in SOAR2 is substituted by a leucine residue. Remarkably, in full-length STIM1, replacement of Phe-394 with the dimensionally similar but polar histidine head group prevents both Orai1 binding and gating, creating an Orai1 non-agonist. Thus, this residue is critical in tuning the efficacy of Orai activation. While STIM1 is a full Orai1-agonist, leucine-replacement of this crucial residue in STIM2 endows it with partial agonist properties, which may be critical for limiting Orai1 activation stemming from its enhanced sensitivity to store-depletion.

  8. AGREEing on Canadian cardiovascular clinical practice guidelines.

    PubMed

    Stone, James A; Austford, Leslie; Parker, John H; Gledhill, Norm; Tremblay, Guy; Arthur, Heather M

    2008-10-01

    The use of clinical practice guidelines (CPGs), particularly the routine implementation of evidence-based cardiovascular health maintenance and disease management recommendations, affords both expert and nonexpert practitioners the opportunity to achieve better, and at least theoretically similar, patient outcomes. However, health care practitioners are often stymied in their efforts to follow even well-researched and well-written CPGs as a consequence of contradictory information. The purposeful integration and harmonization of Canadian cardiovascular CPGs, regardless of their specific risk factor or clinical management focus, is critical to their widespread acceptance and implementation. This level of cooperation and coordination among CPG groups and organizations would help to ensure that their clinical practice roadmaps (ie, best practice recommendations) contain clear, concise and complementary, rather than contradictory, patient care information. Similarly, the application of specific tools intended to improve the quality of CPGs, such as the Appraisal of Guidelines for Research and Evaluation (AGREE) assessment tool, may also lead to improvements in CPG quality and potentially enhance their acceptance and implementation.

  9. Prediction of CpG-island function: CpG clustering vs. sliding-window methods

    PubMed Central

    2010-01-01

    Background Unmethylated stretches of CpG dinucleotides (CpG islands) are an outstanding property of mammal genomes. Conventionally, these regions are detected by sliding window approaches using %G + C, CpG observed/expected ratio and length thresholds as main parameters. Recently, clustering methods directly detect clusters of CpG dinucleotides as a statistical property of the genome sequence. Results We compare sliding-window to clustering (i.e. CpGcluster) predictions by applying new ways to detect putative functionality of CpG islands. Analyzing the co-localization with several genomic regions as a function of window size vs. statistical significance (p-value), CpGcluster shows a higher overlap with promoter regions and highly conserved elements, at the same time showing less overlap with Alu retrotransposons. The major difference in the prediction was found for short islands (CpG islets), often exclusively predicted by CpGcluster. Many of these islets seem to be functional, as they are unmethylated, highly conserved and/or located within the promoter region. Finally, we show that window-based islands can spuriously overlap several, differentially regulated promoters as well as different methylation domains, which might indicate a wrong merge of several CpG islands into a single, very long island. The shorter CpGcluster islands seem to be much more specific when concerning the overlap with alternative transcription start sites or the detection of homogenous methylation domains. Conclusions The main difference between sliding-window approaches and clustering methods is the length of the predicted islands. Short islands, often differentially methylated, are almost exclusively predicted by CpGcluster. This suggests that CpGcluster may be the algorithm of choice to explore the function of these short, but putatively functional CpG islands. PMID:20500903

  10. [Web Visit Patterns for the Clinical Practice Guidelines for Management of Depressive Disorder and Alcohol Abuse-Dependence].

    PubMed

    Suárez-Obando, Fernando; Restrepo, Carlos Gómez

    Clinical practice guidelines (CPG) are a set of recommendations for professionals, patients, and families, in order to make decisions about health care. The CPG respond to the need for concise, accurate, practical, and up to date information. In the field of mental health, Colombia has developed three GPC; alcohol (GPC-OH), depression (GPC-TDA), and schizophrenia. To describe the Web Portal traffic related to psychiatry guidelines, with emphasis on the number of visits, distribution throughout Colombian cities, and estimating user behaviour patterns. An evaluation was made of the traffic at the Clinical Practice Guidelines Web Portal of the Ministry of Health and Social Protection between 2013 and 2015 (two years of observation since the inauguration of the Portal). Out of the 45 GPC published on the website, the CPG-OH represented 1.21% of all page views of the Portal. CPG-TDA reached 1.52% (accumulated percentage of 2.73%), being the eighth most consulted guideline, with CPG-OH being number 16. The highest mean monthly number of visits for this group of guideliness was for the CPG-OH for health professionals (353 visits/month), and the lowest was for the CPG-AD for patients and relatives (24 single visits/month). Bogotá D.C. was the city where health carers accessed the guidelines more often. The guidelines for patients and relatives were consulted more in Villavicencio, Cúcuta, Manizales, Pereira, and Pasto. The web portal partially fulfills the purpose of circulating the CPG in Colombia. The visits to the CPG of mental health is quite low, and requires better dissemination strategies that allow the use of information and communication technology. Copyright © 2016 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

  11. Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-tumor activity.

    PubMed

    Schettini, Jorge; Kidiyoor, Amritha; Besmer, Dahlia M; Tinder, Teresa L; Roy, Lopamudra Das; Lustgarten, Joseph; Gendler, Sandra J; Mukherjee, Pinku

    2012-11-01

    Monoclonal antibodies (mAbs) against tumor-associated antigens are useful anticancer agents. Antibody-dependent cellular cytotoxicity (ADCC) is one of the major mechanisms responsible for initiating natural killer cell (NK)-mediated killing of tumors. However, the regulation of ADCC via NK cells is poorly understood. We have investigated the cytolytic activity of NK cells against pancreatic cancer cells that were coated with an antibody directed against the human tumor antigen, Mucin-1 designated HMFG-2, either alone or conjugated to CpG oligodeoxynucleotide (CpG ODN). Conjugated antibodies were tested for their ability to elicit ADCC in vitro and in vivo against pancreatic cancer cells. NK cells cultured in the presence of immobilized CpG ODN, HMFG-2 Ab, or CpG ODN-conjugated HMFG-2 Ab were able to up-regulate perforin similarly. Interestingly, a significant higher ADCC was observed when CpG ODN-conjugated HMFG-2-coated tumor cells were co-cultured with NK cells compared to unconjugated HMFG-2 Ab or CpG ODN alone. Moreover, MyD88-deficient NK cells can perform ADCC in vitro. Furthermore, intratumoral injections of CpG ODN-conjugated HMFG-2 induced a significant reduction in tumor burden in vivo in an established model of pancreatic tumor in nude mice compared to CpG ODN or the HMFG-2 alone. Depletion of macrophages or NK cells before treatment confirmed that both cells were required for the anti-tumor response in vivo. Results also suggest that CpG ODN and HMFG-2 Ab could be sensed by NK cells on the mAb-coated tumor cells triggering enhanced ADCC in vitro and in vivo.

  12. Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-tumor activity

    PubMed Central

    Schettini, Jorge; Kidiyoor, Amritha; Besmer, Dahlia M.; Tinder, Teresa L.; Roy, Lopamudra Das; Lustgarten, Joseph; Gendler, Sandra J.

    2013-01-01

    Monoclonal antibodies (mAbs) against tumor-associated antigens are useful anticancer agents. Antibody-dependent cellular cytotoxicity (ADCC) is one of the major mechanisms responsible for initiating natural killer cell (NK)-mediated killing of tumors. However, the regulation of ADCC via NK cells is poorly understood. We have investigated the cytolytic activity of NK cells against pancreatic cancer cells that were coated with an antibody directed against the human tumor antigen, Mucin-1 designated HMFG-2, either alone or conjugated to CpG oligodeoxynucleotide (CpG ODN). Conjugated antibodies were tested for their ability to elicit ADCC in vitro and in vivo against pancreatic cancer cells. NK cells cultured in the presence of immobilized CpG ODN, HMFG-2 Ab, or CpG ODN-conjugated HMFG-2 Ab were able to up-regulate perforin similarly. Interestingly, a significant higher ADCC was observed when CpG ODN-conjugated HMFG-2-coated tumor cells were co-cultured with NK cells compared to unconjugated HMFG-2 Ab or CpG ODN alone. Moreover, MyD88-deficient NK cells can perform ADCC in vitro. Furthermore, intratumoral injections of CpG ODN-conjugated HMFG-2 induced a significant reduction in tumor burden in vivo in an established model of pancreatic tumor in nude mice compared to CpG ODN or the HMFG-2 alone. Depletion of macrophages or NK cells before treatment confirmed that both cells were required for the anti-tumor response in vivo. Results also suggest that CpG ODN and HMFG-2 Ab could be sensed by NK cells on the mAb-coated tumor cells triggering enhanced ADCC in vitro and in vivo. PMID:22543528

  13. Cytosine-phosphate-guanine oligodeoxynucleotides containing GACGTT motifs enhance the immune responses elicited by keyhole limpet hemocyanin antigen in dairy cattle.

    PubMed

    Chu, Chun-Yen; Lee, Shang-Chun; Liu, Shyh-Shyan; Lin, Yu-Ming; Shen, Perng-Chi; Yu, Chi; Lee, Kuo-Hua; Zhao, Xin; Lee, Jai-Wei

    2011-10-01

    Adjuvants are important components of vaccine formulations. Effective adjuvants line innate and adaptive immunity by signaling through pathogen recognition receptors. Synthetic cytosine-phosphate-guanine (CpG) oligodeoxynucleotides (ODNs) have been shown to have potentials as adjuvants for vaccines. However, the immunostimulatory effect of CpG is species-specific and depends on the sequence of CpG motifs. A CpG ODN (2135), containing 3 identical copies of GTCGTT motif, was previously reported to have the strongest effects on bovine peripheral blood mononuclear cells (PBMC). Based on the sequence of 2135, we replaced the GTCGTT motif with 11 other sequences containing CG and investigated their effects on bovine lymphocyte proliferation. Results showed that the CpG ODNs containing 3 copies of GACGTT motif had the highest lymphocyte stimulation index (7.91±1.18), which was significantly (P<0.05) higher than that of 2135 (4.25±0.56). The CpG ODNs containing 3 copies of GACGTT motif also significantly increased the mRNA expression of interferon (IFN)-α, interleukin (IL)-12, and IL-21 in bovine PBMC. When dairy cows were immunized with the keyhole limpet hemocyanin (KLH) antigen formulated with CpG ODNs containing 3 copies of GACGTT, production of KLH-specific antibodies in serum and in milk whey was significantly (P<0.05) enhanced. IFN-γ in whole blood stimulated by KLH was also significantly (P<0.05) increased in cows immunized with KLH plus CpG ODNs. Our results indicate that CpG ODNs containing 3 copies of the GACGTT motifs is a potential adjuvant for bovine vaccines.

  14. Assessing the efficacy of Duddingtonia flagrans chlamydospores per gram of faeces to control Haemonchus contortus larvae.

    PubMed

    Ojeda-Robertos, Nadia Florencia; Torres-Acosta, Juan Felipe de Jesus; Aguilar-Caballero, Armando Jacinto; Ayala-Burgos, Armín; Cob-Galera, Ligia Amira; Sandoval-Castro, Carlos Alfredo; Barrientos-Medina, Roberto Carlos; de Gives, Pedro Mendoza

    2008-12-20

    The aims were (a) to quantify the number of Duddingtonia flagrans chlamydospores per gram of faeces (CPG) recovered from sheep administered with different oral doses and, (b) to describe the relationship between CPG and eggs per gram of faeces (EPG) on the efficacy to reduce Haemonchus contortus infective larvae. Three doses of chlamydospores per kg BW were orally administered during seven days: (T1) non treated control group, (T2) 1 x 10(6), (T3) 2.5 x 10(6) and (T4) 5 x 10(6). Three lambs, infected with H. contortus, were used per group. Faeces were obtained from the rectum of each lamb during the fungal administration period (days 0-6) and for six days after that period. Four coproculture replicates were made from each animal in days 2, 4, 6, 8 and 10. A higher chlamydospore dose produced higher CPG in faeces (p < 0.05), but a clear dose dependent effect was not found either in the larvae reduction or in the CPG:EPG ratio. When ratios were re-analyzed, independently of the treatment groups of origin, a better efficacy was obtained with a ratio from 5 to 10 CPG:EPG and a higher ratio (> 10 per egg) showed a lower reduction efficacy (p < 0.05). The binomial analysis showed that for each unit of increment in CPG:EPG ratio there was a reduction of larvae number until a point (between 5 and 10 CPG:EPG) where no further reduction was detected. The surface response test indicated that the number of larvae was reduced by CPG until possible saturation. The highest CPG:EPG ratios did not necessarily improve efficacy of D. flagrans.

  15. Interaction of DRD4 Methylation and Phthalate Metabolites Affects Continuous Performance Test Performance in ADHD.

    PubMed

    Kim, Johanna Inhyang; Kim, Jae-Won; Shin, Inkyung; Kim, Bung-Nyun

    2018-05-01

    We investigated the interaction effect between the methylation of dopamine receptor D4 (DRD4) and phthalate exposure in ADHD on continuous performance test (CPT) variables. Urine concentrations of mono-(2-ethyl-5-hydroxyhexyl) phthalate (MEHHP), mono-(2-ethyl-5-oxohexyl) phthalate (MEOHP), and mono-n-butyl phthalate (MBP) were tested. The methylation status was analyzed for CpG sites of DRD4. Multivariable linear regression models were applied to investigate the interaction effects of methylation and phthalate levels. There was a significant interaction effect of the methylation of CpG26 and CpG28 with the MEHHP level on omission errors in ADHD patients, but not in controls. The post hoc analysis revealed a significant correlation between the MEHHP concentration and omission errors in the methylated group, but not in the unmethylated group. The interaction between the methylation status of CpG sites of DRD4, particularly CpG26 and CpG28, and phthalate metabolite levels affects the attention level in ADHD patients.

  16. Dietary and supplemental maternal methyl-group donor intake and cord blood DNA methylation.

    PubMed

    Pauwels, Sara; Ghosh, Manosij; Duca, Radu Corneliu; Bekaert, Bram; Freson, Kathleen; Huybrechts, Inge; A S Langie, Sabine; Koppen, Gudrun; Devlieger, Roland; Godderis, Lode

    2017-01-02

    Maternal nutrition is critically involved in the development and health of the fetus. We evaluated maternal methyl-group donor intake through diet (methionine, betaine, choline, folate) and supplementation (folic acid) before and during pregnancy in relation to global DNA methylation and hydroxymethylation and gene specific (IGF2 DMR, DNMT1, LEP, RXRA) cord blood methylation. A total of 115 mother-infant pairs were enrolled in the MAternal Nutrition and Offspring's Epigenome (MANOE) study. The intake of methyl-group donors was assessed using a food-frequency questionnaire. LC-MS/MS and pyrosequencing were used to measure global and gene specific methylation, respectively. Dietary intake of methyl-groups before and during pregnancy was associated with changes in LEP, DNMT1, and RXRA cord blood methylation. Statistically significant higher cord blood LEP methylation was observed when mothers started folic acid supplementation more than 6 months before conception compared with 3-6 months before conception (34.6 ± 6.3% vs. 30.1 ± 3.6%, P = 0.011, LEP CpG1) or no folic acid used before conception (16.2 ± 4.4% vs. 13.9 ± 3%, P = 0.036 for LEP CpG3 and 24.5 ± 3.5% vs. 22.2 ± 3.5%, P = 0.045 for LEP mean CpG). Taking folic acid supplements during the entire pregnancy resulted in statistically significantly higher cord blood RXRA methylation as compared with stopping supplementation in the second trimester (12.3 ± 1.9% vs. 11.1 ± 2%, P = 0.008 for RXRA mean CpG). To conclude, long-term folic acid use before and during pregnancy was associated with higher LEP and RXRA cord blood methylation, respectively. To date, pregnant women are advised to take a folic acid supplement of 400 µg/day from 4 weeks before until 12 weeks of pregnancy. Our results suggest significant epigenetic modifications when taking a folic acid supplement beyond the current advice.

  17. DNA motifs associated with aberrant CpG island methylation.

    PubMed

    Feltus, F Alex; Lee, Eva K; Costello, Joseph F; Plass, Christoph; Vertino, Paula M

    2006-05-01

    Epigenetic silencing involving the aberrant methylation of promoter region CpG islands is widely recognized as a tumor suppressor silencing mechanism in cancer. However, the molecular pathways underlying aberrant DNA methylation remain elusive. Recently we showed that, on a genome-wide level, CpG island loci differ in their intrinsic susceptibility to aberrant methylation and that this susceptibility can be predicted based on underlying sequence context. These data suggest that there are sequence/structural features that contribute to the protection from or susceptibility to aberrant methylation. Here we use motif elicitation coupled with classification techniques to identify DNA sequence motifs that selectively define methylation-prone or methylation-resistant CpG islands. Motifs common to 28 methylation-prone or 47 methylation-resistant CpG island-containing genomic fragments were determined using the MEME and MAST algorithms (). The five most discriminatory motifs derived from methylation-prone sequences were found to be associated with CpG islands in general and were nonrandomly distributed throughout the genome. In contrast, the eight most discriminatory motifs derived from the methylation-resistant CpG islands were randomly distributed throughout the genome. Interestingly, this latter group tended to associate with Alu and other repetitive sequences. Used together, the frequency of occurrence of these motifs successfully discriminated methylation-prone and methylation-resistant CpG island groups with an accuracy of 87% after 10-fold cross-validation. The motifs identified here are candidate methylation-targeting or methylation-protection DNA sequences.

  18. Characterization of Immune Responses to an Inactivated Avian Influenza Virus Vaccine Adjuvanted with Nanoparticles Containing CpG ODN.

    PubMed

    Singh, Shirene M; Alkie, Tamiru N; Abdelaziz, Khaled Taha; Hodgins, Douglas C; Novy, Anastasia; Nagy, Éva; Sharif, Shayan

    2016-06-01

    Avian influenza virus (AIV), a mucosal pathogen, gains entry into host chickens through respiratory and gastrointestinal routes. Most commercial AIV vaccines for poultry consist of inactivated, whole virus with adjuvant, delivered by parenteral administration. Recent advances in vaccine development have led to the application of nanoparticle emulsion delivery systems, such as poly (d,l-lactic-co-glycolic acid) (PLGA) nanoparticles to enhance antigen-specific immune responses. In chickens, the Toll-like receptor 21 ligand, CpG oligodeoxynucleotides (ODNs), have been demonstrated to be immunostimulatory. The objective of this study was to compare the adjuvant potential of CpG ODN 2007 encapsulated in PLGA nanoparticles with nonencapsulated CpG ODN 2007 when combined with a formalin-inactivated H9N2 virus, through intramuscular and aerosol delivery routes. Chickens were vaccinated at days 7 and 21 posthatch for the intramuscular route and at days 7, 21, and 35 for the aerosol route. Antibody-mediated responses were evaluated weekly in sera and lacrimal secretions in specific pathogen-free chickens. The results indicate that nonencapsulated CpG ODN 2007 in inactivated AIV vaccines administered by the intramuscular route generated higher antibody responses compared to the encapsulated CpG ODN 2007 formulation by the same route. Additionally, encapsulated CpG ODN 2007 in AIV vaccines administered by the aerosol route elicited higher mucosal responses compared to nonencapsulated CpG ODN 2007. Future studies may be aimed at evaluating protective immune responses induced with PLGA encapsulation of AIV and adjuvants.

  19. Identification of regions correlating MGMT promoter methylation and gene expression in glioblastomas

    PubMed Central

    Everhard, Sibille; Tost, Jörg; Abdalaoui, Hafida El; Crinière, Emmanuelle; Busato, Florence; Marie, Yannick; Gut, Ivo G.; Sanson, Marc; Mokhtari, Karima; Laigle-Donadey, Florence; Hoang-Xuan, Khê; Delattre, Jean-Yves; Thillet, Joëlle

    2009-01-01

    The O6-methylguanine-DNA methyltransferase gene (MGMT) is methylated in several cancers, including gliomas. However, the functional role of cysteine-phosphate-guanine (CpG) island (CGI) methylation in MGMT silencing is still controversial. The aim of this study was to investigate whether MGMT CGI methylation correlates inversely with RNA expression of MGMT in glioblastomas and to determine the CpG region whose methylation best reflects the level of expression. The methylation level of CpG sites that are potentially related to expression was investigated in 54 glioblastomas by pyrosequencing, a highly quantitative method, and analyzed with respect to their MGMT mRNA expression status. Three groups of patients were identified according to the methylation pattern of all 52 analyzed CpG sites. Overall, an 85% rate of concordance was observed between methylation and expression (p < 0.0001). When analyzing each CpG separately, six CpG sites were highly correlated with expression (p < 0.0001), and two CpG regions could be used as surrogate markers for RNA expression in 81.5% of the patients. This study indicates that there is good statistical agreement between MGMT methylation and expression, and that some CpG regions better reflect MGMT expression than do others. However, if transcriptional repression is the key mechanism in explaining the higher chemosensitivity of MGMT-methylated tumors, a substantial rate of discordance should lead clinicians to be cautious when deciding on a therapeutic strategy based on MGMT methylation status alone. PMID:19224763

  20. Identification of regions correlating MGMT promoter methylation and gene expression in glioblastomas.

    PubMed

    Everhard, Sibille; Tost, Jörg; El Abdalaoui, Hafida; Crinière, Emmanuelle; Busato, Florence; Marie, Yannick; Gut, Ivo G; Sanson, Marc; Mokhtari, Karima; Laigle-Donadey, Florence; Hoang-Xuan, Khê; Delattre, Jean-Yves; Thillet, Joëlle

    2009-08-01

    The O(6)-methylguanine-DNA methyltransferase gene (MGMT) is methylated in several cancers, including gliomas. However, the functional role of cysteine-phosphate-guanine (CpG) island (CGI) methylation in MGMT silencing is still controversial. The aim of this study was to investigate whether MGMT CGI methylation correlates inversely with RNA expression of MGMT in glioblastomas and to determine the CpG region whose methylation best reflects the level of expression. The methylation level of CpG sites that are potentially related to expression was investigated in 54 glioblastomas by pyrosequencing, a highly quantitative method, and analyzed with respect to their MGMT mRNA expression status. Three groups of patients were identified according to the methylation pattern of all 52 analyzed CpG sites. Overall, an 85% rate of concordance was observed between methylation and expression (p < 0.0001). When analyzing each CpG separately, six CpG sites were highly correlated with expression (p < 0.0001), and two CpG regions could be used as surrogate markers for RNA expression in 81.5% of the patients. This study indicates that there is good statistical agreement between MGMT methylation and expression, and that some CpG regions better reflect MGMT expression than do others. However, if transcriptional repression is the key mechanism in explaining the higher chemosensitivity of MGMT-methylated tumors, a substantial rate of discordance should lead clinicians to be cautious when deciding on a therapeutic strategy based on MGMT methylation status alone.

  1. Early demethylation of non-CpG, CpC-rich, elements in the myogenin 5′-flanking region

    PubMed Central

    Fuso, Andrea; Ferraguti, Giampiero; Grandoni, Francesco; Ruggeri, Raffaella; Scarpa, Sigfrido; Strom, Roberto

    2010-01-01

    The dynamic changes and structural patterns of DNA methylation of genes without CpG islands are poorly characterized. The relevance of CpG to the non-CpG methylation equilibrium in transcriptional repression is unknown. In this work, we analyzed the DNA methylation pattern of the 5′-flanking of the myogenin gene, a positive regulator of muscle differentiation with no CpG island and low CpG density, in both C2C12 muscle satellite cells and embryonic muscle. Embryonic brain was studied as a non-expressing tissue. High levels of both CpG and non-CpG methylation were observed in non-expressing experimental conditions. Both CpG and non-CpG methylation rapidly dropped during muscle differentiation and myogenin transcriptional activation with active demethylation dynamics. Non-CpG demethylation occurred more rapidly than CpG demethylation. Demethylation spread from initially highly methylated short CpC-rich elements to a virtually unmethylated status. These short elements have a high CpC content and density, share some motifs and largely coincide with putative recognition sequences of some differentiation-related transcription factors. Our findings point to a dynamically controlled equilibrium between CpG and non-CpG active demethylation in the transcriptional control of tissue-specific genes. The short CpC-rich elements are new structural features of the methylation machinery, whose functions may include priming the complete demethylation of a transcriptionally crucial DNA region. PMID:20935518

  2. A cross-study analysis of prenatal exposures to environmental contaminants and the epigenome: support for stress-responsive transcription factor occupancy as a mediator of gene-specific CpG methylation patterning

    PubMed Central

    Martin, Elizabeth M.; Fry, Rebecca C.

    2016-01-01

    Abstract A biological mechanism by which exposure to environmental contaminants results in gene-specific CpG methylation patterning is currently unknown. We hypothesize that gene-specific CpG methylation is related to environmentally perturbed transcription factor occupancy. To test this hypothesis, a database of 396 genes with altered CpG methylation either in cord blood leukocytes or placental tissue was compiled from 14 studies representing assessments of six environmental contaminants. Subsequently, an in silico approach was used to identify transcription factor binding sites enriched among the genes with altered CpG methylation in relationship to the suite of environmental contaminants. For each study, the sequences of the promoter regions (representing −1000 to +500 bp from the transcription start site) of all genes with altered CpG methylation were analyzed for enrichment of transcription factor binding sites. Binding sites for a total of 56 unique transcription factors were identified to be enriched within the promoter regions of the genes. Binding sites for the Kidney-Enriched Krupple-like Factor 15, a known responder to endogenous stress, were enriched ( P  < 0.001–0.041) among the genes with altered CpG methylation associated for five of the six environmental contaminants. These data support the transcription factor occupancy theory as a potential mechanism underlying environmentally-induced gene-specific CpG methylation. PMID:27066266

  3. Stimulation of dendritic cells enhances immune response after photodynamic therapy

    NASA Astrophysics Data System (ADS)

    Mroz, Pawel; Castano, Ana P.; Hamblin, Michael R.

    2009-02-01

    Photodynamic therapy (PDT) involves the administration of photosensitizers followed by illumination of the primary tumor with red light producing reactive oxygen species that cause vascular shutdown and tumor cell necrosis and apoptosis. Anti-tumor immunity is stimulated after PDT due to the acute inflammatory response, priming of the immune system to recognize tumor-associated antigens (TAA). The induction of specific CD8+ Tlymphocyte cells that recognize major histocompatibility complex class I (MHC-I) restricted epitopes of TAAs is a highly desirable goal in cancer therapy. The PDT killed tumor cells may be phagocytosed by dendritic cells (DC) that then migrate to draining lymph nodes and prime naÃve T-cells that recognize TAA epitopes. This process is however, often sub-optimal, in part due to tumor-induced DC dysfunction. Instead of DC that can become mature and activated and have a potent antigen-presenting and immune stimulating phenotype, immature dendritic cells (iDC) are often found in tumors and are part of an immunosuppressive milieu including regulatory T-cells and immunosuppressive cytokines such as TGF-beta and IL10. We here report on the use of a potent DC activating agent, an oligonucleotide (ODN) that contains a non-methylated CpG motif and acts as an agonist of toll like receptor (TLR) 9. TLR activation is a danger signal to notify the immune system of the presence of invading pathogens. CpG-ODN (but not scrambled non-CpG ODN) increased bone-marrow DC activation after exposure to PDT-killed tumor cells, and significantly increased tumor response to PDT and mouse survival after peri-tumoral administration. CpG may be a valuable immunoadjuvant to PDT especially for tumors that produce DC dysfunction.

  4. Intradermal immunisation using the TLR3-ligand Poly (I:C) as adjuvant induces mucosal antibody responses and protects against genital HSV-2 infection

    PubMed Central

    Bardel, Emilie; Doucet-Ladeveze, Remi; Mathieu, Cyrille; Harandi, Ali M; Dubois, Bertrand; Kaiserlian, Dominique

    2016-01-01

    Development of vaccines able to induce mucosal immunity in the genital and gastrointestinal tracts is a major challenge to counter sexually transmitted pathogens such as HIV-1 and HSV-2. Herein, we showed that intradermal (ID) immunisation with sub-unit vaccine antigens (i.e., HIV-1 gp140 and HSV-2 gD) delivered with Poly(I:C) or CpG1668 as adjuvant induces long-lasting virus-specific immunoglobulin (Ig)-G and IgA antibodies in the vagina and feces. Poly(I:C)-supplemented sub-unit viral vaccines caused minimal skin reactogenicity at variance to those containing CpG1668, promoted a delayed-type hypersensitivity (DTH) to the vaccine and protected mice from genital and neurological symptoms after a lethal vaginal HSV-2 challenge. Interestingly, Poly(I:C12U) (Ampligen), a Poly(I:C) structural analogue that binds to TLR3 but not MDA-5, promoted robust mucosal and systemic IgG antibodies, a weak skin DTH to the vaccine but not IgA responses and failed to confer protection against HSV-2 infection. Moreover, Poly(I:C) was far superior to Poly(I:C12U) at inducing prompt and robust upregulation of IFNß transcripts in lymph nodes draining the injection site. These data illustrate that ID vaccination with glycoproteins and Poly(I:C) as adjuvant promotes long-lasting mucosal immunity and protection from genital HSV-2 infection, with an acceptable skin reactogenicity profile. The ID route thus appears to be an unexpected inductive site for mucosal immunity and anti-viral protection suitable for sub-unit vaccines. This works further highlights that TLR3/MDA5 agonists such as Poly(I:C) may be valuable adjuvants for ID vaccination against sexually transmitted diseases. PMID:29263853

  5. 75 FR 13555 - Compliance Policy Guide Sec. 540.375 Canned Salmon - Adulteration Involving Decomposition (CPG...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-22

    ...] (Formerly Docket No. 1998N-0046) Compliance Policy Guide Sec. 540.375 Canned Salmon -- Adulteration... of Compliance Policy Guide Sec. 540.375 Canned Salmon -- Adulteration Involving Decomposition (CPG... relating to decomposition in fish and fishery products, including canned salmon, is provided in CPG Sec...

  6. Quantitative, high-resolution epigenetic profiling of CpG loci identifies associations with cord blood plasma homocysteine and birth weight in humans

    PubMed Central

    Ismail, Khaled MK; Haworth, Kim E; Mein, Charles; Carroll, William D

    2011-01-01

    Supplementation with folic acid during pregnancy is known to reduce the risk of neural tube defects and low birth weight. It is thought that folate and other one-carbon intermediates might secure these clinical effects via DNA methylation. We examined the effects of folate on the human methylome using quantitative interrogation of 27,578 CpG loci associated with 14,496 genes at single-nucleotide resolution across 12 fetal cord blood samples. Consistent with previous studies, the majority of CpG dinucleotides located within CpG islands exhibited hypomethylation while those outside CpG islands showed mid-high methylation. However, for the first time in human samples, unbiased analysis of methylation across samples revealed a significant correlation of methylation patterns with plasma homocysteine, LINE-1 methylation and birth weight centile. Additionally, CpG methylation significantly correlated with either birth weight or LINE-1 methylation were predominantly located in CpG islands. These data indicate that levels of folate-associated intermediates in cord blood reflect their influence and consequences for the fetal epigenome and potentially on pregnancy outcome. In these cases, their influence might be exerted during late gestation or reflect those present during the peri-conceptual period. PMID:20864804

  7. Role of Replication and CpG Methylation in Fragile X Syndrome CGG Deletions in Primate Cells

    PubMed Central

    Nichol Edamura, Kerrie; Leonard, Michelle R.; Pearson, Christopher E.

    2005-01-01

    Instability of the fragile X CGG repeat involves both maternally derived expansions and deletions in the gametes of full-mutation males. It has also been suggested that the absence of aberrant CpG methylation may enhance repeat deletions through an unknown process. The effect of CGG tract length, DNA replication direction, location of replication initiation, and CpG methylation upon CGG stability were investigated using an SV40 primate replication system. Replication-dependant deletions with 53 CGG repeats were observed when replication was initiated proximal to the repeat, with CGG as the lagging-strand template. When we initiated replication further from the repeat, while maintaining CGG as the lagging-strand template or using CCG as the lagging-strand template, significant instability was not observed. CpG methylation of the unstable template stabilized the repeat, decreasing both the frequency and the magnitude of deletion events. Furthermore, CpG methylation slowed the efficiency of replication for all templates. Interestingly, replication forks displayed no evidence of a block at the CGG repeat tract, regardless of replication direction or CpG methylation status. Templates with 20 CGG repeats were stable under all circumstances. These results reveal that CGG deletions occur during replication and are sensitive to replication-fork dynamics, tract length, and CpG methylation. PMID:15625623

  8. Topical CpG enhances the response of murine malignant melanoma to dacarbazine.

    PubMed

    Najar, Hossain M; Dutz, Jan P

    2008-09-01

    Malignant melanoma is a potentially fatal skin cancer that is increasing in incidence. Standard chemoimmunotherapy consisting of dacarbazine (DTIC) given with IFN-alpha has had disappointing results. We describe a chemoimmunotherapy protocol for cutaneous melanoma that combines the administration of DTIC with the topical application of CpG oligodinucleotide (ODN). Subcutaneous B16 melanoma tumors in C57BL/6 mice were treated with intraperitoneal injections of DTIC followed by the topical application of CpG-ODN over the tumors. This therapeutic approach abrogated the growth of established tumors and significantly enhanced survival. Topical CpG application was more effective than intratumoral CpG. Cell depletion studies indicated that the antitumor effect was dependent on both CD4(+) and CD8(+) cells but not on natural killer (NK) cells. Tumor-specific cytotoxic T-lymphocyte activity was generated in treated animals and was highest in topically treated animals. Immunohistochemical analysis revealed that DTIC, but not CpG, enhanced tumor cell apoptosis. Further, topical CpG induced an expansion of a B220(+)CD8(+) subset of dendritic cells and a subset of NK1.1(+) CD11c(+) cells within the tumors. By enhancing both tumor cell death and local immune activation, DTIC/topical CpG chemoimmunotherapy induced an effective T-cell-dependent host-immune response against melanoma.

  9. CpG oligodeoxynucleotides augment the murine immune response to the Yersinia pestis F1-V vaccine in bubonic and pneumonic models of plague.

    PubMed

    Amemiya, Kei; Meyers, Jennifer L; Rogers, Taralyn E; Fast, Randy L; Bassett, Anthony D; Worsham, Patricia L; Powell, Bradford S; Norris, Sarah L; Krieg, Arthur M; Adamovicz, Jeffrey J

    2009-04-06

    The current U.S. Department of Defense candidate plague vaccine is a fusion between two Yersinia pestis proteins: the F1 capsular protein, and the low calcium response (Lcr) V-protein. We hypothesized that an immunomodulator, such as CpG oligodeoxynucleotide (ODN)s, could augment the immune response to the plague F1-V vaccine in a mouse model for plague. CpG ODNs significantly augmented the antibody response and efficacy of a single dose of the plague vaccine in murine bubonic and pneumonic models of plague. In the latter study, we also found an overall significant augmentation the immune response to the individual subunits of the plague vaccine by CpG ODN 2006. In a long-term, prime-boost study, CpG ODN induced a significant early augmentation of the IgG response to the vaccine. The presence of CpG ODN induced a significant increase in the IgG2a subclass response to the vaccine up to 5 months after the boost. Our studies showed that CpG ODNs significantly augmented the IgG antibody response to the plague vaccine, which increased the probability of survival in murine models of plague (P<0.0001).

  10. The evolution of CpG density and lifespan in conserved primate and mammalian promoters

    PubMed Central

    McLain, Adam T.

    2018-01-01

    Gene promoters are evolutionarily conserved across holozoans and enriched in CpG sites, the target for DNA methylation. As animals age, the epigenetic pattern of DNA methylation degrades, with highly methylated CpG sites gradually becoming demethylated while CpG islands increase in methylation. Across vertebrates, aging is a trait that varies among species. We used this variation to determine whether promoter CpG density correlates with species’ maximum lifespan. Human promoter sequences were used to identify conserved regions in 131 mammals and a subset of 28 primate genomes. We identified approximately 1000 gene promoters (5% of the total), that significantly correlated CpG density with lifespan. The correlations were performed via the phylogenetic least squares method to account for trait similarity by common descent using phylogenetic branch lengths. Gene set enrichment analysis revealed no significantly enriched pathways or processes, consistent with the hypothesis that aging is not under positive selection. However, within both mammals and primates, 95% of the promoters showed a positive correlation between increasing CpG density and species lifespan, and two thirds were shared between the primate subset and mammalian datasets. Thus, these genes may require greater buffering capacity against age-related dysregulation of DNA methylation in longer-lived species. PMID:29661983

  11. Increased Neutrophil Secretion Induced by NLRP3 Mutation Links the Inflammasome to Azurophilic Granule Exocytosis

    PubMed Central

    Johnson, Jennifer L.; Ramadass, Mahalakshmi; Haimovich, Ariela; McGeough, Matthew D.; Zhang, Jinzhong; Hoffman, Hal M.; Catz, Sergio D.

    2017-01-01

    Heterozygous mutations in the NLRP3 gene in patients with cryopyrin associated periodic syndrome (CAPS) lead to hyper-responsive inflammasome function. CAPS is a systemic auto-inflammatory syndrome characterized by the activation of the innate immune system induced by elevated pro-inflammatory cytokines, but the involvement of selective innate immune cells in this process is not fully understood. Neutrophil secretion and the toxic components of their granules are mediators of inflammation associated with several human diseases and inflammatory conditions. Here, using the Nlrp3A350V inducible mouse model (MWS CreT) that recapitulates human patients with the A352V mutation in NLRP3 observed in the Muckle-Wells sub-phenotype of CAPS, we studied the relationship between hyper-activation of the inflammasome and neutrophil exocytosis. Using a flow cytometry approach, we show that Nlrp3A350V (MWS) neutrophils express normal basal levels of CD11b at the plasma membrane and that the upregulation of CD11b from secretory vesicles in response to several plasma membrane or endocytic agonist including the bacterial-derived mimetic peptide formyl-Leu-Met-Phe (fMLF) and the unmethylated oligonucleotide CpG is normal in MWS neutrophils. Significant but modest CD11b upregulation in MWS neutrophils compared to wild type was only observed in response to GM-CSF and CpG. The same pattern was observed for the secretion of matrix metalloproteinase-9 (MMP-9) from gelatinase granules in that MMP-9 secretion in MWS neutrophils was not different from that observed in wild-type neutrophils except when stimulated with GM-CSF and CpG. In contrast, azurophilic granule secretion, whose cargoes constitute the most toxic secretory and pro-inflammatory factors of the neutrophil, was markedly dysregulated in MWS neutrophils under both basal and stimulated conditions. This could not be attributed to paracrine effects of secretory cytokines because IL-1β secretion by neutrophils was undetectable under these experimental conditions. The increased azurophilic granule exocytosis in MWS neutrophils was attenuated by treatment with the neutrophil exocytosis inhibitor Nexinhib20. In agreement with a possible neutrophil contribution to systemic inflammation in CAPS, the levels of neutrophil secretory proteins were significantly elevated in the plasma from Nlrp3A350V mice. Altogether, our data indicates an azurophilic granule-selective dysregulation of neutrophil exocytosis in CAPS. PMID:29322034

  12. Ionotropic and metabotropic glutamate receptor mediation of glucocorticoid-induced apoptosis in hippocampal cells and the neuroprotective role of synaptic N-methyl-D-aspartate receptors.

    PubMed

    Lu, J; Goula, D; Sousa, N; Almeida, O F X

    2003-01-01

    Glutamate receptors have been proposed to mediate the apoptotic actions of glucocorticoids in hippocampal cells. To further analyze the role of glutamate receptors in this process, we pretreated primary hippocampal cells from neonatal (postnatal day 4) rats with antagonists of ionotropic glutamate receptor (iGluR) and metabotropic glutamate receptor (mGluR) antagonists before exposure to the specific glucocorticoid receptor agonist dexamethasone (DEX) at a dose of 1 microM. Dizocilpine (MK801; a general N-methyl-D-aspartic acid [NMDA] receptor antagonist, NMDAR antagonist) and ifenprodil (a specific ligand of the NMDAR 2B subunit, NR2B), were used to block iGluR; (RS)-alpha-ethyl-4-carboxyphenylglycine (E4CPG) and (RS)-alpha-cyclopropyl-4-phosphonophenyl-glycine (CPPG) were employed as I/II (E4CPG) and II/III (CPPG) mGluR antagonists. Blockade of iGluR resulted in a significant attenuation of DEX-induced cell death; the finding that ifenprodil exerted a similar potency to MK801 demonstrates the involvement of NR2B receptors in glucocorticoid-induced cell death. Apoptosis accounted for a significant amount of the cell loss observed, as detected by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling histochemistry for the in situ labeling of DNA breaks; apoptotic cells were distinguished from necrosis on the basis of morphological criteria, including chromatin condensation, membrane blebbing and presence of apoptotic bodies. Treatment with E4CPG and CPPG completely abolished the apoptotic response to DEX, thus showing the additional contribution of mGluR to the phenomenon. Further, dose-response studies with NMDA revealed that whereas high (10 microM) doses of NMDA themselves elicit cytotoxic responses, low (1-5 microM) concentrations of NMDA can effectively oppose DEX-induced cell death. Interestingly, the neuroprotective actions of low dose NMDA stimulation were abolished when either synaptic or extrasynaptic NMDA receptors were blocked with MK801 in combination with the GABA receptor antagonist bicuculline (synaptic) or ifenprodil (extrasynaptic). In summary, the present data show that both iGluR and mGluR mediate the neurotoxic effects of glucocorticoids on hippocampal cells and that pre-treatment with low doses of NMDA, by acting on synaptic and extrasynaptic receptors, render hippocampal cells less vulnerable to glucocorticoid insults.

  13. Leveraging workflow control patterns in the domain of clinical practice guidelines.

    PubMed

    Kaiser, Katharina; Marcos, Mar

    2016-02-10

    Clinical practice guidelines (CPGs) include recommendations describing appropriate care for the management of patients with a specific clinical condition. A number of representation languages have been developed to support executable CPGs, with associated authoring/editing tools. Even with tool assistance, authoring of CPG models is a labor-intensive task. We aim at facilitating the early stages of CPG modeling task. In this context, we propose to support the authoring of CPG models based on a set of suitable procedural patterns described in an implementation-independent notation that can be then semi-automatically transformed into one of the alternative executable CPG languages. We have started with the workflow control patterns which have been identified in the fields of workflow systems and business process management. We have analyzed the suitability of these patterns by means of a qualitative analysis of CPG texts. Following our analysis we have implemented a selection of workflow patterns in the Asbru and PROforma CPG languages. As implementation-independent notation for the description of patterns we have chosen BPMN 2.0. Finally, we have developed XSLT transformations to convert the BPMN 2.0 version of the patterns into the Asbru and PROforma languages. We showed that although a significant number of workflow control patterns are suitable to describe CPG procedural knowledge, not all of them are applicable in the context of CPGs due to their focus on single-patient care. Moreover, CPGs may require additional patterns not included in the set of workflow control patterns. We also showed that nearly all the CPG-suitable patterns can be conveniently implemented in the Asbru and PROforma languages. Finally, we demonstrated that individual patterns can be semi-automatically transformed from a process specification in BPMN 2.0 to executable implementations in these languages. We propose a pattern and transformation-based approach for the development of CPG models. Such an approach can form the basis of a valid framework for the authoring of CPG models. The identification of adequate patterns and the implementation of transformations to convert patterns from a process specification into different executable implementations are the first necessary steps for our approach.

  14. Immunogenic properties of a recombinant fusion protein containing the C-terminal 19 kDa of Plasmodium falciparum merozoite surface protein-1 and the innate immunity agonist FliC flagellin of Salmonella typhimurium.

    PubMed

    Bargieri, Daniel Y; Leite, Juliana A; Lopes, Stefanie C P; Sbrogio-Almeida, Maria Elisabete; Braga, Catarina J M; Ferreira, Luis C S; Soares, Irene S; Costa, Fabio T M; Rodrigues, Mauricio M

    2010-04-01

    In a recent study, we demonstrated the immunogenic properties of a new malaria vaccine polypeptide based on a 19 kDa C-terminal fragment of the merozoite surface protein-1 (MSP1(19)) from Plasmodium vivax and an innate immunity agonist, the Salmonella enterica serovar Typhimurium flagellin (FliC). Herein, we tested whether the same strategy, based on the MSP1(19) component of the deadly malaria parasite Plasmodium falciparum, could also generate a fusion polypeptide with enhanced immunogenicity. The His(6)FliC-MSP1(19) fusion protein was expressed from a recombinant Escherichia coli and showed preserved in vitro TLR5-binding activity. In contrast to animals injected with His(6)MSP1(19), mice subcutaneously immunised with the recombinant His(6)FliC-MSP1(19) developed strong MSP1(19)-specific systemic antibody responses with a prevailing IgG1 subclass. Incorporation of other adjuvants, such as CpG ODN 1826, complete and incomplete Freund's adjuvants or Quil-A, improved the IgG responses after the second, but not the third, immunising dose. It also resulted in a more balanced IgG subclass response, as evaluated by the IgG1/IgG2c ratio, and higher cell-mediated immune response, as determined by the detection of antigen-specific interferon-gamma secretion by immune spleen cells. MSP1(19)-specific antibodies recognised not only the recombinant protein, but also the native protein expressed on the surface of P. falciparum parasites. Finally, sera from rabbits immunised with the fusion protein alone inhibited the in vitro growth of three different P. falciparum strains. In summary, these results extend our previous observations and further demonstrate that fusion of the innate immunity agonist FliC to Plasmodium antigens is a promising alternative to improve their immunogenicity. (c) 2010 Elsevier Ltd. All rights reserved.

  15. In ovo CpG DNA delivery increases innate and adaptive immune cells in respiratory, gastrointestinal and immune systems post-hatch correlating with lower infectious laryngotracheitis virus infection.

    PubMed

    Abdul-Cader, Mohamed Sarjoon; Amarasinghe, Aruna; Palomino-Tapia, Victor; Ahmed-Hassan, Hanaa; Bakhtawar, Khawaja; Nagy, Eva; Sharif, Shayan; Gomis, Susantha; Abdul-Careem, Mohamed Faizal

    2018-01-01

    Cytosine-guanosine deoxynucleotides (CpG) DNA can be delivered in ovo at embryo day (ED)18 for the stimulation of toll-like receptor (TLR)21 signaling pathway that ultimately protects chickens against a number of bacterial and viral infections. There is a dearth of information understanding the mechanisms of protection induced by in ovo delivered CpG DNA. The objective of this study was to determine the immune cell changes post-hatch following in ovo delivery of the TLR21 ligand, CpG DNA. In order to quantify changes of percentage of KUL01+, IgM+ B, cluster of differentiation (CD)4+ and CD8α+ cells, trachea, lung, duodenum, large intestine, spleen and bursa of Fabricius were collected on day 1 post-hatch. We found increased recruitments of KUL01+ cells, in organs of these body systems post-hatch following in ovo delivery of CpG DNA. Although IgM+ B cells, CD4+ and CD8α+ cells were increased in lungs and immune system organs, these cells were not quantifiable from the trachea, duodenum and large intestine immediately following the hatch. Furthermore, when CpG DNA is delivered in ovo and subsequently infected with infectious laryngotracheitis virus (ILTV) post-hatch on day 1, CpG DNA reduces morbidity and mortality resulting from ILTV infection. This study provides insights into the mechanisms of host responses elicited following in ovo delivery of CpG DNA in avian species.

  16. Rolling Thunder -- Integration of the Solo 161 Stirling engine with the CPG-460 solar concentrator at Ft. Huachuca

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Diver, R.B.; Moss, T.A.; Goldberg, V.

    Project Rolling Thunder is a dish/Stirling demonstration project at Ft. Huachuca, a US Army fort in southeastern Arizona (Huachuca means rolling thunder in Apache). It has been supported by the Strategic Environmental Research and Development Program (SERDP), a cooperative program between the Department of Defense (DoD) and the Department of Energy (DOE). As part of a 1992 SERDP project, Cummins Power Generation, Inc. (CPG) installed a CPG 7 kW(c) dish/Stirling system at the Joint Interoperability Test Command (JITC) in Ft. Huachuca, Arizona. The primary objective of the SERDP Dish/Stirling for DoD Applications project was to demonstrate a CPG 7-kW(c) dish/Stirlingmore » system at a military facility. Unfortunately, Cummins Engine Company decided to divest its solar operations. As a direct result of Ft. Huachuca`s interest in the Cummins dish/Stirling technology, Sandia explored the possibility of installing a SOLO 161 Stirling power conversion unit (PCU) on the Ft. Huachuca CPG-460. In January 1997, a decision was made to retrofit a SOLO 161 Stirling engine on the CPG-460 at Ft. Huachuca. Project Rolling Thunder. The SOLO 161 Demonstration at Ft. Huachuca has been a challenge. Although, the SOLO 161 PCU has operated nearly flawlessly and the CPG-460 has been, for the most part, a solid and reliable component, integration of the SOLO PCU with the CPG-460 has required significant attention. In this paper, the integration issues and technical approaches of project Rolling Thunder are presented. Lessons of the project are also discussed.« less

  17. Guideline-Driven Care Improves Outcomes in Patients with Traumatic Rib Fractures.

    PubMed

    Flarity, Kathleen; Rhodes, Whitney C; Berson, Andrew J; Leininger, Brian E; Reckard, Paul E; Riley, Keyan D; Shahan, Charles P; Schroeppel, Thomas J

    2017-09-01

    There is no established national standard for rib fracture management. A clinical practice guideline (CPG) for rib fractures, including monitoring of pulmonary function, early initiation of aggressive loco-regional analgesia, and early identification of deteriorating respiratory function, was implemented in 2013. The objective of the study was to evaluate the effect of the CPG on hospital length of stay. Hospital length of stay (LOS) was compared for adult patients admitted to the hospital with rib fracture(s) two years before and two years after CPG implementation. A separate analysis was done for the patients admitted to the intensive care unit (ICU). Over the 48-month study period, 571 patients met inclusion criteria for the study. Pre-CPG and CPG study groups were well matched with few differences. Multivariable regression did not demonstrate a difference in LOS (B = -0.838; P = 0.095) in the total study cohort. In the ICU cohort (n = 274), patients in the CPG group were older (57 vs 52 years; P = 0.023) and had more rib fractures (4 vs 3; P = 0.003). Multivariable regression identified a significant decrease in LOS for those patients admitted in the CPG period (B = -2.29; P = 0.019). Despite being significantly older with more rib fractures in the ICU cohort, patients admitted after implementation of the CPG had a significantly reduced LOS on multivariable analysis, reducing LOS by over two days. This structured intervention can limit narcotic usage, improve pulmonary function, and decrease LOS in the most injured patients with chest trauma.

  18. Energetic study of cardioplegic hearts under ischaemia/reperfusion and [Ca(2+)] changes in cardiomyocytes of guinea-pig: mitochondrial role.

    PubMed

    Ragone, M I; Torres, N S; Consolini, A E

    2013-02-01

    To study the role of mitochondria in the recovery of guinea-pig hearts exposed to high-K(+)-cardioplegia (CPG) and ischaemia/reperfusion (I/R) METHODS: We measured contractility and heat release in perfused guinea-pig hearts and cytosolic and mitochondrial Ca(2+) by epifluorescence and confocal microscopy in isolated cardiomyocytes loaded with Fluo-4 or Rhod-2. In hearts, CPG increased the postischaemic contractile recovery, and this was potentiated by the mNCX blocker clonazepam and the mKATP opener diazoxide, which also prevented the fall in muscle economy. Moreover, CPG prevented the stunning induced by ouabain, which was reduced by clonazepam. In cardiomyocytes, CPG increased fluorescent signals of cytosolic and mitochondrial Ca(2+), while the addition of a mNCX blocker (CGP37157) increased cytosolic but reduced mitochondrial [Ca(2+)]. Ouabain in CPG increased cytosolic Ca(2+) and resting heat, but the addition of CGP37157 reduced them, as well as mitochondrial Ca(2+). CPG, diazoxide and clonazepam improve postischaemic recovery, respectively, by increasing the Ca(2+) cycling and by reducing the mitochondrial Ca(2+) uptake either by uniporter or by mNCX. The mitochondria compete with the leaky sarcoplasmic reticulum (SR) as sink of Ca(2+) in guinea-pig hearts, affecting the postischaemic contractility. CPG also prevented the ouabain-induced dysfunction by avoiding the Ca(2+) overload. Ouabain reduced the synergism between CPG and clonazepam suggesting that [Na(+)]i and SR load influence the mNCX role. © 2012 The Authors Acta Physiologica © 2012 Scandinavian Physiological Society.

  19. 75 FR 60761 - Government-Owned Inventions; Availability for Licensing

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-01

    ... cells conjugated to a K-type CpG oligodeoxynucleotide (ODN) to a subject. Methods for treating a tumor... therapeutically effective amount of apoptotic tumor cells conjugated to a K-type CpG oligodeoxynucleotide (ODN) to... the prevention of cancer and other indications Use of CpG oligonucleotides for prophylaxis and/or...

  20. 78 FR 46594 - Prospective Grant of Start-up Exclusive License: Topical Antibiotic With Immune Stimulating...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-01

    ... Speed Wound Healing; and Use of CpG Oligodeoxynucleotides To Induce Epithelial Cell Growth AGENCY... CpG Oligodeoxynucleotides to Induce Epithelial Cell Growth'' to Tollgene having a place of business... 37 CFR part 404. These technologies relate to relate to use of CpG oligodeoxynucleotides (ODNs) to...

  1. Promoter methylation assay of SASH1 gene in breast cancer.

    PubMed

    Sheyu, Lin; Hui, Liu; Junyu, Zhang; Jiawei, Xu; Honglian, Wang; Qing, Sang; Hengwei, Zhang; Xuhui, Guo; Qinghe, Xing; Lin, He

    2013-01-01

    To analyze the relationship between the expression of SASH1 and its methylation level of SASH1 gene promoter in human breast cancer. Expression levels of SASH1 were examined in breast cancer tissues and adjacent normal tissues with immunohistochemistry and with real time PCR (RT-PCR) methylation analysis was performed with MassArray. Immunohistochemistry showed that SASH1 expression was strongly reduced in breast cancer compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed that CpG sites in SASH1 promoter shared similar methylation pattern in tumor tissue and adjacent normal tissue. The CpG sites with significant difference in methylation level were CpG_26.27 and CpG_54.55. Moreover, 5-aza-2'-deoxycytidine (5-Aza-dc) treatment of tumor cell line MDA-MB-231 caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation level in the promoter region of gene SASH1, particularly CpG_26.27 or CpG_54.55 sites, possibly repressed SASH1 expression in breast cancer.

  2. Methylation detection oligonucleotide microarray analysis: a high-resolution method for detection of CpG island methylation

    PubMed Central

    Kamalakaran, Sitharthan; Kendall, Jude; Zhao, Xiaoyue; Tang, Chunlao; Khan, Sohail; Ravi, Kandasamy; Auletta, Theresa; Riggs, Michael; Wang, Yun; Helland, Åslaug; Naume, Bjørn; Dimitrova, Nevenka; Børresen-Dale, Anne-Lise; Hicks, Jim; Lucito, Robert

    2009-01-01

    Methylation of CpG islands associated with genes can affect the expression of the proximal gene, and methylation of non-associated CpG islands correlates to genomic instability. This epigenetic modification has been shown to be important in many pathologies, from development and disease to cancer. We report the development of a novel high-resolution microarray that detects the methylation status of over 25 000 CpG islands in the human genome. Experiments were performed to demonstrate low system noise in the methodology and that the array probes have a high signal to noise ratio. Methylation measurements between different cell lines were validated demonstrating the accuracy of measurement. We then identified alterations in CpG islands, both those associated with gene promoters, as well as non-promoter-associated islands in a set of breast and ovarian tumors. We demonstrate that this methodology accurately identifies methylation profiles in cancer and in principle it can differentiate any CpG methylation alterations and can be adapted to analyze other species. PMID:19474344

  3. The Use of Chlorhexidine/n-Propyl Gallate (CPG) as an Ambient-Temperature Urine Preservative

    NASA Technical Reports Server (NTRS)

    Nillen, Jeannie L.; Smith, Scott M.

    2003-01-01

    A safe, effective ambient temperature urine preservative, chlorhexidine/n-propyl gallate (CPG), has been formulated for use during spacefli ght that reduces the effects of oxidation and bacterial contamination on sample integrity while maintaining urine pH. The ability of this preservative to maintain stability of nine key analytes was evaluated for a period of one year. CPG effectively maintained stability of a mmonia, total nitrogen, 3-methylhistidine, chloride, sodium, potassiu m, and urea; however, creatinine and osmolality were not preserved by CPG. These data indicate that CPG offers prolonged room-temperature storage for multiple urine analytes, reducing the requirements for f rozen urine storage on future spaceflights. Iii medical applications on Earth, this technology can allow urine samples to be collected in remote settings and eliminate the need to ship frozen samples.

  4. Methylation oligonucleotide microarray: a novel tool to analyze methylation patterns

    NASA Astrophysics Data System (ADS)

    Hou, Peng; Ji, Meiju; He, Nongyao; Lu, Zuhong

    2003-04-01

    A new technique to analyze methylation patterns in several adjacent CpG sites was developed and reported here. We selected a 336bp segment of the 5"-untranslated region and the first exon of the p16Ink4a gene, which include the most densely packed CpG fragment of the islands containing 32 CpG dinucleotides, as the investigated target. The probes that include all types of methylation patterns were designed to fabricate a DNA microarray to determine the methylation patterns of seven adjacent CpG dinucleotides sites. High accuracy and reproducibility were observed in several parallel experiments. The results led us to the conclusion that the methylation oligonucleotide microarray can be applied as a novel and powerful tool to map methylation patterns and changes in multiple CpG island loci in a variety of tumors.

  5. DNA methylation profiles of long- and short-term glioblastoma survivors

    PubMed Central

    Shinawi, Thoraia; Hill, Victoria K.; Krex, Dietmar; Schackert, Gabriele; Gentle, Dean; Morris, Mark R.; Wei, Wenbin; Cruickshank, Garth; Maher, Eamonn R.; Latif, Farida

    2013-01-01

    Glioblastoma (GBM) is the most common and malignant type of primary brain tumor in adults and prognosis of most GBM patients is poor. However, a small percentage of patients show a long term survival of 36 mo or longer after diagnosis. Epigenetic profiles can provide molecular markers for patient prognosis: recently, a G-CIMP positive phenotype associated with IDH1 mutations has been described for GBMs with good prognosis. In the present analysis we performed genome-wide DNA methylation profiling of short-term survivors (STS; overall survival < 1 y) and long-term survivors (LTS; overall survival > 3 y) by utilizing the HumanMethylation450K BeadChips to assess quantitative methylation at > 480,000 CpG sites. Cluster analysis has shown that a subset of LTS showed a G-CIMP positive phenotype that was tightly associated with IDH1 mutation status and was confirmed by analysis of the G-CIMP signature genes. Using high stringency criteria for differential hypermethylation between non-cancer brain and tumor samples, we identified 2,638 hypermethylated CpG loci (890 genes) in STS GBMs, 3,101 hypermethylated CpG loci (1,062 genes) in LTS (wild type IDH1) and 11,293 hypermethylated CpG loci in LTS (mutated for IDH1), reflecting the CIMP positive phenotype. The location of differentially hypermethylated CpG loci with respect to CpG content, neighborhood context and functional genomic distribution was similar in our sample set, with the majority of CpG loci residing in CpG islands and in gene promoters. Our preliminary study also identified a set of CpG loci differentially hypermethylated between STS and LTS cases, including members of the homeobox gene family (HOXD8, HOXD13 and HOXC4), the transcription factors NR2F2 and TFAP2A, and Dickkopf 2, a negative regulator of the wnt/β-catenin signaling pathway. PMID:23291739

  6. Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity.

    PubMed

    Zheng, Min; Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei

    2017-08-16

    Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2-4 and CpG 17-18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2-4 and CpG 17-18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2-4 were correlated negatively with the percentage of neutrophils ( β = -0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity.

  7. Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity

    PubMed Central

    Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei

    2017-01-01

    Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2–4 and CpG 17–18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2–4 and CpG 17–18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2–4 were correlated negatively with the percentage of neutrophils (β = −0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity. PMID:28813025

  8. Vitamin D dose response is underestimated by Endocrine Society's Clinical Practice Guideline.

    PubMed

    McKenna, Malachi J; Murray, Barbara F

    2013-06-01

    The recommended daily intakes of vitamin D according to the recent Clinical Practice Guideline (CPG) of the Endocrine Society are three- to fivefold higher than the Institute of Medicine (IOM) report. We speculated that these differences could be explained by different mathematical approaches to the vitamin D dose response. Studies were selected if the daily dose was ≤2000 IU/day, the duration exceeded 3 months, and 25-hydroxyvitamin D (25OHD) concentrations were measured at baseline and post-therapy. The rate constant was estimated according to the CPG approach. The achieved 25OHD result was estimated according to the following: i) the regression equation approach of the IOM; ii) the regression approach of the Vitamin D Supplementation in Older Subjects (ViDOS) study; and iii) the CPG approach using a rate constant of 2.5 (CPG2.5) and a rate constant of 5.0 (CPG5.0). The difference between the expected and the observed 25OHD result was expressed as a percentage of observed and analyzed for significance against a value of 0% for the four groups. Forty-one studies were analyzed. The mean (95% CI) rate constant was 5.3 (4.4-6.2) nmol/l per 100 IU per day, on average twofold higher than the CPG rate constant. The mean (95% CI) for the difference between the expected and observed expressed as a percentage of observed was as follows: i) IOM, -7 (-16,+2)% (t=1.64, P=0.110); ii) ViDOS, +2 (-8,+12)% (t=0.40, P=0.69); iii) CPG2.5, -21 (-27,-15)% (t=7.2, P<0.0001); and iv) CPG5.0+3 (-4,+10)% (t=0.91, P=0.366). The CPG 'rule of thumb' should be doubled to 5.0 nmol/l (2.0 ng/ml) per 100 IU per day, adopting a more risk-averse position.

  9. CpG methylation patterns and decitabine treatment response in acute myeloid leukemia cells and normal hematopoietic precursors

    PubMed Central

    Negrotto, Soledad; Ng, Kwok Peng; Jankowska, Ania M.; Bodo, Juraj; Gopalan, Banu; Guinta, Kathryn; Mulloy, James C.; Hsi, Eric; Maciejewski, Jaroslaw; Saunthararajah, Yogen

    2011-01-01

    The DNA hypomethylating drug decitabine maintains normal hematopoietic stem cell (HSC) self-renewal but induces terminal differentiation in acute myeloid leukemia (AML) cells. The basis for these contrasting cell-fates, and for selective CpG hypomethylation by decitabine, is poorly understood. Promoter CpGs, with methylation measured by microarray, were classified by the direction of methylation change with normal myeloid maturation. In AML cells, the methylation pattern at maturation-responsive CpG suggested at least partial maturation. Consistent with partial maturation, in gene expression analyses, AML cells expressed high levels of the key lineage-specifying factor CEBPA, but relatively low levels of the key late-differentiation driver CEBPE. In methylation analysis by mass-spectrometry, CEBPE promoter CpG that are usually hypomethylated during granulocyte maturation were significantly hypermethylated in AML cells. Decitabine treatment induced cellular differentiation of AML cells, and the largest methylation decreases were at CpG that are hypomethylated with myeloid maturation, including CEBPE promoter CpG. In contrast, decitabine-treated normal HSC retained immature morphology, and methylation significantly decreased at CpG that are less methylated in immature cells. High expression of lineage-specifying factor and aberrant epigenetic repression of some key late-differentiation genes distinguishes AML cells from normal HSC and could explain the contrasting differentiation and methylation responses to decitabine. PMID:21836612

  10. Dopamine receptor D4 promoter hypermethylation increases the risk of drug addiction.

    PubMed

    Ji, Huihui; Xu, Xuting; Liu, Guili; Liu, Huifen; Wang, Qinwen; Shen, Wenwen; Li, Longhui; Xie, Xiaohu; Hu, Haochang; Xu, Lei; Zhou, Wenhua; Duan, Shiwei

    2018-02-01

    Heroin and methylamphetamine (METH) are two addictive drugs that cause serious problems for society. Dopamine receptor D4 (DRD4), a key receptor in the dopaminergic system, may facilitate the development of drug addiction. The aim of the present study was to investigate the association between the promoter methylation level of DRD4 gene and drug addiction. Bisulfite pyrosequencing technology was used to measure the methylation levels of DRD4 promoter in 60 drug addicts and 52 matched controls. Significantly higher levels of DRD4 CpG1 and CpG4 methylation were detected in METH and heroin drug addicts compared with controls (P<0.05). Male METH addicts exhibited significantly higher DRD4 CpG1, CpG2 and CpG4 methylation levels compared with sex-matched controls (P<0.05). In heroin addicts, a positive correlation was observed between depression-dejection and DRD4 CpG5 methylation (r=0.537, P=0.039) whereas there was a negative correlation between drug usage frequency and CpG1 methylation (r=-0.632, P=0.011). In METH addicts, methylation levels were not significantly associated with depression-dejection and drug usage frequency. In addition, luciferase assays demonstrated that the target sequence of the DRD4 promoter upregulates gene expression. The results of the present study suggest that DNA methylation of DRD4 may be responsible for the pathophysiology of drug addiction.

  11. Levels of DNA Methylation Vary at CpG Sites across the BRCA1 Promoter, and Differ According to Triple Negative and "BRCA-Like" Status, in Both Blood and Tumour DNA.

    PubMed

    Daniels, Sarah L; Burghel, George J; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D; Brock, Ian W; Cramp, Helen E; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S; Cox, Angela

    2016-01-01

    Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies.

  12. Reconstruction of Toll-like receptor 9-mediated responses in HEK-Blue hTLR9 cells by transfection of human macrophage scavenger receptor 1 gene.

    PubMed

    Ohtsuki, Shozo; Takahashi, Yuki; Inoue, Takao; Takakura, Yoshinobu; Nishikawa, Makiya

    2017-10-20

    We used human Toll-like receptor 9 (hTLR9)-expressing HEK-Blue hTLR9 cells, which release secreted embryonic alkaline phosphatase (SEAP) upon response to CpG DNA, to evaluate the immunological properties of nucleic acid drug candidates. Our preliminary studies showed that phosphodiester CpG DNA hardly induced any SEAP secretion in HEK-Blue hTLR9 cells. In the current study, therefore, we developed HEK-Blue hTLR9 cells transduced with human macrophage scavenger receptor-1 (hMSR1), a cell-surface DNA receptor, and determined whether HEK-Blue hTLR9/hMSR1 cells respond to phosphorothioate (PS) CpG DNA and phosphodiester (PO) CpG DNA. We selected PS CpG2006, a single-stranded PO CpG DNA (ssCpG), and a tetrapod-like structured DNA (tetrapodna) containing ssCpG (tetraCpG) as model TLR9 ligands. Alexa Fluor 488-labeled ligands were used for flow cytometry. Unlike the mock-transfected HEK-Blue hTLR9 cells, the HEK-Blue hTLR9/hMSR1 cells efficiently took up all three CpG DNAs. SEAP release was almost proportional to the uptake. Treatment of HEK-Blue hTLR9/hMSR1 cells with an anti-hMSR1 antibody significantly reduced the uptake of ssCpG and tetraCpG. Collectively, reconstruction of TLR9-mediated responses to CpG DNA in HEK-Blue hTLR9 cells can be used to evaluate the toxicity of nucleic acid drug candidates with diverse physicochemical properties.

  13. Evidence-based clinical practice guideline for adult Still's disease.

    PubMed

    Mimura, Toshihide; Kondo, Yuya; Ohta, Akihide; Iwamoto, Masahiro; Ota, Akiko; Okamoto, Nami; Kawaguchi, Yasushi; Kono, Hajime; Takasaki, Yoshinari; Takei, Shuji; Nishimoto, Norihiro; Fujimoto, Manabu; Asanuma, Yu Funakubo; Mimori, Akio; Okiyama, Naoko; Kaneko, Shunta; Takahashi, Hiroyuki; Yokosawa, Masahiro; Sumida, Takayuki

    2018-05-09

    Using an expert- and data-driven methodology, we have constructed the first clinical practice guidelines (CPGs) for adult Still's disease (ASD) after complete systematic review (SR) of the literature based upon the Medical Information Network Distribution Service (Minds) procedure. The CPG committee for ASD organized by the Research Team for Autoimmune Diseases, the Research Program for Intractable Disease of the Japanese Ministry of Health, Labour, and Welfare has developed CPG for ASD 2017, according to the procedure proposed by Minds. The CPG development process includes (1) clarification of the purpose of CPG, (2) organization of the steering committee, (3) organization of the CPG committee and secretariat, (4) defining the scope (setting of clinical questions (CQs)), (5) SR, (6) development of recommendations, (7) drafting the CPG, (8) external evaluation and public comments, and (9) release. Because we wanted to construct CPG for ASD to encompass both adult-onset Still's disease (AOSD) and adult patients with systemic juvenile idiopathic arthritis (sJIA), we also included SR data from sJIA in this study. Twenty-six CQs were selected and roughly divided into the following items: (1) clinical findings (CQs 1-4), (2) laboratory findings (CQs 5-8), (3) complications (CQs 9-13), (4) treatment with oral medicine (CQs 14-19), (5) treatment with biological reagents (CQs 20-23), and (6) treatments for sJIA (CQs 25-26). Recommendations and the strength of the recommendations for these CQs were decided by a modified Delphi method. We have developed the first published CPG for ASD including AOSD and sJIA, which includes 26 CQs and recommendations. This guideline will help rheumatologists, non-specialized physicians, other healthcare providers, medical and health-related students, and patients and their family members to understand and treat ASD.

  14. Provider Adherence to Implementation of Clinical Practice Guidelines for Neurogenic Bowel in Adults With Spinal Cord Injury

    PubMed Central

    Goetz, Lance L; Nelson, Audrey L; Guihan, Marylou; Bosshart, Helen T; Harrow, Jeffrey J; Gerhart, Kevin D; Krasnicka, Barbara; Burns, Stephen P

    2005-01-01

    Background/Objectives: Clinical Practice Guidelines (CPGs) have been published on a number of topics in spinal cord injury (SCI) medicine. Research in the general medical literature shows that the distribution of CPGs has a minimal effect on physician practice without targeted implementation strategies. The purpose of this study was to determine (a) whether dissemination of an SCI CPG improved the likelihood that patients would receive CPG recommended care and (b) whether adherence to CPG recommendations could be improved through a targeted implementation strategy. Specifically, this study addressed the “Neurogenic Bowel Management in Adults with Spinal Cord Injury” Clinical Practice Guideline published in March 1998 by the Consortium for Spinal Cord Medicine Methods: CPG adherence was determined from medical record review at 6 Veterans Affairs SCI centers for 3 time periods: before guideline publication (T1), after guideline publication but before CPG implementation (T2), and after targeted CPG implementation (T3). Specific implementation strategies to enhance guideline adherence were chosen to address the barriers identified by SCI providers in focus groups before the intervention. Results: Overall adherence to recommendations related to neurogenic bowel did not change between T1 and T2 (P = not significant) but increased significantly between T2 and T3 (P < 0.001) for 3 of 6 guideline recommendations. For the other 3 guideline recommendations, adherence rates were noted to be high at T1. Conclusions: While publication of the CPG alone did not alter rates of provider adherence, the use of a targeted implementation plan resulted in increases in adherence rates with some (3 of 6) CPG recommendations for neurogenic bowel management. PMID:16869086

  15. The Genomic Impact of DNA CpG Methylation on Gene Expression; Relationships in Prostate Cancer.

    PubMed

    Long, Mark D; Smiraglia, Dominic J; Campbell, Moray J

    2017-02-14

    The process of DNA CpG methylation has been extensively investigated for over 50 years and revealed associations between changing methylation status of CpG islands and gene expression. As a result, DNA CpG methylation is implicated in the control of gene expression in developmental and homeostasis processes, as well as being a cancer-driver mechanism. The development of genome-wide technologies and sophisticated statistical analytical approaches has ushered in an era of widespread analyses, for example in the cancer arena, of the relationships between altered DNA CpG methylation, gene expression, and tumor status. The remarkable increase in the volume of such genomic data, for example, through investigators from the Cancer Genome Atlas (TCGA), has allowed dissection of the relationships between DNA CpG methylation density and distribution, gene expression, and tumor outcome. In this manner, it is now possible to test that the genome-wide correlations are measurable between changes in DNA CpG methylation and gene expression. Perhaps surprisingly is that these associations can only be detected for hundreds, but not thousands, of genes, and the direction of the correlations are both positive and negative. This, perhaps, suggests that CpG methylation events in cancer systems can act as disease drivers but the effects are possibly more restricted than suspected. Additionally, the positive and negative correlations suggest direct and indirect events and an incomplete understanding. Within the prostate cancer TCGA cohort, we examined the relationships between expression of genes that control DNA methylation, known targets of DNA methylation and tumor status. This revealed that genes that control the synthesis of S -adenosyl-l-methionine (SAM) associate with altered expression of DNA methylation targets in a subset of aggressive tumors.

  16. Bayesian inference supports a location and neighbour-dependent model of DNA methylation propagation at the MGMT gene promoter in lung tumours.

    PubMed

    Bonello, Nicolas; Sampson, James; Burn, John; Wilson, Ian J; McGrown, Gail; Margison, Geoff P; Thorncroft, Mary; Crossbie, Philip; Povey, Andrew C; Santibanez-Koref, Mauro; Walters, Kevin

    2013-11-07

    We exploit model-based Bayesian inference methodologies to analyse lung tumour-derived methylation data from a CpG island in the O6-methylguanine-DNA methyltransferase (MGMT) promoter. Interest is in modelling the changes in methylation patterns in a CpG island in the first exon of the promoter during lung tumour development. We propose four competils of methylation state propagation based on two mechanisms. The first is the location-dependence mechanism in which the probability of a gain or loss of methylation at a CpG within the promoter depends upon its location in the CpG sequence. The second mechanism is that of neighbour-dependence in which gain or loss of methylation at a CpG depends upon the methylation status of the immediately preceding CpG. Our data comprises the methylation status at 12 CpGs near the 5' end of the CpG island in two lung tumour samples for both alleles of a nearby polymorphism. We use approximate Bayesian computation, a computationally intensive rejection-sampling algorithm to infer model parameters and compare models without the need to evaluate the likelihood function. We compare the four proposed models using two criteria: the approximate Bayes factors and the distribution of the Euclidean distance between the summary statistics of the observed and simulated datasets. Our model-based analysis demonstrates compelling evidence for both location and neighbour dependence in the process of aberrant DNA methylation of this MGMT promoter CpG island in lung tumours. We find equivocal evidence to support the hypothesis that the methylation patterns of the two alleles evolve independently. © 2013 Published by Elsevier Ltd. All rights reserved.

  17. Structural impact of complete CpG methylation within target DNA on specific complex formation of the inducible transcription factor Egr-1.

    PubMed

    Zandarashvili, Levani; White, Mark A; Esadze, Alexandre; Iwahara, Junji

    2015-07-08

    The inducible transcription factor Egr-1 binds specifically to 9-bp target sequences containing two CpG sites that can potentially be methylated at four cytosine bases. Although it appears that complete CpG methylation would make an unfavorable steric clash in the previous crystal structures of the complexes with unmethylated or partially methylated DNA, our affinity data suggest that DNA recognition by Egr-1 is insensitive to CpG methylation. We have determined, at a 1.4-Å resolution, the crystal structure of the Egr-1 zinc-finger complex with completely methylated target DNA. Structural comparison of the three different methylation states reveals why Egr-1 can recognize the target sequences regardless of CpG methylation. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  18. CpG oligodeoxyribonucleotides protect mice from Burkholderia pseudomallei but not Francisella tularensis Schu S4 aerosols

    PubMed Central

    2010-01-01

    Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species. PMID:20181102

  19. CpG oligodeoxyribonucleotides protect mice from Burkholderia pseudomallei but not Francisella tularensis Schu S4 aerosols.

    PubMed

    Rozak, David A; Gelhaus, Herbert C; Smith, Mark; Zadeh, Mojgan; Huzella, Louis; Waag, David; Adamovicz, Jeffrey J

    2010-02-05

    Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species.

  20. Extensive sequence-influenced DNA methylation polymorphism in the human genome

    PubMed Central

    2010-01-01

    Background Epigenetic polymorphisms are a potential source of human diversity, but their frequency and relationship to genetic polymorphisms are unclear. DNA methylation, an epigenetic mark that is a covalent modification of the DNA itself, plays an important role in the regulation of gene expression. Most studies of DNA methylation in mammalian cells have focused on CpG methylation present in CpG islands (areas of concentrated CpGs often found near promoters), but there are also interesting patterns of CpG methylation found outside of CpG islands. Results We compared DNA methylation patterns on both alleles between many pairs (and larger groups) of related and unrelated individuals. Direct observation and simulation experiments revealed that around 10% of common single nucleotide polymorphisms (SNPs) reside in regions with differences in the propensity for local DNA methylation between the two alleles. We further showed that for the most common form of SNP, a polymorphism at a CpG dinucleotide, the presence of the CpG at the SNP positively affected local DNA methylation in cis. Conclusions Taken together with the known effect of DNA methylation on mutation rate, our results suggest an interesting interdependence between genetics and epigenetics underlying diversity in the human genome. PMID:20497546

  1. DNA activates human immune cells through a CpG sequence-dependent manner

    PubMed Central

    Bauer, M; Heeg, K; Wagner, H; Lipford, G B

    1999-01-01

    While bacterial DNA and cytosine–guanosine-dinucleotide-containing oligonucleotides (CpG ODN) are well described activators of murine immune cells, their effect on human cells is inconclusive. We investigated their properties on human peripheral blood mononuclear cells (PBMC) and subsets thereof, such as purified monocytes, T and B cells. Here we demonstrate that bacterial DNA and CpG ODN induce proliferation of B cells, while other subpopulations, such as monocytes and T cells, did not proliferate. PBMC mixed cell cultures, as well as purified monocytes, produced interleukin-6 (IL-6), IL-12 and tumour necrosis factor-α upon stimulation with bacterial DNA; however, only IL-6 and IL-12 secretion became induced upon CpG ODN stimulation. We conclude that monocytes, but not B or T cells, represent the prime source of cytokines. Monocytes up-regulated expression of antigen-presenting, major histocompatibility complex class I and class II molecules in response to CpG DNA. In addition, both monocytes and B cells up-regulate costimulatory CD86 and CD40 molecules. The activation by CpG ODN depended on sequence motifs containing the core dinucleotide CG since destruction of the motif strongly reduced immunostimulatory potential. PMID:10457226

  2. [Evaluation of the quality of clinical practice guidelines published in the Annales de Biologie Clinique with the help of the EFLM checklist].

    PubMed

    Wils, Julien; Fonfrède, Michèle; Augereau, Christine; Watine, Joseph

    2014-01-01

    Several tools are available to help evaluate the quality of clinical practice guidelines (CPG). The AGREE instrument (Appraisal of guidelines for research & evaluation) is the most consensual tool but it has been designed to assess CPG methodology only. The European federation of laboratory medicine (EFLM) recently designed a check-list dedicated to laboratory medicine which is supposed to be comprehensive and which therefore makes it possible to evaluate more thoroughly the quality of CPG in laboratory medicine. In the present work we test the comprehensiveness of this check-list on a sample of CPG written in French and published in Annales de biologie clinique (ABC). Thus we show that some work remains to be achieved before a truly comprehensive check-list is designed. We also show that there is some room for improvement for the CPG published in ABC, for example regarding the fact that some of these CPG do not provide any information about allowed durations of transport and of storage of biological samples before analysis, or about standards of minimal analytical performance, or about the sensitivities or the specificities of the recommended tests.

  3. Towards autonomous locomotion: CPG-based control of smooth 3D slithering gait transition of a snake-like robot.

    PubMed

    Bing, Zhenshan; Cheng, Long; Chen, Guang; Röhrbein, Florian; Huang, Kai; Knoll, Alois

    2017-04-04

    Snake-like robots with 3D locomotion ability have significant advantages of adaptive travelling in diverse complex terrain over traditional legged or wheeled mobile robots. Despite numerous developed gaits, these snake-like robots suffer from unsmooth gait transitions by changing the locomotion speed, direction, and body shape, which would potentially cause undesired movement and abnormal torque. Hence, there exists a knowledge gap for snake-like robots to achieve autonomous locomotion. To address this problem, this paper presents the smooth slithering gait transition control based on a lightweight central pattern generator (CPG) model for snake-like robots. First, based on the convergence behavior of the gradient system, a lightweight CPG model with fast computing time was designed and compared with other widely adopted CPG models. Then, by reshaping the body into a more stable geometry, the slithering gait was modified, and studied based on the proposed CPG model, including the gait transition of locomotion speed, moving direction, and body shape. In contrast to sinusoid-based method, extensive simulations and prototype experiments finally demonstrated that smooth slithering gait transition can be effectively achieved using the proposed CPG-based control method without generating undesired locomotion and abnormal torque.

  4. CpG island methylator phenotype in colorectal cancer

    PubMed Central

    Toyota, Minoru; Ahuja, Nita; Ohe-Toyota, Mutsumi; Herman, James G.; Baylin, Stephen B.; Issa, Jean-Pierre J.

    1999-01-01

    Aberrant methylation of promoter region CpG islands is associated with transcriptional inactivation of tumor-suppressor genes in neoplasia. To understand global patterns of CpG island methylation in colorectal cancer, we have used a recently developed technique called methylated CpG island amplification to examine 30 newly cloned differentially methylated DNA sequences. Of these 30 clones, 19 (63%) were progressively methylated in an age-dependent manner in normal colon, 7 (23%) were methylated in a cancer-specific manner, and 4 (13%) were methylated only in cell lines. Thus, a majority of CpG islands methylated in colon cancer are also methylated in a subset of normal colonic cells during the process of aging. In contrast, methylation of the cancer-specific clones was found exclusively in a subset of colorectal cancers, which appear to display a CpG island methylator phenotype (CIMP). CIMP+ tumors also have a high incidence of p16 and THBS1 methylation, and they include the majority of sporadic colorectal cancers with microsatellite instability related to hMLH1 methylation. We thus define a pathway in colorectal cancer that appears to be responsible for the majority of sporadic tumors with mismatch repair deficiency. PMID:10411935

  5. CpG methylation increases the DNA binding of 9-aminoacridine carboxamide Pt analogues.

    PubMed

    Kava, Hieronimus W; Murray, Vincent

    2016-10-01

    This study investigated the effect of CpG methylation on the DNA binding of cisplatin analogues with an attached aminoacridine intercalator. DNA-targeted 9-aminoacridine carboxamide Pt complexes are known to bind at 5'-CpG sequences. Their binding to methylated and non-methylated 5'-CpG sequences was determined and compared with cisplatin. The damage profiles of each platinum compound were quantified via a polymerase stop assay with fluorescently labelled primers and capillary electrophoresis. Methylation at 5'-CpG was shown to significantly increase the binding intensity for the 9-aminoacridine carboxamide compounds, whereas no significant increase was found for cisplatin. 5'-CpG methylation had the largest effect on the 9-ethanolamine-acridine carboxamide Pt complex, followed by the 9-aminoacridine carboxamide Pt complex and the 7-fluoro complex. The methylation state of a cell's genome is important in maintaining normal gene expression, and is often aberrantly altered in cancer cells. An analogue of cisplatin which differentially targets methylated DNA may be able to improve its therapeutic activity, or alter its range of targets and evade the chemoresistance which hampers cisplatin efficacy in clinical use. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. CpG Oligodeoxynucleotide and Montanide ISA 51 Adjuvant Combination Enhanced the Protective Efficacy of a Subunit Malaria Vaccine

    PubMed Central

    Kumar, Sanjai; Jones, Trevor R.; Oakley, Miranda S.; Zheng, Hong; Kuppusamy, Shanmuga P.; Taye, Alem; Krieg, Arthur M.; Stowers, Anthony W.; Kaslow, David C.; Hoffman, Stephen L.

    2004-01-01

    Unmethylated CpG dinucleotide motifs present in bacterial genomes or synthetic oligodeoxynucleotides (ODNs) serve as strong immunostimulatory agents in mice, monkeys and humans. We determined the adjuvant effect of murine CpG ODN 1826 on the immunogenicity and protective efficacy of the Saccharomyces cerevisiae-expressed 19-kDa C-terminal region of merozoite surface protein 1 (yMSP119) of the murine malaria parasite Plasmodium yoelii. We found that in C57BL/6 mice, following sporozoite challenge, the degree of protective immunity against malaria induced by yMSP119 in a formulation of Montanide ISA 51 (ISA) plus CpG ODN 1826 was similar or superior to that conferred by yMSP119 emulsified in complete Freund's adjuvant (CFA/incomplete Freund's adjuvant). In total, among mice immunized with yMSP119, 22 of 32 (68.7%) with ISA plus CpG 1826, 0 of 4 (0%) with CFA/incomplete Freund’s adjuvant, 0 of 4 (0%) with CpG 1826 mixed with ISA (no yMSP119), and 0 of 11 (0%) with CpG 1826 alone were completely protected against development of erythrocytic stage infection after sporozoite challenge. The adjuvant effect of CpG ODN 1826 was manifested as both significantly improved complete protection from malaria (defined as the absence of detectable erythrocytic form parasites) (P = 0.007, chi square) and reduced parasite burden in infected mice. In vivo depletions of interleukin-12 and gamma interferon cytokines and CD4+ and CD8+ T cells in vaccinated mice had no significant effect on immunity. On the other hand, immunoglobulin G (IgG) isotype levels appeared to correlate with protection. Inclusion of CpG ODN 1826 in the yMSP119 plus ISA vaccine contributed towards the induction of higher levels of IgG2a and IgG2b (Th1 type) antibodies, suggesting that CpG ODN 1826 caused a shift towards a Th1 type of immune response that could be responsible for the higher degree of protective immunity. Our results indicate that this potent adjuvant formulation should be further evaluated for use in clinical trials of recombinant malarial vaccine candidates. PMID:14742540

  7. Inhibitory and modulatory inputs to the vocal central pattern generator of a teleost fish

    PubMed Central

    Rosner, Elisabeth; Rohmann, Kevin N.; Bass, Andrew H.

    2018-01-01

    Abstract Vocalization is a behavioral feature that is shared among multiple vertebrate lineages, including fish. The temporal patterning of vocal communication signals is set, in part, by central pattern generators (CPGs). Toadfishes are well‐established models for CPG coding of vocalization at the hindbrain level. The vocal CPG comprises three topographically separate nuclei: pre‐pacemaker, pacemaker, motor. While the connectivity between these nuclei is well understood, their neurochemical profile remains largely unexplored. The highly vocal Gulf toadfish, Opsanus beta, has been the subject of previous behavioral, neuroanatomical and neurophysiological studies. Combining transneuronal neurobiotin‐labeling with immunohistochemistry, we map the distribution of inhibitory neurotransmitters and neuromodulators along with gap junctions in the vocal CPG of this species. Dense GABAergic and glycinergic label is found throughout the CPG, with labeled somata immediately adjacent to or within CPG nuclei, including a distinct subset of pacemaker neurons co‐labeled with neurobiotin and glycine. Neurobiotin‐labeled motor and pacemaker neurons are densely co‐labeled with the gap junction protein connexin 35/36, supporting the hypothesis that transneuronal neurobiotin‐labeling occurs, at least in part, via gap junction coupling. Serotonergic and catecholaminergic label is also robust within the entire vocal CPG, with additional cholinergic label in pacemaker and prepacemaker nuclei. Likely sources of these putative modulatory inputs are neurons within or immediately adjacent to vocal CPG neurons. Together with prior neurophysiological investigations, the results reveal potential mechanisms for generating multiple classes of social context‐dependent vocalizations with widely divergent temporal and spectral properties. PMID:29424431

  8. Molecular characterization and transcriptional analysis of the female-enriched chondroitin proteoglycan 2 of Toxocara canis.

    PubMed

    Ma, G X; Zhou, R Q; Hu, L; Luo, Y L; Luo, Y F; Zhu, H H

    2018-03-01

    Toxocara canis is an important but neglected zoonotic parasite, and is the causative agent of human toxocariasis. Chondroitin proteoglycans are biological macromolecules, widely distributed in extracellular matrices, with a great diversity of functions in mammals. However, there is limited information regarding chondroitin proteoglycans in nematode parasites. In the present study, a female-enriched chondroitin proteoglycan 2 gene of T. canis (Tc-cpg-2) was cloned and characterized. Quantitative real-time polymerase chain reaction (qRT-PCR) was employed to measure the transcription levels of Tc-cpg-2 among tissues of male and female adult worms. A 485-amino-acid (aa) polypeptide was predicted from a continuous 1458-nuleotide open reading frame and designated as TcCPG2, which contains a 21-aa signal peptide. Conserved domain searching indicated three chitin-binding peritrophin-A (CBM_14) domains in the amino acid sequence of TcCPG2. Multiple alignment with the inferred amino acid sequences of Caenorhabditis elegans and Ascaris suum showed that CBM_14 domains were well conserved among these species. Phylogenetic analysis suggested that TcCPG2 was closely related to the sequence of chondroitin proteoglycan 2 of A. suum. Interestingly, a high level of Tc-cpg-2 was detected in female germline tissues, particularly in the oviduct, suggesting potential roles of this gene in reproduction (e.g. oogenesis and embryogenesis) of adult T. canis. The functional roles of Tc-cpg-2 in reproduction and development in this parasite and related parasitic nematodes warrant further functional studies.

  9. Validation of DAB2IP methylation and its relative significance in predicting outcome in renal cell carcinoma

    PubMed Central

    Zhao, Liang-Yun; Kapur, Payal; Wu, Kai-Jie; Wang, Bin; Yu, Yan-Hong; Liao, Bing; He, Da-Lin; Chen, Wei; Margulis, Vitaly; Hsieh, Jer-Tsong; Luo, Jun-Hang

    2016-01-01

    We have recently reported tumor suppressive role of DAB2IP in RCC development. In this study, We identified one CpG methylation biomarker (DAB2IP CpG1) located UTSS of DAB2IP that was associated with poor overall survival in a cohort of 318 ccRCC patients from the Cancer Genome Atlas (TCGA). We further validated the prognostic accuracy of DAB2IP CpG methylation by pyrosequencing quantitative methylation assay in 224 ccRCC patients from multiple Chinese centers (MCHC set), and 239 patients from University of Texas Southwestern Medical Center at Dallas (UTSW set) by using FFPE samples. DAB2IP CpG1 can predict the overall survival of patients in TCGA, MCHC, and UTSW sets independent of patient age, Fuhrman grade and TNM stage (all p<0.05). DAB2IP CpG1 successfully categorized patients into high-risk and low-risk groups with significant differences of clinical outcome in respective clinical subsets, regardless of age, sex, grade, stage, or race (HR: 1.63-7.83; all p<0.05). The detection of DAB2IP CpG1 methylation was minimally affected by ITH in ccRCC. DAB2IP mRNA expression was regulated by DNA methylation in vitro. DAB2IP CpG1 methylation is a practical and repeatable biomarker for ccRCC, which can provide prognostic value that complements the current staging system. PMID:27129174

  10. CpG Distribution and Methylation Pattern in Porcine Parvovirus

    PubMed Central

    Tóth, Renáta; Mészáros, István; Stefancsik, Rajmund; Bartha, Dániel; Bálint, Ádám; Zádori, Zoltán

    2013-01-01

    Based on GC content and the observed/expected CpG ratio (oCpGr), we found three major groups among the members of subfamily Parvovirinae: Group I parvoviruses with low GC content and low oCpGr values, Group II with low GC content and high oCpGr values and Group III with high GC content and high oCpGr values. Porcine parvovirus belongs to Group I and it features an ascendant CpG distribution by position in its coding regions similarly to the majority of the parvoviruses. The entire PPV genome remains hypomethylated during the viral lifecycle independently from the tissue of origin. In vitro CpG methylation of the genome has a modest inhibitory effect on PPV replication. The in vitro hypermethylation disappears from the replicating PPV genome suggesting that beside the maintenance DNMT1 the de novo DNMT3a and DNMT3b DNA methyltransferases can’t methylate replicating PPV DNA effectively either, despite that the PPV infection does not seem to influence the expression, translation or localization of the DNA methylases. SNP analysis revealed high mutability of the CpG sites in the PPV genome, while introduction of 29 extra CpG sites into the genome has no significant biological effects on PPV replication in vitro. These experiments raise the possibility that beyond natural selection mutational pressure may also significantly contribute to the low level of the CpG sites in the PPV genome. PMID:24392033

  11. Levels of DNA Methylation Vary at CpG Sites across the BRCA1 Promoter, and Differ According to Triple Negative and “BRCA-Like” Status, in Both Blood and Tumour DNA

    PubMed Central

    Burghel, George J.; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D.; Brock, Ian W.; Cramp, Helen E.; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S.; Cox, Angela

    2016-01-01

    Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies. PMID:27463681

  12. TLR9 is critical for glioma stem cell maintenance and targeting.

    PubMed

    Herrmann, Andreas; Cherryholmes, Gregory; Schroeder, Anne; Phallen, Jillian; Alizadeh, Darya; Xin, Hong; Wang, Tianyi; Lee, Heehyoung; Lahtz, Christoph; Swiderski, Piotr; Armstrong, Brian; Kowolik, Claudia; Gallia, Gary L; Lim, Michael; Brown, Christine; Badie, Behnam; Forman, Stephen; Kortylewski, Marcin; Jove, Richard; Yu, Hua

    2014-09-15

    Understanding supports for cancer stem-like cells in malignant glioma may suggest therapeutic strategies for their elimination. Here, we show that the Toll-like receptor TLR9 is elevated in glioma stem-like cells (GSC) in which it contributes to glioma growth. TLR9 overexpression is regulated by STAT3, which is required for GSC maintenance. Stimulation of TLR9 with a CpG ligand (CpG ODN) promoted GSC growth, whereas silencing TLR9 expression abrogated GSC development. CpG-ODN treatment induced Frizzled4-dependent activation of JAK2, thereby activating STAT3. Targeted delivery of siRNA into GSC was achieved via TLR9 using CpG-siRNA conjugates. Through local or systemic treatment, administration of CpG-Stat3 siRNA to silence STAT3 in vivo reduced GSC along with glioma growth. Our findings identify TLR9 as a functional marker for GSC and a target for the delivery of efficacious therapeutics for glioma treatment. Cancer Res; 74(18); 5218-28. ©2014 AACR. ©2014 American Association for Cancer Research.

  13. Changes in the Coding and Non-coding Transcriptome and DNA Methylome that Define the Schwann Cell Repair Phenotype after Nerve Injury.

    PubMed

    Arthur-Farraj, Peter J; Morgan, Claire C; Adamowicz, Martyna; Gomez-Sanchez, Jose A; Fazal, Shaline V; Beucher, Anthony; Razzaghi, Bonnie; Mirsky, Rhona; Jessen, Kristjan R; Aitman, Timothy J

    2017-09-12

    Repair Schwann cells play a critical role in orchestrating nerve repair after injury, but the cellular and molecular processes that generate them are poorly understood. Here, we perform a combined whole-genome, coding and non-coding RNA and CpG methylation study following nerve injury. We show that genes involved in the epithelial-mesenchymal transition are enriched in repair cells, and we identify several long non-coding RNAs in Schwann cells. We demonstrate that the AP-1 transcription factor C-JUN regulates the expression of certain micro RNAs in repair Schwann cells, in particular miR-21 and miR-34. Surprisingly, unlike during development, changes in CpG methylation are limited in injury, restricted to specific locations, such as enhancer regions of Schwann cell-specific genes (e.g., Nedd4l), and close to local enrichment of AP-1 motifs. These genetic and epigenomic changes broaden our mechanistic understanding of the formation of repair Schwann cell during peripheral nervous system tissue repair. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  14. Probable Chemical Hypoxia Effects on Progress of CNV Through Induction of Promoter CpG Demethylation and Overexpression of IL17RC in Human RPE Cells.

    PubMed

    Alivand, Mohammad Reza; Sabouni, Farzaneh; Soheili, Zahra-Soheila

    2016-09-01

    To survey the changes of promoter CpG methylation status and mRNA expression of IL17RC (interleukin 17 receptor C) gene in retinal pigment epithelium (RPE) cells under chemical hypoxia condition for choroidal neovascularization (CNV) modeling in vitro. RPE cells were cultured in both untreated as a control group and treated by cobalt chloride media as a hypoxia group for various concentrations (100-150μM) and times (24-36 hrs.) To confirm chemical hypoxia condition, mRNA expression of HIF (Hypoxia Inducible Factor) -1α, -2α, and Vascular Endothelial Growth Factor (VEGF) was compared between two groups by Real-time PCR. Also, in normoxia and hypoxia conditions, IL17RC expression changes and promoter CpG methylation status were evaluated by Real-time PCR and methylation-specific PCR (MSP) techniques, respectively. Overexpression of HIF-1α, HIF-2α, and VEGF was significant in hypoxia versus normoxia conditions. Our data showed overexpression of IL17RC (2.1- to 6.3-fold) and decreasing of its promoter methylation in comparison with hypoxia and normoxia conditions. It was found that there are significant association between promoter methylation status and expression of IL17RC in chemical hypoxia condition. Therefore, methylation of IL17RC could play as a marker in CNV and degeneration of RPE cells in vitro. Additionally, HIF-α and methylation phenomena may be considered as critical targets for blocking in angiogenesis of age-related degeneration in future studies.

  15. Discovery and Characterization of Novel Subtype-Selective Allosteric Agonists for the Investigation of M1 Receptor Function in the Central Nervous System

    PubMed Central

    2009-01-01

    Cholinergic transmission in the forebrain is mediated primarily by five subtypes of muscarinic acetylcholine receptors (mAChRs), termed M1−M5. Of the mAChR subtypes, M1 is among the most heavily expressed in regions that are critical for learning and memory and has been viewed as the most critical mAChR subtype for memory and attention mechanisms. Unfortunately, it has been difficult to develop selective activators of M1 and other individual mAChR subtypes, which has prevented detailed studies of the functional roles of selective activation of M1. Using a functional high-throughput screening and subsequent diversity-oriented synthesis approach, we have discovered a novel series of highly selective M1 allosteric agonists. These compounds activate M1 with EC50 values in the 150−500 nM range and have unprecedented, clean ancillary pharmacology (no substantial activity at 10 μM across a large panel of targets). Targeted mutagenesis revealed a potentially novel allosteric binding site in the third extracellular loop of the M1 receptor for these allosteric agonists. Optimized compounds, such as VU0357017, provide excellent brain exposure after systemic dosing and have robust in vivo efficacy in reversing scopolamine-induced deficits in a rodent model of contextual fear conditioning. This series of selective M1 allosteric agonists provides critical research tools to allow dissection of M1-mediated effects in the CNS and potential leads for novel treatments for Alzheimer’s disease and schizophrenia. PMID:21961051

  16. The Toll-Like Receptor 2/6 Agonist, FSL-1 Lipopeptide, Therapeutically Mitigates Acute Radiation Syndrome.

    PubMed

    Kurkjian, Cathryn J; Guo, Hao; Montgomery, Nathan D; Cheng, Ning; Yuan, Hong; Merrill, Joseph R; Sempowski, Gregory D; Brickey, W June; Ting, Jenny P-Y

    2017-12-11

    Risks of radiation exposure from nuclear incidents and cancer radiotherapy are undeniable realities. These dangers urgently compel the development of agents for ameliorating radiation-induced injuries. Biologic pathways mediated by myeloid differentiation primary response gene 88 (MyD88), the common adaptor for toll-like receptor (TLR) and Interleukin-1 receptor signaling, are critical for radioprotection. Treating with agonists prior to radiation enhances survival by activating TLR signaling, whereas radiomitigating TLR-activating therapeutics given after exposure are less defined. We examine the radiomitigation capability of TLR agonists and identify one that is superior for its efficacy and reduced toxic consequences compared to other tested agonists. We demonstrate that the synthetic TLR2/6 ligand Fibroblast-stimulating lipopeptide (FSL-1) substantially prolongs survival in both male and female mice when administered 24 hours after radiation and shows MyD88-dependent function. FSL-1 treatment results in accelerated hematopoiesis in bone marrow, spleen and periphery, and augments systemic levels of hematopoiesis-stimulating factors. The ability of FSL-1 to stimulate hematopoiesis is critical, as hematopoietic dysfunction results from a range of ionizing radiation doses. The efficacy of a single FSL-1 dose for alleviating radiation injury while protecting against adverse effects reveals a viable radiation countermeasures agent.

  17. Protective immunity against Megalocytivirus infection in rock bream (Oplegnathus fasciatus) following CpG ODN administration.

    PubMed

    Jung, Myung-Hwa; Lee, Jehee; Ortega-Villaizan, M; Perez, Luis; Jung, Sung-Ju

    2017-06-27

    Rock bream iridovirus (RBIV) disease in rock bream (Oplegnathus fasciatus) remains an unsolved problem in Korea aquaculture farms. CpG ODNs are known as immunostimulant, can improve the innate immune system of fish providing resistance to diseases. In this study, we evaluated the potential of CpG ODNs to induce anti-viral status protecting rock bream from different RBIV infection conditions. We found that, when administered into rock bream, CpG ODN 1668 induces better antiviral immune responses compared to other 5 CpG ODNs (2216, 1826, 2133, 2395 and 1720). All CpG ODN 1668 administered fish (1/5µg) at 2days before infection (1.1×10 7 ) held at 26°C died even though mortality was delayed from 8days (1µg) and 4days (5µg). Similarly, CpG ODN 1668 administered (5µg) at 2days before infection (1.2×10 6 ) held at 23/20°C had 100% mortality; the mortality was delayed from 9days (23°C) and 11days (20°C). Moreover, when CpG ODN 1668 administered (1/5/10µg) at 2/4/7days before infection or virus concentration was decreased to 1.1×10 4 and held at 20°C had mortality rates of 20/60/30% (2days), 30/40/60% (4days) and 60/60/20% (7days), respectively, for the respective administration dose, through 100 dpi. To investigate the development of a protective immune response, survivors were re-infected with RBIV (1.1×10 7 ) at 100 and 400 dpi, respectively. While 100% of the previously unexposed fish died, 100% of the previously infected fish survived. The high survival rate of fish following re-challenge with RBIV indicates that protective immunity was established in the surviving rock bream. Our results showed the possibility of developing preventive measures against RBIV using CpG ODN 1668 by reducing RBIV replication speed (i.e. water temperature of 20°C and infection dose of 1.1×10 4 ). Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Enhanced early innate and T cell-mediated responses in subjects immunized with Anthrax Vaccine Adsorbed Plus CPG 7909 (AV7909).

    PubMed

    Minang, Jacob T; Inglefield, Jon R; Harris, Andrea M; Lathey, Janet L; Alleva, David G; Sweeney, Diane L; Hopkins, Robert J; Lacy, Michael J; Bernton, Edward W

    2014-11-28

    NuThrax™ (Anthrax Vaccine Adsorbed with CPG 7909 Adjuvant) (AV7909) is in development. Samples obtained in a phase Ib clinical trial were tested to confirm biomarkers of innate immunity and evaluate effects of CPG 7909 (PF-03512676) on adaptive immunity. Subjects received two intramuscular doses of commercial BioThrax(®) (Anthrax Vaccine Adsorbed, AVA), or two intramuscular doses of one of four formulations of AV7909. IP-10, IL-6, and C-reactive protein (CRP) levels were elevated 24-48 h after administration of AV7909 formulations, returning to baseline by Day 7. AVA (no CPG 7909) resulted in elevated IL-6 and CRP, but not IP-10. Another marker of CpG, transiently decreased absolute lymphocyte counts (ALCs), correlated with transiently increased IP-10. Cellular recall responses to anthrax protective antigen (PA) or PA peptides were assessed by IFN-γ ELISpot assay performed on cryopreserved PBMCs obtained from subjects prior to immunization and 7 days following the second immunization (study day 21). One-half of subjects that received AV7909 with low-dose (0.25mg/dose) CPG 7909 possessed positive Day 21 T cell responses to PA. In contrast, positive T cell responses occurred at an 11% average rate (1/9) for AVA-treated subjects. Differences in cellular responses due to dose level of CPG 7909 were not associated with differences in humoral anti-PA IgG responses, which were elevated for recipients of AV7909 compared to recipients of AVA. Serum markers at 24 or 48 h (i.e. % ALC decrease, or increase in IL-6, IP-10, or CRP) correlated with the humoral (antibody) responses 1 month later, but did not correlate with cellular ELISpot responses. In summary, biomarkers of early responses to CPG 7909 were confirmed, and adding a CpG adjuvant to a vaccine administered twice resulted in increased T cell effects relative to vaccine alone. Changes in early biomarkers correlated with subsequent adaptive humoral immunity but not cellular immunity. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  19. Dendritic cells tolerized with adenosine A2AR agonist attenuate acute kidney injury

    PubMed Central

    Li, Li; Huang, Liping; Ye, Hong; Song, Steven P.; Bajwa, Amandeep; Lee, Sang Ju; Moser, Emily K.; Jaworska, Katarzyna; Kinsey, Gilbert R.; Day, Yuan J.; Linden, Joel; Lobo, Peter I.; Rosin, Diane L.; Okusa, Mark D.

    2012-01-01

    DC-mediated NKT cell activation is critical in initiating the immune response following kidney ischemia/reperfusion injury (IRI), which mimics human acute kidney injury (AKI). Adenosine is an important antiinflammatory molecule in tissue inflammation, and adenosine 2A receptor (A2AR) agonists protect kidneys from IRI through their actions on leukocytes. In this study, we showed that mice with A2AR-deficient DCs are more susceptible to kidney IRI and are not protected from injury by A2AR agonists. In addition, administration of DCs treated ex vivo with an A2AR agonist protected the kidneys of WT mice from IRI by suppressing NKT production of IFN-γ and by regulating DC costimulatory molecules that are important for NKT cell activation. A2AR agonists had no effect on DC antigen presentation or on Tregs. We conclude that ex vivo A2AR–induced tolerized DCs suppress NKT cell activation in vivo and provide a unique and potent cell-based strategy to attenuate organ IRI. PMID:23093781

  20. Milk: an epigenetic amplifier of FTO-mediated transcription? Implications for Western diseases.

    PubMed

    Melnik, Bodo C

    2015-12-21

    Single-nucleotide polymorphisms within intron 1 of the FTO (fat mass and obesity-associated) gene are associated with enhanced FTO expression, increased body weight, obesity and type 2 diabetes mellitus (T2DM). The N (6) -methyladenosine (m(6)A) demethylase FTO plays a pivotal regulatory role for postnatal growth and energy expenditure. The purpose of this review is to provide translational evidence that links milk signaling with FTO-activated transcription of the milk recipient. FTO-dependent demethylation of m(6)A regulates mRNA splicing required for adipogenesis, increases the stability of mRNAs, and affects microRNA (miRNA) expression and miRNA biosynthesis. FTO senses branched-chain amino acids (BCAAs) and activates the nutrient sensitive kinase mechanistic target of rapamycin complex 1 (mTORC1), which plays a key role in translation. Milk provides abundant BCAAs and glutamine, critical components increasing FTO expression. CpG hypomethylation in the first intron of FTO has recently been associated with T2DM. CpG methylation is generally associated with gene silencing. In contrast, CpG demethylation generally increases transcription. DNA de novo methylation of CpG sites is facilitated by DNA methyltransferases (DNMT) 3A and 3B, whereas DNA maintenance methylation is controlled by DNMT1. MiRNA-29s target all DNMTs and thus reduce DNA CpG methylation. Cow´s milk provides substantial amounts of exosomal miRNA-29s that reach the systemic circulation and target mRNAs of the milk recipient. Via DNMT suppression, milk exosomal miRNA-29s may reduce the magnitude of FTO methylation, thereby epigenetically increasing FTO expression in the milk consumer. High lactation performance with increased milk yield has recently been associated with excessive miRNA-29 expression of dairy cow mammary epithelial cells (DCMECs). Notably, the galactopoietic hormone prolactin upregulates the transcription factor STAT3, which induces miRNA-29 expression. In a retrovirus-like manner milk exosomes may transfer DCMEC-derived miRNA-29s and bovine FTO mRNA to the milk consumer amplifying FTO expression. There is compelling evidence that obesity, T2DM, prostate and breast cancer, and neurodegenerative diseases are all associated with increased FTO expression. Maximization of lactation performance by veterinary medicine with enhanced miRNA-29s and FTO expression associated with increased exosomal miRNA-29 and FTO mRNA transfer to the milk consumer may represent key epigenetic mechanisms promoting FTO/mTORC1-mediated diseases of civilization.

  1. Clinical evaluation of CpG oligonucleotides as adjuvants for vaccines targeting infectious diseases and cancer

    PubMed Central

    Scheiermann, Julia; Klinman, Dennis M.

    2014-01-01

    Synthetic oligonucleotides (ODN) that express unmethylated “CpG motifs” trigger cells that express Toll-like receptor 9. In humans this includes plasmacytoid dendritic cells and B cells. CpG ODN induce an innate immune response characterized by the production of Th1 and pro-inflammatory cytokines. Their utility as vaccine adjuvants was evaluated in a number of clinical trials. Results indicate that CpG ODN improve antigen presentation and the generation of vaccine-specific cellular and humoral responses. This work provides an up-to-date overview of the utility of CpG ODN as adjuvants for vaccines targeting infectious agents and cancer. PMID:24975812

  2. Transcultural Endocrinology: Adapting Type-2 Diabetes Guidelines on a Global Scale.

    PubMed

    Nieto-Martínez, Ramfis; González-Rivas, Juan P; Florez, Hermes; Mechanick, Jeffrey I

    2016-12-01

    Type-2 diabetes (T2D) needs to be prevented and treated effectively to reduce its burden and consequences. White papers, such as evidence-based clinical practice guidelines (CPG) and their more portable versions, clinical practice algorithms and clinical checklists, may improve clinical decision-making and diabetes outcomes. However, CPG are underused and poorly validated. Protocols that translate and implement these CPG are needed. This review presents the global dimension of T2D, details the importance of white papers in the transculturalization process, compares relevant international CPG, analyzes cultural variables, and summarizes translation strategies that can improve care. Specific protocols and algorithmic tools are provided. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Transcutaneous immunization with tetanus toxoid and mutants of Escherichia coli heat-labile enterotoxin as adjuvants elicits strong protective antibody responses.

    PubMed

    Tierney, Rob; Beignon, Anne-Sophie; Rappuoli, Rino; Muller, Sylviane; Sesardic, Dorothea; Partidos, Charalambos D

    2003-09-01

    In this study, the adjuvanticity of 2 nontoxic derivatives (LTK63 and LTR72) of heat-labile enterotoxin of Escherichia coli (LT) was evaluated and was compared with that of a cytosine phosphodiester-guanine (CpG) motif, after transcutaneous immunization with tetanus toxoid (TT). TT plus LTR72 elicited the strongest antibody responses, compared with those elicited by the other vaccines (TT, TT plus LTK63, TT plus CpG, and TT plus LTK63 plus CpG); it neutralized the toxin and conferred full protection after passive transfer in mice. Preexisting immunity to LT mutants did not adversely affect their adjuvant potency. Both LTK63 and LTR72 promoted the induction of IgG1 antibodies. In contrast, mice receiving either CpG motif alone or CpG motif plus LTK63 produced strong IgG2a anti-TT antibody responses. Overall, these findings demonstrate that mutants of enterotoxins with reduced toxicity are effective adjuvants for transcutaneous immunization.

  4. On the Role of Sensory Feedbacks in Rowat–Selverston CPG to Improve Robot Legged Locomotion

    PubMed Central

    Amrollah, Elmira; Henaff, Patrick

    2010-01-01

    This paper presents the use of Rowat and Selverston-type of central pattern generator (CPG) to control locomotion. It focuses on the role of afferent exteroceptive and proprioceptive signals in the dynamic phase synchronization in CPG legged robots. The sensori-motor neural network architecture is evaluated to control a two-joint planar robot leg that slips on a rail. Then, the closed loop between the CPG and the mechanical system allows to study the modulation of rhythmic patterns and the effect of the sensing loop via sensory neurons during the locomotion task. Firstly simulations show that the proposed architecture easily allows to modulate rhythmic patterns of the leg, and therefore the velocity of the robot. Secondly, simulations show that sensori-feedbacks from foot/ground contact of the leg make the hip velocity smoother and larger. The results show that the Rowat–Selverston-type CPG with sensory feedbacks is an effective choice for building adaptive neural CPGs for legged robots. PMID:21228904

  5. [The effect of entrapment of CpG sequence with cationic PLG nanoparticles on the immune responses of mice to pig paratyphoid vaccine].

    PubMed

    Wu, Mei; Shi, Ling; Liu, Shigui; Li, Jiangling; Wu, Kaiyuan; Wang, Lihuan; Shen, Yi; Liu, Kun; Zheng, Yong; Zhang, Xinshen; Gao, Rong

    2005-10-01

    Cationic PLG nanoparticles and liposome were prepared and used as package molecules to pack up pUC18-CpG. The effects of the packed pUC18-CpG on the cellular and humoral immune responses were detected in the mice that were inoculated with pig paratyphoid vaccine. The results showed that compared with the control, the amount of IgG and the titre of specific antibody were significantly increased in the sera of mice immunized with the CpG plasmid entrapped by cationic PLG nanoparticles; the proliferation and induced IL-2 bioactivity of lymphocytes were significantly enhanced in the spleen of the immunized mice; the stimulatory effect of cationic PLG nanoparticles was similar to or stronger than that of cationic liposome. These indicated that cationic PLG nanoparticle could be employed as an effective package molecule to promote the immunostimulatory effect of pUC18-CpG.

  6. Genome-Wide Locations of Potential Epimutations Associated with Environmentally Induced Epigenetic Transgenerational Inheritance of Disease Using a Sequential Machine Learning Prediction Approach.

    PubMed

    Haque, M Muksitul; Holder, Lawrence B; Skinner, Michael K

    2015-01-01

    Environmentally induced epigenetic transgenerational inheritance of disease and phenotypic variation involves germline transmitted epimutations. The primary epimutations identified involve altered differential DNA methylation regions (DMRs). Different environmental toxicants have been shown to promote exposure (i.e., toxicant) specific signatures of germline epimutations. Analysis of genomic features associated with these epimutations identified low-density CpG regions (<3 CpG / 100bp) termed CpG deserts and a number of unique DNA sequence motifs. The rat genome was annotated for these and additional relevant features. The objective of the current study was to use a machine learning computational approach to predict all potential epimutations in the genome. A number of previously identified sperm epimutations were used as training sets. A novel machine learning approach using a sequential combination of Active Learning and Imbalance Class Learner analysis was developed. The transgenerational sperm epimutation analysis identified approximately 50K individual sites with a 1 kb mean size and 3,233 regions that had a minimum of three adjacent sites with a mean size of 3.5 kb. A select number of the most relevant genomic features were identified with the low density CpG deserts being a critical genomic feature of the features selected. A similar independent analysis with transgenerational somatic cell epimutation training sets identified a smaller number of 1,503 regions of genome-wide predicted sites and differences in genomic feature contributions. The predicted genome-wide germline (sperm) epimutations were found to be distinct from the predicted somatic cell epimutations. Validation of the genome-wide germline predicted sites used two recently identified transgenerational sperm epimutation signature sets from the pesticides dichlorodiphenyltrichloroethane (DDT) and methoxychlor (MXC) exposure lineage F3 generation. Analysis of this positive validation data set showed a 100% prediction accuracy for all the DDT-MXC sperm epimutations. Observations further elucidate the genomic features associated with transgenerational germline epimutations and identify a genome-wide set of potential epimutations that can be used to facilitate identification of epigenetic diagnostics for ancestral environmental exposures and disease susceptibility.

  7. Detection and evaluation of DNA methylation markers found at SCGN and KLF14 loci to estimate human age.

    PubMed

    Alghanim, Hussain; Antunes, Joana; Silva, Deborah Soares Bispo Santos; Alho, Clarice Sampaio; Balamurugan, Kuppareddi; McCord, Bruce

    2017-11-01

    Recent developments in the analysis of epigenetic DNA methylation patterns have demonstrated that certain genetic loci show a linear correlation with chronological age. It is the goal of this study to identify a new set of epigenetic methylation markers for the forensic estimation of human age. A total number of 27 CpG sites at three genetic loci, SCGN, DLX5 and KLF14, were examined to evaluate the correlation of their methylation status with age. These sites were evaluated using 72 blood samples and 91 saliva samples collected from volunteers with ages ranging from 5 to 73 years. DNA was bisulfite modified followed by PCR amplification and pyrosequencing to determine the level of DNA methylation at each CpG site. In this study, certain CpG sites in SCGN and KLF14 loci showed methylation levels that were correlated with chronological age, however, the tested CpG sites in DLX5 did not show a correlation with age. Using a 52-saliva sample training set, two age-predictor models were developed by means of a multivariate linear regression analysis for age prediction. The two models performed similarly with a single-locus model explaining 85% of the age variance at a mean absolute deviation of 5.8 years and a dual-locus model explaining 84% of the age variance with a mean absolute deviation of 6.2 years. In the validation set, the mean absolute deviation was measured to be 8.0 years and 7.1 years for the single- and dual-locus model, respectively. Another age predictor model was also developed using a 40-blood sample training set that accounted for 71% of the age variance. This model gave a mean absolute deviation of 6.6 years for the training set and 10.3years for the validation set. The results indicate that specific CpGs in SCGN and KLF14 can be used as potential epigenetic markers to estimate age using saliva and blood specimens. These epigenetic markers could provide important information in cases where the determination of a suspect's age is critical in developing investigative leads. Copyright © 2017. Published by Elsevier B.V.

  8. Stress-induced gene expression and behavior are controlled by DNA methylation and methyl donor availability in the dentate gyrus

    PubMed Central

    Saunderson, Emily A.; Spiers, Helen; Gutierrez-Mecinas, Maria; Trollope, Alexandra F.; Shaikh, Abeera; Mill, Jonathan; Reul, Johannes M. H. M.

    2016-01-01

    Stressful events evoke long-term changes in behavioral responses; however, the underlying mechanisms in the brain are not well understood. Previous work has shown that epigenetic changes and immediate-early gene (IEG) induction in stress-activated dentate gyrus (DG) granule neurons play a crucial role in these behavioral responses. Here, we show that an acute stressful challenge [i.e., forced swimming (FS)] results in DNA demethylation at specific CpG (5′-cytosine–phosphate–guanine-3′) sites close to the c-Fos (FBJ murine osteosarcoma viral oncogene homolog) transcriptional start site and within the gene promoter region of Egr-1 (early growth response protein 1) specifically in the DG. Administration of the (endogenous) methyl donor S-adenosyl methionine (SAM) did not affect CpG methylation and IEG gene expression at baseline. However, administration of SAM before the FS challenge resulted in an enhanced CpG methylation at the IEG loci and suppression of IEG induction specifically in the DG and an impaired behavioral immobility response 24 h later. The stressor also specifically increased the expression of the de novo DNA methyltransferase Dnmt3a [DNA (cytosine-5-)-methyltransferase 3 alpha] in this hippocampus region. Moreover, stress resulted in an increased association of Dnmt3a enzyme with the affected CpG loci within the IEG genes. No effects of SAM were observed on stress-evoked histone modifications, including H3S10p-K14ac (histone H3, phosphorylated serine 10 and acetylated lysine-14), H3K4me3 (histone H3, trimethylated lysine-4), H3K9me3 (histone H3, trimethylated lysine-9), and H3K27me3 (histone H3, trimethylated lysine-27). We conclude that the DNA methylation status of IEGs plays a crucial role in FS-induced IEG induction in DG granule neurons and associated behavioral responses. In addition, the concentration of available methyl donor, possibly in conjunction with Dnmt3a, is critical for the responsiveness of dentate neurons to environmental stimuli in terms of gene expression and behavior. PMID:27078100

  9. DNA Methylation of Gene Expression in Acanthamoeba castellanii Encystation.

    PubMed

    Moon, Eun-Kyung; Hong, Yeonchul; Lee, Hae-Ahm; Quan, Fu-Shi; Kong, Hyun-Hee

    2017-04-01

    Encystation mediating cyst specific cysteine proteinase (CSCP) of Acanthamoeba castellanii is expressed remarkably during encystation. However, the molecular mechanism involved in the regulation of CSCP gene expression remains unclear. In this study, we focused on epigenetic regulation of gene expression during encystation of Acanthamoeba . To evaluate methylation as a potential mechanism involved in the regulation of CSCP expression, we first investigated the correlation between promoter methylation status of CSCP gene and its expression. A 2,878 bp of promoter sequence of CSCP gene was amplified by PCR. Three CpG islands (island 1-3) were detected in this sequence using bioinformatics tools. Methylation of CpG island in trophozoites and cysts was measured by bisulfite sequence PCR. CSCP promoter methylation of CpG island 1 (1,633 bp) was found in 8.2% of trophozoites and 7.3% of cysts. Methylation of CpG island 2 (625 bp) was observed in 4.2% of trophozoites and 5.8% of cysts. Methylation of CpG island 3 (367 bp) in trophozoites and cysts was both 3.6%. These results suggest that DNA methylation system is present in CSCP gene expression of Acanthamoeba . In addition, the expression of encystation mediating CSCP is correlated with promoter CpG island 1 hypomethylation.

  10. Trial Watch: Toll-like receptor agonists for cancer therapy.

    PubMed

    Vacchelli, Erika; Eggermont, Alexander; Sautès-Fridman, Catherine; Galon, Jérôme; Zitvogel, Laurence; Kroemer, Guido; Galluzzi, Lorenzo

    2013-08-01

    Toll-like receptors (TLRs) have long been known for their ability to initiate innate immune responses upon exposure to conserved microbial components such as lipopolysaccharide (LPS) and double-stranded RNA. More recently, this family of pattern recognition receptors has been attributed a critical role in the elicitation of anticancer immune responses, raising interest in the development of immunochemotherapeutic regimens based on natural or synthetic TLR agonists. In spite of such an intense wave of preclinical and clinical investigation, only three TLR agonists are currently licensed by FDA for use in cancer patients: bacillus Calmette-Guérin (BCG), an attenuated strain of Mycobacterium bovis that operates as a mixed TLR2/TLR4 agonist; monophosphoryl lipid A (MPL), a derivative of Salmonella minnesota that functions as a potent agonist of TLR4; and imiquimod, a synthetic imidazoquinoline that activates TLR7. One year ago, in the August and September issues of OncoImmunology , we described the main biological features of TLRs and discussed the progress of clinical studies evaluating the safety and therapeutic potential of TLR agonists in cancer patients. Here, we summarize the latest developments in this exciting area of research, focusing on preclinical studies that have been published during the last 13 mo and clinical trials launched in the same period to investigate the antineoplastic activity of TLR agonists.

  11. Successful early romiplostim use in a case of severe immune thrombocytopenia with critical carotid arterial injury.

    PubMed

    Watanabe, Reiko; Tabayashi, Takayuki; Tomikawa, Tatsuki; Sagawa, Morihiko; Anan-Nemoto, Tomoe; Kimura, Yuta; Takahashi, Yasuyuki; Tokuhira, Michihide; Otaki, Satoshi; Oi, Hidenori; Sawano, Makoto; Sugiyama, Satoshi; Kizaki, Masahiro

    2017-01-01

    Thrombopoietin receptor (TPO-R) agonists have been shown to be effective in refractory chronic immune thrombocytopenia (ITP); however, their efficacy in patients under critical care is not known. We report the case of a female patient with a newly diagnosed ITP who experienced severe bleeding from an external wound. The patient was administered the standard treatments for ITP, which are high-dose intravenous immunoglobulin (IVIg) and corticosteroids. However, following failure of these treatments, we administered romiplostim on day 6 after the onset of ITP. On day 6 after the initiation of romiplostim, there was improvement in platelet count and bleeding tendency. We were subsequently able to perform a splenectomy successfully. The efficacy of TPO-R agonists in ITP has been reported in several situations, including before surgery in an ITP patient; however, the use of TPO-R for arterial bleeding with shock has not been reported. To our knowledge, the present article is a rare case report of the use of a TPO-R agonist in a patient with critical artery injury. Our data suggest that the early use of romiplostim is effective in emergency cases of newly diagnosed ITP with life-threatening bleeding, which is refractory to standard treatment.

  12. Exosome-based tumor antigens-adjuvant co-delivery utilizing genetically engineered tumor cell-derived exosomes with immunostimulatory CpG DNA.

    PubMed

    Morishita, Masaki; Takahashi, Yuki; Matsumoto, Akihiro; Nishikawa, Makiya; Takakura, Yoshinobu

    2016-12-01

    For cancer immunotherapy via tumor antigen vaccination in combination with an adjuvant, major challenges include the identification of a particular tumor antigen and efficient delivery of the antigen as well as adjuvant to antigen-presenting cells. In this study, we proposed an efficient exosome-based tumor antigens-adjuvant co-delivery system using genetically engineered tumor cell-derived exosomes containing endogenous tumor antigens and immunostimulatory CpG DNA. Murine melanoma B16BL6 cells were transfected with a plasmid vector encoding a fusion streptavidin (SAV; a protein that binds to biotin with high affinity)-lactadherin (LA; an exosome-tropic protein) protein, yielding genetically engineered SAV-LA-expressing exosomes (SAV-exo). SAV-exo were combined with biotinylated CpG DNA to prepare CpG DNA-modified exosomes (CpG-SAV-exo). Fluorescent microscopic observation revealed the successful modification of exosomes with CpG DNA by SAV-biotin interaction. CpG-SAV-exo showed efficient and simultaneous delivery of exosomes with CpG DNA to murine dendritic DC2.4 cells in culture. Treatment with CpG-SAV-exo effectively activated DC2.4 cells and enhanced tumor antigen presentation capacity. Immunization with CpG-SAV-exo exhibited stronger in vivo antitumor effects in B16BL6 tumor-bearing mice than simple co-administration of exosomes and CpG DNA. Thus, genetically engineered CpG-SAV-exo is an effective exosome-based tumor antigens-adjuvant co-delivery system that will be useful for cancer immunotherapy. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Use of DNA from human stools to detect aberrant CpG island methylation of genes implicated in colorectal cancer.

    PubMed

    Belshaw, Nigel J; Elliott, Giles O; Williams, Elizabeth A; Bradburn, David M; Mills, Sarah J; Mathers, John C; Johnson, Ian T

    2004-09-01

    Hypermethylation of cytosine residues in the CpG islands of tumor suppressor genes is a key mechanism of colorectal carcinogenesis. Detection and quantification of CpG island methylation in human DNA isolated from stools might provide a novel strategy for the detection and investigation of colorectal neoplasia. To explore the feasibility of this approach, colorectal biopsies and fecal samples were obtained from 32 patients attending for colonoscopy or surgery, who were found to have adenomatous polyps, colorectal cancer, or no evidence of neoplasia. A further 18 fecal samples were obtained from healthy volunteers, with no bowel symptoms. Isolated DNA was modified with sodium bisulfite and analyzed by methylation-specific PCR and combined bisulfite restriction analysis for CpG island methylation of ESR1, MGMT, HPP1, p16(INK4a), APC, and MLH1. CpG island methylation was readily detectable in both mucosal and fecal DNA with methylation-specific PCR. Using combined bisulfite restriction analysis, it was established that, in volunteers from whom biopsies were available, the levels of methylation at two CpG sites within ESR1 assayed using fecal DNA were significantly correlated with methylation in DNA from colorectal mucosa. Thus, noninvasive techniques can be used to obtain quantitative information about the level of CpG island methylation in human colorectal mucosa. The methods described here could be applied to a much expanded range of genes and may be valuable both for screening purposes and to provide greater insight into the functional consequences of epigenetic changes in the colorectal mucosa of free-living individuals.

  14. Maternal treatment with a high dose of CpG ODN during gestation alters fetal craniofacial and distal limb development in C57BL/6 mice.

    PubMed

    Prater, M Renee; Johnson, Victor J; Germolec, Dori R; Luster, Michael I; Holladay, Steven D

    2006-01-16

    Synthetic oligodeoxynucleotides (ODN) containing CpG motifs, characteristic of bacterial DNA, are currently being evaluated as vaccine adjuvants for inducing protective immunity. Recently, there is increasing pressure to vaccinate pregnant women against maternally transmitted diseases including AIDS and tetanus, as well as against potential bio-weapons such as anthrax. CpG vaccines are effective because they trigger transient increases in T(H)1 cytokine production. Recent literature suggests, however, that a shift toward a T(H)1 cytokine profile during pregnancy may increase the risk of fetal morphologic defects. On this basis, we hypothesized that exposure to CpG motifs during pregnancy could result in T(H)1 inflammation leading to adverse effects on fetal development. To address this hypothesis, pregnant C57BL/6 mice were injected with CpG ODN (0-300 microg/dam) and maternal and fetal outcomes were determined. Injection of dams with the highest dose of CpG ODN resulted in markedly increased fetal resorptions and craniofacial/limb defects, while lower doses had little, if any effects. Histological examination of placentas revealed cellular necrosis with mixed inflammation and calcification in the spongiotrophoblast layer and dysregulation of labyrinthine vascular development. Concomitant elevations in maternal serum cytokine levels were observed including interleukin (IL)-2, IL-10 and IL-12. Treatment with 300 microg of non-CpG ODN did not cause any adverse effects. The 300 microg dose of CpG ODN used in the present study is 30-fold higher than the highest dose that has been administered to humans during clinical trials. These results suggest that the induction of T(H)1 cytokines during pregnancy by CpG motifs may potentially increase the risk of fetal loss and morphologic defects in mice, at least at high doses, and support the need for further investigation of teratogenesis that may result from exposure to vaccine adjuvants designed to produce T(H)1 cytokine profile shifts.

  15. Prognostication of patients with clear cell renal cell carcinomas based on quantification of DNA methylation levels of CpG island methylator phenotype marker genes.

    PubMed

    Tian, Ying; Arai, Eri; Gotoh, Masahiro; Komiyama, Motokiyo; Fujimoto, Hiroyuki; Kanai, Yae

    2014-10-20

    The CpG island methylator phenotype (CIMP) of clear cell renal cell carcinomas (ccRCCs) is characterized by accumulation of DNA methylation at CpG islands and poorer patient outcome. The aim of this study was to establish criteria for prognostication of patients with ccRCCs using the ccRCC-specific CIMP marker genes. DNA methylation levels at 299 CpG sites in the 14 CIMP marker genes were evaluated quantitatively in tissue specimens of 88 CIMP-negative and 14 CIMP-positive ccRCCs in a learning cohort using the MassARRAY system. An additional 100 ccRCCs were also analyzed as a validation cohort. Receiver operating characteristic curve analysis showed that area under the curve values for the 23 CpG units including the 32 CpG sites in the 7 CIMP-marker genes, i.e. FAM150A, ZNF540, ZNF671, ZNF154, PRAC, TRH and SLC13A5, for discrimination of CIMP-positive from CIMP-negative ccRCCs were larger than 0.95. Criteria combining the 23 CpG units discriminated CIMP-positive from CIMP-negative ccRCCs with 100% sensitivity and specificity in the learning cohort. Cancer-free and overall survival rates of patients with CIMP-positive ccRCCs diagnosed using the criteria combining the 23 CpG units in a validation cohort were significantly lower than those of patients with CIMP-negative ccRCCs (P = 1.41 × 10-5 and 2.43 × 10-13, respectively). Patients with CIMP-positive ccRCCs in the validation cohort had a higher likelihood of disease-related death (hazard ratio, 75.8; 95% confidence interval, 7.81 to 735; P = 1.89 × 10-4) than those with CIMP-negative ccRCCs. The established criteria are able to reproducibly diagnose CIMP-positive ccRCCs and may be useful for personalized medicine for patients with ccRCCs.

  16. Parvovirus B19 DNA CpG Dinucleotide Methylation and Epigenetic Regulation of Viral Expression

    PubMed Central

    Bonvicini, Francesca; Manaresi, Elisabetta; Di Furio, Francesca; De Falco, Luisa; Gallinella, Giorgio

    2012-01-01

    CpG DNA methylation is one of the main epigenetic modifications playing a role in the control of gene expression. For DNA viruses whose genome has the ability to integrate in the host genome or to maintain as a latent episome, a correlation has been found between the extent of DNA methylation and viral quiescence. No information is available for Parvovirus B19, a human pathogenic virus, which is capable of both lytic and persistent infections. Within Parvovirus B19 genome, the inverted terminal regions display all the characteristic signatures of a genomic CpG island; therefore we hypothesised a role of CpG dinucleotide methylation in the regulation of viral genome expression. The analysis of CpG dinucleotide methylation of Parvovirus B19 DNA was carried out by an aptly designed quantitative real-time PCR assay on bisulfite-modified DNA. The effects of CpG methylation on the regulation of viral genome expression were first investigated by transfection of either unmethylated or in vitro methylated viral DNA in a model cell line, showing that methylation of viral DNA was correlated to lower expression levels of the viral genome. Then, in the course of in vitro infections in different cellular environments, it was observed that absence of viral expression and genome replication were both correlated to increasing levels of CpG methylation of viral DNA. Finally, the presence of CpG methylation was documented in viral DNA present in bioptic samples, indicating the occurrence and a possible role of this epigenetic modification in the course of natural infections. The presence of an epigenetic level of regulation of viral genome expression, possibly correlated to the silencing of the viral genome and contributing to the maintenance of the virus in tissues, can be relevant to the balance and outcome of the different types of infection associated to Parvovirus B19. PMID:22413013

  17. A CpG Oligonucleotide Can Protect Mice From a Low Aerosol Challenge Dose of Burkholderia mallei

    DTIC Science & Technology

    2006-03-01

    may protect victims of a biological attack from glanders . Burkholderia mallei , the causative agent of glanders , natu- rally infects equines, but it can...attack from glanders . 15. SUBJECT TERMS Burkholderia mallei , glanders , oligonucleotides, CpG motif, efficacy, laboratory animals, mice 16...Society for Microbiology. All Rights Reserved. A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei David M

  18. [Similarity of cycloprolylglycine to piracetam in antihypoxic and neuroprotective effects].

    PubMed

    Kolisnikova, K N; Gudasheva, T A; Nazarova, G A; Antipov, T A; Voronina, T A; Seredenin, S B

    2012-01-01

    The antihypoxic activity of the endogenous cyclic dipeptide cycloprolylglycine (CPG) has been studied on a model of normobaric hypoxia with hypercapnia and its neuroprotective activity has been studied on a model of human neuroblastoma SH-SY5Y cell damage by 6-hydroxydopamine. It is established that CPG exhibits the antihypoxic activity at doses of 0.5 and 1.0 mg/kg (i.p.) on outbred and BALB/c mice, but not on C57B1/6 mice. The neuroprotective activity of CPG was detected in 10(-5) - 10(-8) M concentration range only when the treatment was carried out 24h before toxin introduction. The obtained data confirm the hypothesis that piracetam is a mimetic of the endogenous CPG neuropeptide.

  19. CpG oligodeoxynucleotides containing GACGTT motifs enhance the immune responses elicited by a goose parvovirus vaccine in ducks.

    PubMed

    Lee, Jai-Wei; Lin, Yu-Ming; Yen, Ting-Ying; Yang, Wen-Jen; Chu, Chun-Yen

    2010-11-23

    Recombinant parvovirus VP2 (rVP2) was formulated with different types of adjuvant, including aluminum adjuvant and CpG oligodeoxynucleotides (ODNs), and the immunological responses after vaccination in ducks were examined. In comparison with the control group, production of rVP2-specific antibodies, expression of cytokines in peripheral blood mononuclear cells (PBMC) stimulated by rVP2, and percentage of CD4(+)/CD8(+) cells in PBMC were significantly increased in ducks immunized with rVP2 formulated with CpG ODNs containing 3 copies of GACGTT motif. CpG ODNs with GACGTT motifs might be used to improve the efficacy of vaccines for ducks. Copyright © 2010 Elsevier Ltd. All rights reserved.

  20. Beta-3 adrenergic agonists reduce pulmonary vascular resistance and improve right ventricular performance in a porcine model of chronic pulmonary hypertension.

    PubMed

    García-Álvarez, Ana; Pereda, Daniel; García-Lunar, Inés; Sanz-Rosa, David; Fernández-Jiménez, Rodrigo; García-Prieto, Jaime; Nuño-Ayala, Mario; Sierra, Federico; Santiago, Evelyn; Sandoval, Elena; Campelos, Paula; Agüero, Jaume; Pizarro, Gonzalo; Peinado, Víctor I; Fernández-Friera, Leticia; García-Ruiz, José M; Barberá, Joan A; Castellá, Manuel; Sabaté, Manel; Fuster, Valentín; Ibañez, Borja

    2016-07-01

    Beta-3 adrenergic receptor (β3AR) agonists have been shown to produce vasodilation and prevention of ventricular remodeling in different conditions. Given that these biological functions are critical in pulmonary hypertension (PH), we aimed to demonstrate a beneficial effect of β3AR agonists in PH. An experimental study in pigs (n = 34) with chronic PH created by pulmonary vein banding was designed to evaluate the acute hemodynamic effect and the long-term effect of β3AR agonists on hemodynamics, vascular remodeling and RV performance in chronic PH. Ex vivo human experiments were performed to explore the expression of β3AR mRNA and the vasodilator response of β3AR agonists in pulmonary arteries. Single intravenous administration of the β3AR agonist BRL37344 produced a significant acute reduction in PVR, and two-weeks treatment with two different β3AR selective agonists, intravenous BRL37344 or oral mirabegron, resulted in a significant reduction in PVR (median of -2.0 Wood units/m(2) for BRL37344 vs. +1.5 for vehicle, p = 0.04; and -1.8 Wood units/m(2) for mirabegron vs. +1.6 for vehicle, p = 0.002) associated with a significant improvement in magnetic resonance-measured RV performance. Histological markers of pulmonary vascular proliferation (p27 and Ki67) were significantly attenuated in β3AR agonists-treated pigs. β3AR was expressed in human pulmonary arteries and β3AR agonists produced vasodilatation. β3AR agonists produced a significant reduction in PVR and improved RV performance in experimental PH, emerging as a potential novel approach for treating patients with chronic PH.

  1. Combined study of genetic and epigenetic biomarker risperidone treatment efficacy in Chinese Han schizophrenia patients

    PubMed Central

    Shi, Y; Li, M; Song, C; Xu, Q; Huo, R; Shen, L; Xing, Q; Cui, D; Li, W; Zhao, J; He, L; Qin, S

    2017-01-01

    Nowadays, risperidone is an atypical antipsychotic drug that has been increasingly used for treatment and maintenance therapy in schizophrenia. However, partially affected by genetic or environmental factors, there is significant difference in treatment outcomes among patients. In this study, we aimed to interpret the difference between good and poor responders treated with risperidone in both genetic and epigenetic levels in 288 mainland Chinese patients. We recruited a Henan cohort including 98 patients as initial discovery group and then confirmed our results in Shanghai cohort. In genetic studies, we found 10 candidate single-nucleotide polymorphisms (SNPs) and 2 rare variants in Henan cohort by next-generation sequencing of 100 risperidone-response-related genes. After replication in Shanghai cohort by massarray platform, ultimately, rs6706232 and rs4818 were significantly associated with risperidone response in the two cohort meta-analysis (P=0.024 and 0.04, respectively). Besides, we also selected another reported 17 candidate SNPs associated with risperidone drug response to replicate in our mainland Chinese samples, while, we found no significant SNPs after Bonferroni correction. In epigenetic studies, we investigated the methylation status in promoters or gene-coding region of risperidone drug response-related genes including CYP3A4, CYP2D6, ABCB1, HTR2A, DRD2. Totally we found seven significant CpG sites in the meta-analysis with Bonferroni-corrected PCYP3A4_CpG_-36=0.0014, PCYP3A4_CpG_-258=0.0013, PCYP3A4_CpG_-296=0.0014, PCYP3A4_CpG_-367:-372:-374=0.028, PCYP2D6_CpG_193=0.012, PCYP2D6_CpG_242:244:250=0.00076 and PCYP2D6_CpG_284=0.034, respectively. As genetic and epigenetic factors may interactively affect drug response, we finally carried out a multivariant interaction analysis with multifactor dimensionality reduction and discovered a significant four-locus model (CYP3A4_CpG_-82:-86 +rs6280+rs1800497+rs6265, P=0.038) affecting drug response. These findings could partially explain different risperidone response outcome in Chinese population in a systematic level. PMID:28696411

  2. Improvement of the Immunogenicity of Porcine Circovirus Type 2 DNA Vaccine by Recombinant ORF2 Gene and CpG Motifs.

    PubMed

    Li, Jun; Shi, Jian-Li; Wu, Xiao-Yan; Fu, Fang; Yu, Jiang; Yuan, Xiao-Yuan; Peng, Zhe; Cong, Xiao-Yan; Xu, Shao-Jian; Sun, Wen-Bo; Cheng, Kai-Hui; Du, Yi-Jun; Wu, Jia-Qiang; Wang, Jin-Bao; Huang, Bao-Hua

    2015-06-01

    Nowadays, adjuvant is still important for boosting immunity and improving resistance in animals. In order to boost the immunity of porcine circovirus type 2 (PCV2) DNA vaccine, CpG motifs were inserted. In this study, the dose-effect was studied, and the immunity of PCV2 DNA vaccines by recombinant open reading frame 2 (ORF2) gene and CpG motifs was evaluated. Three-week-old Changbai piglets were inoculated intramuscularly with 200 μg, 400 μg, and 800 μg DNA vaccines containing 14 and 18 CpG motifs, respectively. Average gain and rectum temperature were recorded everyday during the experiments. Blood was collected from the piglets after vaccination to detect the changes of specific antibodies, interleukin-2, and immune cells every week. Tissues were collected for histopathology and polymerase chain reaction. The results indicated that compared to those of the control piglets, all concentrations of two DNA vaccines could induce PCV2-specific antibodies. A cellular immunity test showed that PCV2-specific lymphocytes proliferated the number of TH, TC, and CD3+ positive T-cells raised in the blood of DNA vaccine immune groups. There was no distinct pathological damage and viremia occurring in pigs that were inoculated with DNA vaccines, but there was some minor pathological damage in the control group. The results demonstrated that CpG motifs as an adjuvant could boost the humoral and cellular immunity of pigs to PCV2, especially in terms of cellular immunity. Comparing two DNA vaccines that were constructed, the one containing 18 CpG motifs was more effective. This is the first report that CpG motifs as an adjuvant insert to the PCV2 DNA vaccine could boost immunity.

  3. Potential for diagnosis versus therapy monitoring of attention deficit hyperactivity disorder: a new epigenetic biomarker interacting with both genotype and auto-immunity.

    PubMed

    Adriani, Walter; Romano, Emilia; Pucci, Mariangela; Pascale, Esterina; Cerniglia, Luca; Cimino, Silvia; Tambelli, Renata; Curatolo, Paolo; Granstrem, Oleg; Maccarrone, Mauro; Laviola, Giovanni; D'Addario, Claudio

    2018-02-01

    In view of the need for easily accessible biomarkers, we evaluated in ADHD children the epigenetic status of the 5'-untranslated region (UTR) in the SLC6A3 gene, coding for human dopamine transporter (DAT). We analysed buccal swabs and sera from 30 children who met DSM-IV-TR criteria for ADHD, assigned to treatment according to severity. Methylation levels at six-selected CpG sites (among which, a CGGCGGCGG and a CGCG motif), alone or in combination with serum titers in auto-antibodies against dopamine transporter (DAT aAbs), were analysed for correlation with CGAS scores (by clinicians) and Conners' scales (by parents), collected at recruitment and after 6 weeks. In addition, we characterized the DAT genotype, i.e., the variable number tandem repeat (VNTR) polymorphisms at the 3'-UTR of the gene. DAT methylation levels were greatly reduced in ADHD patients compared to control, healthy children. Within patients carrying at least one DAT 9 allele (DAT 9/x), methylation at positions CpG2 and/or CpG6 correlated with recovery, as evident from delta-CGAS scores as well as delta Conners' scales ('inattentive' and 'hyperactive' subscales). Moreover, hypermethylation at CpG1 position denoted severity, specifically for those patients carrying a DAT 10/10 genotype. Intriguingly, high serum DAT-aAbs titers appeared to corroborate indications from high CpG1 versus high CpG2/CpG6 levels, likewise denoting severity versus recovery in DAT 10/10 versus 9/x patients, respectively. These profiles suggest that DAT 5'UTR epigenetics plus serum aAbs can serve as suitable biomarkers, to confirm ADHD diagnosis and/or to predict the efficacy of treatment.

  4. Perception, attitude, and satisfaction of paediatric physicians and nurses towards clinical practice guidelines at a university teaching hospital.

    PubMed

    Amer, Yasser Sami; Al Nemri, Abdulrahman; Osman, Mohamed Elfaki; Saeed, Elshazaly; Assiri, Asaad Mohamed; Mohamed, Sarar

    2018-04-03

    To explore perception, attitude, and satisfaction of paediatric clinicians, trainees, and nurses at King Khalid University Hospital towards clinical practice guidelines (CPGs) including the locally adapted diabetic ketoacidosis CPG (DKA-CPG). A cross-sectional survey was distributed to 260 doctors and nurses working in the paediatrics department. The response rate was 95.4%. The respondents had a positive perception and attitude towards general CPGs and specifically for the DKA-CPG; 98.7% thought CPGs were useful sources of advice, improved safety, and decreased risk, and reduced variation in practice. A total of 99.2% thought CPGs were good clinical tools, 98.3% satisfied with, had confidence in well-developed CPGs, and would recommend them to their colleagues to use, and 94.6% agreed they were cost-effective. The preferred format for CPGs was paper (46.6%) and electronic (42.9%). The DKA-CPG helped in managing patients and respondents were all satisfied and had confidence with it (100%). The rationale and objectives of the DKA-CPG were clear for 99.25%; 98.5% thought the layout was clear and well organized and user-friendly (96.2%). Compared with nurses, physicians had a higher perception towards CPGs in general (P < .05) and the DKA-CPG (P < .05). The paediatric doctors, and nurses have a great perception and satisfaction and positive attitude towards CPGs in general, towards the paediatric diabetic ketoacidosis CPG in particular, which in turn had a positive impact on the acceptability and implementation of the CPGs. These findings could help in sustaining a safe and high-quality health care environment through implementation of evidence-based CPGs. © 2018 John Wiley & Sons, Ltd.

  5. CpG island methylator phenotype-low (CIMP-low) colorectal cancer shows not only few methylated CIMP-high-specific CpG islands, but also low-level methylation at individual loci.

    PubMed

    Kawasaki, Takako; Ohnishi, Mutsuko; Nosho, Katsuhiko; Suemoto, Yuko; Kirkner, Gregory J; Meyerhardt, Jeffrey A; Fuchs, Charles S; Ogino, Shuji

    2008-03-01

    The CpG island methylator phenotype (CIMP or CIMP-high) with widespread promoter methylation is a distinct phenotype in colorectal cancer. However, the concept of CIMP-low with less extensive CpG island methylation is still evolving. Our aim is to examine whether density of methylation in individual CpG islands was different between CIMP-low and CIMP-high tumors. Utilizing MethyLight technology and 889 population-based colorectal cancers, we quantified DNA methylation (methylation index, percentage of methylated reference) at 14 CpG islands, including 8 CIMP-high-specific loci (CACNA1G, CDKN2A (p16), CRABP1, IGF2, MLH1, NEUROG1, RUNX3 and SOCS1). Methylation positivity in each locus was defined as methylation index>4. Low-level methylation (methylation index>0, <20) in each CIMP-high-specific locus was significantly more common in 340 CIMP-low tumors (1/8-5/8 methylation-positive loci) than 133 CIMP-high tumors (> or =6/8 methylation-positive loci) and 416 CIMP-0 tumors (0/8 methylation-positive loci) (P< or =0.002). In the other six loci (CHFR, HIC1, IGFBP3, MGMT, MINT31 and WRN), which were not highly specific for CIMP-high, low-level methylation, was not persistently more prevalent in CIMP-low tumors. In conclusion, compared to CIMP-high and CIMP-0 tumors, CIMP-low colorectal cancers show not only few methylated CIMP-high-specific CpG islands, but also more frequent low-level methylation at individual loci. Our data may provide supporting evidence for a difference in pathogenesis of DNA methylation between CIMP-low and CIMP-high tumors.

  6. [Comparative analysis of methylation profiles in tissues of oral leukoplakia and oral squamous cell carcinoma].

    PubMed

    Fu, J; Su, Y; Liu, Y; Zhang, X Y

    2018-04-09

    Objective: To compare the methylation profiles in tissues of oral leukoplakia (OLK) and oral squamous cell carcinoma (OSCC) with healthy tissues of oral mucosa, in order to identify the role of DNA methylation played in tumorigenesis. Methods: DNA samples extracted from tissues of 4 healthy oral mucosa, 4 OSCC and 4 OLK collected from patients of the Department of Oral Medicine, Capital Medical University School of Stomatology were examined and compared using Methylation 450 Bead Chip. The genes associated with differentially methylated CpG sites were selected for gene ontology (GO) analysis and Kyoto encyclopedia of genes and genomes (KEGG) pathway enrichment. Results: Multiple differentially methylated CpG sites were identified by using the above mentioned assay. Hypermethylation constitutes 86.18% (23 290/27 025) of methylation changes in OLK and hypomethylation accounts for 13.82% (3 734/27 025) of methylation changes. Both hypermethylated and hypomethylated CpG sites were markedly increased in OSCC tissue compared with OLK tissue. The majority of differentially methylated CpG sites were located outside CpG islands, with approximately one-fourth in CpG shores flanking the islands, which were considered highly important for gene regulation and tumorigenesis. Pathway analysis revealed that differentially methylated CpG sites in both OLK and OSCC patients shared the same pathway enrichments, most of which were correlated with carcinogenesis and cancer progression (e.g., DNA repair, cell cycle, and apoptosis). Conclusions: In the present study, methylation-associated alterations affect almost all pathways in the cellular network in both OLK and OSCC. OLK and OSCC shared similar methylation changes whether in pathways or genes, indicating that epigenetically they might have the same molecular basis for disease progression.

  7. The Antimalarial Artemisinin Synergizes with Antibiotics To Protect against Lethal Live Escherichia coli Challenge by Decreasing Proinflammatory Cytokine Release

    PubMed Central

    Wang, Jun; Zhou, Hong; Zheng, Jiang; Cheng, Juan; Liu, Wei; Ding, Guofu; Wang, Liangxi; Luo, Ping; Lu, Yongling; Cao, Hongwei; Yu, Shuangjiang; Li, Bin; Zhang, Lezhi

    2006-01-01

    In the present study artemisinin (ART) was found to have potent anti-inflammatory effects in animal models of sepsis induced by CpG-containing oligodeoxy-nucleotides (CpG ODN), lipopolysaccharide (LPS), heat-killed Escherichia coli 35218 or live E. coli. Furthermore, we found that ART protected mice from a lethal challenge by CpG ODN, LPS, or heat-killed E. coli in a dose-dependent manner and that the protection was related to a reduction in serum tumor necrosis factor alpha (TNF-α). More significantly, the administration of ART together with ampicillin or unasyn (a complex of ampicillin and sulbactam) decreased mortality from 100 to 66.7% or 33.3%, respectively, in mice subjected to a lethal live E. coli challenge. Together with the observation that ART alone does not inhibit bacterial growth, this result suggests that ART protection is achieved as a result of its anti-inflammatory activity rather than an antimicrobial effect. In RAW264.7 cells, pretreatment with ART potently inhibited TNF-α and interleukin-6 release induced by CpG ODN, LPS, or heat-killed E. coli in a dose- and time-dependent manner. Experiments utilizing affinity sensor technology revealed no direct binding of ART with CpG ODN or LPS. Flow cytometry further showed that ART did not alter binding of CpG ODN to cell surfaces or the internalization of CpG ODN. In addition, upregulated levels of TLR9 and TLR4 mRNA were not attenuated by ART treatment. ART treatment did, however, block the NF-κB activation induced by CpG ODN, LPS, or heat-killed E. coli. These findings provide compelling evidence that ART may be an important potential drug for sepsis treatment. PMID:16801421

  8. Intraperitoneal prophylaxis with CpG oligodeoxynucleotides protects neutropenic mice against intracerebral Escherichia coli K1 infection.

    PubMed

    Ribes, Sandra; Meister, Tanja; Ott, Martina; Redlich, Sandra; Janova, Hana; Hanisch, Uwe-Karsten; Nessler, Stefan; Nau, Roland

    2014-01-23

    Prophylaxis with unmethylated cytosine phosphate guanidine (CpG) oligodeoxynucleotides (ODN) protects against several systemic experimental infections. Escherichia coli is a major cause of Gram-negative neonatal bacterial meningitis and also causes meningitis and meningoencephalitis in older and immunocompromised patients. Wild-type (wt) and Toll-like receptor 9 (TLR9)-deficient mice were rendered neutropenic by intraperitoneal administration of the anti-Ly-6G monoclonal antibody. Immunocompetent and neutropenic mice received intraperitoneal CpG ODN or vehicle 72 h prior to induction of E. coli K1 meningoencephalitis. Pre-treatment with CpG ODN significantly increased survival of neutropenic wt mice from 33% to 75% (P = 0.0003) but did not protect neutropenic TLR9-/- mice. The protective effect of CpG ODN was associated with an enhanced production of interleukin (IL)-12/IL-23p40 with sustained increased levels in serum and spleen at least for 17 days after conditioning compared to buffer-treated animals. CpG-treated neutropenic wt mice showed reduced bacterial concentrations and increased recruitment of Ly6ChighCCR2+ monocytes in brain and spleen 42 h after infection. The levels of macrophage inflammatory protein 1α (MIP-1α) and interferon gamma (IFN-γ) in spleen were higher 42 h after infection in CpG-treated compared to buffer-treated neutropenic animals. In immunocompetent mice, prophylaxis with CpG ODN did not significantly increase survival compared to the buffer group (60% vs. 45%, P = 0.2). These findings suggest that systemic administration of CpG ODN may help to prevent bacterial CNS infections in immunocompromised individuals.

  9. Complete Chloroplast Genome of Pinus massoniana (Pinaceae): Gene Rearrangements, Loss of ndh Genes, and Short Inverted Repeats Contraction, Expansion.

    PubMed

    Ni, ZhouXian; Ye, YouJu; Bai, Tiandao; Xu, Meng; Xu, Li-An

    2017-09-11

    The chloroplast genome (CPG) of Pinus massoniana belonging to the genus Pinus (Pinaceae), which is a primary source of turpentine, was sequenced and analyzed in terms of gene rearrangements, ndh genes loss, and the contraction and expansion of short inverted repeats (IRs). P. massoniana CPG has a typical quadripartite structure that includes large single copy (LSC) (65,563 bp), small single copy (SSC) (53,230 bp) and two IRs (IRa and IRb, 485 bp). The 108 unique genes were identified, including 73 protein-coding genes, 31 tRNAs, and 4 rRNAs. Most of the 81 simple sequence repeats (SSRs) identified in CPG were mononucleotides motifs of A/T types and located in non-coding regions. Comparisons with related species revealed an inversion (21,556 bp) in the LSC region; P. massoniana CPG lacks all 11 intact ndh genes (four ndh genes lost completely; the five remained truncated as pseudogenes; and the other two ndh genes remain as pseudogenes because of short insertions or deletions). A pair of short IRs was found instead of large IRs, and size variations among pine species were observed, which resulted from short insertions or deletions and non-synchronized variations between "IRa" and "IRb". The results of phylogenetic analyses based on whole CPG sequences of 16 conifers indicated that the whole CPG sequences could be used as a powerful tool in phylogenetic analyses.

  10. Multi-step aberrant CpG island hyper-methylation is associated with the progression of adult T-cell leukemia/lymphoma.

    PubMed

    Sato, Hiaki; Oka, Takashi; Shinnou, Yoko; Kondo, Takami; Washio, Kana; Takano, Masayuki; Takata, Katsuyoshi; Morito, Toshiaki; Huang, Xingang; Tamura, Maiko; Kitamura, Yuta; Ohara, Nobuya; Ouchida, Mamoru; Ohshima, Koichi; Shimizu, Kenji; Tanimoto, Mitsune; Takahashi, Kiyoshi; Matsuoka, Masao; Utsunomiya, Atae; Yoshino, Tadashi

    2010-01-01

    Aberrant CpG island methylation contributes to the pathogenesis of various malignancies. However, little is known about the association of epigenetic abnormalities with multistep tumorigenic events in adult T cell leukemia/lymphoma (ATLL). To determine whether epigenetic abnormalities induce the progression of ATLL, we analyzed the methylation profiles of the SHP1, p15, p16, p73, HCAD, DAPK, hMLH-1, and MGMT genes by methylation specific PCR assay in 65 cases with ATLL patients. The number of CpG island methylated genes increased with disease progression and aberrant hypermethylation in specific genes was detected even in HTLV-1 carriers and correlated with progression to ATLL. The CpG island methylator phenotype (CIMP) was observed most frequently in lymphoma type ATLL and was also closely associated with the progression and crisis of ATLL. The high number of methylated genes and increase of CIMP incidence were shown to be unfavorable prognostic factors and correlated with a shorter overall survival by Kaplan-Meyer analysis. The present findings strongly suggest that the multistep accumulation of aberrant CpG methylation in specific target genes and the presence of CIMP are deeply involved in the crisis, progression, and prognosis of ATLL, as well as indicate the value of CpG methylation and CIMP for new diagnostic and prognostic biomarkers.

  11. Multi-Step Aberrant CpG Island Hyper-Methylation Is Associated with the Progression of Adult T–Cell Leukemia/Lymphoma

    PubMed Central

    Sato, Hiaki; Oka, Takashi; Shinnou, Yoko; Kondo, Takami; Washio, Kana; Takano, Masayuki; Takata, Katsuyoshi; Morito, Toshiaki; Huang, Xingang; Tamura, Maiko; Kitamura, Yuta; Ohara, Nobuya; Ouchida, Mamoru; Ohshima, Koichi; Shimizu, Kenji; Tanimoto, Mitsune; Takahashi, Kiyoshi; Matsuoka, Masao; Utsunomiya, Atae; Yoshino, Tadashi

    2010-01-01

    Aberrant CpG island methylation contributes to the pathogenesis of various malignancies. However, little is known about the association of epigenetic abnormalities with multistep tumorigenic events in adult T cell leukemia/lymphoma (ATLL). To determine whether epigenetic abnormalities induce the progression of ATLL, we analyzed the methylation profiles of the SHP1, p15, p16, p73, HCAD, DAPK, hMLH-1, and MGMT genes by methylation specific PCR assay in 65 cases with ATLL patients. The number of CpG island methylated genes increased with disease progression and aberrant hypermethylation in specific genes was detected even in HTLV-1 carriers and correlated with progression to ATLL. The CpG island methylator phenotype (CIMP) was observed most frequently in lymphoma type ATLL and was also closely associated with the progression and crisis of ATLL. The high number of methylated genes and increase of CIMP incidence were shown to be unfavorable prognostic factors and correlated with a shorter overall survival by Kaplan-Meyer analysis. The present findings strongly suggest that the multistep accumulation of aberrant CpG methylation in specific target genes and the presence of CIMP are deeply involved in the crisis, progression, and prognosis of ATLL, as well as indicate the value of CpG methylation and CIMP for new diagnostic and prognostic biomarkers. PMID:20019193

  12. Immunostimulatory CpG on Carbon Nanotubes Selectively Inhibits Migration of Brain Tumor Cells.

    PubMed

    Alizadeh, Darya; White, Ethan E; Sanchez, Teresa C; Liu, Shunan; Zhang, Leying; Badie, Behnam; Berlin, Jacob M

    2018-05-16

    Even when treated with aggressive current therapies, patients with glioblastoma usually survive less than two years and exhibit a high rate of recurrence. CpG is an oligonucleotide that activates the innate immune system via Toll-like receptor 9 (TLR9) activation. Injection of CpG into glioblastoma tumors showed promise as an immunotherapy in mouse models but proved disappointing in human trials. One aspect of glioma that is not addressed by CpG therapy alone is the highly invasive nature of glioma cells, which is associated with resistance to radiation and chemotherapy. Here, we demonstrate that single-walled carbon nanotubes noncovalently functionalized with CpG (SWNT/CpG), which retain the immunostimulatory property of the CpG, selectively inhibit the migration of glioma cells and not macrophages without affecting cell viability or proliferation. SWNT/CpG also selectively decreased NF-κB activation in glioma cells, while activating macrophages by induction of the TLR9/NF-κB pathway, as we have previously reported. The migration inhibition of glioma cells was correlated with selective reduction of intracellular levels of reactive oxygen species (ROS), suggesting that an antioxidant-based mechanism mediates the observed effects. To the best of our knowledge, SWNT/CpG is the first nanomaterial that inhibits the migration of cancer cells while stimulating the immune system.

  13. Survival differences of CIMP subtypes integrated with CNA information in human breast cancer.

    PubMed

    Wang, Huihan; Yan, Weili; Zhang, Shumei; Gu, Yue; Wang, Yihan; Wei, Yanjun; Liu, Hongbo; Wang, Fang; Wu, Qiong; Zhang, Yan

    2017-07-25

    CpG island methylator phenotype of breast cancer is associated with widespread aberrant methylation at specified CpG islands and distinct patient outcomes. However, the influence of copy number contributing to the prognosis of tumors with different CpG island methylator phenotypes is still unclear. We analyzed both genetic (copy number) and epigenetic alterations in 765 breast cancers from The Cancer Genome Atlas data portal and got a panel of 15 biomarkers for copy number and methylation status evaluation. The gene panel identified two groups corresponding to distinct copy number profiles. In status of mere-loss copy number, patients were faced with a greater risk if they presented a higher CpG islands methylation pattern in biomarker panels. But for samples presenting merely-gained copy number, higher methylation level of CpG islands was associated with improved viability. In all, the integration of copy number alteration and methylation information enhanced the classification power on prognosis. Moreover, we found the molecular subtypes of breast cancer presented different distributions in two CpG island methylation phenotypes. Generated by the same set of human methylation 450K data, additional copy number information could provide insights into survival prediction of cancers with less heterogeneity and might help to determine the biomarkers for diagnosis and treatment for breast cancer patients in a more personalized approach.

  14. Survival differences of CIMP subtypes integrated with CNA information in human breast cancer

    PubMed Central

    Wang, Huihan; Yan, Weili; Zhang, Shumei; Gu, Yue; Wang, Yihan; Wei, Yanjun; Liu, Hongbo; Wang, Fang; Wu, Qiong; Zhang, Yan

    2017-01-01

    CpG island methylator phenotype of breast cancer is associated with widespread aberrant methylation at specified CpG islands and distinct patient outcomes. However, the influence of copy number contributing to the prognosis of tumors with different CpG island methylator phenotypes is still unclear. We analyzed both genetic (copy number) and epigenetic alterations in 765 breast cancers from The Cancer Genome Atlas data portal and got a panel of 15 biomarkers for copy number and methylation status evaluation. The gene panel identified two groups corresponding to distinct copy number profiles. In status of mere-loss copy number, patients were faced with a greater risk if they presented a higher CpG islands methylation pattern in biomarker panels. But for samples presenting merely-gained copy number, higher methylation level of CpG islands was associated with improved viability. In all, the integration of copy number alteration and methylation information enhanced the classification power on prognosis. Moreover, we found the molecular subtypes of breast cancer presented different distributions in two CpG island methylation phenotypes. Generated by the same set of human methylation 450K data, additional copy number information could provide insights into survival prediction of cancers with less heterogeneity and might help to determine the biomarkers for diagnosis and treatment for breast cancer patients in a more personalized approach. PMID:28415743

  15. DNA Methylation of T1R1 Gene in the Vegetarian Adaptation of Grass Carp Ctenopharyngodon idella.

    PubMed

    Cai, Wenjing; He, Shan; Liang, Xu-Fang; Yuan, Xiaochen

    2018-05-02

    Although previous studies have indicated importance of taste receptors in food habits formation in mammals, little is known about those in fish. Grass carp is an excellent model for studying vegetarian adaptation, as it shows food habit transition from carnivore to herbivore. In the present study, pseudogenization or frameshift mutations of the umami receptors that hypothesized related to dietary switch in vertebrates, were not found in grass carp, suggesting other mechanisms for vegetarian adaptation in grass carp. T1R1 and T1R3 strongly responded to L-Arg and L-Lys, differing from those of zebrafish and medaka, contributing to high species specificity in amino acid preferences and diet selection of grass carp. After food habit transition of grass carp, DNA methylation levels were higher in CPG1 and CPG3 islands of upstream control region of T1R1 gene. Luciferase activity assay of upstream regulatory region of T1R1 (-2500-0 bp) without CPG1 or CPG3 indicated that CPG1 and CPG3 might be involved in transcriptional regulation of T1R1 gene. Subsequently, high DNA methylation decreased expression of T1R1 in intestinal tract. It could be a new mechanism to explain, at least partially, the vegetarian adaptation of grass carp by regulation of expression of umami receptor via epigenetic modification.

  16. The contribution of a central pattern generator in a reflex-based neuromuscular model

    PubMed Central

    Dzeladini, Florin; van den Kieboom, Jesse; Ijspeert, Auke

    2014-01-01

    Although the concept of central pattern generators (CPGs) controlling locomotion in vertebrates is widely accepted, the presence of specialized CPGs in human locomotion is still a matter of debate. An interesting numerical model developed in the 90s’ demonstrated the important role CPGs could play in human locomotion, both in terms of stability against perturbations, and in terms of speed control. Recently, a reflex-based neuro-musculo-skeletal model has been proposed, showing a level of stability to perturbations similar to the previous model, without any CPG components. Although exhibiting striking similarities with human gaits, the lack of CPG makes the control of speed/step length in the model difficult. In this paper, we hypothesize that a CPG component will offer a meaningful way of controlling the locomotion speed. After introducing the CPG component in the reflex model, and taking advantage of the resulting properties, a simple model for gait modulation is presented. The results highlight the advantages of a CPG as feedforward component in terms of gait modulation. PMID:25018712

  17. Systematic Review of Clinical Practice Guidelines for Failed Antidepressant Treatment Response in Major Depressive Disorder, Dysthymia, and Subthreshold Depression in Adults.

    PubMed

    MacQueen, Glenda; Santaguida, Pasqualina; Keshavarz, Homa; Jaworska, Natalia; Levine, Mitchell; Beyene, Joseph; Raina, Parminder

    2017-01-01

    This systematic review critically evaluated clinical practice guidelines (CPGs) for treating adults with major depressive disorder, dysthymia, or subthreshold or minor depression for recommendations following inadequate response to first-line treatment with selective serotonin reuptake inhibitors (SSRIs). Searches for CPGs (January 2004 to November 2014) in English included 7 bibliographic databases and grey literature sources using CPG and depression as the keywords. Two raters selected CPGs on depression with a national scope. Data extraction included definitions of adequate response and recommended treatment options. Two raters assessed quality using the Appraisal of Guidelines for Research and Evaluation II (AGREE II) instrument. From 46,908 citations, 3167 were screened at full text. From these 21 CPG were applicable to adults in primary care and outpatient settings. Five CPGs consider patients with dysthymia or subthreshold or minor depression. None provides recommendations for those who do not respond to first-line SSRI treatment. For adults with MDD, most CPGs do not define an "inadequate response" or provide specific suggestions regarding how to choose alternative medications when switching to an alternative antidepressant. There is variability between CPGs in recommending combination strategies. AGREE II ratings for stakeholder involvement in CPG development, editorial independence, and rigor of development are domains in which depression guidelines are often less robust. About half of patients with depression require second-line treatment to achieve remission. Consistency and clarity in guidelines for second-line treatment of depression are therefore important for clinicians but lacking in most current guidelines. This may reflect a paucity of primary studies upon which to base conclusions.

  18. Distinctive Klf4 mutants determine preference for DNA methylation status

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hashimoto, Hideharu; Wang, Dongxue; Steves, Alyse N.

    Reprogramming of mammalian genome methylation is critically important but poorly understood. Klf4, a transcription factor directing reprogramming, contains a DNA binding domain with three consecutive C2H2 zinc fingers. Klf4 recognizes CpG or TpG within a specific sequence. Mouse Klf4 DNA binding domain has roughly equal affinity for methylated CpG or TpG, and slightly lower affinity for unmodified CpG. The structural basis for this key preference is unclear, though the side chain of Glu446 is known to contact the methyl group of 5-methylcytosine (5mC) or thymine (5-methyluracil). We examined the role of Glu446 by mutagenesis. Substituting Glu446 with aspartate (E446D) resultedmore » in preference for unmodified cytosine, due to decreased affinity for 5mC. In contrast, substituting Glu446 with proline (E446P) increased affinity for 5mC by two orders of magnitude. Structural analysis revealed hydrophobic interaction between the proline's aliphatic cyclic structure and the 5-methyl group of the pyrimidine (5mC or T). As in wild-type Klf4 (E446), the proline at position 446 does not interact directly with either the 5mC N4 nitrogen or the thymine O4 oxygen. In contrast, the unmethylated cytosine's exocyclic N4 amino group (NH2) and its ring carbon C5 atom hydrogen bond directly with the aspartate carboxylate of the E446D variant. Both of these interactions would provide a preference for cytosine over thymine, and the latter one could explain the E446D preference for unmethylated cytosine. Finally, we evaluated the ability of these Klf4 mutants to regulate transcription of methylated and unmethylated promoters in a luciferase reporter assay.« less

  19. Bidirectional plasticity of pontine pneumotaxic postinspiratory drive: implication for a pontomedullary respiratory central pattern generator.

    PubMed

    Poon, Chi-Sang; Song, Gang

    2014-01-01

    The "pneumotaxic center" in the rostral dorsolateral pons as delineated by Lumsden nine decades ago is known to play an important role in promoting the inspiratory off-switch (IOS) for inspiratory-expiratory phase transition as a fail-safe mechanism for preventing apneusis in the absence of vagal input. Traditionally, the pontine pneumotaxic mechanism has been thought to contribute a tonic descending input that lowers the IOS threshold in medullary respiratory central pattern generator (rCPG) circuits, but otherwise does not constitute part of the rCPG. Recent evidence indicates that descending input from the Kölliker-Fuse nucleus (KFN) within the pneumotaxic center is essential for gating the postinspiratory phase of the three-phase respiratory rhythm to control the IOS in vagotomized animals. A critical question arising is whether such a descending pneumotaxic input from KFN that drives postinspiratory activity is tonic (null hypothesis) or rhythmic with postinspiratory phase modulation (alternative hypothesis). Here, we show that multifarious evidence reported in the literature collectively indicates that the descending pneumotaxic input may exhibit NMDA receptor-dependent short-term plasticity in the form of a biphasic neural differentiator that bidirectionally and phase-selectively modulates postinspiratory phase duration in response to vagal and peripheral chemoreceptor inputs independent of the responses in inspiratory and late-expiratory activities. The phase-selectivity property of the descending pneumotaxic input implicates a population of pontine early-expiratory (postinspiratory/expiratory-decrementing) neurons as the most likely neural correlate of the pneumotaxic mechanism that drives post-I activity, suggesting that the pontine pneumotaxic mechanism may be an integral part of a pontomedullary rCPG that underlies the three-phase respiratory rhythm. © 2014 Elsevier B.V. All rights reserved.

  20. Bacterial DNA induces pulmonary damage via TLR-9 through cross-talk with neutrophils.

    PubMed

    Itagaki, Kiyoshi; Adibnia, Yasaman; Sun, Shiqin; Zhao, Cong; Sursal, Tolga; Chen, Yu; Junger, Wolfgang; Hauser, Carl J

    2011-12-01

    Bacterial DNA (bDNA) contains hypomethylated "CpG" repeats that can be recognized by Toll-like receptor 9 (TLR-9) as a pathogen-associated molecular pattern. The ability of bDNA to initiate lung injury via TLR-9 has been inferred on the basis of studies using artificial CpG DNA. But the role of authentic bDNA in lung injury is still unknown. Moreover, the mechanisms by which CpG DNA species can lead to pulmonary injury are unknown, although neutrophils (PMNs) are thought to play a key role in the genesis of septic acute lung injury. We evaluated the effects of bDNA on PMN-endothelial cell (EC) interactions thought critical for initiation of acute lung injury. Using a biocapacitance system to monitor real-time changes in endothelial permeability, we demonstrate here that bDNA causes EC permeability in a dose-dependent manner uniquely in the presence of PMNs. These permeability changes are inhibited by chloroquine, suggesting TLR-9 dependency. When PMNs were preincubated with bDNA and applied to ECs or when bDNA was applied to ECs without PMNs, no permeability changes were detected. To study the underlying mechanisms, we evaluated the effects of bDNA on PMN-EC adherence. Bacterial DNA significantly increased PMN adherence to ECs in association with upregulated adhesion molecules in both cell types. Taken together, our results strongly support the conclusion that bDNA can initiate lung injury by stimulating PMN-EC adhesive interactions predisposing to endothelial permeability. Bacterial DNA stimulation of TLR-9 appears to promote enhanced gene expression of adhesion molecules in both cell types. This leads to PMN-EC cross-talk, which is required for injury to occur.

  1. The central pattern generator underlying swimming in Dendronotus iris: a simple half-center network oscillator with a twist.

    PubMed

    Sakurai, Akira; Katz, Paul S

    2016-10-01

    The nudibranch mollusc, Dendronotus iris, swims by rhythmically flexing its body from left to right. We identified a bilaterally represented interneuron, Si3, that provides strong excitatory drive to the previously identified Si2, forming a half-center oscillator, which functions as the central pattern generator (CPG) underlying swimming. As with Si2, Si3 inhibited its contralateral counterpart and exhibited rhythmic bursts in left-right alternation during the swim motor pattern. Si3 burst almost synchronously with the contralateral Si2 and was coactive with the efferent impulse activity in the contralateral body wall nerve. Perturbation of bursting in either Si3 or Si2 by current injection halted or phase-shifted the swim motor pattern, suggesting that they are both critical CPG members. Neither Si2 nor Si3 exhibited endogenous bursting properties when activated alone; activation of all four neurons was necessary to initiate and maintain the swim motor pattern. Si3 made a strong excitatory synapse onto the contralateral Si2 to which it is also electrically coupled. When Si3 was firing tonically but not exhibiting bursting, artificial enhancement of the Si3-to-Si2 synapse using dynamic clamp caused all four neurons to burst. In contrast, negation of the Si3-to-Si2 synapse by dynamic clamp blocked ongoing swim motor patterns. Together, these results suggest that the Dendronotus swim CPG is organized as a "twisted" half-center oscillator in which each "half" is composed of two excitatory-coupled neurons from both sides of the brain, each of which inhibits its contralateral counterpart. Consisting of only four neurons, this is perhaps the simplest known network oscillator for locomotion. Copyright © 2016 the American Physiological Society.

  2. Systematic Review of Clinical Practice Guidelines for Failed Antidepressant Treatment Response in Major Depressive Disorder, Dysthymia, and Subthreshold Depression in Adults

    PubMed Central

    MacQueen, Glenda; Santaguida, Pasqualina; Keshavarz, Homa; Jaworska, Natalia; Levine, Mitchell; Beyene, Joseph

    2016-01-01

    Objective: This systematic review critically evaluated clinical practice guidelines (CPGs) for treating adults with major depressive disorder, dysthymia, or subthreshold or minor depression for recommendations following inadequate response to first-line treatment with selective serotonin reuptake inhibitors (SSRIs). Method: Searches for CPGs (January 2004 to November 2014) in English included 7 bibliographic databases and grey literature sources using CPG and depression as the keywords. Two raters selected CPGs on depression with a national scope. Data extraction included definitions of adequate response and recommended treatment options. Two raters assessed quality using the Appraisal of Guidelines for Research and Evaluation II (AGREE II) instrument. Results: From 46,908 citations, 3167 were screened at full text. From these 21 CPG were applicable to adults in primary care and outpatient settings. Five CPGs consider patients with dysthymia or subthreshold or minor depression. None provides recommendations for those who do not respond to first-line SSRI treatment. For adults with MDD, most CPGs do not define an “inadequate response” or provide specific suggestions regarding how to choose alternative medications when switching to an alternative antidepressant. There is variability between CPGs in recommending combination strategies. AGREE II ratings for stakeholder involvement in CPG development, editorial independence, and rigor of development are domains in which depression guidelines are often less robust. Conclusions: About half of patients with depression require second-line treatment to achieve remission. Consistency and clarity in guidelines for second-line treatment of depression are therefore important for clinicians but lacking in most current guidelines. This may reflect a paucity of primary studies upon which to base conclusions. PMID:27554483

  3. The cancer-promoting gene fatty acid-binding protein 5 (FABP5) is epigenetically regulated during human prostate carcinogenesis.

    PubMed

    Kawaguchi, Koichiro; Kinameri, Ayumi; Suzuki, Shunsuke; Senga, Shogo; Ke, Youqiang; Fujii, Hiroshi

    2016-02-15

    FABPs (fatty-acid-binding proteins) are a family of low-molecular-mass intracellular lipid-binding proteins consisting of ten isoforms. FABPs are involved in binding and storing hydrophobic ligands such as long-chain fatty acids, as well as transporting these ligands to the appropriate compartments in the cell. FABP5 is overexpressed in multiple types of tumours. Furthermore, up-regulation of FABP5 is strongly associated with poor survival in triple-negative breast cancer. However, the mechanisms underlying the specific up-regulation of the FABP5 gene in these cancers remain poorly characterized. In the present study, we determined that FABP5 has a typical CpG island around its promoter region. The DNA methylation status of the CpG island in the FABP5 promoter of benign prostate cells (PNT2), prostate cancer cells (PC-3, DU-145, 22Rv1 and LNCaP) and human normal or tumour tissue was assessed by bisulfite sequencing analysis, and then confirmed by COBRA (combined bisulfite restriction analysis) and qAMP (quantitative analysis of DNA methylation using real-time PCR). These results demonstrated that overexpression of FABP5 in prostate cancer cells can be attributed to hypomethylation of the CpG island in its promoter region, along with up-regulation of the direct trans-acting factors Sp1 (specificity protein 1) and c-Myc. Together, these mechanisms result in the transcriptional activation of FABP5 expression during human prostate carcinogenesis. Importantly, silencing of Sp1, c-Myc or FABP5 expression led to a significant decrease in cell proliferation, indicating that up-regulation of FABP5 expression by Sp1 and c-Myc is critical for the proliferation of prostate cancer cells. © 2016 Authors; published by Portland Press Limited.

  4. Global Epigenetic Changes May Underlie Ethnic Differences and susceptibility to Prostate Cancer

    DTIC Science & Technology

    2012-09-01

    tissues; in the prostate, hypermethylation of the GSTP1 CpG has been detected in PIA lesions [8]. DNA methylation occurs at CpG sites in the human...that the GSTP1 CpG island was frequently hypermethylated in PCa, more than 40 genes have been reported to be targets of DNA hypermethylation-associated...One study demonstrated that GSTP1 hypermethylation was significantly higher in PCa samples from AA men in comparison with EA and Asians [12]. Another

  5. DNA methylation levels at chromosome 8q24 in peripheral blood are associated with 8q24 cancer susceptibility loci.

    PubMed

    Barry, Kathryn Hughes; Moore, Lee E; Sampson, Joshua; Yan, Liying; Meyer, Ann; Oler, Andrew J; Chung, Charles C; Wang, Zhaoming; Yeager, Meredith; Amundadottir, Laufey; Berndt, Sonja I

    2014-12-01

    Chromosome 8q24 has emerged as an important region for genetic susceptibility to various cancers, but little is known about the contribution of DNA methylation at 8q24. To evaluate variability in DNA methylation levels at 8q24 and the relationship with cancer susceptibility single nucleotide polymorphisms (SNPs) in this region, we quantified DNA methylation levels in peripheral blood at 145 CpG sites nearby 8q24 cancer susceptibility SNPs or MYC using pyrosequencing among 80 Caucasian men in the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial. For the 60 CpG sites meeting quality control, which also demonstrated temporal stability over a 5-year period, we calculated pairwise Spearman correlations for DNA methylation levels at each CpG site with 42 8q24 cancer susceptibility SNPs. To account for multiple testing, we adjusted P values into q values reflecting the false discovery rate (FDR). In contrast to the MYC CpG sites, most sites nearby the SNPs demonstrated good reproducibility, high methylation levels, and moderate-high between-individual variation. We observed 10 statistically significant (FDR < 0.05) CpG site-SNP correlations. These included correlations between an intergenic CpG site at Chr8:128393157 and the prostate cancer SNP rs16902094 (ρ = -0.54; P = 9.7 × 10(-7); q = 0.002), a PRNCR1 CpG site at Chr8:128167809 and the prostate cancer SNP rs1456315 (ρ = 0.52; P = 1.4 × 10(-6); q = 0.002), and two POU5F1B CpG sites and several prostate/colorectal cancer SNPs (for Chr8:128498051 and rs6983267, ρ = 0.46; P = 2.0 × 10(-5); q = 0.01). This is the first report of correlations between blood DNA methylation levels and cancer susceptibility SNPs at 8q24, suggesting that DNA methylation at this important susceptibility locus may contribute to cancer risk. ©2014 American Association for Cancer Research.

  6. Experimental murine myopia induces collagen type Iα1 (COL1A1) DNA methylation and altered COL1A1 messenger RNA expression in sclera

    PubMed Central

    Zhou, Xiangtian; Ji, Fengtao; An, Jianhong; Zhao, Fuxin; Shi, Fanjun; Huang, Furong; Li, Yuan; Jiao, Shiming; Yan, Dongsheng; Chen, Xiaoyan; Chen, JiangFan

    2012-01-01

    Purpose To investigate whether myopia development is associated with changes of scleral DNA methylation in cytosine-phosphate-guanine (CpG) sites in the collagen 1A1 (COL1A1) promoter and messenger RNA (mRNA) levels following murine form deprivation myopia. Methods Fifty-seven C57BL/6 mice (postnatal day 23) were randomly assigned to four groups: (1) monocular form deprivation (MD) in which a diffuser lens was placed over one eye for 28 days; (2) normal controls without MD; (3) MD recovery in which the diffuser lens was removed for seven days; and (4) MD recovery normal controls. The DNA methylation pattern in COL1A1 promoter and exon 1 was determined by bisulfite DNA sequencing, and the COL1A1 mRNA level in sclera was determined by quantitative PCR. Results MD was found to induce myopia in the treated eyes. Six CpG sites in the promoter and exon 1 region of COL1A1 were methylated with significantly higher frequency in the treated eyes than normal control eyes (p<0.05), with CpG island methylation in MD-contralateral eyes being intermediate. Consistent with the CpG methylation, scleral COL1A1 mRNA was reduced by 57% in the MD-treated eyes compared to normal controls (p<0.05). After seven days of MD recovery, CpG methylation was significantly reduced (p=0.01). The methylation patterns returned to near normal level in five CpG sites, but the sixth was hypomethylated compared to normal controls. Conclusions In parallel with the development of myopia and the reduced COL1A1 mRNA, the frequency of methylation in CpG sites of the COL1A1 promoter/exon 1 increased during MD and returned to near normal during recovery. Thus, hypermethylation of CpG sites in the promoter/exon 1 of COL1A1 may underlie reduced collagen synthesis at the transcriptional level in myopic scleras. PMID:22690110

  7. Primary care clinical practice guidelines in South Africa: qualitative study exploring perspectives of national stakeholders.

    PubMed

    Kredo, Tamara; Abrams, Amber; Young, Taryn; Louw, Quinette; Volmink, Jimmy; Daniels, Karen

    2017-08-29

    Clinical practice guidelines (CPGs) are common tools in policy and clinical practice informing clinical decisions at the bedside, governance of health facilities, health insurer and government spending, and patient choices. South Africa's health sector is transitioning to a national health insurance system, aiming to build on other primary health care initiatives to transform the previously segregated, inequitable services. Within these plans CPGs are an integral tool for delivering standardised and cost effective care. Currently, there is no accepted standard approach to developing, adapting or implementing CPGs efficiently or effectively in South Africa. We explored the current players; drivers; and the context and processes of primary care CPG development from the perspective of stakeholders operating at national level. We used a qualitative approach. Sampling was initially purposeful, followed by snowballing and further sampling to reach representivity of primary care service providers. Individual in-depth interviews were recorded and transcribed verbatim. We used thematic content analysis to analyse the data. We conducted 37 in-depth interviews from June 2014-July 2015. We found CPG development and implementation were hampered by lack of human and funding resources for technical and methodological work; fragmentation between groups, and between national and provincial health sectors; and lack of agreed systems for CPG development and implementation. Some CPG contributors steadfastly work to improve processes aiming to enhance communication, use of evidence, and transparency to ensure credible guidance is produced. Many interviewed had shared values, and were driven to address inequity, however, resource gaps were perceived to create an enabling environment for commercial interests or personal agendas to drive the CPG development process. Our findings identified strengths and gaps in CPG development processes, and a need for national standards to guide CPG development and implementation. Based on our findings and suggestions from participants, a possible way forward would be for South Africa to have a centrally coordinated CPG unit to address these needs and aspects of fragmentation by devising processes that support collaboration, transparency and credibility across sectors and disciplines. Such an initiative will require adequate resourcing to build capacity and ensure support for the delivery of high quality CPGs for South African primary care.

  8. Hydrocarbon pyrolysis reactor experimentation and modeling for the production of solar absorbing carbon nanoparticles

    NASA Astrophysics Data System (ADS)

    Frederickson, Lee Thomas

    Much of combustion research focuses on reducing soot particulates in emissions. However, current research at San Diego State University (SDSU) Combustion and Solar Energy Laboratory (CSEL) is underway to develop a high temperature solar receiver which will utilize carbon nanoparticles as a solar absorption medium. To produce carbon nanoparticles for the small particle heat exchange receiver (SPHER), a lab-scale carbon particle generator (CPG) has been built and tested. The CPG is a heated ceramic tube reactor with a set point wall temperature of 1100-1300°C operating at 5-6 bar pressure. Natural gas and nitrogen are fed to the CPG where natural gas undergoes pyrolysis resulting in carbon particles. The gas-particle mixture is met downstream with dilution air and sent to the lab scale solar receiver. To predict soot yield and general trends in CPG performance, a model has been setup in Reaction Design CHEMKIN-PRO software. One of the primary goals of this research is to accurately measure particle properties. Mean particle diameter, size distribution, and index of refraction are calculated using Scanning Electron Microscopy (SEM) and a Diesel Particulate Scatterometer (DPS). Filter samples taken during experimentation are analyzed to obtain a particle size distribution with SEM images processed in ImageJ software. These results are compared with the DPS, which calculates the particle size distribution and the index of refraction from light scattering using Mie theory. For testing with the lab scale receiver, a particle diameter range of 200-500 nm is desired. Test conditions are varied to understand effects of operating parameters on particle size and the ability to obtain the size range. Analysis of particle loading is the other important metric for this research. Particle loading is measured downstream of the CPG outlet and dilution air mixing point. The air-particle mixture flows through an extinction tube where opacity of the mixture is measured with a 532 nm laser and detector. Beer's law is then used to calculate particle loading. The CPG needs to produce a certain particle loading for a corresponding receiver test. By obtaining the particle loading in the system, the reaction conversion to solid carbon in the CPG can be calculated to measure the efficiency of the CPG. To predict trends in reaction conversion and particle size from experimentation, the CHEMKIN-PRO computer model for the CPG is run for various flow rates and wall temperature profiles. These predictions were a reason for testing at higher wall set point temperatures. Based on these research goals, it was shown that the CPG consistently produces a mean particle diameter of 200-400 nm at the conditions tested, fitting perfectly inside the desired range. This led to successful lab scale SPHER testing which produced a 10-point efficiency increase and 150°C temperature difference with particles present. Also, at 3 g/s dilution air flow rate, an efficiency of 80% at an outlet temperature above 800°C was obtained. Promise was shown at higher CPG experimental temperatures to produce higher reaction conversion, both experimentally and in the model. However, based on wall temperature data taken during experimentation, it is apparent that the CPG needs to have multiple heating zones with separate temperature controllers in order to have an isothermal zone rather than a parabolic temperature profile. As for the computer model, it predicted much higher reaction conversion at higher temperature. The mass fraction of fuel in the inlet stream was shown to not affect conversion while increasing residence time led to increasing conversion. Particle size distribution in the model was far off and showed a bimodal distribution for one of the statistical methods. Using the results from experimentation and modeling, a preliminary CPG design is presented that will operate in a 5MWth receiver system.

  9. Year 2000 (Y2K) computer compliance guide; guidance for FDA personnel. Food and Drug Administration. Notice.

    PubMed

    1999-05-14

    The Food and Drug Administration (FDA) is announcing the availability of a new compliance policy guide (CPG) entitled "Year 2000 (Y2K) Computer Compliance" (section 160-800). This guidance document represents the agency's current thinking on the manufacturing and distribution of domestic and imported products regulated by FDA using computer systems that may not perform properly before, or during, the transition to the year 2000 (Y2K). The text of the CPG is included in this notice. This compliance guidance document is an update to the Compliance Policy Guides Manual (August 1996 edition). It is a new CPG, and it will be included in the next printing of the Compliance Policy Guides Manual. This CPG is intended for FDA personnel, and it is available electronically to the public.

  10. CPG-inspired workspace trajectory generation and adaptive locomotion control for quadruped robots.

    PubMed

    Liu, Chengju; Chen, Qijun; Wang, Danwei

    2011-06-01

    This paper deals with the locomotion control of quadruped robots inspired by the biological concept of central pattern generator (CPG). A control architecture is proposed with a 3-D workspace trajectory generator and a motion engine. The workspace trajectory generator generates adaptive workspace trajectories based on CPGs, and the motion engine realizes joint motion imputes. The proposed architecture is able to generate adaptive workspace trajectories online by tuning the parameters of the CPG network to adapt to various terrains. With feedback information, a quadruped robot can walk through various terrains with adaptive joint control signals. A quadruped platform AIBO is used to validate the proposed locomotion control system. The experimental results confirm the effectiveness of the proposed control architecture. A comparison by experiments shows the superiority of the proposed method against the traditional CPG-joint-space control method.

  11. Association of Tissue-Specific DNA Methylation Alterations with α-Thalassemia Southeast Asian Deletion

    PubMed Central

    Pangeson, Tanapat; Sanguansermsri, Phanchana; Sanguansermsri, Torpong; Seeratanachot, Teerapat; Suwanakhon, Narutchala; Srikummool, Metawee; Kaewkong, Worasak; Mahingsa, Khwanruedee

    2017-01-01

    In the wild-type allele, DNA methylation levels of 10 consecutive CpG sites adjacent to the upstream 5′-breakpoint of α-thalassemia Southeast Asian (SEA) deletion are not different between placenta and leukocytes. However, no previous study has reported the map of DNA methylation in the SEA allele. This report aims to show that the SEA mutation is associated with DNA methylation changes, resulting in differential methylation between placenta and leukocytes. Methylation-sensitive high-resolution analysis was used to compare DNA methylation among placenta, leukocytes, and unmethylated control DNA. The result indicates that the DNA methylation between placenta and leukocyte DNA is different and shows that the CpG status of both is not fully unmethylated. Mapping of individual CpG sites was performed by targeted bisulfite sequencing. The DNA methylation level of the 10 consecutive CpG sites was different between placenta and leukocyte DNA. When the 10th CpG of the mutation allele was considered as a hallmark for comparing DNA methylation level, it was totally different from the unmethylated 10th CpG of the wild-type allele. Finally, the distinct DNA methylation patterns between both DNA were extracted. In total, 24 patterns were found in leukocyte samples and 9 patterns were found in placenta samples. This report shows that the large deletion is associated with DNA methylation change. In further studies for clinical application, the distinct DNA methylation pattern might be a potential marker for detecting cell-free fetal DNA. PMID:29162979

  12. A distinct group of CpG islands shows differential DNA methylation between replicas of the same cell line in vitro

    PubMed Central

    2013-01-01

    Background CpG dinucleotide-rich genomic DNA regions, known as CpG islands (CGIs), can be methylated at their cytosine residues as an epigenetic mark that is stably inherited during cell mitosis. Differentially methylated regions (DMRs) are genomic regions showing different degrees of DNA methylation in multiple samples. In this study, we focused our attention on CGIs showing different DNA methylation between two culture replicas of the same cell line. Results We used methylation data of 35 cell lines from the Encyclopedia of DNA Elements (ENCODE) consortium to identify CpG islands that were differentially methylated between replicas of the same cell line and denoted them Inter Replicas Differentially Methylated CpG islands (IRDM-CGIs). We identified a group of IRDM-CGIs that was consistently shared by different cell lines, and denoted it common IRDM-CGIs. X chromosome CGIs were overrepresented among common IRDM-CGIs. Autosomal IRDM-CGIs were preferentially located in gene bodies and intergenic regions had a lower G + C content, a smaller mean length, and a reduced CpG percentage. Functional analysis of the genes associated with autosomal IRDM-CGIs showed that many of them are involved in DNA binding and development. Conclusions Our results show that several specific functional and structural features characterize common IRDM-CGIs. They may represent a specific subset of CGIs that are more prone to being differentially methylated for their intrinsic characteristics. PMID:24106769

  13. The role of system Xc- in methamphetamine-induced dopaminergic neurotoxicity in mice.

    PubMed

    Dang, Duy-Khanh; Shin, Eun-Joo; Tran, Hai-Quyen; Kim, Dae-Joong; Jeong, Ji Hoon; Jang, Choon-Gon; Nah, Seung-Yeol; Sato, Hideyo; Nabeshima, Toshitaka; Yoneda, Yukio; Kim, Hyoung-Chun

    2017-09-01

    The cystine/glutamate antiporter (system Xc - , Sxc) transports cystine into cell in exchange for glutamate. Since xCT is a specific subunit of Sxc, we employed xCT knockout mice and investigated whether this antiporter affected methamphetamine (MA)-induced dopaminergic neurotoxicity. MA treatment significantly increased striatal oxidative burdens in wild type mice. xCT inhibitor [i.e., S-4-carboxy-phenylglycine (CPG), sulfasalazine] or an xCT knockout significantly protected against these oxidative burdens. MA-induced increases in Iba-1 expression and Iba-1-labeled microglial immunoreactivity (Iba-1-IR) were significantly attenuated by CPG or sulfasalazine administration or xCT knockout. CPG or sulfasalazine significantly attenuated MA-induced TUNEL-positive cell populations in the striatum of Taconic ICR mice. The decrease in excitatory amino acid transporter-2 (or glutamate transporter-1) expression and increase in glutamate release were attenuated by CPG, sulfasalazine or xCT knockout. In addition, CPG, sulfasalazine or xCT knockout significantly protected against dopaminergic loss (i.e., decreases in tyrosine hydroxylase expression and immunoreactivity, and an increase in dopamine turnover rate) induced by MA. However, CPG, sulfasalazine or xCT knockout did not significantly affect the impaired glutathione system [i.e., decrease in reduced glutathione (GSH) and increase in oxidized glutathione (GSSG)] induced by MA. Our results suggest that Sxc mediates MA-induced neurotoxicity via facilitating oxidative stress, microgliosis, proapoptosis, and glutamate-related toxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Critical Appraisal of International Clinical Practice Guidelines in Kidney Transplantation Using the Appraisal of Guidelines for Research and Education (AGREE) II Tool: A Systematic Review.

    PubMed

    OʼDonoghue, Katriona Jane Marie; Reed, Rhiannon D; Knight, Simon R; O'Callaghan, John M; Ayaz-Shah, Anam A; Hassan, Sevda; Weissenbacher, Annemarie; Morris, Peter J; Pengel, Liset H M

    2018-05-22

    Whilst Clinical Practice Guidelines (CPGs) are used for the development of local protocols in kidney transplantation (Ktx), the quality of their methodology is variable. This systematic review aimed to critically appraise international CPGs in all aspects of Ktx using the Appraisal of Guidelines for Research and Evaluation (AGREE) II tool. CPGs in Ktx and donation published between 2010 and 2017 were identified from MEDLINE, Embase, National Guideline Clearinghouse, NHS and NICE Evidence Searches, and the websites of transplant societies. Using AGREE II, 3 appraisers assessed the quality of CPGs. Interrater reliability was measured using the intraclass correlation coefficient (ICC). Searches identified 3,168 records and 115 CPGs were included. The highest scoring AGREE II domain was 'Scope and Purpose' (80%; Range 30-100%), followed by 'Clarity of Presentation' (77%; Range 43-98%), 'Editorial independence' (52%; Range 0-94%), 'Rigour of Development' (47%; Range 6-97%) and 'Stakeholder Involvement' (41%; Range 11-85%). The poorest scoring domain was 'Applicability' (31%; Range 3-74%). Most CPGs were recommended for future use either with (63%) or without modifications (18%). A small number were not recommended for future use (14%) or reviewers did not agree on recommending the CPG (5%). The overall mean CPG quality score was 4 out of 7 (Range 2-7). The mean ICC of 0.74 indicated substantial agreement between reviewers. The quality of international CPGs in Ktx was variable, and most CPGs lacked key aspects of methodological robustness and transparency. Improvements in methodology, patient involvement and strategies for implementation are required.

  15. The Cambridge Prognostic Groups for improved prediction of disease mortality at diagnosis in primary non-metastatic prostate cancer: a validation study.

    PubMed

    Gnanapragasam, V J; Bratt, O; Muir, K; Lee, L S; Huang, H H; Stattin, P; Lophatananon, A

    2018-02-28

    The purpose of this study is to validate a new five-tiered prognostic classification system to better discriminate cancer-specific mortality in men diagnosed with primary non-metastatic prostate cancer. We applied a recently described five-strata model, the Cambridge Prognostic Groups (CPGs 1-5), in two international cohorts and tested prognostic performance against the current standard three-strata classification of low-, intermediate- or high-risk disease. Diagnostic clinico-pathological data for men obtained from the Prostate Cancer data Base Sweden (PCBaSe) and the Singapore Health Study were used. The main outcome measure was prostate cancer mortality (PCM) stratified by age group and treatment modality. The PCBaSe cohort included 72,337 men, of whom 7162 died of prostate cancer. The CPG model successfully classified men with different risks of PCM with competing risk regression confirming significant intergroup distinction (p < 0.0001). The CPGs were significantly better at stratified prediction of PCM compared to the current three-tiered system (concordance index (C-index) 0.81 vs. 0.77, p < 0.0001). This superiority was maintained for every age group division (p < 0.0001). Also in the ethnically different Singapore cohort of 2550 men with 142 prostate cancer deaths, the CPG model outperformed the three strata categories (C-index 0.79 vs. 0.76, p < 0.0001). The model also retained superior prognostic discrimination in the treatment sub-groups: radical prostatectomy (n = 20,586), C-index 0.77 vs. 074; radiotherapy (n = 11,872), C-index 0.73 vs. 0.69; and conservative management (n = 14,950), C-index 0.74 vs. 0.73. The CPG groups that sub-divided the old intermediate-risk (CPG2 vs. CPG3) and high-risk categories (CPG4 vs. CPG5) significantly discriminated PCM outcomes after radical therapy or conservative management (p < 0.0001). This validation study of nearly 75,000 men confirms that the CPG five-tiered prognostic model has superior discrimination compared to the three-tiered model in predicting prostate cancer death across different age and treatment groups. Crucially, it identifies distinct sub-groups of men within the old intermediate-risk and high-risk criteria who have very different prognostic outcomes. We therefore propose adoption of the CPG model as a simple-to-use but more accurate prognostic stratification tool to help guide management for men with newly diagnosed prostate cancer.

  16. Successful Therapy of Murine Visceral Leishmaniasis with Astrakurkurone, a Triterpene Isolated from the Mushroom Astraeus hygrometricus, Involves the Induction of Protective Cell-Mediated Immunity and TLR9

    PubMed Central

    Mallick, Suvadip; Dutta, Aritri; Chaudhuri, Ankur; Mukherjee, Debasri; Dey, Somaditya; Halder, Subhadra; Ghosh, Joydip; Mukherjee, Debarati; Sultana, Sirin Salma; Biswas, Gunjan; Lai, Tapan Kumar; Patra, Pradyumna; Sarkar, Indranil; Chakraborty, Sibani; Saha, Bhaskar; Acharya, Krishnendu

    2016-01-01

    In our previous report, we showed that astrakurkurone, a triterpene isolated from the Indian mushroom Astraeus hygrometricus (Pers.) Morgan, induced reactive oxygen species, leading to apoptosis in Leishmania donovani promastigotes, and also was effective in inhibiting intracellular amastigotes at the 50% inhibitory concentration of 2.5 μg/ml. The aim of the present study is to characterize the associated immunomodulatory potentials and cellular activation provided by astrakurkurone, leading to effective antileishmanial activity in vitro and in vivo. Astrakurkurone-mediated antileishmanial activity was evaluated by real-time PCR and flow cytometry. The involvement of Toll-like receptor 9 (TLR9) was studied by in vitro assay in the presence of a TLR9 agonist and antagonist and by in silico modeling of a three-dimensional structure of the ectodomain of TLR9 and its interaction with astrakurkurone. Astrakurkurone caused a significant increase in TLR9 expression of L. donovani-infected macrophages along with the activation of proinflammatory responses. The involvement of TLR9 in astrakurkurone-mediated amastigote killing has been evidenced from the fact that a TLR9 agonist (CpG, ODN 1826) in combination with astrakurkurone enhanced the amastigote killing, while a TLR9 antagonist (bafilomycin A1) alone or in combination with astrakurkurone curbed the amastigote killing, which could be further justified by in silico evidence of docking between mouse TLR9 and astrakurkurone. Astrakurkurone was found to reduce the parasite burden in vivo by inducing protective cytokines, gamma interferon and interleukin 17. Moreover, astrakurkurone was nontoxic toward peripheral blood mononuclear cells of immunocompromised patients with visceral leishmaniasis. Astrakurkurone, a nontoxic antileishmanial, enhances the immune efficiency of host cells, leading to parasite clearance in vitro and in vivo. PMID:26883702

  17. IRAK4 as a molecular target in the amelioration of innate immunity-related endotoxic shock and acute liver injury by chlorogenic acid.

    PubMed

    Park, Sun Hong; Baek, Seung-Il; Yun, Jieun; Lee, Seungmin; Yoon, Da Young; Jung, Jae-Kyung; Jung, Sang-Hun; Hwang, Bang Yeon; Hong, Jin Tae; Han, Sang-Bae; Kim, Youngsoo

    2015-02-01

    Mice lacking the IL-1R-associated kinase 4 (IRAK4) are completely resistant to LPS-induced endotoxic disorder or the TLR9 agonist CpG DNA plus d-galactosamine-induced acute liver injury (ALI), whereas wild-type strains succumb. However, translational drugs against sepsis or ALI remain elusive. Lonicerae flos extract is undergoing the clinical trial phase I in LPS-injected healthy human volunteers for sepsis treatment. In the current study, chlorogenic acid (CGA), a major anti-inflammatory constituent of lonicerae flos extract, rescued endotoxic mortality of LPS-intoxicated C57BL/6 mice, as well as ameliorated ALI of LPS/d-galactosamine-challenged C57BL/6 mice. As a mechanism, CGA inhibited various TLR agonist-, IL-1α-, or high-mobility group box-1-stimulated autophosphorylation (activation) of IRAK4 in peritoneal macrophages from C57BL/6 or C3H/HeJ mice via directly affecting the kinase activity of IRAK4, a proximal signal transducer in the MyD88-mediated innate immunity that enhances transcriptional activity of NF-κB or AP-1. CGA consequently attenuated protein or mRNA levels of NF-κB/AP-1 target genes encoding TNF-α, IL-1α, IL-6, and high-mobility group box-1 in vivo under endotoxemia or ALI. Finally, this study suggests IRAK4 as a molecular target of CGA in the treatment of innate immunity-related shock and organ dysfunction following insult of various TLR pathogens from bacteria and viruses. Copyright © 2015 by The American Association of Immunologists, Inc.

  18. TLR9 agonists oppositely modulate DNA repair genes in tumor versus immune cells and enhance chemotherapy effects.

    PubMed

    Sommariva, Michele; De Cecco, Loris; De Cesare, Michelandrea; Sfondrini, Lucia; Ménard, Sylvie; Melani, Cecilia; Delia, Domenico; Zaffaroni, Nadia; Pratesi, Graziella; Uva, Valentina; Tagliabue, Elda; Balsari, Andrea

    2011-10-15

    Synthetic oligodeoxynucleotides expressing CpG motifs (CpG-ODN) are a Toll-like receptor 9 (TLR9) agonist that can enhance the antitumor activity of DNA-damaging chemotherapy and radiation therapy in preclinical mouse models. We hypothesized that the success of these combinations is related to the ability of CpG-ODN to modulate genes involved in DNA repair. We conducted an in silico analysis of genes implicated in DNA repair in data sets obtained from murine colon carcinoma cells in mice injected intratumorally with CpG-ODN and from splenocytes in mice treated intraperitoneally with CpG-ODN. CpG-ODN treatment caused downregulation of DNA repair genes in tumors. Microarray analyses of human IGROV-1 ovarian carcinoma xenografts in mice treated intraperitoneally with CpG-ODN confirmed in silico findings. When combined with the DNA-damaging drug cisplatin, CpG-ODN significantly increased the life span of mice compared with individual treatments. In contrast, CpG-ODN led to an upregulation of genes involved in DNA repair in immune cells. Cisplatin-treated patients with ovarian carcinoma as well as anthracycline-treated patients with breast cancer who are classified as "CpG-like" for the level of expression of CpG-ODN modulated DNA repair genes have a better outcome than patients classified as "CpG-untreated-like," indicating the relevance of these genes in the tumor cell response to DNA-damaging drugs. Taken together, the findings provide evidence that the tumor microenvironment can sensitize cancer cells to DNA-damaging chemotherapy, thereby expanding the benefits of CpG-ODN therapy beyond induction of a strong immune response.

  19. Direct Toll-like receptor-mediated stimulation of hematopoietic stem and progenitor cells occurs in vivo and promotes differentiation toward macrophages.

    PubMed

    Megías, Javier; Yáñez, Alberto; Moriano, Silvia; O'Connor, José-Enrique; Gozalbo, Daniel; Gil, María-Luisa

    2012-07-01

    As Toll-like receptors (TLRs) are expressed by hematopoietic stem and progenitor cells (HSPCs), they may play a role in hematopoiesis in response to pathogens during infection. We show here that TLR2, TLR4, and TLR9 agonists (tripalmitoyl-S-glyceryl-L-Cys-Ser-(Lys)4 [Pam3CSK4], lipopolysaccharide [LPS], and CpG oligodeoxynucleotide [ODN]) induce the in vitro differentiation of purified murine lineage negative cells (Lin(-) ) as well as HSPCs (identified as Lin(-) c-Kit(+) Sca-1(+) IL-7Rα(-) [LKS] cells) toward macrophages (Mph), through a myeloid differentiation factor 88 (MyD88)-dependent pathway. In order to investigate the possible direct interaction of soluble microorganism-associated molecular patterns and TLRs on HSPCs in vivo, we designed a new experimental approach: purified Lin(-) and LKS cells from bone marrow of B6Ly5.1 mice (CD45.1 alloantigen) were transplanted into TLR2(-/-) , TLR4(-/-) , or MyD88(-/-) mice (CD45.2 alloantigen), which were then injected with soluble TLR ligands (Pam3CSK4, LPS, or ODN, respectively). As recipient mouse cells do not recognize the TLR ligands injected, interference by soluble mediators secreted by recipient cells is negligible. Transplanted cells were detected in the spleen and bone marrow of recipient mice, and in response to soluble TLR ligands, cells differentiated preferentially to Mph. These results show, for the first time, that HSPCs may be directly stimulated by TLR agonists in vivo, and that the engagement of these receptors induces differentiation toward Mph. Therefore, HSPCs may sense pathogen or pathogen-derived products directly during infection, inducing a rapid generation of cells of the innate immune system. Copyright © 2012 AlphaMed Press.

  20. Developing prehospital clinical practice guidelines for resource limited settings: why re-invent the wheel?

    PubMed

    McCaul, Michael; de Waal, Ben; Hodkinson, Peter; Pigoga, Jennifer L; Young, Taryn; Wallis, Lee A

    2018-02-05

    Methods on developing new (de novo) clinical practice guidelines (CPGs) have received substantial attention. However, the volume of literature is not matched by research into alternative methods of CPG development using existing CPG documents-a specific issue for guideline development groups in low- and middle-income countries. We report on how we developed a context specific prehospital CPG using an alternative guideline development method. Difficulties experienced and lessons learnt in applying existing global guidelines' recommendations to a national context are highlighted. The project produced the first emergency care CPG for prehospital providers in Africa. It included > 270 CPGs and produced over 1000 recommendations for prehospital emergency care. We encountered various difficulties, including (1) applicability issues: few pre-hospital CPGs applicable to Africa, (2) evidence synthesis: heterogeneous levels of evidence classifications and (3) guideline quality. Learning points included (1) focusing on key CPGs and evidence mapping, (2) searching other resources for CPGs, (3) broad representation on CPG advisory boards and (4) transparency and knowledge translation. Re-inventing the wheel to produce CPGs is not always feasible. We hope this paper will encourage further projects to use existing CPGs in developing guidance to improve patient care in resource-limited settings.

  1. Decreased interferon-α production in response to CpG DNA dysregulates cytokine responses in patients with multiple sclerosis.

    PubMed

    Hirotani, Makoto; Niino, Masaaki; Fukazawa, Toshiyuki; Yaguchi, Hiroaki; Nakamura, Masakazu; Kikuchi, Seiji; Sasaki, Hidenao

    2012-05-01

    Type I interferons (IFNs), represented by IFN-α and β, activate immune effector cells belonging to the innate and adaptive immune systems. Plasmacytoid dendritic cells (pDCs) produce IFN-α in response to CpG DNA. We aimed to examine the impact of pDC-produced IFN-α on the adaptive immune system in Multiple Sclerosis (MS). Our results demonstrated that CpG DNA-induced IFN-α production was significantly decreased in PBMCs from MS patients. Decreased levels of IL-12 p70, IFN-γ, and IL-17 and increased level of IL-10 were found in CpG DNA-treated PBMCs of healthy subjects unlike in those from MS patients. In samples pre-treated with IFN-α and IFN-β, decreased levels of IL-12 p70, IFN-γ, and IL-17 and increased level of IL-10 were detected in PBMCs from MS patients. These results suggest that CpG DNA-induced decreased IFN-α production causes pro-inflammatory cytokine secretion, and either IFN-α or IFN-β induces anti-inflammatory cytokine secretion in the adaptive immune system in MS. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. Simulation design of high reverse blocking high-K/low-K compound passivation AlGaN/GaN Schottky barrier diode with gated edge termination

    NASA Astrophysics Data System (ADS)

    Bai, Zhiyuan; Du, Jiangfeng; Xin, Qi; Li, Ruonan; Yu, Qi

    2017-11-01

    In this paper, a novel high-K/low-K compound passivation AlGaN/GaN Schottky Barrier Diode (CPG-SBD) is proposed to improve the off-state characteristics of AlGaN/GaN schottky barrier diode with gated edge termination (GET-SBD) by adding low-K blocks in to the high-K passivation layer. The reverse leakage current of CPG-SBD can be reduced to 1.6 nA/mm by reducing the thickness of high-K dielectric under GET region to 5 nm, while the forward voltage and on-state resistance keep 1 V and 3.8 Ω mm, respectively. Breakdown voltage of CPG-SBDs can be improved by inducing discontinuity of the electric field at the high-K/low-K interface. The breakdown voltage of the optimized CPG-SBD with 4 blocks of low-K can reach 1084 V with anode to cathode distance of 5 μm yielding a high FOM of 5.9 GW/cm2. From the C-V simulation results, CPG-SBDs induce no parasitic capacitance by comparison of the GET-SBDs.

  3. Hypermethylation of brain natriuretic peptide gene is associated with the risk of rheumatic heart disease

    PubMed Central

    Li, Ni; Zheng, Dawei; Sun, Lebo; Shi, Huoshun; Zhu, Xiuying; Xu, Guodong; Wang, Qinning; Zhu, Caimin

    2016-01-01

    To investigate the contribution of brain natriuretic peptide (BNP) promoter DNA methylation to the risk of rheumatic heart disease (RHD) and the influence of warfarin anticoagulant therapy on BNP methylation levels for RHD patients after surgery. BNP methylation levels were determined by bisulfite pyrosequencing from plasma samples of RHD patients compared with healthy controls. Several factors influencing the RHD patients were included like age, smoking and cholesterol levels. A fragment of five CG sites (CpG1–5) in the promoter region of BNP gene was measured. BNP gene hypermethylation was found in CpG4 and CpG5 in RHD patients compared with non-RHD controls. A significant difference was also observed between RHD patients with long-term administration of warfarin and RHD patients who had recently undergone an operation. Moreover, single CpG4 and CpG5 analysis revealed a significant increase in methylation levels in men. BNP gene body hypermethylation is associated with the risk of RHD, and also influenced by the warfarin anticoagulant therapy of RHD patients after surgery, which could represent novel and promising targets for therapeutic development. PMID:27920275

  4. Compositional searching of CpG islands in the human genome

    NASA Astrophysics Data System (ADS)

    Luque-Escamilla, Pedro Luis; Martínez-Aroza, José; Oliver, José L.; Gómez-Lopera, Juan Francisco; Román-Roldán, Ramón

    2005-06-01

    We report on an entropic edge detector based on the local calculation of the Jensen-Shannon divergence with application to the search for CpG islands. CpG islands are pieces of the genome related to gene expression and cell differentiation, and thus to cancer formation. Searching for these CpG islands is a major task in genetics and bioinformatics. Some algorithms have been proposed in the literature, based on moving statistics in a sliding window, but its size may greatly influence the results. The local use of Jensen-Shannon divergence is a completely different strategy: the nucleotide composition inside the islands is different from that in their environment, so a statistical distance—the Jensen-Shannon divergence—between the composition of two adjacent windows may be used as a measure of their dissimilarity. Sliding this double window over the entire sequence allows us to segment it compositionally. The fusion of those segments into greater ones that satisfy certain identification criteria must be achieved in order to obtain the definitive results. We find that the local use of Jensen-Shannon divergence is very suitable in processing DNA sequences for searching for compositionally different structures such as CpG islands, as compared to other algorithms in literature.

  5. Effect of alcohol consumption on CpG methylation in the differentially methylated regions of H19 and IG-DMR in male gametes: implications for fetal alcohol spectrum disorders.

    PubMed

    Ouko, Lillian A; Shantikumar, Katpaham; Knezovich, Jaysen; Haycock, Philip; Schnugh, Desmond J; Ramsay, Michèle

    2009-09-01

    Exposure to alcohol in utero is the main attributable cause of fetal alcohol spectrum disorders (FASD) which in its most severe form is characterized by irreversible behavioral and cognitive disability. Paternal preconception drinking is not considered to be a significant risk factor, even though animal studies have demonstrated that chronic paternal alcohol consumption has a detrimental effect on the physical and mental development of offspring even in the absence of in utero alcohol exposure. It has been documented that alcohol can reduce the levels and activity of DNA methyltransferases resulting in DNA hypomethylation and that reduced methyltransferase activity can cause activation of normally silenced genes. The aim of this study was to establish a link between alcohol use in men and hypomethylation of paternally imprinted loci in sperm DNA in genomic regions critical for embryonic development, thus providing a mechanism for paternal effects in the aetiology of FASD. Sperm DNA from male volunteers was bisulfite treated and the methylation patterns of 2 differentially methylated regions (DMRs), H19 and IG-DMR, analyzed following sequencing of individual clones. The methylation patterns were correlated with the alcohol consumption levels of the volunteer males. There was a pattern of increased demethylation with alcohol consumption at the 2 imprinted loci with a significant difference observed at the IG-DMR between the nondrinking and heavy alcohol consuming groups. Greater inter-individual variation in average methylation was observed at the H19 DMR and individual clones were more extensively demethylated than those of the IG-DMR. CpG site #4 in the IG-DMR was preferentially demethylated among all individuals and along with the H19 DMR CpG site #7 located within the CTCF binding site 6 showed significant demethylation in the alcohol consuming groups compared with the control group. This study demonstrates a correlation between chronic alcohol use and demethylation of normally hypermethylated imprinted regions in sperm DNA. We hypothesize that, should these epigenetic changes in imprinted genes be transmitted through fertilization, they would alter the critical gene expression dosages required for normal prenatal development resulting in offspring with features of FASD.

  6. Genome-Wide Assessment of Differential DNA Methylation Associated with Autoantibody Production in Systemic Lupus Erythematosus.

    PubMed

    Chung, Sharon A; Nititham, Joanne; Elboudwarej, Emon; Quach, Hong L; Taylor, Kimberly E; Barcellos, Lisa F; Criswell, Lindsey A

    2015-01-01

    Systemic lupus erythematosus (SLE) is characterized by the development of autoantibodies associated with specific clinical manifestations. Previous studies have shown an association between differential DNA methylation and SLE susceptibility, but have not investigated SLE-related autoantibodies. Our goal was to determine whether DNA methylation is associated with production of clinically relevant SLE-related autoantibodies, with an emphasis on the anti-dsDNA autoantibody. In this study, we characterized the methylation status of 467,314 CpG sites in 326 women with SLE. Using a discovery and replication study design, we identified and replicated significant associations between anti-dsDNA autoantibody production and the methylation status of 16 CpG sites (pdiscovery<1.07E-07 and preplication<0.0029) in 11 genes. Associations were further investigated using multivariable regression to adjust for estimated leukocyte cell proportions and population substructure. The adjusted mean DNA methylation difference between anti-dsDNA positive and negative cases ranged from 1.2% to 19%, and the adjusted odds ratio for anti-dsDNA autoantibody production comparing the lowest and highest methylation tertiles ranged from 6.8 to 18.2. Differential methylation for these CpG sites was also associated with anti-SSA, anti-Sm, and anti-RNP autoantibody production. Overall, associated CpG sites were hypomethylated in autoantibody positive compared to autoantibody negative cases. Differential methylation of CpG sites within the major histocompatibility region was not strongly associated with autoantibody production. Genes with differentially methylated CpG sites represent multiple biologic pathways, and have not been associated with autoantibody production in genetic association studies. In conclusion, hypomethylation of CpG sites within genes from different pathways is associated with anti-dsDNA, anti-SSA, anti-Sm, and anti-RNP production in SLE, and these associations are not explained by genetic variation. Thus, studies of epigenetic mechanisms such as DNA methylation represent a complementary method to genetic association studies to identify biologic pathways that may contribute to the clinical heterogeneity of autoimmune diseases.

  7. Asymmetric Operation of the Locomotor Central Pattern Generator in the Neonatal Mouse Spinal Cord

    PubMed Central

    Endo, Toshiaki; Kiehn, Ole

    2008-01-01

    The rhythmic voltage oscillations in motor neurons (MNs) during locomotor movements reflect the operation of the pre-MN central pattern generator (CPG) network. Recordings from MNs can thus be used as a method to deduct the organization of CPGs. Here, we use continuous conductance measurements and decomposition methods to quantitatively assess the weighting and phase tuning of synaptic inputs to different flexor and extensor MNs during locomotor-like activity in the isolated neonatal mice lumbar spinal cord preparation. Whole cell recordings were obtained from 22 flexor and 18 extensor MNs in rostral and caudal lumbar segments. In all flexor and the large majority of extensor MNs the extracted excitatory and inhibitory synaptic conductances alternate but with a predominance of inhibitory conductances, most pronounced in extensors. These conductance changes are consistent with a “push–pull” operation of locomotor CPG. The extracted excitatory and inhibitory synaptic conductances varied between 2 and 56% of the mean total conductance. Analysis of the phase tuning of the extracted synaptic conductances in flexor and extensor MNs in the rostral lumbar cord showed that the flexor-phase–related synaptic conductance changes have sharper locomotor-phase tuning than the extensor-phase–related conductances, suggesting a modular organization of premotor CPG networks consisting of reciprocally coupled, but differently composed, flexor and extensor CPG networks. There was a clear difference between phase tuning in rostral and caudal MNs, suggesting a distinct operation of CPG networks in different lumbar segments. The highly asymmetric features were preserved throughout all ranges of locomotor frequencies investigated and with different combinations of locomotor-inducing drugs. The asymmetric nature of CPG operation and phase tuning of the conductance profiles provide important clues to the organization of the rodent locomotor CPG and are compatible with a multilayered and distributed structure of the network. PMID:18829847

  8. Nullomers and High Order Nullomers in Genomic Sequences

    PubMed Central

    Vergni, Davide; Santoni, Daniele

    2016-01-01

    A nullomer is an oligomer that does not occur as a subsequence in a given DNA sequence, i.e. it is an absent word of that sequence. The importance of nullomers in several applications, from drug discovery to forensic practice, is now debated in the literature. Here, we investigated the nature of nullomers, whether their absence in genomes has just a statistical explanation or it is a peculiar feature of genomic sequences. We introduced an extension of the notion of nullomer, namely high order nullomers, which are nullomers whose mutated sequences are still nullomers. We studied different aspects of them: comparison with nullomers of random sequences, CpG distribution and mean helical rise. In agreement with previous results we found that the number of nullomers in the human genome is much larger than expected by chance. Nevertheless antithetical results were found when considering a random DNA sequence preserving dinucleotide frequencies. The analysis of CpG frequencies in nullomers and high order nullomers revealed, as expected, a high CpG content but it also highlighted a strong dependence of CpG frequencies on the dinucleotide position, suggesting that nullomers have their own peculiar structure and are not simply sequences whose CpG frequency is biased. Furthermore, phylogenetic trees were built on eleven species based on both the similarities between the dinucleotide frequencies and the number of nullomers two species share, showing that nullomers are fairly conserved among close species. Finally the study of mean helical rise of nullomers sequences revealed significantly high mean rise values, reinforcing the hypothesis that those sequences have some peculiar structural features. The obtained results show that nullomers are the consequence of the peculiar structure of DNA (also including biased CpG frequency and CpGs islands), so that the hypermutability model, also taking into account CpG islands, seems to be not sufficient to explain nullomer phenomenon. Finally, high order nullomers could emphasize those features that already make simple nullomers useful in several applications. PMID:27906971

  9. Design and pilot evaluation of a system to develop computer-based site-specific practice guidelines from decision models.

    PubMed

    Sanders, G D; Nease, R F; Owens, D K

    2000-01-01

    Local tailoring of clinical practice guidelines (CPGs) requires experts in medicine and evidence synthesis unavailable in many practice settings. The authors' computer-based system enables developers and users to create, disseminate, and tailor CPGs, using normative decision models (DMs). ALCHEMIST, a web-based system, analyzes a DM, creates a CPG in the form of an annotated algorithm, and displays for the guideline user the optimal strategy. ALCHEMIST'S interface enables remote users to tailor the guideline by changing underlying input variables and observing the new annotated algorithm that is developed automatically. In a pilot evaluation of the system, a DM was used to evaluate strategies for staging non-small-cell lung cancer. Subjects (n = 15) compared the automatically created CPG with published guidelines for this staging and critiqued both using a previously developed instrument to rate the CPGs' usability, accountability, and accuracy on a scale of 0 (worst) to 2 (best), with higher scores reflecting higher quality. The mean overall score for the ALCHEMIST CPG was 1.502, compared with the published-CPG score of 0.987 (p = 0.002). The ALCHEMIST CPG scores for usability, accountability, and accuracy were 1.683, 1.393, and 1.430, respectively; the published CPG scores were 1.192, 0.941, and 0.830 (each comparison p < 0.05). On a scale of 1 (worst) to 5 (best), users' mean ratings of ALCHEMIST'S ease of use, usefulness of content, and presentation format were 4.76, 3.98, and 4.64, respectively. The results demonstrate the feasibility of a web-based system that automatically analyzes a DM and creates a CPG as an annotated algorithm, enabling remote users to develop site-specific CPGs. In the pilot evaluation, the ALCHEMIST guidelines met established criteria for quality and compared favorably with national CPGs. The high usability and usefulness ratings suggest that such systems can be a good tool for guideline development.

  10. DNA Methylation at the DAT Promoter and Risk for Psychopathology: Intergenerational Transmission between School-Age Youths and Their Parents in a Community Sample.

    PubMed

    Cimino, Silvia; Cerniglia, Luca; Ballarotto, Giulia; Marzilli, Eleonora; Pascale, Esterina; D'Addario, Claudio; Adriani, Walter; Tambelli, Renata

    2017-01-01

    The effect of gene polymorphisms and promoter methylation, associated with maladaptive developmental outcomes, vary depending on environmental factors (e.g., parental psychopathology). Most studies have focused on 0- to 5-year-old children, adolescents, or adults, whereas there is dearth of research on school-age youths and pre-adolescents. In a sample of 21 families recruited at schools, we addressed parents' psychopathological symptoms (through SCL-90-R); offspring emotional-behavioral functioning (through CBCL-6-18); dopamine transporter gene (DAT1) for epigenetic status of the 5'-untranslated region (UTR) and for genotype, i.e., variable number of tandem repeats polymorphism at the 3'-UTR. Possible associations were explored between bio-genetic and psychological characteristics within the same individual and between triplets of children, mothers, and fathers. DAT methylation of CpG at positions M1, M6, and M7 in mothers was correlated with maternal (phobic) anxiety, whereas in fathers' position M6 was related to paternal depression, anxiety, hostility, psychoticism, and higher Global Severity Index (GSI). No significant correlations were found between maternal and offspring DAT methylation. Significant correlations were found between fathers' methylation at CpG M1 and children's methylation at CpG M6. Linear regressions showed that mothers and fathers' GSI predicted children's methylation at CpG sites M2, M3, and M6, whereas fathers' GSI predicted children's methylation at CpG sites, particularly M1, M2, and M6. Moreover, offspring methylation of DAT at CpG M2 predicted somatic complaint, internalizing and attention problems; methylation of DAT at CpG M6 predicted withdraw. This study may have important clinical implication for the prevention and treatment of emotional-behavioral difficulties in children, as it adds to previous knowledge about the role of genetic and environmental factors in predicting psychopathological symptoms within non-clinical populations.

  11. Conserved Role of Intragenic DNA Methylation in Regulating Alternative Promoters

    PubMed Central

    Maunakea, Alika K.; Nagarajan, Raman P.; Bilenky, Mikhail; Ballinger, Tracy J.; D’Souza, Cletus; Fouse, Shaun D.; Johnson, Brett E.; Hong, Chibo; Nielsen, Cydney; Zhao, Yongjun; Turecki, Gustavo; Delaney, Allen; Varhol, Richard; Thiessen, Nina; Shchors, Ksenya; Heine, Vivi M.; Rowitch, David H.; Xing, Xiaoyun; Fiore, Chris; Schillebeeckx, Maximiliaan; Jones, Steven J.M.; Haussler, David; Marra, Marco A.; Hirst, Martin; Wang, Ting; Costello, Joseph F.

    2014-01-01

    While the methylation of DNA in 5′ promoters suppresses gene expression, the role of DNA methylation in gene bodies is unclear1–5. In mammals, tissue- and cell type-specific methylation is present in a small percentage of 5′ CpG island (CGI) promoters, while a far greater proportion occurs across gene bodies, coinciding with highly conserved sequences5–10. Tissue-specific intragenic methylation might reduce,3 or, paradoxically, enhance transcription elongation efficiency1,2,4,5. Capped analysis of gene expression (CAGE) experiments also indicate that transcription commonly initiates within and between genes11–15. To investigate the role of intragenic methylation, we generated a map of DNA methylation from human brain encompassing 24.7 million of the 28 million CpG sites. From the dense, high-resolution coverage of CpG islands, the majority of methylated CpG islands were revealed to be in intragenic and intergenic regions, while less than 3% of CpG islands in 5′ promoters were methylated. The CpG islands in all three locations overlapped with RNA markers of transcription initiation, and unmethylated CpG islands also overlapped significantly with trimethylation of H3K4, a histone modification enriched at promoters16. The general and CpG-island-specific patterns of methylation are conserved in mouse tissues. An in-depth investigation of the human SHANK3 locus17,18 and its mouse homologue demonstrated that this tissue-specific DNA methylation regulates intragenic promoter activity in vitro and in vivo. These methylation-regulated, alternative transcripts are expressed in a tissue and cell type-specific manner, and are expressed differentially within a single cell type from distinct brain regions. These results support a major role for intragenic methylation in regulating cell context-specific alternative promoters in gene bodies. PMID:20613842

  12. Immunization of Aged Pigs with Attenuated Pseudorabies Virus Vaccine Combined with CpG Oligodeoxynucleotide Restores Defective Th1 Immune Responses

    PubMed Central

    Chu, Pinpin; Ma, Miaopeng; Shi, Juqing; Cai, Haiming; Huang, Chaoyuan; Li, Huazhou; Jiang, Zhenggu; Wang, Houguang; Wang, Weifang; Zhang, Shuiqing; Zhang, Linghua

    2013-01-01

    Background and Aims Attempts to immunize aged subjects often result in the failure to elicit a protective immune response. Murine model studies have shown that oligonucleotides containing CpG motifs (CpG ODN) can stimulate immune system in aged mice as effectively as in young mice. Since many physiological and pathophysiological data of pigs can be transferred to humans, research in pigs is important to confirm murine data. Here we investigated whether immunization of aged pig model with attenuated pseudorabies virus vaccine (PRV vaccine) formulated with CpG ODN could promote a successful development of immune responses that were comparable to those induced in young pigs in a similar manner. Methodology Young and aged pigs were immunized IM with PRV vaccine alone, or in combination with CpG ODN respectively. At days 3, 7, 14 post immunization sera were assayed by ELISA for IgG titres, at day 7 for IgG1 and IgG2 subtypes titres. All blood samples collected in evacuated test tubes with K-EDTA at day 7 were analyzed for flow cytometer assay. Blood samples at day 7 collected in evacuated test tubes with heparin were analysed for antigen-specific cytokines production and peripheral blood mononuclear cells (PBMCs) proliferative responses. Results CpG ODN could enhance Th1 responses (PRV-specific IgG2/IgG1 ratio, proliferative responses, Th1 cytokines production) when used as an adjuvant for the vaccination of aged pigs, which were correlated with enhanced CD4+ T cells percentage, decreased CD4+CD8+CD45RO+ T cells percentage and improved PRV-specific CD4+ T cells activation. Conclusions Our results demonstrate a utility for CpG ODN, as a safe vaccine adjuvant for promoting effective systemic immune responses in aged pig model. This agent could have important clinical uses in overcoming some of age-associated depressions in immune function that occur in response to vaccination. PMID:23785433

  13. Generalized concentration addition: a method for examining mixtures containing partial agonists.

    PubMed

    Howard, Gregory J; Webster, Thomas F

    2009-08-07

    Environmentally relevant toxic exposures often consist of simultaneous exposure to multiple agents. Methods to predict the expected outcome of such combinations are critical both to risk assessment and to an accurate judgment of whether combinations are synergistic or antagonistic. Concentration addition (CA) has commonly been used to assess the presence of synergy or antagonism in combinations of similarly acting chemicals, and to predict effects of combinations of such agents. CA has the advantage of clear graphical interpretation: Curves of constant joint effect (isoboles) must be negatively sloped straight lines if the mixture is concentration additive. However, CA cannot be directly used to assess combinations that include partial agonists, although such agents are of considerable interest. Here, we propose a natural extension of CA to a functional form that may be applied to mixtures including full agonists and partial agonists. This extended definition, for which we suggest the term "generalized concentration addition," encompasses linear isoboles with slopes of any sign. We apply this approach to the simple example of agents with dose-response relationships described by Hill functions with slope parameter n=1. The resulting isoboles are in all cases linear, with negative, zero and positive slopes. Using simple mechanistic models of ligand-receptor systems, we show that the same isobole pattern and joint effects are generated by modeled combinations of full and partial agonists. Special cases include combinations of two full agonists and a full agonist plus a competitive antagonist.

  14. Automating Guidelines for Clinical Decision Support: Knowledge Engineering and Implementation.

    PubMed

    Tso, Geoffrey J; Tu, Samson W; Oshiro, Connie; Martins, Susana; Ashcraft, Michael; Yuen, Kaeli W; Wang, Dan; Robinson, Amy; Heidenreich, Paul A; Goldstein, Mary K

    2016-01-01

    As utilization of clinical decision support (CDS) increases, it is important to continue the development and refinement of methods to accurately translate the intention of clinical practice guidelines (CPG) into a computable form. In this study, we validate and extend the 13 steps that Shiffman et al. 5 identified for translating CPG knowledge for use in CDS. During an implementation project of ATHENA-CDS, we encoded complex CPG recommendations for five common chronic conditions for integration into an existing clinical dashboard. Major decisions made during the implementation process were recorded and categorized according to the 13 steps. During the implementation period, we categorized 119 decisions and identified 8 new categories required to complete the project. We provide details on an updated model that outlines all of the steps used to translate CPG knowledge into a CDS integrated with existing health information technology.

  15. Neonatal testosterone suppresses a neuroendocrine pulse generator required for reproduction

    NASA Astrophysics Data System (ADS)

    Israel, Jean-Marc; Cabelguen, Jean-Marie; Le Masson, Gwendal; Oliet, Stéphane H.; Ciofi, Philippe

    2014-02-01

    The pituitary gland releases hormones in a pulsatile fashion guaranteeing signalling efficiency. The determinants of pulsatility are poorly circumscribed. Here we show in magnocellular hypothalamo-neurohypophyseal oxytocin (OT) neurons that the bursting activity underlying the neurohormonal pulses necessary for parturition and the milk-ejection reflex is entirely driven by a female-specific central pattern generator (CPG). Surprisingly, this CPG is active in both male and female neonates, but is inactivated in males after the first week of life. CPG activity can be restored in males by orchidectomy or silenced in females by exogenous testosterone. This steroid effect is aromatase and caspase dependent, and is mediated via oestrogen receptor-α. This indicates the apoptosis of the CPG network during hypothalamic sexual differentiation, explaining why OT neurons do not burst in adult males. This supports the view that stereotypic neuroendocrine pulsatility is governed by CPGs, some of which are subjected to gender-specific perinatal programming.

  16. Output variability across animals and levels in a motor system

    PubMed Central

    Norris, Brian J; Günay, Cengiz; Kueh, Daniel

    2018-01-01

    Rhythmic behaviors vary across individuals. We investigated the sources of this output variability across a motor system, from the central pattern generator (CPG) to the motor plant. In the bilaterally symmetric leech heartbeat system, the CPG orchestrates two coordinations in the bilateral hearts with different intersegmental phase relations (Δϕ) and periodic side-to-side switches. Population variability is large. We show that the system is precise within a coordination, that differences in repetitions of a coordination contribute little to population output variability, but that differences between bilaterally homologous cells may contribute to some of this variability. Nevertheless, much output variability is likely associated with genetic and life history differences among individuals. Variability of Δϕ were coordination-specific: similar at all levels in one, but significantly lower for the motor pattern than the CPG pattern in the other. Mechanisms that transform CPG output to motor neurons may limit output variability in the motor pattern. PMID:29345614

  17. Targeting NF-κB signaling with protein kinase C agonists as an emerging strategy for combating HIV latency.

    PubMed

    Jiang, Guochun; Dandekar, Satya

    2015-01-01

    Highly active antiretroviral therapy (HAART) is very effective in suppressing HIV-1 replication and restoring immune functions in HIV-infected individuals. However, it fails to eradicate the latent viral reservoirs and fully resolve chronic inflammation in HIV infection. The "shock-and-kill" strategy was recently proposed to induce latent HIV expression in the presence of HAART. Recent studies have shown that the protein kinase C (PKC) agonists are highly potent in inducing latent HIV expression from the viral reservoirs in vitro and ex vivo and in protecting primary CD4(+) T cells from HIV infection through down-modulation of their HIV coreceptor expression. The PKC agonists are excellent candidates for advancing to clinical HIV eradication strategies. This article will present a critical review of the structure and function of known PKC agonists, their mechanisms for the reactivation of latent HIV expression, and the potential of these compounds for advancing clinical HIV eradication strategies.

  18. The Healthy Weight Commitment Foundation Pledge

    PubMed Central

    Ng, Shu Wen; Slining, Meghan M.; Popkin, Barry M.

    2014-01-01

    Corporate voluntary pledges to improve the health of Americans have not been held to either explicit measurable outcomes or a framework for independent evaluation. The Healthy Weight Commitment Foundation (HWCF), whose members include 16 of the nation’s leading consumer packaged goods (CPG) food and beverage manufacturers, voluntarily pledged to collectively sell 1 trillion fewer calories in the U.S. marketplace by 2012 (against a 2007 baseline), and sell 1.5 trillion fewer calories by 2015. This paper presents the findings of an independent evaluation of the 2012 HWCF marketplace pledge, conducted in 2013. The 16 HWCF companies collectively sold approximately 6.4 trillion fewer calories (−10.6%) in 2012 than in the baseline year of 2007. Taking into account population changes over the 5-year period of 2007–2012, CPG caloric sales from brands included in the HWCF pledge declined by an average of 78 kcals/capita/day. CPG caloric sales from non-HWCF national brands during the same period declined by 11 kcals/capita/day, but there was little change in calories from private label products. Thus, the total reduction in CPG caloric sales between 2007 and 2012 was 87 kcals/capita/day. This independent evaluation is the first to evaluate food industry compliance with its calorie reduction pledges and to assess how sales from the CPG food and beverage sector are changing. An accompanying paper investigates the extent to which the HWCF pledge affected household-level changes in CPG calories purchased, controlling for important economic and sociodemographic factors affecting household food purchases over this period. PMID:25240967

  19. 76 FR 28308 - Compliance Policy Guide: Surgeons' Gloves and Patient Examination Gloves; Defects-Criteria for...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-17

    ... quality levels (AQLs) for leaks and visual defects observed during FDA testing of medical gloves. The CPG... practices regulation (21 CFR 10.115). The CPG represents FDA's current thinking on the criteria for direct...

  20. Adjuvant-Loaded Spiky Gold Nanoparticles for Activation of Innate Immune Cells.

    PubMed

    Nam, Jutaek; Son, Sejin; Moon, James J

    2017-10-01

    Gold nanoparticles are versatile carriers for delivery of biomacromolecules. Here, we have developed spiky gold nanoparticles (SGNPs) that can efficiently deliver immunostimulatory agents. Our goal was to develop a platform technology for co-delivery of multiple adjuvant molecules for synergistic stimulation and maturation of innate immune cells. SGNPs were synthesized by a seed-mediated, surfactant-free synthesis method and incorporated with polyinosinic-polycytidylic acid (pIC) and DNA oligonucleotide containing unmethylated CpG motif (CpG) by an electrostatic layer-by-layer approach. Adjuvant-loaded SGNP nano-complexes were examined for their biophysical and biochemical properties and studied for immune activation using bone marrow-derived dendritic cells (BMDCs). We have synthesized SGNPs with branched nano-spikes layered with pIC and/or CpG. Adjuvant-loaded SGNP nano-complexes promoted cellular uptake of the adjuvants. Importantly, we achieved spatio-temporal control over co-delivery of pIC and CpG via SGNPs, which produced synergistic enhancement in cytokine release (IL-6, TNF-α) and upregulation of co-stimulatory markers (CD40, CD80, CD86) in BMDCs, compared with pIC, CpG, or their admixtures. SGNPs serve as a versatile delivery platform that allows flexible and on-demand cargo fabrication for strong activation of innate immune cells.

  1. A multifaceted knowledge translation strategy can increase compliance with guideline recommendations for mechanical bowel preparation.

    PubMed

    Eskicioglu, Cagla; Pearsall, Emily; Victor, J Charles; Aarts, Mary-Anne; Okrainec, Allan; McLeod, Robin S

    2015-01-01

    The successful transfer of evidence into clinical practice is a slow and haphazard process. We report the outcome of a 5-year knowledge translation (KT) strategy to increase adherence with a clinical practice guideline (CPG) for mechanical bowel preparation (MBP) for elective colorectal surgery patients. A locally tailored CPG recommending MBP practices was developed. Data on MBP practices were collected at six University of Toronto hospitals before CPG implementation as well as after two separate KT strategies. KT strategy #1 included development of the CPG, education by opinion leaders, reminder cards, and presentations of data. KT strategy #2 included selection of hospital champions, development of communities of practice, education, reminder cards, electronic updates, pre-printed standardized orders, and audit and feedback. A total of 744 patients (400 males, 344 females, mean age 57.0) were included. Compliance increased from 58.6 to 70.4% after KT strategy #1 and to 81.1% after KT strategy #2 (p < 0.001). Using a tailored KT strategy, increased compliance was observed with CPG recommendations over time suggesting that a longitudinal KT strategy is required to increase and sustain compliance with recommendations. Furthermore, different strategies may be required at different times (i.e., educational sessions initially and reminders and standardized orders to maintain adherence).

  2. Length of paternal lifespan is manifested in the DNA methylome of their nonagenarian progeny

    PubMed Central

    Marttila, Saara; Kananen, Laura; Jylhävä, Juulia; Nevalainen, Tapio; Hervonen, Antti; Jylhä, Marja; Hurme, Mikko

    2015-01-01

    The heritability of lifespan is 20-30%, but only a few genes associated with longevity have been identified. To explain this discrepancy, the inheritance of epigenetic features, such as DNA methylation, have been proposed to contribute to the heritability of lifespan. We investigated whether parental lifespan is associated with DNA methylation profile in nonagenarians. A regression model, adjusted for differences in blood cell proportions, identified 659 CpG sites where the level of methylation was associated with paternal lifespan. However, no association was observed between maternal lifespan and DNA methylation. The 659 CpG sites associated with paternal lifespan were enriched outside of CpG islands and were located in genes associated with development and morphogenesis, as well as cell signaling. The largest difference in the level of methylation between the progeny of the shortest-lived and longest-lived fathers was identified for CpG sites mapping to CXXC5. In addition, the level of methylation in three Notch-genes (NOTCH1, NOTCH3 and NOTCH4) was also associated with paternal lifespan. There are implications for the inheritance of acquired traits via epigenetic mechanisms in mammals. Here we describe DNA methylation features that are associated with paternal lifespan, and we speculate that the identified CpG sites may represent intergenerational epigenetic inheritance. PMID:26436701

  3. Synthetic Poly(L-Glutamic Acid)-conjugated CpG Exhibits Antitumor Efficacy With Increased Retention in Tumor and Draining Lymph Nodes After Intratumoral Injection in a Mouse Model of Melanoma.

    PubMed

    Ma, Qing; Zhou, Dapeng; DeLyria, Elizabeth S; Wen, Xiaoxia; Lu, Wei; Thapa, Prakash; Liu, Chengwen; Li, Dan; Bassett, Roland L; Overwijk, Willem W; Hwu, Patrick; Li, Chun

    2017-01-01

    There is an urgent need for new clinically applicable drug-delivery methods to enhance accumulation of immune-activating drugs in tumors. We synthesized a poly(L-glutamic acid)-CpG ODN2216 conjugate (PG-CpG) and injected it intratumorally into C57BL/6 mice bearing subcutaneous B16-ovalbumin melanoma. PG-CpG elicited the same potent antitumoral activity as CpG with respect to reducing tumor growth and triggering antigen-specific CD8 T-cell responses in this well-established solid tumor model. Moreover, PG-CpG was retained significantly longer in both tumor and draining lymph nodes than was free CpG after intratumoral injection. Specifically, 48 hours after injection, 26.5%±16.9% of the injected PG-CpG dose versus 4.72%±2.61% of free CpG remained at the tumor, and 1.53%±1.22% of the injected PG-CpG versus 0.37%±0.33% of free CpG was retained in the draining inguinal lymph nodes. These findings indicate that PG is an effective synthetic polymeric carrier for delivery of immunostimulatory agents to tumors and lymph nodes.

  4. 5-Fluorotryptamine is a partial agonist at 5-HT3 receptors, and reveals that size and electronegativity at the 5 position of tryptamine are critical for efficient receptor function.

    PubMed

    Bower, Kiowa S; Price, Kerry L; Sturdee, Laura E C; Dayrell, Mariza; Dougherty, Dennis A; Lummis, Sarah C R

    2008-02-12

    Antagonists, but not agonists, of the 5-HT3 receptor are useful therapeutic agents, and it is possible that partial agonists may also be potentially useful in the clinic. Here we show that 5-fluorotryptamine (5-FT) is a partial agonist at both 5-HT3A and 5-HT3AB receptors with an Rmax (Imax/Imax 5-HT) of 0.64 and 0.45 respectively. It is about 10 fold less potent than 5-HT: EC50=16 and 27 microM, and Ki for displacement of [3H]granisetron binding=0.8 and 1.8 microM for 5-HT3A and 5-HT3AB receptors respectively. We have also explored the potencies and efficacies of tryptamine and a range of 5-substituted tryptamine derivatives. At 5-HT3A receptors tryptamine is a weak (Rmax=0.15), low affinity (EC50=113 microM; Ki=4.8 microM) partial agonist, while 5-chlorotryptamine has a similar affinity to 5-FT (EC50=8.1 microM; Ki=2.7 microM) but is a very weak partial agonist (Rmax=0. 0037). These, and data from 5-methyltryptamine and 5-methoxytryptamine, reveal the importance of size and electronegativity at this location for efficient channel opening.

  5. The therapeutic potential of nicotinic acetylcholine receptor agonists for pain control.

    PubMed

    Decker, M W; Meyer, M D; Sullivan, J P

    2001-10-01

    Due to the limitations of currently available analgesics, a number of novel alternatives are currently under investigation, including neuronal nicotinic acetylcholine receptor (nAChR) agonists. During the 1990s, the discovery of the antinociceptive properties of the potent nAChR agonist epibatidine in rodents sparked interest in the analgesic potential of this class of compounds. Although epibatidine also has several mechanism-related toxicities, the identification of considerable nAChR diversity suggested that the toxicities and therapeutic actions of the compound might be mediated by distinct receptor subtypes. Consistent with this view, a number of novel nAChR agonists with antinociceptive activity and improved safety profiles in preclinical models have now been identified, including A-85380, ABT-594, DBO-83, SIB-1663 and RJR-2403. Of these, ABT-594 is the most advanced and is currently in Phase II clinical evaluation. Nicotinically-mediated antinociception has been demonstrated in a variety of rodent pain models and is likely mediated by the activation of descending inhibitory pathways originating in the brainstem with the predominant high-affinity nicotine site in brain, the alpha4beta2 subtype, playing a critical role. Thus, preclinical findings suggest that nAChR agonists have the potential to be highly efficacious treatments in a variety of pain states. However, clinical proof-of-principle studies will be required to determine if nAChR agonists are active in pathological pain.

  6. Adverse Effects of GLP-1 Receptor Agonists

    PubMed Central

    Filippatos, Theodosios D.; Panagiotopoulou, Thalia V.; Elisaf, Moses S.

    2014-01-01

    Glucagon-like peptide-1 (GLP-1) receptor agonists are a class of injective anti-diabetic drugs that improve glycemic control and many other atherosclerosis-related parameters in patients with type 2 diabetes (T2D). However, the use of this relatively new class of drugs may be associated with certain adverse effects. Concerns have been expressed regarding the effects of these drugs on pancreatic and thyroid tissue, since animal studies and analyses of drug databases indicate an association of GLP-1 receptor agonists with pancreatitis, pancreatic cancer, and thyroid cancer. However, several meta-analyses failed to confirm a cause-effect relation between GLP-1 receptor agonists and the development of these adverse effects. One benefit of GLP-1 receptor agonists is that they do not cause hypoglycemia when combined with metformin or thiazolidinediones, but the dose of concomitant sulphonylurea or insulin may have to be decreased to reduce the risk of hypoglycemic episodes. On the other hand, several case reports have linked the use of these drugs, mainly exenatide, with the occurrence of acute kidney injury, primarily through hemodynamic derangement due to nausea, vomiting, and diarrhea. The most common symptoms associated with the use of GLP-1 receptor agonists are gastrointestinal symptoms, mainly nausea. Other common adverse effects include injection site reactions, headache, and nasopharyngitis, but these effects do not usually result in discontinuation of the drug. Current evidence shows that GLP-1 receptor agonists have no negative effects on the cardiovascular risk of patients with T2D. Thus, GLP-1 receptor agonists appear to have a favorable safety profile, but ongoing trials will further assess their cardiovascular effects. The aim of this review is to analyze critically the available data regarding adverse events of GLP-1 receptor agonists in different anatomic systems published in Pubmed and Scopus. Whenever possible, certain differences between GLP-1 receptor agonists are described. The review also provides the reader with structured data that compare the rates of the most common adverse effects for each of the various GLP-1 receptor agonists. PMID:26177483

  7. Effects of CPG ODN on biological behavior of PANC-1 and expression of TLR9 in pancreatic cancer.

    PubMed

    Wu, Han-Qing; Wang, Bo; Zhu, Shi-Kai; Tian, Yuan; Zhang, Jing-Hui; Wu, He-Shui

    2011-02-28

    To determine the expression of toll-like receptor 9 (TLR9) in pancreatic tumor and the effects of cytosine phosphate-guanosine oligodeoxynucleotides 2216 (CPG ODN2216) on biological behavior of pancreatic carcinoma cell line PANC-1 and explore their clinical significance. The immunohistochemistry and Western blot were used to determine the expression of TLR9 protein in pancreatic cancer tissues, and immunofluorescence staining was performed to detect the TLR9 protein expression in pancreatic carcinoma cell line PANC-1. To assess the effects of CPG ODN2216 on the invasive property of Panc-1 cells, in vitro cell adhesion, wound-healing scrape, and invasion and cell colony formation were evaluated. TLR9 was highly expressed in pancreatic cancer tissues and PANC-1 cells. The percentage of positive cells expressing TLR9 protein in human pancreatic tissues, paracancerous tissues and normal tissues were 73.3%, 33.3% and 20.0%, respectively, and the protein expression level of TLR9 was gradually descending (P < 0.05). In vitro tests in wound-healing scrape, cell adhesion, colony formation and matrigel invasion showed that the adhesion and motility of PANC-1 cells in CPG ODN 2216 treatment group were significantly lower than in the control group (P < 0.05). The cell growth assay showed that the proliferative ability of PANC-1 cells in treatment group was significantly decreased and CPG ODN2216 had an inhibitive effect in the growth of Panc-1 cells in a dose and time-dependent manner (P < 0.05). The gene of TLR9 is correlated with the invasive and metastatic potential of human pancreatic carcinoma, and CPG ODN2216 induces the inhibition of migration and invasion of Panc-1 cells.

  8. Genome-wide DNA Methylation Profiling of CpG Islands in Hypospadias

    PubMed Central

    Choudhry, Shweta; Deshpande, Archana; Qiao, Liang; Beckman, Kenneth; Sen, Saunak; Baskin, Laurence S.

    2013-01-01

    Purpose Hypospadias is one of the most frequent genital malformations in the male newborn, and results from abnormal penile and urethral development. The etiology of hypospadias remains largely unknown despite intensive investigations. Fetal androgens have a crucial role in genital differentiation. Recent studies have suggested that molecular mechanisms that underlie the effects of androgens on the fetus may involve disruption of epigenetic programming of gene expression during development. We assessed whether epigenetic modification of DNA methylation is associated with hypospadias in a case-control study of 12 hypospadias and 8 control subjects. Materials and Methods Genome-wide DNA methylation profiling was performed on the study subjects using the Illumina Infinium® HumanMethylation450 Bead-Chip, which enables the direct investigation of methylation status of more than 485,000 individual CpG sites throughout the genome. The methylation level at each CpG site was compared between cases and controls using the t test and logistic regression. Results We identified 14 CpG sites that were associated with hypospadias with p <0.00001. These CpG sites were in or near the SCARB1, MYBPH, SORBS1, LAMA4, HOXD11, MYO1D, EGFL7, C10orf41, LMAN1L and SULF1 genes. Two CpG sites in SCARB1 and MYBPH genes remained statistically significant after correction for multiple testing (p = 2.61×10−09, pcorrected = 0.008; p = 3.06×10−08, pcorrected = 0.02, respectively). Conclusions To our knowledge this is the first study to investigate hypospadias using a unique and novel epigenetic approach. Our findings suggest DNA methylation patterns are useful in identifying new genes such as SCARB1 and MYBPH that may be involved in the etiology of hypospadias. PMID:22906644

  9. Repetition priming of motor activity mediated by a central pattern generator: the importance of extrinsic vs. intrinsic program initiators

    PubMed Central

    Siniscalchi, Michael J.; Jing, Jian; Weiss, Klaudiusz R.

    2016-01-01

    Repetition priming is characterized by increased performance as a behavior is repeated. Although this phenomenon is ubiquitous, mediating mechanisms are poorly understood. We address this issue in a model system, the feeding network of Aplysia. This network generates both ingestive and egestive motor programs. Previous data suggest a chemical coding model: ingestive and egestive inputs to the feeding central pattern generator (CPG) release different modulators, which act via different second messengers to prime motor activity in different ways. The ingestive input to the CPG (neuron CBI-2) releases the peptides feeding circuit activating peptide and cerebral peptide 2, which produce an ingestive pattern of activity. The egestive input to the CPG (the esophageal nerve) releases the peptide small cardioactive peptide. This model is based on research that focused on a single aspect of motor control (radula opening). Here we ask whether repetition priming is observed if activity is triggered with a neuron within the core CPG itself and demonstrate that it is not. Moreover, previous studies demonstrated that effects of modulatory neurotransmitters that induce repetition priming persist. This suggests that it should be possible to “prime” motor programs triggered from within the CPG by first stimulating extrinsic modulatory inputs. We demonstrate that programs triggered after ingestive input activation are ingestive and programs triggered after egestive input activation are egestive. We ask where this priming occurs and demonstrate modifications within the CPG itself. This arrangement is likely to have important consequences for “task” switching, i.e., the cessation of one type of motor activity and the initiation of another. PMID:27466134

  10. Comprehensive DNA methylation analysis of human neuroblastoma cells treated with blonanserin.

    PubMed

    Murata, Yui; Nishioka, Masaki; Bundo, Miki; Sunaga, Fumiko; Kasai, Kiyoto; Iwamoto, Kazuya

    2014-03-20

    Blonanserin is a second-generation antipsychotic drug for schizophrenia. The pharmacological actions of blonanserin are shown to be the antagonism of dopamine receptor 2 and serotonin receptors. However, its molecular mechanisms in brain cells have not been fully characterized. Accumulating evidence suggests that antipsychotic drugs and mood stabilizers show epigenetic effects on a wide range of genes in animal and cellular models. We performed genome-wide DNA methylation analysis targeting 479,814 CpG sites of cultured human neuroblastoma cells administered with blonanserin. We found that 3,057 CpG sites showed statistically significant changes in DNA methylation at two different doses of blonanserin (1.36 nM and 13.6 nM). These included hypermethylated CpG sites that were enriched in genes related to axonogenesis and cell morphogenesis involved in neuron differentiation. We also showed that the global effect on DNA methylome depends on the concentration of the drug. With a high dose of blonanserin, the overall methylation levels across all CpG sites significantly increased. These increases in DNA methylation were prominent in the CpG sites distant from promoter regions. We further examined DNA methylation changes in specific genes implicated for the actions of antipsychotic drugs, such as the dopamine receptor 2 (DRD2) gene and the serotonin receptor 2A (HTR2A) gene. We observed that CpG sites that were located within DRD2 and HTR2A genes were significantly hypermethylated by blonanserin. The DNA methylation changes induced by the treatment with blonanserin will be useful for understanding its pharmacological actions at the cellular level. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  11. Syncope Best Practices: A Syncope Clinical Practice Guideline to Improve Quality.

    PubMed

    Phelps, Heather M; Sachdeva, Ritu; Mahle, William T; McCracken, Courtney E; Kelleman, Michael; McConnell, Michael; Fischbach, Peter S; Cardis, Brian M; Campbell, Robert M; Oster, Matthew E

    2016-05-01

    To determine whether implementation of a standardized clinical practice guideline (CPG) for the evaluation of syncope would decrease practice variability and resource utilization. A retrospective review of medical records of patients presenting to our practice for outpatient evaluation of syncope before and after implementation of the CPG. The guideline included elements of history, physical exam, electrocardiogram, and "red flags" for further testing. Outpatient pediatric cardiology offices of a large pediatric cardiology practice. All new patients between 3 and 21 years old, who presented to cardiology clinic with a chief complaint of syncope. The CPG for the evaluation of pediatric syncope was presented to the providers. Resource utilization was determined by the tests ordered by individual physicians before and after initiation of the CPG. Patient final diagnoses were recorded and the medical records were subsequently reviewed to determine if any patients, who presented again to the system, were ultimately diagnosed with cardiac disease. Of the 1496 patients with an initial visit for syncope, there was no significant difference in the diagnosis of cardiac disease before or after initiation of the CPG: (0.6% vs. 0.4%, P = .55). Electrocardiography provides the highest yield in the evaluation of pediatric syncope. Despite high compliance (86.9%), there were no overall changes in costs ($346.31 vs. $348.53, P = .85) or in resource utilization. There was, however, a decrease in the variability of ordering of echocardiograms among physicians, particularly among those at the extremes of utilization. Although the CPG did not decrease already low costs, it did decrease the wide variability in echo utilization. Evaluation beyond detailed history, physical exam, and electrocardiography provides no additional benefit in the evaluations of pediatric patients presenting with syncope. © 2015 Wiley Periodicals, Inc.

  12. Polycomb-like proteins link the PRC2 complex to CpG islands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Haojie; Liefke, Robert; Jiang, Junyi

    The Polycomb repressive complex 2 (PRC2) mainly mediates transcriptional repression1,2 and has essential roles in various biological processes including the maintenance of cell identity and proper differentiation. Polycomb-like (PCL) proteins, such as PHF1, MTF2 and PHF19, are PRC2-associated factors that form sub-complexes with PRC2 core components3, and have been proposed to modulate the enzymatic activity of PRC2 or the recruitment of PRC2 to specific genomic loci4,5,6,7,8,9,10,11,12,13. Mammalian PRC2-binding sites are enriched in CG content, which correlates with CpG islands that display a low level of DNA methylation14. However, the mechanism of PRC2 recruitment to CpG islands is not fully understood.more » Here we solve the crystal structures of the N-terminal domains of PHF1 and MTF2 with bound CpG-containing DNAs in the presence of H3K36me3-containing histone peptides. We show that the extended homologous regions of both proteins fold into a winged-helix structure, which specifically binds to the unmethylated CpG motif but in a completely different manner from the canonical winged-helix DNA recognition motif. We also show that the PCL extended homologous domains are required for efficient recruitment of PRC2 to CpG island-containing promoters in mouse embryonic stem cells. Our research provides the first, to our knowledge, direct evidence to demonstrate that PCL proteins are crucial for PRC2 recruitment to CpG islands, and further clarifies the roles of these proteins in transcriptional regulation in vivo.« less

  13. Methylated site display (MSD)-AFLP, a sensitive and affordable method for analysis of CpG methylation profiles.

    PubMed

    Aiba, Toshiki; Saito, Toshiyuki; Hayashi, Akiko; Sato, Shinji; Yunokawa, Harunobu; Maruyama, Toru; Fujibuchi, Wataru; Kurita, Hisaka; Tohyama, Chiharu; Ohsako, Seiichiroh

    2017-03-09

    It has been pointed out that environmental factors or chemicals can cause diseases that are developmental in origin. To detect abnormal epigenetic alterations in DNA methylation, convenient and cost-effective methods are required for such research, in which multiple samples are processed simultaneously. We here present methylated site display (MSD), a unique technique for the preparation of DNA libraries. By combining it with amplified fragment length polymorphism (AFLP) analysis, we developed a new method, MSD-AFLP. Methylated site display libraries consist of only DNAs derived from DNA fragments that are CpG methylated at the 5' end in the original genomic DNA sample. To test the effectiveness of this method, CpG methylation levels in liver, kidney, and hippocampal tissues of mice were compared to examine if MSD-AFLP can detect subtle differences in the levels of tissue-specific differentially methylated CpGs. As a result, many CpG sites suspected to be tissue-specific differentially methylated were detected. Nucleotide sequences adjacent to these methyl-CpG sites were identified and we determined the methylation level by methylation-sensitive restriction endonuclease (MSRE)-PCR analysis to confirm the accuracy of AFLP analysis. The differences of the methylation level among tissues were almost identical among these methods. By MSD-AFLP analysis, we detected many CpGs showing less than 5% statistically significant tissue-specific difference and less than 10% degree of variability. Additionally, MSD-AFLP analysis could be used to identify CpG methylation sites in other organisms including humans. MSD-AFLP analysis can potentially be used to measure slight changes in CpG methylation level. Regarding the remarkable precision, sensitivity, and throughput of MSD-AFLP analysis studies, this method will be advantageous in a variety of epigenetics-based research.

  14. The Healthy Weight Commitment Foundation pledge: calories sold from U.S. consumer packaged goods, 2007-2012.

    PubMed

    Ng, Shu Wen; Slining, Meghan M; Popkin, Barry M

    2014-10-01

    Corporate voluntary pledges to improve the health of Americans have not been held to either explicit measurable outcomes or a framework for independent evaluation. The Healthy Weight Commitment Foundation (HWCF), whose members include 16 of the nation's leading consumer packaged goods (CPG) food and beverage manufacturers, voluntarily pledged to collectively sell 1 trillion fewer calories in the U.S. marketplace by 2012 (against a 2007 baseline), and sell 1.5 trillion fewer calories by 2015. This paper presents the findings of an independent evaluation of the 2012 HWCF marketplace pledge, conducted in 2013. The 16 HWCF companies collectively sold approximately 6.4 trillion fewer calories (-10.6%) in 2012 than in the baseline year of 2007. Taking into account population changes over the 5-year period of 2007-2012, CPG caloric sales from brands included in the HWCF pledge declined by an average of 78 kcal/capita/day. CPG caloric sales from non-HWCF national brands during the same period declined by 11 kcal/capita/day, and there were similar declines in calories from private label products. Thus, the total reduction in CPG caloric sales between 2007 and 2012 was 99 kcal/capita/day. This independent evaluation is the first to evaluate food industry compliance with its calorie reduction pledges and to assess how sales from the CPG food and beverage sector are changing. An accompanying paper investigates the extent to which the HWCF pledge affected household-level changes in CPG calories purchased, controlling for important economic and sociodemographic factors affecting household food purchases over this period. Copyright © 2014 American Journal of Preventive Medicine. Published by Elsevier Inc. All rights reserved.

  15. Blood fatty acid composition of pregnant and nonpregnant Korean women: red cells may act as a reservoir of arachidonic acid and docosahexaenoic acid for utilization by the developing fetus.

    PubMed

    Ghebremeskel, K; Min, Y; Crawford, M A; Nam, J H; Kim, A; Koo, J N; Suzuki, H

    2000-05-01

    Relative fatty acid composition of plasma and red blood cell (RBC) choline phosphoglycerides (CPG), and RBC ethanolamine phosphoglycerides (EPG) of pregnant (n = 40) and nonpregnant, nonlactating (n = 40), healthy Korean women was compared. The two groups were of the same ethnic origin and comparable in age and parity. Levels of arachidonic (AA) and docosahexaenoic (DHA) acids were lower (P < 0.05) and palmitic and oleic acids higher (P < 0.0001) in plasma CPG of the pregnant women. Similarly, the RBC CPG and EPG of the pregnant women had lower AA and DHA (P < 0.05) and higher palmitic and oleic acids (P < 0.01). The reduction in DHA and total n-3 fatty acids in plasma CPG of the pregnant women was paralleled by an increase in docosatetraenoic (DTA) and docosapentaenoic (DPA) acids of the n-6 series and in DPA/DTA ratio. In the RBC phospholipids (CPG and EPG) of the pregnant women, DTA and DPA acids of the n-6 series and DPA/DTA ratio did not increase with the decrease of the n-3 metabolites (eicosapentaenoic acid, DPA, and DHA) and total n-3. Since pregnancy was the main identifiable variable between the two groups, the lower levels of AA and DHA in RBC CPG and EPG of the pregnant women suggest that the mothers were mobilizing membrane AA and DHA to meet the high fetal requirement for these nutrients. It may also suggest that RBC play a role as a potential store of AA and DHA and as a vehicle for the transport of these fatty acids from maternal circulation to the placenta to be utilized by the developing fetus.

  16. Adopting Health Behavior Change Theory throughout the Clinical Practice Guideline Process

    ERIC Educational Resources Information Center

    Ceccato, Natalie E.; Ferris, Lorraine E.; Manuel, Douglas; Grimshaw, Jeremy M.

    2007-01-01

    Adopting a theoretical framework throughout the clinical practice guideline (CPG) process (development, dissemination, implementation, and evaluation) can be useful in systematically identifying, addressing, and explaining behavioral influences impacting CPG uptake and effectiveness. This article argues that using a theoretical framework should…

  17. 78 FR 42526 - Salmonella

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-07-16

    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2013-D-0254] Salmonella Contamination of Dry Dog Food; Withdrawal of Compliance Policy Guide AGENCY: Food and Drug... entitled ``Sec. 690.700 Salmonella Contamination of Dry Dog Food (CPG 690.700)'' on October 1, 1980. CPG...

  18. CpG islands: algorithms and applications in methylation studies.

    PubMed

    Zhao, Zhongming; Han, Leng

    2009-05-15

    Methylation occurs frequently at 5'-cytosine of the CpG dinucleotides in vertebrate genomes; however, this epigenetic feature is rarely observed in CpG islands (CGIs) or CpG clusters in the promoter regions of genes. Aberrant methylation of the promoter-associated CGIs might influence gene expression and cause carcinogenesis. Because of the functional importance, multiple algorithms have been available for identifying CGIs in a genome or a sequence. They can be categorized into the traditional algorithms (e.g., Gardiner-Garden and Frommer (1987), Takai and Jones (2002), and CpGPRoD (2002)) or statistical property based algorithms (CpGcluster (2006) and CG cluster (2007)). We reviewed the features of these algorithms and evaluated their performance on identifying functional CGIs using genome-wide methylation data. Moreover, identification of CGIs is an initial step in many recent studies for predicting methylation status as well as in the design of methylation detection platforms. We reviewed the benchmarks and features used in these studies.

  19. Gait Planning and Stability Control of a Quadruped Robot

    PubMed Central

    Li, Junmin; Wang, Jinge; Yang, Simon X.; Zhou, Kedong; Tang, Huijuan

    2016-01-01

    In order to realize smooth gait planning and stability control of a quadruped robot, a new controller algorithm based on CPG-ZMP (central pattern generator-zero moment point) is put forward in this paper. To generate smooth gait and shorten the adjusting time of the model oscillation system, a new CPG model controller and its gait switching strategy based on Wilson-Cowan model are presented in the paper. The control signals of knee-hip joints are obtained by the improved multi-DOF reduced order control theory. To realize stability control, the adaptive speed adjustment and gait switch are completed by the real-time computing of ZMP. Experiment results show that the quadruped robot's gaits are efficiently generated and the gait switch is smooth in the CPG control algorithm. Meanwhile, the stability of robot's movement is improved greatly with the CPG-ZMP algorithm. The algorithm in this paper has good practicability, which lays a foundation for the production of the robot prototype. PMID:27143959

  20. Gait Planning and Stability Control of a Quadruped Robot.

    PubMed

    Li, Junmin; Wang, Jinge; Yang, Simon X; Zhou, Kedong; Tang, Huijuan

    2016-01-01

    In order to realize smooth gait planning and stability control of a quadruped robot, a new controller algorithm based on CPG-ZMP (central pattern generator-zero moment point) is put forward in this paper. To generate smooth gait and shorten the adjusting time of the model oscillation system, a new CPG model controller and its gait switching strategy based on Wilson-Cowan model are presented in the paper. The control signals of knee-hip joints are obtained by the improved multi-DOF reduced order control theory. To realize stability control, the adaptive speed adjustment and gait switch are completed by the real-time computing of ZMP. Experiment results show that the quadruped robot's gaits are efficiently generated and the gait switch is smooth in the CPG control algorithm. Meanwhile, the stability of robot's movement is improved greatly with the CPG-ZMP algorithm. The algorithm in this paper has good practicability, which lays a foundation for the production of the robot prototype.

  1. Cancer immunotherapeutic effects of novel CpG ODN in murine tumor model.

    PubMed

    Cho, Hyeon Cheol; Kim, Bo Hwan; Kim, Kyunghoon; Park, Ju Youn; Chang, Jae-Ho; Kim, Soo-Ki

    2008-10-01

    While CpG oligodeoxynucleotides (ODN) are excellent candidates for cancer immunotherapeutics, the numbers of usable CpG ODNs are limited in current clinical settings. To resolve this, we investigated whether novel CpG ODN (KSK-CpG) would be an effective immunotherapeutic in a murine tumor model by affecting in vivo and in vitro parameters, such as survival span, the number of tumor nodules, natural killer (NK) cell and cytotoxic T lymphocyte (CTL) activity and interleukin (IL)-6 or IL-12 cytokine release in splenocytes. We found that KSK-CpG was effective in the murine cancer model by way of prolonging survival span, reducing the number of tumor nodules, augmenting NK cell and CTL cytotoxicity, as well as evoking IL-6 and IL-12 cytokine release in splenocytes. Collectively, these data demonstrate that KSK-CpG is active against the highly malignant B16BL6 and EL4 tumor mouse model via innate immune augmentation.

  2. Temporal Expression of Bim Limits the Development of Agonist-Selected Thymocytes and Skews Their TCRβ Repertoire

    PubMed Central

    Li, Kun-Po; Fahnrich, Anke; Roy, Eron; Cuda, Carla M.; Grimes, H. Leighton; Perlman, Harris R.; Kalies, Kathrin; Hildeman, David A.

    2017-01-01

    CD8αα TCRαβ+ intestinal intraepithelial lymphocytes play a critical role in promoting intestinal homeostasis, although mechanisms controlling their development and peripheral homeostasis remain unclear. In this study, we examined the spatiotemporal role of Bim in the thymic selection of CD8αα precursors and the fate of these cells in the periphery. We found that T cell–specific expression of Bim during early/cortical, but not late/medullary, thymic development controls the agonist selection of CD8αα precursors and limits their private TCRβ repertoire. During this process, agonist-selected double-positive cells lose CD4/8 coreceptor expression and masquerade as double-negative (DN) TCRαβhi thymocytes. Although these DN thymocytes fail to re-express coreceptors after OP9-DL1 culture, they eventually mature and accumulate in the spleen where TCR and IL-15/STAT5 signaling promotes their conversion to CD8αα cells and their expression of gut-homing receptors. Adoptive transfer of splenic DN cells gives rise to CD8αα cells in the gut, establishing their precursor relationship in vivo. Interestingly, Bim does not restrict the IL-15–driven maturation of CD8αα cells that is critical for intestinal homeostasis. Thus, we found a temporal and tissue-specific role for Bim in limiting thymic agonist selection of CD8αα precursors and their TCRβ repertoire, but not in the maintenance of CD8αα intraepithelial lymphocytes in the intestine. PMID:27852740

  3. Genetic variation and epigenetic modification of the prodynorphin gene in peripheral blood cells in alcoholism.

    PubMed

    D'Addario, Claudio; Shchetynsky, Klementy; Pucci, Mariangela; Cifani, Carlo; Gunnar, Agneta; Vukojević, Vladana; Padyukov, Leonid; Terenius, Lars

    2017-06-02

    Dynorphins are critically involved in the development, maintenance and relapse of alcoholism. Alcohol-induced changes in the prodynorphin gene expression may be influenced by both gene polymorphisms and epigenetic modifications. The present study of human alcoholics aims to evaluate DNA methylation patterns in the prodynorphin gene (PDYN) promoter and to identify single nucleotide polymorphisms (SNPs) associated with alcohol dependence and with altered DNA methylation. Genomic DNA was isolated from peripheral blood cells of alcoholics and healthy controls, and DNA methylation was studied in the PDYN promoter by bisulfite pyrosequencing. In alcoholics, DNA methylation increased in three of the seven CpG sites investigated, as well as in the average of the seven CpG sites. Data stratification showed lower increase in DNA methylation levels in individuals reporting craving and with higher levels of alcohol consumption. Association with alcoholism was observed for rs2235751 and the presence of the minor allele G was associated with reduced DNA methylation at PDYN promoter in females and younger subjects. Genetic and epigenetic factors within PDYN are related to risk for alcoholism, providing further evidence of its involvement on ethanol effects. These results might be of relevance for developing new biomarkers to predict disease trajectories and therapeutic outcome. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Chimeric peptide containing both B and T cells epitope of tumor-associated antigen L6 enhances anti-tumor effects in HLA-A2 transgenic mice.

    PubMed

    Lin, Su-I; Huang, Ming-Hsi; Chang, Yu-Wen; Chen, I-Hua; Roffler, Steve; Chen, Bing-Mae; Sher, Yuh-Pyng; Liu, Shih-Jen

    2016-07-28

    Synthetic peptides are attractive for cancer immunotherapy because of their safety and flexibility. In this report, we identified a new B cell epitope of tumor-associated antigen L6 (TAL6) that could induce antibody-dependent cellular cytotoxicity (ADCC) in vivo. We incorporated the B cell epitope with a cytotoxic T lymphocyte (CTL) and a helper T (Th) epitope to form a chimeric long peptide. We formulated the chimeric peptide with different adjuvants to immunize HLA-A2 transgenic mice and evaluate their immunogenicity. The chimeric peptide formulated with an emulsion type nanoparticle (PELC) adjuvant and a toll-like receptor 9 agonist (CpG ODN) (PELC/CpG) induced the greatest ADCC and CTL responses. The induced anti-tumor immunity inhibited the growth of TAL6-positive cancer cells. Moreover, we observed that immunization with the chimeric peptide inhibited cancer cell migration in vitro and metastasis in vivo. These data suggest that a chimeric peptide containing both B and T cell epitopes of TAL6 formulated with PELC/CpG adjuvant is feasible for cancer immunotherapy. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  5. Identification and expression analysis of cobia (Rachycentron canadum) Toll-like receptor 9 gene.

    PubMed

    Byadgi, Omkar; Puteri, Dinda; Lee, Yan-Horn; Lee, Jai-Wei; Cheng, Ta-Chih

    2014-02-01

    Cobia culture is hindered by bacterial infection (Photobacterium damselae subsp. piscicida) and in order to study the effect of P. damselae subsp. piscicida challenge and CpG ODN stimulation on cobia Toll like receptor 9 (RCTLR9), we used PCR to clone RCTLR9 gene and qRT-PCR to quantify gene expression. The results indicated that RCTLR9 cDNA contains 3141 bp. It encodes 1047 amino acids containing 16 typical structures of leucine-rich repeats (LRRs) including an LRRTYP, LRRCT and a motif involved in PAMP binding was identified at position 240-253 amino acid. Broad expression of RCTLR9 was found in larval, juvenile and adult stages irrespective of the tissues. In larval stage, RCTLR9 mRNA expression decreased at 5 d and then increased at 10 dph. At juvenile stage cobia, the expression was significantly high (p < 0.05) in spleen and intestine compared to gill, kidney, liver and skin. However, at adult stage, the significant high expression was found in gill and intestine. Cobia challenged with P. damselae subsp. piscicida showed significant increase in RCTLR9 expression at 24 h post challenge in intestine, spleen and liver, while in kidney the expression was peak at 12 h and later it decreased at 24 h. The highest expression was 40 fold increase in spleen and the lowest expression was ∼3.6 fold increase in liver. Cobia stimulated with CpG oligonucleotides showed that the induction of these genes was CpG ODN type and time dependent. In spleen and liver, CpG ODNs 1668 and 2006 injected group showed high expression of RCTLR9, IL-1β, chemokine CC compared to other groups. Meanwhile, CpG ODN 2006 has induced high expression of IgM. The CpG ODNs 2395 have induced significant high expression of Mx in spleen and liver. These results demonstrates the potential of using CpG ODN to enhance cobia resistance to P. damselae subsp. piscicida infection and use as an adjuvant in vaccine development. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. CpG Sites Associated with Cigarette Smoking: Analysis of Epigenome-Wide Data from the Sister Study

    PubMed Central

    Harlid, Sophia; Xu, Zongli; Panduri, Vijayalakshmi; Sandler, Dale P.

    2014-01-01

    Background: Smoking increases the risk of many diseases, and it is also linked to blood DNA methylation changes that may be important in disease etiology. Objectives: We sought to identify novel CpG sites associated with cigarette smoking. Methods: We used two epigenome-wide data sets from the Sister Study to identify and confirm CpG sites associated with smoking. One included 908 women with methylation measurements at 27,578 CpG sites using the HumanMethylation27 BeadChip; the other included 200 women with methylation measurements for 473,844 CpG sites using the HumanMethylation450 BeadChip. Significant CpGs from the second data set that were not included in the 27K assay were validated by pyrosequencing in a subset of 476 samples from the first data set. Results: Our study successfully confirmed smoking associations for 9 previously established CpGs and identified 2 potentially novel CpGs: cg26764244 in GNG12 (p = 9.0 × 10–10) and cg22335340 in PTPN6 (p = 2.9 × 10–05). We also found strong evidence of an association between smoking status and cg02657160 in CPOX (p = 7.3 × 10–7), which has not been previously reported. All 12 CpGs were undermethylated in current smokers and showed an increasing percentage of methylation in former and never-smokers. Conclusions: We identified 2 potentially novel smoking related CpG sites, and provided independent replication of 10 previously reported CpGs sites related to smoking, one of which is situated in the gene CPOX. The corresponding enzyme is involved in heme biosynthesis, and smoking is known to increase heme production. Our study extends the evidence base for smoking-related changes in DNA methylation. Citation: Harlid S, Xu Z, Panduri V, Sandler DP, Taylor JA. 2014. CpG sites associated with cigarette smoking: analysis of epigenome-wide data from the Sister Study. Environ Health Perspect 122:673–678; http://dx.doi.org/10.1289/ehp.1307480 PMID:24704585

  7. pH-Responsive Nanoparticle Vaccines for Dual-Delivery of Antigens and Immunostimulatory Oligonucleotides

    PubMed Central

    Wilson, John T.; Keller, Salka; Manganiello, Matthew J.; Cheng, Connie; Lee, Chen-Chang; Opara, Chinonso; Convertine, Anthony; Stayton, Patrick S.

    2013-01-01

    Protein subunit vaccines offer important potential advantages over live vaccine vectors, but generally elicit weaker and shorter-lived cellular immune responses. Here we investigate the use of pH-responsive, endosomolytic polymer nanoparticles that were originally developed for RNA delivery as vaccine delivery vehicles for enhancing cellular and humoral immune responses. Micellar nanoparticles were assembled from amphiphilic diblock copolymers composed of an ampholytic core-forming block and a re-designed polycationic corona block doped with thiol-reactive pyridyl disulfide groups to enable dual-delivery of antigens and immunostimulatory CpG oligodeoxynucleotide (CpG ODN) adjuvants. Polymers assembled into 23 nm particles with simultaneous packaging of CpG ODN and a thiolated protein antigen, ovalbumin (ova). Conjugation of ova to nanoparticles significantly enhanced antigen cross-presentation in vitro relative to free ova or an unconjugated, physical mixture of the parent compounds. Subcutaneous vaccination of mice with ova-nanoparticle conjugates elicited a significantly higher CD8+ T cell response (0.5% IFN-ɣ+ of CD8+) compared to mice vaccinated with free ova or a physical mixture of the two components. Significantly, immunization with ova-nanoparticle conjugates electrostatically complexed with CpG ODN (dual-delivery) enhanced CD8+ T cell responses (3.4% IFN-ɣ+ of CD8+) 7-, 18-, and 8-fold relative to immunization with conjugates, ova administered with free CpG, or a formulation containing free ova and CpG complexed to micelles, respectively. Similarly, dual-delivery carriers significantly increased CD4+IFN-ɣ+ (Th1) responses, and elicited a balanced IgG1/IgG2c antibody response. Intradermal administration further augmented cellular immune responses, with dual-delivery carriers inducing ~7% antigen-specific CD8+ T cells. This work demonstrates the ability of pH-responsive, endosomolytic nanoparticles to actively promote antigen cross-presentation and augment cellular and humoral immune responses via dual-delivery of protein antigens and CpG ODN. Hence, pH-responsive polymeric nanoparticles offer promise as a delivery platform for protein subunit vaccines. PMID:23590591

  8. Nicotine induced CpG methylation of Pax6 binding motif in StAR promoter reduces the gene expression and cortisol production

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Tingting; Department of Pharmacology, Uniformed Services University of the Health Sciences, Bethesda, Maryland; Chen, Man

    Steroidogenic acute regulatory protein (StAR) mediates the rate-limiting step in the synthesis of steroid hormones, essential to fetal development. We have reported that the StAR expression in fetal adrenal is inhibited in a rat model of nicotine-induced intrauterine growth retardation (IUGR). Here using primary human fetal adrenal cortex (pHFAC) cells and a human fetal adrenal cell line NCI-H295A, we show that nicotine inhibits StAR expression and cortisol production in a dose- and time-dependent manner, and prolongs the inhibitory effect on cells proliferating over 5 passages after termination of nicotine treatment. Methylation detection within the StAR promoter region uncovers a singlemore » site CpG methylation at nt -377 that is sensitive to nicotine treatment. Nicotine-induced alterations in frequency of this point methylation correlates well with the levels of StAR expression, suggesting an important role of the single site in regulating StAR expression. Further studies using bioinformatics analysis and siRNA approach reveal that the single CpG site is part of the Pax6 binding motif (CGCCTGA) in the StAR promoter. The luciferase activity assays validate that Pax6 increases StAR gene expression by binding to the glucagon G3-like motif (CGCCTGA) and methylation of this site blocks Pax6 binding and thus suppresses StAR expression. These data identify a nicotine-sensitive CpG site at the Pax6 binding motif in the StAR promoter that may play a central role in regulating StAR expression. The results suggest an epigenetic mechanism that may explain how nicotine contributes to onset of adult diseases or disorders such as metabolic syndrome via fetal programming. -- Highlights: Black-Right-Pointing-Pointer Nicotine-induced StAR inhibition in two human adrenal cell models. Black-Right-Pointing-Pointer Nicotine-induced single CpG site methylation in StAR promoter. Black-Right-Pointing-Pointer Persistent StAR inhibition and single CpG methylation after nicotine termination. Black-Right-Pointing-Pointer Single CpG methylation located at Pax6 binding motif regulates StAR expression.« less

  9. Quantitative methylation level of the EPHX1 promoter in peripheral blood DNA is associated with polycystic ovary syndrome.

    PubMed

    Sang, Qing; Li, Xin; Wang, Haojue; Wang, Huan; Zhang, Shaozhen; Feng, Ruizhi; Xu, Yao; Li, Qiaoli; Zhao, Xinzhi; Xing, Qinghe; Jin, Li; He, Lin; Wang, Lei

    2014-01-01

    Steroid synthesis and metabolic pathways play important roles in the pathophysiology of PCOS, but until now there have been no studies on the methylation profiles of specific genes in steroid synthesis pathways that are known to be associated with PCOS. Here we used MassARRAY quantitative methylation analysis to determine the methylation levels of each CpG site or cluster in the promoters of EPHX1, SRD5A1, and CYP11A1 in 64 peripheral blood samples. We further examined the methylation level of EPHX1 in an independent cohort consisting of 116 people. Finally, we investigated the role of EPHX1 in steroidogenesis in the KGN cell line. For SRD5A1 and CYP11A1, there was no significant difference in methylation level between patients and controls. For EPHX1, however, the methylation levels of a few consecutive CpG sites and clusters were found to be significantly associated with PCOS. The methylation levels of a number of CpG clusters or sites were significantly lower in patients than in controls in the first cohort consisting of 64 people, such as clusters 13-14 (P<0.05), 15-16 (P<0.001), and 19-24 (P<0.001) and sites CpG_53 (P<0.01) and CpG_54 (P<0.05). Among differentiated methylation sites and clusters, the methylation levels of the CpG cluster 13-14 and CpG cluster 19-24 in PCOS patients were significantly lower than in controls in the second cohort of 116 people (P<0.05 for both). In addition, knockdown and overexpression experiments in KGN cells showed that EPHX1 can regulate estradiol concentrations, and this indicates a role for EPHX1 in steroidogenesis. Our study has demonstrated that methylation of the EPHX1 promoter might be associated with PCOS. This study provides direct evidence that methylation plays an important role in PCOS and demonstrates a novel role for EPHX1 in female reproduction.

  10. Quantitative Methylation Level of the EPHX1 Promoter in Peripheral Blood DNA Is Associated with Polycystic Ovary Syndrome

    PubMed Central

    Wang, Huan; Zhang, Shaozhen; Feng, Ruizhi; Xu, Yao; Li, Qiaoli; Zhao, Xinzhi; Xing, Qinghe; Jin, Li; He, Lin; Wang, Lei

    2014-01-01

    Steroid synthesis and metabolic pathways play important roles in the pathophysiology of PCOS, but until now there have been no studies on the methylation profiles of specific genes in steroid synthesis pathways that are known to be associated with PCOS. Here we used MassARRAY quantitative methylation analysis to determine the methylation levels of each CpG site or cluster in the promoters of EPHX1, SRD5A1, and CYP11A1 in 64 peripheral blood samples. We further examined the methylation level of EPHX1 in an independent cohort consisting of 116 people. Finally, we investigated the role of EPHX1 in steroidogenesis in the KGN cell line. For SRD5A1 and CYP11A1, there was no significant difference in methylation level between patients and controls. For EPHX1, however, the methylation levels of a few consecutive CpG sites and clusters were found to be significantly associated with PCOS. The methylation levels of a number of CpG clusters or sites were significantly lower in patients than in controls in the first cohort consisting of 64 people, such as clusters 13–14 (P<0.05), 15–16 (P<0.001), and 19–24 (P<0.001) and sites CpG_53 (P<0.01) and CpG_54 (P<0.05). Among differentiated methylation sites and clusters, the methylation levels of the CpG cluster 13–14 and CpG cluster 19–24 in PCOS patients were significantly lower than in controls in the second cohort of 116 people (P<0.05 for both). In addition, knockdown and overexpression experiments in KGN cells showed that EPHX1 can regulate estradiol concentrations, and this indicates a role for EPHX1 in steroidogenesis. Our study has demonstrated that methylation of the EPHX1 promoter might be associated with PCOS. This study provides direct evidence that methylation plays an important role in PCOS and demonstrates a novel role for EPHX1 in female reproduction. PMID:24505354

  11. DNA methylation and transcription in a distal region upstream from the bovine AlphaS1 casein gene after once or twice daily milking.

    PubMed

    Nguyen, Minh; Boutinaud, Marion; Pétridou, Barbara; Gabory, Anne; Pannetier, Maëlle; Chat, Sophie; Bouet, Stephan; Jouneau, Luc; Jaffrezic, Florence; Laloë, Denis; Klopp, Christophe; Brun, Nicolas; Kress, Clémence; Jammes, Hélène; Charlier, Madia; Devinoy, Eve

    2014-01-01

    Once daily milking (ODM) induces a reduction in milk production when compared to twice daily milking (TDM). Unilateral ODM of one udder half and TDM of the other half, enables the study of underlying mechanisms independently of inter-individual variability (same genetic background) and of environmental factors. Our results show that in first-calf heifers three CpG, located 10 kb upstream from the CSN1S1 gene were methylated to 33, 34 and 28%, respectively, after TDM but these levels were higher after ODM, 38, 38 and 33%, respectively. These methylation levels were much lower than those observed in the mammary gland during pregnancy (57, 59 and 50%, respectively) or in the liver (74, 78 and 61%, respectively). The methylation level of a fourth CpG (CpG4), located close by (29% during TDM) was not altered after ODM. CpG4 methylation reached 39.7% and 59.5%, during pregnancy or in the liver, respectively. CpG4 is located within a weak STAT5 binding element, arranged in tandem with a second high affinity STAT5 element. STAT5 binding is only marginally modulated by CpG4 methylation, but it may be altered by the methylation levels of the three other CpG nearby. Our results therefore shed light on mechanisms that help to explain how milk production is almost, but not fully, restored when TDM is resumed (15.1 ± 0.2 kg/day instead of 16.2 ± 0.2 kg/day, p<0.01). The STAT5 elements are 100 bp away from a region transcribed in the antisense orientation, in the mammary gland during lactation, but not during pregnancy or in other reproductive organs (ovary or testes). We now need to clarify whether the transcription of this novel RNA is a consequence of STAT5 interacting with the CSN1S1 distal region, or whether it plays a role in the chromatin structure of this region.

  12. EFFECTS OF ENVIRONMENTAL ANTIANDROGENS IN EXPERIMENTAL ANIMALS

    EPA Science Inventory

    In mammals, the androgens testosterone (T) and dihydrotestosterone (DHT) are critical for normal male reproductive development and function. In humans, drugs that act as androgen receptor (AR) agonists and antagonists or inhibit fetal steroidogenesis can cause pseudohermaphrodi...

  13. Aberrant DNA methylation at genes associated with a stem cell-like phenotype in cholangiocarcinoma tumours

    PubMed Central

    Dai, Wei; Siddiq, Afshan; Walley, Andrew J; Limpaiboon, Temduang; Brown, Robert

    2013-01-01

    Genetic abnormalities of cholangiocarcinoma have been widely studied; however, epigenomic changes related to cholangiocarcinogenesis have been less well characterised. We have profiled the DNA methylomes of 28 primary cholangiocarcinoma and six matched adjacent normal tissues using Infinium’s HumanMethylation27 BeadChips with the aim of identifying gene sets aberrantly epigenetically regulated in this tumour type. Using a linear model for microarray data we identified 1610 differentially methylated autosomal CpG sites with 809 CpG sites (representing 603 genes) being hypermethylated and 801 CpG sites (representing 712 genes) being hypomethylated in cholangiocarcinoma versus adjacent normal tissues (false discovery rate ≤ 0.05). Gene ontology and gene set enrichment analyses identified gene sets significantly associated with hypermethylation at linked CpG sites in cholangiocarcinoma including homeobox genes and target genes of PRC2, EED, SUZ12 and histone H3 trimethylation at lysine 27. We confirmed frequent hypermethylation at the homeobox genes HOXA9 and HOXD9 by bisulfite pyrosequencing in a larger cohort of cholangiocarcinoma (n = 102). Our findings indicate a key role for hypermethylation of multiple CpG sites at genes associated with a stem cell-like phenotype as a common molecular aberration in cholangiocarcinoma. These data have implications for cholangiocarcinogenesis, as well as possible novel treatment options using histone methyltransferase inhibitors. PMID:24089088

  14. Differential methylation of the oxytocin receptor gene in patients with anorexia nervosa: a pilot study.

    PubMed

    Kim, Youl-Ri; Kim, Jeong-Hyun; Kim, Mi Jeong; Treasure, Janet

    2014-01-01

    Recent studies in patients with anorexia nervosa suggest that oxytocin may be involved in the pathophysiology of anorexia nervosa. We examined whether there was evidence of variation in methylation status of the oxytocin receptor (OXTR) gene in patients with anorexia nervosa that might account for these findings. We analyzed the methylation status of the CpG sites in a region from the exon 1 to the MT2 regions of the OXTR gene in buccal cells from 15 patients and 36 healthy women using bisulfite sequencing. We further examined whether methylation status was associated with markers of illness severity or form. We identified six CpG sites with significant differences in average methylation levels between the patient and control groups. Among the six differentially methylated CpG sites, five showed higher than average methylation levels in patients than those in the control group (64.9-88.8% vs. 6.6-45.0%). The methylation levels of these five CpG sites were negatively associated with body mass index (BMI). BMI, eating disorders psychopathology, and anxiety were identified in a regression analysis as factors affecting the methylation levels of these CpG sites with more variation accounted for by BMI. Epigenetic misregulation of the OXTR gene may be implicated in anorexia nervosa, which may either be a mechanism linking environmental adversity to risk or may be a secondary consequence of the illness.

  15. DNA methylation profiles of donor nuclei cells and tissues of cloned bovine fetuses.

    PubMed

    Kremenskoy, Maksym; Kremenska, Yuliya; Suzuki, Masako; Imai, Kei; Takahashi, Seiya; Hashizume, Kazuyoshi; Yagi, Shintaro; Shiota, Kunio

    2006-04-01

    Methylation of DNA in CpG islands plays an important role during fetal development and differentiation because CpG islands are preferentially located in upstream regions of mammalian genomic DNA, including the transcription start site of housekeeping genes and are also associated with tissue-specific genes. Somatic nuclear transfer (NT) technology has been used to generate live clones in numerous mammalian species, but only a low percentage of nuclear transferred animals develop to term. Abnormal epigenetic changes in the CpG islands of donor nuclei after nuclear transfer could contribute to a high rate of abortion during early gestation and increase perinatal death. These changes have yet to be explored. Thus, we investigated the genome-wide DNA methylation profiles of CpG islands in nuclei donor cells and NT animals. Using Restriction Landmark Genomic Scanning (RLGS), we showed, for the first time, the epigenetic profile formation of tissues from NT bovine fetuses produced from cumulus cells. From approximately 2600 unmethylated NotI sites visualized on the RLGS profile, at least 35 NotI sites showed different methylation statuses. Moreover, we proved that fetal and placental tissues from artificially inseminated and cloned cattle have tissue-specific differences in the genome-wide methylation profiles of the CpG islands. We also found that possible abnormalities occurred in the fetal brain and placental tissues of cloned animals.

  16. The influence of providing a clinical practice guideline on dental students' decision making.

    PubMed

    van der Sanden, Wil J M; Mettes, Dirk G; Plasschaert, Alphons J M; Mulder, Jan; Verdonschot, Emiel H

    2004-02-01

    The aim of this study was to assess the effect of the provision of a clinical practice guideline (CPG) on dental students' decisions to remove asymptomatic, impacted lower third molars. All dental students, who in 2001 were in the 3rd, 4th or 5th (final) year of their study at the Nijmegen College of Dental Sciences, were invited to participate. A pre-test-post-test control group design was used. Given 36 patient cases, all dental students were asked to assess the need for removal of asymptomatic, impacted lower third molars. All pre-test respondents were randomly allocated to the control or intervention group. After the provision of a CPG to the intervention group, both groups were asked to assess the same cases again. Frequencies of decisions to remove the third molars were calculated. Chi-square tests and anova were used to test the influence of study year and gender on the drop-out rate and on the effect of the provision of a CPG on students' treatment decisions. The decrease in indications to remove third molars by the intervention group was statistically significant (P < 0.05). In the control group, no significant decrease was observed. It was concluded that the provision of a CPG significantly influences dental students' decision making about treatment in a third-molar decision task. Students who used the CPG showed more guideline-conformed decision making.

  17. Does Epileptiform Activity Represent a Failure of Neuromodulation to Control Central Pattern Generator-Like Neocortical Behavior?

    PubMed Central

    Traub, Roger D.; Whittington, Miles A.; Hall, Stephen P.

    2017-01-01

    Rhythmic motor patterns in invertebrates are often driven by specialized “central pattern generators” (CPGs), containing small numbers of neurons, which are likely to be “identifiable” in one individual compared with another. The dynamics of any particular CPG lies under the control of modulatory substances, amines, or peptides, entering the CPG from outside it, or released by internal constituent neurons; consequently, a particular CPG can generate a given rhythm at different frequencies and amplitudes, and perhaps even generate a repertoire of distinctive patterns. The mechanisms exploited by neuromodulators in this respect are manifold: Intrinsic conductances (e.g., calcium, potassium channels), conductance state of postsynaptic receptors, degree of plasticity, and magnitude and kinetics of transmitter release can all be affected. The CPG concept has been generalized to vertebrate motor pattern generating circuits (e.g., for locomotion), which may contain large numbers of neurons – a construct that is sensible, if there is enough redundancy: that is, the large number of neurons consists of only a small number of classes, and the cells within any one class act stereotypically. Here we suggest that CPG and modulator ideas may also help to understand cortical oscillations, normal ones, and particularly transition to epileptiform pathology. Furthermore, in the case illustrated, the mechanism of the transition appears to be an exaggerated form of a normal modulatory action used to influence sensory processing. PMID:29093667

  18. Platelet-activating factor receptor agonists mediate xeroderma pigmentosum A photosensitivity.

    PubMed

    Yao, Yongxue; Harrison, Kathleen A; Al-Hassani, Mohammed; Murphy, Robert C; Rezania, Samin; Konger, Raymond L; Travers, Jeffrey B

    2012-03-16

    To date, oxidized glycerophosphocholines (Ox-GPCs) with platelet-activating factor (PAF) activity produced non-enzymatically have not been definitively demonstrated to mediate any known disease processes. Here we provide evidence that these Ox-GPCs play a pivotal role in the photosensitivity associated with the deficiency of the DNA repair protein xeroderma pigmentosum type A (XPA). It should be noted that XPA-deficient cells are known to have decreased antioxidant defenses. These studies demonstrate that treatment of human XPA-deficient fibroblasts with the pro-oxidative stressor ultraviolet B (UVB) radiation resulted in increased reactive oxygen species and PAF receptor (PAF-R) agonistic activity in comparison with gene-corrected cells. The UVB irradiation-generated PAF-R agonists were inhibited by antioxidants. UVB irradiation of XPA-deficient (Xpa-/-) mice also resulted in increased PAF-R agonistic activity and skin inflammation in comparison with control mice. The increased UVB irradiation-mediated skin inflammation and TNF-α production in Xpa-/- mice were blocked by systemic antioxidants and by PAF-R antagonists. Structural characterization of PAF-R-stimulating activity in UVB-irradiated XPA-deficient fibroblasts using mass spectrometry revealed increased levels of sn-2 short-chain Ox-GPCs along with native PAF. These studies support a critical role for PAF-R agonistic Ox-GPCs in the pathophysiology of XPA photosensitivity.

  19. Optimization of a Small Tropomyosin-related Kinase B (TrkB) Agonist 7,8-Dihydroxyflavone Active in Mouse Models of Depression

    PubMed Central

    Liu, Xia; Chan, Chi-Bun; Qi, Qi; Xiao, Ge; Luo, Hongbo R.; He, Xiaolin; Ye, Keqiang

    2012-01-01

    Structure-activity relationship study shows that the catechol group in 7,8-dihdyroxyflavone, a selective small TrkB receptor agonist, is critical for the agonistic activity. To improve the poor pharmacokinetic profiles intrinsic to catechol-containing molecules and elevate the agonistic effect of the lead compound, we initiated the lead optimization campaign by synthesizing various bioisosteric derivatives. Here we show that the optimized 2-methyl-8-(4′-(pyrrolidin-1-yl)phenyl)chromeno[7,8-d]imidazol-6(1H)-one derivative possesses the enhanced TrkB stimulatory activity. Chronic oral administration of this compound significantly reduces the immobility in forced swim test and tail suspension test, two classical antidepressant behavioral animal models, which is accompanied by robust TrkB activation in hippocampus of mouse brain. Further, in vitro ADMET studies demonstrate that this compound possesses the improved features compared to the previous lead compound. Hence, this optimized compound may act as a promising lead candidate for in-depth drug development for treating various neurological disorders including depression. PMID:22984948

  20. The Adjuvant LT-K63 Can Restore Delayed Maturation of Follicular Dendritic Cells and Poor Persistence of Both Protein- and Polysaccharide-Specific Antibody-Secreting Cells in Neonatal Mice

    PubMed Central

    Bjarnarson, Stefania P.; Adarna, Brenda C.; Benonisson, Hreinn; Del Giudice, Giuseppe

    2012-01-01

    Ab responses in early life are low and short-lived; therefore, induction of protective immunity requires repeated vaccinations. One of the major limitations in early-life immunity is delayed maturation of follicular dendritic cells (FDCs), which play a central role in mediating the germinal center (GC) reaction leading to production of Ab-secreting cells (AbSCs). We assessed whether a nontoxic mutant of Escherichia coli heat-labile enterotoxin (LT-K63) and CpG1826 as model adjuvants could accelerate FDC maturation and immune response in neonatal mice, using a pneumococcal polysaccharide of serotype 1 conjugated to tetanus toxoid (Pnc1-TT) as a model vaccine. In neonatal NMRI mice, a single dose of Pnc1-TT coadministered with LT-K63 enhanced Pnc1-TT–induced GC reaction. In contrast, CpG1826 had no effect. Accordingly, LT-K63, but not CpG1826, accelerated the maturation of FDC networks, detected by FDC-M2+ staining, characteristic for adult-like FDCs. This coincided with migration of MOMA-1+ macrophages into the GCs that can enhance GC reaction and B cell activation. The FDC-M2+ FDC networks colocalized with enhanced expression of TNF-α, which is critical for the maintenance of mature FDCs and is poorly expressed in neonates. The accelerated maturation of FDC networks correlated with increased frequency and prolonged persistence of polysaccharide- and protein-specific IgG+ AbSCs in spleen and bone marrow. Our data show for the first time, to our knowledge, that an adjuvant (LT-K63) can overcome delayed maturation of FDCs in neonates, enhance the GC reaction, and prolong the persistence of vaccine-specific AbSCs in the BM. These properties are attractive for parenteral vaccination in early life. PMID:22753937

  1. Factors affecting the persistence of drug-induced reprogramming of the cancer methylome

    PubMed Central

    Bell, Joshua S. K.; Kagey, Jacob D.; Barwick, Benjamin G.; Dwivedi, Bhakti; McCabe, Michael T.; Kowalski, Jeanne; Vertino, Paula M.

    2016-01-01

    ABSTRACT Aberrant DNA methylation is a critical feature of cancer. Epigenetic therapy seeks to reverse these changes to restore normal gene expression. DNA demethylating agents, including 5-aza-2′-deoxycytidine (DAC), are currently used to treat certain leukemias, and can sensitize solid tumors to chemotherapy and immunotherapy. However, it has been difficult to pin the clinical efficacy of these agents to specific demethylation events, and the factors that contribute to the durability of response remain largely unknown. Here we examined the genome-wide kinetics of DAC-induced DNA demethylation and subsequent remethylation after drug withdrawal in breast cancer cells. We find that CpGs differ in both their susceptibility to demethylation and propensity for remethylation after drug removal. DAC-induced demethylation was most apparent at CpGs with higher initial methylation levels and further from CpG islands. Once demethylated, such sites exhibited varied remethylation potentials. The most rapidly remethylating CpGs regained >75% of their starting methylation within a month of drug withdrawal. These sites had higher pretreatment methylation levels, were enriched in gene bodies, marked by H3K36me3, and tended to be methylated in normal breast cells. In contrast, a more resistant class of CpG sites failed to regain even 20% of their initial methylation after 3 months. These sites had lower pretreatment methylation levels, were within or near CpG islands, marked by H3K79me2 or H3K4me2/3, and were overrepresented in sites that become aberrantly hypermethylated in breast cancers. Thus, whereas DAC-induced demethylation affects both endogenous and aberrantly methylated sites, tumor-specific hypermethylation is more slowly regained, even as normal methylation promptly recovers. Taken together, these data suggest that the durability of DAC response is linked to its selective ability to stably reset at least a portion of the cancer methylome. PMID:27082926

  2. EFFECTS OF ENVIRONMENTAL ANTIANDROGENS ON REPRODUCTIVE DEVELOPMENT IN EXPERIMENTAL ANIMALS

    EPA Science Inventory

    In mammals, the androgens testosterone (T) and dihydrotestosterone (DHT) are critical for normal male reproductive development and function. In humans, drugs that act as androgen receptor (AR) agonists and antagonists or inhibit fetal steroidogenesis can cause pseudohermaphrodi...

  3. Endogenous stem cell proliferation induced by intravenous hedgehog agonist administration after contusion in the adult rat spinal cord.

    PubMed

    Bambakidis, Nicholas C; Horn, Eric M; Nakaji, Peter; Theodore, Nicholas; Bless, Elizabeth; Dellovade, Tammy; Ma, Chiyuan; Wang, Xukui; Preul, Mark C; Coons, Stephen W; Spetzler, Robert F; Sonntag, Volker K H

    2009-02-01

    Sonic hedgehog (Shh) is a glycoprotein molecule that upregulates the transcription factor Gli1. The Shh protein plays a critical role in the proliferation of endogenous neural precursor cells when directly injected into the spinal cord after a spinal cord injury in adult rodents. Small-molecule agonists of the hedgehog (Hh) pathway were used in an attempt to reproduce these findings through intravenous administration. The expression of Gli1 was measured in rat spinal cord after the intravenous administration of an Hh agonist. Ten adult rats received a moderate contusion and were treated with either an Hh agonist (10 mg/kg, intravenously) or vehicle (5 rodents per group) 1 hour and 4 days after injury. The rats were killed 5 days postinjury. Tissue samples were immediately placed in fixative. Samples were immunohistochemically stained for neural precursor cells, and these cells were counted. Systemic dosing with an Hh agonist significantly upregulated Gli1 expression in the spinal cord (p < 0.005). After spinal contusion, animals treated with the Hh agonist had significantly more nestin-positive neural precursor cells around the rim of the lesion cavity than in vehicle-treated controls (means +/- SDs, 46.9 +/- 12.9 vs 20.9 +/- 8.3 cells/hpf, respectively, p < 0.005). There was no significant difference in the area of white matter injury between the groups. An intravenous Hh agonist at doses that upregulate spinal cord Gli1 transcription also increases the population of neural precursor cells after spinal cord injury in adult rats. These data support previous findings based on injections of Shh protein directly into the spinal cord.

  4. Immunoregulation of GVHD by triggering the innate immune system with CpG.

    PubMed

    Morecki, Shoshana; Slavin, Shimon

    2009-08-01

    Stimulation of Toll-like receptors by oligodeoxynucleotide sequences containing a CpG motif provides signals capable of triggering the innate and adaptive immune systems, thereby leading either to stimulation or suppression of immunoreactivities. Similar immunoregulatory capabilities are necessary for achieving the fine balance between engraftment and graft-versus-host disease required in the setup of allogeneic cell therapy. Ligation of CpG to its Toll-like receptors can be accomplished by treatment of the host or pretransplant treatment of the donor in vivo. These different strategies are presented in this review, which summarizes the attempts to maximize beneficial alloreactivity against malignant or other undesirable host cells, while controlling graft-versus-host disease.

  5. CpG methylation in human papillomavirus (HPV) type 31 long control region (LCR) in cervical infections associated with cytological abnormalities.

    PubMed

    László, Brigitta; Ferenczi, Annamária; Madar, László; Gyöngyösi, Eszter; Szalmás, Anita; Szakács, Levente; Veress, György; Kónya, József

    2016-08-01

    The mechanisms that regulate papillomavirus gene expression include DNA methylation. The transcription of papillomavirus oncogenes E6 and E7 is controlled by certain regulatory elements in the LCR, which include binding sites for the E2 protein, a viral regulator of oncogene expression. In HPV-31-infected exfoliated cervical cells, the CpG methylation of the entire LCR was determined by next-generation sequencing after bisulfite modification. Six of the 22 cases had methylated CpG sites in the HPV-31 LCR, including position 7479 and/or 7485, at the promoter distal E2 binding site, thus suggesting a potential regulatory mechanism for papillomavirus transcription.

  6. The active analog approach applied to the pharmacophore identification of benzodiazepine receptor ligands

    NASA Astrophysics Data System (ADS)

    Tebib, Souhail; Bourguignon, Jean-Jacques; Wermuth, Camille-Georges

    1987-07-01

    Applied to seven potent benzodiazepine-receptor ligands belonging to chemically different classes, the active analog approach allowed the stepwise identification of the pharmacophoric pattern associated with the recognition by the benzodiazepine receptor. A unique pharmacophore model was derived which involves six critical zones: (a) a π-electron rich aromatic (PAR) zone; (b) two electron-rich zones δ1 and δ2 placed at 5.0 and 4.5 Å respectively from the reference centroid in the PAR zone; (c) a freely rotating aromatic ring (FRA) region; (d) an out-of-plane region (OPR), strongly associated with agonist properties; and (e) an additional hydrophobic region (AHR). The model accommodates all presently known ligands of the benzodiazepine receptor, identifies sensitivity to steric hindrance close to the δ1 zone, accounts for R and S differential affinities and distinguishes requirements for agonist versus non-agonist activity profiles.

  7. Efficacy of QCDCR formulated CpG ODN 2007 in Nile tilapia against Streptococcus iniae and identification of upregulated genes

    USDA-ARS?s Scientific Manuscript database

    The potential of using a QCDCR (quilA:cholesterol:dimethyl dioctadecyl ammonium bromide:carbopol:R1005 glycolipid) formulated CpG oligodeoxynucleotide (ODN), ODN 2007, to confer protection in Nile tilapia against Streptococcus iniae infection was evaluated in this study. At two days post treatment, ...

  8. CpG DNA: A pathogenic factor in systemic lupus erythematosus?

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krieg, A.M.

    1995-11-01

    Systemic lupus erythematosus (SLE) is a multifactorial disease of unknown etiology. Characteristic features of SLE include (1) polyclonal B cell activation, (2) overexpression of the immune stimulatory cytokine interleukin-6 (IL-6), (3) defective tolerance to self antigens, and (4) production of anti-DNA antibodies (Ab). Bacterial infection has been suspected as a triggering factor for lupus. Bacterial DNA differs from vertebrate DNA in the frequency and methylation of CpG dinucleotides. These CpG motifs in bacterial DNA induce a variety of immune effects, including (1) polyclonal activation of murine and human B cells, (2) IL-6 secretion, and (3) resistance to apoptosis, thereby potentiallymore » allowing the survival of autoreactive cells. These results suggest that microbial DNA could therefore be a pathogenic factor in SLE. SLE patients have elevated levels of circulating plasma DNA which is reportedly enriched in hypomethylated CpGs. Genomic DNA is also hypomethylated in SLE. The purpose of this review is to summarize the immune effects of CpG motifs and to present the evidence for their possible involvement in the pathogenesis of SLE. 77 refs.« less

  9. CpG Methylation Analysis—Current Status of Clinical Assays and Potential Applications in Molecular Diagnostics

    PubMed Central

    Sepulveda, Antonia R.; Jones, Dan; Ogino, Shuji; Samowitz, Wade; Gulley, Margaret L.; Edwards, Robin; Levenson, Victor; Pratt, Victoria M.; Yang, Bin; Nafa, Khedoudja; Yan, Liying; Vitazka, Patrick

    2009-01-01

    Methylation of CpG islands in gene promoter regions is a major molecular mechanism of gene silencing and underlies both cancer development and progression. In molecular oncology, testing for the CpG methylation of tissue DNA has emerged as a clinically useful tool for tumor detection, outcome prediction, and treatment selection, as well as for assessing the efficacy of treatment with the use of demethylating agents and monitoring for tumor recurrence. In addition, because CpG methylation occurs early in pre-neoplastic tissues, methylation tests may be useful as markers of cancer risk in patients with either infectious or inflammatory conditions. The Methylation Working Group of the Clinical Practice Committee of the Association of Molecular Pathology has reviewed the current state of clinical testing in this area. We report here our summary of both the advantages and disadvantages of various methods, as well as the needs for standardization and reporting. We then conclude by summarizing the most promising areas for future clinical testing in cancer molecular diagnostics. PMID:19541921

  10. Systematic feature selection improves accuracy of methylation-based forensic age estimation in Han Chinese males.

    PubMed

    Feng, Lei; Peng, Fuduan; Li, Shanfei; Jiang, Li; Sun, Hui; Ji, Anquan; Zeng, Changqing; Li, Caixia; Liu, Fan

    2018-03-23

    Estimating individual age from biomarkers may provide key information facilitating forensic investigations. Recent progress has shown DNA methylation at age-associated CpG sites as the most informative biomarkers for estimating the individual age of an unknown donor. Optimal feature selection plays a critical role in determining the performance of the final prediction model. In this study we investigate methylation levels at 153 age-associated CpG sites from 21 previously reported genomic regions using the EpiTYPER system for their predictive power on individual age in 390 Han Chinese males ranging from 15 to 75 years of age. We conducted a systematic feature selection using a stepwise backward multiple linear regression analysis as well as an exhaustive searching algorithm. Both approaches identified the same subset of 9 CpG sites, which in linear combination provided the optimal model fitting with mean absolute deviation (MAD) of 2.89 years of age and explainable variance (R 2 ) of 0.92. The final model was validated in two independent Han Chinese male samples (validation set 1, N = 65, MAD = 2.49, R 2  = 0.95, and validation set 2, N = 62, MAD = 3.36, R 2  = 0.89). Other competing models such as support vector machine and artificial neural network did not outperform the linear model to any noticeable degree. The validation set 1 was additionally analyzed using Pyrosequencing technology for cross-platform validation and was termed as validation set 3. Directly applying our model, in which the methylation levels were detected by the EpiTYPER system, to the data from pyrosequencing technology showed, however, less accurate results in terms of MAD (validation set 3, N = 65 Han Chinese males, MAD = 4.20, R 2  = 0.93), suggesting the presence of a batch effect between different data generation platforms. This batch effect could be partially overcome by a z-score transformation (MAD = 2.76, R 2  = 0.93). Overall, our systematic feature selection identified 9 CpG sites as the optimal subset for forensic age estimation and the prediction model consisting of these 9 markers demonstrated high potential in forensic practice. An age estimator implementing our prediction model allowing missing markers is freely available at http://liufan.big.ac.cn/AgePrediction. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. pcDNA-IL-12 vaccination blocks eosinophilic inflammation but not airway hyperresponsiveness following murine Toxocara canis infection.

    PubMed

    Malheiro, Adriana; Aníbal, Fernanda F; Martins-Filho, Olindo Assis; Teixeira-Carvalho, Andréa; Perini, Adenir; Martins, Milton A; Medeiros, Alexandra I; Turato, Walter M; Acencio, Milene P M; Brandão, Izaíra T; Nomizo, Auro; Silva, Célio L; Faccioli, Lúcia H

    2008-01-17

    We have investigated the effect of pcDNA3-CpG and pcDNA-IL-12, delivered by intradermal gene gun administration, on the blood/lung eosinophilia, airway hyperresponsiveness as well as the immune response in a murine model of toxocariasis. Our results demonstrated that pcDNA-IL-12 but not pcDNA3-CpG vaccination led to a persistent lower blood/bronchoalveolar eosinophilia following Toxocara canis infection, as pcDNA3-CpG led only to an early transient blockage of eosinophil transmigration into bronchoalveolar fluid following T. canis infection. Prominent Type-1 immune response was pointed out as the hallmark of T. canis infection following pcDNA-IL-12 vaccination. Outstanding IFN-gamma/IL-4 ratio besides low levels of IgG1 with subsequent high IgG2a/IgG1 ratio further characterized a Type-1 polarized immunological profile in pcDNA-IL-12-vaccinated animals. Nevertheless, only pcDNA3-CpG was able to prevent airway hyperresponsiveness induced by T. canis infection. The persistent airway hyperresponsiveness observed in pcDNA-IL-12-vaccinated animals demonstrated that the airway constriction involved other immunological mediator than those blocked by pcDNA-IL-12. Together, these data indicated that pcDNA-IL-12 and pcDNA3-CpG vaccines have distinct therapeutic benefits regarding the eosinophilic inflammation/airway hyperresponsiveness triggered by T. canis infection, suggesting their possible use in further combined therapeutic interventions.

  12. Oxytocin Receptor Genetic and Epigenetic Variations: Association With Child Abuse and Adult Psychiatric Symptoms.

    PubMed

    Smearman, Erica L; Almli, Lynn M; Conneely, Karen N; Brody, Gene H; Sales, Jessica M; Bradley, Bekh; Ressler, Kerry J; Smith, Alicia K

    2016-01-01

    Childhood abuse can alter biological systems and increase risk for adult psychopathology. Epigenetic mechanisms, alterations in DNA structure that regulate the gene expression, are a potential mechanism underlying this risk. While abuse associates with methylation of certain genes, particularly those in the stress response system, no study to date has evaluated abuse and methylation of the oxytocin receptor (OXTR). However, studies support a role for OXTR in the link between abuse and adverse adult outcomes, showing that abuse can confer greater risk for psychiatric symptoms in those with specific OXTR genotypes. This study therefore sought to (a) assess the role of epigenetics in the link between abuse and psychopathology and (b) begin to integrate the genetic and epigenetic literature by exploring associations between OXTR genotypes and DNA CpG methylation. Data on 18 OXTR CpG sites, 44 single nucleotide polymorphisms, childhood abuse, and adult depression and anxiety symptoms were assessed in 393 African American adults (age = 41 ± 12.8 years). Overall, 68% of genotypes were associated with methylation of nearby CpG sites, with a subset surviving multiple test correction. Child abuse associated with higher methylation of two CpG sites yet did not survive correction or serve as a mediator of psychopathology. However, abuse interacted with CpG methylation to predict psychopathology. These findings suggest a role for OXTR in understanding the influence of early environments on adult psychiatric symptoms. © 2016 The Authors. Child Development © 2016 Society for Research in Child Development, Inc.

  13. CpG island methylation profile in non-invasive oral rinse samples is predictive of oral and pharyngeal carcinoma.

    PubMed

    Langevin, Scott M; Eliot, Melissa; Butler, Rondi A; Cheong, Agnes; Zhang, Xiang; McClean, Michael D; Koestler, Devin C; Kelsey, Karl T

    2015-01-01

    There are currently no screening tests in routine use for oral and pharyngeal cancer beyond visual inspection and palpation, which are provided on an opportunistic basis, indicating a need for development of novel methods for early detection, particularly in high-risk populations. We sought to address this need through comprehensive interrogation of CpG island methylation in oral rinse samples. We used the Infinium HumanMethylation450 BeadArray to interrogate DNA methylation in oral rinse samples collected from 154 patients with incident oral or pharyngeal carcinoma prior to treatment and 72 cancer-free control subjects. Subjects were randomly allocated to either a training or a testing set. For each subject, average methylation was calculated for each CpG island represented on the array. We applied a semi-supervised recursively partitioned mixture model to the CpG island methylation data to identify a classifier for prediction of case status in the training set. We then applied the resultant classifier to the testing set for validation and to assess the predictive accuracy. We identified a methylation classifier comprised of 22 CpG islands, which predicted oral and pharyngeal carcinoma with a high degree of accuracy (AUC = 0.92, 95 % CI 0.86, 0.98). This novel methylation panel is a strong predictor of oral and pharyngeal carcinoma case status in oral rinse samples and may have utility in early detection and post-treatment follow-up.

  14. Genomic sequencing and in vivo footprinting of an expression-specific DNase I-hypersensitive site of avian vitellogenin II promoter reveal a demethylation of a mCpG and a change in specific interactions of proteins with DNA.

    PubMed Central

    Saluz, H P; Feavers, I M; Jiricny, J; Jost, J P

    1988-01-01

    Genomic sequencing was used to study the in vivo methylation pattern of two CpG sites in the promoter region of the avian vitellogenin gene. The CpG at position +10 was fully methylated in DNA isolated from tissues that do not express the gene but was unmethylated in the liver of mature hens and estradiol-treated roosters. In the latter tissue, this site became demethylated and DNase I hypersensitive after estradiol treatment. A second CpG (position -52) was unmethylated in all tissues examined. In vivo genomic footprinting with dimethyl sulfate revealed different patterns of DNA protection in silent and expressed genes. In rooster liver cells, at least 10 base pairs of DNA, including the methylated CpG, were protected by protein(s). Gel-shift assays indicated that a protein factor, present in rooster liver nuclear extract, bound at this site only when it was methylated. In hen liver cells, the same unmethylated CpG lies within a protected region of approximately equal to 20 base pairs. In vitro DNase I protection and gel-shift assays indicate that this sequence is bound by a protein, which binds both double- and single-stranded DNA. For the latter substrate, this factor was shown to bind solely the noncoding (i.e., mRNA-like) strand. Images PMID:3413118

  15. Changes in the activity of a CpG neuron after the reinforcement of an operantly conditioned behavior in Lymnaea.

    PubMed

    Spencer, Gaynor E; Kazmi, Mustapha H; Syed, Naweed I; Lukowiak, Ken

    2002-10-01

    We have previously shown that the aerial respiratory behavior of the mollusk Lymnaea stagnalis can be operantly conditioned, and the central pattern generating (CPG) neurons underlying this behavior have been identified. As neural correlates of operant conditioning remain poorly defined in both vertebrates and invertebrates, we have used the Lymnaea respiratory CPG to investigate neuronal changes associated with the change in behavior after conditioning. After operant conditioning of the intact animals, semi-intact preparations were dissected, so that changes in the respiratory behavior (pneumostome openings) and underlying activity of the identified CPG neuron, right pedal dorsal 1 (RPeD1), could be monitored simultaneously. RPeD1 was studied because it initiates the rhythmic activity of the CPG and receives chemo-sensory input from the pneumostome area. Pneumostome openings and RPeD1 activity were monitored both before and after a reinforcing training stimulus applied to the open pneumostome of operantly conditioned and yoked control preparations. After presentation of the reinforcing stimulus, there was a significant reduction in both breathing behavior and RPeD1 activity in operant preparations but not in yoked and naïve controls. Furthermore these changes were only significant in the subgroup of operantly conditioned animals described as good learners and not in poor learners. These data strongly suggest that changes in RPeD1 activity may underlie the behavioral changes associated with the reinforcement of operant conditioning of the respiratory behavior.

  16. Unique DNA methylome profiles in CpG island methylator phenotype colon cancers

    PubMed Central

    Xu, Yaomin; Hu, Bo; Choi, Ae-Jin; Gopalan, Banu; Lee, Byron H.; Kalady, Matthew F.; Church, James M.; Ting, Angela H.

    2012-01-01

    A subset of colorectal cancers was postulated to have the CpG island methylator phenotype (CIMP), a higher propensity for CpG island DNA methylation. The validity of CIMP, its molecular basis, and its prognostic value remain highly controversial. Using MBD-isolated genome sequencing, we mapped and compared genome-wide DNA methylation profiles of normal, non-CIMP, and CIMP colon specimens. Multidimensional scaling analysis revealed that each specimen could be clearly classified as normal, non-CIMP, and CIMP, thus signifying that these three groups have distinctly different global methylation patterns. We discovered 3780 sites in various genomic contexts that were hypermethylated in both non-CIMP and CIMP colon cancers when compared with normal colon. An additional 2026 sites were found to be hypermethylated in CIMP tumors only; and importantly, 80% of these sites were located in CpG islands. These data demonstrate on a genome-wide level that the additional hypermethylation seen in CIMP tumors occurs almost exclusively at CpG islands and support definitively that these tumors were appropriately named. When these sites were examined more closely, we found that 25% were adjacent to sites that were also hypermethylated in non-CIMP tumors. Thus, CIMP is also characterized by more extensive methylation of sites that are already prone to be hypermethylated in colon cancer. These observations indicate that CIMP tumors have specific defects in controlling both DNA methylation seeding and spreading and serve as an important first step in delineating molecular mechanisms that control these processes. PMID:21990380

  17. Genome-wide DNA methylation profiling identifies ALDH1A3 promoter methylation as a prognostic predictor in G-CIMP- primary glioblastoma.

    PubMed

    Zhang, Wei; Yan, Wei; You, Gan; Bao, Zhaoshi; Wang, Yongzhi; Liu, Yanwei; You, Yongping; Jiang, Tao

    2013-01-01

    To date, the aberrations in the DNA methylation patterns that are associated with different prognoses of G-CIMP- primary GBMs remain to be elucidated. Here, DNA methylation profiling of primary GBM tissues from 13 long-term survivors (LTS; overall survival ⩾18months) and 20 short-term survivors (STS; overall survival ⩽9months) was performed. Then G-CIMP+ samples were excluded. The differentially expressed CpG loci were identified between residual 18 STS and 9 LTS G-CIMP- samples. Methylation levels of 11 CpG loci (10genes) were statistically significantly lower, and 43 CpG loci (40genes) were statistically significantly higher in the tumor tissues of LTS than those of STS G-CIMP- samples (P<0.01). Of the 43 CpG loci that were hypermethylated in LTS G-CIMP- samples, 3 CpG loci localized in the promoter of ALDH1A3. Furthermore, using an independent validation cohort containing 37 primary GBM samples without IDH1 mutation and MGMT promoter methylation, the hypermethylation status of ALDH1A3 promoter predicted a better prognosis with an accompanied low expression of ALDH1A3 protein. Taken together, our results defined prognosis-related methylation signatures systematically for the first time in G-CIMP- primary GBMs. ALDH1A3 promoter methylation conferred a favorable prognosis in G-CIMP- primary GBMs. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  18. Peripheral oxygen-sensing cells directly modulate the output of an identified respiratory central pattern generating neuron.

    PubMed

    Bell, Harold J; Inoue, Takuya; Shum, Kelly; Luk, Collin; Syed, Naweed I

    2007-06-01

    Breathing is an essential homeostatic behavior regulated by central neuronal networks, often called central pattern generators (CPGs). Despite ongoing advances in our understanding of the neural control of breathing, the basic mechanisms by which peripheral input modulates the activities of the central respiratory CPG remain elusive. This lack of fundamental knowledge vis-à-vis the role of peripheral influences in the control of the respiratory CPG is due in large part to the complexity of mammalian respiratory control centres. We have therefore developed a simpler invertebrate model to study the basic cellular and synaptic mechanisms by which a peripheral chemosensory input affects the central respiratory CPG. Here we report on the identification and characterization of peripheral chemoreceptor cells (PCRCs) that relay hypoxia-sensitive chemosensory information to the known respiratory CPG neuron right pedal dorsal 1 in the mollusk Lymnaea stagnalis. Selective perfusion of these PCRCs with hypoxic saline triggered bursting activity in these neurons and when isolated in cell culture these cells also demonstrated hypoxic sensitivity that resulted in membrane depolarization and spiking activity. When cocultured with right pedal dorsal 1, the PCRCs developed synapses that exhibited a form of short-term synaptic plasticity in response to hypoxia. Finally, osphradial denervation in intact animals significantly perturbed respiratory activity compared with their sham counterparts. This study provides evidence for direct synaptic connectivity between a peripheral regulatory element and a central respiratory CPG neuron, revealing a potential locus for hypoxia-induced synaptic plasticity underlying breathing behavior.

  19. Identification of Gene Networks Associated with Acute Myeloid Leukemia by Comparative Molecular Methylation and Expression Profiling

    PubMed Central

    Dellett, Margaret; O’Hagan, Kathleen Ann; Colyer, Hilary Ann Alexandra; Mills, Ken I.

    2010-01-01

    Around 80% of acute myeloid leukemia (AML) patients achieve a complete remission, however many will relapse and ultimately die of their disease. The association between karyotype and prognosis has been studied extensively and identified patient cohorts as having favourable [e.g. t(8; 21), inv (16)/t(16; 16), t(15; 17)], intermediate [e.g. cytogenetically normal (NK-AML)] or adverse risk [e.g. complex karyotypes]. Previous studies have shown that gene expression profiling signatures can classify the sub-types of AML, although few reports have shown a similar feature by using methylation markers. The global methylation patterns in 19 diagnostic AML samples were investigated using the Methylated CpG Island Amplification Microarray (MCAM) method and CpG island microarrays containing 12,000 CpG sites. The first analysis, comparing favourable and intermediate cytogenetic risk groups, revealed significantly differentially methylated CpG sites (594 CpG islands) between the two subgroups. Mutations in the NPM1 gene occur at a high frequency (40%) within the NK-AML subgroup and are associated with a more favourable prognosis in these patients. A second analysis comparing the NPM1 mutant and wild-type research study subjects again identified distinct methylation profiles between these two subgroups. Network and pathway analysis revealed possible molecular mechanisms associated with the different risk and/or mutation sub-groups. This may result in a better classification of the risk groups, improved monitoring targets, or the identification of novel molecular therapies. PMID:24179384

  20. Differential Effects of the Cannabinoid Agonist WIN55,212-2 on Delay and Trace Eyeblink Conditioning

    PubMed Central

    Steinmetz, Adam B.; Freeman, John H.

    2014-01-01

    Central cannabinoid-1 receptors (CB1R) play a role in the acquisition of delay eyeblink conditioning but not trace eyeblink conditioning in humans and animals. However, it is not clear why trace conditioning is immune to the effects of cannabinoid receptor compounds. The current study examined the effects of variants of delay and trace conditioning procedures to elucidate the factors that determine the effects of CB1R agonists on eyeblink conditioning. In Experiment 1 rats were administered the cannabinoid agonist WIN55,212-2 during delay, long delay, or trace conditioning. Rats were impaired during delay and long delay but not trace conditioning; the impairment was greater for long delay than delay conditioning. Trace conditioning was further examined in Experiment 2 by manipulating the trace interval and keeping constant the conditioned stimulus (CS) duration. It was found that when the trace interval was 300 ms or less WIN55,212-2 administration impaired the rate of learning. Experiment 3 tested whether the trace interval duration or the relative durations of the CS and trace interval were critical parameters influencing the effects of WIN55,212-2 on eyeblink conditioning. Rats were not impaired with a 100 ms CS, 200 ms trace paradigm but were impaired with a 1000 ms CS, 500 ms trace paradigm, indicating that the duration of the trace interval does not matter but the proportion of the interstimulus interval occupied by the CS relative to the trace period is critical. Taken together the results indicate that cannabinoid agonists affect cerebellar learning the CS is longer than the trace interval. PMID:24128358

  1. Effect of dietary betaine supplementation on lipogenesis gene expression and CpG methylation of lipoprotein lipase gene in broilers.

    PubMed

    Xing, Jinyi; Kang, Li; Jiang, Yunliang

    2011-03-01

    Experiments were conducted to investigate the effect of betaine supplementation on mRNA expression levels of lipogenesis genes and CpG methylation of lipoprotein lipase gene (LPL) in broilers. From 22 days of age, 78 broilers were feed basal diet without betaine and basal diet supplemented with 0.1% betaine, respectively, and at 56 and 66 days of age, the traits of 15 chickens (7 males and 8 females) of each group were recorded and abdominal fat pads were collected. The mRNA expression levels of several lipogenesis gene were analyzed by semi-quantitative RT-PCR and real-time quantitative RT-PCR (qPCR), respectively. The CpG methylation profile at the promoter region of LPL gene in 66-day-old broilers was determined by bisulfite sequencing. The average daily gain and percent abdominal fat traits were slightly improved in 56-day-old and 66-day-old broilers after dietary supplementation of betaine to diet. After adding 0.1% betaine to diet, the mRNA levels of fatty acid synthase (FAS) and adipocyte-type fatty acid-binding protein genes in abdominal adipose were significantly decreased in 56-day-old broilers, and those of LPL and FAS genes in abdominal adipose were significantly decreased in 66-day-old broilers comparing with the control group (P < 0.05 and P < 0.001). Moreover, in 66-day-old broilers fed 0.1% betaine diet, a different CpG methylation pattern was observed: the CpG dinucleotides of 1st, 6th, 7th, 8th and from 10th to 50th were less methylated; however, those of 2nd, 5th and 9th were more heavily methylated. The results suggest that transcription of some lipogenesis genes was decreased by betaine supplementation and betaine may decrease LPL mRNA expression by altering CpG methylation pattern on LPL promoter region.

  2. Distribution of CpG Motifs in Upstream Gene Domains in a Reef Coral and Sea Anemone: Implications for Epigenetics in Cnidarians.

    PubMed

    Marsh, Adam G; Hoadley, Kenneth D; Warner, Mark E

    2016-01-01

    Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG) motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera) and an anemone (Nematostella vectensis). Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS) are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to environmental stress in reef corals and potential roles of epigenetics on survival and fitness in the face of global climate change.

  3. Gene expression profiling of chicken cecal tonsils and ileum following oral exposure to soluble and PLGA-encapsulated CpG ODN, and lysate of Campylobacter jejuni.

    PubMed

    Taha-Abdelaziz, Khaled; Alkie, Tamiru Negash; Hodgins, Douglas C; Yitbarek, Alexander; Shojadoost, Bahram; Sharif, Shayan

    2017-12-01

    Campylobacter jejuni (C. jejuni) is a leading bacterial cause of food-borne illness in humans. Contaminated chicken meat is an important source of infection for humans. Chickens are not clinically affected by colonization, and immune responses following natural infection have limited effects on bacterial load in the gut. Induction of intestinal immune responses may possibly lead to a breakdown of the commensal relationship of chickens with Campylobacter. We have recently shown that soluble and poly D, L-lactic-co-glycolic acid (PLGA)-encapsulated CpG oligodeoxynucleotide (ODN) as well as C. jejuni lysate, are effective in reducing the intestinal burden of C. jejuni in chickens; however, the mechanisms behind this protection have yet to be determined. The present study was undertaken to investigate the mechanisms of host responses conferred by these treatments. Chickens were treated orally with soluble CpG ODN, or PLGA-encapsulated CpG ODN, or C. jejuni lysate, and expression of cytokines and antimicrobial peptides was evaluated in cecal tonsils and ileum using quantitative RT-PCR. Oral administration of soluble CpG ODN upregulated the expression of interferon (IFN)-γ, interleukin (IL)-1β, CXCLi2, transforming growth factor (TGF)-β4/1, IL-10 and IL-13, while treatment with PLGA-encapsulated CpG ODN upregulated the expression of IL-1β, CXCLi2, TGF-β4/1, IL-13, avian β-defensin (AvBD) 1, AvBD2 and cathelicidin 3 (CATHL-3). C. jejuni lysate upregulated the expression of IFN-γ, IL-1β, TGF-β4/1, IL-13, AvBD1, and CATHL-3. In conclusion, induction of cytokine and antimicrobial peptides expression in intestinal microenvironments may provide a means of reducing C. jejuni colonization in broiler chickens, a key step in reducing the incidence of campylobacteriosis in humans. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Influence of the Prader-Willi syndrome imprinting center on the DNA methylation landscape in the mouse brain

    PubMed Central

    Brant, Jason O; Riva, Alberto; Resnick, James L; Yang, Thomas P

    2014-01-01

    Reduced representation bisulfite sequencing (RRBS) was used to analyze DNA methylation patterns across the mouse brain genome in mice carrying a deletion of the Prader-Willi syndrome imprinting center (PWS-IC) on either the maternally- or paternally-inherited chromosome. Within the ∼3.7 Mb imprinted Angelman/Prader-Willi syndrome (AS/PWS) domain, 254 CpG sites were interrogated for changes in methylation due to PWS-IC deletion. Paternally-inherited deletion of the PWS-IC increased methylation levels ∼2-fold at each CpG site (compared to wild-type controls) at differentially methylated regions (DMRs) associated with 5′ CpG island promoters of paternally-expressed genes; these methylation changes extended, to a variable degree, into the adjacent CpG island shores. Maternal PWS-IC deletion yielded little or no changes in methylation at these DMRs, and methylation of CpG sites outside of promoter DMRs also was unchanged upon maternal or paternal PWS-IC deletion. Using stringent ascertainment criteria, ∼750,000 additional CpG sites were also interrogated across the entire mouse genome. This analysis identified 26 loci outside of the imprinted AS/PWS domain showing altered DNA methylation levels of ≥25% upon PWS-IC deletion. Curiously, altered methylation at 9 of these loci was a consequence of maternal PWS-IC deletion (maternal PWS-IC deletion by itself is not known to be associated with a phenotype in either humans or mice), and 10 of these loci exhibited the same changes in methylation irrespective of the parental origin of the PWS-IC deletion. These results suggest that the PWS-IC may affect DNA methylation at these loci by directly interacting with them, or may affect methylation at these loci through indirect downstream effects due to PWS-IC deletion. They further suggest the PWS-IC may have a previously uncharacterized function outside of the imprinted AS/PWS domain. PMID:25482058

  5. Influence of the Prader-Willi syndrome imprinting center on the DNA methylation landscape in the mouse brain.

    PubMed

    Brant, Jason O; Riva, Alberto; Resnick, James L; Yang, Thomas P

    2014-11-01

    Reduced representation bisulfite sequencing (RRBS) was used to analyze DNA methylation patterns across the mouse brain genome in mice carrying a deletion of the Prader-Willi syndrome imprinting center (PWS-IC) on either the maternally- or paternally-inherited chromosome. Within the ~3.7 Mb imprinted Angelman/Prader-Willi syndrome (AS/PWS) domain, 254 CpG sites were interrogated for changes in methylation due to PWS-IC deletion. Paternally-inherited deletion of the PWS-IC increased methylation levels ~2-fold at each CpG site (compared to wild-type controls) at differentially methylated regions (DMRs) associated with 5' CpG island promoters of paternally-expressed genes; these methylation changes extended, to a variable degree, into the adjacent CpG island shores. Maternal PWS-IC deletion yielded little or no changes in methylation at these DMRs, and methylation of CpG sites outside of promoter DMRs also was unchanged upon maternal or paternal PWS-IC deletion. Using stringent ascertainment criteria, ~750,000 additional CpG sites were also interrogated across the entire mouse genome. This analysis identified 26 loci outside of the imprinted AS/PWS domain showing altered DNA methylation levels of ≥25% upon PWS-IC deletion. Curiously, altered methylation at 9 of these loci was a consequence of maternal PWS-IC deletion (maternal PWS-IC deletion by itself is not known to be associated with a phenotype in either humans or mice), and 10 of these loci exhibited the same changes in methylation irrespective of the parental origin of the PWS-IC deletion. These results suggest that the PWS-IC may affect DNA methylation at these loci by directly interacting with them, or may affect methylation at these loci through indirect downstream effects due to PWS-IC deletion. They further suggest the PWS-IC may have a previously uncharacterized function outside of the imprinted AS/PWS domain.

  6. Enhanced immune response to gastric cancer specific antigen Peptide by coencapsulation with CpG oligodeoxynucleotides in nanoemulsion.

    PubMed

    Shi, Rui; Hong, Liu; Wu, Daocheng; Ning, Xiaoxuan; Chen, Yu; Lin, Tao; Fan, Daiming; Wu, Kaichun

    2005-02-01

    CpG oligodeoxynucleotides (CpG ODN) have been shown to have potent adjuvant activity for a wide range of antigens. Of particular interest is their improved activity when closely associated with the antigen. The purpose of this study is to construct a nanovaccine coencapsulated with a gastric cancer specific antigen MG7 mimotope peptide and adjuvant CpG ODN 1645 using new nanotechnology as nanoemulsion and evaluate its immunocompetence. Nanoemulsion vaccine was prepared using magnetic ultrasound methods. BALB/c mice were immunized and the in vivo effectiveness was evaluated using tumor challenge assay. It was shown that the tumor masses formed in the mice immunized with coencapsulated nanovaccine (0.0825 g) markedly smaller (P < 0.01) than those formed in the mice immunized with nanovaccine encapsulated with antigen peptide alone (0.4465 g). A tumor inhibiting rate as high as 82.5% of the coencapsulated nanovaccine was obtained, while nanovaccine encapsulated with peptide only could not achieve the same effect (28.5%) (P < 0.01). Enzyme-linked immunospot assay (ELISPOT) showed that immunization using MG7 mimotope peptide coencapsulated with CpG ODN within the same nanoemulsion enhanced the frequency of splenocytes secreting IFN-gamma significantly (P < 0.01) when compared with immunization using MG7 peptide encapsulated in nanoemulsion alone (197spots/1 x 10(6) vs. 73 spots/1 x 10(6)). Cellular ELISA indicated that serum titer of antibody against MG7-Ag was significantly higher (P < 0.01) in mice immunized with coencapsulation form nanovaccine (0.7884) than that in the group immunized with nanovaccine encapsulated with MG7 peptide alone (0.3616). Using intracellular flow cytometric analysis, it was found that the IFN-gamma response was contributed by CD4+ T-cells. Our experiments suggest that a vaccinal approach using nano-delivery system carrying in tumoral epitope and CpG ODN as adjuvant may have important implications for cancer therapy.

  7. Hypermethylation of the Human Glutathione S-Transferase-π Gene (GSTP1) CpG Island Is Present in a Subset of Proliferative Inflammatory Atrophy Lesions but Not in Normal or Hyperplastic Epithelium of the Prostate

    PubMed Central

    Nakayama, Masashi; Bennett, Christina J.; Hicks, Jessica L.; Epstein, Jonathan I.; Platz, Elizabeth A.; Nelson, William G.; De Marzo, Angelo M.

    2003-01-01

    Somatic inactivation of the glutathione S-transferase-π gene (GSTP1) via CpG island hypermethylation occurs early during prostate carcinogenesis, present in ∼70% of high-grade prostatic intraepithelial neoplasia (high-grade PIN) lesions and more than 90% of adenocarcinomas. Recently, there has been a resurgence of the concept that foci of prostatic atrophy (referred to as proliferative inflammatory atrophy or PIA) may be precursor lesions for the development of prostate cancer and/or high-grade PIN. Many of the cells within PIA lesions contain elevated levels of GSTP1, glutathione S-transferase-α (GSTA1), and cyclooxygenase-II proteins, suggesting a stress response. Because not all PIA cells are positive for GSTP1 protein, we hypothesized that some of the cells within these regions acquire GSTP1 CpG island hypermethylation, increasing the chance of progression to high-grade PIN and/or adenocarcinoma. Separate regions (n =199) from 27 formalin-fixed paraffin-embedded prostates were microdissected by laser-capture microdissection (Arcturus PixCell II). These regions included normal epithelium (n = 48), hyperplasticepithelium from benign prostatic hyperplasia nodules (n = 22), PIA (n = 64), high-grade PIN (n = 32), and adenocarcinoma (n = 33). Genomic DNA was isolated and assessed for GSTP1 CpG island hypermethylation by methylation-specific polymerase chain reaction. GSTP1 CpG island hypermethylation was not detected in normal epithelium (0 of 48) or in hyperplastic epithelium (0 of 22), but was found in 4 of 64 (6.3%) PIA lesions. The difference in the frequency of GSTP1 CpG island hypermethylation between normal or hyperplastic epithelium and PIA was statistically significant (P = 0.049). Similar to studies using nonmicrodissected cases, hypermethylation was found in 22 of 32 (68.8%) high-grade PIN lesions and in 30 of 33 (90.9%) adenocarcinoma lesions. Unlike normal or hyperplastic epithelium, GSTP1 CpG island hypermethylation can be detected in some PIA lesions. These data support the hypothesis that atrophic epithelium in a subset of PIA lesions may lead to high-grade PIN and/or adenocarcinoma. Because these atrophic lesions are so prevalent and extensive, even though only a small subset contains this somatic DNA alteration, the clinical impact may be substantial. PMID:12937133

  8. DNA methylation and exposure to ambient air pollution in two prospective cohorts.

    PubMed

    Plusquin, Michelle; Guida, Florence; Polidoro, Silvia; Vermeulen, Roel; Raaschou-Nielsen, Ole; Campanella, Gianluca; Hoek, Gerard; Kyrtopoulos, Soterios A; Georgiadis, Panagiotis; Naccarati, Alessio; Sacerdote, Carlotta; Krogh, Vittorio; Bas Bueno-de-Mesquita, H; Monique Verschuren, W M; Sayols-Baixeras, Sergi; Panni, Tommaso; Peters, Annette; Hebels, Dennie G A J; Kleinjans, Jos; Vineis, Paolo; Chadeau-Hyam, Marc

    2017-11-01

    Long-term exposure to air pollution has been associated with several adverse health effects including cardiovascular, respiratory diseases and cancers. However, underlying molecular alterations remain to be further investigated. The aim of this study is to investigate the effects of long-term exposure to air pollutants on (a) average DNA methylation at functional regions and, (b) individual differentially methylated CpG sites. An assumption is that omic measurements, including the methylome, are more sensitive to low doses than hard health outcomes. This study included blood-derived DNA methylation (Illumina-HM450 methylation) for 454 Italian and 159 Dutch participants from the European Prospective Investigation into Cancer and Nutrition (EPIC). Long-term air pollution exposure levels, including NO 2 , NO x , PM 2.5 , PM coarse , PM 10 , PM 2.5 absorbance (soot) were estimated using models developed within the ESCAPE project, and back-extrapolated to the time of sampling when possible. We meta-analysed the associations between the air pollutants and global DNA methylation, methylation in functional regions and epigenome-wide methylation. CpG sites found differentially methylated with air pollution were further investigated for functional interpretation in an independent population (EnviroGenoMarkers project), where (N=613) participants had both methylation and gene expression data available. Exposure to NO 2 was associated with a significant global somatic hypomethylation (p-value=0.014). Hypomethylation of CpG island's shores and shelves and gene bodies was significantly associated with higher exposures to NO 2 and NO x . Meta-analysing the epigenome-wide findings of the 2 cohorts did not show genome-wide significant associations at single CpG site level. However, several significant CpG were found if the analyses were separated by countries. By regressing gene expression levels against methylation levels of the exposure-related CpG sites, we identified several significant CpG-transcript pairs and highlighted 5 enriched pathways for NO 2 and 9 for NO x mainly related to the immune system and its regulation. Our findings support results on global hypomethylation associated with air pollution, and suggest that the shores and shelves of CpG islands and gene bodies are mostly affected by higher exposure to NO 2 and NO x . Functional differences in the immune system were suggested by transcriptome analyses. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  9. 5-Fluorotryptamine is a partial agonist at 5-HT3 receptors, and reveals that size and electronegativity at the 5 position of tryptamine are critical for efficient receptor function

    PubMed Central

    Bower, Kiowa S.; Price, Kerry L.; Sturdee, Laura E.C.; Dayrell, Mariza; Dougherty, Dennis A.; Lummis, Sarah C.R.

    2008-01-01

    Antagonists, but not agonists, of the 5-HT3 receptor are useful therapeutic agents, and it is possible that partial agonists may also be potentially useful in the clinic. Here we show that 5-fluorotryptamine (5-FT) is a partial agonist at both 5-HT3A and 5-HT3AB receptors with an Rmax (Imax / Imax5-HT) of 0.64 and 0.45 respectively. It is about 10 fold less potent than 5-HT: EC50 = 16 and 27 μM, and Ki for displacement of [3H]granisetron binding = 0.8 and 1.8 μM for 5-HT3A and 5-HT3AB receptors respectively. We have also explored the potencies and efficacies of tryptamine and a range of 5-substituted tryptamine derivatives. At 5-HT3A receptors tryptamine is a weak (Rmax = 0.15), low affinity (EC50 = 113 μM; Ki = 4.8 μM) partial agonist, while 5-chlorotryptamine has a similar affinity to 5-FT (EC50 = 8.1 μM; Ki = 2.7 μM) but is a very weak partial agonist (Rmax = 0. 0037). These, and data from 5-methyltryptamine and 5-methoxytryptamine, reveal the importance of size and electronegativity at this location for efficient channel opening. PMID:18082160

  10. Heritable DNA methylation in CD4+ cells among complex families displays genetic and non-genetic effects

    USDA-ARS?s Scientific Manuscript database

    DNA methylation at CpG sites is both heritable and influenced by environment, but the relative contributions of each to DNA methylation levels are unclear. We conducted a heritability analysis of CpG methylation in human CD4+ cells across 975 individuals from 163 families in the Genetics of Lipid-lo...

  11. 76 FR 58398 - Revised Guidance on Marketed Unapproved Drugs; Compliance Policy Guide Sec. 440.100; Marketed New...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-21

    ... enforcement action at any time, without prior notice and without regard to the enforcement priorities set... the enforcement priorities set forth in CPG 440.100 for unapproved new drugs marketed prior to September 19, 2011. The revision to CPG 440.100 excludes from the enforcement priorities set forth in the...

  12. Collaborations between CpG sites in DNA methylation

    NASA Astrophysics Data System (ADS)

    Song, You; Ren, Honglei; Lei, Jinzhi

    2017-08-01

    DNA methylation patterns have profound impacts on genome stability, gene expression and development. The molecular base of DNA methylation patterns has long been focused at single CpG sites level. Here, we construct a kinetic model of DNA methylation with collaborations between CpG sites, from which a correlation function was established based on experimental data. The function consists of three parts that suggest three possible sources of the correlation: movement of enzymes along DNA, collaboration between DNA methylation and nucleosome modification, and global enzyme concentrations within a cell. Moreover, the collaboration strength between DNA methylation and nucleosome modification is universal for mouse early embryo cells. The obtained correlation function provides insightful understanding for the mechanisms of inheritance of DNA methylation patterns.

  13. Modulation of aerial respiratory behaviour in a pond snail.

    PubMed

    Lukowiak, Ken; Martens, Kara; Orr, Mike; Parvez, Kashif; Rosenegger, David; Sangha, Susan

    2006-11-01

    Aerial respiratory in Lymnaea is driven by a three-neuron CPG whose sufficiency and necessity has been directly demonstrated. While this CPG is 'hard-wired' it displays a tremendous amount of plasticity. That is, it is possible by employing specific training procedures to alter how it functions in a specific hypoxic environment. Thus, it is possible to study directly the causal mechanisms of long-term memory formation, forgetting, and modulation of the memory at a single cell level. Thus, it is possible to use a relatively simple three-neuron CPG to study not only important questions concerning regulation of important homeostatic mechanisms but to also use it to study how learning and non-declarative memory are mediated at a cellular level.

  14. Modelling the Interaction of Catecholamines with the α1A Adrenoceptor Towards a Ligand-induced Receptor Structure

    NASA Astrophysics Data System (ADS)

    Kinsella, Gemma K.; Rozas, Isabel; Watson, Graeme W.

    2005-06-01

    Adrenoceptors are members of the important G protein coupled receptor family for which the detailed mechanism of activation remains unclear. In this study, we have combined docking and molecular dynamics simulations to model the ligand induced effect on an homology derived human α1A adrenoceptor. Analysis of agonist/α1A adrenoceptor complex interactions focused on the role of the charged amine group, the aromatic ring, the N-methyl group of adrenaline, the beta hydroxyl group and the catechol meta and para hydroxyl groups of the catecholamines. The most critical interactions for the binding of the agonists are consistent with many earlier reports and our study suggests new residues possibly involved in the agonist-binding site, namely Thr-174 and Cys-176. We further observe a number of structural changes that occur upon agonist binding including a movement of TM-V away from TM-III and a change in the interactions of Asp-123 of the conserved DRY motif. This may cause Arg-124 to move out of the TM helical bundle and change the orientation of residues in IC-II and IC-III, allowing for increased affinity of coupling to the G-protein.

  15. Impaired capacity for upregulation of MHC class II in tumor-associated microglia.

    PubMed

    Schartner, Jill M; Hagar, Aaron R; Van Handel, Michelle; Zhang, Leying; Nadkarni, Nivedita; Badie, Behnam

    2005-09-01

    Immunotherapy for malignant gliomas is being studied as a possible adjunctive therapy for this highly fatal disease. Thus far, inadequate understanding of brain tumor immunology has hindered the design of such therapies. For instance, the role of microglia and macrophages, which comprise a significant proportion of tumor-infiltrating inflammatory cells, in the regulation of the local anti-tumor immune response is poorly understood. To study the response of microglia and macrophages to known activators in brain tumors, we injected CpG oligodeoxynucleotide (ODN), interferon-gamma (IFN-gamma), and IFN-gamma/LPS into normal and intracranial RG2 glioma-bearing rodents. Microglia/macrophage infiltration and their surface expression of MHC class II B7.1 and B7.2 was examined by flow cytometry. Each agent evaluated yielded a distinct microglia/macrophage response: CpG ODN was the most potent inducer of microglia/macrophage infiltration and B7.1 expression, while IFN-gamma resulted in the highest MHC-II expression in both normal and tumors. Regardless of the agent injected, however, MHC-II induction was significantly muted in tumor microglia/macrophage as compared with normal brain. These data suggest that microglia/macrophage responsiveness to activators can vary in brain tumors when compared with normal brain. Understanding the mechanism of these differences may be critical in the development of novel immunotherapies for malignant glioma. (c) 2005 Wiley-Liss, Inc.

  16. Procainamide Is a Specific Inhibitor of DNA Methyltransferase 1*

    PubMed Central

    Lee, Byron H.; Yegnasubramanian, Srinivasan; Lin, Xiaohui; Nelson, William G.

    2007-01-01

    CpG island hypermethylation occurs in most cases of cancer, typically resulting in the transcriptional silencing of critical cancer genes. Procainamide has been shown to inhibit DNA methyltransferase activity and reactivate silenced gene expression in cancer cells by reversing CpG island hypermethylation. We report here that procainamide specifically inhibits the hemimethylase activity of DNA methyltransferase 1 (DNMT1), the mammalian enzyme thought to be responsible for maintaining DNA methylation patterns during replication. At micromolar concentrations, procainamide was found to be a partial competitive inhibitor of DNMT1, reducing the affinity of the enzyme for its two substrates, hemimethylated DNA and S-adenosyl-l-methionine. By doing so, procainamide significantly decreased the processivity of DNMT1 on hemimethylated DNA. Procainamide was not a potent inhibitor of the de novo methyltransferases DNMT3a and DNMT3b2. As further evidence of the specificity of procainamide for DNMT1, procainamide failed to lower genomic 5-methyl-2′-deoxycytidine levels in HCT116 colorectal cancer cells when DNMT1 was genetically deleted but significantly reduced genomic 5-methyl-2′-deoxycyti-dine content in parental HCT116 cells and in HCT116 cells where DNMT3b was genetically deleted. Because many reports have strongly linked DNMT1 with epigenetic alterations in carcinogenesis, procainamide may be a useful drug in the prevention of cancer. PMID:16230360

  17. Cognitive skills assessment during robot-assisted surgery: separating the wheat from the chaff.

    PubMed

    Guru, Khurshid A; Esfahani, Ehsan T; Raza, Syed J; Bhat, Rohit; Wang, Katy; Hammond, Yana; Wilding, Gregory; Peabody, James O; Chowriappa, Ashirwad J

    2015-01-01

    To investigate the utility of cognitive assessment during robot-assisted surgery (RAS) to define skills in terms of cognitive engagement, mental workload, and mental state; while objectively differentiating between novice and expert surgeons. In all, 10 surgeons with varying operative experience were assigned to beginner (BG), combined competent and proficient (CPG), and expert (EG) groups based on the Dreyfus model. The participants performed tasks for basic, intermediate and advanced skills on the da Vinci Surgical System. Participant performance was assessed using both tool-based and cognitive metrics. Tool-based metrics showed significant differences between the BG vs CPG and the BG vs EG, in basic skills. While performing intermediate skills, there were significant differences only on the instrument-to-instrument collisions between the BG vs CPG (2.0 vs 0.2, P = 0.028), and the BG vs EG (2.0 vs 0.1, P = 0.018). There were no significant differences between the CPG and EG for both basic and intermediate skills. However, using cognitive metrics, there were significant differences between all groups for the basic and intermediate skills. In advanced skills, there were no significant differences between the CPG and the EG except time (1116 vs 599.6 s), using tool-based metrics. However, cognitive metrics revealed significant differences between both groups. Cognitive assessment of surgeons may aid in defining levels of expertise performing complex surgical tasks once competence is achieved. Cognitive assessment may be used as an adjunct to the traditional methods for skill assessment during RAS. © 2014 The Authors. BJU International © 2014 BJU International.

  18. DNA methylation analysis of phenotype specific stratified Indian population.

    PubMed

    Rotti, Harish; Mallya, Sandeep; Kabekkodu, Shama Prasada; Chakrabarty, Sanjiban; Bhale, Sameer; Bharadwaj, Ramachandra; Bhat, Balakrishna K; Dedge, Amrish P; Dhumal, Vikram Ram; Gangadharan, G G; Gopinath, Puthiya M; Govindaraj, Periyasamy; Joshi, Kalpana S; Kondaiah, Paturu; Nair, Sreekumaran; Nair, S N Venugopalan; Nayak, Jayakrishna; Prasanna, B V; Shintre, Pooja; Sule, Mayura; Thangaraj, Kumarasamy; Patwardhan, Bhushan; Valiathan, Marthanda Varma Sankaran; Satyamoorthy, Kapaettu

    2015-05-08

    DNA methylation and its perturbations are an established attribute to a wide spectrum of phenotypic variations and disease conditions. Indian traditional system practices personalized medicine through indigenous concept of distinctly descriptive physiological, psychological and anatomical features known as prakriti. Here we attempted to establish DNA methylation differences in these three prakriti phenotypes. Following structured and objective measurement of 3416 subjects, whole blood DNA of 147 healthy male individuals belonging to defined prakriti (Vata, Pitta and Kapha) between the age group of 20-30years were subjected to methylated DNA immunoprecipitation (MeDIP) and microarray analysis. After data analysis, prakriti specific signatures were validated through bisulfite DNA sequencing. Differentially methylated regions in CpG islands and shores were significantly enriched in promoters/UTRs and gene body regions. Phenotypes characterized by higher metabolism (Pitta prakriti) in individuals showed distinct promoter (34) and gene body methylation (204), followed by Vata prakriti which correlates to motion showed DNA methylation in 52 promoters and 139 CpG islands and finally individuals with structural attributes (Kapha prakriti) with 23 and 19 promoters and CpG islands respectively. Bisulfite DNA sequencing of prakriti specific multiple CpG sites in promoters and 5'-UTR such as; LHX1 (Vata prakriti), SOX11 (Pitta prakriti) and CDH22 (Kapha prakriti) were validated. Kapha prakriti specific CDH22 5'-UTR CpG methylation was also found to be associated with higher body mass index (BMI). Differential DNA methylation signatures in three distinct prakriti phenotypes demonstrate the epigenetic basis of Indian traditional human classification which may have relevance to personalized medicine.

  19. Differential DNA Methylation in Relation to Age and Health Risks of Obesity.

    PubMed

    Mansego, María Luisa; Milagro, Fermín I; Zulet, María Ángeles; Moreno-Aliaga, María J; Martínez, José Alfredo

    2015-07-24

    The aim of this study was to evaluate whether genome-wide levels of DNA methylation are associated with age and the health risks of obesity (HRO); defined according to BMI categories as "Low HRO" (overweight and class 1 obesity) versus "High HRO" (class 2 and class 3 obesity). Anthropometric measurements were assessed in a subsample of 48 volunteers from the Metabolic Syndrome Reduction in Navarra (RESMENA) study and 24 women from another independent study, Effects of Lipoic Acid and Eicosapentaenoic Acid in Human Obesity (OBEPALIP study). In the pooled population; the methylation levels of 55 CpG sites were significantly associated with age after Benjamini-Hochberg correction. In addition, DNA methylation of three CpG sites located in ELOVL2; HOXC4 and PI4KB were further negatively associated with their mRNA levels. Although no differentially methylated CpG sites were identified in relation to HRO after multiple testing correction; several nominally significant CpG sites were identified in genes related to insulin signaling; energy and lipid metabolism. Moreover, statistically significant associations between BMI or mRNA levels and two HRO-related CpG sites located in GPR133 and ITGB5 are reported. As a conclusion, these findings from two Spanish cohorts add knowledge about the important role of DNA methylation in the age-related regulation of gene expression. In addition; a relevant influence of age on DNA methylation in white blood cells was found, as well as, on a trend level, novel associations between DNA methylation and obesity.

  20. Base Excision Repair of Tandem Modifications in a Methylated CpG Dinucleotide*

    PubMed Central

    Sassa, Akira; Çağlayan, Melike; Dyrkheeva, Nadezhda S.; Beard, William A.; Wilson, Samuel H.

    2014-01-01

    Cytosine methylation and demethylation in tracks of CpG dinucleotides is an epigenetic mechanism for control of gene expression. The initial step in the demethylation process can be deamination of 5-methylcytosine producing the TpG alteration and T:G mispair, and this step is followed by thymine DNA glycosylase (TDG) initiated base excision repair (BER). A further consideration is that guanine in the CpG dinucleotide may become oxidized to 7,8-dihydro-8-oxoguanine (8-oxoG), and this could affect the demethylation process involving TDG-initiated BER. However, little is known about the enzymology of BER of altered in-tandem CpG dinucleotides; e.g. Tp8-oxoG. Here, we investigated interactions between this altered dinucleotide and purified BER enzymes, the DNA glycosylases TDG and 8-oxoG DNA glycosylase 1 (OGG1), apurinic/apyrimidinic (AP) endonuclease 1, DNA polymerase β, and DNA ligases. The overall TDG-initiated BER of the Tp8-oxoG dinucleotide is significantly reduced. Specifically, TDG and DNA ligase activities are reduced by a 3′-flanking 8-oxoG. In contrast, the OGG1-initiated BER pathway is blocked due to the 5′-flanking T:G mispair; this reduces OGG1, AP endonuclease 1, and DNA polymerase β activities. Furthermore, in TDG-initiated BER, TDG remains bound to its product AP site blocking OGG1 access to the adjacent 8-oxoG. These results reveal BER enzyme specificities enabling suppression of OGG1-initiated BER and coordination of TDG-initiated BER at this tandem alteration in the CpG dinucleotide. PMID:24695738

  1. Methylation of avpr1a in the cortex of wild prairie voles: effects of CpG position and polymorphism

    PubMed Central

    Maguire, S. M.; Phelps, S. M.

    2017-01-01

    DNA methylation can cause stable changes in neuronal gene expression, but we know little about its role in individual differences in the wild. In this study, we focus on the vasopressin 1a receptor (avpr1a), a gene extensively implicated in vertebrate social behaviour, and explore natural variation in DNA methylation, genetic polymorphism and neuronal gene expression among 30 wild prairie voles (Microtus ochrogaster). Examination of CpG density across 8 kb of the locus revealed two distinct CpG islands overlapping promoter and first exon, characterized by few CpG polymorphisms. We used a targeted bisulfite sequencing approach to measure DNA methylation across approximately 3 kb of avpr1a in the retrosplenial cortex, a brain region implicated in male space use and sexual fidelity. We find dramatic variation in methylation across the avrp1a locus, with pronounced diversity near the exon–intron boundary and in a genetically variable putative enhancer within the intron. Among our wild voles, differences in cortical avpr1a expression correlate with DNA methylation in this putative enhancer, but not with the methylation status of the promoter. We also find an unusually high number of polymorphic CpG sites (polyCpGs) in this focal enhancer. One polyCpG within this enhancer (polyCpG 2170) may drive variation in expression either by disrupting transcription factor binding motifs or by changing local DNA methylation and chromatin silencing. Our results contradict some assumptions made within behavioural epigenetics, but are remarkably concordant with genome-wide studies of gene regulation. PMID:28280564

  2. Real-time biomimetic Central Pattern Generators in an FPGA for hybrid experiments

    PubMed Central

    Ambroise, Matthieu; Levi, Timothée; Joucla, Sébastien; Yvert, Blaise; Saïghi, Sylvain

    2013-01-01

    This investigation of the leech heartbeat neural network system led to the development of a low resources, real-time, biomimetic digital hardware for use in hybrid experiments. The leech heartbeat neural network is one of the simplest central pattern generators (CPG). In biology, CPG provide the rhythmic bursts of spikes that form the basis for all muscle contraction orders (heartbeat) and locomotion (walking, running, etc.). The leech neural network system was previously investigated and this CPG formalized in the Hodgkin–Huxley neural model (HH), the most complex devised to date. However, the resources required for a neural model are proportional to its complexity. In response to this issue, this article describes a biomimetic implementation of a network of 240 CPGs in an FPGA (Field Programmable Gate Array), using a simple model (Izhikevich) and proposes a new synapse model: activity-dependent depression synapse. The network implementation architecture operates on a single computation core. This digital system works in real-time, requires few resources, and has the same bursting activity behavior as the complex model. The implementation of this CPG was initially validated by comparing it with a simulation of the complex model. Its activity was then matched with pharmacological data from the rat spinal cord activity. This digital system opens the way for future hybrid experiments and represents an important step toward hybridization of biological tissue and artificial neural networks. This CPG network is also likely to be useful for mimicking the locomotion activity of various animals and developing hybrid experiments for neuroprosthesis development. PMID:24319408

  3. Region of interest methylation analysis: a comparison of MSP with MS-HRM and direct BSP.

    PubMed

    Akika, Reem; Awada, Zainab; Mogharbil, Nahed; Zgheib, Nathalie K

    2017-07-01

    The aim of this study was to compare and contrast three DNA methylation methods of a specific region of interest (ROI): methylation-specific PCR (MSP), methylation-sensitive high resolution melting (MS-HRM) and direct bisulfite sequencing (BSP). The methylation of a CpG area in the promoter region of Estrogen receptor alpha (ESR1) was evaluated by these three methods with samples and standards of different methylation percentages. MSP data were neither reproducible nor sensitive, and the assay was not specific due to non-specific binding of primers. MS-HRM was highly reproducible and a step forward into categorizing the methylation status of the samples as percent ranges. Direct BSP was the most informative method regarding methylation percentage of each CpG site. Though not perfect, it was reproducible and sensitive. We recommend the use of either method depending on the research question and target amplicon, and provided that the designed primers and expected amplicons are within recommendations. If the research question targets a limited number of CpG sites and simple yes/no results are enough, MSP may be attempted. For short amplicons that are crowded with CpG sites and of single melting domain, MS-HRM may be the method of choice though it only indicates the overall methylation percentage of the entire amplicon. Although the assay is highly reproducible, being semi-quantitative makes it of lesser interest to study ROI methylation of samples with little methylation differences. Direct BSP is a step forward as it gives information about the methylation percentage at each CpG site.

  4. In Vivo Control of CpG and Non-CpG DNA Methylation by DNA Methyltransferases

    PubMed Central

    Arand, Julia; Spieler, David; Karius, Tommy; Branco, Miguel R.; Meilinger, Daniela; Meissner, Alexander; Jenuwein, Thomas; Xu, Guoliang; Leonhardt, Heinrich; Wolf, Verena; Walter, Jörn

    2012-01-01

    The enzymatic control of the setting and maintenance of symmetric and non-symmetric DNA methylation patterns in a particular genome context is not well understood. Here, we describe a comprehensive analysis of DNA methylation patterns generated by high resolution sequencing of hairpin-bisulfite amplicons of selected single copy genes and repetitive elements (LINE1, B1, IAP-LTR-retrotransposons, and major satellites). The analysis unambiguously identifies a substantial amount of regional incomplete methylation maintenance, i.e. hemimethylated CpG positions, with variant degrees among cell types. Moreover, non-CpG cytosine methylation is confined to ESCs and exclusively catalysed by Dnmt3a and Dnmt3b. This sequence position–, cell type–, and region-dependent non-CpG methylation is strongly linked to neighboring CpG methylation and requires the presence of Dnmt3L. The generation of a comprehensive data set of 146,000 CpG dyads was used to apply and develop parameter estimated hidden Markov models (HMM) to calculate the relative contribution of DNA methyltransferases (Dnmts) for de novo and maintenance DNA methylation. The comparative modelling included wild-type ESCs and mutant ESCs deficient for Dnmt1, Dnmt3a, Dnmt3b, or Dnmt3a/3b, respectively. The HMM analysis identifies a considerable de novo methylation activity for Dnmt1 at certain repetitive elements and single copy sequences. Dnmt3a and Dnmt3b contribute de novo function. However, both enzymes are also essential to maintain symmetrical CpG methylation at distinct repetitive and single copy sequences in ESCs. PMID:22761581

  5. Intensive hypermethylation of the CpG island of Ras association domain family 1A in hepatitis B virus-associated hepatocellular carcinomas.

    PubMed

    Zhong, Sheng; Yeo, Winnie; Tang, Mandy W; Wong, Nathalie; Lai, Paul B S; Johnson, Phillip J

    2003-08-15

    The human Ras association domain family 1A gene (RASSF1A) is a newly isolated tumor suppressor gene. In this study, we analyzed the methylation status of the promoter region of RASSF1A using bisulfite sequencing and PCR-RFLP in four liver cancer cell lines (Hep3B, HepG(2), SK-HEP-1, and Huh-7) and a cohort of 43 hepatitis B virus-associated hepatocellular carcinoma (HCC) tissues and their corresponding nontumor tissue specimens. The methylation of the CpG islands in the RASSF1A promoter was not detected in 4 samples of normal liver tissue or 10 samples of peripheral blood mononuclear cells from normal subjects. However, the CpG islands were completely methylated, and transcription of the RASSF1A was silenced in the four cell lines. Treatment with the DNA methylation inhibitor 5-aza-2'-deoxycytidine reactivated the expression of RASSF1A in the Hep3B and HepG2 cells. In 41 of 43 (95%) HCC specimens studied, the promoter region of RASSF1A was intensively methylated at its CpG sites. Although heterogeneous methylation was also detected in 16 of the 23 (70%) corresponding nontumorous tissues analyzed, the level of methylation was significantly lower than in the corresponding tumor tissues. HCC has the highest incidence of promoter methylation of RASSF1A among all malignancies yet reported suggesting that hypermethylation of the CpG island promoter of RASSF1A may play an important pathological role in this tumor.

  6. Preliminary evaluation of cytosine-phosphate-guanine oligodeoxynucleotides bound to gelatine nanoparticles as immunotherapy for canine atopic dermatitis.

    PubMed

    Wagner, I; Geh, K J; Hubert, M; Winter, G; Weber, K; Classen, J; Klinger, C; Mueller, R S

    2017-07-29

    Cytosine-phosphate-guanine oligodeoxynucleotides (CpG ODN) are a promising new immunotherapeutic treatment option for canine atopic dermatitis (AD). The aim of this uncontrolled pilot study was to evaluate clinical and immunological effects of gelatine nanoparticle (GNP)-bound CpG ODN (CpG GNP) on atopic dogs. Eighteen dogs with AD were treated for 8 weeks (group 1, n=8) or 18 weeks (group 2, n=10). Before inclusion and after 2 weeks, 4 weeks, 6 weeks (group 1+2), 8 weeks, 12 weeks and 16 weeks (group 2) 75 µg CpG ODN/dog (bound to 1.5 mg GNP) were injected subcutaneously. Pruritus was evaluated daily by the owner. Lesions were evaluated and serum concentrations and mRNA expressions of interferon-γ, tumour necrosis factor-α, transforming growth factor-β, interleukin (IL) 10 and IL-4 (only mRNA expression) were determined at inclusion and after 8 weeks (group 1+2) and 18 weeks (group 2). Lesions and pruritus improved significantly from baseline to week 8. Mean improvements from baseline to week 18 were 23 per cent and 44 per cent for lesions and pruritus, respectively, an improvement of ≥50 per cent was seen in six out of nine and three out of six dogs, respectively. IL-4 mRNA expression decreased significantly. The results of this study show a clinical improvement of canine AD with CpG GNP comparable to allergen immunotherapy. Controlled studies are needed to confirm these findings. British Veterinary Association.

  7. Racial Differences in DNA-Methylation of CpG Sites Within Preterm-Promoting Genes and Gene Variants.

    PubMed

    Salihu, H M; Das, R; Morton, L; Huang, H; Paothong, A; Wilson, R E; Aliyu, M H; Salemi, J L; Marty, P J

    2016-08-01

    Objective To evaluate the role DNA methylation may play in genes associated with preterm birth for higher rates of preterm births in African-American women. Methods Fetal cord blood samples from births collected at delivery and maternal demographic and medical information were used in a cross-sectional study to examine fetal DNA methylation of genes implicated in preterm birth among black and non-black infants. Allele-specific DNA methylation analysis was performed using a methylation bead array. Targeted maximum likelihood estimation was applied to examine the relationship between race and fetal DNA methylation of candidate preterm birth genes. Receiver-operating characteristic analyses were then conducted to validate the CpG site methylation marker within the two racial groups. Bootstrapping, a method of validation and replication, was employed. Results 42 CpG sites were screened within 20 candidate gene variants reported consistently in the literature as being associated with preterm birth. Of these, three CpG sites on TNFAIP8 and PON1 genes (corresponding to: cg23917399; cg07086380; and cg07404485, respectively) were significantly differentially methylated between black and non-black individuals. The three CpG sites showed lower methylation status among infants of black women. Bootstrapping validated and replicated results. Conclusion for Practice Our study identified significant differences in levels of methylation on specific genes between black and non-black individuals. Understanding the genetic/epigenetic mechanisms that lead to preterm birth may lead to enhanced prevention strategies to reduce morbidity and mortality by eventually providing a means to identify individuals with a genetic predisposition to preterm labor.

  8. Use of Toll-Like Receptor Agonists to Induce Ectopic Lymphoid Structures in Myasthenia Gravis Mouse Models

    PubMed Central

    Robinet, Marieke; Villeret, Bérengère; Maillard, Solène; Cron, Mélanie A.; Berrih-Aknin, Sonia; Le Panse, Rozen

    2017-01-01

    Myasthenia gravis (MG) is an autoimmune disease mediated by autoantibodies against the acetylcholine receptor (AChR) at the neuromuscular junction. MG symptoms are characterized by muscle weaknesses. The thymus of MG patients is very often abnormal and possesses all the characteristics of tertiary lymphoid organs such as neoangiogenesis processes, overexpression of inflammatory cytokines and chemokines, and infiltration of B lymphocytes leading to ectopic germinal center (GC) development. We previously demonstrated that injections of mice with polyinosinic–polycytidylic acid [Poly(I:C)], a synthetic double-stranded RNA mimicking viral infection, induce thymic changes and trigger MG symptoms. Upon Poly(I:C) injections, we observed increased thymic expressions of α-AChR, interferon-β and chemokines such as CXCL13 and CCL21 leading to B-cell recruitment. However, these changes were only transient. In order to develop an experimental MG model associated with thymic GCs, we used Poly(I:C) in the classical experimental autoimmune MG model induced by immunizations with purified AChR emulsified in complete Freund’s adjuvant. We observed that Poly(I:C) strongly favored the development of MG as almost all mice displayed MG symptoms. Nevertheless, we did not observe any ectopic GC development. We next challenged mice with Poly(I:C) together with other toll-like receptor (TLR) agonists known to be involved in GC development and that are overexpressed in MG thymuses. Imiquimod and CpG oligodeoxynucleotides that activate TLR7 and TLR9, respectively, did not induce thymic changes. In contrast, lipopolysaccharide that activates TLR4 potentiated Poly(I:C) effects and induced a significant expression of CXCL13 mRNA in the thymus associated with a higher recruitment of B cells that induced over time thymic B-lymphoid structures. Altogether, these data suggest that tertiary lymphoid genesis in MG thymus could result from a combined activation of TLR signaling pathways. PMID:28970832

  9. CpG-ODN Shapes Alum Adjuvant Activity Signaling via MyD88 and IL-10

    PubMed Central

    Mirotti, Luciana; Alberca Custódio, Ricardo Wesley; Gomes, Eliane; Rammauro, Florencia; de Araujo, Eliseu Frank; Garcia Calich, Vera Lucia; Russo, Momtchilo

    2017-01-01

    Aluminum-containing adjuvants usually referred as Alum are considered as T helper type-2 (Th2) adjuvants, while agonists of toll-like receptors (TLRs) are viewed as adjuvants that favor Th1/Th17 immunity. Alum has been used in numerous vaccine formulations; however, its undesired pro-Th2 adjuvant activity constitutes a caveat for Alum-based vaccines. Combining Alum with TLR-dependent, pro-Th1/Th17 adjuvants might dampen the pro-Th2 activity and improve the effectiveness of vaccine formulations. Here, using the ovalbumin (OVA) model of allergic lung inflammation, we found that sensitization with the synthetic TLR9 agonist, which is composed of oligodeoxynucleotides containing CpG motifs adsorbed to Alum, inhibited the development of OVA-induced lung allergic Th2 responses without shifting toward a Th1 pattern. The conversion of T cell immunity from the polarized allergic Th2 response to a non-polarized form by sensitization with OVA/Alum/CpG was dependent on MyD88 signaling in myeloid cells. Notably, sensitization of IL-10-deficient mice with OVA/Alum/CpG resulted in the development of neutrophilic lung inflammation associated with IFNγ production. However, in IL-10/IL-12-deficient mice, it resulted in neutrophilic inflammation dominated by IL-17 production. We conclude that OVA/Alum/CpG sensitization signaling via MyD88 and IL-10 molecules results in non-polarized immunity. Conversely, OVA/Alum/CpG sensitization in presence of MyD88 but absence of IL-10 or IL-10/IL-12 molecules results, respectively, in neutrophilic inflammation associated with IFNγ or IL-17 production. Our work provides novel OVA models of lung inflammation and suggests that Alum/CpG-based formulations might be of potential use in anti-allergic or anti-infectious processes. PMID:28220116

  10. TLR9 expression is required for the development of cigarette smoke-induced emphysema in mice

    PubMed Central

    Foronjy, Robert F.; Salathe, Matthias A.; Dabo, Abdoulaye J.; Baumlin, Nathalie; Cummins, Neville; Eden, Edward

    2016-01-01

    The expression of Toll-like receptor (TLR)-9, a pathogen recognition receptor that recognizes unmethylated CpG sequences in microbial DNA molecules, is linked to the pathogenesis of several lung diseases. TLR9 expression and signaling was investigated in animal and cell models of chronic obstructive pulmonary disease (COPD). We observed enhanced TLR9 expression in mouse lungs following exposure to cigarette smoke. Tlr9−/− mice were resistant to cigarette smoke-induced loss of lung function as determined by mean linear intercept, total lung capacity, lung compliance, and tissue elastance analysis. Tlr9 expression also regulated smoke-mediated immune cell recruitment to the lung; apoptosis; expression of granulocyte-colony stimulating factor (G-CSF), the CXCL5 protein, and matrix metalloproteinase-2 (MMP-2); and protein tyrosine phosphatase 1B (PTP1B) activity in the lung. PTP1B, a phosphatase with anti-inflammatory abilities, was identified as binding to TLR9. In vivo delivery of a TLR9 agonist enhanced TLR9 binding to PTP1B, which inactivated PTP1B. Ptp1b−/− mice had elevated lung concentrations of G-CSF, CXCL5, and MMP-2, and tissue expression of type-1 interferon following TLR9 agonist administration, compared with wild-type mice. TLR9 responses were further determined in fully differentiated normal human bronchial epithelial (NHBE) cells isolated from nonsmoker, smoker, and COPD donors, and then cultured at air liquid interface. NHBE cells from smokers and patients with COPD expressed more TLR9 and secreted greater levels of G-CSF, IL-6, CXCL5, IL-1β, and MMP-2 upon TLR9 ligand stimulation compared with cells from nonsmoker donors. Although TLR9 combats infection, our results indicate that TLR9 induction can affect lung function by inactivating PTP1B and upregulating expression of proinflammatory cytokines. PMID:27288485

  11. dbCPG: A web resource for cancer predisposition genes.

    PubMed

    Wei, Ran; Yao, Yao; Yang, Wu; Zheng, Chun-Hou; Zhao, Min; Xia, Junfeng

    2016-06-21

    Cancer predisposition genes (CPGs) are genes in which inherited mutations confer highly or moderately increased risks of developing cancer. Identification of these genes and understanding the biological mechanisms that underlie them is crucial for the prevention, early diagnosis, and optimized management of cancer. Over the past decades, great efforts have been made to identify CPGs through multiple strategies. However, information on these CPGs and their molecular functions is scattered. To address this issue and provide a comprehensive resource for researchers, we developed the Cancer Predisposition Gene Database (dbCPG, Database URL: http://bioinfo.ahu.edu.cn:8080/dbCPG/index.jsp), the first literature-based gene resource for exploring human CPGs. It contains 827 human (724 protein-coding, 23 non-coding, and 80 unknown type genes), 637 rats, and 658 mouse CPGs. Furthermore, data mining was performed to gain insights into the understanding of the CPGs data, including functional annotation, gene prioritization, network analysis of prioritized genes and overlap analysis across multiple cancer types. A user-friendly web interface with multiple browse, search, and upload functions was also developed to facilitate access to the latest information on CPGs. Taken together, the dbCPG database provides a comprehensive data resource for further studies of cancer predisposition genes.

  12. Multilevel Analysis of Locomotion in Immature Preparations Suggests Innovative Strategies to Reactivate Stepping after Spinal Cord Injury.

    PubMed

    Brumley, Michele R; Guertin, Pierre A; Taccola, Giuliano

    2017-01-01

    Locomotion is one of the most complex motor behaviors. Locomotor patterns change during early life, reflecting development of numerous peripheral and hierarchically organized central structures. Among them, the spinal cord is of particular interest since it houses the central pattern generator (CPG) for locomotion. This main command center is capable of eliciting and coordinating complex series of rhythmic neural signals sent to motoneurons and to corresponding target-muscles for basic locomotor activity. For a long-time, the CPG has been considered a black box. In recent years, complementary insights from in vitro and in vivo animal models have contributed significantly to a better understanding of its constituents, properties and ways to recover locomotion after a spinal cord injury (SCI). This review discusses key findings made by comparing the results of in vitro isolated spinal cord preparations and spinal-transected in vivo models from neonatal animals. Pharmacological, electrical, and sensory stimulation approaches largely used to further understand CPG function may also soon become therapeutic tools for potent CPG reactivation and locomotor movement induction in persons with SCI or developmental neuromuscular disorder. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  13. Enhancement of infectious disease vaccines through TLR9-dependent recognition of CpG DNA.

    PubMed

    McCluskie, M J; Krieg, A M

    2006-01-01

    The adaptive immune system-with its remarkable ability to generate antigen-specific antibodies and T lymphocytes against pathogens never before "seen" by an organism-is one of the marvels of evolution. However, to generate these responses, the adaptive immune system requires activation by the innate immune system. Toll-like receptors (TLRs) are perhaps the best-understood family of innate immune receptors for detecting infections and stimulating adaptive immune responses. TLR9 appears to have evolved to recognize infections by a subtle structural difference between eukaryotic and prokaryotic/viral DNA; only the former frequently methylates CpG dinucleotides. Used as vaccine adjuvants, synthetic oligodeoxynucleotide (ODN) ligands for TLR9--CpG ODN--greatly enhance the speed and strength of the immune responses to vaccination.

  14. In vitro induction of T regulatory cells by a methylated CpG DNA sequence in humans: Potential therapeutic applications in allergic and autoimmune diseases.

    PubMed

    Lawless, Oliver J; Bellanti, Joseph A; Brown, Milton L; Sandberg, Kathryn; Umans, Jason G; Zhou, Li; Chen, Weiqian; Wang, Julie; Wang, Kan; Zheng, Song Guo

    2018-03-01

    Allergic and autoimmune diseases comprise a group of inflammatory disorders caused by aberrant immune responses in which CD25+ Forkhead box P3-positive (FOXP3+) T regulatory (Treg) cells that normally suppress inflammatory events are often poorly functioning. This has stimulated an intensive investigative effort to find ways of increasing Tregs as a method of therapy for these conditions. One such line of investigation includes the study of how ligation of Toll-like receptors (TLRs) by CpG oligonucleotides (ODN) results in an immunostimulatory cascade that leads to induction of T-helper (Th) type 1 and Treg-type immune responses. The present study investigated the mechanisms by which calf thymus mammalian double-stranded DNA (CT-DNA) and a synthetic methylated DNA CpG ODN sequence suppress in vitro lymphoproliferative responses to antigens, mitogens, and alloantigens when measured by [3H]-thymidine incorporation and promote FoxP3 expression in human CD4+ T cells in the presence of transforming growth factor (TGF) beta and interleukin-2 (IL-2). Lymphoproliferative responses of peripheral blood mononuclear cells from four healthy subjects or nine subjects with systemic lupus erythematosus to CT-DNA or phytohemagglutinin (PHA) was measured by tritiated thymidine ([3H]-TdR) incorporation expressed as a stimulation index. Mechanisms of immunosuppressive effects of CT-DNA were evaluated by measurement of the degree of inhibition to lymphoproliferative responses to streptokinase-streptodornase, phytohemagglutinin (PHA), concanavalin A (Con A), pokeweed mitogen (PWM), or alloantigens by a Con A suppressor assay. The effects of CpG methylation on induction of FoxP3 expression in human T cells were measured by comparing inhibitory responses of synthetic methylated and nonmethylated 8-mer CpG ODN sequences by using cell sorting, in vitro stimulation, and suppressor assay. Here, we showed that CT-DNA and a synthetic methylated DNA 8-mer sequence could suppress antigen-, mitogen-, and alloantigen-induced lymphoproliferation in vitro when measured by [3H]-thymidine. The synthetic methylated DNA CpG ODN but not an unmethylated CpG ODN sequence was shown to promote FoxP3 expression in human CD4+ T cells in the presence of TGF beta and IL-2. The induction of FoxP3+ suppressor cells is dose dependent and offers a potential clinical therapeutic application in allergic and autoimmune and inflammatory diseases. The use of this methylated CpG ODN offers a broad clinical application as a novel therapeutic method for Treg induction and, because of its low cost and small size, should facilitate delivery via nasal, respiratory, gastrointestinal routes, and/or by injection, routes of administration important for vaccine delivery to target sites responsible for respiratory, gastrointestinal, and systemic forms of allergic and autoimmune disease.

  15. The cellular distribution of fluorescently labeled arrestins provides a robust, sensitive, and universal assay for screening G protein-coupled receptors.

    PubMed

    Oakley, Robert H; Hudson, Christine C; Cruickshank, Rachael D; Meyers, Diane M; Payne, Richard E; Rhem, Shay M; Loomis, Carson R

    2002-11-01

    G protein-coupled receptors (GPCRs) have proven to be a rich source of therapeutic targets; therefore, finding compounds that regulate these receptors is a critical goal in drug discovery. The Transfluor technology utilizes the redistribution of fluorescently labeled arrestins from the cytoplasm to agonist-occupied receptors at the plasma membrane to monitor quantitatively the activation or inactivation of GPCRs. Here, we show that the Transfluor technology can be quantitated on the INCell Analyzer system (INCAS) using the vasopressin V(2) receptor (V(2)R), which binds arrestin with high affinity, and the beta(2)-adrenergic receptor (beta(2)AR), which binds arrestin with low affinity. U2OS cells stably expressing an arrestin-green fluorescent protein conjugate and either the V(2)R or the beta(2)AR were plated in 96-well plastic plates and analyzed by the INCAS at a screening rate of 5 min per plate. Agonist dose-response and antagonist dose-inhibition curves revealed signal-to-background ratios of approximately 25:1 and 8:1 for the V(2)R and beta(2)AR, respectively. EC(50) values agreed closely with K(d) values reported in the literature for the different receptor agonists. In addition, small amounts of arrestin translocation induced by sub-EC(50) doses of agonist were distinguished from the background noise of untreated cells. Furthermore, differences in the magnitude of arrestin translocation distinguished partial agonists from full agonists, and Z' values for these ligands were >0.5. These data show that the Transfluor technology, combined with an automated image analysis system, provides a direct, robust, and universal assay for high throughput screening of known and orphan GPCRs.

  16. Opiate agonist-induced re-distribution of Wntless, a mu-opioid receptor interacting protein, in rat striatal neurons.

    PubMed

    Reyes, B A S; Vakharia, K; Ferraro, T N; Levenson, R; Berrettini, W H; Van Bockstaele, E J

    2012-01-01

    Wntless (WLS), a mu-opioid receptor (MOR) interacting protein, mediates Wnt protein secretion that is critical for neuronal development. We investigated whether MOR agonists induce re-distribution of WLS within rat striatal neurons. Adult male rats received either saline, morphine or [d-Ala2, N-Me-Phe4, Gly-ol5]-enkephalin (DAMGO) directly into the lateral ventricles. Following thirty minutes, brains were extracted and tissue sections were processed for immunogold silver detection of WLS. In saline-treated rats, WLS was distributed along the plasma membrane and within the cytoplasmic compartment of striatal dendrites as previously described. The ratio of cytoplasmic to total dendritic WLS labeling was 0.70±0.03 in saline-treated striatal tissue. Morphine treatment decreased this ratio to 0.48±0.03 indicating a shift of WLS from the intracellular compartment to the plasma membrane. However, following DAMGO treatment, the ratio was 0.85±0.05 indicating a greater distribution of WLS intracellularly. The difference in the re-distribution of the WLS following different agonist exposure may be related to DAMGO's well known ability to induce internalization of MOR in contrast to morphine, which is less effective in producing receptor internalization. Furthermore, these data are consistent with our hypothesis that MOR agonists promote dimerization of WLS and MOR, thereby preventing WLS from mediating Wnt secretion. In summary, our findings indicate differential agonist-induced trafficking of WLS in striatal neurons following distinct agonist exposure. Adaptations in WLS trafficking may represent a novel pharmacological target in the treatment of opiate addiction and/or pain. Copyright © 2011 Elsevier Inc. All rights reserved.

  17. Computer simulations of neural mechanisms explaining upper and lower limb excitatory neural coupling

    PubMed Central

    2010-01-01

    Background When humans perform rhythmic upper and lower limb locomotor-like movements, there is an excitatory effect of upper limb exertion on lower limb muscle recruitment. To investigate potential neural mechanisms for this behavioral observation, we developed computer simulations modeling interlimb neural pathways among central pattern generators. We hypothesized that enhancement of muscle recruitment from interlimb spinal mechanisms was not sufficient to explain muscle enhancement levels observed in experimental data. Methods We used Matsuoka oscillators for the central pattern generators (CPG) and determined parameters that enhanced amplitudes of rhythmic steady state bursts. Potential mechanisms for output enhancement were excitatory and inhibitory sensory feedback gains, excitatory and inhibitory interlimb coupling gains, and coupling geometry. We first simulated the simplest case, a single CPG, and then expanded the model to have two CPGs and lastly four CPGs. In the two and four CPG models, the lower limb CPGs did not receive supraspinal input such that the only mechanisms available for enhancing output were interlimb coupling gains and sensory feedback gains. Results In a two-CPG model with inhibitory sensory feedback gains, only excitatory gains of ipsilateral flexor-extensor/extensor-flexor coupling produced reciprocal upper-lower limb bursts and enhanced output up to 26%. In a two-CPG model with excitatory sensory feedback gains, excitatory gains of contralateral flexor-flexor/extensor-extensor coupling produced reciprocal upper-lower limb bursts and enhanced output up to 100%. However, within a given excitatory sensory feedback gain, enhancement due to excitatory interlimb gains could only reach levels up to 20%. Interconnecting four CPGs to have ipsilateral flexor-extensor/extensor-flexor coupling, contralateral flexor-flexor/extensor-extensor coupling, and bilateral flexor-extensor/extensor-flexor coupling could enhance motor output up to 32%. Enhancement observed in experimental data exceeded 32%. Enhancement within this symmetrical four-CPG neural architecture was more sensitive to relatively small interlimb coupling gains. Excitatory sensory feedback gains could produce greater output amplitudes, but larger gains were required for entrainment compared to inhibitory sensory feedback gains. Conclusions Based on these simulations, symmetrical interlimb coupling can account for much, but not all of the excitatory neural coupling between upper and lower limbs during rhythmic locomotor-like movements. PMID:21143960

  18. Motor Neurons Tune Premotor Activity in a Vertebrate Central Pattern Generator

    PubMed Central

    2017-01-01

    Central patterns generators (CPGs) are neural circuits that drive rhythmic motor output without sensory feedback. Vertebrate CPGs are generally believed to operate in a top-down manner in which premotor interneurons activate motor neurons that in turn drive muscles. In contrast, the frog (Xenopus laevis) vocal CPG contains a functionally unexplored neuronal projection from the motor nucleus to the premotor nucleus, indicating a recurrent pathway that may contribute to rhythm generation. In this study, we characterized the function of this bottom-up connection. The X. laevis vocal CPG produces a 50–60 Hz “fast trill” song used by males during courtship. We recorded “fictive vocalizations” in the in vitro CPG from the laryngeal nerve while simultaneously recording premotor activity at the population and single-cell level. We show that transecting the motor-to-premotor projection eliminated the characteristic firing rate of premotor neurons. Silencing motor neurons with the intracellular sodium channel blocker QX-314 also disrupted premotor rhythms, as did blockade of nicotinic synapses in the motor nucleus (the putative location of motor neuron-to-interneuron connections). Electrically stimulating the laryngeal nerve elicited primarily IPSPs in premotor neurons that could be blocked by a nicotinic receptor antagonist. Our results indicate that an inhibitory signal, activated by motor neurons, is required for proper CPG function. To our knowledge, these findings represent the first example of a CPG in which precise premotor rhythms are tuned by motor neuron activity. SIGNIFICANCE STATEMENT Central pattern generators (CPGs) are neural circuits that produce rhythmic behaviors. In vertebrates, motor neurons are not commonly known to contribute to CPG function, with the exception of a few spinal circuits where the functional significance of motor neuron feedback is still poorly understood. The frog hindbrain vocal circuit contains a previously unexplored connection from the motor to premotor region. Our results indicate that motor neurons activate this bottom-up connection, and blocking this signal eliminates normal premotor activity. These findings may promote increased awareness of potential involvement of motor neurons in a wider range of CPGs, perhaps clarifying our understanding of network principles underlying motor behaviors in numerous organisms, including humans. PMID:28219984

  19. Randomized, double-blind, placebo-controlled, safety and immunogenicity study of 4 formulations of Anthrax Vaccine Adsorbed plus CPG 7909 (AV7909) in healthy adult volunteers.

    PubMed

    Hopkins, Robert J; Daczkowski, Nancy F; Kaptur, Paulina E; Muse, Derek; Sheldon, Eric; LaForce, Craig; Sari, Suha; Rudge, Thomas L; Bernton, Edward

    2013-06-26

    A new anthrax vaccine that could accelerate the immune response and possibly reduce the number of injections needed for protection would be desirable in a post-exposure setting. This Phase 1 study compared the safety and immunogenicity of 2 IM doses (Days 0 and 14) of 4 formulations of AV7909 (AVA plus CPG 7909) with 2 IM doses of BioThrax(®) (Anthrax Vaccine Adsorbed) and 2 IM doses of saline placebo administered on Days 0 and 14. A total of 105 healthy adults 18-50 years of age were randomized to 1 of 6 study groups: BioThrax (0.5 mL), AV7909 Formulation 1 (0.5 mL AVA+0.5mg CPG 7909), AV7909 Formulation 2 (0.5 mL AVA+0.25mg CPG 7909), AV7909 Formulation 3 (0.25 mL AVA+0.5mg CPG 7909), AV7909 Formulation 4 (0.25 mL AVA+0.25mg CPG 7909), or saline placebo (0.5 mL). All randomized subjects received at least 1 vaccination, and 100 subjects completed the trial. After 2 doses, mean peak normalized toxin neutralizing antibody responses (TNA NF50) in the AV7909 groups were higher than in the BioThrax group. Differences among the 4 AV7909 groups were not statistically significant. Subjects who received AV7909 reached peak titers on Day 28 vs. Day 35 in the BioThrax group. The most common adverse events (AEs) in the BioThrax and AV7909 groups assessed as related to vaccination were injection site reactions. Transient lymphopenia was observed after the first dose in each AV7909 group. Frequencies of injection site and systemic reactions recorded by subjects in diaries for 7 days after each injection were highest with AV7909 Formulation 1. No AEs of special interest (autoimmune events) were observed in the study. Further studies of doses and dosing regimens are planned to assess the immunogenicity and reactogenicity of AV7909. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. DNA methylation of the BRD2 promoter is associated with juvenile myoclonic epilepsy in Caucasians.

    PubMed

    Pathak, Shilpa; Miller, James; Morris, Emily C; Stewart, William C L; Greenberg, David A

    2018-05-01

    Juvenile myoclonic epilepsy (JME) is a common adolescent-onset genetic generalized epilepsy (GGE) syndrome. Multiple linkage and association studies have found that BRD2 influences the expression of JME. The BRD2-JME connection is further corroborated by our murine model; Brd2 haploinsufficiency produces characteristics that typify the clinical hallmarks of JME. Neither we, nor several large-scale studies of JME, found JME-related BRD2 coding mutations. Therefore, we investigated noncoding BRD2 regions, seeking the origin of BRD2's JME influence. BRD2's promoter harbors a JME-associated single nucleotide polymorphism (rs3918149) and a CpG (C-phosphate-G dinucleotides) island (CpG76), making it a potential "hotspot" for JME-associated epigenetic variants. Methylating promoter CpG sites causes gene silencing, often resulting in reduced gene expression. We tested for differences in DNA methylation at CpG76 in 3 different subgroups: (1) JME patients versus their unaffected family members, (2) JME versus patients with other forms of GGE, and (3) Caucasian versus non-Caucasian JME patients. We used DNA pyrosequencing to analyze the methylation status of 10 BRD2 promoter CpG sites in lymphoblastoid cells from JME patients of Caucasian and non-Caucasian origin, unaffected family members, and also non-JME GGE patients. We also measured global methylation levels and DNA methyl transferase 1 (DNMT1) transcript expression in JME families by standard methods. CpG76 is highly methylated in JME patients compared to unaffected family members. In families with non-JME GGE, we found no relationship between promoter methylation and epilepsy. In non-Caucasian JME families, promoter methylation was mostly not associated with epilepsy. This makes the BRD2 promoter a JME-specific, ethnicity-specific, differentially methylated region. Global methylation was constant across groups. BRD2 promoter methylation in JME, and the lack of methylation in unaffected relatives, in non-JME GGE patients, and in non-Caucasian JME, demonstrate that methylation specificity is a possible seizure susceptibility motif in JME risk and suggests JME therapeutics targeting BRD2. Wiley Periodicals, Inc. © 2018 International League Against Epilepsy.

  1. Design of a new peptidomimetic agonist for the melanocortin receptors based on the solution structure of the peptide ligand, Ac-Nle-cyclo[Asp-Pro-DPhe-Arg-Trp-Lys]-NH(2).

    PubMed

    Fotsch, Christopher; Smith, Duncan M; Adams, Jeffrey A; Cheetham, Janet; Croghan, Michael; Doherty, Elizabeth M; Hale, Clarence; Jarosinski, Mark A; Kelly, Michael G; Norman, Mark H; Tamayo, Nuria A; Xi, Ning; Baumgartner, James W

    2003-07-21

    The solution structure of a potent melanocortin receptor agonist, Ac-Nle-cyclo[Asp-Pro-DPhe-Arg-Trp-Lys]-NH(2) (1) was calculated using distance restraints determined from 1H NMR spectroscopy. Eight of the lowest energy conformations from this study were used to identify non-peptide cores that mimic the spatial arrangement of the critical tripeptide region, DPhe-Arg-Trp, found in 1. From these studies, compound 2a, containing the cis-cyclohexyl core, was identified as a functional agonist of the melanocortin-4 receptor (MC4R) with an IC(50) and EC(50) below 10 nM. Compound 2a also showed 36- and 7-fold selectivity over MC3R and MC1R, respectively, in the binding assays. Subtle changes in cyclohexane stereochemistry and removal of functional groups led to analogues with lower affinity for the MC receptors.

  2. Importance of the pharmacological profile of the bound ligand in enrichment on nuclear receptors: toward the use of experimentally validated decoy ligands.

    PubMed

    Lagarde, Nathalie; Zagury, Jean-François; Montes, Matthieu

    2014-10-27

    The evaluation of virtual ligand screening methods is of major importance to ensure their reliability. Taking into account the agonist/antagonist pharmacological profile should improve the quality of the benchmarking data sets since ligand binding can induce conformational changes in the nuclear receptor structure and such changes may vary according to the agonist/antagonist ligand profile. We indeed found that splitting the agonist and antagonist ligands into two separate data sets for a given nuclear receptor target significantly enhances the quality of the evaluation. The pharmacological profile of the ligand bound in the binding site of the target structure was also found to be an additional critical parameter. We also illustrate that active compound data sets for a given pharmacological activity can be used as a set of experimentally validated decoy ligands for another pharmacological activity to ensure a reliable and challenging evaluation of virtual screening methods.

  3. The Extracellular Surface of the GLP-1 Receptor Is a Molecular Trigger for Biased Agonism.

    PubMed

    Wootten, Denise; Reynolds, Christopher A; Smith, Kevin J; Mobarec, Juan C; Koole, Cassandra; Savage, Emilia E; Pabreja, Kavita; Simms, John; Sridhar, Rohan; Furness, Sebastian G B; Liu, Mengjie; Thompson, Philip E; Miller, Laurence J; Christopoulos, Arthur; Sexton, Patrick M

    2016-06-16

    Ligand-directed signal bias offers opportunities for sculpting molecular events, with the promise of better, safer therapeutics. Critical to the exploitation of signal bias is an understanding of the molecular events coupling ligand binding to intracellular signaling. Activation of class B G protein-coupled receptors is driven by interaction of the peptide N terminus with the receptor core. To understand how this drives signaling, we have used advanced analytical methods that enable separation of effects on pathway-specific signaling from those that modify agonist affinity and mapped the functional consequence of receptor modification onto three-dimensional models of a receptor-ligand complex. This yields molecular insights into the initiation of receptor activation and the mechanistic basis for biased agonism. Our data reveal that peptide agonists can engage different elements of the receptor extracellular face to achieve effector coupling and biased signaling providing a foundation for rational design of biased agonists. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  4. Epigenetic Contribution of the Myosin Light Chain Kinase Gene to the Risk for Acute Respiratory Distress Syndrome

    PubMed Central

    Szilágyi, Keely L.; Liu, Cong; Zhang, Xu; Wang, Ting; Fortman, Jeffrey D.; Zhang, Wei; Garcia, Joe G.N.

    2016-01-01

    Acute respiratory distress syndrome (ARDS) is a devastating clinical syndrome with a considerable case fatality rate (~30-40%). Health disparities exist with African descent subjects (ADs) exhibiting greater mortality than European descent individuals (EDs). Myosin light chain kinase (MLCK) is encoded by MYLK whose genetic variants are implicated in ARDS pathogenesis and may influence ARDS mortality. As baseline population-specific epigenetic changes, i.e. cytosine modifications, have been observed between AD and ED individuals, epigenetic variations in MYLK may provide insights into ARDS disparities. We compared methylation levels of MYLK CpGs between ARDS patients and ICU controls overall and by ethnicity in a nested case control study of 39 ARDS cases and 75 non-ARDS intensive care unit controls. Two MYLK CpG sites (cg03892735, cg23344121) were differentially modified between ARDS subjects and controls (p<0.05; q<0.25) in a logistic regression model, where no effect modification from ethnicity or age was found. One CpG site was associated with ARDS in patients less than 58 years old, cg19611163 (intron 19,20). Two CpG sites were associated with ARDS in EDs only, gene body CpG (cg01894985, intron 2,3) and CpG (cg16212219, intron 31,32), with higher modification levels exhibited in ARDS subjects than controls. Cis-acting mQTL (modified cytosine quantitative trait loci) were identified using linear regression between local genetic variants and modification levels for two ARDS-associated CpGs (cg23344121, cg16212219). In summary, these ARDS-associated MYLK CpGs with effect modification by ethnicity and local mQTL, suggest that MYLK epigenetic variation and local genetic background may contribute to health disparities observed in ARDS. PMID:27543902

  5. Cardioprotective benefits of adenosine triphosphate-sensitive potassium channel opener diazoxide are lost with administration after the onset of stress in mouse and human myocytes.

    PubMed

    Janjua, M Burhan; Makepeace, Carol M; Anastacio, Melissa M; Schuessler, Richard B; Nichols, Colin G; Lawton, Jennifer S

    2014-10-01

    Adenosine triphosphate-sensitive (KATP) potassium channel opener diazoxide (DZX) maintains myocyte volume and contractility during stress via an unknown mechanism when administered at the onset of stress. This study was performed to investigate the cardioprotective potential of DZX when added after the onset of the stresses of hyperkalemic cardioplegia, metabolic inhibition, and hypo-osmotic stress. Isolated mouse ventricular and human atrial myocytes were exposed to control Tyrode's solution (TYR) for 10 to 20 minutes, test solution for 30 minutes (hypothermic hyperkalemic cardioplegia [CPG], CPG + 100uM diazoxide [CPG+DZX], metabolic inhibition [MI], MI+DZX, mild hypo-osmotic stress [0.9T], or 0.9T + DZX), with DZX added after 10 or 20 minutes of stress, followed by 20 minutes of re-exposure to TYR (±DZX). Myocyte volume (human + mouse) and contractility (mouse) were compared. Mouse and human myocytes demonstrated significant swelling during exposure to CPG, MI, and hypo-osmotic stress that was not prevented by DZX when administered either at 10 or 20 minutes after the onset of stress. Contractility after the stress of CPG in mouse myocytes significantly declined when DZX was administered 20 minutes after the onset of stress (p < 0.05 vs TYR). Contractility after hypo-osmotic stress in mouse myocytes was not altered by the addition of DZX. To maintain myocyte volume homeostasis and contractility during stress (hyperkalemic cardioplegia, metabolic inhibition, and hypo-osmotic stress), KATP channel opener diazoxide requires administration at the onset of stress in this isolated myocyte model. These data have potential implications for any future clinical application of diazoxide. Copyright © 2014 American College of Surgeons. Published by Elsevier Inc. All rights reserved.

  6. Bisphenol A-associated epigenomic changes in prepubescent girls: a cross-sectional study in Gharbiah, Egypt

    PubMed Central

    2013-01-01

    Background There is now compelling evidence that epigenetic modifications link adult disease susceptibility to environmental exposures during specific life stages, including pre-pubertal development. Animal studies indicate that bisphenol A (BPA), the monomer used in epoxy resins and polycarbonate plastics, may impact health through epigenetic mechanisms, and epidemiological data associate BPA levels with metabolic disorders, behavior changes, and reproductive effects. Thus, we conducted an environmental epidemiology study of BPA exposure and CpG methylation in pre-adolescent girls from Gharbiah, Egypt hypothesizing that methylation profiles exhibit exposure-dependent trends. Methods Urinary concentrations of total (free plus conjugated) species of BPA in spot samples were quantified for 60 girls aged 10 to 13. Genome-wide CpG methylation was concurrently measured in bisulfite-converted saliva DNA using the Infinium HumanMethylation27 BeadChip (N = 46). CpG sites from four candidate genes were validated via quantitative bisulfite pyrosequencing. Results CpG methylation varied widely among girls, and higher urinary BPA concentrations were generally associated with less genomic methylation. Based on pathway analyses, genes exhibiting reduced methylation with increasing urinary BPA were involved in immune function, transport activity, metabolism, and caspase activity. In particular, hypomethylation of CpG targets on chromosome X was associated with higher urinary BPA. Using the Comparative Toxicogenomics Database, we identified a number of candidate genes in our sample that previously have been associated with BPA-related expression change. Conclusions These data indicate that BPA may affect human health through specific epigenomic modification of genes in relevant pathways. Thus, epigenetic epidemiology holds promise for the identification of biomarkers from previous exposures and the development of epigenetic-based diagnostic strategies. PMID:23590724

  7. Superior diastolic function with KATP channel opener diazoxide in a novel mouse Langendorff model.

    PubMed

    Makepeace, Carol M; Suarez-Pierre, Alejandro; Kanter, Evelyn M; Schuessler, Richard B; Nichols, Colin G; Lawton, Jennifer S

    2018-07-01

    Adenosine triphosphate-sensitive potassium (K ATP ) channel openers have been found to be cardioprotective in multiple animal models via an unknown mechanism. Mouse models allow genetic manipulation of K ATP channel components for the investigation of this mechanism. Mouse Langendorff models using 30 min of global ischemia are known to induce measurable myocardial infarction and injury. Prolongation of global ischemia in a mouse Langendorff model could allow the determination of the mechanisms involved in K ATP channel opener cardioprotection. Mouse hearts (C57BL/6) underwent baseline perfusion with Krebs-Henseleit buffer (30 min), assessment of function using a left ventricular balloon, delivery of test solution, and prolonged global ischemia (90 min). Hearts underwent reperfusion (30 min) and functional assessment. Coronary flow was measured using an inline probe. Test solutions included were as follows: hyperkalemic cardioplegia alone (CPG, n = 11) or with diazoxide (CPG + DZX, n = 12). Although the CPG + DZX group had greater percent recovery of developed pressure and coronary flow, this was not statistically significant. Following a mean of 74 min (CPG) and 77 min (CPG + DZX), an additional increase in end-diastolic pressure was noted (plateau), which was significantly higher in the CPG group. Similarly, the end-diastolic pressure (at reperfusion and at the end of experiment) was significantly higher in the CPG group. Prolongation of global ischemia demonstrated added benefit when DZX was added to traditional hyperkalemic CPG. This model will allow the investigation of DZX mechanism of cardioprotection following manipulation of targeted K ATP channel components. This model will also allow translation to prolonged ischemic episodes associated with cardiac surgery. Copyright © 2018 Elsevier Inc. All rights reserved.

  8. A phenolic glycoside from Flacourtia indica induces heme mediated oxidative stress in Plasmodium falciparum and attenuates malaria pathogenesis in mice.

    PubMed

    Singh, Shiv Vardan; Manhas, Ashan; Singh, Suriya P; Mishra, Sonali; Tiwari, Nimisha; Kumar, Parmanand; Shanker, Karuna; Srivastava, Kumkum; Sashidhara, Koneni V; Pal, Anirban

    2017-07-01

    Flacourtia indica is especially popular among the various communities of many African countries where it is being used traditionally for the treatment of malaria. In our previous report, we have identified some phenolic glycosides from the aerial parts of F. indica as promising antiplasmodial agents under in vitro conditions. Antimalarial bioprospection of F. indica derived phenolic glycoside in Swiss mice (in vivo) with special emphasis on its mode of action. Chloroquine sensitive strain of Plasmodium falciparum was routinely cultured and used for the in vitro studies. The in vivo antimalarial potential of phenolic glycoside was evaluated against P. berghei in Swiss mice through an array of parameters viz., hematological, biochemical, chemo-suppression and mean survival time. 2-(6-benzoyl-β-d-glucopyranosyloxy)-7-(1α, 2α, 6α-trihydroxy-3-oxocyclohex-4-enoyl)-5-hydroxybenzyl alcohol (CPG), a phenolic glycoside isolated from the aerial parts of F. indica was found to exhibit promising antiplasmodial activity by arresting the P. falciparum growth at the trophozoite stage. Spectroscopic investigations reveal that CPG possesses a strong binding affinity with free heme moieties. In addition, these interactions lead to the inhibition of heme polymerization in malaria parasite, augmenting oxidative stress, and delaying the rapid growth of parasite. Under in-vivo condition, CPG exhibited significant antimalarial activity against P. berghei at 50 and 75mg/kg body weight through chemo-suppression of parasitemia and ameliorating the parasite induced inflammatory and oxidative (hepatic) imbalance in the experimental mice. CPG was found to be a potential antimalarial constituent of F. indica with an explored mechanism of action, which also offers the editing choices for developing CPG based antimalarial chemotypes. Copyright © 2017 Elsevier GmbH. All rights reserved.

  9. Adherence to Clinical Practice Guidelines during Dementia Work-Up in a Real-World Setting: A Study from the Registry of Dementias of Girona.

    PubMed

    Turró-Garriga, Oriol; Calvó-Perxas, Laia; Vilalta-Franch, Joan; Hernández-Ferrándiz, Marta; Flaqué, Margarita; Linares, Marta; Cullell, Marta; Gich, Jordi; Casas, Isabel; Perkal, Héctor; Garre-Olmo, Josep

    2017-01-01

    There are several position statements and clinical practice guidelines (CPG) for diagnosing dementia. Our aims were to evaluate the adherence to CPG among specialists in the 7 memory clinics included in the Registry of Dementias of Girona (ReDeGi), and to compare the results between 2007-2011 and 2012-2015. We also determined the time and number of visits required to achieve a diagnosis, the supplementary tests ordered, and the drugs prescribed according to dementia subtypes. Medical charts of a stratified random sample of 475 ReDeGi cases were reviewed. Basic dementia work-up was evaluated using as a reference evidence-based CPG. An Index of Adherence (AI) was calculated using the following items in the medical chart: cognitive symptomatology; functional disability evaluation; physical examination; neurological examination; psychiatric examination; brief cognitive examination; activities of daily living performance examination; blood test; structural neuroimaging (CT-scan or MRI). The mean AI to CPG among specialists was of 8.2 points, and it improved from 7.9 points in 2007-2011 to 8.5 points in 2012-2015 (Cohen's d = 0.46). A lower adherence was detected in the most severe cases. A dementia diagnosis required 3.5 visits, regardless of the subtype of dementia, although milder cases required more time, more visits, and more supplementary tests than severe cases. The adherence to CPG in the catchment area of the ReDeGi is high, and an epidemiological surveillance system such as the ReDeGi may help in improving it. Dementia guidelines should establish procedures adapted to clinical practice, with simplified recommendations for most severe cases.

  10. Genome-wide methylation analysis identifies differentially methylated CpG loci associated with severe obesity in childhood.

    PubMed

    Huang, R C; Garratt, E S; Pan, H; Wu, Y; Davis, E A; Barton, S J; Burdge, G C; Godfrey, K M; Holbrook, J D; Lillycrop, K A

    2015-01-01

    Childhood obesity is a major public health issue. Here we investigated whether differential DNA methylation was associated with childhood obesity. We studied DNA methylation profiles in whole blood from 78 obese children (mean BMI Z-score: 2.6) and 71 age- and sex-matched controls (mean BMI Z-score: 0.1). DNA samples from obese and control groups were pooled and analyzed using the Infinium HumanMethylation450 BeadChip array. Comparison of the methylation profiles between obese and control subjects revealed 129 differentially methylated CpG (DMCpG) loci associated with 80 unique genes that had a greater than 10% difference in methylation (P-value < 0.05). The top pathways enriched among the DMCpGs included developmental processes, immune system regulation, regulation of cell signaling, and small GTPase-mediated signal transduction. The associations between the methylation of selected DMCpGs with childhood obesity were validated using sodium bisulfite pyrosequencing across loci within the FYN, PIWIL4, and TAOK3 genes in individual subjects. Three CpG loci within FYN were hypermethylated in obese individuals (all P < 0.01), while obesity was associated with lower methylation of CpG loci within PIWIL4 (P = 0.003) and TAOK3 (P = 0.001). After building logistic regression models, we determined that a 1% increase in methylation in TAOK3, multiplicatively decreased the odds of being obese by 0.91 (95% CI: 0.86 - 0.97), and an increase of 1% methylation in FYN CpG3, multiplicatively increased the odds of being obese by 1.03 (95% CI: 0.99 - 1.07). In conclusion, these findings provide evidence that childhood obesity is associated with specific DNA methylation changes in whole blood, which may have utility as biomarkers of obesity risk.

  11. Correlation of CpG Island Methylation of the Cytochrome P450 2E1/2D6 Genes with Liver Injury Induced by Anti-Tuberculosis Drugs: A Nested Case-Control Study.

    PubMed

    Zhang, Jinling; Zhu, Xuebin; Li, Yuhong; Zhu, Lingyan; Li, Shiming; Zheng, Guoying; Ren, Qi; Xiao, Yonghong; Feng, Fumin

    2016-08-01

    This study investigated the role of CpG island methylation of the CYP2E1 and CYP2D6 genes in liver injury induced by anti-TB drugs from an epigenetic perspective in a Chinese cohort. A 1:1 matched nested case-control study design was applied. Pulmonary tuberculosis (TB) patients, who underwent standard anti-TB therapy and developed liver injury were defined as cases, while those who did not develop liver injury were defined as control. The two groups were matched in terms of sex, treatment regimen, and age. In 114 pairs of cases, CpG island methylation levels of the CYP2E1 and CYP2D6 genes in plasma cell-free DNA were found to be significantly correlated with the occurrence of anti-TB drug-induced liver injury (ADLI), with odds ratio (OR) values of 2.429 and 3.500, respectively (p < 0.01). Moreover, through multivariate logistic regression analysis, CpG island methylation of the CYP2E1 and CYP2D6 genes in plasma cell-free DNA were found to be significantly correlated with the occurrence of ADLI, with adjusted OR values of 4.390 (95% confidence interval (CI): 1.982-9.724) and 9.193 (95% CI: 3.624-25.888), respectively (p < 0.001). These results suggest that aberrantly elevated methylation of CpG islands of the CYP2E1 and CYP2D6 genes in plasma cell-free DNA may increase the risk of ADLI in Chinese TB patients.

  12. Methylomics of gene expression in human monocytes

    PubMed Central

    Liu, Yongmei; Ding, Jingzhong; Reynolds, Lindsay M.; Lohman, Kurt; Register, Thomas C.; De La Fuente, Alberto; Howard, Timothy D.; Hawkins, Greg A.; Cui, Wei; Morris, Jessica; Smith, Shelly G.; Barr, R. Graham; Kaufman, Joel D.; Burke, Gregory L.; Post, Wendy; Shea, Steven; Mccall, Charles E.; Siscovick, David; Jacobs, David R.; Tracy, Russell P.; Herrington, David M.; Hoeschele, Ina

    2013-01-01

    DNA methylation is one of several epigenetic mechanisms that contribute to the regulation of gene expression; however, the extent to which methylation of CpG dinucleotides correlates with gene expression at the genome-wide level is still largely unknown. Using purified primary monocytes from subjects in a large community-based cohort (n = 1264), we characterized methylation (>485 000 CpG sites) and mRNA expression (>48K transcripts) and carried out genome-wide association analyses of 8370 expression phenotypes. We identified 11 203 potential cis-acting CpG loci whose degree of methylation was associated with gene expression (eMS) at a false discovery rate threshold of 0.001. Most of the associations were consistent in effect size and direction of effect across sex and three ethnicities. Contrary to expectation, these eMS were not predominately enriched in promoter regions, or CpG islands, but rather in the 3′ UTR, gene bodies, CpG shores or ‘offshore’ sites, and both positive and negative correlations between methylation and expression were observed across all locations. eMS were enriched for regions predicted to be regulatory by ENCODE (Encyclopedia of DNA Elements) data in multiple cell types, particularly enhancers. One of the strongest association signals detected (P < 2.2 × 10−308) was a methylation probe (cg17005068) in the promoter/enhancer region of the glutathione S-transferase theta 1 gene (GSTT1, encoding the detoxification enzyme) with GSTT1 mRNA expression. Our study provides a detailed description of the epigenetic architecture in human monocytes and its relationship to gene expression. These data may help prioritize interrogation of biologically relevant methylation loci and provide new insights into the epigenetic basis of human health and diseases. PMID:23900078

  13. Gold nanoparticle–M2e conjugate coformulated with CpG induces protective immunity against influenza A virus

    PubMed Central

    Tao, Wenqian; Ziemer, Katherine S; Gill, Harvinder S

    2014-01-01

    Aim: This study aimed to develop a novel influenza A vaccine by conjugating the highly conserved extracellular region of the matrix 2 protein (M2e) of influenza A virus to gold nanoparticles (AuNPs) and to test the vaccine in a mouse influenza challenge model. Materials & methods: Citrate-reduced AuNPs (diameter: 12 nm) were synthesized, and characterized by transmission electron microscopy and dynamic light scattering. M2e was conjugated to AuNPs through thiol–gold interactions to form M2e–AuNP conjugates. Particle stability was confirmed by UV–visible spectra, and M2e conjugation was further characterized by x-ray photoelectron spectroscopy. Mice were immunized with M2e–AuNPs with or without CpG (cytosine-guanine rich oligonucleotide) as an adjuvant with appropriate control groups. Sera was collected and M2e-specific immunoglobulin (IgG) was measured, and immunized mice were challenged with PR8-H1N1 influenza virus. Results: M2e-capped AuNPs could be lyophilized and stably resuspended in water. Intranasal vaccination of mice with M2e–AuNP conjugates induced M2e-specific IgG serum antibodies, which significantly increased upon addition of soluble CpG as adjuvant. Upon challenge with lethal PR8, mice vaccinated with M2e-AuNP conjugates were only partially protected, while mice that received soluble CpG as adjuvant in addition to M2e–AuNP were fully protected. Conclusion: Overall, this study demonstrates the potential of using the M2e–AuNP conjugates with CpG as an adjuvant as a platform for developing an influenza A vaccine. PMID:23829488

  14. In vitro effects of CpG oligodeoxynucleotides delivered by gelatin nanoparticles on canine peripheral blood mononuclear cells of atopic and healthy dogs - a pilot study.

    PubMed

    Prélaud, Ana Rostaher; Fuchs, Sebastian; Weber, Karin; Winter, Gerhard; Coester, Conrad; Mueller, Ralf S

    2013-10-01

    Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides offer a novel promising immunotherapeutic approach for atopic dermatitis (AD) both in humans and animals. Gelatin nanoparticles (GNP) enhance and prolong CpG-associated immunomodulatory effects and minimize adverse effects both in vitro and in vivo. Information about the effects of this combination in dogs is lacking. The aim of this study was to evaluate immunological effects of CpG coupled to GNP on canine peripheral blood mononuclear cells (PBMCs) in vitro. Eight dogs with AD, diagnosed by standard criteria and with a concurrent immediate hypersensitivity to house dust mites were included. Control samples were taken from eight healthy, age-matched control dogs without history or evidence of cutaneous or systemic illness. Peripheral blood mononuclear cells of healthy and allergic dogs were incubated with CpG-GNP and the uptake of CpG-GNP was demonstrated using confocal laser scanning microscopy. Cell culture supernatant concentrations of interferon gamma (IFN-γ), interleukin (IL)-4, IL-6 and IL-10 were measured by Canine Cytokine Milliplex. No significant changes in IFN-γ and IL-4 were found when comparing PBMCs incubated with CpG and CpG-GNP with the negative controls in atopic and healthy dogs. Interleukin-6 was not detected in any of the groups. However, a statistically significant increase in IL-10 concentration was found after 24 h stimulation with CpG-GNP compared with CpG alone both in atopic and healthy dogs. As IL-10 is considered an immunosuppressive cytokine playing a key role in peripheral tolerance; the reported CpG-GNP formulation could be a new approach in allergy treatment. © 2013 ESVD and ACVD.

  15. DNA methylation signatures of chronic low-grade inflammation are associated with complex diseases.

    PubMed

    Ligthart, Symen; Marzi, Carola; Aslibekyan, Stella; Mendelson, Michael M; Conneely, Karen N; Tanaka, Toshiko; Colicino, Elena; Waite, Lindsay L; Joehanes, Roby; Guan, Weihua; Brody, Jennifer A; Elks, Cathy; Marioni, Riccardo; Jhun, Min A; Agha, Golareh; Bressler, Jan; Ward-Caviness, Cavin K; Chen, Brian H; Huan, Tianxiao; Bakulski, Kelly; Salfati, Elias L; Fiorito, Giovanni; Wahl, Simone; Schramm, Katharina; Sha, Jin; Hernandez, Dena G; Just, Allan C; Smith, Jennifer A; Sotoodehnia, Nona; Pilling, Luke C; Pankow, James S; Tsao, Phil S; Liu, Chunyu; Zhao, Wei; Guarrera, Simonetta; Michopoulos, Vasiliki J; Smith, Alicia K; Peters, Marjolein J; Melzer, David; Vokonas, Pantel; Fornage, Myriam; Prokisch, Holger; Bis, Joshua C; Chu, Audrey Y; Herder, Christian; Grallert, Harald; Yao, Chen; Shah, Sonia; McRae, Allan F; Lin, Honghuang; Horvath, Steve; Fallin, Daniele; Hofman, Albert; Wareham, Nicholas J; Wiggins, Kerri L; Feinberg, Andrew P; Starr, John M; Visscher, Peter M; Murabito, Joanne M; Kardia, Sharon L R; Absher, Devin M; Binder, Elisabeth B; Singleton, Andrew B; Bandinelli, Stefania; Peters, Annette; Waldenberger, Melanie; Matullo, Giuseppe; Schwartz, Joel D; Demerath, Ellen W; Uitterlinden, André G; van Meurs, Joyce B J; Franco, Oscar H; Chen, Yii-Der Ida; Levy, Daniel; Turner, Stephen T; Deary, Ian J; Ressler, Kerry J; Dupuis, Josée; Ferrucci, Luigi; Ong, Ken K; Assimes, Themistocles L; Boerwinkle, Eric; Koenig, Wolfgang; Arnett, Donna K; Baccarelli, Andrea A; Benjamin, Emelia J; Dehghan, Abbas

    2016-12-12

    Chronic low-grade inflammation reflects a subclinical immune response implicated in the pathogenesis of complex diseases. Identifying genetic loci where DNA methylation is associated with chronic low-grade inflammation may reveal novel pathways or therapeutic targets for inflammation. We performed a meta-analysis of epigenome-wide association studies (EWAS) of serum C-reactive protein (CRP), which is a sensitive marker of low-grade inflammation, in a large European population (n = 8863) and trans-ethnic replication in African Americans (n = 4111). We found differential methylation at 218 CpG sites to be associated with CRP (P < 1.15 × 10 -7 ) in the discovery panel of European ancestry and replicated (P < 2.29 × 10 -4 ) 58 CpG sites (45 unique loci) among African Americans. To further characterize the molecular and clinical relevance of the findings, we examined the association with gene expression, genetic sequence variants, and clinical outcomes. DNA methylation at nine (16%) CpG sites was associated with whole blood gene expression in cis (P < 8.47 × 10 -5 ), ten (17%) CpG sites were associated with a nearby genetic variant (P < 2.50 × 10 -3 ), and 51 (88%) were also associated with at least one related cardiometabolic entity (P < 9.58 × 10 -5 ). An additive weighted score of replicated CpG sites accounted for up to 6% inter-individual variation (R2) of age-adjusted and sex-adjusted CRP, independent of known CRP-related genetic variants. We have completed an EWAS of chronic low-grade inflammation and identified many novel genetic loci underlying inflammation that may serve as targets for the development of novel therapeutic interventions for inflammation.

  16. Combined epigenetic and intraspecific variation of the DRD4 and SERT genes influence novelty seeking behavior in great tit Parus major

    PubMed Central

    Riyahi, Sepand; Sánchez-Delgado, Marta; Calafell, Francesc; Monk, David; Senar, Juan Carlos

    2015-01-01

    DNA methylation is one of the main epigenetic mechanisms that can regulate gene expression and is an important means for creating phenotypic variation. In the present study, we performed methylation profiling of 2 candidate genes for personality traits, namely DRD4 and SERT, in the great tit Parus major to ascertain whether personality traits and behavior within different habitats have evolved with the aid of epigenetic variation. We applied bisulphite PCR and strand-specific sequencing to determine the methylation profile of the CpG dinucleotides in the DRD4 and SERT promoters and also in the CpG island overlapping DRD4 exon 3. Furthermore, we performed pyrosequencing to quantify the total methylation levels at each CpG location. Our results indicated that methylation was ∼1–4% higher in urban than in forest birds, for all loci and tissues analyzed, suggesting that this epigenetic modification is influenced by environmental conditions. Screening of genomic DNA sequence revealed that the SERT promoter is CpG poor region. The methylation at a single CpG dinucleotide located 288 bp from the transcription start site was related to exploration score in urban birds. In addition, the genotypes of the SERT polymorphism SNP234 located within the minimal promoter were significantly correlated with novelty seeking behavior in captivity, with the allele increasing this behavior being more frequent in urban birds. As a conclusion, it seems that both genetic and methylation variability of the SERT gene have an important role in shaping personality traits in great tits, whereas genetic and methylation variation at the DRD4 gene is not strongly involved in behavior and personality traits. PMID:25933062

  17. Adherence to Clinical Practice Guidelines (CPG) management of dengue infection in adults (revised 2nd edition)

    PubMed Central

    Suli, Zailiza; Singh Gill, Balvinder; Rudra Deva, Shanti; Abdullah Sani, Ana Fizalinda; Romli, Erni Zurina; Mohamed Ghazali, Izzuna Mudla; Mohd. Yusof, Mohd. Aminuddin; Ahmad Lutfi, Nafisah; Shuib, Shahril Effendi; Mohd Darus, Noormah; Bakri, Rugayah

    2017-01-01

    The Malaysian Dengue Clinical Practice Guidelines (CPG) have been developed to provide evidence-based guidance in the management of dengue infections. The use of these guidelines is essential to ensure its recommendations are being practiced. However, the adherence to the guidelines for management of dengue (revised 2nd edition) by healthcare providers still remains unknown. Therefore, the aim of this study was to evaluate the proportion among healthcare providers that adhere to this Dengue CPG. A retrospective cohort study of dengue cases registered from 1 January 2014 to 1 June 2015 was conducted in public hospitals and health clinics in Selangor, Putrajaya and Kuala Lumpur. Adherence to the CPG recommendations were recorded by reviewing patients’ case notes. Overall proportion of adherence in clinical components of the recommendation were (7.1 to 100.0% versus 7.7 to 73.8%) in history taking, (6.7 to 100.0% versus 12.3 to 60.0%) in physical examinations, (18.4 to 100.0% versus 23.1 to 83.2%) in assessment of warning signs, (0.6 to 100.0% versus 12.3 to 87.7%) in assessment of haemodynamic status, (60.0 to 100.0% versus 27.7 to 40.0%) in diagnosis, (46.6 to 80.0% versus 52.3%) in case notifications, (73.2 to 100.0% versus 89.2 to 96.9%) in performing specific laboratory investigations and (7.9 to 100.0% versus 21.5%) in monitoring, for outpatient versus inpatient, respectively. Adherence trends were demonstrated to be higher in hospital settings compared to outpatient settings. Adherence to this Dengue CPG varies widely with overall good clinical outcomes observed. PMID:29095822

  18. The correlation between pulmonary fibrosis and methylation of peripheral Smad3 in cases of pigeon breeder's lung in a Chinese Uygur population.

    PubMed

    Wu, Chao; Ding, Wei; Li, Qifeng; Wang, Wenyi; Deng, Mingqin; Jin, Rong; Pang, Baosen; Yang, Xiaohong

    2017-06-27

    Smad3 is a key protein in the transforming growth factor-beta (TGF-β)/Smad signaling pathway, which is involved in fibrosis in many organs. We investigated the relationship between Smad3 gene methylation and pulmonary fibrosis in pigeon breeder's lung (PBL). Twenty Uygur PBL patients with pulmonary fibrosis in Kashi between October 2015 and March 2016 were enrolled. Twenty PBL-free pigeon breeders and 20 healthy non-pigeon breeders enrolled during the same period constituted the negative and normal control groups, respectively. Participants' data and peripheral blood samples were collected, and three Smad3 CpG loci were examined. Distributions of CpG_2 and CpG_4 methylation rates did not differ across groups, whereas distributions of CpG_3 methylation rates were significantly different among the three groups. The CpG_3 methylation rate was significantly lower in the patient group than in the negative control group. Smad3 mRNA expression was significantly higher in the patient group than in the negative control group but did not differ between the two control groups. TGF-βlevels were significantly higher in the patient group than in either control group (both P<0.01). Smad3 gene methylation and Smad3 mRNA expression were negatively correlated, with a correlation coefficient of -0.84. The number of pigeons bred during the preceding three months was positively correlated with Smad3 mRNA expression, with a correlation coefficient of 0.77. Smad3 gene hypomethylation might promote pulmonary fibrosis in Uygur PBL patients via increased Smad3 mRNA expression. Smad3 methylation, Smad3 mRNA expression and TGF-β level were correlated with the number of pigeons bred by patients.

  19. The Human ARF Cell Cycle Regulatory Gene Promoter Is a CpG Island Which Can Be Silenced by DNA Methylation and Down-Regulated by Wild-Type p53

    PubMed Central

    Robertson, Keith D.; Jones, Peter A.

    1998-01-01

    The INK4a/ARF locus encodes two proteins involved in tumor suppression in a manner virtually unique in mammalian cells. Distinct first exons, driven from separate promoters, splice onto a common exon 2 and 3 but utilize different reading frames to produce two completely distinct proteins, both of which play roles in cell cycle control. INK4a, a critical element of the retinoblastoma gene pathway, binds to and inhibits the activities of CDK4 and CDK6, while ARF, a critical element of the p53 pathway, increases the level of functional p53 via interaction with MDM2. Here we clone and characterize the promoter of the human ARF gene and show that it is a CpG island characteristic of a housekeeping gene which contains numerous Sp1 sites. Both ARF and INK4a are coordinately expressed in cells except when their promoter regions become de novo methylated. In one of these situations, ARF transcription could be reactivated by treatment with the DNA methylation inhibitor 5-aza-2′-deoxycytidine, and the reactivation kinetics of ARF and INK4a were found to differ slightly in a cell line in which both genes were silenced by methylation. The ARF promoter was also found to be highly responsive to E2F1 expression, in keeping with previous results at the RNA level. Lastly, transcription from the ARF promoter was down-regulated by wild-type p53 expression, and the magnitude of the effect correlated with the status of the endogenous p53 gene. This finding points to the existence of an autoregulatory feedback loop between p53, MDM2, and ARF, aimed at keeping p53 levels in check. PMID:9774662

  20. [The German program for disease management guidelines: evaluation by use of quality indicators].

    PubMed

    Kopp, Ina B; Geraedts, Max; Jäckel, Wilfried H; Altenhofen, Lutz; Thomeczek, Christian; Ollenschläger, Günter

    2007-08-15

    The Program for National Disease Management Guidelines (German DM-CPG Program) in Germany aims at the implementation of best-practice recommendations for prevention, acute care, rehabilitation and chronic care in the setting of disease management programs and integrated health-care systems. Like other guidelines, DM-CPG need to be assessed regarding their influence on structures, processes and outcomes of care. However, quality assessment in integrated health-care systems is challenging. On the one hand, a multitude of potential domains for measurement, actors and perspectives need to be considered. On the other hand, measures need to be identified that assess the function of the diagnostic and therapeutic chain in terms of cooperation and coordination of care. The article reviews methods and use of quality indicators in the context of the German DM-CPG Program.

  1. [General Strategies for Implementation of Clinical Practice Guidelines].

    PubMed

    Valenzuela-Flores, Adriana Abigail; Viniegra-Osorio, Arturo; Torres-Arreola, Laura Laura

    2015-01-01

    The need to use clinical practice guidelines (CPG) arises from the health conditions and problems that public health institutions in the country face. CPG are informative documents that help improve the quality of care processes and patient safety; having among its objectives, to reduce the variability of medical practice. The Instituto Mexicano del Seguro Social designed a strategic plan for the dissemination, implementation, monitoring and control of CPG to establish an applicable model in the medical units in the three levels of care at the Instituto. This paper summarizes some of the strategies of the plan that were made with the knowledge and experience of clinicians and managers, with which they intend to promote the adoption of the key recommendations of the guidelines, to promote a sense of belonging for health personnel, and to encourage changes in organizational culture.

  2. Profiling DNA methylome landscapes of mammalian cells with single-cell reduced-representation bisulfite sequencing.

    PubMed

    Guo, Hongshan; Zhu, Ping; Guo, Fan; Li, Xianlong; Wu, Xinglong; Fan, Xiaoying; Wen, Lu; Tang, Fuchou

    2015-05-01

    The heterogeneity of DNA methylation within a population of cells necessitates DNA methylome profiling at single-cell resolution. Recently, we developed a single-cell reduced-representation bisulfite sequencing (scRRBS) technique in which we modified the original RRBS method by integrating all the experimental steps before PCR amplification into a single-tube reaction. These modifications enable scRRBS to provide digitized methylation information on ∼1 million CpG sites within an individual diploid mouse or human cell at single-base resolution. Compared with the single-cell bisulfite sequencing (scBS) technique, scRRBS covers fewer CpG sites, but it provides better coverage for CpG islands (CGIs), which are likely to be the most informative elements for DNA methylation. The entire procedure takes ∼3 weeks, and it requires strong molecular biology skills.

  3. Education Agonistes: An Epistle to the Transnational Capitalist Class

    ERIC Educational Resources Information Center

    McLaren, Peter

    2014-01-01

    This article examines the current crisis of neoliberal capitalism and globalized imperialism from the perspective of a Marxist-humanist approach to pedagogy known as "revolutionary critical pedagogy". It is written as an epistle to the transnational capitalist class, demanding that those who willingly serve its interests reconsider their…

  4. To Enforce or Not to Enforce? The Use of Collaborative Interfaces to Promote Social Skills in Children with High Functioning Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Ben-Sasson, Ayelet; Lamash, Liron; Gal, Eynat

    2013-01-01

    The goal of this study was to examine whether a technological touch activated Collaborative Puzzle Game (CPG) increased positive social behaviors in children with high functioning autism spectrum disorder (HFASD). The CPG involved construction of a virtual puzzle by selecting and dragging pieces into the solution area on a touch screen table. The…

  5. South African Guidelines Excellence (SAGE): Adopt, adapt, or contextualise?

    PubMed

    Dizon, J M; Grimmer, K; Louw, Q; Kredo, T; Young, T; Machingaidze, S

    2016-12-01

    Clinical practice guideline (CPG) activities must be planned carefully for efficient use of available resources and evidence-based implementation. De novo development of CPGs may sometimes 'recreate the wheel' and delay implementation. Three innovative alternatives to de novo CPG development (adopt, contextualise or adapt) are outlined, which have greater potential than de novo development to best use the limited available resources, personnel and time in settings such as South Africa.

  6. Integrative Cardiac Health Project, Windber Research Institute

    DTIC Science & Technology

    2014-07-01

    laparoscopically placed adjustable gastric banding (LAGB) baseline (5) and one year (5), control baseline (5) and one year (5). OD260/280 ratios...coverage and detection of 3-4 million CpG sites . All samples had a bisulfite conversion rate of >98.25%; number of CpG (methylated) sites per sample...methylation) and hyper-methylated (increasing methylation) sites in the three groups were identified. For LAGB patients, a heat map based on

  7. Modulation of transcription factor binding and epigenetic regulation of the MLH1 CpG island and shore by polymorphism rs1800734 in colorectal cancer

    PubMed Central

    Savio, Andrea J.; Bapat, Bharati

    2017-01-01

    ABSTRACT The MLH1 promoter polymorphism rs1800734 is associated with MLH1 CpG island hypermethylation and expression loss in colorectal cancer (CRC). Conversely, variant rs1800734 is associated with MLH1 shore, but not island, hypomethylation in peripheral blood mononuclear cell DNA. To explore these distinct patterns, MLH1 CpG island and shore methylation was assessed in CRC cell lines stratified by rs1800734 genotype. Cell lines containing the variant A allele demonstrated MLH1 shore hypomethylation compared to wild type (GG). There was significant enrichment of transcription factor AP4 at the MLH1 promoter in GG and GA cell lines, but not the AA cell line, by chromatin immunoprecipitation studies. Preferential binding to the G allele was confirmed by sequencing in the GA cell line. The enhancer-associated histone modification H3K4me1 was enriched at the MLH1 shore; however, H3K27ac was not, indicating the shore is an inactive enhancer. These results demonstrate the role of variant rs1800734 in altering transcription factor binding as well as epigenetics at regions beyond the MLH1 CpG island in which it is located. PMID:28304185

  8. Modulation of transcription factor binding and epigenetic regulation of the MLH1 CpG island and shore by polymorphism rs1800734 in colorectal cancer.

    PubMed

    Savio, Andrea J; Bapat, Bharati

    2017-06-03

    The MLH1 promoter polymorphism rs1800734 is associated with MLH1 CpG island hypermethylation and expression loss in colorectal cancer (CRC). Conversely, variant rs1800734 is associated with MLH1 shore, but not island, hypomethylation in peripheral blood mononuclear cell DNA. To explore these distinct patterns, MLH1 CpG island and shore methylation was assessed in CRC cell lines stratified by rs1800734 genotype. Cell lines containing the variant A allele demonstrated MLH1 shore hypomethylation compared to wild type (GG). There was significant enrichment of transcription factor AP4 at the MLH1 promoter in GG and GA cell lines, but not the AA cell line, by chromatin immunoprecipitation studies. Preferential binding to the G allele was confirmed by sequencing in the GA cell line. The enhancer-associated histone modification H3K4me1 was enriched at the MLH1 shore; however, H3K27ac was not, indicating the shore is an inactive enhancer. These results demonstrate the role of variant rs1800734 in altering transcription factor binding as well as epigenetics at regions beyond the MLH1 CpG island in which it is located.

  9. Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration.

    PubMed

    Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu

    2015-01-01

    Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn't affect Egf mRNA expression during the re-organization phase.

  10. Applying the RE-AIM Framework to Evaluate the Dissemination and Implementation of Clinical Practice Guidelines for Sexually Transmitted Infections.

    PubMed

    Jeong, Heon-Jae; Jo, Heui-Sug; Oh, Moo-Kyung; Oh, Hyung-Won

    2015-07-01

    Clinical practice guidelines (CPG) are one of the most effective ways to translate evidence of medical improvement into everyday practice. This study evaluated the dissemination and implementation of the Sexually Transmitted Infections-Korean Guidelines (STIKG) by applying the reach, effectiveness, adoption, implementation and maintenance (RE-AIM) framework. A survey questionnaire was administered to clinicians via the internet. Among the 332 respondents, 190 (57.2%) stated that they were aware of STIKG and 107 (33.2%) implemented STIKG in their practice. The odds that a physician was exposed to STIKG (dissemination) were 2.61 times greater among physicians with previous training or education for any CPG than those who did not. Clinicians who indicated that STIKG were easy to understand were 4.88 times more likely to implement STIKG in their practice than those who found them not so easy. When a clinician's workplace had a supporting system for CPG use, the odds of implementation was 3.76 times higher. Perceived level of effectiveness of STIKG did not significantly influence their implementation. The findings of this study suggest that, ultimately, knowing how to engage clinicians in CPG implementation is as important as how to disseminate such guidelines; moreover, easy-to-use guidelines and institutional support are key factors.

  11. Toward robust phase-locking in Melibe swim central pattern generator models

    NASA Astrophysics Data System (ADS)

    Jalil, Sajiya; Allen, Dane; Youker, Joseph; Shilnikov, Andrey

    2013-12-01

    Small groups of interneurons, abbreviated by CPG for central pattern generators, are arranged into neural networks to generate a variety of core bursting rhythms with specific phase-locked states, on distinct time scales, which govern vital motor behaviors in invertebrates such as chewing and swimming. These movements in lower level animals mimic motions of organs in higher animals due to evolutionarily conserved mechanisms. Hence, various neurological diseases can be linked to abnormal movement of body parts that are regulated by a malfunctioning CPG. In this paper, we, being inspired by recent experimental studies of neuronal activity patterns recorded from a swimming motion CPG of the sea slug Melibe leonina, examine a mathematical model of a 4-cell network that can plausibly and stably underlie the observed bursting rhythm. We develop a dynamical systems framework for explaining the existence and robustness of phase-locked states in activity patterns produced by the modeled CPGs. The proposed tools can be used for identifying core components for other CPG networks with reliable bursting outcomes and specific phase relationships between the interneurons. Our findings can be employed for identifying or implementing the conditions for normal and pathological functioning of basic CPGs of animals and artificially intelligent prosthetics that can regulate various movements.

  12. dbCPG: A web resource for cancer predisposition genes

    PubMed Central

    Wei, Ran; Yao, Yao; Yang, Wu; Zheng, Chun-Hou; Zhao, Min; Xia, Junfeng

    2016-01-01

    Cancer predisposition genes (CPGs) are genes in which inherited mutations confer highly or moderately increased risks of developing cancer. Identification of these genes and understanding the biological mechanisms that underlie them is crucial for the prevention, early diagnosis, and optimized management of cancer. Over the past decades, great efforts have been made to identify CPGs through multiple strategies. However, information on these CPGs and their molecular functions is scattered. To address this issue and provide a comprehensive resource for researchers, we developed the Cancer Predisposition Gene Database (dbCPG, Database URL: http://bioinfo.ahu.edu.cn:8080/dbCPG/index.jsp), the first literature-based gene resource for exploring human CPGs. It contains 827 human (724 protein-coding, 23 non-coding, and 80 unknown type genes), 637 rats, and 658 mouse CPGs. Furthermore, data mining was performed to gain insights into the understanding of the CPGs data, including functional annotation, gene prioritization, network analysis of prioritized genes and overlap analysis across multiple cancer types. A user-friendly web interface with multiple browse, search, and upload functions was also developed to facilitate access to the latest information on CPGs. Taken together, the dbCPG database provides a comprehensive data resource for further studies of cancer predisposition genes. PMID:27192119

  13. Next-generation sequencing identifies major DNA methylation changes during progression of Ph+ chronic myeloid leukemia

    PubMed Central

    Heller, G; Topakian, T; Altenberger, C; Cerny-Reiterer, S; Herndlhofer, S; Ziegler, B; Datlinger, P; Byrgazov, K; Bock, C; Mannhalter, C; Hörmann, G; Sperr, W R; Lion, T; Zielinski, C C; Valent, P; Zöchbauer-Müller, S

    2016-01-01

    Little is known about the impact of DNA methylation on the evolution/progression of Ph+ chronic myeloid leukemia (CML). We investigated the methylome of CML patients in chronic phase (CP-CML), accelerated phase (AP-CML) and blast crisis (BC-CML) as well as in controls by reduced representation bisulfite sequencing. Although only ~600 differentially methylated CpG sites were identified in samples obtained from CP-CML patients compared with controls, ~6500 differentially methylated CpG sites were found in samples from BC-CML patients. In the majority of affected CpG sites, methylation was increased. In CP-CML patients who progressed to AP-CML/BC-CML, we identified up to 897 genes that were methylated at the time of progression but not at the time of diagnosis. Using RNA-sequencing, we observed downregulated expression of many of these genes in BC-CML compared with CP-CML samples. Several of them are well-known tumor-suppressor genes or regulators of cell proliferation, and gene re-expression was observed by the use of epigenetic active drugs. Together, our results demonstrate that CpG site methylation clearly increases during CML progression and that it may provide a useful basis for revealing new targets of therapy in advanced CML. PMID:27211271

  14. Developing Guidelines on the Assessment and Treatment of Delirium in Older Adults at the End of Life

    PubMed Central

    Brajtman, Susan; Wright, David; Hogan, David B.; Allard, Pierre; Bruto, Venera; Burne, Deborah; Gage, Laura; Gagnon, Pierre R.; Sadowski, Cheryl A.; Helsdingen, Sherri; Wilson, Kimberley

    2011-01-01

    Background and Purpose Delirium at the end of life is common and can have serious consequences on an older person’s quality of life and death. In spite of the importance of detecting, diagnosing, and managing delirium at the end of life, comprehensive clinical practice guidelines (CPG) are lacking. Our objective was to develop CPG for the assessment and treatment of delirium that would be applicable to seniors receiving end-of-life care in diverse settings. Methods Using as a starting point the 2006 Canadian Coalition for Seniors’ Mental Health CPG on the assessment and treatment of delirium, a team of palliative care researchers and clinicians partnered with members of the original guideline development group to adapt the guidelines for an end-of-life care context. This process was supported by an extensive literature review. The final guidelines were reviewed by external experts. Results Comprehensive CPG on the assessment and treatment of delirium in older adults at the end of life were developed and can be downloaded from http://www.ccsmh.ca. Conclusions Further research is needed on the implementation and evaluation of these adapted delirium guidelines for older patients receiving end-of-life care in various palliative care settings. PMID:23251311

  15. Identification of the physiological promoter for spinocerebellar ataxia 2 gene reveals a CpG island for promoter activity situated into the exon 1 of this gene and provides data about the origin of the nonmethylated state of these types of islands.

    PubMed

    Aguiar, J; Santurlidis, S; Nowok, J; Alexander, C; Rudnicki, D; Gispert, S; Schulz, W; Auburger, G

    1999-01-19

    In order to further use the spinocerebellar ataxia 2 (SCA2) promoter for transgenic mice models of "CAG repeat" neurodegeneration, different fragments of this 5' end were ligated into pGL3-Luc plasmid to obtain the better promoter-activity of the physiological promoter for SCA2. Base-par composition of the SCA2-5' region, and promoter prediction algorithms such as TSSW and TSSG, together with the high firefly luciferase expression after 48 hours of transient transfection in mammalian cells lines, showed a typical CpG island for promoter-activity. The promoter activity was specifically localized into the exon 1 of the SCA2 gene. The higher expression of firefly luciferase in the embryonal F9 cells by the use of SCA2 promoter, rather than by the use of CMV promoter may be related with the origin of the nonmethylated CpG island during the early embryogenesis. Analysis of the 5' region from HD gene revealed to a CpG island, which could be containing the physiological promoter for this gene. Copyright 1999 Academic Press.

  16. Prognostic implication of the CpG island methylator phenotype in colorectal cancers depends on tumour location

    PubMed Central

    Bae, J M; Kim, J H; Cho, N-Y; Kim, T-Y; Kang, G H

    2013-01-01

    Background: Colorectal cancer (CRC) is usually categorised as proximal or distal CRC. Recently, many researchers have tried to determine the molecular heterogeneity of CRCs along bowel subsites. However, the differential effects of the CpG island methylator phenotype (CIMP) and microsatellite instability (MSI) on the clinical outcome according to tumour location are not well-known. Methods: We analysed clinicopathologic and molecular characteristics, including CIMP, MSI, KRAS and BRAF mutations, in 734 CRCs according to bowel subsites. And the prognostic value of CIMP and MSI was analysed according to tumour location. Results: We found a linear increase of female predominance, T, N category, stage, differentiation, absence of luminal necrosis, tumour -infiltrating lymphocytes, Crohn's-like lymphoid reaction, serration and mucin production from the rectum to caecum. CpG island methylator phenotype -high and MSI-high gradually increased from the rectum to caecum. CpG island methylator phenotype is a poor prognostic factor of overall survival (hazard ratio (HR): 4.13, 95% confidence interval (CI): 1.27–13.46) and disease-free survival (HR: 2.90, 95% CI: 1.04–8.08) in rectal cancers. Conclusion: Clinicopathologic and molecular profiles of CRCs gradually change along bowel subsites, and the prognostic implication of CIMP is different according to tumour location. PMID:23900220

  17. CpG island methylator phenotype (CIMP) in cancer: causes and implications.

    PubMed

    Teodoridis, Jens M; Hardie, Catriona; Brown, Robert

    2008-09-18

    Strong evidence exists for a subgroup of tumours, from a variety of tissue types, exhibiting concordant tumour specific DNA methylation: the "CpG island methylator phenotype" (CIMP). Occurrence of CIMP is associated with a range of genetic and environmental factors, although the molecular causes are not well-understood. Both increased expression and aberrant targeting of DNA methyltransferases (DNMTs) could contribute to the occurrence of CIMP. One under-explored area is the possibility that DNA damage may induce or select for CIMP during carcinogenesis or treatment of tumours with chemotherapy. DNA damaging agents can induce DNA damage at guanine rich regions throughout the genome, including CpG islands. This DNA damage can result in stalled DNA synthesis, which will lead to localised increased DNMT1 concentration and therefore potentially increased DNA methylation at these sites. Chemotherapy can select for cells which have increased tolerance to DNA damage due to increased lesion bypass, in some cases by mechanisms which involve inactivation of genes by CpG island methylation. CIMP has been associated with worse patient prognosis, probably due to increased epigenetic plasticity. Therefore, further clinical testing of the diagnostic and prognostic value of the current CIMP markers, as well as increasing our understanding of the molecular causes underlying CIMP are required.

  18. Resource utilization in lung cancer diagnostic procedures: Current use and budget consequences.

    PubMed

    Brinkhof, Sander; Groen, Harry J M; Siesling, Sabine S; IJzerman, Maarten J

    2017-01-01

    The main objective of this study is to determine the current use of lung cancer diagnostic procedures in two large hospitals in the Netherlands, to explore deviations in guideline adherence between the hospitals, and to estimate the budget impact of the diagnostic work-up as well as the over- and underutilization. A state transition model for the diagnostic pathway for lung cancer patients was developed using existing clinical practice guidelines (CPG) combined with a systematic literature. In addition to the CPGs depicting current practice, diagnostic utilization was gathered in two large hospitals representing an academic tertiary care hospital and a large regional teaching hospital for patients, who were selected from the Netherlands cancer registry. The total population consisted of 376 patients with lung cancer. Not in all cases the guideline was followed, for instance in the usage of MR brain with stage III lung cancer patients (n = 70). The state-transition model predicts an average budget impact for the diagnostic pathway per patient estimated of € 2496 in the academic tertiary care hospital and € 2191 in the large regional teaching hospital. The adherence to the CPG's differed between hospitals, which questions the adherence to CPG's in general. Adherence to CPG's could lead to less costs in the diagnostic pathway for lung cancer patients.

  19. Extensive Variation in the Mutation Rate Between and Within Human Genes Associated with Mendelian Disease.

    PubMed

    Smith, Thomas; Ho, Gladys; Christodoulou, John; Price, Elizabeth Ann; Onadim, Zerrin; Gauthier-Villars, Marion; Dehainault, Catherine; Houdayer, Claude; Parfait, Beatrice; van Minkelen, Rick; Lohman, Dietmar; Eyre-Walker, Adam

    2016-05-01

    We have investigated whether the mutation rate varies between genes and sites using de novo mutations (DNMs) from three genes associated with Mendelian diseases (RB1, NF1, and MECP2). We show that the relative frequency of mutations at CpG dinucleotides relative to non-CpG sites varies between genes and relative to the genomic average. In particular we show that the rate of transition mutation at CpG sites relative to the rate of non-CpG transversion is substantially higher in our disease genes than amongst DNMs in general; the rate of CpG transition can be several hundred-fold greater than the rate of non-CpG transversion. We also show that the mutation rate varies significantly between sites of a particular mutational type, such as non-CpG transversion, within a gene. We estimate that for all categories of sites, except CpG transitions, there is at least a 30-fold difference in the mutation rate between the 10% of sites with the highest and lowest mutation rates. However, our best estimate is that the mutation rate varies by several hundred-fold variation. We suggest that the presence of hypermutable sites may be one reason certain genes are associated with disease. © 2016 WILEY PERIODICALS, INC.

  20. Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration

    PubMed Central

    Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu

    2015-01-01

    Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn’t affect Egf mRNA expression during the re-organization phase. PMID:26464832

  1. CpG methylation of a silent controlling element in the murine Avy allele is incomplete and unresponsive to methyl donor supplementation.

    PubMed

    Cropley, Jennifer E; Suter, Catherine M; Beckman, Kenneth B; Martin, David I K

    2010-02-04

    The viable yellow allele of agouti (A(vy)) is remarkable for its unstable and partially heritable epigenetic state, which produces wide variation in phenotypes of isogenic mice. In the A(vy) allele an inserted intracisternal A particle (IAP) acts as a controlling element which deregulates expression of agouti by transcription from the LTR of the IAP; the phenotypic state has been linked to CpG methylation of the LTR. Phenotypic variation between A(vy) mice indicates that the epigenetic state of the IAP is unstable in the germline. We have made a detailed examination of somatic methylation of the IAP using bisulphite allelic sequencing, and find that the promoter is incompletely methylated even when it is transcriptionally silent. In utero exposure to supplementary methyl donors, which alters the spectrum of A(vy) phenotypes, does not increase the density of CpG methylation in the silent LTR. Our findings suggest that, contrary to previous supposition, methyl donor supplementation acts through an indirect mechanism to silence A(vy). The incomplete cytosine methylation we observe at the somatically silent A(vy) allele may reflect its unstable germline state, and the influence of epigenetic modifications underlying CpG methylation.

  2. CpG Methylation of a Silent Controlling Element in the Murine Avy Allele Is Incomplete and Unresponsive to Methyl Donor Supplementation

    PubMed Central

    Cropley, Jennifer E.; Suter, Catherine M.; Beckman, Kenneth B.; Martin, David I. K.

    2010-01-01

    Background The viable yellow allele of agouti (Avy) is remarkable for its unstable and partially heritable epigenetic state, which produces wide variation in phenotypes of isogenic mice. In the Avy allele an inserted intracisternal A particle (IAP) acts as a controlling element which deregulates expression of agouti by transcription from the LTR of the IAP; the phenotypic state has been linked to CpG methylation of the LTR. Phenotypic variation between Avy mice indicates that the epigenetic state of the IAP is unstable in the germline. Principal Findings We have made a detailed examination of somatic methylation of the IAP using bisulphite allelic sequencing, and find that the promoter is incompletely methylated even when it is transcriptionally silent. In utero exposure to supplementary methyl donors, which alters the spectrum of Avy phenotypes, does not increase the density of CpG methylation in the silent LTR. Conclusions Our findings suggest that, contrary to previous supposition, methyl donor supplementation acts through an indirect mechanism to silence Avy. The incomplete cytosine methylation we observe at the somatically silent Avy allele may reflect its unstable germline state, and the influence of epigenetic modifications underlying CpG methylation. PMID:20140227

  3. Combined DNA methylation and gene expression profiling in gastrointestinal stromal tumors reveals hypomethylation of SPP1 as an independent prognostic factor.

    PubMed

    Haller, Florian; Zhang, Jitao David; Moskalev, Evgeny A; Braun, Alexander; Otto, Claudia; Geddert, Helene; Riazalhosseini, Yasser; Ward, Aoife; Balwierz, Aleksandra; Schaefer, Inga-Marie; Cameron, Silke; Ghadimi, B Michael; Agaimy, Abbas; Fletcher, Jonathan A; Hoheisel, Jörg; Hartmann, Arndt; Werner, Martin; Wiemann, Stefan; Sahin, Ozgür

    2015-03-01

    Gastrointestinal stromal tumors (GISTs) have distinct gene expression patterns according to localization, genotype and aggressiveness. DNA methylation at CpG dinucleotides is an important mechanism for regulation of gene expression. We performed targeted DNA methylation analysis of 1.505 CpG loci in 807 cancer-related genes in a cohort of 76 GISTs, combined with genome-wide mRNA expression analysis in 22 GISTs, to identify signatures associated with clinicopathological parameters and prognosis. Principal component analysis revealed distinct DNA methylation patterns associated with anatomical localization, genotype, mitotic counts and clinical follow-up. Methylation of a single CpG dinucleotide in the non-CpG island promoter of SPP1 was significantly correlated with shorter disease-free survival. Hypomethylation of this CpG was an independent prognostic parameter in a multivariate analysis compared to anatomical localization, genotype, tumor size and mitotic counts in a cohort of 141 GISTs with clinical follow-up. The epigenetic regulation of SPP1 was confirmed in vitro, and the functional impact of SPP1 protein on tumorigenesis-related signaling pathways was demonstrated. In summary, SPP1 promoter methylation is a novel and independent prognostic parameter in GISTs, and might be helpful in estimating the aggressiveness of GISTs from the intermediate-risk category. © 2014 UICC.

  4. Generation of a novel artificial TrkB agonist, BM17d99, using T7 phage-displayed random peptide libraries.

    PubMed

    Ohnishi, Toshiyuki; Sakamoto, Kotaro; Asami-Odaka, Asano; Nakamura, Kimie; Shimizu, Ayako; Ito, Takashi; Asami, Taiji; Ohtaki, Tetsuya; Inooka, Hiroshi

    2017-01-29

    Tropomyosin receptor kinase B (TrkB) is a known receptor of brain-derived neurotrophic factor (BDNF). Because it plays a critical role in the regulation of neuronal development, maturation, survival, etc., TrkB is a good target for drugs against central nervous system diseases. In this study, we aimed to generate peptidic TrkB agonists by applying random peptide phage display technology. After the phage panning against recombinant Fc-fused TrkB (TrkB-Fc), agonistic phages were directly screened against TrkB-expressing HEK293 cells. Through subsequent screening of the first-hit BM17 peptide-derived focus library, we successfully obtained the BM17d99 peptide, which had no sequence similarity with BDNF but had TrkB-binding capacity. We then synthesized a dimeric BM17d99 analog peptide that could phosphorylate or activate TrkB by facilitating receptor homodimerization. Treatment of TrkB-expressing HEK293 cells with the dimeric BM17d99 analog peptide significantly induced the phosphorylation of TrkB, suggesting that homodimerization of TrkB was enhanced by the dimeric peptide. This report demonstrates that our approach is useful for the generation of artificial peptidic agonists of cell surface receptors. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Estradiol agonists inhibit human LoVo colorectal-cancer cell proliferation and migration through p53.

    PubMed

    Hsu, Hsi-Hsien; Kuo, Wei-Wen; Ju, Da-Tong; Yeh, Yu-Lan; Tu, Chuan-Chou; Tsai, Ying-Lan; Shen, Chia-Yao; Chang, Sheng-Huang; Chung, Li-Chin; Huang, Chih-Yang

    2014-11-28

    To investigate the effects of 17β-estradiol via estrogen receptors (ER) or direct administration of ER agonists on human colorectal cancer. LoVo cells were established from the Bioresource Collection and Research Center and cultured in phenol red-free DMEM (Sigma, United States). To investigate the effects of E2 and/or ER selective agonists on cellular proliferation, LoVo colorectal cells were treated with E2 or ER-selective agonists for 24 h and 48 h and subjected to the MTT (Sigma) assay to find the concentration. And investigate the effects of E2 and/or ER selective agonists on cell used western immunoblotting to find out the diversification of signaling pathways. In order to observe motility and migration the wound healing assay and a transwell chamber (Neuro Probe) plate were tased. For a quantitative measure, we counted the number of migrating cells to the wound area post-wounding for 24 h. We further examined the cellular migration-regulating factors urokinase-type plasminogen activator (u-PA), tissue-type plasminogen activator (t-PA) and matrix metalloproteinase (MMP)-9 in human LoVo cells so gelatin zymography that we used and gelatinolytic activity was visualized by Coomassie blue staining. And these results are presented as means ± SE, and statistical comparisons were made using Student's t-test. The structure was first compared with E2 and ER agonists. We then treated the LoVo cells with E2 and ER agonists (10(-8) mol/L) for 24 h and 48 h and subsequently measured the cell viability using MTT assay. Our results showed that treatment with 17β-estradiol and/or ER agonists in human LoVo colorectal cancer cells activated p53 and then up-regulated p21 and p27 protein levels, subsequently inhibiting the downstream target gene, cyclin D1, which regulates cell proliferation. Taken together, our findings demonstrate the anti-tumorigenesis effects of 17β-estradiol and/or ER agonists and suggest that these compounds may prove to be a potential alternative therapy in the treatment of human colorectal cancer. These results demonstrate that 17β-estradiol and/or ER agonists downregulate migration-related proteins through the p53 signaling pathway in human LoVo colorectal cancer cells. These findings suggest that p53 plays a critical role in the 17β-estradiol and/or ER agonist-mediated protective activity against colorectal cancer progression. In addition, 17β-estradiol and/or ER agonists dramatically inhibited cell migration and reduced the expression of u-PA, t-PA and MMP-9 as well as MMP-2/9 activity in LoVo cells, which regulate cell metastasis. Moreover, we observed that pretreatment with a p53 inhibitor significantly blocked the anti-migration effects of E2 and/or ER agonists on LoVo cells. That E2 and/or ER agonists may impair LoVo cell migration by modulating migration-related factors via the p53 tumor suppressor gene. Direct ER treatment may prove to be an attractive alternative therapy in the treatment of human colorectal tumors in the future.

  6. The epigenetic effect of glucosamine and a nuclear factor-kappa B (NF-kB) inhibitor on primary human chondrocytes - Implications for osteoarthritis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Imagawa, Kei, E-mail: k.Imagawa@soton.ac.uk; Tohoku University School of Medicine, Sendai; Andres, MC de

    Research highlights: {yields} Glucosamine and a NF-kB inhibitor reduce inflammation in OA. {yields} Cytokine induced demethylation of CpG site in IL1{beta} promoter prevented by glucosamine. {yields} Glucosamine and NF-kB inhibitor have epigenetic effects on human chondrocytes. -- Abstract: Objective: Idiopathic osteoarthritis is the most common form of osteoarthritis (OA) world-wide and remains the leading cause of disability and the associated socio-economic burden in an increasing aging population. Traditionally, OA has been viewed as a degenerative joint disease characterized by progressive destruction of the articular cartilage and changes in the subchondral bone culminating in joint failure. However, the etiology of OAmore » is multifactorial involving genetic, mechanical and environmental factors. Treatment modalities include analgesia, joint injection with steroids or hyaluronic acid, oral supplements including glucosamine and chondroitin sulfate, as well as physiotherapy. Thus, there is significant interest in the discovery of disease modifying agents. One such agent, glucosamine (GlcN) is commonly prescribed even though the therapeutic efficacy and mechanism of action remain controversial. Inflammatory cytokines, including IL-1{beta}, and proteinases such as MMP-13 have been implicated in the pathogenesis and progression of OA together with an associated CpG demethylation in their promoters. We have investigated the potential of GlcN to modulate NF-kB activity and cytokine-induced abnormal gene expression in articular chondrocytes and, critically, whether this is associated with an epigenetic process. Method: Human chondrocytes were isolated from the articular cartilage of femoral heads, obtained with ethical permission, following fractured neck of femur surgery. Chondrocytes were cultured for 5 weeks in six separate groups; (i) control culture, (ii) cultured with a mixture of 2.5 ng/ml IL-1{beta} and 2.5 ng/ml oncostatin M (OSM), (iii) cultured with 2 mM N-acetyl GlcN (Sigma-Aldrich), (iv) cultured with a mixture of 2.5 ng/ml IL-1{beta}, 2.5 ng/ml OSM and 2 mM GlcN, (v) cultured with 1.0 {mu}M BAY 11-7082 (BAY; NF-kB inhibitor: Calbiochem, Darmstadt, Germany) and, (vi) cultured with a mixture of 2.5 ng/ml IL-1{beta}, 2.5 ng/ml OSM and 1.0 {mu}M BAY. The levels of IL1B and MMP13 mRNA were examined using qRT-PCR. The percentage DNA methylation in the CpG sites of the IL1{beta} and MMP13 proximal promoter were quantified by pyrosequencing. Result:IL1{beta} expression was enhanced over 580-fold in articular chondrocytes treated with IL-1{beta} and OSM. GlcN dramatically ameliorated the cytokine-induced expression by 4-fold. BAY alone increased IL1{beta} expression by 3-fold. In the presence of BAY, IL-1{beta} induced IL1B mRNA levels were decreased by 6-fold. The observed average percentage methylation of the -256 CpG site in the IL1{beta} promoter was 65% in control cultures and decreased to 36% in the presence of IL-1{beta}/OSM. GlcN and BAY alone had a negligible effect on the methylation status of the IL1B promoter. The cytokine-induced loss of methylation status in the IL1B promoter was ameliorated by both GlcN and BAY to 44% and 53%, respectively. IL-1{beta}/OSM treatment increased MMP13 mRNA levels independently of either GlcN or BAY and no change in the methylation status of the MMP13 promoter was observed. Conclusion: We demonstrate for the first time that GlcN and BAY can prevent cytokine-induced demethylation of a specific CpG site in the IL1{beta} promoter and this was associated with decreased expression of IL1{beta}. These studies provide a potential mechanism of action for OA disease modifying agents via NF-kB and, critically, demonstrate the need for further studies to elucidate the role that NF-kB may play in DNA demethylation in human chondrocytes.« less

  7. PlantPAN 2.0: an update of plant promoter analysis navigator for reconstructing transcriptional regulatory networks in plants.

    PubMed

    Chow, Chi-Nga; Zheng, Han-Qin; Wu, Nai-Yun; Chien, Chia-Hung; Huang, Hsien-Da; Lee, Tzong-Yi; Chiang-Hsieh, Yi-Fan; Hou, Ping-Fu; Yang, Tien-Yi; Chang, Wen-Chi

    2016-01-04

    Transcription factors (TFs) are sequence-specific DNA-binding proteins acting as critical regulators of gene expression. The Plant Promoter Analysis Navigator (PlantPAN; http://PlantPAN2.itps.ncku.edu.tw) provides an informative resource for detecting transcription factor binding sites (TFBSs), corresponding TFs, and other important regulatory elements (CpG islands and tandem repeats) in a promoter or a set of plant promoters. Additionally, TFBSs, CpG islands, and tandem repeats in the conserve regions between similar gene promoters are also identified. The current PlantPAN release (version 2.0) contains 16 960 TFs and 1143 TF binding site matrices among 76 plant species. In addition to updating of the annotation information, adding experimentally verified TF matrices, and making improvements in the visualization of transcriptional regulatory networks, several new features and functions are incorporated. These features include: (i) comprehensive curation of TF information (response conditions, target genes, and sequence logos of binding motifs, etc.), (ii) co-expression profiles of TFs and their target genes under various conditions, (iii) protein-protein interactions among TFs and their co-factors, (iv) TF-target networks, and (v) downstream promoter elements. Furthermore, a dynamic transcriptional regulatory network under various conditions is provided in PlantPAN 2.0. The PlantPAN 2.0 is a systematic platform for plant promoter analysis and reconstructing transcriptional regulatory networks. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Epigenetic regulation of the circadian clock: role of 5-aza-2′-deoxycytidine

    PubMed Central

    Tomita, Tatsunosuke; Kurita, Ryoji

    2017-01-01

    We have been investigating transcriptional regulation of the BMAL1 gene, a critical component of the mammalian clock system including DNA methylation. Here, a more detailed analysis of the regulation of DNA methylation of BMAL1 proceeded in RPMI8402 lymphoma cells. We found that CpG islands in the BMAL1 and the PER2 promoters were hyper- and hypomethylated, respectively and that 5-aza-2′-deoxycytidine (aza-dC) not only enhanced PER2 gene expression but also PER2 oscillation within 24 h in RPMI8402 cells. That is, such hypermethylation of CpG islands in the BMAL1 promoter restricted PER2 expression which was recovered by aza-dC within 1 day in these cells. These results suggest that the circadian clock system can be recovered through BMAL1 expression induced by aza-dC within a day. The RPIB9 promoter of RPMI8402 cells, which is a methylation hotspot in lymphoblastic leukemia, was also hypermethylated and aza-dC gradually recovered RPIB9 expression in 3 days. In addition, methylation-specific PCR revealed a different degree of aza-dC-induced methylation release between BMAL1 and RPIB9. These results suggest that the aza-dC-induced recovery of gene expression from DNA methylation is dependent on a gene, for example the rapid response to demethylation by the circadian system, and thus, is of importance to clinical strategies for treating cancer. PMID:28487473

  9. CpG island methylation of TMS1/ASC and CASP8 genes in cervical cancer

    PubMed Central

    2009-01-01

    Background Gene silencing associated with aberrant methylation of promoter region CpG islands is an acquired epigenetic alteration that serves as an alternative to genetic defects in the inactivation of tumor suppressor and other genes in human cancers. Aims This study describes the methylation status of TMS1/ASC and CASP8 genes in cervical cancer. We also examined the prevalence of TMS1/ASC and CASP8 genes methylation in cervical cancer tissue and none - neo plastic samples in an effort to correlate with smoking habit and clinicopathological features. Method Target DNA was modified by sodium bisulfite, converting all unmethylated, but not methylated, cytosines to uracil, and subsequently amplified by Methylation Specific (MS) PCR with primers specific for methylated versus unmethylated DNA. The PCR product was detected by gel electrophoresis and combined with the clinical records of patients. Results The methylation pattern of the TMS1/ASC and CASP8 genes in specimens of cervical cancer and adjacent normal tissues were detected [5/80 (6.2%), 3/80 (3.75%)-2/80 (2.5%), 1/80 (1.2%) respectively]. No statistical differences were seen in the extent of differentiation, invasion, pathological type and smoking habit between the methylated and unmethylated tissues (P > 0.05). Conclusion The present study conclude that the frequency of TMS1/ASC and CASP8 genes methylation in cervical cancer are rare (< 6%), and have no any critical role in development of cervical cancer. PMID:19258216

  10. Management of convulsive status epilepticus in children: an adapted clinical practice guideline for pediatricians in Saudi Arabia

    PubMed Central

    Bashiri, Fahad A.; Hamad, Muddathir H.; Amer, Yasser S.; Abouelkheir, Manal M.; Mohamed, Sarar; Kentab, Amal Y.; Salih, Mustafa A.; Nasser, Mohammad N. Al; Al-Eyadhy, Ayman A.; Othman, Mohammed A. Al; Al-Ahmadi, Tahani; Iqbal, Shaikh M.; Somily, Ali M.; Wahabi, Hayfaa A.; Hundallah, Khalid J.; Alwadei, Ali H.; Albaradie, Raidah S.; Al-Twaijri, Waleed A.; Jan, Mohammed M.; Al-Otaibi, Faisal; Alnemri, Abdulrahman M.; Al-Ansary, Lubna A.

    2017-01-01

    Objective: To increase the use of evidence-based approaches in the diagnosis, investigations and treatment of Convulsive Status Epilepticus (CSE) in children in relevant care settings. Method: A Clinical Practice Guideline (CPG) adaptation group was formulated at a university hospital in Riyadh. The group utilized 2 CPG validated tools including the ADAPTE method and the AGREE II instrument. Results: The group adapted 3 main categories of recommendations from one Source CPG. The recommendations cover; (i)first-line treatment of CSE in the community; (ii)treatment of CSE in the hospital; and (iii)refractory CSE. Implementation tools were built to enhance knowledge translation of these recommendations including a clinical algorithm, audit criteria, and a computerized provider order entry. Conclusion: A clinical practice guideline for the Saudi healthcare context was formulated using a guideline adaptation process to support relevant clinicians managing CSE in children. PMID:28416791

  11. An Integrative, Multi-Scale Computational Model of a Swimming Lamprey Fully Coupled to Its Fluid Environment and Incorporating Proprioceptive Feedback

    NASA Astrophysics Data System (ADS)

    Hamlet, C. L.; Hoffman, K.; Fauci, L.; Tytell, E.

    2016-02-01

    The lamprey is a model organism for both neurophysiology and locomotion studies. To study the role of sensory feedback as an organism moves through its environment, a 2D, integrative, multi-scale model of an anguilliform swimmer driven by neural activation from a central pattern generator (CPG) is constructed. The CPG in turn drives muscle kinematics and is fully coupled to the surrounding fluid. The system is numerically evolved in time using an immersed boundary framework producing an emergent swimming mode. Proprioceptive feedback to the CPG based on experimental observations adjust the activation signal as the organism interacts with its environment. Effects on the speed, stability and cost (metabolic work) of swimming due to nonlinear dependencies associated with muscle force development combined with proprioceptive feedback to neural activation are estimated and examined.

  12. [Counseling interventions for smoking cessation: systematic review].

    PubMed

    Alba, Luz Helena; Murillo, Raúl; Castillo, Juan Sebastián

    2013-04-01

    A systematic review on efficacy and safety of smoking cessation counseling was developed. The ADAPTE methodology was used with a search of Clinical Practice Guidelines (CPG) in Medline, EMBASE, CINAHL, LILACS, and Cochrane. DELBI was used to select CPG with score over 60 in methodological rigor and applicability to the Colombian health system. Smoking cessation rates at 6 months were assessed according to counseling provider, model, and format. In total 5 CPG out of 925 references were selected comprising 44 systematic reviews and meta-analyses. Physician brief counseling and trained health professionals' intensive counseling (individual, group, proactive telephone) are effective with abstinence rates between 2.1% and 17.4%. Only practical counseling and motivational interview were found effective intensive interventions. The clinical effect of smoking cessation counseling is low and long term cessation rates uncertain. Cost-effectiveness analyses are recommended for the implementation of counseling in public health programs.

  13. Deletion and aberrant CpG island methylation of Caspase 8 gene in medulloblastoma.

    PubMed

    Gonzalez-Gomez, Pilar; Bello, M Josefa; Inda, M Mar; Alonso, M Eva; Arjona, Dolores; Amiñoso, Cinthia; Lopez-Marin, Isabel; de Campos, Jose M; Sarasa, Jose L; Castresana, Javier S; Rey, Juan A

    2004-09-01

    Aberrant methylation of promoter CpG islands in human genes is an alternative genetic inactivation mechanism that contributes to the development of human tumors. Nevertheless, few studies have analyzed methylation in medulloblastomas. We determined the frequency of aberrant CpG island methylation for Caspase 8 (CASP8) in a group of 24 medulloblastomas arising in 8 adult and 16 pediatric patients. Complete methylation of CASP8 was found in 15 tumors (62%) and one case displayed hemimethylation. Three samples amplified neither of the two primer sets for methylated or unmethylated alleles, suggesting that genomic deletion occurred in the 5' flanking region of CASP8. Our findings suggest that methylation commonly contributes to CASP8 silencing in medulloblastomas and that homozygous deletion or severe sequence changes involving the promoter region may be another mechanism leading to CASP8 inactivation in this neoplasm.

  14. Quantitative Evaluation of MMP-9 and TIMP-1 Promoter Methylation in Chronic Periodontitis.

    PubMed

    Li, Xiting; Lu, Jiaxuan; Teng, Wei; Zhao, Chuanjiang; Ye, Xiaolei

    2018-03-01

    In this study, we investigated the promoter DNA methylation (DNAm) status of the MMP-9 and TIMP-1 genes in patients with chronic periodontitis to evaluate disease progression. Using pyrosequencing technology, DNAm levels of MMP-9 and TIMP-1 CpG islands were measured in 88 chronic periodontitis patients and 15 healthy controls. We found a positive correlation between methylation levels of MMP-9 CpG islands and the severity of chronic periodontitis. Methylated CpG islands were also closely associated with the duration of chronic periodontitis. Moreover, female patients exhibited lower methylation levels of MMP-9 but higher methylation levels of TIMP-1 compared with male patients, and the methylation levels of TIMP-1 gradually decreased with age. The findings of gender disparity in the DNAm of MMP-9 and TIMP-1 genes provide novel insights into chronic periodontitis.

  15. Using an Artificial Neural Bypass to Restore Cortical Control of Rhythmic Movements in a Human with Quadriplegia

    NASA Astrophysics Data System (ADS)

    Sharma, Gaurav; Friedenberg, David A.; Annetta, Nicholas; Glenn, Bradley; Bockbrader, Marcie; Majstorovic, Connor; Domas, Stephanie; Mysiw, W. Jerry; Rezai, Ali; Bouton, Chad

    2016-09-01

    Neuroprosthetic technology has been used to restore cortical control of discrete (non-rhythmic) hand movements in a paralyzed person. However, cortical control of rhythmic movements which originate in the brain but are coordinated by Central Pattern Generator (CPG) neural networks in the spinal cord has not been demonstrated previously. Here we show a demonstration of an artificial neural bypass technology that decodes cortical activity and emulates spinal cord CPG function allowing volitional rhythmic hand movement. The technology uses a combination of signals recorded from the brain, machine-learning algorithms to decode the signals, a numerical model of CPG network, and a neuromuscular electrical stimulation system to evoke rhythmic movements. Using the neural bypass, a quadriplegic participant was able to initiate, sustain, and switch between rhythmic and discrete finger movements, using his thoughts alone. These results have implications in advancing neuroprosthetic technology to restore complex movements in people living with paralysis.

  16. Simple robot suggests physical interlimb communication is essential for quadruped walking

    PubMed Central

    Owaki, Dai; Kano, Takeshi; Nagasawa, Ko; Tero, Atsushi; Ishiguro, Akio

    2013-01-01

    Quadrupeds have versatile gait patterns, depending on the locomotion speed, environmental conditions and animal species. These locomotor patterns are generated via the coordination between limbs and are partly controlled by an intraspinal neural network called the central pattern generator (CPG). Although this forms the basis for current control paradigms of interlimb coordination, the mechanism responsible for interlimb coordination remains elusive. By using a minimalistic approach, we have developed a simple-structured quadruped robot, with the help of which we propose an unconventional CPG model that consists of four decoupled oscillators with only local force feedback in each leg. Our robot exhibits good adaptability to changes in weight distribution and walking speed simply by responding to local feedback, and it can mimic the walking patterns of actual quadrupeds. Our proposed CPG-based control method suggests that physical interaction between legs during movements is essential for interlimb coordination in quadruped walking. PMID:23097501

  17. Simple robot suggests physical interlimb communication is essential for quadruped walking.

    PubMed

    Owaki, Dai; Kano, Takeshi; Nagasawa, Ko; Tero, Atsushi; Ishiguro, Akio

    2013-01-06

    Quadrupeds have versatile gait patterns, depending on the locomotion speed, environmental conditions and animal species. These locomotor patterns are generated via the coordination between limbs and are partly controlled by an intraspinal neural network called the central pattern generator (CPG). Although this forms the basis for current control paradigms of interlimb coordination, the mechanism responsible for interlimb coordination remains elusive. By using a minimalistic approach, we have developed a simple-structured quadruped robot, with the help of which we propose an unconventional CPG model that consists of four decoupled oscillators with only local force feedback in each leg. Our robot exhibits good adaptability to changes in weight distribution and walking speed simply by responding to local feedback, and it can mimic the walking patterns of actual quadrupeds. Our proposed CPG-based control method suggests that physical interaction between legs during movements is essential for interlimb coordination in quadruped walking.

  18. Generation of Adaptive Gait Patterns for Quadruped Robot with CPG Network including Motor Dynamic Model

    NASA Astrophysics Data System (ADS)

    Son, Yurak; Kamano, Takuya; Yasuno, Takashi; Suzuki, Takayuki; Harada, Hironobu

    This paper describes the generation of adaptive gait patterns using new Central Pattern Generators (CPGs) including motor dynamic models for a quadruped robot under various environment. The CPGs act as the flexible oscillators of the joints and make the desired angle of the joints. The CPGs are mutually connected each other, and the sets of their coupling parameters are adjusted by genetic algorithm so that the quadruped robot can realize the stable and adequate gait patterns. As a result of generation, the suitable CPG networks for not only a walking straight gait pattern but also rotation gait patterns are obtained. Experimental results demonstrate that the proposed CPG networks are effective to automatically adjust the adaptive gait patterns for the tested quadruped robot under various environment. Furthermore, the target tracking control based on image processing is achieved by combining the generated gait patterns.

  19. SU94. Allele-Specific and Trauma-Related Epigenetic Changes in the FKBP5 Gene: Differences Between Psychotic Patients and Healthy Controls

    PubMed Central

    Mihaljevic, Marina; Franic, Dusica; Soldatovic, Ivan; Andric, Sanja; Mirjanic, Tijana; Novakovic, Ivana; Adzic, Miroslav; Maric, Nadja

    2017-01-01

    Abstract Background: Hypothalamic-pituitary-adrenal (HPA) axis dysregulation is a proposed etiological mechanism of psychosis. Recent studies highlighted impact of the FKBP5 gene and its functional variant rs1360780, which risk (T) allele affects the activity of HPA axis following stress exposure, on psychotic patients exposed to early trauma (1). Additionally, risk allele and trauma dependent FKBP5 demethylation in intron 7 was observed in traumatized individuals (2). Thus, the purpose of this pilot study was to investigate influence of the risk allele and trauma on FKBP5 DNA methylation levels at intron 7 in psychotic patients and to compare it with healthy individuals. Methods: The sample consisted of 24 psychosis spectrum patients and 24 controls matched by age and gender. All participants were genotyped for rs1360780 and divided into 2 groups depending on the presence of the risk allele (risk and nonrisk group). DNA methylation levels at 3 CpG sites (CpG1, CpG2, and CpG3) in intron 7 were analyzed by Sanger sequencing. Early-life adversities were measured by Childhood Trauma Questionnaire. Pearson correlation and t test were performed as appropriate. Results: Analyses revealed decreased FKBP5 methylation at targeted CpG sites and averaged methylation level (AML) at intron 7 in patients compared to controls (P = .026, P = .017, P = .027, and P = .003, respectively). Decreased AML and methylation at CpG3 were observed comparing risk and nonrisk patients’ groups (P = .018 and P = .016, respectively). Additionally, decreased methylation was found in risk patients’ group compared to risk controls’ group. No differences were found comparing nonrisk groups. Furthermore, strong negative associations between trauma and methylation at CpG3 and AML were observed only in risk controls’ group (r = −0.707, P = .007; r = −0.741, P = .004, respectively). Conclusion: Our preliminary results revealed allele-specific epigenetic changes of the FKBP5 gene in psychotic patients, which is in line with previous reports in traumatized individuals. Trauma-related demethylation in risk controls’ group supports the hypothesis that psychotic and stress-related conditions could share common neurobiological underlying mechanism, such as HPA axis dysregulation, particularly in individuals with genetic predisposition for altered stress response. References 1.Daskalakis NP, Binder EB. Schizophrenia in the spectrum of gene-stress interactions: the FKBP5 example. Schizophr Bull. 2015;41:323–329. 2.Klengel T, Mehta D, Anacker C et al. Allele-specific FKBP5 DNA demethylation mediates gene-childhood trauma interactions. Nat Neurosci. 2013;16:33–41.

  20. The Impact of Social Media on Dissemination and Implementation of Clinical Practice Guidelines: A Longitudinal Observational Study.

    PubMed

    Narayanaswami, Pushpa; Gronseth, Gary; Dubinsky, Richard; Penfold-Murray, Rebecca; Cox, Julie; Bever, Christopher; Martins, Yolanda; Rheaume, Carol; Shouse, Denise; Getchius, Thomas S D

    2015-08-13

    Evidence-based clinical practice guidelines (CPGs) are statements that provide recommendations to optimize patient care for a specific clinical problem or question. Merely reading a guideline rarely leads to implementation of recommendations. The American Academy of Neurology (AAN) has a formal process of guideline development and dissemination. The last few years have seen a burgeoning of social media such as Facebook, Twitter, and LinkedIn, and newer methods of dissemination such as podcasts and webinars. The role of these media in guideline dissemination has not been studied. Systematic evaluation of dissemination methods and comparison of the effectiveness of newer methods with traditional methods is not available. It is also not known whether specific dissemination methods may be more effectively targeted to specific audiences. Our aim was to (1) develop an innovative dissemination strategy by adding social media-based dissemination methods to traditional methods for the AAN clinical practice guidelines "Complementary and alternative medicine in multiple sclerosis" ("CAM in MS") and (2) evaluate whether the addition of social media outreach improves awareness of the CPG and knowledge of CPG recommendations, and affects implementation of those recommendations. Outcomes were measured by four surveys in each of the two target populations: patients and physicians/clinicians ("physicians"). The primary outcome was the difference in participants' intent to discuss use of complementary and alternative medicine (CAM) with their physicians or patients, respectively, after novel dissemination, as compared with that after traditional dissemination. Secondary outcomes were changes in awareness of the CPG, knowledge of CPG content, and behavior regarding CAM use in multiple sclerosis (MS). Response rates were 25.08% (622/2480) for physicians and 43.5% (348/800) for patients. Awareness of the CPG increased after traditional dissemination (absolute difference, 95% confidence interval: physicians 36%, 95% CI 25-46, and patients 10%, 95% CI 1-11) but did not increase further after novel dissemination (physicians 0%, 95% CI -11 to 11, and patients -4%, 95% CI -6 to 14). Intent to discuss CAM also increased after traditional dissemination but did not change after novel dissemination (traditional: physicians 12%, 95% CI 2-22, and patients 19%, 95% CI 3-33; novel: physicians 11%, 95% CI -1 to -21, and patients -8%, 95% CI -22 to 8). Knowledge of CPG recommendations and behavior regarding CAM use in MS did not change after either traditional dissemination or novel dissemination. Social media-based dissemination methods did not confer additional benefit over print-, email-, and Internet-based methods in increasing CPG awareness and changing intent in physicians or patients. Research on audience selection, message formatting, and message delivery is required to utilize Web 2.0 technologies optimally for dissemination.

  1. The Impact of Social Media on Dissemination and Implementation of Clinical Practice Guidelines: A Longitudinal Observational Study

    PubMed Central

    Gronseth, Gary; Dubinsky, Richard; Penfold-Murray, Rebecca; Cox, Julie; Bever Jr, Christopher; Martins, Yolanda; Rheaume, Carol; Shouse, Denise; Getchius, Thomas SD

    2015-01-01

    Background Evidence-based clinical practice guidelines (CPGs) are statements that provide recommendations to optimize patient care for a specific clinical problem or question. Merely reading a guideline rarely leads to implementation of recommendations. The American Academy of Neurology (AAN) has a formal process of guideline development and dissemination. The last few years have seen a burgeoning of social media such as Facebook, Twitter, and LinkedIn, and newer methods of dissemination such as podcasts and webinars. The role of these media in guideline dissemination has not been studied. Systematic evaluation of dissemination methods and comparison of the effectiveness of newer methods with traditional methods is not available. It is also not known whether specific dissemination methods may be more effectively targeted to specific audiences. Objective Our aim was to (1) develop an innovative dissemination strategy by adding social media-based dissemination methods to traditional methods for the AAN clinical practice guidelines “Complementary and alternative medicine in multiple sclerosis” (“CAM in MS”) and (2) evaluate whether the addition of social media outreach improves awareness of the CPG and knowledge of CPG recommendations, and affects implementation of those recommendations. Methods Outcomes were measured by four surveys in each of the two target populations: patients and physicians/clinicians (“physicians”). The primary outcome was the difference in participants’ intent to discuss use of complementary and alternative medicine (CAM) with their physicians or patients, respectively, after novel dissemination, as compared with that after traditional dissemination. Secondary outcomes were changes in awareness of the CPG, knowledge of CPG content, and behavior regarding CAM use in multiple sclerosis (MS). Results Response rates were 25.08% (622/2480) for physicians and 43.5% (348/800) for patients. Awareness of the CPG increased after traditional dissemination (absolute difference, 95% confidence interval: physicians 36%, 95% CI 25-46, and patients 10%, 95% CI 1-11) but did not increase further after novel dissemination (physicians 0%, 95% CI -11 to 11, and patients -4%, 95% CI -6 to 14). Intent to discuss CAM also increased after traditional dissemination but did not change after novel dissemination (traditional: physicians 12%, 95% CI 2-22, and patients 19%, 95% CI 3-33; novel: physicians 11%, 95% CI -1 to -21, and patients -8%, 95% CI -22 to 8). Knowledge of CPG recommendations and behavior regarding CAM use in MS did not change after either traditional dissemination or novel dissemination. Conclusions Social media-based dissemination methods did not confer additional benefit over print-, email-, and Internet-based methods in increasing CPG awareness and changing intent in physicians or patients. Research on audience selection, message formatting, and message delivery is required to utilize Web 2.0 technologies optimally for dissemination. PMID:26272267

  2. Therapeutic Potential of 5-HT2C Receptor Agonists for Addictive Disorders.

    PubMed

    Higgins, Guy A; Fletcher, Paul J

    2015-07-15

    The neurotransmitter 5-hydroxytryptamine (5-HT; serotonin) has long been associated with the control of a variety of motivated behaviors, including feeding. Much of the evidence linking 5-HT and feeding behavior was obtained from studies of the effects of the 5-HT releaser (dex)fenfluramine in laboratory animals and humans. Recently, the selective 5-HT2C receptor agonist lorcaserin received FDA approval for the treatment of obesity. This review examines evidence to support the use of selective 5-HT2C receptor agonists as treatments for conditions beyond obesity, including substance abuse (particularly nicotine, psychostimulant, and alcohol dependence), obsessive compulsive, and excessive gambling disorder. Following a brief survey of the early literature supporting a role for 5-HT in modulating food and drug reinforcement, we propose that intrinsic differences between SSRI and serotonin releasers may have underestimated the value of serotonin-based pharmacotherapeutics to treat clinical forms of addictive behavior beyond obesity. We then highlight the critical involvement of the 5-HT2C receptor in mediating the effect of (dex)fenfluramine on feeding and body weight gain and the evidence that 5-HT2C receptor agonists reduce measures of drug reward and impulsivity. A recent report of lorcaserin efficacy in a smoking cessation trial further strengthens the idea that 5-HT2C receptor agonists may have potential as a treatment for addiction. This review was prepared as a contribution to the proceedings of the 11th International Society for Serotonin Research Meeting held in Hermanus, South Africa, July 9-12, 2014.

  3. Phosphorylation state of mu-opioid receptor determines the alternative recycling of receptor via Rab4 or Rab11 pathway.

    PubMed

    Wang, Feifei; Chen, Xiaoqing; Zhang, Xiaoqing; Ma, Lan

    2008-08-01

    Agonist-induced phosphorylation, internalization, and intracellular trafficking of G protein-coupled receptors are critical in regulating both cellular responsiveness and signal transduction. The current study investigated the role of receptor phosphorylation state in regulation of agonist-induced internalization and intracellular trafficking of mu-opioid receptor (MOR). Our results showed that after agonist stimulation, the recycle of a mutant MOR that lacks the C-terminal residues after Asn(362) (MOR362T) was greatly decreased, whereas a C-terminal phosphorylation sites-mutated MOR (MOR3A), which is deficient in agonist-induced phosphorylation recycled back to the membrane at a level comparable to that of the wild-type receptor, however, interestingly at a slower rate. Inhibition of functions of either Rab4 or Rab11 by dominant-negative mutants and small interfering RNA both significantly impaired the recycling of the wild-type MOR, whereas the recycling of the phosphorylation-deficient mutant was only inhibited by the dominant-negative mutant and small interfering RNA of Rab11, suggesting that the recycling of nonphosphorylated MOR is exclusively via Rab11-mediated pathway. Furthermore, phosphorylated MOR was observed accumulated in Rab5- and Rab4-, but not Rab11-positive vesicles. Our data indicate that both phosphorylated and nonphosphorylated MOR internalize via Rab5-dependent pathway after agonist stimulation, and the phosphorylated and nonphosphorylated MORs recycle through distinct vesicular trafficking pathways mediated by Rab4 and Rab11, respectively, which may ultimately lead to differential cellular responsiveness or downstream signaling.

  4. Identifying Medication Targets for Psychostimulant Addiction: Unraveling the Dopamine D3 Receptor Hypothesis

    PubMed Central

    2016-01-01

    The dopamine D3 receptor (D3R) is a target for developing medications to treat substance use disorders. D3R-selective compounds with high affinity and varying efficacies have been discovered, providing critical research tools for cell-based studies that have been translated to in vivo models of drug abuse. D3R antagonists and partial agonists have shown especially promising results in rodent models of relapse-like behavior, including stress-, drug-, and cue-induced reinstatement of drug seeking. However, to date, translation to human studies has been limited. Herein, we present an overview and illustrate some of the pitfalls and challenges of developing novel D3R-selective compounds toward clinical utility, especially for treatment of cocaine abuse. Future research and development of D3R-selective antagonists and partial agonists for substance abuse remains critically important but will also require further evaluation and development of translational animal models to determine the best time in the addiction cycle to target D3Rs for optimal therapeutic efficacy. PMID:25826710

  5. Effect of non-selective dopaminergic receptor agonist on disrupted maternal behavior in olfactory bulbectomized mice.

    PubMed

    Sato, Atsushi; Nakagawasai, Osamu; Tan-No, Koichi; Onogi, Hiroshi; Niijima, Fukie; Tadano, Takeshi

    2010-07-11

    Olfactory bulbectomy (OBX) animals are considered a putative model of depression that produces behavioral, physiological, and neurochemical alterations resembling clinical depression. Depression is a critical cause of child abuse and neglect, and it has been reported that maternal behavior involves dopaminergic neurons of the mesolimbic pathway. In this study, we investigated the effect of apomorphine, a non-selective dopaminergic receptor agonist, on maternal behavior to examine the influence of activated brain dopaminergic function in OBX mice. In addition, we conducted the sucrose preference test to examine the reward system which has a critical relationship to mesolimbic dopaminergic function and maternal behavior. Maternal behavior was observed on postnatal day (PND) 0 and 4. OBX female mice showed a reduction in sucrose preference 2 weeks post surgery. OBX dams showed maternal behavior deficits on PND 0, and these deficits were ameliorated by administration of apomorphine. These results suggest that maternal behavior deficits in OBX dams may involve brain hypodopaminergic function in the central nervous system induced by OBX. Copyright 2010 Elsevier B.V. All rights reserved.

  6. Bacterial lysates improve the protective antibody response against respiratory viruses through Toll-like receptor 4

    PubMed Central

    Coviello, Silvina; Wimmenauer, Vera; Polack, Fernando P; Irusta, Pablo M

    2014-01-01

    Respiratory viruses cause significant morbidity and mortality in infants and young children worldwide. Current strategies to modulate the immune system and prevent or treat respiratory viral infections in this age group have shown limited success. Here, we demonstrate that a lysate derived from Gram-positive and Gram-negative organisms positively modulates protective antibody responses against both respiratory syncytial virus (RSV) and influenza virus in murine models of infection. Interestingly, despite the complex mixture of Toll-like receptor (TLR) agonists present in the bacterial lysate, the modulatory effects were mostly dependent on TLR4 signaling. Our results indicate that the use of simple formulations of TLR-agonists can significantly improve the immune response against critical pediatric respiratory pathogens. PMID:25483455

  7. TSH and Thyrotropic Agonists: Key Actors in Thyroid Homeostasis

    PubMed Central

    Dietrich, Johannes W.; Landgrafe, Gabi; Fotiadou, Elisavet H.

    2012-01-01

    This paper provides the reader with an overview of our current knowledge of hypothalamic-pituitary-thyroid feedback from a cybernetic standpoint. Over the past decades we have gained a plethora of information from biochemical, clinical, and epidemiological investigation, especially on the role of TSH and other thyrotropic agonists as critical components of this complex relationship. Integrating these data into a systems perspective delivers new insights into static and dynamic behaviour of thyroid homeostasis. Explicit usage of this information with mathematical methods promises to deliver a better understanding of thyrotropic feedback control and new options for personalised diagnosis of thyroid dysfunction and targeted therapy, also by permitting a new perspective on the conundrum of the TSH reference range. PMID:23365787

  8. The dynamic DNA methylation landscape of the mutL homolog 1 shore is altered by MLH1-93G>A polymorphism in normal tissues and colorectal cancer.

    PubMed

    Savio, Andrea J; Mrkonjic, Miralem; Lemire, Mathieu; Gallinger, Steven; Knight, Julia A; Bapat, Bharat

    2017-01-01

    Colorectal cancers (CRCs) undergo distinct genetic and epigenetic alterations. Expression of mutL homolog 1 ( MLH1 ), a mismatch repair gene that corrects DNA replication errors, is lost in up to 15% of sporadic tumours due to mutation or, more commonly, due to DNA methylation of its promoter CpG island. A single nucleotide polymorphism (SNP) in the CpG island of MLH1 ( MLH1 -93G>A or rs1800734) is associated with CpG island hypermethylation and decreased MLH1 expression in CRC tumours. Further, in peripheral blood mononuclear cell (PBMC) DNA of both CRC cases and non-cancer controls, the variant allele of rs1800734 is associated with hypomethylation at the MLH1 shore, a region upstream of its CpG island that is less dense in CpG sites . To determine whether this genotype-epigenotype association is present in other tissue types, including colorectal tumours, we assessed DNA methylation in matched normal colorectal tissue, tumour, and PBMC DNA from 349 population-based CRC cases recruited from the Ontario Familial Colorectal Cancer Registry. Using the semi-quantitative real-time PCR-based MethyLight assay, MLH1 shore methylation was significantly higher in tumour tissue than normal colon or PBMCs ( P  < 0.01). When shore methylation levels were stratified by SNP genotype, normal colorectal DNA and PBMC DNA were significantly hypomethylated in association with variant SNP genotype ( P  < 0.05). However, this association was lost in tumour DNA. Among distinct stages of CRC, metastatic stage IV CRC tumours incurred significant hypomethylation compared to stage I-III cases, irrespective of genotype status. Shore methylation of MLH1 was not associated with MSI status or promoter CpG island hypermethylation, regardless of genotype. To confirm these results, bisulfite sequencing was performed in matched tumour and normal colorectal specimens from six CRC cases, including two cases per genotype (wildtype, heterozygous, and homozygous variant). Bisulfite sequencing results corroborated the methylation patterns found by MethyLight, with significant hypomethylation in normal colorectal tissue of variant SNP allele carriers. These results indicate that the normal tissue types tested (colorectum and PBMC) experience dynamic genotype-associated epigenetic alterations at the MLH1 shore, whereas tumour DNA incurs aberrant hypermethylation compared to normal DNA.

  9. Local Delivery of the Toll-Like Receptor 9 Ligand CpG Downregulates Host Immune and Inflammatory Responses, Ameliorating Established Leishmania (Viannia) panamensis Chronic Infection

    PubMed Central

    Fernández, Olga L.; Rodriguez-Pinto, Daniel; Castilho, Tiago M.; Corral Caridad, Maria J.; Goldsmith-Pestana, Karen; Saravia, Nancy Gore; McMahon-Pratt, Diane

    2017-01-01

    ABSTRACT Infection by Leishmania (Viannia) panamensis, the predominant etiologic agent for cutaneous leishmaniasis in Colombia, is characterized by a chronic mixed inflammatory response. Current treatment options are plagued by toxicity, lengthy treatment regimens, and growing evidence of drug resistance. Immunotherapy, modulating the immune system to mount a protective response, may provide an alternate therapeutic approach. We investigated the ability of the Toll-like receptor 9 (TLR9) ligand CpG to modulate established disease in the L. (V.) panamensis mouse model. Treatment of established infection with a high dose (50 μg) of CpG ameliorated disease and lowered parasite burden. Interestingly, immediately after treatment there was a significant increase in transforming growth factor β (TGF-β) and concomitantly an increase in T regulatory cell (Treg) function. Although a general reduction in cell-mediated immune cytokine and chemokine (gamma interferon [IFN-γ], interleukin 10 [IL-10], IL-13, IL-6, granulocyte-macrophage colony-stimulating factor [GM-CSF], IL-4, and MIP-1α) responses of the treated mice was observed, certain chemokines (RANTES, monocyte chemoattractant protein 1[MCP-1], and IP-10) were increased. Further, in peripheral blood mononuclear cells (PBMCs) from patients with cutaneous leishmaniasis, CpG treatment similarly exhibited a dose-response effect on the production of IFN-γ, IL-17, IL-10, and IL-13, with reductions observed at higher doses. To further understand the underlying mechanisms and cell populations driving the CpG mediated response, we examined the ex vivo dose effects mediated by the TLR9+ cell populations (dendritic cells, macrophages, and B cells) found to accumulate labeled CpG in vivo. Notably, B cells altered the production of IL-17, IL-13, and IFN-γ, supporting a role for B cells functioning as antigen-presenting cells (APCs) and/or regulatory cells during infection. Interestingly, B cells have been previously demonstrated as a primary type of APC in patients infected with L. (V.) panamensis and thus may be useful targets of immunotherapy. Collectively, our results show that CpG-induced immune regulation leads to a dampening of the host immune response and healing in the mouse model, and it may provide an alternate approach to treatment of cutaneous leishmaniasis caused by L. (V.) panamensis. PMID:28052994

  10. Royal Australian and New Zealand College of Psychiatrists clinical practice guidelines for the treatment of eating disorders.

    PubMed

    Hay, Phillipa; Chinn, David; Forbes, David; Madden, Sloane; Newton, Richard; Sugenor, Lois; Touyz, Stephen; Ward, Warren

    2014-11-01

    This clinical practice guideline for treatment of DSM-5 feeding and eating disorders was conducted as part of the Royal Australian and New Zealand College of Psychiatrists (RANZCP) Clinical Practice Guidelines (CPG) Project 2013-2014. The CPG was developed in accordance with best practice according to the National Health and Medical Research Council of Australia. Literature of evidence for treatments of anorexia nervosa (AN), bulimia nervosa (BN), binge eating disorder (BED), other specified and unspecified eating disorders and avoidant restrictive food intake disorder (ARFID) was sourced from the previous RANZCP CPG reviews (dated to 2009) and updated with a systematic review (dated 2008-2013). A multidisciplinary working group wrote the draft CPG, which then underwent expert, community and stakeholder consultation, during which process additional evidence was identified. In AN the CPG recommends treatment as an outpatient or day patient in most instances (i.e. in the least restrictive environment), with hospital admission for those at risk of medical and/or psychological compromise. A multi-axial and collaborative approach is recommended, including consideration of nutritional, medical and psychological aspects, the use of family based therapies in younger people and specialist therapist-led manualised based psychological therapies in all age groups and that include longer-term follow-up. A harm minimisation approach is recommended in chronic AN. In BN and BED the CPG recommends an individual psychological therapy for which the best evidence is for therapist-led cognitive behavioural therapy (CBT). There is also a role for CBT adapted for internet delivery, or CBT in a non-specialist guided self-help form. Medications that may be helpful either as an adjunctive or alternative treatment option include an antidepressant, topiramate, or orlistat (the last for people with comorbid obesity). No specific treatment is recommended for ARFID as there are no trials to guide practice. Specific evidence based psychological and pharmacological treatments are recommended for most eating disorders but more trials are needed for specific therapies in AN, and research is urgently needed for all aspects of ARFID assessment and management. Associate Professor Susan Byrne, Dr Angelica Claudino, Dr Anthea Fursland, Associate Professor Jennifer Gaudiani, Dr Susan Hart, Ms Gabriella Heruc, Associate Professor Michael Kohn, Dr Rick Kausman, Dr Sarah Maguire, Ms Peta Marks, Professor Janet Treasure and Mr Andrew Wallis. © The Royal Australian and New Zealand College of Psychiatrists 2014.

  11. Immunogenicity of porcine circovirus type 2 nucleic acid vaccine containing CpG motif for mice.

    PubMed

    Li, Jun; Yu, Jiang; Xu, Shaojian; Shi, Jianli; Xu, Shengnan; Wu, Xiaoyan; Fu, Fang; Peng, Zhe; Zhang, Lingling; Zheng, Shuxuan; Yuan, Xiaoyuan; Cong, Xiaoyan; Sun, Wenbo; Cheng, Kaihui; Du, Yijun; Wu, Jiaqiang; Wang, Jinbao

    2016-11-14

    This study aimed at reseaching the immune effect of porcine circovirus type 2 (PCV2) DNA vaccine containing CpG motif on mice. A total of 40 6-week-old female BALB/c mice were randomly divided into four groups which were immunized by 18CpG-pVAX1-ORF2, pVAX1-ORF2, pVAX1 and PBS, respectively, and immunized again 2 weeks later. All mice were challenged with 0.2 mL PCV2 cells virulent strain SD (10 6.0 TCID 50 /mL) after 4 weeks. Average daily gain, blood antibody levels, microscopic changes and viremia were detected to estimate the effect of DNA vaccine. The results showed that compared to those of the control mice, groups immunized with pVAX1-ORF2 and 18CpG-pVAX1-ORF2 could induce PCV2-specific antibodies. The PCV2-specific antibodies level of 18 CpG-pVAX1-ORF2 groups was higher significantly than other groups and decreased slowly along with time. There was no distinct pathological damage and viremia occurring in mice that inoculated with CpG motif DNA vaccines. The results demonstrated that the DNA vaccine containing 18 CpG could build up resistibility immunity and reduce immune organ damage on mice.

  12. Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing

    PubMed Central

    Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L.

    2016-01-01

    Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1, an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from −938 to −337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1. We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34+ selected hematopoietic stem and progenitor cells. PMID:27570841

  13. Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing.

    PubMed

    Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L

    Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1 , an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from -938 to -337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1 . We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34 + selected hematopoietic stem and progenitor cells.

  14. Activation of the Early B-Cell-Specific mb-1 (Ig-α) Gene by Pax-5 Is Dependent on an Unmethylated Ets Binding Site

    PubMed Central

    Maier, Holly; Colbert, Jeff; Fitzsimmons, Daniel; Clark, Dawn R.; Hagman, James

    2003-01-01

    Methylation of cytosine in CpG dinucleotides promotes transcriptional repression in mammals by blocking transcription factor binding and recruiting methyl-binding proteins that initiate chromatin remodeling. Here, we use a novel cell-based system to show that retrovirally expressed Pax-5 protein activates endogenous early B-cell-specific mb-1 genes in plasmacytoma cells, but only when the promoter is hypomethylated. CpG methylation does not directly affect binding of the promoter by Pax-5. Instead, methylation of an adjacent CpG interferes with assembly of ternary complexes comprising Pax-5 and Ets proteins. In electrophoretic mobility shift assays, recruitment of Ets-1 is blocked by methylation of the Ets site (5′CCGGAG) on the antisense strand. In transfection assays, selective methylation of a single CpG within the Pax-5-dependent Ets site greatly reduces mb-1 promoter activity. Prior demethylation of the endogenous mb-1 promoter is required for its activation by Pax-5 in transduced cells. Although B-lineage cells have only unmethylated mb-1 genes and do not modulate methylation of the mb-1 promoter during development, other tissues feature high percentages of methylated alleles. Together, these studies demonstrate a novel DNA methylation-dependent mechanism for regulating transcriptional activity through the inhibition of DNA-dependent protein-protein interactions. PMID:12612069

  15. Mechanism of Mitochondrial Transcription Factor A Attenuation of CpG-Induced Antibody Production

    PubMed Central

    Saifee, Jessica F.; Torres, Raul M.; Janoff, Edward N.

    2016-01-01

    Mitochondrial transcription factor A (TFAM) had previously been shown to act as a damage associated molecular pattern with the ability to enhance CpG-A phosphorothioate oligodeoxynucleotide (ODN)-mediated stimulation of IFNα production from human plasmacytoid dendritic cells. Examination of the mechanism by which TFAM might influence CpG ODN mediated innate immune responses revealed that TFAM binds directly, tightly and selectively to the structurally related CpG-A, -B, and -C ODN. TFAM also modulated the ability of the CpG-B or -C to stimulate the production of antibodies from human B cells. TFAM showed a dose-dependent modulation of CpG-B, and -C -induced antibody production from human B cells in vitro, with enhancement of high dose and inhibition of low doses of CpG stimulation. This effect was linked to the ability of TFAM to directly inhibit the binding of CpG ODNs to B cells, in a manner consistent with the relative binding affinities of TFAM for the ODNs. These data suggest that TFAM alters the free concentration of the CpG available to stimulate B cells by sequestering this ODN in a TFAM-CpG complex. Thus, TFAM has the potential to decrease the pathogenic consequences of exposure to natural CpG-like hypomethylated DNA in vivo, as well as such as that found in traumatic injury, infection, autoimmune disease and during pregnancy. PMID:27280778

  16. The development, implementation and evaluation of clinical practice guidelines in Gulf Cooperation Council (GCC) countries: a systematic review of literature.

    PubMed

    Koornneef, Erik; Robben, Paul; Hajat, Cother; Ali, Azhar

    2015-12-01

    Our aim was to examine and describe the current situation in Gulf Cooperation Council (GCC) member countries regarding the development, implementation and evaluation of clinical practice guidelines (CPG). The objectives were to describe from where the studies originated, what the clinical focus was of each study and examine the methodology and the status of each study (i.e. development, dissemination, implementation and evaluation). Review of literature - two stages: stage 1: screening through an abstract review, followed by independent adjudicator; stage 2: detailed assessment and classification. Considering the widespread acceptance that CPG's are useful and effective tools for quality improvement in health care, it is worth noting that relatively few studies have been conducted in the GCC region that examine CPG. Furthermore, the reviewers found that the quality of the research methods used could be improved. The majority of the studies that were conducted evaluated the effects of guidelines and focused on the 'lifestyle diseases', in particular diabetes and cardiovascular diseases. It is also worth noting that there has been a steady increase in the number of publications over the 10 years period. More attention needs to be given to developing, disseminating, implementing and evaluating CPG's in the GCC region in order to improve the quality and safety of health care. © 2015 John Wiley & Sons, Ltd.

  17. Gene silencing of Nox4 by CpG island methylation during hepatocarcinogenesis in rats

    PubMed Central

    López-Álvarez, Guadalupe S.; Wojdacz, Tomasz K.; García-Cuellar, Claudia M.; Monroy-Ramírez, Hugo C.; Rodríguez-Segura, Miguel A.; Pacheco-Rivera, Ruth A.; Valencia-Antúnez, Carlos A.; Cervantes-Anaya, Nancy; Soto-Reyes, Ernesto; Vásquez-Garzón, Verónica R.; Sánchez-Pérez, Yesennia; Villa-Treviño, Saúl

    2017-01-01

    ABSTRACT The association between the downregulation of genes and DNA methylation in their CpG islands has been extensively studied as a mechanism that favors carcinogenesis. The objective of this study was to analyze the methylation of a set of genes selected based on their microarray expression profiles during the process of hepatocarcinogenesis. Rats were euthanized at: 24 h, 7, 11, 16 and 30 days and 5, 9, 12 and 18 months post-treatment. We evaluated the methylation status in the CpG islands of four deregulated genes (Casp3, Cldn1, Pex11a and Nox4) using methylation-sensitive high-resolution melting technology for the samples obtained from different stages of hepatocarcinogenesis. We did not observe methylation in Casp3, Cldn1 or Pex11a. However, Nox4 exhibited altered methylation patterns, reaching a maximum of 10%, even during the early stages of hepatocarcinogenesis. We observed downregulation of mRNA and protein of Nox4 (97.5% and 40%, respectively) after the first carcinogenic stimulus relative to the untreated samples. Our results suggest that Nox4 downregulation is associated with DNA methylation of the CpG island in its promoter. We propose that methylation is a mechanism that can silence the expression of Nox4, which could contribute to the acquisition of neoplastic characteristics during hepatocarcinogenesis in rats. PMID:27895046

  18. Epigenetic Biomarker to Support Classification into Pluripotent and Non-Pluripotent Cells

    NASA Astrophysics Data System (ADS)

    Lenz, Michael; Goetzke, Roman; Schenk, Arne; Schubert, Claudia; Veeck, Jürgen; Hemeda, Hatim; Koschmieder, Steffen; Zenke, Martin; Schuppert, Andreas; Wagner, Wolfgang

    2015-03-01

    Quality control of human induced pluripotent stem cells (iPSCs) can be performed by several methods. These methods are usually relatively labor-intensive, difficult to standardize, or they do not facilitate reliable quantification. Here, we describe a biomarker to distinguish between pluripotent and non-pluripotent cells based on DNA methylation (DNAm) levels at only three specific CpG sites. Two of these CpG sites were selected by their discriminatory power in 258 DNAm profiles - they were either methylated in pluripotent or non-pluripotent cells. The difference between these two β-values provides an Epi-Pluri-Score that was validated on independent DNAm-datasets (264 pluripotent and 1,951 non-pluripotent samples) with 99.9% specificity and 98.9% sensitivity. This score was complemented by a third CpG within the gene POU5F1 (OCT4), which better demarcates early differentiation events. We established pyrosequencing assays for the three relevant CpG sites and thereby correctly classified DNA of 12 pluripotent cell lines and 31 non-pluripotent cell lines. Furthermore, DNAm changes at these three CpGs were tracked in the course of differentiation of iPSCs towards mesenchymal stromal cells. The Epi-Pluri-Score does not give information on lineage-specific differentiation potential, but it provides a simple, reliable, and robust biomarker to support high-throughput classification into either pluripotent or non-pluripotent cells.

  19. Site-specific methylation of the rat prolactin and growth hormone promoters correlates with gene expression.

    PubMed Central

    Ngô, V; Gourdji, D; Laverrière, J N

    1996-01-01

    The methylation patterns of the rat prolactin (rPRL) (positions -440 to -20) and growth hormone (rGH) (positions -360 to -110) promoters were analyzed by bisulfite genomic sequencing. Two normal tissues, the anterior pituitary and the liver, and three rat pituitary GH3 cell lines that differ considerably in their abilities to express both genes were tested. High levels of rPRL gene expression were correlated with hypomethylation of the CpG dinucleotides located at positions -277 and -97, near or within positive cis-acting regulatory elements. For the nine CpG sites analyzed in the rGH promoter, an overall hypomethylation-expression coupling was also observed for the anterior pituitary, the liver, and two of the cell lines. The effect of DNA methylation was tested by measuring the transient expression of the chloramphenicol acetyltransferase reporter gene driven by a regionally methylated rPRL promoter. CpG methylation resulted in a decrease in the activity of the rPRL promoter which was proportional to the number of modified CpG sites. The extent of the inhibition was also found to be dependent on the position of methylated sites. Taken together, these data suggest that site-specific methylation may modulate the action of transcription factors that dictate the tissue-specific expression of the rPRL and rGH genes in vivo. PMID:8668139

  20. Immortalization of T-cells is accompanied by gradual changes in CpG methylation resulting in a profile resembling a subset of T-cell leukemias.

    PubMed

    Degerman, Sofie; Landfors, Mattias; Siwicki, Jan Konrad; Revie, John; Borssén, Magnus; Evelönn, Emma; Forestier, Erik; Chrzanowska, Krystyna H; Rydén, Patrik; Keith, W Nicol; Roos, Göran

    2014-07-01

    We have previously described gene expression changes during spontaneous immortalization of T-cells, thereby identifying cellular processes important for cell growth crisis escape and unlimited proliferation. Here, we analyze the same model to investigate the role of genome-wide methylation in the immortalization process at different time points pre-crisis and post-crisis using high-resolution arrays. We show that over time in culture there is an overall accumulation of methylation alterations, with preferential increased methylation close to transcription start sites (TSSs), islands, and shore regions. Methylation and gene expression alterations did not correlate for the majority of genes, but for the fraction that correlated, gain of methylation close to TSS was associated with decreased gene expression. Interestingly, the pattern of CpG site methylation observed in immortal T-cell cultures was similar to clinical T-cell acute lymphoblastic leukemia (T-ALL) samples classified as CpG island methylator phenotype positive. These sites were highly overrepresented by polycomb target genes and involved in developmental, cell adhesion, and cell signaling processes. The presence of non-random methylation events in in vitro immortalized T-cell cultures and diagnostic T-ALL samples indicates altered methylation of CpG sites with a possible role in malignant hematopoiesis. Copyright © 2014 Neoplasia Press, Inc. Published by Elsevier Inc. All rights reserved.

  1. Dysfunction of bulbar central pattern generator in ALS patients with dysphagia during sequential deglutition.

    PubMed

    Aydogdu, Ibrahim; Tanriverdi, Zeynep; Ertekin, Cumhur

    2011-06-01

    The aim of this study is to investigate a probable dysfunction of the central pattern generator (CPG) in dysphagic patients with ALS. We investigated 58 patients with ALS, 23 patients with PD, and 33 normal subjects. The laryngeal movements and EMG of the submental muscles were recorded during sequential water swallowing (SWS) of 100ml of water. The coordination of SWS and respiration was also studied in some normal cases and ALS patients. Normal subjects could complete the SWS optimally within 10s using 7 swallows, while in dysphagic ALS patients, the total duration and the number of swallows were significantly increased. The novel finding was that the regularity and rhythmicity of the swallowing pattern during SWS was disorganized to irregular and arhythmic pattern in 43% of the ALS patients. The duration and speed of swallowing were the most sensitive parameters for the disturbed oropharyngeal motility during SWS. The corticobulbar control of swallowing is insufficient in ALS, and the swallowing CPG cannot work very well to produce segmental muscle activation and sequential swallowing. CPG dysfunction can result in irregular and arhythmical sequential swallowing in ALS patients with bulbar plus pseudobulbar types. The arhythmical SWS pattern can be considered as a kind of dysfunction of CPG in human ALS cases with dysphagia. Copyright © 2010 International Federation of Clinical Neurophysiology. Published by Elsevier Ireland Ltd. All rights reserved.

  2. Distinct genetic profiles in colorectal tumors with or without the CpG island methylator phenotype

    PubMed Central

    Toyota, Minoru; Ohe-Toyota, Mutsumi; Ahuja, Nita; Issa, Jean-Pierre J.

    2000-01-01

    Colorectal cancers (CRCs) are characterized by multiple genetic (mutations) and epigenetic (CpG island methylation) alterations, but it is not known whether these evolve independently through stochastic processes. We have recently described a novel pathway termed CpG island methylator phenotype (CIMP) in CRC, which is characterized by the simultaneous methylation of multiple CpG islands, including several known genes, such as p16, hMLH1, and THBS1. We have now studied mutations in K-RAS, p53, DPC4, and TGFβRII in a panel of colorectal tumors with or without CIMP. We find that CIMP defines two groups of tumors with significantly different genetic lesions: frequent K-RAS mutations were found in CIMP+ CRCs (28/41, 68%) compared with CIMP− cases (14/47, 30%, P = 0.0005). By contrast, p53 mutations were found in 24% (10/41) of CIMP+ CRCs vs. 60% (30/46) of CIMP− cases (P = 0.002). Both of these differences were independent of microsatellite instability. These interactions between CIMP, K-RAS mutations, and p53 mutations were preserved in colorectal adenomas, suggesting that they occur early in carcinogenesis. The distinct combinations of epigenetic and genetic alterations in each group suggest that activation of oncogenes and inactivation of tumor suppressor genes is related to the underlying mechanism of generating molecular diversity in cancer, rather than simply accumulate stochastically during cancer development. PMID:10639144

  3. Variation in Post-Injury Antibiotic Prophylaxis Patterns over Five Years in a Combat Zone

    PubMed Central

    Lloyd, Col Bradley A; Murray, COL Clinton K.; Bradley, William; Shaikh, Faraz; Aggarwal, Deepak; Carson, M. Leigh; Tribble, David R.

    2016-01-01

    In 2008, a clinical practice guideline (CPG) was developed for the prevention of infections among combat casualties and was later revised in 2011. We evaluated utilization of antimicrobials within 48 hours following injury in the combat zone over a five-year period (June 2009–May 2014) with regard to number of regimens, type of antimicrobial, and adherence to the 2011 CPG. The study population consisted of 5196 wounded military personnel. Open fractures and skin and soft-tissue injuries were the most frequent injuries. Closed injuries had the highest overall compliance (83%), while open fractures and maxillofacial injuries had significant improvement in compliance from 2009–2010 (34% and 50%, respectively) to 2013–2014 (73% and 76%; p<0.05). Part of the improvement with open fractures was a significant reduction of expanded Gram-negative coverage (61% received it in 2009–2010 compared to 7% in 2013–2014; p<0.001). Use of Gram-negative coverage with maxillofacial injuries also significantly declined (37% to 12%; p=0.001). Being injured during 2011–2014 compared to 2009–2010 was associated with CPG compliance (p<0.001), while high injury severity scores (≥10) and admission to the intensive care unit in Germany were associated with noncompliance (p<0.001). Our analysis demonstrates an increasing trend toward CPG compliance with significant reduction of expanded Gram-negative coverage. PMID:28291497

  4. [SPRINT on clinical practice: It's time to change the management of arterial hypertension in Latin America?

    PubMed

    Galvez-Olortegui, José Kelvin; Condor-Rojas, Yudy; Galvez-Olortegui, Tomas Vladimir; Camacho-Saavedra, Luis

    This paper analyzes the feasibility of the implementation of SPRINT trial results, the need to rethink the clinical practice guidelines(CPG) for the management of arterial hypertension and associated costs with daily practice applicability. SPRINT is a clinical trial comparing systolic blood pressure control <120mmHg and <140mmHg over cardiovascular complications, generating a great worldwide impact followed by publication of several studies that addressed relevance, usefulness, applicability and controversial aspects of SPRINT from different perspectives. Achieving blood pressure goals is one of the most discussed issue in widely used hypertension CPG around the world and in Latin American. SPRINT has generated and will generate a great impact on CPG, being necessary the reassessment of blood pressure goals and inclusion in future CPG, as has been considered in 2016 Canadian guideline and will be considered in NICE guideline update scheduled for June. The SPRINT trial raises new evidence for the management of hypertension, useful in people over 50 years, from urban populations, with defined cardiovascular risk without associated comorbidities. The applicability of SPRINT in Latin America is limited by increased costs associated with hypertensive patients' integrated health care, low care coverage, and lack of integrated care programs. Copyright © 2016 Instituto Nacional de Cardiología Ignacio Chávez. Publicado por Masson Doyma México S.A. All rights reserved.

  5. Oral and intraperitoneal administration of phosphorothioate oligodeoxynucleotides leads to control of Cryptosporidium parvum infection in neonatal mice.

    PubMed

    Barrier, Mathieu; Lacroix-Lamandé, Sonia; Mancassola, Roselyne; Auray, Gaël; Bernardet, Nelly; Chaussé, Anne-Marie; Uematsu, Satoshi; Akira, Shizuo; Laurent, Fabrice

    2006-05-15

    Neonates are particularly vulnerable to infections, in part because of the incomplete development of their immune system. Recent advances in immunostimulatory treatments based on conserved microbial components led us to assess the potential of oligodeoxynucleotides (ODNs) for decreasing the sensitivity of neonates to Cryptosporidium parvum infection. Neonate mice were treated orally or intraperitoneally (ip) with CpG ODNs or non-CpG ODNs 24 h before C. parvum infection, and parasite load and cytokine up-regulation were evaluated. CpG ODN 1668 and non-CpG ODN 1668 administered orally, as well as CpG ODN 1668 administered ip, induced an 80%-95% decrease in intestinal parasite load 6 days after infection. Intraperitoneal and oral pretreatment with CpG ODN 1668 led to a strong initial up-regulation of cytokines and CD69 messenger RNA in the intestine and a decrease in parasite load by a Toll-like receptor 9 (TLR9)-dependent mechanism. By contrast, oral administration of non-CpG ODN 1668 decreased parasite load by a TLR9-independent mechanism. The control of neonatal C. parvum infection by ip or oral administration of ODNs is feasible by 2 different mechanisms: (1) the well-known interaction involving CpG/TLR9, leading to the production of cytokines and lymphocyte activation, and (2) a new unknown mechanism that is independent of TLR9 and effective orally.

  6. Agonizing care: care ethics, agonistic feminism and a political theory of care.

    PubMed

    Cloyes, Kristin G

    2002-09-01

    'Care' is central to nursing theory and practice, and has been described in a variety of ways. Intense conversations about care have been developing in other fields of study as well, from the social sciences to the humanities. Care ethics has grown out of intellectual exchange between feminist thought, moral theory and the critique of traditional western political philosophy. However, care ethics is not without its critics, as these accounts of care have also sparked vigorous challenges. This paper traces the construct of care through nursing theory, care ethics, feminist critiques of moral and political theory and agonistic feminism to outline a set of problematics that a political theory of care should engage. It discusses how care is conventionally posited in more or less essentialist, universalizing and naturalizing terms. It introduces the ideas of feminist theorists who resist dichotomizing care and the political, and situate care in the context of power and politics. The tensions between care feminism and agonistic feminism are highlighted in order to explore the potential of theorizing both care and nursing in political terms.

  7. Leukemia-associated Rho guanine nucleotide exchange factor (LARG) plays an agonist specific role in platelet function through RhoA activation

    PubMed Central

    Zou, Siying; Teixeira, Alexandra M.; Yin, Mingzhu; Xiang, Yaozu; Xavier-Ferruccio, Juliana; Zhang, Ping-xia; Hwa, John; Min, Wang; Krause, Diane S.

    2018-01-01

    Summary Leukemia-Associated RhoGEF (LARG) is highly expressed in platelets, which are essential for maintaining normal hemostasis. We studied the function of LARG in murine and human megakaryocytes and platelets with Larg knockout, shRNA-mediated knockdown and small molecule-mediated inhibition. We found that LARG is important for human, but not murine, megakaryocyte maturation. Larg KO mice exhibit macrothrombocytopenia, internal bleeding in the ovaries and prolonged bleeding times. KO platelets have impaired aggregation, α-granule release and integrin α2bβ3 activation in response to thrombin and thromboxane, but not to ADP. The same agonist-specific reductions in platelet aggregation occur in human platelets treated with a LARG inhibitor. Larg KO platelets have reduced RhoA activation and myosin light chain phosphorylation, suggesting that Larg plays an agonist-specific role in platelet signal transduction. Using 2 different in vivo assays, Larg KO mice are protected from in vivo thrombus formation. Together, these results establish that LARG regulates human megakaryocyte maturation, and is critical for platelet function in both humans and mice. PMID:27345948

  8. Leukaemia-associated Rho guanine nucleotide exchange factor (LARG) plays an agonist specific role in platelet function through RhoA activation.

    PubMed

    Zou, Siying; Teixeira, Alexandra M; Yin, Mingzhu; Xiang, Yaozu; Xavier-Ferrucio, Juliana; Zhang, Ping-Xia; Hwa, John; Min, Wang; Krause, Diane S

    2016-08-30

    Leukemia-Associated RhoGEF (LARG) is highly expressed in platelets, which are essential for maintaining normal haemostasis. We studied the function of LARG in murine and human megakaryocytes and platelets with Larg knockout (KO), shRNA-mediated knockdown and small molecule-mediated inhibition. We found that LARG is important for human, but not murine, megakaryocyte maturation. Larg KO mice exhibit macrothrombocytopenia, internal bleeding in the ovaries and prolonged bleeding times. KO platelets have impaired aggregation, α-granule release and integrin α2bβ3 activation in response to thrombin and thromboxane, but not to ADP. The same agonist-specific reductions in platelet aggregation occur in human platelets treated with a LARG inhibitor. Larg KO platelets have reduced RhoA activation and myosin light chain phosphorylation, suggesting that Larg plays an agonist-specific role in platelet signal transduction. Using two different in vivo assays, Larg KO mice are protected from in vivo thrombus formation. Together, these results establish that LARG regulates human megakaryocyte maturation, and is critical for platelet function in both humans and mice.

  9. Structure-Based Design of a Small Molecule CD4-Antagonist with Broad Spectrum Anti-HIV-1 Activity

    DOE PAGES

    Curreli, Francesca; Kwon, Young Do; Zhang, Hongtao; ...

    2015-08-24

    Earlier we reported the discovery and design of NBD-556 and their analogs which demonstrated their potential as HIV-1 entry inhibitors. However, progress in developing these inhibitors has been stymied by their CD4-agonist properties, an unfavorable trait for use as drug. Here in this paper, we demonstrate the successful conversion of a full CD4-agonist (NBD-556) through a partial CD4-agonist (NBD-09027), to a full CD4-antagonist (NBD-11021) by structure-based modification of the critical oxalamide midregion, previously thought to be intolerant of modification. NBD-11021 showed unprecedented neutralization breath for this class of inhibitors, with pan-neutralization against a panel of 56 Env-pseudotyped HIV-1 representing diversemore » subtypes of clinical isolates (IC 50 as low as 270 nM). The cocrystal structure of NBD-11021 complexed to a monomeric HIV-1 gp120 core revealed its detail binding characteristics. The study is expected to provide a framework for further development of NBD series as HIV-1 entry inhibitors for clinical application against AIDS.« less

  10. PPARγ in Bacterial Infections: A Friend or Foe?

    PubMed

    Reddy, Aravind T; Lakshmi, Sowmya P; Reddy, Raju C

    2016-01-01

    Peroxisome proliferator-activated receptor γ (PPAR γ ) is now recognized as an important modulator of leukocyte inflammatory responses and function. Its immunoregulatory function has been studied in a variety of contexts, including bacterial infections of the lungs and central nervous system, sepsis, and conditions such as chronic granulomatous disease. Although it is generally believed that PPAR γ activation is beneficial for the host during bacterial infections via its anti-inflammatory and antibacterial properties, PPAR γ agonists have also been shown to dampen the host immune response and in some cases exacerbate infection by promoting leukocyte apoptosis and interfering with leukocyte migration and infiltration. In this review we discuss the role of PPAR γ and its activation during bacterial infections, with focus on the potential of PPAR γ agonists and perhaps antagonists as novel therapeutic modalities. We conclude that adjustment in the dosage and timing of PPAR γ agonist administration, based on the competence of host antimicrobial defenses and the extent of inflammatory response and tissue injury, is critical for achieving the essential balance between pro- and anti-inflammatory effects on the immune system.

  11. PPARγ in Bacterial Infections: A Friend or Foe?

    PubMed Central

    2016-01-01

    Peroxisome proliferator-activated receptor γ (PPARγ) is now recognized as an important modulator of leukocyte inflammatory responses and function. Its immunoregulatory function has been studied in a variety of contexts, including bacterial infections of the lungs and central nervous system, sepsis, and conditions such as chronic granulomatous disease. Although it is generally believed that PPARγ activation is beneficial for the host during bacterial infections via its anti-inflammatory and antibacterial properties, PPARγ agonists have also been shown to dampen the host immune response and in some cases exacerbate infection by promoting leukocyte apoptosis and interfering with leukocyte migration and infiltration. In this review we discuss the role of PPARγ and its activation during bacterial infections, with focus on the potential of PPARγ agonists and perhaps antagonists as novel therapeutic modalities. We conclude that adjustment in the dosage and timing of PPARγ agonist administration, based on the competence of host antimicrobial defenses and the extent of inflammatory response and tissue injury, is critical for achieving the essential balance between pro- and anti-inflammatory effects on the immune system. PMID:27774097

  12. Structure-Based Design of a Small Molecule CD4-Antagonist with Broad Spectrum Anti-HIV-1 Activity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Curreli, Francesca; Kwon, Young Do; Zhang, Hongtao

    Earlier we reported the discovery and design of NBD-556 and their analogs which demonstrated their potential as HIV-1 entry inhibitors. However, progress in developing these inhibitors has been stymied by their CD4-agonist properties, an unfavorable trait for use as drug. Here in this paper, we demonstrate the successful conversion of a full CD4-agonist (NBD-556) through a partial CD4-agonist (NBD-09027), to a full CD4-antagonist (NBD-11021) by structure-based modification of the critical oxalamide midregion, previously thought to be intolerant of modification. NBD-11021 showed unprecedented neutralization breath for this class of inhibitors, with pan-neutralization against a panel of 56 Env-pseudotyped HIV-1 representing diversemore » subtypes of clinical isolates (IC 50 as low as 270 nM). The cocrystal structure of NBD-11021 complexed to a monomeric HIV-1 gp120 core revealed its detail binding characteristics. The study is expected to provide a framework for further development of NBD series as HIV-1 entry inhibitors for clinical application against AIDS.« less

  13. Epigenetic contribution of the myosin light chain kinase gene to the risk for acute respiratory distress syndrome.

    PubMed

    Szilágyi, Keely L; Liu, Cong; Zhang, Xu; Wang, Ting; Fortman, Jeffrey D; Zhang, Wei; Garcia, Joe G N

    2017-02-01

    Acute respiratory distress syndrome (ARDS) is a devastating clinical syndrome with a considerable case fatality rate (∼30%-40%). Health disparities exist with African descent (AD) subjects exhibiting greater mortality than European descent (ED) individuals. Myosin light chain kinase is encoded by MYLK, whose genetic variants are implicated in ARDS pathogenesis and may influence ARDS mortality. As baseline population-specific epigenetic changes, that is, cytosine modifications, have been observed between AD and ED individuals, epigenetic variations in MYLK may provide insights into ARDS disparities. We compared methylation levels of MYLK cytosine-guanine dinucleotides (CpGs) between ARDS patients and intensive care unit (ICU) controls overall and by ethnicity in a nested case-control study of 39 ARDS cases and 75 non-ARDS ICU controls. Two MYLK CpG sites (cg03892735 and cg23344121) were differentially modified between ARDS subjects and controls (P < 0.05; q < 0.25) in a logistic regression model, where no effect modification by ethnicity or age was found. One CpG site was associated with ARDS in patients aged <58 years, cg19611163 (intron 19, 20). Two CpG sites were associated with ARDS in EDs only, gene body CpG (cg01894985, intron 2, 3) and CpG (cg16212219, intron 31, 32), with higher modification levels exhibited in ARDS subjects than controls. Cis-acting modified cytosine quantitative trait loci (mQTL) were identified using linear regression between local genetic variants and modification levels for 2 ARDS-associated CpGs (cg23344121 and cg16212219). In summary, these ARDS-associated MYLK CpGs with effect modification by ethnicity and local mQTL suggest that MYLK epigenetic variation and local genetic background may contribute to health disparities observed in ARDS. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Providers' perceptions of spinal cord injury pressure ulcer guidelines.

    PubMed

    Thomason, Susan S; Evitt, Celinda P; Harrow, Jeffrey J; Love, Linda; Moore, D Helen; Mullins, Maria A; Powell-Cope, Gail; Nelson, Audrey L

    2007-01-01

    Pressure ulcers are a serious complication for people with spinal cord injury (SCI). The Consortium for Spinal Cord Medicine (CSCM) published clinical practice guidelines (CPGs) that provided guidance for pressure ulcer prevention and treatment after SCI. The aim of this study was to assess providers' perceptions for each of the 32 CPG recommendations regarding their agreement with CPGs, degree of CPG implementation, and CPG implementation barriers and facilitators. This descriptive mixed-methods study included both qualitative (focus groups) and quantitative (survey) data collection approaches. The sample (n = 60) included 24 physicians and 36 nurses who attended the 2004 annual national conferences of the American Paraplegia Society or American Association of Spinal Cord Injury Nurses. This sample drew from two sources: a purposive sample from a list of preregistered participants and a convenience sample of conference attendee volunteers. We analyzed quantitative data using descriptive statistics and qualitative data using a coding scheme to capture barriers and facilitators. The focus groups agreed unanimously on the substance of 6 of the 32 recommendations. Nurse and physician focus groups disagreed on the degree of CGP implementation at their sites, with nurses as a group perceiving less progress in implementation of the guideline recommendations. The focus groups identified only one recommendation, complications of surgery, as being fully implemented at their sites. Categories of barriers and facilitators for implementation of CPGs that emerged from the qualitative analysis included (a) characteristics of CPGs: need for research/evidence, (b) characteristics of CPGs: complexity of design and wording, (c) organizational factors, (d) lack of knowledge, and (e) lack of resources. Although generally SCI physicians and nurses agreed with the CPG recommendations as written, they did not feel these recommendations were fully implemented in their respective clinical settings. The focus groups identified multiple barriers to the implementation of the CPGs and suggested several facilitators/solutions to improve implementation of these guidelines in SCI. Participants identified organizational factors and the lack of knowledge as the most substantial systems/issues that created barriers to CPG implementation.

  15. Feed forward and feedback control for over-ground locomotion in anaesthetized cats

    NASA Astrophysics Data System (ADS)

    Mazurek, K. A.; Holinski, B. J.; Everaert, D. G.; Stein, R. B.; Etienne-Cummings, R.; Mushahwar, V. K.

    2012-04-01

    The biological central pattern generator (CPG) integrates open and closed loop control to produce over-ground walking. The goal of this study was to develop a physiologically based algorithm capable of mimicking the biological system to control multiple joints in the lower extremities for producing over-ground walking. The algorithm used state-based models of the step cycle each of which produced different stimulation patterns. Two configurations were implemented to restore over-ground walking in five adult anaesthetized cats using intramuscular stimulation (IMS) of the main hip, knee and ankle flexor and extensor muscles in the hind limbs. An open loop controller relied only on intrinsic timing while a hybrid-CPG controller added sensory feedback from force plates (representing limb loading), and accelerometers and gyroscopes (representing limb position). Stimulation applied to hind limb muscles caused extension or flexion in the hips, knees and ankles. A total of 113 walking trials were obtained across all experiments. Of these, 74 were successful in which the cats traversed 75% of the 3.5 m over-ground walkway. In these trials, the average peak step length decreased from 24.9 ± 8.4 to 21.8 ± 7.5 (normalized units) and the median number of steps per trial increased from 7 (Q1 = 6, Q3 = 9) to 9 (8, 11) with the hybrid-CPG controller. Moreover, within these trials, the hybrid-CPG controller produced more successful steps (step length ≤ 20 cm ground reaction force ≥ 12.5% body weight) than the open loop controller: 372 of 544 steps (68%) versus 65 of 134 steps (49%), respectively. This supports our previous preliminary findings, and affirms that physiologically based hybrid-CPG approaches produce more successful stepping than open loop controllers. The algorithm provides the foundation for a neural prosthetic controller and a framework to implement more detailed control of locomotion in the future.

  16. A systematic review of recent clinical practice guidelines and best practice statements for the evaluation of the infertile male.

    PubMed

    Esteves, Sandro C; Chan, Peter

    2015-09-01

    We systematically identified and reviewed the methods and consistency of recommendations of recently developed clinical practice guidelines (CPG) and best practice statements (BPS) on the evaluation of the infertile male. MEDLINE and related engines as well as guidelines' Web sites were searched for CPG and BPS written in English on the general evaluation of male infertility published between January 2008 and April 2015. Four guidelines were identified, all of which reported to have been recently updated. Systematic review was not consistently used in the BPS despite being reported in the CPG. Only one of them reported having a patient representative in its development team. The CPG issued by the European Association of Urology (EAU) graded some recommendations and related that to levels (but not quality) of evidence. Overall, the BPS issued respectively by the American Urological Association and American Society for Reproductive Medicine concurred with each other, but both differed from the EAU guidelines with regard to methods of collection, extraction and interpretation of data. None of the guidelines incorporated health economics. Important specific limitations of conventional semen analysis results were ignored by all guidelines. Besides variation in the methodological quality, implementation strategies were not reported in two out of four guidelines. While the various panels of experts who contributed to the development of the CPG and BPS reviewed should be commended on their tremendous efforts aiming to establish a clinical standard in both the evaluation and management of male infertility, we recognized inconsistencies in the methodology of their synthesis and in the contents of their final recommendations. These discrepancies pose a barrier in the general implementation of these guidelines and may limit their utility in standardizing clinical practice or improving health-related outcomes. Continuous efforts are needed to generate high-quality evidence to allow further development of these important guidelines for the evaluation and management of males suffering from infertility.

  17. [Association between obesity and DNA methylation among the 7-16 year-old twins].

    PubMed

    Li, C X; Gao, Y; Gao, W J; Yu, C Q; Lyu, J; Lyu, R R; Duan, J L; Sun, Y; Guo, X H; Wang, S F; Zhou, B; Wang, G; Cao, W H; Li, L M

    2018-04-10

    Objective: On whole-genome scale, we tried to explore the correlation between obesity-related traits and DNA methylation sites, based on discordant monozygotic twin pairs. Methods: A total of 90 pairs of 6-17 year-old twins were recruited in Chaoyang district, Yanqing district and Fangshan district in Beijing in 2016. Information on twins was gathered through a self-designed questionnaire and results: from physical examination, including height, weight and waist circumference of the subjects under study. DNA methylation detection was chosen on the Illumina Human Methylation EPIC BeadChip. R 3.3.1 language was used to read the DNA methylation signal under quality control on samples and probes. Ebayes function of empirical Bayes paired moderated t -test was used to identify the differential methylated CpG sites (DMCs). VarFit function of empirical Bayes paired moderated Levene test was used to identify the differentially variables CpG sits (DVCs) in obese and normal groups. Results According to the obesity discordance criteria, we collected 23 pairs of twins (age range 7 to 16 years), including 12 male pairs. A total of 817 471 qualified CpG loci were included in the genome-wide correlation analysis. According to the significance level of FDR set as <0.05, no positive sites would meet this standard. When DMC CpG site cg05684382, with the smallest P value (1.26E-06) as on chromosome 12, the DVC CpG site cg26188191 with the smallest P value (6.44E-06) appeared in CMIP gene on chromosome 16. Conclusions: In this study, we analyzed the genome-wide DNA methylation and its correlation with obesity traits. After multiple testing corrections, no positive sites were found to have associated with obesity. However, results from the correlation analysis demonstrated sites cg05684382 (chr: 12) and cg26188191 (chr: 16) might have played a role in the development of obesity. This study provides a methodologic reference for the studies on discordance twins related problems.

  18. Epigenome-wide association study of fasting measures of glucose, insulin, and HOMA-IR in the Genetics of Lipid Lowering Drugs and Diet Network study.

    PubMed

    Hidalgo, Bertha; Irvin, M Ryan; Sha, Jin; Zhi, Degui; Aslibekyan, Stella; Absher, Devin; Tiwari, Hemant K; Kabagambe, Edmond K; Ordovas, Jose M; Arnett, Donna K

    2014-02-01

    Known genetic susceptibility loci for type 2 diabetes (T2D) explain only a small proportion of heritable T2D risk. We hypothesize that DNA methylation patterns may contribute to variation in diabetes-related risk factors, and this epigenetic variation across the genome can contribute to the missing heritability in T2D and related metabolic traits. We conducted an epigenome-wide association study for fasting glucose, insulin, and homeostasis model assessment of insulin resistance (HOMA-IR) among 837 nondiabetic participants in the Genetics of Lipid Lowering Drugs and Diet Network study, divided into discovery (N = 544) and replication (N = 293) stages. Cytosine guanine dinucleotide (CpG) methylation at ∼470,000 CpG sites was assayed in CD4(+) T cells using the Illumina Infinium HumanMethylation 450 Beadchip. We fit a mixed model with the methylation status of each CpG as the dependent variable, adjusting for age, sex, study site, and T-cell purity as fixed-effects and family structure as a random-effect. A Bonferroni corrected P value of 1.1 × 10(-7) was considered significant in the discovery stage. Significant associations were tested in the replication stage using identical models. Methylation of a CpG site in ABCG1 on chromosome 21 was significantly associated with insulin (P = 1.83 × 10(-7)) and HOMA-IR (P = 1.60 × 10(-9)). Another site in the same gene was significant for HOMA-IR and of borderline significance for insulin (P = 1.29 × 10(-7) and P = 3.36 × 10(-6), respectively). Associations with the top two signals replicated for insulin and HOMA-IR (P = 5.75 × 10(-3) and P = 3.35 × 10(-2), respectively). Our findings suggest that methylation of a CpG site within ABCG1 is associated with fasting insulin and merits further evaluation as a novel disease risk marker.

  19. GRASP/Ada 95: Reverse Engineering Tools for Ada

    NASA Technical Reports Server (NTRS)

    Cross, James H., II

    1996-01-01

    The GRASP/Ada project (Graphical Representations of Algorithms, Structures, and Processes for Ada) has successfully created and prototyped an algorithmic level graphical representation for Ada software, the Control Structure Diagram (CSD), and a new visualization for a fine-grained complexity metric called the Complexity Profile Graph (CPG). By synchronizing the CSD and the CPG, the CSD view of control structure, nesting, and source code is directly linked to the corresponding visualization of statement level complexity in the CPG. GRASP has been integrated with GNAT, the GNU Ada 95 Translator to provide a comprehensive graphical user interface and development environment for Ada 95. The user may view, edit, print, and compile source code as a CSD with no discernible addition to storage or computational overhead. The primary impetus for creation of the CSD was to improve the comprehension efficiency of Ada software and, as a result, improve reliability and reduce costs. The emphasis has been on the automatic generation of the CSD from Ada 95 source code to support reverse engineering and maintenance. The CSD has the potential to replace traditional prettyprinted Ada source code. The current update has focused on the design and implementation of a new Motif compliant user interface, and a new CSD generator consisting of a tagger and renderer. The Complexity Profile Graph (CPG) is based on a set of functions that describes the context, content, and the scaling for complexity on a statement by statement basis. When combined graphicafly, the result is a composite profile of complexity for the program unit. Ongoing research includes the development and refinement of the associated functions, and the development of the CPG generator prototype. The current Version 5.0 prototype provides the capability for the user to generate CSDs and CPGs from Ada 95 source code in a reverse engineering as well as forward engineering mode with a level of flexibility suitable for practical application. This report provides an overview of the GRASP/Ada project with an emphasis on the current update.

  20. Feed forward and feedback control for over-ground locomotion in anaesthetized cats

    PubMed Central

    Mazurek, K A; Holinski, B J; Everaert, D G; Stein, R B; Etienne-Cummings, R; Mushahwar, V K

    2012-01-01

    The biological central pattern generator (CPG) integrates open and closed loop control to produce over-ground walking. The goal of this study was to develop a physiologically based algorithm capable of mimicking the biological system to control multiple joints in the lower extremities for producing over-ground walking. The algorithm used state-based models of the step cycle each of which produced different stimulation patterns. Two configurations were implemented to restore over-ground walking in five adult anaesthetized cats using intramuscular stimulation (IMS) of the main hip, knee and ankle flexor and extensor muscles in the hind limbs. An open loop controller relied only on intrinsic timing while a hybrid-CPG controller added sensory feedback from force plates (representing limb loading), and accelerometers and gyroscopes (representing limb position). Stimulation applied to hind limb muscles caused extension or flexion in the hips, knees and ankles. A total of 113 walking trials were obtained across all experiments. Of these, 74 were successful in which the cats traversed 75% of the 3.5 m over-ground walkway. In these trials, the average peak step length decreased from 24.9 ± 8.4 to 21.8 ± 7.5 (normalized units) and the median number of steps per trial increased from 7 (Q1=6, Q3 = 9) to 9 (8, 11) with the hybrid-CPG controller. Moreover, these trials, the hybrid-CPG controller produced more successful steps (step length ≤ 20 cm; ground reaction force ≥ 12.5% body weight) than the open loop controller: 372 of 544 steps (68%) versus 65 of 134 steps (49%), respectively. This supports our previous preliminary findings, and affirms that physiologically based hybrid-CPG approaches produce more successful stepping than open loop controllers. The algorithm provides the foundation for a neural prosthetic controller and a framework to implement more detailed control of locomotion in the future. PMID:22328615

Top